EP3274459A1 - Platform for non-natural amino acid incorporation into proteins - Google Patents

Platform for non-natural amino acid incorporation into proteins

Info

Publication number
EP3274459A1
EP3274459A1 EP16771096.1A EP16771096A EP3274459A1 EP 3274459 A1 EP3274459 A1 EP 3274459A1 EP 16771096 A EP16771096 A EP 16771096A EP 3274459 A1 EP3274459 A1 EP 3274459A1
Authority
EP
European Patent Office
Prior art keywords
trna
trnas
anticodon
natural
codon
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP16771096.1A
Other languages
German (de)
French (fr)
Other versions
EP3274459A4 (en
Inventor
Sergey MUREEV
Zhenling CUI
Kirill Alexandrov
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Queensland UQ
Original Assignee
University of Queensland UQ
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2015901121A external-priority patent/AU2015901121A0/en
Application filed by University of Queensland UQ filed Critical University of Queensland UQ
Publication of EP3274459A1 publication Critical patent/EP3274459A1/en
Publication of EP3274459A4 publication Critical patent/EP3274459A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/64Cyclic peptides containing only normal peptide links
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/02Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/10Libraries containing peptides or polypeptides, or derivatives thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/332Abasic residue
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y603/00Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/04Other carbon-nitrogen ligases (6.3.4)
    • C12Y603/04019Other carbon-nitrogen ligases (6.3.4) tRNA(Ile)-lysidine synthetase (6.3.4.19)

Definitions

  • PROTEINS TECHNICAL FIELD relates to protein engineering. More particularly, this invention relates to producing recombinant proteins that comprise one or more non-natural moieties (e.g non- natural amino acids) as well as any of all of the twenty (20) natural amino acids.
  • non-natural moieties e.g non- natural amino acids
  • Proteins are the central functional constituents in all living organisms. They are formed by natural biosynthetic pathways using genetically determined sequences of the twenty (20) genetically encoded "natural" amino acids that form the structural units of such proteins. To date, advances in understanding protein structure, function and diversity have largely focussed on natural structure, function and diversity given the relative simplicity of producing proteins that comprise natural amino acids. While the human genome encodes about 30,000 different proteins, there is potentially even more enormous diversity if proteins can be made that include structural moieties other than natural amino acids (e.g non-natural amino acids, chemical derivatives of natural amino acids, chemically-reactive moieties and the like).
  • non-natural proteins could be used to create synthetic protein libraries, protein-based bioactives such as pharmaceuticals, biotherapeutics (e.g antibodies, peptide hormones, immunomodulators), detection or diagnostic reagents having unprecedented structures and activities not found in naturally-occurring proteins.
  • biotherapeutics e.g antibodies, peptide hormones, immunomodulators
  • detection or diagnostic reagents having unprecedented structures and activities not found in naturally-occurring proteins.
  • the recombinant production of such "non-natural” proteins has proven to be a difficult proposition.
  • tRNA acylation ribozyme that can charge non-natural amino acids onto tRNAs in vitro. This is achieved by the formation of a transient complex with the 3 '-end of a tRNA, where the 3'-OH of the terminal ribose engages in a nucleophilic attack on the activated carboxyl carbon of the non-natural amino acid.
  • Protocols have also been developed for chemical acylation tRNAs. This enables the incorporation of chemical functionalities that are quite distinct from native amino acids and thereby difficult to charge via the aaRS route. While several synthesis routes have been developed, they are typically low-yield and are not widely used.
  • a natural frameshift suppressor tRNA containing an extended anticodon loop can read as a four-base codon, such as UAGN and ACCN, and suppress the +1 frame shift.
  • encoding a non-natural amino acid via four-base codons is a far less efficient approach than the use of nonsense suppression, whereby the yield of a target protein is significantly lowered by false- reading of the quadruplet-codon as a triplet.
  • a more recent strategy for amino acid incorporation is the exclusion of certain amino acids from the genetic code (such as Phe), thereby generating "free" codons that are assignable to a non-natural amino acid. However, this leads to a reduction of the amino acid vocabulary.
  • the present invention broadly provides a method whereby tRNA anticodons can be "reassigned" from natural amino acids to non-natural moieties, such as non- natural amino acids, to enable the production of recombinant proteins that include one or a plurality of non-natural moieties, without compromising the ability to incorporate natural amino acids into the recombinant protein.
  • the invention provides method of producing a complement of tRNAs suitable for translation of a protein comprising at least one non-natural moiety, said method including the step of substituting at least one tRNA that comprises an anticodon for a natural amino acid with at least one tRNA comprising the same anticodon reassigned to a non-natural moiety, wherein the complement of tRNAs is operable to facilitate translation of an RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety whereby the translated protein may comprise any or all of the twenty (20) natural amino acids.
  • the reassigned anticodon is one of a plurality of different anticodons for the same natural amino acid.
  • the invention provides a composition comprising a complement of tRNAs suitable for translation of a protein comprising at least one non-natural moiety, said complement comprising at least one tRNA that comprises an anticodon for a non-natural moiety reassigned from an anticodonfor a natural amino acid , wherein the complement of tRNAs is operable to facilitate translation of an RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety whereby the translated protein may comprise any or all of the twenty (20) natural amino acids.
  • the reassigned anticodon is one of a plurality of different anticodons for the same natural amino acid.
  • the invention provides a method of producing a translation system suitable for translation of a protein comprising at least one non-natural moiety, said method including producing a complement of tRNAs comprising at least one tRNA that comprises an anti-codon for a natural amino acid that has been reassigned to a non-natural moiety; and producing a transcribable RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety, wherein the mRNA may be transcribed to produce a translated protein that may comprise any or all of the twenty (20) natural amino acids.
  • the invention provides a translation system suitable for translation of a protein comprising at least one non-natural moiety, said system comprising: a complement of tRNAs comprising at least one tRNA that comprises an anticodon for a natural amino acid that has been reassigned to a non-natural moiety; and a translatable mRNA which comprises a codon corresponding to the anticodon that has been reassigned to a non-natural moiety, wherein the mRNA may be transcribed to produce a translated protein that may comprise any or all of the twenty (20) natural amino acids.
  • the invention provides a method of producing a recombinant protein comprising at least one non-natural moiety, said method including the step of translating an mRNA which comprises a codon corresponding to an anticodon of a tRNA that has been reassigned to a non-natural moiety in a complement of tRNAs comprising at least one tRNA that comprises an anti-codon for a natural amino acid that has been reassigned to a non-natural moiety, wherein the translated protein may comprise any or all of the twenty (20) natural amino acids.
  • the reassigned anticodon is fourfold or six-fold degenerate.
  • the reassigned anticodon is an anticodon for He, Ala, Gly, Pro, Thr, Val, Arg, Leu or Ser.
  • the translated protein may comprise one or a plurality of the same or different non-natural moieties.
  • the invention provides a recombinant protein produced by the method of the fifth aspect.
  • isolated proteins may comprise one or a plurality of same or different non-natural moieties that facilitate PEGylation, conjugation of small molecules, labelling, immobilisation, intermolecular and/or intramolecular cross-linking or other interactions, formation of higher order strucutres and/or one or more catalytic activities, although without limitation thereto.
  • the recombinant protein comprises two or more of the same or different non-natural moieties that are capable of intramolecular covalent bonding.
  • the recombinant protein is a macrocyclic protein.
  • indefinite articles “a” and “an” are not to be read as singular indefinite articles or as otherwise excluding more than one or more than a single subject to which the indefinite article refers.
  • a protein includes one protein, one or more proteins or a plurality of proteins.
  • FIG. 1 Denaturing PAGE analysis of 48 in vitro synthesized t7tRNA species.
  • the t7tRNAs are denoted by the respective single letter amino acid code (uppercase) and the 5 '-3' anticodon triplet (lowercase).
  • Polymorphic tRNA variants are indicated by the respective numerical indeces.
  • tRNAs for He and Trp (Igau and Wcca) were generated through auto-cleavage of the HHRz-containing RNA precursor.
  • the asterisks above and below the corresponding tRNA-bands denote the precursor and the excised HHRz, respectively.
  • Initiator and elongator tRNAs(Met) are prefixed with "i" and "e", respectively.
  • FIG. 1 Principle and calibration of the affinity clamp peptide biosensor.
  • A Schematic representation of experimental procedure. The RNA sequences at the top represent coding frames for RGS-peptide and its derivatives, RGSl and RGS2, the latter comprising the "insulator" codons (green) followed by the test-codon triplet (XXX, red). The resulting peptide containing the constant eight-amino-acid C- terminus and variable N-terminus binds to the biosensor composed of an autoinhibited TVMV-protease, with PDZ and FN3 domains forming the affinity clamp.
  • FIG. 3 Cell-free translation of eGFP and RGS-peptide in tRNA-depleted E.coli lysate.
  • A Native tRNA-dependent eGFP expression.
  • B Analysis of the depletion efficiency of native tRNAs for each codon assessed by withholding individual t7tRNA from the t7tRNA mixture, mediating RGS peptide translation in the depleted lysate. The codon/anticodon pairs corresponding to t7tRNA that were individualy excluded are located below the corresponding bars.
  • Elongator t7tRNAs were supplemented to a final concentration of 0.8 ⁇ , with the initiator t7tRNAiMet at 1.6 ⁇ and the native tRNA mixture at 1 ⁇ g/ ⁇ l final concentrations.
  • FIG. 4 The t7tRNA decoding table. Ser, Arg, and Leu, shaded in blue, are encoded by mixed codon family boxes from which two codons (N1N2N3) belong to a split and the other four to unsplit codon family boxes 19 . The 4- and 2-fold degenerate amino acids are shaded in green and gray, respectively.
  • Native tRNAs and t7tRNAs are denoted by their respective anticodons (N34N35N36). The letters other than A/U/G/C in the native tRNA anticodons denote modified nucleosides 55 .
  • the native and t7tRNA decoding patterns are indicated by arrow-lines from the left and right sides of the codon columns, respectively.
  • Anticodons of the tRNAs specific for Lys, Glu, and He where modification either in anticodon or another part was essential for aminoacylation are highlighted in pink.
  • Lys t7tRNA with U34 to C34 anticodon replacement based on tRNALys(UUU) is highlighted in red.
  • the arrow- lines connecting t7tRNAs and the respective codons indicate the tRNA/codon combinations tested in the peptide biosensor assay.
  • the dashed gray and black continuous arrow-lines correspond to ⁇ 10% or ⁇ 10% codon decoding efficiency, respectively.
  • the associated number beside the black arrow-line indicates the calculated decoding efficiency of the t7tRNAs towards the analyzed codon as described in Fig. 11.
  • the N34 modifications include "V"- uridine 5-oxyacetic acid, "["- 5-methyl-aminomethyluridine(mnm 5 U), “$"- 5-carboxymethylaminomethyl-2- thiouridine(cmnm 5 s 2 U), “S"- 5-methylaminomethyl-2-thiouridine (mnm 5 s 2 U), ")"-5- carboxymethylaminomethyl-2'-0-methyluridine (cmnm 5 Um), "B”- 2'-0- methylcytidine (Cm), “M”- N4-acetylcytidine (ac4C), "]”- 2-lysidine (k2C), ' ⁇ '- Inosine, "Q"- queuosine, and "Q*"- glutamyl-queuosine 55 .
  • FIG. 5 Analysis of the purified native tRNAs for He, Glu and Asn.
