TECHNICAL FIELD
-
The disclosure provided herein relates to treatment of hematological cancers using the combination of a telomerase inhibitor and a Bcl-2 inhibitor.
BACKGROUND
-
Patients of acute myeloid leukemia (AML) have limited treatment options at diagnosis, which typically takes the form of chemotherapy to quickly reduce the leukemic cell burden. Invasive leukapheresis procedures to remove large numbers of leukocytes (normal and diseased) can be applied in parallel to chemotherapy to lower tumor cell burden, but are ultimately only temporary. However successful induction phase chemotherapy can be, most healthy cells residing in patient bone marrow are also killed, causing illness and requiring additional palliative therapy to ward off infection and raise leukocyte counts as well as formal blood transfusions. Additional rounds of chemotherapy can be used to attempt to keep patients in remission, but relapse is still common despite.
-
Telomerase is present in >90% of tumors across all cancer types and as such a strong candidate for drug targeting. Lacking expression in normal, healthy tissues, targeting telomerase provides a promising molecular target with minimal theoretical consequence outside of tumorigenic tissues. Imetelstat sodium is a novel, first-in-class telomerase inhibitor that is currently in clinical development. It is a covalently-lipidated 13-mer oligonucleotide(shown below) complimentary to the human telomerase RNA (hTR) template region. Imetelstat sodium does not function through an anti-sense mechanism and therefore lacks the side effects commonly observed with such therapies. Imetelstat sodium is the sodium salt of imetelstat (shown below):
Imetelstat sodium
Unless otherwise indicated or clear from the context, references below to imetelstat also include salts thereof. As mentioned above, imetelstat sodium in particular is the sodium salt of imetelstat.
-
ABT-199/venetoclax (trade name Venclexta) is an FDA approved Bcl-2 inhibitor for use in chronic lymphocytic leukemia (CLL) patients with del17p who are relapsed/refractory. Unless otherwise indicated or clear from the context, references below to ABT-199 also include pharmaceutically acceptable salts thereof Specifically in the Examples however, ABT-199 was used in the free base form.
-
ABT-199, shown below in the free base form, is highly specific to Bcl-2, unlike other first generation inhibitors which showed affinity for related Bcl family members and induced greater side effects. Inhibition of Bcl-2 blocks the pro-apoptotic signals caused by damage to or abnormalities within cellular DNA and ultimately leads to programmed cell death in treated cells via the caspase cascade and apoptosis through the intrinsic pathway.
ABT-199 (shown in the free base form)
SUMMARY OF INVENTION
-
The combined dosing of imetelstat sodium and ABT-199 in AML cells provides a novel treatment for hematologic cancers and specifically AML. Imetelstat sodium is currently being investigated clinically in myeloid fibrosis (MF) and myelodysplastic syndrome (MDS). ABT-199 is FDA approved in CLL and is also being investigated in AML.
-
When administered in combination, these two agents can promote apoptosis in cancer cells. When administered in combination these two agents can treat cancer in a subject in need thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
-
- Figure 1. Figure 1a shows dot plots of KG-1 cells after 48 hour treatment with various concentrations of ABT-199 and/ or imetelstat sodium and staining with Annexin V and Propridium Iodide. Figure 1b shows a graph of % apoptotic cells as a concentration of compound for 48 hour treatment of KG-1 cells with various concentrations of ABT-199 and/or imetelstat sodium. Apoptotic cells are double labeled with Annexin V and Propridium Iodide.
- Figure 2. Figure 2a shows dot plots of KG-1 cells after 96 hour treatment with various concentrations of ABT-199 and/ or imetelstat sodium and staining with Annexin V and Propridium Iodide. Figure 2b shows a graph of % apoptotic cells as a concentration of compound for 96 hour treatment of KG-1 cells with various concentrations of ABT-199 and/or imetelstat sodium. Apoptotic cells are double labeled with Annexin V and Propridium Iodide.
- Figure 3. Figure 3a shows dot plots of KG-1 cells after 48 hour treatment with various concentrations of ABT-199 and/ or control oligonucleotides and staining with Annexin V and Propridium Iodide. Figure 3b shows a graph of % apoptotic cells as a concentration of compound for 48 hour treatment of KG-1 cells with various concentrations of ABT-199 and/or Control oligonucleotides. Non-Comp refers to the non-complimentary control oligonucleotide. Apoptotic cells are double labeled with Annexin V and Propridium Iodide.
- Figure 4. Figure 4a shows dot plots of KG-1 cells after 96 treatment with various concentrations of ABT-199 and/ or control oligonucleotides and staining with Annexin V and Propridium Iodide. Figure 3b shows a graph of % apoptotic cells as a concentration of compound for 48 hour treatment of KG-1 cells with various concentrations of ABT-199 and/or Control oligonucleotides. Non-Comp refers to the non-complimentary control oligonucleotide. Apoptotic cells are double labeled with Annexin V and Propridium Iodide. treatment with various concentrations of ABT-199 and/ or control oligonucleotides and staining with Annexin V and Propridium Iodide. Figure 3b shows a graph of % apoptotic cells as a concentration of compound for 48 hour treatment of KG-1 cells with various concentrations of ABT-199 and/or Control oligonucleotides. Non-Comp refers to the non-complimentary control oligonucleotide. Apoptotic cells are double labeled with Annexin V and Propridium Iodide.
- Figure 5. Figure 5a shows dot plots of MOLM-13 cells after 48 hour treatment with various concentrations of ABT-199 and/ or imetelstat sodium and staining with Annexin V and Propridium Iodide. Figure 5b shows a graph of % apoptotic cells as a concentration of compound for 48 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or imetelstat sodium. Apoptotic cells are double labeled with Annexin V and Propridium Iodide.
- Figure 6. Figure 6a shows dot plots of MOLM-13 cells after 96 hour treatment with various concentrations of ABT-199 and/ or imetelstat sodium and staining with Annexin V and Propridium Iodide. Figure 6b shows a graph of % apoptotic cells as a concentration of compound for 96 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or imetelstat sodium. Apoptotic cells are double labeled with Annexin V and Propridium Iodide.
- Figure 7. Figure 7a shows dot plots of MOLM-13 cells after 48 hour treatment with various concentrations of ABT-199 and/ or control oligonucleotides and staining with Annexin V and Propridium Iodide. Figure 7b shows a graph of % apoptotic cells as a concentration of compound for 48 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or Control oligonucleotides. Apoptotic cells are double labeled with Annexin V and Propridium Iodide.
- Figure 8. Figure 8a shows dot plots of MOLM-13 cells after 96 hour treatment with various concentrations of ABT-199 and/ or control oligonucleotides and staining with Annexin V and Propridium Iodide. Figure 8b shows a graph of % apoptotic cells as a concentration of compound for 96 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or Control oligonucleotides. Apoptotic cells are double labeled with Annexin V and Propridium Iodide.
- Figure 9. Figure 9 shows hTERT transcription levels measured by RT-qPCR after treatment with imetelstat sodium, ABT-199, or combination at 48 and 96 hours in KG-1 or MOLM-13 cells.
- Figure 10. Figure 10 shows telomerase enzyme activity levels measured by qPCR TRAP after treatment with imetelstat sodium, ABT-199, or combination at 48 and 96 hours in KG-1 or MOLM-13 cells.
- Figure 11. Figure 11 shows a graph of % apoptotic cells as a concentration of compound for 48 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or imetelstat sodium. Apoptotic cells are double labeled with Annexin V and Propridium Iodide.
- Figure 12. Figure Figure 12a shows a graph of % apoptotic cells as a concentration of compound for 48 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or control Non-complimentary oligonucleotide. Figure 12b shows a graph of % apoptotic cells as a concentration of compound for 48 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or control Non-complimentary oligonucleotide. Apoptotic cells are double labeled with Annexin V and Propridium Iodide.
- Figure 13. Figure 13 shows a graph of % apoptotic cells as a concentration of compound for 96 hour treatment ofMOLM-13 cells with various concentrations of ABT-199 and/or imetelstat sodium. Apoptotic cells are double labeled with Annexin V and Propridium Iodide.
- Figure 14. Figure 14a shows a graph of % apoptotic cells as a concentration of compound for 96 hour treatment ofMOLM-13 cells with various concentrations of ABT-199 and/or control Non-complimentary oligonucleotide. Figure 14b shows a graph of % apoptotic cells as a concentration of compound for 96 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or control Non-complimentary oligonucleotide. Apoptotic cells are double labeled with Annexin V and Propridium Iodide.
DESCRIPTION
-
The invention provides methods of treating hematological cancers with a combination of a telomerase inhibitor and a Bcl-2 inhibitor. Recent pre-clinical studies have demonstrated that cell growth is inhibited and apoptosis is observed in acute myeloid leukemia (AML) cells upon treatment with ABT-199 (Venetoclax), a Bcl-2 inhibitor. Although ABT-199 effectively induced apoptosis in some ALM cell lines, a large fraction of cells remained alive after treatment with ABT-199. Drug resistant cell populations can lead to incomplete response to treatment or relapse of disease. It is the finding of the inventors that the combination of a telomerase inhibitor and a Bcl-2 inhibitor work synergistically to induce greater levels of apoptosis in AML cells than either drug can induce independently. The invention provides a method of inducing apoptosis in a hematologic cancer cell comprising contacting the cell with a therapeutically effective amount of a telomerase inhibitor and a therapeutically effective amount of a Bcl-2 inhibitor. In some embodiments, the telomerase inhibitor is imetelstat. In some embodiments, the Bcl-2 inhibitor is ABT-199. In some embodiments, the hematological cancer is AML.
-
In certain instances, the combination provides an enhanced inhibiting effect relative to either component alone; in some cases, the combination provides a supraadditive or synergistic effect relative to the combined or additive effects of the components.
-
In some embodiments, the method is a method of inducing apoptosis in a hematologic cancer cell. The subject method can include contacting the cell with a therapeutically effective amount of a telomerase inhibitor, and contacting the cell with a therapeutically effective amount of a Bcl-2 inhibitor. In certain embodiments, the telomerase inhibitor is imetelstat. In some embodiments, the telomerase inhibitor is imetelstat sodium. In some embodiments, the Bcl-2 inhibitor is ABT-199. The contacting of the cell with the telomerase inhibitor can be performed before, during and/or after the contacting of the cell with the Bcl-2 inhibitor. The contacting of the cell with the telomerase inhibitor and the Bcl-2 inhibitor can be performed simultaneous or sequentially.
-
In an embodiment, the telomerase inhibitor is an oligonucleotide with telomerase inhibiting activity, in particular an oligonucleotide as defined in
WO2005/023994 and/or
WO2014088785 , herein incorporated by reference.