  • A Analysis of purified tRNAs on the denaturing PAGE stained with SYBR green.
  • B- D The activities of purified native tRNAGlu (B), tRNAAsn (C) and tRNAIle(GAU) (D) analyzed by the peptide expression assay. The final concentration of native tRNAs in the assay was 1.6 ⁇ .
  • FIG. 6 sGFP expression in semi-synthetic in vitro translation system.
  • A DNA templates for three sGFP ORFs of various codon compositions were expressed in tRNA-depleted lysate programmed with semi -synthetic tRNA complements or native tRNA mixture at different concentrations.
  • B Expression of sGFP_T2 template in tRNA-depleted lysate supplemented with semi -synthetic tRNA mixtures lacking the indicated t7tRNAs. Corresponding codons are shown below the tRNAs where y stands for U or C and r for A or G.
  • FIG. 7 Expression of sGFP Tl in the PURE in vitro translation system and in the tRNA-depleted S30 lysate. In vitro translation experiments were performed without tRNA(circles), with native tRNA (squares) or with semi-synthetic tRNAs (triangles).
  • Figure 8 Construction of DNA templates for in vitro synthesis of 48 E.coli tRNA species.
  • A DNA templates for tRNAs starting with G, U or C;
  • B DNA templates for tRNAs starting with A or U. These DNA templates contain a HHRz- coding sequence which auto-cleaves from the precursor after transcription releasing the tRNA. The box indicates the FIHRz-coding sequence and the arrow in the box indicates the ribozyme cleavage site;
  • C A summary of 48 E.coli tRNA species defined on the table from al to dl2. The tRNA designations as per Figl and their respective gene copy number, the first base and size are shown.
  • Figure 9 Calibration curves for RGS-peptide derivatives GGRGS and DDRGS in the affinity clamp assay. Here the initial rates of TVMV substrate de-quenching are plotted against the concentration of the peptide and fitted to a linear equation.
  • Figure 10. The peptide expression levels from RGS templates prefaced by various codons. Codons were placed (A) immediately downstream the AUG initiator codon or (B) downstream the two consecutive GAU codons following AUG. The prefacing codons are shown below the respective bars.
  • Figure 11 Calculation of native tRNA depletion efficiency and t7tRNA decoding activity. Two coding frames harbouring one or two test-codons were used.
  • the difference between the reactions primed with complete ( ⁇ t7tRNA mix) and incomplete t7tRNA mixtures was used to assess the relative activity of test-codon specific t7tRNA as well as to reveal all possible cognate or non-cognate cross- recognition events within the unsplit or split codon family boxes.
  • the concentration of the test-codon specifict7tRNAs in the cell-free translation reaction was either 1.6 for both or 6.4 ⁇ respectively.
  • the full spectrum of codon/tRNAcombinations for all 20 canonical amino acids was assayed and the peptide yield was determined by the affinity clamp assay. Unless indicated, each reaction was performed in duplicates.
  • FIG. 12 Evaluation of t7tRNA activities for Ser, Arg and Leu.
  • A Decoding efficiencies for the four t7tRNASer isoacceptors towards six Ser-codons were tested using one-codon template at 1.6 ⁇ tRNA concentration (upper) or two-codon template at 1.6 ⁇ (middle) and 6.4 ⁇ (bottom) tRNA concentrations.
  • B The average t7tRNA decoding efficiencies towards the most of Ser, Arg and Leu codons were calculated as the mean value of relative activities provided by one- and two- codon templates at 1.6 ⁇ or 6.4 ⁇ of t7tRNA.
  • FIG. 14 Analysis of t7tRNA decoding efficiencies for codons of 1-, 2- and 3- fold degenerate amino acids.
  • the t7tRNA relative activities were calculated as in Fig. 13.
  • Figure 16 Depletion of specific tRNAs from the total tRNA mixture using RNA aptamer (kissing loop) chromatography.
  • A schematic representation of the base- pairing mechanism of kissing loop:tRNA complex formation
  • B Flow chart for preparation of in vitro translation system depleted for a specific tRNA..
  • C Measurement of GFP-synthesis following tRNA reconstitution.
  • FIG. 19 A: Cysteinylated or selemocysteinylated tRNACys(Secys) harbouring grafted GCU- or CCU-anticodons (Cys-tRNA(Cys)gcu/ccu).
  • D Effective suppression of amber-codon in the eGFP- coding ORF (position 153) by pre-translationaly selenocysteinylated tRNACys harbouring grafted CUA anticodon (reaction conditions as in B).
  • E Purification of Secys-tRNACys (CCU-anticodon) conjugation product with BodipyFL iodoacetamide.
  • Figure 20 Macrocyclic peptide design by incorporation of non-natural amino acids.
  • A Reassignment of AGG codon at the position 108 of EGFP using BODIPY- tRNA-Cys in reconstituted cell-free system lacking tRNA Arg (CCU).
  • B Reassignment of AGC codon at position 4 of EGFP.
  • Left panel is a scan of SDS-PAGE loaded with EGFP purified from E.coli in vitro translation reactions. Lane 1 represents the unmodified cell-free system while lanes 2 and 3 represent the reaction in which ocutR A was replaced with Pyr ocutRNA charged with cyclooctene Lysine (COC).
  • COC cyclooctene Lysine
  • the COC was labelled with Atto488-tetrazine prior to purification.
  • C Expression yields of EGFP with one or two reassigned Ser(AGC) or amber (TAG) codons.
  • D Tetrazine ligation reaction
  • E Structures of bifunctional tetrazine derivative capable of ligating two cyclooctene containing amino acids.
  • F Trifunctional tetrazine derivative
  • G SDS- PAGE analysis of in vitro translation mixture expressing COC-containing EGFP protein
  • B cross-linked with di-tetrazine (DT). The gel was loaded with unboiled samples and scanned for EGFP fluorescence
  • H Example of macrocyclic polypeptides formation using codon reassignment and copper catalysed click reaction.
  • Figure 21 Translation efficiency of two GFP-coding templates with either all six (6) or just one arginine codon/s changed to AGG (6 AGG or 1 AGG on the figure, respectively) in the translation reactions programmed with 3 tRNA mixtures as indicated.
  • Total tRNA and Depl tRNA indicate the total home-isolated tRNA mixture before and after tRNAccu/ucu depletion, respectively.
  • a third mixture contains synthetic t7tRNAccu to added a final concentration at of 5 ⁇ .
  • FIG. 22 Comparative analysis of amber codon suppression efficiencies in E.coli cell-free translation system with different nnAA/o-tRNA/aaRS combinations.
  • A The structure of nnAAs used here.
  • B-D Suppression Amber suppression of A 151X template. The suppression efficiency is defined as a ratio compared to the fluorescence ofpercentage of wild type eGFP fluorescence wild type eGFP without stop codon inside its ORF.
  • B Incorporation of four nnAAs by three PylRS variants. The final concentrations of PylTcua, PylRS variants and nnAAs were 20 ⁇ , 20 ⁇ and ImM, respectively.
  • C AzF incorporation by four MjY tRNA variants.
  • MjYl, MjY2, MjY3 and MjY4 are corresponding to the tRNAs pAzPhel, pAzPhe2, pAzPhe3 and tRNAopt CUA in original publication 5 ' 37 .
  • the final concentrations of MjYtRNA variants, AzFRS and AzF are 10 ⁇ ,10 ⁇ and ImM, respectively.
  • D Effect of o-tRNA and o-aaRS concentrations on amber codon suppression efficiency of MjY2/ AzFRS/ AzF and PylT/PylRSAF/PrK.
  • E The effect of codon contexts on nnAA incorporation efficiency in two orthogonal systems.
  • A_1X, A_151X, B_1X and B_151X were used in the analysis (sequences are shown in SI).
  • a and B denote the template backbones with different codon biases where codon vocabulary in A is optimized for eGFP while in B it is simplified mostly utilizing the unique codon to decode each amino acid type.
  • the numeric indicates the position of amber codon in ORF sequence. The relative activity in individual reactions is given as a percent of fluorescent intensity provided whileobtained when using EctRNATyr(cua) as a suppressor.
  • FIG. 23 AGG reassignment to AzF in the context of four GFP ORFs.
  • the GFP protein was expressed in cell-free system depleted of tRNA species decoding AGG codon with and without addition of MjY suppression system (MjY2/ AzFRS).
  • MjY2/ AzFRS MjY suppression system
  • the final concentrations for MjY2, AzFRS, AzF are were 10 ⁇ , 10 ⁇ and ImM, respectively.
  • the anticodon in Mj Y2 was changed to CCU in order to reassign AGG codon to AzF.
  • FIG. 24 Synthesis of BPFL-tRNA for AGG and UAG-suppression.
  • A HPLC purification of BPFL-conjugated tRNAs. The tRNACys bearing CUA or CCU anticodons were charged with Cys by CysRS and reacted with the iodoacetamide group on the BP-FL. Absorbance measurement at 254nm detected the ribonucleic acid while 490nm channel was used for BP-FL detection.
  • B-C Analysis of labelled protein yields by fluorescence scanning and total protein yield by Western blotting of 12% PAGE gel. The BP-FL incorporation was detected on the gel after quenching eliminatingthe GFP fluorescence by boiling of the sample.
  • the total protein was detected by Western bolting using anti-GFP antibody. The intensity of each band was calculated by ImagJ scaled to by the intensity of the faintest band that was set to 1.
  • B The sGFP_T2 template harboring one AGG codon was expressed with or without addition of Biodipy-charged tRNAccu in the normal lysate or tRNA depleted lysate supplemented with indicated tRNA mixtures.
  • C Comparison of BP-FL incorporation mediated through amber or AGG codon suppression.
  • the translation reactions for AGG suppression are programmed by templates with single AGG at the 1st or 151 st GFP ORF respectively and reconstituted of tRNA-depleted lysate and total tRNA mixture lacking AGG suppressors with or without BPFL-tRNAccu suppressors.
  • the similar reactions are performed for amber suppression but with total tRNA mixture, template harbouringharboring single amber codon and BPFL-tRNAcua suppressor.
  • FIG. 25 Site-specific double labelled labelling of CaM for smFRET-based conformational change analysis.
  • A Fluorescence scanning scans of mono- and dual- labelled CaM. Dual labelled CaM protein was prepared in the cell-free translation system reconstituted of tRNA-depleted lysate and total tRNA mixture lacking AGG suppressors. Two suppression systems, MjY2(cua)/AzFRS/AzF and BPFL-cys-tRNAccu, were supplemented for recoding UAG and AGG codon at the 1st and 149th position, respectively. AzF incorporated in the protein was then reacted with DIBO-TAMRA through copper-free click chemistry.
  • the green and red dots indicate the BP-FL and TAMRA installed in the CaM ORF at the 1st and 149th position, respectively.
  • D-E smFRET histograms recorded of dual-labelled CaM under different conditions.
  • D in 50mM Tris-HCl, 150mM NaCl buffer without Ca2+
  • E 2mM Ca2+
  • F with lOmM EDTA .
  • the solid lines represent Gaussian fits to data using Origin software. Each peak indicates an individual conformation.
  • Figure 26 Vector map for pOPINE CaM template.
  • Figure 27 Translational performance of depleted commercial tRNA mixture with or without supplementation of t7tRNAccu. Two GFP-coding templates with either all or just one AGG codon, 6AGG or lAGG indicated in the figure, were tested in the translation reactions programmed with 3 tRNA mixtures. Total tRNA and Depl tRNA indicate the commercial tRNA mixture before and after tRNAccu/ucu depletion. A third mixture contains t7tRNAccu to make a final concentration at 5 ⁇ .
  • FIG. 28 Alignment of four previously reported MjYtRNA species. MjYl, MjY2, MjY3 and MjY4 are corresponding to the tRNAs named pAzPhel, pAzPhe2, pAzPhe3 and tRNAopt CUA in original publications 4 . Unlike the sequence reported in the original paper, the N63 to N67 in the MjY2_tRNA here is "CATCG” instead of "CATCGT” (the "T” in the end appears to be erroneous in the original paper).
  • Figure 29 The incorporation efficiency of 5 nnAAs precharged by flexizyme with their respective active group.
  • A The structure of five activated acid substrates for tRNA acylation by Flexizyme, including L-Propargylglycine 4-chlorobenzyl thioester (Pra-CBT), L-Azidolysine 4-chlorobenzyl thioester (Lys(N3)-CBT), L- Azidohomoalanine 4-chlorobenzyl thioester (Aha-CBT), N ⁇ -biotinyl-L-lysine 3,5- dinitrobenzyl ester (Lys(biotin)-DBN) and L-Azidophenylalanine-cyanomethyl ester (AzF-CME).
  • nnAAs are shown in black while their respective active groups in red.
  • B The amber suppression efficiency of 5 nnAAs precharged tRNA tested by using A 151X template in the cell free translation system. The precharged tRNA was used to prime the translational reactions at 10, 20 or 30uM of final tRNA concentration. The flexizyme reaction time and the final concentration of precharged nnAA-tRNAs were indicated. Among the five nnAAs tested here, AzF demonstrated the highest translational activity. This suggested that compared to other nnAAs, the flexizyme could charge AzF very well on the o-tRNAs and this precharged AzF- tRNA was well accepted by EF-Tu and Ribosome.
  • FIG 30 Orthogonality of the two suppression systems, Mj Y2/AzFRS/AzF and PylT/PylRSAF/PrK, in E.coli in vitro translation systems.
  • the reactions lacking either nn A A- substrate, o-tRNAs or enzyme were used to assess the level of nonspecific suppression on amber codon in template A 151X.
  • the concentration of MjY2 and AzFRS were 10 ⁇ for both while PylT and PylRS were used at 20 and 40 ⁇ , respectively.
  • Figure 31 (A) The TAG codon in Template A 151X was reassigned to AzF. The MS/MS analysis of the identified peptides containing the nnAA incorporation site are shown. (B).
  • Figure 33 The tertiary complex of tRNA, amino acid and elongation factor.
  • the structure of tRNATrp charged with different amino acids formed tertiary complex with elongation factor EF-Tu.
  • Figure 34 The ability of tRNACysccu in supporting AGG translation.
  • Cell free translation reactions were performed in the context of tRNA-depleted lysate supplemented with semisynthetic tRNA mixtures lacking AGG-isoacceptors.
  • the sGFP_T2 template harboring one AGG codon was expressed with or without addition of tRNA species with CCU anticodon as indicated.
  • tRNAArgccu is the synthetic wt AGG tRNA isoacceptor and severs as a positive control.
  • Figure 35 Translational performance of commercial tRNA mixture used at 0.25 and 0.5 ⁇ g/ ⁇ l depleted for native AGC- and AGG-codon tRNA supressors ( ⁇ -a5/6,- el l) with or without supplementation of their t7tRNA counterparts: t7tRNAccu (a05) and t7tRNAgcu (c11).
  • Two GFP-coding templates with either just one unique (eGFP xl AGC) or two consequtive (x2AGC) AGC codons at positions 4 or 4,5 both devoid of any of AGG and one template with both unique AGC (position 4) and AGG (position 151) codons (eGFP xlAGC/xlAGG) were used in the suppression experiments.
  • the translation reactions was programmed with either total tRNA mixtures lacking native isoacceptors for the desired AGC- and AGG- codons or the same mixture containing the supplemented t7tRNA analogs for both. Schematic representation of the used ORF is shown below each graph.
  • FIG. 37 Site-specific double labelling of CaM. Fluorescence scanning of mono- and dual- labelled CaM. Dual labelled CaM protein was prepared in the cell- free translation system reconstituted of tRNA-depleted lysate and total tRNA mixture lacking suppressors for both AGG/AGA and AGC-codons. Two suppression systems, MjY2(gcu)/AzFRS/AzF and BPFL-cys-tRNAccu, were supplemented for decoding AGC and AGG codon at the 1 st and 151 st position, respectively.
  • Protein harbouring AzF was either loaded on SDS-PAGE directly or subjected to the subseqent conjugation with DIBO-TAMRA through the copper-free strain-promoted cycloaddition.
  • the two CaM-coding ORFs harbouring 1 (xlAGC) or two (x2) consequitive AGC-codons at position 1 or 1,2- in addition to a unique AGG at the 151 position were used.
  • SDS-PAGE gel was scanned in two indicated wavelengths using two channels.
  • the present invention provides a protein translation system that allows the incorporation of non- natural moieties (e.g non- natural amino acids) into the translated protein without compromising the ability to incorporate all of the twenty (20) natural amino acids into the protein.
  • This is achieved by reassigning one of the tRNA anticodons for amino acids that are normally decoded by at least two (2) different tRNA anticodons to a non-natural moiety, wherein at least one codon can be uniquely recognized by the reassigned anticodon and at least one another codon (i.e. from the same codon box) cannot be recognized by the reassigned anticodon.
  • an mRNA for translation is engineered to comprise one or more specific codons corresponding to the reassigned tRNA anticodon(s) so that the non- natural moiety is incorporated into the translated protein at an appropriate or desired position.
  • the invention provides a method of producing a complement of tRNAs suitable for translation of a protein comprising at least one non-natural moiety, said method including the step of substituting at least one tRNA that comprises an anticodon for a natural amino acid with at least one tRNA comprising the same anticodon reassigned to a non-natural moiety, wherein the complement of tRNAs is operable to facilitate translation of an RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety whereby the translated protein may comprise any or all of the twenty (20) natural amino acids.
  • the invention provides a composition comprising a complement of tRNAs suitable for translation of a protein comprising at least one non-natural moiety, said complement comprising at least one tRNA that comprises an anticodon for a non-natural moiety reassigned from an anticodon for a natural amino acid , wherein the complement of tRNAs is operable to facilitate translation of an RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety whereby the translated protein may comprise any or all of the twenty (20) natural amino acids.
  • a protein is a polymer comprising two (2) or more covalently linked moieties which may be natural L-amino acids and/or non-natural moieties such as non-natural amino acids.
  • a peptide is a protein comprising no more than fifty (50) contiguous moieties.
  • a polypeptide is a protein comprising more than fifty (50) contiguous moieties.
  • a "natural amino acid” is an L-amino acid that can be genetically encoded by a genome of an organism. Typically, a natural amino acid reacts at a peptidyl transferase center at a physiological range of kinetic constants.
  • the natural amino acid is selected from the group consisting of: alanine, asparagine, aspartate, cysteine, glycine, lysine, glutamate, glutamine, arginine, histidine, methionine, serine, threonine, valine, leucine, isoleucine, proline, tyrosine, tryptophan, phenylalanine, or a derivative of these which would normally be incorporable into a translated protein via a tRNA having an anticodon for any of these natural amino acids.
  • Derivatives may be naturally-occurring derivatives such as post-translationally modified amino acids ⁇ e.g. selenocysteine).
  • non-natural moiety may be any molecule capable of incorporation into a protein translatable from an RNA template via ribosome- mediated chain elongation, with the proviso that it is not a natural amino acid as hereinbefore defined.
  • non-natural moieties may include non-natural amino acids, natural or synthetic chemical derivatives of natural amino acids and/or chemically-reactive moieties such as moieties capable of forming intramolecular covalent bonds.
  • the non- natural amino acid may be any organic compound with an amine (-NH 2 ) and a carboxylic acid (-COOH) that is capable of peptide bond formation.
  • Non-limiting examples of non-natural moieties include D-amino acids, selenocysteine, pyrrolysine, N- formylmethionine, a-Amino-n-butyric acid, norvaline, norleucine, alloisoleucine, t- leucine, a-Amino-n-heptanoic acid, pipecolic acid, ⁇ , ⁇ -diaminopropionic acid, ⁇ , ⁇ - diaminobutyric acid, ornithine, allothreonine, homocysteine, homoserine, ⁇ -alanine, ⁇ -amino-n-butyric acid, ⁇ -aminoisobutyric acid, ⁇ -aminobutyric acid, a- aminoisobutyric acid, isovaline, sarcosine, N-ethyl glycine, N-propyl glycine, N- isopropyl glycine,
  • Chemical moieties that may be suitable for the formation of intramolecular covalent bonds may be any which facilitate: incorporation of two identical reactive groups that undergo homo-condensation; incorporation of two identical reactive groups that undergo condensation via bifunctional reactive groups; or incorporation of two different reactive groups that undergo hetero-condensation.
  • Non-limiting examples include amino acid side chains or terminal amines or carboxylic acids modified by moieties such as NHS-esters, maleimidies, haloacetyls, although without limitation thereto.
  • a "tRNA” is a transfer RNA or isoacceptor RNA molecule inclusive of native and synthetic tRNA molecules.
  • a tRNA molecule comprises a nucleotide sequence of about 60-93 nucleotides with regions of internal base pairing that results in four or five double-stranded stems and three or four single-stranded loops formed from the primary structure.
  • the 5' and 3' termini are located at the termini of an internally base paired "acceptor stem".
  • the 3 ' terminus comprises the nucleotide sequence CCA, the terminal "A" nucleotide being the site of aminoacylation by amino acid-specific aminoacyl tRNA synthases.
  • the amino acid-specific anticodon is located in Loop II.
  • an "anticodon” is a nucleotide sequence of a tRNA molecule which corresponds to a codon in an mRNA, or its DNA precursor, that encodes a natural amino acid or serves as a translation terminator (UAA, UGA, UAG).
  • the anticodon facilitates aminoacylation of the tRNA by the appropriate aminoacyl tRNA synthase with the correct amino acid encoded by the translatable mRNA codon to which the anticodon corresponds (exept for Ser, Ala and in some cases, Leu).
  • the anticodon may be a 3 '-5 ' tri-nucleotide sequence that forms Watson-Crick base pairs at least at the first and second positions with the corresponding 5 '-3 ' mRNA codon sequence. Since the genetic code is degenerate there may be more than one tRNA decoding a codon box for a given amino acid. Such tRNAs decoding the same amino acid and comprising different anticodons are defined as "isoacceptors".
  • the specificity of base-pairing between the anticodon and the mRNA codon is defined by the first two nucleotides (i.e read 3 '-5' in the anticodon and 5 '-3 ' in the mRNA codon), such that the same anticodon may correspond to two or more degenerate mRNA codons.
  • Each of the single tRNA-isoacceptors for Asp, Asn, Cys, Glu, Gin, His, Lys, Phe and Tyr correspond to two different mRNA codons (i.e "two-fold degenerate").
  • I1e has two isoacceptors, one of which corresponds to a single mRNA codon (i.e "three-fold degenerate”). There are two isoacceptors for Ala, Gly, Pro, Thr and Val that correspond to respective codons in an RNA template (i.e “four-fold degenerate”). For Arg, Leu and Ser there are four or five isoacceptors that correspond to respective codons (i.e "six- fold degenerate”).