-
In general, various combinations of the telomerase inhibitor and the Bcl-2 inhibitor may be employed, used either sequentially or simultaneously. For multiple dosages, the two agents may directly alternate, or two or more doses of one agent may be alternated with a single dose of the other agent, for example. Simultaneous administration of both agents may also be alternated or otherwise interspersed with dosages of the individual agents. In some cases, the time between dosages may be for a period from about 1-6 hours, to about 6-12 hours, to about 12-24 hours, to about 1-2 days, to about 1-2 week or longer following the initiation of treatment. During a course of treatment, the need to complete the planned dosings may be re-evaluated.
-
The term "apoptosis" refers to the process of programmed cell death, with its accompanying cellular morphological changes and loss of cell viability. In one embodiment, the method of inducing apoptosis provides a method for treating a neoplastic disorder in a vertebrate organism.
-
In the context of this method, the term "inducing" means a direct or indirect causal relationship. Thus, the presence and/or maintenance of a particular condition causes or leads to the induced result.
-
The present disclosure provides a treatment comprising combining the administration of the telomerase inhibitor imetelstat sodium with the administration of the Bcl-2 inhibitor ABT-199. The subject method of treatment can be more efficacious and produce a greater response to treatment in patients with AML than is observed using either drug alone. In one embodiment, the method of treatment comprises administering a telomerase inhibitor and a Bcl-2 inhibitor in combination to a subject in need of treatment for hematological cancer. In another embodiment, the hematological cancer is AML. In another embodiment, the telomerase inhibitor is imetelstat. In certain embodiments, the telomerase inhibitor is imetelstat sodium. In another embodiment, the Bcl-2 inhibitor is ABT-199.
-
In some embodiments, the dose of telomerase inhibitor administered to the subject is an amount sufficient to treat the disease when the telomerase inhibitor thereof is used alone. In certain embodiments, the dose of telomerase inhibitor administered to the subject is less than the amount sufficient to treat the disease when the telomerase inhibitor is used alone. In one embodiment, the dose of telomerase inhibitor is reduced when used in combination with ABT-199 in treatment of a subject who has been diagnosed with AML. In some embodiments the telomerase inhibitor is imetelstat. In some embodiments the telomerase inhibitor is imetelstat sodium. In some embodiments, the dose of Bcl-2 inhibitor administered to the subject is an amount sufficient to treat the disease when the Bcl-2 inhibitor is used alone. In certain embodiments, the dose of Bcl-2 inhibitor administered to the subject is less than the amount sufficient to treat the disease when the Bcl-2 inhibitor is used alone. In some embodiments the Bcl-2 inhibitor is ABT-199. In another embodiment, the dose of Bcl-2 inhibitor is reduced when used in combination with imetelstat in treatment of a subject who has been diagnosed with AML. In still another embodiment, the doses of imetelstat thereof and ABT-199 are both reduced when used in combination in treatment of a subject who has been diagnosed with AML
-
In another embodiment, the length of treatment with a telomerase inhibitor is reduced when used in combination with a Bcl-2 inhibitor in treatment of a subject who has a hematological cancer. In another embodiment, the length of treatment with imetelstat is reduced when used in combination with ABT-199 in treatment of a subject with a hematological cancer. In another embodiment, the length of treatment with ABT-199 is reduced when used in combination with imetelstat in treatment of a subject who has been diagnosed with a hematological cancer. In another embodiment, the length of treatment with both imetelstat and ABT-199 is reduced when used in combination in treatment of a subject who has been diagnosed with a hematological cancer. In some embodiments the hematological cancer is AML.
-
For treatment of hematological cancers, telomerase inhibitors (e.g., imetelstat) and Bcl-2 inhibitors (e. g., ABT-199, ABT-263, ABT-737) can be administered in combination to a subject in need of treatment. An example of a cancer that can be treated by this method is acute myeloid leukemia (AML), also called acute myelocytic leukemia, acute myelogenous leukemia, acute granulocytic leukemia or acute non-lymphocytic leukemia. In acute leukemia, the leukemia cells are immature blood cells (called blasts) which are fast growing and divide quickly. Without treatment, most patients with acute leukemia would live only a few months.
-
Telomerase inhibitors and Bcl-2 inhibitors as used in the present invention can be administered at any dose that is therapeutically effective, such as doses comparable to those routinely utilized clinically. Specific dose regimens for known and approved anti-cancer agents (e.g., the recommended effective dose) are known to physicians and are given, for example, in the product descriptions found in the PHYSICIANS' DESK REFERENCE, 2003, 57th Ed., Medical Economics Company, Inc., Oradell, N.J; Goodman & Gilman's THE PHARMACOLOGICAL BASIS OF THERAPEUTICS" 2001, 10th Edition, McGraw-Hill, New York; and/or are available from the Federal Drug Administration and/or are discussed in the medical literature.
-
In some aspects, the dose of a telomerase inhibitor, imetelstat sodium, administered to the subject is 1.0 mg/kg to 13.0 mg/kg. In other aspects, the dose of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments, the dose of a telomerase inhibitor includes at least about any of 6.5 mg/kg, 6.6 mg/kg, 6.7 mg/kg, 6.8 mg/kg, 6.9 mg/kg, 7 mg/kg, 7.1 mg/kg, 7.2 mg/kg, 7.3 mg/kg, 7.4 mg/kg, 7.5 mg/kg, 7.6 mg/kg, 7.7 mg/kg, 7.8 mg/kg, 7.9 mg/kg, 8 mg/kg, 8.1 mg/kg, 8.2 mg/kg, 8.3 mg/kg, 8.4 mg/kg, 8.5 mg/kg, 8.6 mg/kg, 8.7 mg/kg, 8.8 mg/kg, 8.9 mg/kg, 9 mg/kg, 9.1 mg/kg, 9.2 mg/kg, 9.3 mg/kg, 9.4 mg/kg, 9.5 mg/kg, 9.6 mg/kg, 9.7 mg/kg, 9.8 mg/kg, 9.9 mg/kg, 10 mg/kg, 10.1 mg/kg, 10.2 mg/kg, 10.3 mg/kg, 10.4 mg/kg, 10.5 mg/kg, 10.6 mg/kg, 10.7 mg/kg, 10.8 mg/kg, 10.9 mg/kg, 11 mg/kg, 11.1 mg/kg, 11.2 mg/kg, 11.3 mg/kg, 11.4 mg/kg, 11.5 mg/kg, 11.6 mg/kg, 11.7 mg/kg, 11.8 mg/kg, 11.9 mg/kg, 12 mg/kg, 12.1 mg/kg, 12.2 mg/kg, 12.3 mg/kg, 12.4 mg/kg, 12.5 mg/kg, 12.6 mg/kg, 12.7 mg/kg, 12.8 mg/kg, 12.9 mg/kg, or 13 mg/kg.
-
In some embodiments, the effective amount of a telomerase inhibitor administered to the individual includes at least about any of 1 mg/kg, 2.5 mg/kg, 3.5 mg/kg, 5 mg/kg, 6.5 mg/kg, 7.5 mg/kg, 9.4mg/kg, 10 mg/kg, 15 mg/kg, or 20 mg/kg. In various embodiments, the effective amount of a telomerase inhibitor administered to the individual includes less than about any of 350 mg/kg, 300 mg/kg, 250 mg/kg, 200 mg/kg, 150 mg/kg, 100 mg/kg, 50 mg/kg, 30 mg/kg, 25 mg/kg, 20 mg/kg, 10 mg/kg, 7.5 mg/kg, 6.5 mg/kg, 5 mg/kg, 3.5 mg/kg, 2.5 mg/kg, 1 mg/kg, or 0.5 mg/kg of a telomerase inhibitor.
-
Exemplary dosing frequencies for the pharmaceutical compositions (e.g., a pharmaceutical composition including a telomerase inhibitor, and/or a pharmaceutical composition including a Bcl-2 inhibitor) include, but are not limited to, daily; every other day; twice per week; three times per week; weekly without break; weekly, three out of four weeks; once every three weeks; once every two weeks; weekly, two out of three weeks. In some embodiments, the pharmaceutical composition is administered about once every week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 6 weeks, or once every 8 weeks. In some embodiments, the composition is administered at least about any of 1x, 2x, 3x, 4x, 5x, 6x, or 7x (i.e., daily) a week, or three times daily, two times daily. In some embodiments, the intervals between each administration are less than about any of 6 months, 3 months, 1 month, 20 days, 15 days, 12 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day. In some embodiments, the intervals between each administration are more than about any of 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, or 12 months. In some embodiments, there is no break in the dosing schedule. In some embodiments, the interval between each administration is no more than about a week.
-
Telomerase inhibitors such as imetelstat or imetelstat sodium can be administered using any appropriate method. For example, telomerase inhibitors such as imetelstat or imetelstat sodium can be administered intravenously once every 4 weeks over a period of time (e.g., one, two, three, four, or five hours). In one embodiment, imetelstat is administered intravenously once weekly over a period of about 2 hours at 7 - 10 mg/kg. In another embodiment, imetelstat is administered intravenously once every 3 weeks over a period of about 2 hours at 2.5 - 7 mg/kg. In yet another embodiment, imetelstat is administered intravenously for a period of about 2 hours once every 4 weeks at 0.5 - 5 mg/kg.
-
In such cases, when treating with the Bcl-2 inhibitor, ABT-199, the dose of ABT-199 can be about or less than 400 mg PO qDay. For example, a human identified as having a hematological malignancy can be treated with ABT-199 at a dose that is a) 20 mg PO qday, b) 50 mg PO qDay, c) 100 mg PO qDay, d) 200 mg PO qDay or e) 400 mg PO qDay. In another embodiment, ABT-199 is administered according to a weekly ramp-up schedule over 5 weeks to the recommended daily dose of 400 mg starting at 20 mg PO qDay at week 1, 50 mg PO qDay at week 2, 100 mg PO qDay at week 3, 200 mg PO qDay at week 4 and 400 mg PO qDay at week 5 and beyond. In another embodiment, ABT-199 is administered at 400 mg PO qDay. In another embodiment, dosing is continued until disease progression or unacceptable toxicity.
-
The combinations of drugs described herein may be administered to the subject as a composition containing both drugs, or separately. The combinations of drugs described herein may be administered in a combined-drug composition, e.g., by IV administration, or separately.
-
The present invention also concerns pharmaceutical compositions comprising a telomerase inhibitor (e.g., imetelstat, in particular imetelstat sodium) and a Bcl-2 inhibitor (e.g., ABT-199). The combinations of drugs described herein may be administered to the subject as a composition containing both drugs.
-
The carrier or diluent must be "acceptable" in the sense of being compatible with the other ingredients of the composition and not deleterious to the recipients thereof.
-
For ease of administration, the combinations of drugs described herein may be formulated into various pharmaceutical forms for administration purposes. The combinations of drugs described herein may be formulated into various pharmaceutical forms for administration purposes. As appropriate compositions there may be cited all compositions usually employed for systemically administering drugs.