  • the composition disclosed herein includes at least one tRNA that comprises an anticodon reassigned from a natural amino acid to a non-natural moiety.
  • “reassigned” means that the anticodon no longer corresponds to an RNA or DNA codon that encodes its orthogonal, natural amino acid.
  • any RNA translatable using the composition also comprises a corresponding codon at a position where it is intended to incorporate the non-natural moiety into the synthetised protein.
  • anticodons that correspond to redundant codons the composition enables incorporation of non-natural moieties without compromising the ability to include all twenty (20) natural amino acids in a translated protein.
  • a reassigned anticodon according to the invention may be any that corresponds to a redundant RNA codon encoding a natural amino acid, wherein the reassigned codon is one of a plurality of different codons for the same amino acid.
  • the redundant codons for a given amino acid there is at least one RNA codon which uniquely corresponds to the reassigned anticodon and at least one RNA codon which does not correspond to the reassigned anticodon.
  • the genetic code provides degeneracy whereby all natural amino acids other than tryptophan and methionine are encoded by more than one codon.
  • a preferred object of the invention is to provide a protein translation system where, notwithstanding the incorporation of non- natural moieties into the protein, the ability to incorporate all of the twenty (20) non-natutal amino acids is retained. Accordingly, it is preferred that the reassigned anticodons are fourfold degenerate or six-fold degenerate, as hereinbefore described. This allows a "non-reassigned" anticodon to perform its normal role in incorporating a natural amino acid during protein translation. In a particularly preferred form, the anticodons are for Leu, Arg or Ser.
  • the method of producing the composition includes the steps of: (i) depleting one or more tRNAs from a complement of tRNAs suitable for translation of a protein comprising natural amino acids; and (ii) reconstituting the depleted complement of tRNAs with one or more tRNAs respectively reassigned to non-natural moieties and respectively coupled to the non-natural moieties.
  • the complement of tRNAs in (i) is present in a cell- free translation system.
  • step (i) substantially all tRNAs for natural amino acids are depleted from the complement of tRNAs.
  • depletion is by way of binding the tRNAs to ethanolamine sepharose.
  • one or more tRNAs for natural amino acids are selectively depleted from the complement of tRNAs.
  • selective depletion is by selectively binding the one or more tRNAs to respective, specific tRNA depleting agents.
  • agents may be a natural or synthetic protein, DNA, PNA etc.
  • the tRNA depleting agent is an RNA aptamer.
  • each RNA aptamer forms a specific, high affinity complex with a particular tRNA.
  • the RNA aptamer comprises a nucleotide sequence which forms a high affinity complex by binding to the anticodon-containing nucleotide sequence of the target tRNA.
  • the RNA aptamer may be referred to as a "kissing loop" RNA.
  • the tRNA depleting agent comprises one or plurality of single-stranded DNA oligonucleotides having nucleotide sequences specific for respective tRNAs. This embodiment is particularly useful for depletion of specific tRNAs.
  • the reconstituting tRNAs may comprise synthetic tRNAs, native tRNAs, or mixtures thereof (referred to herein as a "semi- synthetic tRNA complement").
  • Synthetic tRNAs may be made by any chemical or enzymatic method known in the art inclusive of RNA polymerase-mediated synthesis. Non-limiting examples include, SP6, SP3 and T7-mediated synthesis, although without limitation thereto.
  • synthetic tRNAs for asparagine, glutamate and isoleucine are substantially non- functional. Accordingly, for the purposes of reconstitution, tRNAs for Asn, Glu and He are suitably native tRNAs, although may be substituted by engineered tRNA mutants.
  • specific tRNAs may be obtained and used for reconstitution after selectively binding to an RNA aptamer such as a "kissing loop" RNA as hereinbefore described.
  • Non-natural moieties may be coupled, charged or loaded onto the reconstituting tRNA by any method known in the art. These may include use of chemical aminocylation or enzymatic aminoacylation.
  • Non-limiting examples of enzymatic aminoacylation include the use of natural, modified aminoacyl tRNA synthases such as PylRS or variants thereof used in pyrrolysine tRNA synthase- mediated aminoacylation, Methanococcus jannaschii tyrosyl-transfer RNA synthetase (Mj TyrRS) or variants thereof, Flexizyme-mediated aminoacylation and/or aminoacylation by a cysteinyl tRNA synthase.
  • a preferred embodiment provides in vitro charging of a synthetic tRNA having an anticodon reassigned to the non-natural moiety. Mutation of a wild-type cysteine tRNA anticodon reduces the affinity of the cysteinyl-tRNA synthetase for the cysteine tRNA but does not substantially reduce or inhibit the aminoacylation activity of cysteinyl tRNA synthetase in vitro where the high concentrations of reactants compensate for the reduction in affinity.
  • cysteine tRNA anticodon mutants are unable to be aminoacylated with cysteine in vivo (e.g in a cell-free translation system) due to the typically lower level of cysteinyl-tRNA synthetase and the presence of competing endogenous cysteine tRNAs.
  • a complement of tRNAs may be produced by charging the synthetic tRNA having an anticodon reassigned to the non-natural moiety in vitro and reconstituting the tRNA complement with this synthetic tRNA, or a plurality of different tRNAs each comprising a different non-natural moiety.
  • the composition disclosed herein may be suitable for use in a method or system for recombinant protein production.
  • an aspect of the invention provides a method of producing a translation system suitable for translation of a protein comprising at least one non- natural moiety, said method including producing a complement of tRNAs comprising at least one tRNA that comprises an anti-codon for a natural amino acid that has been reassigned to a non-natural moiety; and producing a transcribable RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety, wherein the mRNA may be transcribed to produce a translated protein that may comprise any or all of the twenty (20) natural amino acids.
  • a further aspect of the invention provides a method of producing a recombinant protein comprising at least one non-natural moiety, said method including the step of translating an mRNA which comprises a codon corresponding to an anticodon of a tRNA that has been reassigned to a non-natural moiety in a complement of tRNAs comprising at least one tRNA that comprises an anti-codon for a natural amino acid that has been reassigned to a non-natural moiety, wherein the translated protein that may comprise any or all of the twenty (20) natural amino acids.
  • the system and method of these aspects is for performing protein translation in vitro or an otherwise acellular or cell-free translation system.
  • Non- limiting examples include wheat germ, insect, HeLa lysate, rabbit reticulocyte lysate, E. coli and Leishmania-based systems.
  • translatable mRNA may comprise codons for any or all of the twenty (20) natural amino acids in addition to the one or more non-natural moieties, whereby a translated protein may comprise any or all of the twenty (20) natural amino acids in addition to the one or more non-natural moieties.
  • cyclic polypeptides may be useful in bioinformatics methods to design focused peptide libraries containing representatives from some or all of the structural fold classes found in nature.
  • the availability of multiple reassigned codons in the production of proteins comprising cyclizable amino acids may facilitate the construction of libraries of macrocyclic peptides.
  • the following approaches may be used: a) incorporation of two identical reactive groups that undergo homo- condensation; b) incorporation of two identical reactive groups and their condensation via bifunctional reactive groups; and c) incorporation of two different reactive groups that undergo hetero-condensation.
  • reassignment of tRNA anticodons provides a system for testing these approaches.
  • a non-limiting example of constructing a test mRNA coding for a synthetic 10-mer peptide carrying Ser and Arg codons and a C-terminal affinity clamp tag will be described in more detail in the Examples.
  • the invention disclosed herein may be applicable to the production of any protein or peptide, or library comprising a plurality of different proteins and peptides, that incorporate moieties other than natural amino acids in targeted or selected locations, while allowing for the incorporation of natural amino acids as desired.
  • the reporter peptides of different sequences RGSIDTWV, GGRGSIDTWV, DDRGSID TW V, and the fluorescently quenched TVMV substrate peptide (5- Amino-2-nitrobenzoic acid -ETVRFQSK-7-Methoxycoumarin-4-yl), were synthesized by Mimotopes.
  • a fusion of autoinhibited protease and the affinity clamp (peptide biosensor) was purified by ⁇ 2+- ⁇ affinity chromatography and stored in 50 mM Tris-HCl, 1 M NaCl, 5 mM EDTA, 2 mM TCEP, ans 10% glycerol buffer (pH 8.0).
  • the affinity clamp assay was carried out in buffer A of 50 mM Tris- HCl, 1 M NaCl, 1 mM DTT, and 0.5 mM EDTA (pH8.0), supplemented with 1.3 ⁇ of peptide biosensor and 300 ⁇ of TVMV substrate peptide.
  • RGS-peptides were used either as a solution in the buffer or in the context of in vitro translation, and the reaction pro-gress was monitored by exciting the sample at 330 nm and recording the fluorescence changes at 405 nm for 1 h using the Synergy plate reader.
  • a calibration plot was generated to establish the relationship between initial rates of substrate cleavage (Vmax) and known concentrations of the control peptide. Samples were assayed in triplicate.
  • the S30 E. coli cell extract formulated for coupled transcription-translation and supplemented with x2 protease inhibitor cocktail (Roche) was primed with the desired peptide-coding DNA template and incubated at 32°C for 1 h. After translation, NaCl was added to the reaction mixture to the final concentration of 1 M followed by incubation at 65°C for 10 min to inactivate the endogenous proteases otherwise competing with TVMV-protease for the substrate peptide. After centrifugation at 10000 rpm for 5 min, 10 ⁇ of supernatant was used for the affinity clamp assay as described above. In the context of in vitro translation reactions, the calibration plot was obtained by supplementing different amounts of synthetic peptides into the cell-free translation reaction lacking the DNA template. Preparation of tRNA-depleted lysate
  • the s30 E.coli extract was prepared from BL21(DE3)GOLD as described in27, and stored frozen in 10 mM Tris-Acetate(pH8.2), 14 mM Mg(OAc)2, 0.6 mM KOAc, and 0.5 mM DTT buffer at -800 before the tRNA-depletion procedure.
  • the pOPINE-eGFP plasmid vectors were digested by Ncol and NotI, combined with the annealed oligonucleotides, and ligated using T4 DNA ligase. The positive clones were verified by Sanger sequencing (AGRF Brisbane).
  • sGFP Tl The fragments coding for sGFP ORFs with various codon biases denoted as sGFP Tl, sGFP_T2, and sGFP_T3 were synthesized as G-blocks by IDT and cloned into the pOPINE-based plasmid following the standard Gibson cloning procedure.
  • the DNA template for tRNAHis contained an additional G corresponding to -1 position in tRNA.
  • the reactions were diluted 5-fold into buffer C (125 mM NaOAc pH 5.2, 0.25 mM EDTA).
  • the tRNA transcripts were purified by affinity chromatography using ethanolamine-Sepharose matrix. For 1 ml of transcription reaction, 0.2 ml of settled matrix was used. Following the 1-h incubation of the slurry at 40, the matrix with bound tRNAs was extensively washed with buffer C containing 200 mM NaOAc. t7tRNAs were eluted from the matrix into buffer C containing 2 M NaOAc. tRNA was ethanol precipitatated and the pellets were dissolved in tRNA buffer containing 1 mM MgC12 and 0.5 mM NaOAc (pH 5.0). sGFP expression by semi-synthetic tRNA mixture
  • Template 1 had the highest codon variation, including five different synonymous codons coding for Leu, four for Val, and 3 three for Pro, Arg, Ser, and Thr (Table 4).