-
To prepare the pharmaceutical compositions of this invention, an effective amount of a combination of drugs described herein are combined in intimate admixture with a pharmaceutically acceptable carrier, which carrier may take a wide variety of forms depending on the form of preparation desired for administration. These pharmaceutical compositions are desirable in unitary dosage form suitable, in particular, for administration orally, rectally, percutaneously, by parenteral injection or by inhalation. In some cases, administration can be via intravenous injection. For example, in preparing the compositions in oral dosage form, any of the usual pharmaceutical media may be employed such as, for example, water, glycols, oils, alcohols and the like in the case of oral liquid preparations such as suspensions, syrups, elixirs, emulsions and solutions; or solid carriers such as starches, sugars, kaolin, diluents, lubricants, binders, disintegrating agents and the like in the case of powders, pills, capsules and tablets. Because of their ease in administration, tablets and capsules represent the most advantageous oral dosage unit forms in which case solid pharmaceutical carriers are obviously employed. For parenteral compositions, the carrier will usually comprise sterile water, at least in large part, though other ingredients, for example, to aid solubility, may be included. Injectable solutions, for example, may be prepared in which the carrier comprises saline solution, glucose solution or a mixture of saline and glucose solution. Injectable solutions, for example, may be prepared in which the carrier comprises saline solution, glucose solution or a mixture of saline and glucose solution. Injectable solutions containing combination of drugs described herein may be formulated in an oil for prolonged action. Appropriate oils for this purpose are, for example, peanut oil, sesame oil, cottonseed oil, corn oil, soybean oil, synthetic glycerol esters of long chain fatty acids and mixtures of these and other oils. Injectable suspensions may also be prepared in which case appropriate liquid carriers, suspending agents and the like may be employed. Also included are solid form preparations that are intended to be converted, shortly before use, to liquid form preparations. In the compositions suitable for percutaneous administration, the carrier optionally comprises a penetration enhancing agent and/or a suitable wetting agent, optionally combined with suitable additives of any nature in minor proportions, which additives do not introduce a significant deleterious effect on the skin. Said additives may facilitate the administration to the skin and/or may be helpful for preparing the desired compositions. These compositions may be administered in various ways, e.g., as a transdermal patch, as a spot-on, as an ointment.
-
It is especially advantageous to formulate the aforementioned pharmaceutical compositions in unit dosage form for ease of administration and uniformity of dosage. Unit dosage form as used herein refers to physically discrete units suitable as unitary dosages, each unit containing a predetermined quantity of active ingredients calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. Examples of such unit dosage forms are tablets (including scored or coated tablets), capsules, pills, powder packets, wafers, suppositories, injectable solutions or suspensions and the like, and segregated multiples thereof.
-
In order to enhance the solubility and/or the stability of the drugs in the combinations described herein in pharmaceutical compositions, it can be advantageous to employ α-, β- or γ-cyclodextrins or their derivatives, in particular hydroxyalkyl substituted cyclodextrins, e.g. 2-hydroxypropyl-β-cyclodextrin or sulfobutyl-β-cyclodextrin. Also cosolvents such as alcohols may improve the solubility and/or the stability of the compounds according to the invention in pharmaceutical compositions.
-
Depending on the mode of administration, the pharmaceutical composition will preferably comprise from 0.05 to 99 % by weight, more preferably from 0.1 to 70 % by weight, even more preferably from 0.1 to 50 % by weight of the drugs in the combinations described herein, and from 1 to 99.95 % by weight, more preferably from 30 to 99.9 % by weight, even more preferably from 50 to 99.9 % by weight of a pharmaceutically acceptable carrier, all percentages being based on the total weight of the composition.
-
The frequency of administration can be any frequency that reduces the severity of a symptom of a hematological malignancy (e.g., reduces or reverses bone marrow fibrosis) without producing significant toxicity to the mammal. For example, the frequency of administration can be from about once every two months to about once a week, or from about once a month to about twice a month, or from about once every six weeks to about twice a month. The frequency of administration can remain constant or can be variable during the duration of treatment. A course of treatment with a composition containing one or more telomerase inhibitors can include rest periods. For example, a composition containing a telomerase inhibitor and a Bcl-2 inhibitor can be administered weekly over a three week period followed by a two week rest period, and such a regimen can be repeated multiple times. As with the effective amount, various factors can influence the actual frequency of administration used for a particular application. For example, the effective amount, duration of treatment, use of multiple treatment agents, route of administration, and severity of the hematological malignancy may require an increase or decrease in administration frequency.
-
An effective duration for administering a composition containing a telomerase inhibitor (e.g., imetelstat or imetelstat sodium) and a Bcl-2 inhibitor (e.g., ABT-199) can be any duration that reduces the severity of a symptom of a hematological malignancy (e.g., reduces or reverses bone marrow fibrosis) without producing significant toxicity to the mammal. Thus, the effective duration can vary from one month to several months or years (e.g., one month to two years, one month to one year, three months to two years, three months to ten months, or three months to 18 months). In general, the effective duration for the treatment of a hematological malignancy can range in duration from two months to twenty months. In some cases, an effective duration can be for as long as an individual mammal is alive. Multiple factors can influence the actual effective duration used for a particular treatment. For example, an effective duration can vary with the frequency of administration, effective amount, use of multiple treatment agents, route of administration, and severity of the hematological malignancy.
-
In certain instances, a course of treatment and the severity of one or more symptoms related to a hematological malignancy can be monitored. Any method can be used to determine whether or not the severity of a symptom of a hematological malignancy is reduced. For example, the severity of a symptom of a hematological malignancy (e.g., bone marrow fibrosis) can be assessed using biopsy techniques.
-
The term "pharmaceutically acceptable salt" means a salt which is acceptable for administration to a patient, such as a mammal (salts with counterions having acceptable mammalian safety for a given dosage regime). Such salts can be derived from pharmaceutically acceptable inorganic or organic bases and from pharmaceutically acceptable inorganic or organic acids. "Pharmaceutically acceptable salt" refers to pharmaceutically acceptable salts of a compound, which salts are derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, and the like. Pharmaceutically acceptable salts of interest include, but are not limited to, aluminium, ammonium, arginine, barium, benzathine, calcium, cholinate, ethylenediamine, lysine, lithium, magnesium, meglumine, procaine, potassium, sodium, tromethamine, N-methylglucamine, N,N'-dibenzylethylene-diamine, chloroprocaine, diethanolamine, ethanolamine, piperazine, zinc, diisopropylamine, diisopropylethylamine, triethylamine and triethanolamine salts.
-
The term "salt(s) thereof" means a compound formed when a proton of an acid is replaced by a cation, such as a metal cation or an organic cation and the like. Preferably, the salt is a pharmaceutically acceptable salt. By way of example, salts of the present compounds include those wherein the compound is protonated by an inorganic or organic acid to form a cation, with the conjugate base of the inorganic or organic acid as the anionic component of the salt. Salts of interest include, but are not limited to, aluminium, ammonium, arginine, barium, benzathine, calcium, cesium, cholinate, ethylenediamine, lithium, magnesium, meglumine, procaine, N-methylglucamine, piperazine, potassium, sodium, tromethamine, zinc, N,N'-dibenzylethylene-diamine, chloroprocaine, diethanolamine, ethanolamine, piperazine, diisopropylamine, diisopropylethylamine, triethylamine and triethanolamine salts. It is understood that for any of the oligonucleotide structures depicted herein that include a backbone of internucleoside linkages, such oligonucleotides may also include any convenient salt forms. In some embodiments, acidic forms of the internucleoside linkages are depicted for simplicity. In some instances, the salt of the subject compound is a monovalent cation salt. In certain instances, the salt of the subject compound is a divalent cation salt. In some instances, the salt of the subject compound is a trivalent cation salt. "Solvate" refers to a complex formed by combination of solvent molecules with molecules or ions of the solute. The solvent can be an organic compound, an inorganic compound, or a mixture of both. Some examples of solvents include, but are not limited to, methanol, N,N-dimethylformamide, tetrahydrofuran, dimethylsulfoxide, and water. When the solvent is water, the solvate formed is a hydrate.
-
"Stereoisomer" and "stereoisomers" refer to compounds that have same atomic connectivity but different atomic arrangement in space. Stereoisomers include for example cis-trans isomers, E and Z isomers, enantiomers, and diastereomers. As to any of the groups disclosed herein which contain one or more substituents, it is understood, of course, that such groups do not contain any substitution or substitution patterns which are sterically impractical and/or synthetically non-feasible. All stereoisomers are intended to be included within the scope of the present disclosure.
-
A person of ordinary skill in the art would recognize that other tautomeric arrangements of the groups described herein are possible. It is understood that all tautomeric forms of a subject compound are encompassed by a structure where one possible tautomeric arrangement of the groups of the compound is described, even if not specifically indicated.
-
It is intended to include a solvate of a pharmaceutically acceptable salt of a tautomer of a stereoisomer of a subject compound. These are intended to be included within the scope of the present disclosure.
Administration Regimens
-
It will be appreciated that treatment for cancer sometimes involves multiple "rounds" or "cycles" of administration of a drug, where each cycle comprises administration of the drug one or more times according to a specified schedule (e.g., every three weeks for three consecutive days; once per week; etc.). For example, anti-cancer drugs can be administered for from 1 to 8 cycles, or for a longer period. When more than one drug (e.g., two· drugs) is administered to a subject, each can be administered according to its own schedule (e.g., weekly; once every three weeks; etc.). It will be clear that administration of drugs, even those administered with different periodicity, can be coordinated so that both drugs are administered on the same day at least some of the time or, alternatively, so the drugs are administered on consecutive days at least some of the time.
-
In treatment regimens in which a telomerase inhibitor (e.g., imetelstat or imetelstat sodium) and a Bcl-2 inhibitor (e.g., ABT-199 or Veneteclax) are administered in combination, they can be administered in any order. In certain embodiments, the telomerase inhibitor is administered one day before, one day after, or the same day as, administration of the Bcl-2 inhibitor. It will be understood that other schedules can be used as determined by the physician.
-
As is understood in the art, treatment with cancer therapeutic drugs can be suspended temporarily if toxicity is observed, or for the convenience of the patient, without departing from the scope of the invention, and then resumed.
Administration In Combination
-
Two or three drugs are administered to a subject "in combination" when the drugs are administered as part of the same course of therapy. A course of therapy refers to administration of combinations of drugs believed by the medical professional to work together additively, complementarity, synergistically, or otherwise to produce a more favorable outcome than that anticipated for administration of a single drug. A course of therapy can be for one or a few days, but more often extends for several weeks.
-
Thus, an example of administration in combination is administration of imetelstat once every 28 days for 1 to 4 cycles, beginning on day 1, and administration of ABT-199 once every 7 days beginning on day 1 for 4 cycles. In an embodiment administration of ABT-199 begins on day 1, day -1, or day 2 or another day that within the cycle. In an embodiment, administration in combination is administration of imetelstat once every 28 days for 1 to 4 cycles, beginning on day 1, and administration of ABT-199 once every day for 28 days beginning on day 1 for 1 to 4 cycles.
-
When two drugs are administered in combination, a variety of schedules can be used. In one case, for example and without limitation, Drug 1 is first administered prior to administration of Drug 2, and treatment with Drug 1 is continued throughout the course of administration of Drug 2; alternatively Drug 1 is administered after the initiation or completion of Drug 2 therapy; alternatively, Drug 1 is first administered contemporaneously with the initiation of the other cancer therapy. As used in this context, "contemporaneously" means the two drugs are administered the same day, or on consecutive days.
-
Although in principle certain drugs can be co-formulated, in general they are administered in separate compositions. Similarly, although certain drugs can be administered simultaneously, more often (especially for drugs administered by infusion) drugs are administered at different times on the same day, on consecutive days, or according to another schedule.
-
The invention also relates to a combination comprising a telomerase inhibitor and a Bcl-2 inhibitor. In particular the telomerase inhibitor is imetelstat and the Bcl-2 inhibitor is ABT-199. In particular the telomerase inhibitor is imetelstat sodium and the Bcl-2 inhibitor is ABT-199.
-
The invention also relates to a combination comprising a telomerase inhibitor and a Bcl-2 inhibitor for use as a medicament. In particular the telomerase inhibitor is imetelstat and the Bcl-2 inhibitor is ABT-199. In particular the telomerase inhibitor is imetelstat sodium and the Bcl-2 inhibitor is ABT-199.
Hematological Cancers
-
The methods of the present invention can be used for treatment of any convenient hematological malignancy. Hematologic malignancies are forms of cancer that begin in the cells of blood-forming tissue, such as the bone marrow, or in the cells of the immune system. Examples of hematologic cancers are acute and chronic leukemias, lymphomas, multiple myeloma and myelodysplastic syndromes. In some instances, the hematological malignancy is referred to as a hematological cancer. Myeloproliferative neoplasms, or MPNs, are hematologic neoplasms that arise from neoplastic hematopoietic myeloid progenitor cells in the bone marrow, such as the precursor cells of red cells, platelets and granulocytes. Proliferation of neoplastic progenitor cells leads to an overproduction of any combination of white cells, red cells and/or platelets, depending on the disease. These overproduced cells may also be abnormal, leading to additional clinical complications. There are various types of chronic myeloproliferative disorders. Included in the myeloproliferative neoplasms is essential thrombocythemia, polycythemia vera, chronic myelogenous leukemia, myelofibrosis, chronic neutrophilic leukemia, chronic eosinophilic leukemia and acute myelogenous leukemia. A myelodysplastic syndrome (MDS) is a group of symptoms that includes cancer of the blood and bone marrow. MDS includes, but limited to, refractory anemia, refractory anemia with excess blasts, refractory cytopenia with multilineage dysplasia, and chronic myelomonocytic leukemia (CML).
-
Hematological cancers of interest include, but not limited to, AML, essential thrombocythemia, polycythemia vera, primary myelofibrosis, systemic mastocytosis, chronic myeloid leukemia, chronic neutrophilic leukemia, chronic eosinophilic leukemia, refractory anemia with ringed sideroblasts, refractory cytopenia with multilineage dysplasia, refractory anemia with excess blasts, type 1, refractory anemia with excess blasts, type 2, Myelodysplastic syndrome (MDS) with isolated del (5q), MDS unclassifiable, chronic myelomonocytic leukemia (CML), atypical chronic myeloid leukemia, juvenile myelomonocytic leukemia, myeloproliferative/myelodysplatic syndromes-unclassifiable, B lymphoblastic leukemia/lymphoma, T lymphoblastic leukemia/lymphoma, diffuse large B-cell lymphoma, primary central nervous system lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma/leukemia, follicular lymphoma, chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma/Waldenström macroglobulinemia, Mantle cell lymphoma, marginal zone lymphomas, Post-transplant lymphoproliferative disorders, HIV-associated lymphomas, primary effusion lymphoma, Intravascular large B-cell lymphoma, Primary cutaneous B-cell lymphoma, Hairy cell leukemia, Monoclonal gammopathy of unknown significance, smoldering multiple myeloma, and solitary plasmacytomas (solitary bone and extramedullary).
-
Certain treatment regimens of the invention are particularly suited for treatment of AML. In certain embodiments of the invention the subject to whom treatment is administered has AML. Among AMLs, chemotherapy-refractory AMLs, such as AMLs refractory to treatment with cytarabine in combination with daunorubicin or idarubicin can be treated using the methods disclosed herein, e.g., by administration of imetelstat in combination with ABT-199. Response of AML to treatment is known in the art. An example of AML Response Assessment is shown in Table 1.
Table 1. AML Response Assessments | AML Response Assessments |
| Category | Definition |
| Complete response (CR)1 | Bone marrow blasts <5%; absence of blasts with Auer rods; absence of extramedullary disease; absolute neutrophil count >1.0 × 109/L (1000/µL); platelet count >100 × 109/L (100 000/µL); independence of red cell transfusions |
| CR with incomplete recovery (CRi)2 | All CR criteria except for residual neutropenia (<1.0 × 109/L [1000/µL]) or thrombocytopenia (<100 × 109/L [100 000/µL]) |
| Morphologic leukemia-free state3 | Bone marrow blasts <5%; absence of blasts with Auer rods; absence of extramedullary disease; no hematologic recovery required |
| Partial response (PR) | Relevant in the setting of Phase 1 and 2 clinical trials only; all hematologic criteria of CR; decrease of bone marrow blast percentage to 5% to 25%; and decrease of pretreatment bone marrow blast percentage by at least 50% |
| Cytogenetic CR (CRc)4 | Reversion to a normal karyotype at the time of morphologic CR (or CRi) in cases with an abnormal karyotype at the time of diagnosis; based on the evaluation of 20 metaphase cells from bone marrow |
| Molecular CR (CRm)5 | No standard definition; depends on molecular target |
| Relapse6 | Bone marrow blasts ≥5%; or reappearance of blasts in the blood; or development of extramedullary disease |
| Treatment failure7 | >25% absolute increase in the bone marrow blast count from baseline to the present assessment (eg, from 20% to 46%) on bone marrow aspirate (or biopsy in case of dry tap) |
| Stable disease8 | Does not qualify for a complete or partial response and has no evidence of treatment failure. |
Definitions of response criteria are based primarily on those given by Cheson 1990.
1 All criteria need to be fulfilled; marrow evaluation should be based on a count of 200 nucleated cells in an aspirate with spicules; if ambiguous, consider repeat exam after 5 to 7 days; flow cytometric evaluation may help to distinguish between persistent leukemia and regenerating normal marrow; a marrow biopsy should be performed in cases of dry tap, or if no spicules are obtained; no minimum duration of response required.
2 The criterion of CRi is of value in protocols using intensified induction or double induction strategies, in which hematologic recovery is not awaited, but intensive therapy will be continued. In such protocols, CR may even not be achieved in the cycle of the entire treatment plan. In these instances, the overall response rate should include CR and CRi patients. Some patients may not achieve complete hematologic recovery upon longer observation times.
3 This category may be useful in the clinical development of novel agents within phase 1 clinical trials, in which a transient morphologic leukemia-free state may be achieved at the time of early response assessment.
4 Four studies showed that failure to convert to a normal karyotype at the time of CR predicts inferior outcome.
5 As an example, in CBF AML low-level PCR-positivity can be detected in patients even in long-term response. Normalizing to 104 copies of ABL in accordance with standardized criteria, transcript levels below 12 to 10 copies appear to be predictive for long-term response.
6 In cases with low blast percentages (5-10%), a repeat marrow should be performed to confirm relapse. Appearance of new dysplastic changes should be closely monitored for emerging relapse. In a patient who has been recently treated, dysplasia or a transient increase in blasts may reflect a chemotherapy effect and recovery of hematopoiesis. Cytogenetics should be tested to distinguish true relapse from therapy-related MDS/AML. |
-
The combinations of drugs described herein are suitable for use in the treatment of any one of the diseases or disorders mentioned herein, including hematological cancer (or subtypes thereof). The drugs could be administered simultaneously or sequentially.
-
The combinations of drugs described herein are suitable for use in inducing apoptosis in a hematologic cancer cell. The drugs could be administered simultaneously or sequentially.
-
It will also be clear that the compositions described herein are suitable for use in the treatment of any one of the diseases or disorders mentioned herein, including hematological cancer (or subtypes thereof).
Subject
-
A subject is a mammal in need of treatment for cancer. Generally, the subject is a human patient. In some embodiments of the invention, the subject can be a non-human mammal such as a non-human primate, an animal model (e.g., animals such as mice and rats used in screening, characterization and evaluation of medicaments) and other mammals. As used herein, the terms patient, subject and individual are used interchangeably.
Diagnosis
-
For diagnosis of AML, blood and marrow smears are morphologically examined using a May-Grünwald-Giemsa or a Wright-Giemsa stain. It is recommended that at least 200 leukocytes on blood smears and 500 nucleated cells on marrow smears be counted, with the latter containing spicules. For a diagnosis of AML, a marrow or blood blast count of 20% or more is required, except for AML with t(15;17), t(8;21), inv(16) or t(16;16), and some cases of erythroleukemia. Myeloblasts, monoblasts, and megakaryoblasts are included in the blast count. In AML with monocytic or myelomonocytic differentiation, monoblasts and promonocytes, but not abnormal monocytes, are counted as blast equivalents. Erythroblasts are not counted as blasts except in the rare instance of pure erythroid leukemia.
Treatment
-
As used herein, and as well-understood in the art, "treatment" is an approach for obtaining beneficial or desired results, including clinical results. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation or amelioration of one or more symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment. Anti-cancer Agents
-
The following section describes drugs used in various embodiments of the invention. As these drugs are well known, only brief discussions are provided. Publications cited in this section are intended to illustrate aspects of the drug for the benefit of the practitioner; however, citation to a particular publication in this section or elsewhere in this disclosure is not intended to limit the present invention in any respect, including as to doses, combinations, and indications.
Telomerase inhibitors
-
Examples of telomerase inhibitors include, without limitation, imetelstat, specifically imetelstat sodium. In some cases, one or more than one telomerase inhibitor (e.g., two or three telomerase inhibitors) can be administered to a mammal to treat a hematological malignancy.
-
Imetelstat sodium is the sodium salt of imetelstat, which is a synthetic lipid- conjugated, 13-mer oligonucleotide N3'→P5'-thio-phosphoramidate.
-
The chemical name for imetelstat sodium is DNA, d(3'-amino-3'-deoxy-P-thio) (T-A-G-G-G-T-T-A-G-A-C-A-A), 5'-[O-[2-hydroxy-3-(hexadecanoylamino)propyl] phosphorothioate], sodium salt (1:13) (SEQ ID NO: 1).