  • Template 2 was designed to deliver the highest codon biases with only two synonymous codons used to encode Ser, Arg, and Leu, and one codon used to encode Val, Pro, Thr, Ala, and Gly (Table 5).
  • Template 3 featured a medium codon variety with two codons for Ser and Arg, and several codons for Leu, Val, Pro, Thr, Ala, and Gly, as in Tl (Table 6).
  • the proportions of individual tRNAs in the semi-synthetic tRNA mixtures were roughly proportional to their codon abundance in the sGFP ORF sequences, except for codons occurring more than 10 times and those corresponding to the least- depleted native tRNAs.
  • These t7tRNAs in the semi -synthetic mixtures were taken at reduced proportions relative to their codon usage shown in Table 4-6.
  • Production of sGFPs corresponding to Tl-3 in the translation reactions with semisynthetic tRNA complement was monitored on a fluorescence plate reader for 3 h at 485-nm excitation and 528-nm emission wavelengths.
  • T7tRNA transcripts were obtained in good amounts for all tRNAs except tRNAIle(GAU) and tRNATrp(CCA) (Fig. 1).
  • the sequences coding for these tRNAs start with adenosine, which is likely to cause high abortion rates in the early transcription phase.
  • a Hammerhead ribozyme (HHRz) coding sequence prefaced by a strong transcription start site was introduced upstream to the tRNA coding sequences to ensure efficient transcription followed by HHRz- mediated auto-excision (Fig. 8) 1 .
  • Denaturing PAGE analysis revealed that more than 90% of the RNA precursor was cleaved to yield the desired tRNAs (Fig. 1).
  • some tRNAs such as tRNALeu(CAA) and tRNATyr, contain additional minor bands, we obtained a major species of the expected size in all cases.
  • tRNA-depleted E.coli S30 cell extract we modified a previously published chromatographic tRNA depletion protocol 28 .
  • the endogenous tRNAs bind to ethanolamine-Sepharose matrix while other components required for protein synthesis remain in the flow-through.
  • the developed assay provided a platform to systematically test the entire ensemble of t7tRNAs (Fig. 2A). Yet, the initial experiments revealed residual amounts of some isoacceptors in the depleted lysate. These represented tRNAs that are abundant in E.coli, indicating a relationship between the depletion efficiency of individual tRNAs and their abundance (Table 2) 10 ' 36 . The incomplete depletion of endogenous tRNAs potentially complicates the functionality test by masking the signal from their t7tRNA counterparts. However, we observed that including two consecutive codons for a particular tRNA into the template significantly enhances the adverse effect of its depletion on the peptide translation efficiency.
  • His, Asn, Asp, and Cys is carried out by tRNAs with G or its modified form (Q) in the first anticodon position.
  • the A- and G-ending codons are decoded either using modified uri uridine (Lys and Glu) or by adding isoacceptors with C in the first anticodon position (Arg, Leu, and Gin) (Fig 4 blue and grey shaded amino acids).
  • Uridine in the former case is modified with various aminomethyl derivatives that restrict the recognition solely to A- and G-ending codons 40 , additionally supported by ribose 2'-0-methylation when U and C are in the first anticodon position of both Leu isoacceptors.
  • t7tRNAs for Phe, His, Asp, and Cys were efficient (50-70%) in decoding both their cognate (C-ending) codon with Watson-Crick geometry (further referred to as "cognate-WC") (C-ending) and wobble (U-ending) codons.
  • the t7tRNATyr(GUA) decoded UAC with -50% efficiency and UAU with less than 30%.
  • T7tRNAHis(GUG) featuring an additional G-1C73 base pair, demonstrated an effective decoding of its cognate-WC CAC and wobble CAU codons.
  • the t7tRNA lacking G-l was not functional in restoring peptide translation (data not shown), presumably due to failure of the aminoacylation
  • the t7tRNASer(GCU) recognized both AGC and AGU codons with 123 and 75%) efficiency, respectively.
  • Leu and Arg two tRNA isoacceptors are responsible for decoding each split codon box, and in our assay, both Leu t7tRNAs with UAA and CAA anticodons recognized only their cognate codons via exal WC-base pairing. This is in agreement with a previously reported restricted mode of recognition by unmodified uridine 42 , albeit with efficiencies of 36 and 88%>, respectively.
  • the t7tRNAs for Arg with UCU and CCU anticodons demonstrated similar behavior in strictly recognizing their cognate-WC codons at 340 and 202% efficiency, respectively.
  • t7tRNAGln(UUG) could not decode its cognate-WC CAA codons.
  • the t7tRNAGln(CUG) also could not decode CAA codons, although it could decode its cognate-WC CUG codon with 40% efficiency.
  • T7tRNAs for Glu(UUC), Ile(GAU), Asn(GUU), and Lys(UUU) failed to sustain peptide translation from the template comprising both their cognate-WC and wobble codons. Lack of modifications within the anticodon loops of Glu and He t7tRNAs was previously shown to prevent their aminoacylation, making them inactive in the peptide translation 44 ' 45 , and t7tRNAAsn(GUU) prepared with or without the help of Hrz performed poorly in the reporter peptide synthesis.
  • tRNALys Although chimeric t7tRNALys, with the grafted anticodon and the discriminator base both derived from tRNAAsn, could be aminoacylated by AsnRS with Asn 46 , it still failed to support peptide expression in our assay (data not shown). In this regard, it was previously reported that tRNALys, with unmodified U34, failed to decode either of its codons due to the potential loss of structural order in the anticodon loop as well as poor stacking within the codon-anticodon duplex formed by three consecutive, least- overlapping A-U base-planes 47 ' 48 .
  • T7tRNAs for Trp(CCA) and Met(CAU) decoded their cognate-WC codons with 46% and 61% efficiency, respectively.
  • U34 carries a 5'-oxyacetic acid modification which extends recognition beyond its cognate-WC A-ending 50 to G-, U-, and C-ending codons for Val, Pro, and Ala by partially altering the nucleoside sugar pucker geometry 51 ' 52 .
  • t7tRNALeu(UAG) and t7tRNASer(UGA) which are presumably devoid of modifications, show strong preferences for A- and to a lower degree U-, but fail to recognize G- and C-ending codons 24 .
  • t7tRNAs for Val, Pro, Thr, and Ala displayed a similar codon-reading pattern to their native counterparts - i.e., these t7tRNAs not only efficiently decoded their cognate-WC A-ending codons, but also to a lower degree the U- and C-ending ones 54 .
  • Decoding of G-ending codons features strong U34-G3 -mediated recognition for Val and Ala, which lack C34- bearing back-up isoacceptors. This contrasts the inefficient U34-G3 -mediated recognition for Pro and Thr (Fig.4) that is possibly mediated by the cognate-WC isoacceptors.
  • Native tRNAGly(UCC) differs from other tRNAs decoding unsplit boxes with U in the first anticodon position, in that it carries aminomethyl modifications at U34 (see above), which is characteristic of tRNAs decoding split codon boxes 50 .
  • T7tRNAGly(UCC) is an exception to the above-described correlation as it effectively decodes C- and G-ending codons despite the existence of C34 isoacceptor for the cognate-WC decoding of the latter.
  • decoding of four Arg codons from the unsplit family box in bacteria is unusual because it relies on two isoacceptors, one of which carries an inosine modification more common in eukaryotes.
  • This modification enables decoding of A-, U-, and C-ending codons via base pairing with wobble and WC- geometries, respectively.
  • the unmodified anticodon stem-loop of t7tRNA(ACG) showed almost the same affinity to its cognate-WC codon CGU, but was inefficient in binding to its wobble CGC and CGA codons 56 .
  • t7tRNAArg(ACG) could efficiently decode not only U-, but also C-, A-, and, to a lower extent, G- ending codons.
  • tRNAs for Glu, Asn and He were successfully obtained at good purity from the native tRNA mixture by selective hybridization with oligonucleotides complementary to the D- loop and the anticodon loop of the target tRNA (Table 3).
  • the tRNAs were eluted from the matrix by thermal denaturation and were shown to be of >90% purity by denaturing PAGE analysis (Fig. 5A).
  • purified native tRNAs for Glu(SUC), Asn(QUU), and Ile(GAU) was tested as described above using templates harboring their cognate- WC or wobble codons. Two templates with consecutive GAA or GAG codons were employed to test the functionality of purified tRNAGlu(SUC), which, as shown in Figure 5B, could efficiently decode both codons.
  • the purified native tRNAAsn(QUC) restored the translation of templates harboring either AAU or AAC codons.
  • the purified native tRNAIle(GAU) could only decode AUU codons with 40% efficiency, possibly due to inefficient refolding after denaturation or co- isolation of the under-modified isoacceptor variant.
  • the semi -synthetic tRNA mixtures restored sGFP expression, thus reconfirming the functionality of the corresponding t7tRNAs.
  • residual amounts of native tRNAs for CUA and AGC codons proved to be sufficient for sGFP expression.
  • the observed reduction in efficiency may reflect additional post-transcriptional processing of at least some t7tRNAs in the S30 extract, but not in the PURE system. Addressing this issue conclusively would require testing the functionality of individual t7tRNAs in the PURE system. This is not straightforward due to the surprisingly high levels of contaminating native tRNAs (Fig. 7).
  • the developed peptide biosensor assay allowed us to estimate the depletion level of tRNA isoacceptors relative to their codons and revealed a correlation between the depletion efficiency of individual tRNAs and their abundance.
  • RGS1 -peptide expression was also observed in a fully recombinant E.coli PURE system primed with t7tRNA mixtures lacking individual tRNAs (data not shown).
  • the PURE system assembled without exogeneous tRNAs could support the expression of full- length GFP (Fig. 7), indicating presence of the entire spectrum of contaminating tRNAs. This suggests that residual tRNAs most likely copurify with aaRSs or other components of the translational machinery 16. Therefore, efficient tRNA depletion from in vitro translation systems remains a challange.
  • t7tRNA transcripts or their corresponding anticodon stem-loops such as Arg(UCU), Ala(UGC), Cys(GCA), Glu(UUC), and Gln(UUG) have also failed in the ribosome- mediated codon binding assay 50 .
  • Arg(UCU) Ala(UGC)
  • Cys(GCA) Cys(GCA)
  • Glu(UUC) Glu(UUC)
  • Gln(UUG) three remaining t7tRNAs were translationally active in the affinity clamp assay.
  • t7tRNAArg(UCU) demonstrated a 3 -fold higher activity compared to its homolog, which is presumably underrepresented in total native tRNA mix-tures (Fig. 4).
  • the codon-anticodon interaction matrix depicted in Figure 4 shows highly similar codon recognition patterns between native and t7tRNAs, which are most likely devoid of modifications within anticodon loops.
  • U34 in the first anticodon position of t7tRNAs decodes not only its cognate A and G, but also U and C in the third codon position with similar reading patterns to that of cmo5U in the native tRNAs for Ser, Leu, and Gly, and with an identical pattern in tRNAs for Val, Pro, Thr, and Ala.
  • the decoding preferences shown here provide a valuable guide for identifying "orthogonal" vs. "native" codon pairs from the synonymous codons for a particular amino acid. Such pairs can either be created from the codons of different families of 6-fold-degenerate amino acids or from those derived from the unsplit codon family boxes with high wobble restrictions such as Arg, Ser, and Leu and Pro, Thr, and Gly (Table 7). This work suggests that the AGG-codon, for which native tRNA was depleted almost completely, is potentially easier to reassign than all the other codons.