Imetelstat and imetelstat sodium can be produced, formulated, or obtained as described elsewhere (Asai et al, Cancer Res., 63(14):3931- 3939 (2003), Herbert et al, Oncogene, 24:5262-5268 (2005), and Gryaznov, Chem. Biodivers., 7:477-493 (2010)).
-
Imetelstat and imetelstat sodium targets the RNA template of telomerase and has been shown to inhibit telomerase activity and cell proliferation in various cancer cell lines and tumor xenografts in mice. Phase 1 studies involving patients with breast cancer, non-small-cell lung cancer and other solid tumors, multiple myeloma, or chronic lymphocytic leukemia have provided information on drug pharmacokinetics and pharmacodynamics and helped establish 9.4 mg per kilogram of body weight (given as a 2-hour intravenous infusion). A subsequent phase 2 study involving patients with essential thrombocythemia showed platelet-lowering activity accompanied by a significant reduction in JAK2 V617F and CALR mutant allele burdens. Imetelstat sodium is routinely administered intravenously; it is contemplated that in the practice of the present invention other administration routes also can be used, such as intrathecal administration, intratumoral injection, oral administration and others. Imetelstat sodium can be administered at doses comparable to those routinely utilized clinically. In preferred embodiments, imetelstat sodium is administered as described elsewhere herein.
-
A particular embodiment is according to any one of the other embodiments, wherein imetelstat is limited to imetelstat sodium.
Bcl-2 Inhibitor ABT-199
-
ABT-199 (Venetoclax) represents the first-in-class, selective, oral BCL-2 inhibitor sparing platelets (Figure 1b). It showed sub-nanomolar affinity to BCL-2 (K i < 0.010 nM) with antitumor activity against non-Hodgkin's lymphoma (NHL) and CLL in vitro. In vivo mouse xenograft studies showed activity against aggressive (Myc+) lymphomas as well as acute leukemia. A phase Ia trial of ABT-199 in R/R NHL used continuous daily dosing of 200-900 mg. A single dose was administered on day 7 followed by a lead-in period with stepwise upward titration over 2-3 weeks. The single-agent ABT-199 was also studied in a phase 2, open-label, multicenter trial in patients with high-risk R/R AML and in untreated patients who were unfit for intensive chemotherapy. The study allowed intra-patient dose escalation when a patient received 20 mg ABT-199 on week (Wk) 1 day 1. Daily escalation was implemented to target a final dose of 800 mg on day 6 and daily thereafter. Those patients without a Complete Response (CR) or CR with incomplete hematological recovery (CRi) at the first scheduled assessment (end of Wk 4) were able to escalate to 1200 mg. The recommended Phase 2 dose of ABT-199 in combination with rituximab is 400 mg daily.
Kits
-
The present invention also relates to a kit comprising a telomerase inhibitor and a Bcl-2 inhibitor. Also provided is a kit comprising a telomerase inhibitor and a Bcl-2 inhibitor, for use in treating a hematological cancer. Such therapy in some cases comprises administering the Bcl-2 inhibitor to a subject, either preceding, following, or concomitantly with administration of the telomerase inhibitor. In some cases, the telomerase inhibitor is imetelstat.
-
In a related aspect, the invention provides a kit containing a dose of a telomerase inhibitor in an amount effective to inhibit proliferation of cancer cells in a subject. The kit in some cases includes an insert with instructions for administration of the telomerase inhibitor. The insert may provide a user with one set of instructions for using the inhibitor in combination with a Bcl-2 inhibitor. In some instances, the Bcl-2 inhibitor is ABT-199.
-
In some instances, the set of instructions for the combination therapy may recommend (i) a lower dose of the telomerase inhibitor, when used in combination with the Bcl-2 inhibitor, (ii) a lower dose of the Bcl-2 inhibitor, when used in combination with the telomerase inhibitor, and/or (iii) a different dosing regimen for one or both inhibitors than would normally be recommended.
-
It will be clear that in the paragraphs above in some cases, the telomerase inhibitor is imetelstat; in some cases, the telomerase inhibitor is imetelstat sodium; in some cases, the Bcl-2 inhibitor is ABT-199.
Equivalents and Incorporation by Reference
-
While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes can be made and equivalents can be substituted without departing from the scope of the invention. In addition, many modifications can be made to adapt a particular situation, material, composition of matter, process, process step or steps, to achieve the benefits provided by the present invention without departing from the scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto.
-
All publications and patent documents cited herein are incorporated herein by reference as if each such publication or document was specifically and individually indicated to be incorporated herein by reference. Citation of publications and patent documents is not intended as an indication that any such document is pertinent prior art, nor does it constitute any admission as to the contents or date of the same.
EXAMPLES
Example 1: Cell Treatment
-
AML tumor cells KG-1 (ATCC #CCL-246) and MOLM-13 (DSMZ # ACC554) were plated at a density of ∼20,000 cells per well on 96-well polystyrene U-bottom tissue culture plates (Corning catalog # 353777) in RPMI-1640 (ThermoFisher catalog # 11875-085) supplemented with 10% fetal bovine serum (ThermoFisher catalog # 16140-089) and 1% penicillin/streptomycin antibiotic cocktail (ThermoFisher catalog 15140-122) and grown in a 37°C incubator under humidified 5% CO
2 atmosphere. Cells were treated immediately with imetelstat sodium (Johnson and Johnson) prepared in RPMI-1640 supplemented with 10% fetal bovine serum and/or ABT-199 (Selleckchem catalog # S8048) prepared as a 1000x stock in DMSO, diluted 1:100 in phosphate buffered saline (PBS, vehicle; ThermoFisher catalog # 20012-027). In 96 hour experiments, a second dose of compound(s) was applied at 48 hours without the addition of fresh media as both ABT-199 and imetelstat sodium have in-vitro half-lives less than 48hrs (
Shammas, et al Leukemia 2008 22(7):1410-1418). Imetelstat sodium was tested from 0 - 50µM and ABT-199 was tested from 0 -500nM. Control Non-complimentary and Mismatch oligonucleotides (
US7998938 ) shown in Table 2 were used at identical concentrations to imetelstat sodium to show that effects are specific to the combination of imetelstat sodium and ABT-199.
Table 2: hTR Targeting Sequence | Imetelstat sodium a | 5'-R-TAGGGTTAGACAA-NH2-3' | SEQ ID NO: 1 |
| Mismatch oligob | 5'-R-TAGGTGTAAGCAA-NH2-3' | SEQ ID NO:2 |
| Non-complimentary oligoc | 5'-AACAGATTGGGAT-R-3' | SEQ ID NO:3 |
R represents:
a Palmitoyl [(CH2)14CH3] amide is conjugated through an aminoglycerol linker to the 5'thiophosphate group of an N3'→ P5'thiophosphoramidate (NPS) -linked oligonucleotide.
b Palmitoyl [(CH2)14CH3] amide is conjugated through an aminoglycerol linker to the 5'thiophosphate group of an N3'→ P5'thiophosphoramidate (NPS) -linked oligonucleotide.
c Palmitoyl [(CH2)14CH3] amide is conjugated through the terminal 3' amino group of an NPS oligonucleotide. |
-
At 48 and 96 hours, cells were measured for healthy, early apoptotic and apoptotic populations with an Annexin V (interior cell membrane stain) plus Propidium Iodide (PI, DNA binding dye) flow cytometry assay kit (BioLegend catalog 640914). Annexin V detects the externalization of phosphatidylserine in apoptotic cells using recombinant annexin V conjugated to green-fluorescent FITC dye and dead cells using Propidium iodide (PI). Propidium iodide stains necrotic cells with red fluorescence. After treatment with both probes, early apoptotic cells show green fluorescence, apoptotic (dead) cells show red and green fluorescence, and live cells show little or no fluorescence. Briefly, cells were pelleted and washed 2x with PBS before suspension in Annexin V binding buffer containing a 1:2 ratio of anti-Annexin V-FITC and Propidium Iodide, according to the manufacturer's suggested protocol. Cells were stained for 30 minutes at 4°C in the dark, followed by 3x washes with PBS and suspension in FACs Stain Buffer (BD catalog 554657) prior to interrogation on a BD FACs Canto flow cytometer for forward scatter, side scatter, FITC, and PE channels. Cell populations were analyzed using Cytobank software and compared to untreated (no imetelstat sodium or ABT-199) conditions to establish the boundaries for viable cell (unstained in either channel; ie. double-negative population) gating. For all experiments, dot plots of flow cytometry data show four quadrants with the percent of live cells in the lower left quadrant, percent of early apoptotic cells (Annexin V+/PI-) in the upper left quadrant, and percent of apoptotic (dead) cells (double labeled Annexin V+/PI+) in the top right quadrant. The percentage of apoptotic cells (double labeled) was used to calculate combination effects using both the Highest Single Agent (HSA) and Bliss additivity models (J Tang et al. Frontiers in Pharmacology. 2015; 6 (181)).
-
Using the HSA model, the cytotoxic effect of the combined condition ("C") was compared to the effect generated by each of the single agent controls ("A" or "B") for the respective dose in the combination:
-
The Bliss model performs a similar comparison, but instead of the highest effect of single agent, the Bliss model subtracts from the combination a value equal to the sum of each single agent minus their product:
-
These models are able to demonstrate additivity or weak synergy in a combination.
Results of Cell treatment
-
Dot plots of flow cytometry data for KG-1 cells after 48 hour treatment with imetelstat sodium and/ or ABT-199 are shown in
Figure 1a with a graph of % apoptotic cells (double label) vs. ABT-199 concentration at various imetelstat sodium concentrations shown in
Figure 1b. KG-1 exhibits minor sensitivity to ABT-199 after 48 hours (∼9% and ∼14% at 100 nM and 500 nM respectively) and minimal sensitivity to imetelstat sodium. However, when treatment of 50 µM imetelstat sodium is combined with 100 nM or 500nM ABT-199, a greater effect on cell death is observed at (∼27% at 100nM and ∼50% at 500nM). Tables 3 and 4 show the calculations of a combination effect using the HSA or BLISS models for treatment of KG-1 cells at 48 hours. Negative values do not indicate antagonism in these models, only lack of interaction.
-
Dot plots of flow cytometry data for KG-1 cells after 96 hour treatment with imetelstat sodium and/ or ABT-199 are shown in
Figure 2a with a graph of % apoptotic cells (double label) vs. ABT-199 concentration at various imetelstat sodium concentrations shown in
Figure 2b. KG-1 exhibits minor sensitivity to ABT-199 after 96 hours (∼6% and ∼10% at 100nm and 500 nM respectively) and some sensitivity to imetelstat sodium is also observed (5%, 9% and 16 % at 10 µM, 20 µM and 50 µM respectively). However, when treatment of 25 or 50 µM imetelstat sodium is combined with 20 to 500 nM ABT-199, greater effects on cell death are observed at all concentrations. Tables 5 and 6 show the calculations of a combination effect using the HSA or BLISS models on treatment of KG-1 cells at 96 hours.
-
Dot plots of flow cytometry data for KG-1 cells are shown after treatment at 48 hour (
Figure 3a) or 96 hour (
Figure 4a) with mismatch or non-complimentary oligonucleotides and ABT-199. Graphs of % apoptotic cells (double label) vs. ABT-199 concentration at various oligonucleotide concentrations are shown for 48 hour (
Figure 3b) or 96 hours (
Figure 4b). Excess over highest single-agent (Tables 7 and 8) and excess over Bliss (Tables 9 and 10) models confirm no effect with oligonucleotide controls. Negative values do not indicate antagonism in these models, only lack of interaction.
Table 7. Excess over HSA in KG-1 cells at 48 hours with non-complimentary or mismatch controls | Excess over HSA | ABT-199, nM |
| 0 | 1 | 5 | 20 | 100 | 500 |
| Mismatch µM | 50 | 0 | -3 | -2 | -3 | -5 | -8 |
| 25 | 0 | -3 | -2 | -2 | -3 | -5 |
| Non-complimentary, µM | 50 | 0 | -2 | 1 | -1 | -3 | -5 |
| 25 | 0 | -2 | -1 | -2 | -3 | -3 |
Table 8. Excess over HSA in KG-1 cells at 96 hours with non-complimentary or mismatch controls | Excess over HSA | ABT-199, nM |
| 0 | 1 | 5 | 20 | 100 | 500 |
| Mismatch µM | 50 | 0 | 2 | 3 | 2 | 2 | 3 |
| 25 | 0 | 0 | 0 | 0 | 0 | -3 |
| Non-complimentary , µM | 50 | 0 | 1 | 1 | 1 | 1 | -2 |
| 25 | 0 | 0 | 0 | 0 | -1 | -2 |
Table 9. Excess over BLISS in KG-1 cells at 48 hours with non-complimentary or mismatch controls | Excess over Bliss | ABT-199, nM |
| 0 | 1 | 5 | 20 | 100 | 500 |
| Mismatch, µM | 50 | 0 | -5 | -5 | -6 | -8 | -11 |
| 25 | 0 | -5 | -4 | -4 | -5 | -7 |
| Non-complimentary , µM | 50 | 0 | -5 | -2 | -4 | -6 | -8 |
| 25 | 0 | -5 | -4 | -5 | -5 | -5 |
Table 10. Excess over BLISS in KG-1 cells at 96 hours with non-complimentary or mismatch controls | Excess over Bliss | ABT-199, nM |
| 0 | 1 | 5 | 20 | 100 | 500 |
| Mismatch, µM | 50 | 0 | -2 | -1 | -2 | -2 | -1 |
| 25 | 0 | -4 | -3 | -4 | -4 | -7 |
| Non-complimentary , µM | 50 | 0 | -2 | -2 | -2 | -2 | -5 |
| 25 | 0 | -2 | -3 | -3 | -3 | -5 |
-
Dot plots of flow cytometry data for MOLM-13 cells after 48 hour treatment with imetelstat sodium and/ or ABT-199 are shown in
Figure 5a with a graph of % apoptotic cells (double label) vs. ABT-199 concentration at various imetelstat sodium concentrations shown in
Figure 5b. MOLM-13 exhibits some sensitivity to ABT-199 after 48 hours (∼19% and ∼30% at 100 nM and 500 nM respectively) and some sensitivity to imetelstat sodium (21.5% at 50 µM). However, when the 25 µM imetelstat sodium was combined with ABT-199, a greater effect on cell death was observed (∼32% and ∼72% at 100 nM and 500 nM respectively). The greatest effect on cell death was observed with 50 µM imetelstat sodium combined with ABT-199 at 100 nM (62%) and 500 nM (88%). Surprisingly, in combination with imetelstat sodium at 50 µM, ABT-199 has observed effect on cell killing at lower concentrations of 5 nM and 20 nM. Tables 11 and 12 show the calculations of a combination effect using the HSA or BLISS models for treatment of MOLM-13 cells at 48 hours.
-
Dot plots of flow cytometry data for MOLM-13 cells after 96 hour treatment with imetelstat sodium and/ or ABT-199 are shown in
Figure 6a with a graph of % apoptotic cells (double label) vs. ABT-199 concentration at various imetelstat sodium concentrations shown in
Figure 6b. MOLM-13 exhibits sensitivity to ABT-199 after 96 hours (> 30% cell death at 5, 20, 100 and 500 nM) and sensitivity to imetelstat sodium (≥ 30% at 10, 25 and 50 µM). At all concentrations of combined ABT-199 plus imetelstat sodium treatment, there is enhanced cell-killing. Greater that 90% cell death was observed at the lowest concentration of imetelstat sodium (10 µM) when combined with the highest concentration of ABT-199 (500 nM). Greater than 90% cell death was also observed at concentrations of ABT-199 100 nM and 500 nM when combined. At the highest concentration of imetelstat sodium (50 µM) nearly complete cell death was observed at ABT-199 concentrations of 5, 10, 20, 100 and 500 nM. Tables 13 and 14 show the calculations of a combination effect using the HSA or BLISS models for treatment of MOL-13 cells at 96 hours.
-
Dot plots of flow cytometry data for MOLM-13 cells are shown after treatment at 48 hour (
Figure 7a) or 96 hour (
Figure 8a) with mismatch or non-complimentary oligonucleotides and ABT-199. Graphs of % apoptotic cells (double label) vs. ABT-199 concentration at various oligonucleotide concentrations are shown for 48 hour (
Figure 7b) or 96 hours (
Figure 8b). Excess over highest single-agent (Tables 15 and 17) and excess over Bliss (Tables 16 and 18) models confirm no effect with oligonucleotide controls. Negative values do not indicate antagonism in these models, only lack of interaction.
Table 15. Excess over HSA in MOLM-13 cells at 48 hours with non-complimentary or mismatch controls | Excess over HSA | ABT-199, nM |
| 0 | 1 | 5 | 20 | 100 | 500 |
| Mismatch, µM | 50 | 0 | -4 | -1 | 4 | -1 | 3 |
| 25 | 0 | 0 | -1 | 1 | 0 | 5 |
| Non-complimentary, µM | 50 | 0 | 1 | 0 | 5 | 6 | 3 |
| 25 | 0 | -1 | -2 | 0 | -1 | -2 |
Table 16. Excess over BLISS in MOLM-13 cells at 48 hours with non-complimentary or mismatch controls | Excess over Bliss | ABT-199, nM |
| 0 | 1 | 5 | 20 | 100 | 500 |
| Mismatch, µM | 50 | 0 | -10 | -7 | -2 | -6 | -1 |
| 25 | 0 | -6 | -7 | -5 | -6 | 0 |
| Non-complimentary, µM | 50 | 0 | -8 | -9 | -3 | -2 | -4 |
| 25 | 0 | -8 | -9 | -7 | -8 | -8 |
Table 17. Excess over HSA in MOLM-13 cells at 96 hours with non-complimentary or mismatch controls | Excess over HSA | ABT-199, nM |
| 0 | 1 | 5 | 20 | 100 | 500 |
| Mismatch, µM | 50 | 0 | -22 | -32 | -39 | -37 | -32 |
| 25 | 0 | -15 | -26 | -33 | -29 | -17 |
| Non-complimentary, µM | 50 | 0 | -18 | -24 | -31 | -40 | -33 |
| 25 | 0 | -10 | -22 | -28 | -21 | -16 |
Table 18. Excess over BLISS in MOLM-13 cells at 96 hours with non-complimentary or mismatch controls | Excess over Bliss | ABT-199, nM |
| 0 | 1 | 5 | 20 | 100 | 500 |
| Mismatch, µM | 50 | 0 | -25 | -34 | -41 | -40 | -35 |
| 25 | 0 | -24 | -33 | -39 | -36 | -25 |
| Non-complimentary, µM | 50 | 0 | -24 | -29 | -35 | -44 | -38 |
| 25 | 0 | -19 | -29 | -34 | -28 | -24 |
Example 2: Mechanism
-
Mechanistically, imetelstat sodium functions primarily through inhibiting the active site of the telomerase enzyme complex. In so doing, the telomere ends on which the enzyme acts are therefore not elongated. With the rapid and repeated cell division of tumor cells, over time they become vulnerable to progressive telomere shortening. With the process oftelomeric renewal blocked, cells progressively approach crisis and ultimately trigger apoptosis (Bruedigam et al., Cell Stem Cell. 2014; 15: 775-790).
-
Bcl-2 and its related family members play a role in delivering anti-apoptotic signals to tumor cells. Bcl-2 works by inhibiting Bax, which is a key mediator in signaling the release of apoptotic factors that bring about normal programmed cell death. Under these signals Bax translocates to the mitochondria, triggering cytochrome c and other apoptotic factors that lead to activation of the caspase cascade and culminate in cell death via the intrinsic (ie. non-receptor mediated - TRAIL, TNFa, etc) pathway. The presence of Bcl-2 yields interference in these signals as Bcl-2 can directly inhibit Bax. Without Bax, apoptotic factors are not released and cells are freed from the apoptotic signals.
-
These two pathways converge as the primary protein component of telomerase, hTERT, also plays auxiliary roles in the intrinsic apoptotic pathway that intersect with Bcl-2. In addition, Bcl-2 is known to also increase hTERT expression and subsequent telomerase activity, further reducing apoptosis in tumor cells. hTERT has been shown to be able to intercept Bax prior to it reaching the mitochondria and triggering the cascade of apoptotic signals. In addition, within the mitochondria hTERT can enhance Bcl-2's inhibitory effect on Bax. To further elucidate the mechanism of interaction between imetelstat sodium and ABT-199 in treated cells, hTERT expression was measured by evaluating transcription levels using RT-qPCR and telomerase activity was assessed using protein from lysed cells in a PCR-based TRAP assay.
hTERT transcript levels
-
Samples from cell experiments (and single agent controls) were collected for molecular analyses to assess combination effects contributing to potential mechanisms of action. AML cells were grown in Falcon T25 flasks (Corning catalog 353135) in batches of 8 million cells in 8mL of media dosed with either 50 µM imetelstat sodium, 20 nM ABT-199, 50 µM imetelstat sodium plus 20 nM ABT-199, or no drug for 48 and 96 hrs similar to previous experiments and then collected as cell pellets for lysing and either nucleic acid or protein extraction. Nucleic acids were purified by first lysing cells with 350 µL ofRLT Buffer (Qiagen catalog # 1030963) supplemented with 2-mercaptoethanol (Sigma catalog # 63689-100ML-F). RNA was purified with the AllPrep RNA/DNA Mini Kit (Qiagen catalog # 80204) and reverse transcribed to cDNA using a High Capacity cDNA kit (ThermoFisher catalog # 4368814) and pre-amplified prior to analysis with TaqMan PreAmp Master Mix (ThermoFisher catalog # 4384557B). Products were analyzed using an in-house developed Taq-Man RT-qPCR assay to measure hTERT transcription levels (TaqMan Universal PCR Master Mix - ThermoFisher catalog # 4304437; primer and probe sequences below) using a ViiA7 Real-Time PCR system from ThermoFisher:
- hTERT full length forward: 5'-TGTACTTTGTCAAGGTGGATGTGA-3' (SEQ ID NO:4)
- hTERT full length reverse: 5'-GCTGGAGGTCTGTCAAGGTAGAG-3' (SEQ ID NO:5)
- hTERT FAM probe: FAM 5'-CGCGTACGACACCAT-3' MGBNFQ (SEQ ID NO:6) where FAM is the fluorescent reporter and MGBNFQ is the quencher.