  • F2 contains FIHRz-coding sequence followed by a segment complementary to 5 '-part of tRNA. Following a 3-step PCR, the products were purified by ethanol precipitation and employed as templates for T7- transcription as described in Materials and Methods in order to obtain the desired tRNAs. Identity of 3' and 5' of t7tRNA transcripts
  • the generated synthetic tRNAs are expected to contain physiological 3'- hydroxyl group.
  • the 5'- can bear 5'- monophosphate, 5 '-triphosphate, or 5'-hydroxyl groups.
  • the non-physiological 5'- triphosphate may be accepted by aaRS and other translational machinery 67 68 or can be processed to monophosphate in the crude lysate by the endogenous phosphatase activities, such as for instance of RNA pyrophosphohydrolase 69 .
  • the cleaved products contain 5'-hydroxyl which has been reported not to affect the aminoacylation efficiency for tRNA transcripts of Ser, Met, Phe, Tyr, Asp 66 .
  • 5 of the 48 tRNA genes harbouring "CAT" anticodon are assigned to Met in Genomic tRNA database 6 , only 3 of them actually code for Met (2 for initiator and one for elongator Met codons) while the remaining 2 code for He according to the sequences from Modomics database 71 .
  • the test-codons were initially inserted between the RGS- peptide sequence and the initiation codon.
  • the inserted codons in the vicinity of initiator AUG could influence the translation initiation 72 thereby complicating the interpretation of the results.
  • we tested four different codons of varying G/C content such as ACC for Thr, AUC for He, GGC for Gly, GAU for Asp and placed one or two of these codons between the AUG start codon and the peptide- coding frame.
  • OligoDNAs with 3 '-amine, 3 '-biotin or 3 '-thiol groups were synthesized by IDT. OligoDNAs with 3 '-thiol required reduction before immobilization, which added the complexity to the immobilisation protocol. OligoDNAs functionalized with amine, biotin and thiol at 112, 150 and 55 nmole respectively were immobilized to yield 1ml of the respective settled resins. Due to high cost, complicated protocol and low conjugation efficiency the immobilization via thiol-reaction with iodoacetyl- resin was abandoned.
  • TMA-C1 tetramethylammonium chloride
  • E. coli S30 lysate can be to a large extent depleted of total tRNA by the chromatography on ethanolamine sepharose. After the depletion lysate retains -60% of translational efficiency of its parental one if supplemented by commercially available total tRNA fraction (Fig 16 B).
  • KL-immobilized matrix can be used either for specific tRNA-isoacceptor depletion directly from the crude lysate or indirectly by pulling the isoacceptor out of the total tRNA mixture followed by its reconstitution with all-tRNA depleted lysate (Fig (B)).
  • GFP-synthesis in the reaction prepared using either method demonstrates -100% pausing on the codon-biased template with two-consecutive AGC-codons (Fig 16 C).
  • the "kissing loop" coding sequence (upper case) GGTAGTGAGGTAGTTAGCAGATACCTCACTACCaacacacacacacaacacacacacacaca cacaagct with the linker (lower case) was cloned downstream the T7 promoter 3'- flanked by the Hindlll site, followed by runoff T7-transcription from the Hindlll digested plasmid.
  • the KL-RNA was oxidized by sodium periodide and conjugated with the adipic acid dihydrazide- agarose beads (Sigma: A0802-50ML) accordingly to the PMID: 14652075.
  • tRNA(Ser)GCU isoacceptor depletion is high, although incomplete - some small tRNA fraction seems to be a part of complexes with either aminoacyl-tRNA synthetases (ARSases) or EF-Tu thus escaping the KL-trap.
  • ARSases aminoacyl-tRNA synthetases
  • EF-Tu EF-Tu
  • translation lysate is incubated with the KL-immobilized resin in the reaction mixture described above but in addition containing 23mM of Mg(0 Ac) 2 , 5mM of each KOAc and KC1 in the presence of a) excess of counter-isoacceptor (tRNA(Ser)gga) (15 ⁇ ) which is responsible for the decoding of all Ser-codons in codon-biased template except target- AGC (decoded by the isoacceptor being depleted) b) excess of other two substrates of the seryl- aminoacyl-tRNA synthetise (SerRS) such as ATP (20mM) and serine (5mM) as well as c) lmM GDP in order to dissociate the complexes of Aa-tRNA with EF-Tu.
  • tRNA(Ser)gga 15 ⁇
  • Ser-codons in codon-biased template except target- AGC (decoded by the isoacceptor being depleted)
  • SBRS se
  • Cysteinyl tRNA synthase-mediated aminoacylation Cysteinyl-tRNA synthetase (CysRS) has a contact area with the anticodon triplet of tRNA(Cys). Although the affinity of the enzyme towards the mutated tRNA is reduced it still can support high aminoacylation rates at high substrate concentrations in vitro however, we found that such mutant tRNAs were unable to undergo efficient re- acylation in the course of translation reaction due to an insufficient concentration of endogenous CysRS as well as high competing activity of wild type tRNA(Cys). This ensures that only a uAA is incorporated into the growing polypeptide chain.
  • the anticodon of wt t7tRNACys GCA was changed to either CCU or GCU to match the corresponding Arg - AGG or Ser - AGC codons (see FIG. 19 A).
  • Amber- codon suppressor t7tRNACys with CUA anticodon was used to optimize the aminoacylation conditions by monitoring the fluorescence yield in the translation reaction primed with eGFP-ORF where aspartate codon at position 153 was converted to amber-stop codon.
  • Both t7tRNAs were charged with cysteine by recombinant CysRS in vitro in the reaction containing 50mM HepesKOH (pH 8.0), ImM cysteine or 2mM selenocysteine (Secys), lOmM MgCl 2 , 5mM of each KOAc and KCl, 4mM ATP, 22.5 ⁇ tRNA, 10 ⁇ CysRS, 20% DMSO, 25mM DTT, 5 ⁇ ZnCl 2 , O.OOSu/ ⁇ of yeast inorganic pyrophosphatase and 50ug/ml BSA.
  • Cysteinylated or selenocysteinylated tRNA was purified by phenol extraction, precipitated by ethanol and either conjugated with iodoacetamide- (maleimide-) compounds of interest in the reaction containing 50mM TrisHCl (pH8.5 or 7.2 for Secys-tRNA), lOOmM NaCl, 75% DMSO, 80uM Cys(Secys)-tRNA and ImM of iodoacetamide or maleimide derivatives or used directly for the recoding of AGG (Arg) and AGC (Ser) codons for cysteine in control reactions (see FIG. 19A).
  • Cysteinylated or selenocysteinylated t7tRNAs bearing CCU-anticodon were shown to maintain eGFP biosynthesis in concentration dependent manner in a context of translation reaction reconstituted of both all-tRNA depleted lysate and semi- synthetic tRNA complement lacking t7tRNA(Arg)ccu and primed with eGFP-coding template harbouring single AGG- or TAG-codon (see FIG.19B,D). Addition of non-aminoacylated tRNACysccu (FIG.
  • Cysteinylated tRNACys harbouring grafted GCU-anticodon (Cys- tRNA(Cys)gcu - see FIG. 19 A, C) was shown to effectively suppress two consecutive AGC-codons in a context of translation reaction with the lysate directly depleted from endogenous tRNA(Ser)GCU using KL(FIG. 19C).
  • test mRNA coding for a synthetic 10-mer peptide carrying Ser and Arg codons and a C-terminal affinity clamp tag. Initially, two AGC codons will be included in the mRNA sequence. The construct will be expressed in a cell-free system containing cuAtRNA charged with Se-Cys or amino acids carrying azide and alkyne or more reactive trans-cyclo-octene.
  • the Se-Cys-containing peptides are expected to cyclise spontaneously, and the extent of reaction will be determined by mass spectrometry.
  • catalytic Cu(I) will be added into the translation mixture to induce click reaction and formation of the internal bond.
  • functionalised amino acid cyclisation will be achieved by the addition of reagent featuring two coupled tetrazine groups (Fig. 20E).
  • Fig. 20E We synthesised di-tetrazine from commercially available reagents and demonstrated that it can crosslink cyclo-octene- Lys-containing EGFP molecules (Fig. 20G).
  • RNA or DNA display such as CIS display
  • CIS display harnesses the ability of a DNA-binding protein, Rep A, to exclusively bind back to its encoding DNA.
  • the system supports effective library sizes over 10 13 and utilises an E.coli cell-free system, which is ideally suitable for our purposes. Alternatively, this may be performed with in vitro assembled viruses or phage.
  • the libraries cyclised through different codon reassignments will be selected on a recombinant CNH domain, and the outcomes of the selection procedures will be compared using next-generation sequencing.
  • the peptides will then be synthesised in linear and cyclised and used in AlphaScreen and single-molecule coincidence interaction analyses.
  • the approach will be tested on the native Phylomer libraries of 10 8 variants, and the performance of the libraries will be compared by sequencing of the naive and selected libraries.
  • the proposed program will provide a novel approach for constructing and analysing highly diverse libraries of macrocyclic peptides. It allows large structural post- translational diversification of the resulting peptides without the need to generate a new library. This approach is likely to result in a novel platform for the generation of highly potent bioactive compounds. It will also provide scientists on the team with training in the use of bio-orthogonal chemistry and diversity-based active compound developments.
  • Table 1 The t7tRNA complement for RGS1 template.
  • the codons in RGS1 template and the respective t7tRNAs are shown.
  • the final concentrations of initiator(iMcau) 5 and elongator tRNAs in the cell-free translation reaction were 1.6 and 0.8 ⁇ , respectively.
  • the polymorphic isoacceptor versions were mixed in ratios corresponding to their genome copy number.
  • Table 2 The tRNA depletion efficiencies tested using one-codon RGS template.
  • the depletion efficiency (DE.) for specific tRNAs corresponding to their cognate codons (codon) was calculated based on the peptide expression levels in tRNA-depleted lysate programmed by one-codon template and various tRNA mixtures using the formula shown in Fig.1 1 .
  • oligoDNAs DNA oligonucleotides used for affinity purification of specific native tRNAs from the total native tRNA mixture.
  • OligoDNAI and oligoDNA2 are complementary to the target tRNA sequences either spanning the D-arm down to the anticodon loop or the acceptor stem down to variable loop, respectively.
  • the 3'-end of the oligonucleotides were modified with amine, biotin or thiol to facilitate their immobilization on the matrix.
  • TEG denotes triethylene glycol.
  • the best-performing t7tRNA (for designations see Figure 8) for each codon as well as its ratio (%) in the semi-synthetic tRNA complement are shown.
  • the synthetic tRNALys for AAG codon, Kcuu was constructed by U34 to C34 replacement in the anticodon of Kuuu.
  • the non-natural amino acids BCN (Bicyclo [6.1.0] nonyne - Lysine), TCO* (trans-Cyclooct-2-ene - L - Lysine), TCO (trans-Cyclooctene - Lysine), PrK (N- Propargyl-Lysine), were purchased from Sirius Fine Chemicals SiChem GmbH. AzF (p-azidophenylalanine) was purchased from SynChem. TAMRA DIBO Alkyne were purchased from Life Technologies Australia Pty Ltd. BODIPY® FL Iodoacetamide were from Molecular Probes®.
  • Ethanolamine-Sepharose was prepared by coupling ethanolamine on Epoxy-activated Sepharose 6B (GE Healthcare).