-
Bar charts indicating hTERT expression after 48 and 96 hour treatment with imetelstat sodium and/or ABT-199 are shown in Figure 9. RNA expression levels as measured by RT-qPCR are shown as percentages of untreated controls at the same time of exposure. Results show that KG-1 cells have minimal reduction (90-95% as compared to controls at either time point) in RNA levels of hTERT with ABT-199 treatment and MOLM-13 cells show only a slight reduction in hTERT transcription levels after 96 hours of dosing (∼69% as compared to controls). Imetelstat sodium treatment shows a greater reduction in RNA levels for both cell lines, with lower expression at longer treatment times (KG-1 cells from 72% of control at 48 hours and 47% of control at 96 hours; MOLM-13 cells from 39% at 48 hours to undetectable by the assay at 96 hours). For the combination of imetelstat sodium and ABT-199, hTERT expression was unchanged as compared to imetelstat sodium single-agent in KG-1. For MOLM-13 at both time points, hTERT was undetectable.
hTERT enzymatic levels
-
Samples from the previous section for protein analysis were collected as cell pellets by centrifugation at 5 minutes for 1500K for lyses and protein extraction. Protein lysates were analyzed by utilizing a modified method combined from two primary sources (Hou, et al (2001) 43(3) 519-524 and Nature Protocols (2006) 1 (3) 1583-1590). Lysates were generated by adding 80uL of a 10 mM Tris-EDTA, 1% NP-40, 10% Glycerol, 150 mM NaCl, 1 mM MgCl2, 250 µM Sodium Deoxycholate, 100 µM AEBSF, 5mM 2-mercaptoethanol buffer and incubating on ice for 30 minutes. Lysates were centrifuged for 15 minutes at max speed and at 4°C to pellet cellular debris. Protein yield from clarified lysates were quantified using a BCA assay (ThermoFisher catalog 23252) and subjected to a qPCR TRAP-based assay to determine relative telomerase activity (Power SYBR Green PCR Master Mix - ThermoFisher # 4367659) using a ViiA7 Real-Time PCR system from ThermoFisher. In this assay, protein lysates are exposed to synthetic oligonucleotides mimicking telomere sequences in the presence of excess dNTPs and SYBR green dye. The greater the activity of telomerase, the greater extension of the synthetic primers, and therefore greater staining of nucleic acid and signal generated by the SYBR dye. This signal is compared to a standard curve of control protein lysate to determine the relative telomerase activity between samples
- Forward primer: 5' - AATCCGTCGAGCAGAGTT - 3' (SEQ ID NO:7)
- Reverse primer: 5' - GCGCGGCTTACCCTTACCCTTACCCTAACC - 3' (SEQ ID NO:8)
Results for molecular interactions
-
Bar charts indicating telomerase activity after 48 and 96 hour treatment with imetelstat sodium and/or ABT-199 are shown in Figure 10. At 48 hours, ABT-199 shows no effect on telomerase activity in both KG-1 and MOL-13 cells when used as a single agent. At 96 hours of ABT-199 treatment, activity of telomerase was reduced to ∼80% in KG-1 and ∼70% indicating that ABT-199 has little effect on telomerase activity. Imetelstat sodium showed reductions in telomerase activity in both KG-1 and MOLM-13 cell lines. In MOLM-13 cells, reductions as compared to control were comparable at both time points (37% for 48 hours, 44% for 96 hours). KG-1 however showed greater reductions of telomerase activity with imetelstat sodium treatment at 96 hours (64% for 48 hours, 16% for 96 hours). With combination treatment, KG-1 showed minimal differences from the imetelstat sodium single-agent whereas in MOLM-13 reduction of telomerase activity was nearly undetectable by the PCR assay.
Example 3: Elucidating Synergy of Combination
-
Treatment of model AML tumor cell line MOLM-13 was repeated in the experimental format described in Example 1 with the following changes: imetelstat sodium, control mismatch, and control non-complimentary compounds were tested at higher concentrations from 0 - 75 µM (seven total concentrations) and ABT-199 was tested from 20 pM - 1µM (nine total concentrations). Treated cells were analyzed by Flow cytometry for Annexin V and Propidium Iodide staining as described previously. Events gated in the apoptotic population (Annexin V+/Propidium Iodide+) were used to determine synergy scores for the combination matrix. Combination data analysis was generated by the Horizon Chalice™ Analyzer Software (Horizon Discovery Group, Cambridge, UK)
-
To statistically qualify the effects observed in treated MOLM-13 cells, dosing combinations were evaluated with the web application of Horizon's Chalice™ Analyzer Software which summarizes the raw data from isobolar analysis fixed ratio dosing according to the method of Chou and Talalay (Chou TC, Talalay P., Adv Enzyme Regul 1984;22:27-55).. Combination conditions undergo isobolar analysis to generate a combination index and graphically represent the behavior of a combination with synergistic pairs falling below the isobologram and antagonistic falling above it (additive combinations would be expected to fall on the line). The Horizon Chalice™ Analyzer Software additionally provides a synergy score, with values greater than 1 indicating synergy.
-
A graph of% apoptotic cells (double label) vs. ABT-199 concentration at various imetelstat sodium concentrations for 48 hour treatment is shown in
Figure 11. Table 19 shows the calculations in excess of additivity (Loewe Model) at each combination for MOLM-13 cells after 48 hour treatment. Values greater than zero are found in the upper right quadrant of the Table 19, where concentrations of ABT-199 are greater than or equal to 20 nM and concentrations of imetelstat sodium are greater than or equal to 25 µM. The Horizon Chalice™ Analyzer Software additionally provides a synergy score, with values greater than 1 indicating synergy. For cells treated with imetelstat sodium, after 48 hours the synergy score was determined to be 5.12. This compares to scores of 0.22 and 0.41 for the mismatch and non-complimentary controls (Table 20 and 21), respectively. A graph of % apoptotic cells (double label) vs. ABT-199 concentration at various imetelstat sodium concentrations for 48 hour treatment is shown in
Figure 12a and Figure 12b for mismatch and non-complimentary controls respectively.
-
A graph of% apoptotic cells (double label) vs. ABT-199 concentration at various imetelstat sodium concentrations for 96 hour treatment is shown in
Figure 13. Table 22 shows the calculations in excess of additivity (Loewe Model) at each combination for MOLM-13 cells after 96 hour treatment. Values greater than zero are found in the upper right diagnonal of the Table 19. Surprisingly, even the lowest concentrations of ABT-199 (0.04 nM and 0.2 nM) show synergy with imetelstat sodium at 50 µM and 75 µM imetelstat sodium respectively and the lowest concentrations of imetelstat sodium (1 µM and 5 µM) show synergy with ABT-199 at 500 nM and 100 nM respectively. The Horizon Chalice™ Analyzer Software additionally provides a synergy score, with values greater than 1 indicating synergy. For cells treated with imetelstat sodium, after 48 hours the synergy score was determined to be 11.33. This compares to scores of 0.03 and 0.06 for the mismatch and non-complimentary controls (Table 23 and 24), respectively. A graph of % apoptotic cells (double label) vs. ABT-199 concentration at various imetelstat sodium concentrations for 96 hour treatment is shown in
Figure 14a and Figure 14b for mismatch and non-complimentary controls respectively.
-
Other embodiments of the invention may be as follows:
- 1. A method of treatment comprising administering a telomerase inhibitor and a Bcl-2 inhibitor in combination to a subject in need of treatment for hematological cancer.
- 2. The method of embodiment 1 wherein the hematological cancer is AML, essential thrombocythemia, polycythemia vera, primary myelofibrosis, systemic mastocytosis, chronic myeloid leukemia, chronic neutrophilic leukemia, chronic eosinophilic leukemia, refractory anemia with ringed sideroblasts, refractory cytopenia with multilineage dysplasia, refractory anemia with excess blasts, type 1, refractory anemia with excess blasts, type 2, Myelodysplastic syndrome (MDS) with isolated del (5q), MDS unclassifiable, chronic myelomonocytic leukemia (CML), atypical chronic myeloid leukemia, juvenile myelomonocytic leukemia, myeloproliferative/myelodysplatic syndromes-unclassifiable, B lymphoblastic leukemia/lymphoma, T lymphoblastic leukemia/lymphoma, diffuse large B-cell lymphoma, primary central nervous system lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma/leukemia, follicular lymphoma, chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma/Waldenström macroglobulinemia, Mantle cell lymphoma, marginal zone lymphomas, Post-transplant lymphoproliferative disorders, HIV-associated lymphomas, primary effusion lymphoma, Intravascular large B-cell lymphoma, Primary cutaneous B-cell lymphoma, Hairy cell leukemia, Monoclonal gammopathy of unknown significance, smoldering multiple myeloma, and solitary plasmacytomas (solitary bone and extramedullary).
- 3. The method of embodiment 1 wherein the hematological cancer is AML.
- 3b. The method of any one of embodiments 1-3, wherein the telomerase inhibitor is imetelstat.
- 4. The method of embodiment 3b wherein imetelstat is administered for 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 dosage cycles, each cycle comprising:
- a) intravenous administration of 7 - 10 mg/kg imetelstat thereof once every four weeks, b) intravenous administration of 7 - 10 mg/kg imetelstat once weekly for four weeks, or c) intravenous administration of 2.5 - 7 mg/kg imetelstat once every three weeks, or d) intravenous administration of 0.5 - 9.4 mg/kg imetelstat once every four weeks.
- 5. The method of embodiment 4 wherein imetelstat is imetelstat sodium.
- 5b. The method of any one of embodiments 1-5, wherein the Bcl-2 inhibitor is ABT-199.
- 6. The method of embodiment 5b wherein ABT-199 is administered at a dose of
- a) 50 - 400 mg ABT-199 daily;
- b) 2 mg ABT-199 on day 1 with daily escalation to a final dose of 800 mg on day 6 and daily thereafter; or
- c) 25 mg ABT-199 on day 1 with daily escalation to a final dose of 400 mg on day 5 and daily thereafter.
- 7. The method of embodiment 6 wherein the administration of ABT-199 is one day before, one
day after, or the same day as, the administration of the telomerase inhibitor. - 8. A method of inducing apoptosis in a hematologic cancer cell comprising contacting the cell with a therapeutically effective amount of a telomerase inhibitor and contacting the cell with a therapeutically effective amount of a Bcl-2 inhibitor.
- 9. The method of embodiment 8 wherein the telomerase inhibitor is imetelstat.
- 10. The method of embodiment 9 wherein imetelstat is imetelstat sodium.
- 11. The method of any of embodiments 8-10, wherein the Bcl-2 inhibitor is ABT-199.
- 12. The method of embodiment 8 wherein the hematological cancer cell is AML, essential thrombocythemia, polycythemia vera, primary myelofibrosis, systemic mastocytosis, chronic myeloid leukemia, chronic neutrophilic leukemia, chronic eosinophilic leukemia, refractory anemia with ringed sideroblasts, refractory cytopenia with multilineage dysplasia, refractory anemia with excess blasts, type 1, refractory anemia with excess blasts, type 2, Myelodysplastic syndrome (MDS) with isolated del (5q), MDS unclassifiable, chronic myelomonocytic leukemia (CML), atypical chronic myeloid leukemia, juvenile myelomonocytic leukemia, myeloproliferative/myelodysplatic syndromes-unclassifiable, B lymphoblastic leukemia/lymphoma, T lymphoblastic leukemia/lymphoma, diffuse large B-cell lymphoma, primary central nervous system lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma/leukemia, follicular lymphoma, chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma/Waldenström macroglobulinemia, Mantle cell lymphoma, marginal zone lymphomas, Post-transplant lymphoproliferative disorders, HIV-associated lymphomas, primary effusion lymphoma, Intravascular large B-cell lymphoma, Primary cutaneous B-cell lymphoma, Hairy cell leukemia, Monoclonal gammopathy of unknown significance, smoldering multiple myeloma, and solitary plasmacytomas (solitary bone and extramedullary).
- 13. The method of embodiment 8 wherein the hematological cancer cell is an acute myeloid leukemia (AML) cell.
- 14. A kit, comprising:
- (a) a dose of a telomerase inhibitor, in an amount effective, when administered, to induce apoptosis in a hematologic cancer cell; and
- (b) a dose of a Bcl-2 inhibitor, in an amount effective, when administered, to induce apoptosis in a hematologic cancer cell.
- 15. The kit of embodiment 14, wherein:
- the telomerase inhibitor is imetelstat; and
- the Bcl-2 inhibitor is ABT-199.
-
Other embodiments of the invention may be as follows:
- 16. A telomerase inhibitor for use in a method of treating hematological cancer, the method comprising administering the telomerase inhibitor and a Bcl-2 inhibitor in combination to a subject in need thereof.
- 17. A Bcl-2 inhibitor for use in a method of treating hematological cancer, the method comprising administering the Bcl-2 inhibitor and a telomerase inhibitor in combination to a subject in need thereof.
- 18. A combination comprising a telomerase inhibitor and a Bcl-2 inhibitor for use in a method of treating hematological cancer, the method comprising administering the combination to a subject in need thereof.
- 19. The telomerase inhibitor for use according to embodiment 16 or the Bcl-2 inhibitor for use according to embodiment 17 or the combination for use according to embodiment 18 wherein the hematological cancer is AML, essential thrombocythemia, polycythemia vera, primary myelofibrosis, systemic mastocytosis, chronic myeloid leukemia, chronic neutrophilic leukemia, chronic eosinophilic leukemia, refractory anemia with ringed sideroblasts, refractory cytopenia with multilineage dysplasia, refractory anemia with excess blasts, type 1, refractory anemia with excess blasts, type 2, Myelodysplastic syndrome (MDS) with isolated del (5q), MDS unclassifiable, chronic myelomonocytic leukemia (CML), atypical chronic myeloid leukemia, juvenile myelomonocytic leukemia, myeloproliferative/myelodysplatic syndromes-unclassifiable, B lymphoblastic leukemia/lymphoma, T lymphoblastic leukemia/lymphoma, diffuse large B-cell lymphoma, primary central nervous system lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma/leukemia, follicular lymphoma, chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma/Waldenström macroglobulinemia, Mantle cell lymphoma, marginal zone lymphomas, Post-transplant lymphoproliferative disorders, HIV-associated lymphomas, primary effusion lymphoma, Intravascular large B-cell lymphoma, Primary cutaneous B-cell lymphoma, Hairy cell leukemia, Monoclonal gammopathy of unknown significance, smoldering multiple myeloma, and solitary plasmacytomas (solitary bone and extramedullary).
- 20. The telomerase inhibitor for use according to embodiment 16 or the Bcl-2 inhibitor for use according to embodiment 17 or the combination for use according to embodiment 18 wherein the hematological cancer is AML.
- 21. The telomerase inhibitor for use according to embodiment 16 or the Bcl-2 inhibitor for use according to embodiment 17 or the combination for use according to embodiment 18, wherein the telomerase inhibitor is imetelstat.
- 22. The telomerase inhibitor, Bcl-2 inhibitor or combination for use according to embodiment 21 wherein imetelstat is imetelstat sodium.
- 23. The telomerase inhibitor, Bcl-2 inhibitor or combination for use according to embodiment 21 or embodiment 22 wherein imetelstat is administered for 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 dosage cycles, each cycle comprising:
- a) intravenous administration of 7 - 10 mg/kg imetelstat once every four weeks, b) intravenous administration of 7 - 10 mg/kg imetelstat once weekly for four weeks, or c) intravenous administration of 2.5 - 7 mg/kg imetelstat once every three weeks, or d) intravenous administration of 0.5 - 9.4 mg/kg imetelstat once every four weeks.
- 24. The telomerase inhibitor, Bcl-2 inhibitor or combination for use according to any of embodiments 16-23, wherein the Bcl-2 inhibitor is ABT-199.
- 25. The telomerase inhibitor, Bcl-2 inhibitor or combination for use according to embodiment 24 wherein the ABT-199 is administered at a dose of
- a) 50 - 400 mg ABT-199 daily;
- b) 2 mg ABT-199 on day 1 with daily escalation to a final dose of 800 mg on day 6 and daily thereafter; or
- c) 25 mg ABT-199 on day 1 with daily escalation to a final dose of 400 mg on day 5 and daily thereafter.
- 26. The telomerase inhibitor, Bcl-2 inhibitor or combination for use according to embodiment 24 or embodiment 25 wherein the administration of ABT-199 is one day before, one day after, or the same day as, the administration of the telomerase inhibitor.
- 27. The telomerase inhibitor, Bcl-2 inhibitor or combination for use according to any of embodiments 16-26 wherein the combination of telomerase inhibitor and Bcl-2 inhibitor induces apoptosis of hematologic cancer cells.
- 28. An in vitro method of inducing apoptosis in a hematologic cancer cell comprising:
- contacting the cell with a therapeutically effective amount of a telomerase inhibitor; and
- contacting the cell with a therapeutically effective amount of a Bcl-2 inhibitor.
- 29. The method of embodiment 28 wherein the telomerase inhibitor is imetelstat.
- 30. The method of embodiment 29 wherein imetelstat is imetelstat sodium.
- 31. The method of any of embodiments 28-30, wherein the Bcl-2 inhibitor is ABT-199.
- 32. The method of embodiment 28 wherein the hematological cancer cell is AML, essential thrombocythemia, polycythemia vera, primary myelofibrosis, systemic mastocytosis, chronic myeloid leukemia, chronic neutrophilic leukemia, chronic eosinophilic leukemia, refractory anemia with ringed sideroblasts, refractory cytopenia with multilineage dysplasia, refractory anemia with excess blasts, type 1, refractory anemia with excess blasts, type 2, Myelodysplastic syndrome (MDS) with isolated del (5q), MDS unclassifiable, chronic myelomonocytic leukemia (CML), atypical chronic myeloid leukemia, juvenile myelomonocytic leukemia, myeloproliferative/myelodysplatic syndromes-unclassifiable, B lymphoblastic leukemia/lymphoma, T lymphoblastic leukemia/lymphoma, diffuse large B-cell lymphoma, primary central nervous system lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma/leukemia, follicular lymphoma, chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma/Waldenström macroglobulinemia, Mantle cell lymphoma, marginal zone lymphomas, Post-transplant lymphoproliferative disorders, HIV-associated lymphomas, primary effusion lymphoma, Intravascular large B-cell lymphoma, Primary cutaneous B-cell lymphoma, Hairy cell leukemia, Monoclonal gammopathy of unknown significance, smoldering multiple myeloma, and solitary plasmacytomas (solitary bone and extramedullary).
- 33. The method of embodiment 28 wherein the hematological cancer cell is an acute myeloid leukemia (AML) cell.
- 34. A combination comprising a telomerase inhibitor and a Bcl-2 inhibitor.
- 35. The combination of embodiment 34 wherein the telomerase inhibitor is imetelstat and wherein the Bcl-2 inhibitor is ABT-199.
- 36. The combination of embodiment 34 wherein the telomerase inhibitor is imetelstat sodium and wherein the Bcl-2 inhibitor is ABT-199.
- 37. A combination according to any of embodiments 34-36 for use as a medicament.
SEQUENCE LISTING
-
- SEQ ID NO:1 - Imetelstat and imetelstat sodium
5'-R-TAGGGTTAGACAA-NH2-3'
Wherein R represents Palmitoyl [(CH2)14CH3] amide is conjugated through an aminoglycerol linker to the 5'thiophosphate group of an N3' → P5'thiophosphoramidate (NPS) -linked oligonucleotide.
- SEQ ID NO:2 - Mismatch oligonucleotide control
5'-R-TAGGTGTAAGCAA-NH2-3'
Wherein R represents Palmitoyl [(CH2)14CH3] amide is conjugated through an aminoglycerol linker to the 5'thiophosphate group of an N3' → P5'thiophosphoramidate (NPS) -linked oligonucleotide.
- SEQ ID NO:3 - Non-complimentary oligonucleotide control
5'- AACAGATTGGGAT-R-3'
Wherein R represents Palmitoyl [(CH2)14CH3] amide is conjugated through the 3' amino group of an NPS oligonucleotide.
- SEQ ID NO:4 - hTERT full length forward primer
TGTACTTTGTCAAGGTGGATGTGA
- SEQ ID NO:5 - hTERT full length reverse primer
GCTGGAGGTCTGTCAAGGTAGAG
- SEQ ID NO:6 - hTERT FAM probe
FAM 5'-CGCGTACGACACCAT-3' MGBNFQ ()
where FAM is the fluorescent reporter and MGBNFQ is the quencher.
- SEQ ID NO:7 - Forward primer for hTERT enzymatic assay
AATCCGTCGAGCAGAGTT
- SEQ ID NO:8 - Reverse primer for hTERT enzymatic assay
GCGCGGCTTACCCTTACCCTTACCCTAACC