  • Epoxy- activated sepharose 6B was washed extensively by water ( ⁇ 200ml per gram matrix) to remove the additives and then incubated with 1M ethanolamine at room temperature with gentle agitation overnight. Another wash by water was performed till pH close to 7.
  • the resulted ethanolamine-sepharose matrix was stored as 20% slurry in buffer A (lOOmM KOAc, 25mM NaOAc(pH5.2), 0.25mM EDTA) with 2mM NaN 3 . 8 g matrix yields 100 ml 20% slurry.
  • the protein sequence for AzFRS is derived from mutation 7 as described earlier 39 .
  • the protein sequences for PylRS variants, MbBCNRS, MbTCORS 36 and MmPylRSAF 19 ' 29 were obtained from the respective papers.
  • the gBlocks encoding codon optimized ORFs for these proteins containing 6 His-tag at N-terminus was synthesized by IDT and subcloned into Ncol-Notl double digested pOPINE plasmid. Assembly of the digested plasmid and the desired protein gene was achieved by Gibson Assembly® Master Mix (NEB). The correct constructs were identified by sequencing.
  • Protein expression was induced with 0.5mM isfopropyl-P-D- thiogalactopyranoside (IPTG) in Rosetta cells at 20 °C for overnight.
  • AzFRS was purified by Ni2+ affinity chromatography using standard buffer followed by gel filtration on Superdex 200 (GE Healthcare) in PBS buffer.
  • the MbBCNRS and MbTCORS was purified by Ni 2+ affinity chromatography using modified binding buffer (50mM sodium phosphate, pH 7.4, 0.5 M NaCl, 5% Glycerol (vol/vol), lOmM MgC12, 0.1% Tween, lmM DTT, 20mM Imidazole) and elution buffer (binding buffer plus 0.5 M imidazole).
  • the protein was further purified by gel filtration and stored in 40 mM Hepes pH7.4, 150 mM NaCl, 10 Mm MgCl 2 , 10% (vol/vol) glycerol, 0.5 mM TCEP, at -80 °C.
  • the MjYl, MjY2 and MjY3 tRNA are the best three hits identified for AzF incorporation in the earlier publication 37 while Mj Y4 tRNA with six mutations was described in a later report 38 .
  • the sequence alignment of these four tRNAs are shown in SI (Fig 27).
  • the optimized PylT tRNA is a U25C mutant 38 .
  • the sequence of tRNATyr cua is similar as that of wild type tRNATyr except replacing the "GUC" to "CUA" anticodon.
  • the t7 transcripts for all the above tRNA species were prepared as described before 24 .
  • each DNA template including the normal or transzyme construct, was assembled from 5 or 6 oligos (Table 8) using 3 -step PCR.
  • the PCR products were then purified by ethanol precipitation and used for run-off transcription by T7 RNA polymerase.
  • the transcribed tRNA were purified by affinity chromatography using ethanolamine-sepharose matrix. Specifically, 2ml transcription reaction was adjusted into buffer A condition using 10 times stock. The same volume of 20% matrix as the transcription reaction volume was added and incubated at 4° for overnight.
  • Total tRNA mixture was isolated from E.coli (Gold) strain by modified Zubay's method 59 . In brief, the total tRNA was extracted from overnight culture. The cell pellet (20g) was re-suspended in 40ml lOmM Mg(OAc) 2 , ImM Tris pH7.4 buffer. The nucleoside acids were then extracted by 34.4ml of liquefied phenol with vigorously agitated in cold room for 2 hrs. The extraction was repeated again by adding 10ml liquefied phenol. The aqueous phase was then collected by centrifugation at 18,000g for 30 min. RNA was precipitated with 0.05 volume 4M potassium acetate and 2 volume of 100% ethanol for overnight at -20°C.
  • the precipitate was collected by a 10 min centrifugation at 5,000g and re-suspended in 20ml of 1 M cold NaCl. Stirred vigorously for lh in cold room to disperse the precipitate. The supernatant was collected, and extraction was repeated with 1 M NaCl. The supernatant from the two NaCl extractions was combined and precipitate by addition of 2 vol ethanol. After two repeats the crude tRNA fraction was dissolved in water.
  • the specific tRNA species were depleted by DNA-hybridization chromatography from the total mixture as described 24 .
  • the DNA oligo which is complementary to the anticodon loop to acceptor stem was designed and synthesized with a 3 '-amine group from IDT (Table 8). These DNA oligos were immobilized on NHS-Activated Sepharose (GE) according to the manufacturer's protocol with ⁇ 10 of 150 ⁇ oligo used per 1 ⁇ 0 ⁇ resin.
  • reaction mix was diluted 4-fold into l x buffer A for ethanolamine-sepharose purification followed by phenol extraction (residual phenol was removed by 2 subsequent extraction with IV of chlorophorm/isoamyl alchohol (24: 1)) and ethanol precipitation.
  • Conjugation reaction with BODIPY® FL Iodoacetamide (BPFL-IA) was performed in 50mM Tris-HCl (pH8.5 or 7.2 for Secys-tRNA), 80 ⁇ Cys-tRNA,75% DMSO, ImM BPFL-IA and lOOmM NaCl.
  • the obtained fragments were cloned into the pLTE or pOPINE-based plasmids following the standard Gibson assembly cloning procedure (NEB).
  • the correct plasmids with desired mutations were purified by Midiprep Kit (Qiagen) to ensure good quality for cell free protein translation.
  • the sequence information of all the open reading frames used here is provided in SI.
  • the cell-free translation reactions for GFP production were performed following the standard protocol 60 with the optimized Mg 2+ at lOmM concentration. 0.35 volume of depleted lysate, same as that for the standard S30 lysate, was used in the reaction. Supplementing with other compounds were noted for each experiment. GFP production was monitored on a fluorescence plate reader (Synergy) at 30°C for 3-5 h at 485 nm excitation and 528 nm emission wavelengths.
  • the 200 ⁇ cell-free reaction was dialyzed in 12- 14kDa cutoff dialysis tube against 600ml PBS buffer for 3h twice to get rid of AzF in the translation reaction. After dialysis, the reaction volume increased to 250 ⁇ . Add 16 ⁇ 1 of ImM DIBO-TAMRA in the reaction to make the final concentration to 60 ⁇ . The labeling reaction was performed at room temperature for 3hrs.
  • smFRET experiments were performed in 50mM Tris-HCl (pH 8), 150mM NaCl, ImM DTT with ⁇ 100pM of double labeled CaM concentration. Either in the absence and presence of 2mM Ca 2+ or lOmM EDTA were recorded in the smFRET experiments. 20 ⁇ 1 samples, loaded on a home-made silicone plate (SYLGARD®) holding by a 70 ⁇ 80mm coverglass, were used for each experiments. smFRET measurements were carried out at room temperature on the Zeiss LSM 710 microscope equipped with ConfoCor3 module using Apochromat 40x 1.2NA water immersion objective (Zeiss). BP-FL fluorescence was excited by 488 nm laser. Emitted light passed through the pinhole and was splited into donor and acceptor components using a 565 nm dichroic mirror; the donor and acceptor signals were further filtered by 505-540 and 580-610 nm band pass filters, respectively.
  • the donor and acceptor signal were simultaneously recorded for 30s, 20 repeats with 1ms bin time in each experiments. The data from 3 experiments were combined together to obtain enough events for analysis.
  • the leakage of donor emission into the acceptor channel of free TAMRA dye were estimated in a separate experiment with 20 ⁇ fluorophore concentration and calculated as 14% to correct the signals before FRET analysis.
  • a threshold was set at 20 counts for the sum of donor and acceptor signals to filter the background noise out.
  • the FRET efficiency were calculated as [Intensity (acceptor)-leakage from donor channel]/total intensity (Intensity (acceptor)+Intensity(donor)) and plotted as a histogram. Gaussian function was used to fit the data by Origin software (OriginLab Corp.). Results
  • the DNA oligonucleotides complementary to nucleotides of tRNAccu/ucu were used for their chromatographic depletion from the total tRNA mixture.
  • the translation efficiency of tRNA mixtures before and after tRNAccu/ucu depletion were tested by the ability to support translation of GFP templates with one or six AGG codons (Fig 21 and Fig. 27). In the former case, the rest of arginine codons in the total tRNA mixture depleted of AGG-decoding isoacceptors resulted in only negligible background translation observed for 1 AGG template or no detectable translation for 6AGG template (Fig 21 and Fig 27).
  • tRNA depletion efficiency as 1- (RFU (Depl. tRNA)/RFU(Depl. tRNA +t7tRNAccu)). Using this assessment criteria the depletion efficiency for in-house produced tRNA mixtures range from 89% to 94% while for commercially-purchased ones from 62% to 88% calculated based on 1AGG- and 6AGG-templates respectively. In-house produced tRNA mixture was used for all subsequent experiments.
  • the recently developed bio-orthogonal reaction between strained alkenes/alkynes and tetrazine displays the rate constant several orders faster higher than the earlier versions of this reaction 26 .
  • One of the bioorthgonal reactants, Tetrazine is a chromophore quencher and its derivated BODIPY probes show more than 1000-fold turn-on fluorescence after conjugation with the protein 27 , which makes the following removal of unreacted dye much easier and less stringent than the conventional dyes.
  • TyrRS from M. jannaschii is another widely used orthogonal tRNA charging enzyme engineered to mediate incorporation of a range of benzyl side-chain analogs including tetrazine derivative at one or multiple sites 2 ' 13 ' 22 .
  • p-Azido-L-phenylalanine (AzF, Fig 22A) and the respective engineered version of MjTyrRS -AzFRS 39 were chosen based on the reports of their successful application for the amber-codon suppression in vivo and in vitro.
  • AzF showed the best amber-codon incorporation efficiency when used in combination with the flexizyme (eFx) charging system (Fig 29).
  • Fluorophorefluorophore-bearing amino acid analogs can hardly be aminoacylated by aaRS with low efficiency precluding their co- translational useco-translationally due to size limitations. Therefore co-translational supplementing supplementation of pre-charged tRNAs pre-charged with fluorescent amino acid is necessaryprovides an alternative approach.
  • Several strategies have were developed for pre-charging tRNA with the nnAAs. One involves ligation of chemically prepared aminoacylated dinucleotide to a truncated tRNA lacking 3 '-CA dinucleotide 42 . This method involving multi-step protocols is technically challenging.
  • a tRNA acylation ribozyme was developed to charge nnAAs on tRNAs in vitro 43 .
  • this approach is straightforward, its relies on multi-step chemical synthesis and the charging efficiency varies significantly towards different nnAAs and It is expensive as multi-step chemical synthesis that requires a copious amount of fluorescent dye and the dye bulkiness can likely cause steric hindrance preventing the correct orientation of the reactive groups.
  • Another approach involves functional group coupling to the enzymatically aminoacylated tRNA through the reactive amino acid side chain such as a sulfhydryl group of cysteine44 or ⁇ -amino group of lysine residues 45 .
  • cysteine residue as the conjugation tag providing theas its modification results in the shortest aliphatic spacer as well as lack of editing domains in its corresponding cysteinyl-tRNA synthetase (CysRS) 46 ' 47 .
  • Bodipy FL fluorophore BPFL
  • thermodynamic compensation hypothesis demands compatibility between tRNA-body and esterified amino acids for productive incorporation 49 .
  • t7tRNA(Cys) variants harboring either CUA or CCU anticodons were aminoacylated and conjugated to BPFL and yielding BPFL-cys-tRNA and the conjugation products were then purified by FIPLC at with -15-20% final yield (Fig 24 A).
  • FIPLC FIPLC at with -15-20% final yield
  • the reaction was primed by eGFP template with a single AGG codon and the The yield of labelled protein versus total protein produced in both undepleted "parental" lysate and tRNA-depleted lysate programmed by different tRNA mixtures (Fig 24B) was compared.
  • the yield of labelled protein was increased 1.4 times while the relative labelling efficiency was 10 times higher in tRNA-reconstituted system as compared to wt lysate (Fig 24B, lane 3 and 4 with BP-tRNA).
  • the BPFL-tRNA less favorably competes with the native tRNA for decoding the AGG codon in normal lysate due to the presence of the native AGG-isoacceptors even though they are in low abundance abundant in the native tRNA pool 54 .
  • Almost no sGFP was produced in the cell-free system with semi- synthetic t7tRNA complement lacking the AGG isoacceptor (Fig 24B, lane 3 without BP-tRNA).
  • the expression of sGFP could be restored upon addition of BPFL-Cys-tRNAccu, indicating that virtually all expressed polypeptide incorporated BP-fluorophore.
  • Cys-tRNAccu discharged from nnAA during translation underwent negligible co-translational recharging with cysteine (Fig 34, SI).
  • the system's orthogonality is probably due to relatively low concentration of endogenous CysRS and highly reduced kcat/Km of the AGG-suppressor entailing resulting in unfavorable competition with endogeneousendogenous wt tRNA(Cys) since CysRS relies on anticodon (in particular: G35C36) as is an important identity element in tRNA recognition by CysRS recognition 47 .
  • Calmodulin a regulator protein of cellular functions
  • AzF bio-orthogonal reactive group
  • BPFL-Cys fluorophore-b earing aminoacid
  • This reaction can be processed carried out either on pure the protein or in the cell-free reaction context and avoid the side effect of protein aggregation or oxidation caused by metal catalyst which was required in the copper-catalyzed azide-alkyne huisgen cycloaddition (CuAAC). Fluorescence gel scanning demonstrates confirned successful installation of two FRET probes in CaM protein (Fig 25A, first lane).
  • Excitation at 488nm of double labelled CaM revealed two distinct peaks on in the fluorescence emission spectra (Fig 25B).
  • the 512nm peak corresponds to emission of BP-FL while the other peak at 575nm reflects emission of TAMRA.
  • CaM proteins monolabled with BP-FL or TAMRA show low emission at 575nm in their fluorescence emission spectra when excited at 488nm.
  • the concentration of CaM protein single-labelled with TAMRA single-labelled CaM protein was pre-adjusted to equalize its maximum emission fluorescence to that of double labelled protein when excited at 543nm (acceptor excitation wavelength).
  • MjY2 was best most efficient in coding AzF functionalities, although the MjYl was screened identified as the most efficient in vivo 31 and MjY4(tRNAOptCUA) was employed in the most recent work 38 .
  • the evolutionary pressure ensures that in the native system all aa-tRNAs show similar affinity towards elongation factor (EF-Tu) by combining amino acid side chains with different tRNA bodies 49 ' 55 . Therefore, in order to achieve the best nnAA incorporation efficiency, it is desirable to optimize the wild type o-tRNA sequence to work in concert with the chosen target nnAAs to achieve optimal affinity to EF-Tu.
  • MjTyr system performed consistently better than Pyl system in all the four codon contexts we tested here.
  • the relative efficiency of MjTyr system ranged from 55% to 97% in decoding UAG codon.
  • the suppression efficiency of PylT/PylRS/PrK varied and in some cases failed to mediate GFP translation.
  • MjY suppression system not confined to amber suppression but is also well compatible for with AGG-reassignment to AzF when combined with our newly developed cell free system lacking the AGG-native isoacceptors.
  • the low sensitivity of MjTyrRS to the tRNA anticodon triplets of MjTyrRS enables its future use for reassigning reassignment to other sense codons.
  • AGG codon could be reassigned to BP-FL fluorophore directly, which would significantly simplify the labelling procedure, by using precharged BPFL- Cys-tRNAccu.
  • the discharged tRNAccu was is poor substrate of CysRS due to the altered anticodon and underwent negligible co-translational recharging with cysteine. This maintained maintaines the system's fidelity. Further optimization of the tRNA body in the context of esterified BPFL-Cys for interaction withsequence to enhance its compatibility with the esterified BPFL-Cys to be better accommodated by EF-Tu would increase the decoding efficiency.
  • Template A contains SITS protein, eGFP construct and myc tag from N- to C-term. it is used as a parental template to prepare the following derivatives:
  • A_151X TAT(Tyr codon) was changed to TAG codon at the 151st position of eGFP construct (the 2 nd red codon)
  • A_1R AGG codon was introduced at the N-term of eGFP construct (the 1st red codon)
  • A__151R TAT(Tyr codon) was changed to AGG codon at the 15.1st position of eGFP construct (the 2 rId red codon)
  • Template B contains myc tag, sGFP construct, prescission cleavage site and RGS peptide tag from !S!- to C-term. it is used as a parental template to prepare the following derivatives:
  • b_lR AGG codon was introduced at the N-term of sG FP construct (the 1st red codon) (d) B__151R: TAT ⁇ Tyr codon) was changed to AGG codon at the 151st position of sGFP construct (the 2 "d red codon (3) sGFP_T2
  • Template SGFP T2 1 only contains open reading frame for sGFP protein. Arginines in this protein are encoded by AGG codon at 108 position (shown in red) while the rest of them are by CGG codon.
  • CaM template contains myc tag, CaM protein, prescission cleavage site and RGS peptide tag from N- to C-term as shown in the vector map.
  • CysRS Recombinant cysteinyl-tRNA synthease production: The gene fragment for CysRS was amplified by colony PCR on E.coli BL21(DE3) strain and cloned into pET28 vector with the C-terminal His-tag and purified by standard affinity chromotography. Protein expression was induced with 0.5mM isfopropyl-P-D-thiogalactopyranoside (IPTG) in BL21(DE3)RIL cells at 20 °C for overnight. CysRS was purified by Ni2+ affinity chromatography using standard buffer followed by gel filtration on Su- perdex 200 (GE Healthcare) in buffer: 50mM Hepes-KOH, pH8, 150mM NaCl and lmM DTT.
  • Affinity clamp matrix preparation C-terminal Cys were added into sequence of the affinity clamp protein (pdz-fibronectin Fusion Protein, PDB: 3CH8 A). The purified protein with C-terminal Cys was immobilized on Iodoacetyl Gel (UltraLink®) using manufacture's protocol.
  • tRNA charging by flexizyme for amber suppression The acylation reaction were performed as described before 62 . 1 volume of 250 ⁇ o-tRNA was mixed with the same volume of 50 ⁇ Fx (250 ⁇ ) and 3 volume of water. The mixture was then heated at 95° for 5min with constant agitation at 1200rpm and cooled down slowly at room temperature. After adding 1 volume of 0.5M Hepes (pH7.9) and 2 volume of 3M MgCl 2 , the mixture was put on ice for 2min and followed by addition of 2V of nnAA substrate(lOOmM) (in 100% DMSO or 100% ACN). The reactions were incubated at 10° with agitation for the given periods of time (2.5, 5 or lOh). Flexizyme acylation reactions were stopped and used to prime the translational reactions.
  • the orthogonality of PylT/PylRSAF pair is better than Mj Y2/ AzFRS pair. Exclusion either nnAA, PylT or PylRS, no detectable fluorescence was observed. However, when supplementing the reaction with MjY2 tRNA, the protein yield increased slightly which indicated MjYtRNA may be misacylated by PylRS with Prk. The ratio of each matured tRNAs and their cognate aaRSs are evolutionary balanced to ensure the translational fidelity and efficiency. Therefore, when the 21st and 22nd o-tRNA/aaRS pairs are introduced into the translation system, care must be taken to avoid cross-recognition.
  • the reaction was performed at 28°C for 3h.
  • the translated product from 200 ⁇ cell-free reaction was immobilized on Affinity-clamp resin beads (see Example 7). Resin with the immobilized translation product was washed with 25mM Tris (pH7.5), 0.25M NaCl, 0.1% Triton X-100 buffer to remove free AzF from the translation reaction, followed by addition of DIBO-TAMRA to ImM final concentration in two original reaction volumes of PBS.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

A complement to tRNAs and a protein translation system are provided that enable the incorporation of non-natural moieties such as non-natural amino acids without compromising the ability to incorporate all of the twenty natural amino acids into the protein. This is achieved by reassigning one of the tRNA anticodons for amino acids that are normally decoded by at least two different tRNA anticodons to a non-natural moiety, wherein at least one codon can be uniquely recognized by the reassigned anticodon and at least one another codon from the same codon box cannot be recognized by the reassigned anticodon. Accordingly, an mRNA for translation is engineered to comprise one or more specific codons corresponding to the reassigned tRNA anticodons so that the non-natural moiety is incorporated into the translated protein at a selected position.

Description

TITLE
PLATFORM FOR NON-NATURAL AMINO ACID INCORPORATION INTO
PROTEINS TECHNICAL FIELD THIS INVENTION relates to protein engineering. More particularly, this invention relates to producing recombinant proteins that comprise one or more non-natural moieties (e.g non- natural amino acids) as well as any of all of the twenty (20) natural amino acids.
BACKGROUND
Proteins are the central functional constituents in all living organisms. They are formed by natural biosynthetic pathways using genetically determined sequences of the twenty (20) genetically encoded "natural" amino acids that form the structural units of such proteins. To date, advances in understanding protein structure, function and diversity have largely focussed on natural structure, function and diversity given the relative simplicity of producing proteins that comprise natural amino acids. While the human genome encodes about 30,000 different proteins, there is potentially even more enormous diversity if proteins can be made that include structural moieties other than natural amino acids (e.g non-natural amino acids, chemical derivatives of natural amino acids, chemically-reactive moieties and the like). These "non-natural" proteins could be used to create synthetic protein libraries, protein-based bioactives such as pharmaceuticals, biotherapeutics (e.g antibodies, peptide hormones, immunomodulators), detection or diagnostic reagents having unprecedented structures and activities not found in naturally-occurring proteins. However, the recombinant production of such "non-natural" proteins has proven to be a difficult proposition.
Generally, approaches to producing recombinant "non-natural" proteins have relied upon manipulating protein translation (particularly in cell-free expression systems) by subverting the normal function of orthogonal tRNAs to provide a specific, natural amino acid for each step of protein chain elongation. It is possible to aminoacylate orthogonal tRNA with non-natural amino acids, either enzymatically or chemically. Enzymatic aminoacetylation requires the availability of orthogonal aminoacyl tRNA synthetase (aaRS). Typically, multiple rounds of directed evolution are required to generate orthogonal tRNA/aaRS pairs that can accept a non-natural amino acid as its substrate. While hundreds of non-natural amino acids have been incorporated into proteins using these approaches, the majority of them fall into a narrow structural category, defined by the specificity of their "parental" aaRS.
A noticeable departure from this concept is the use of an evolved tRNA acylation ribozyme (Flexizyme) that can charge non-natural amino acids onto tRNAs in vitro. This is achieved by the formation of a transient complex with the 3 '-end of a tRNA, where the 3'-OH of the terminal ribose engages in a nucleophilic attack on the activated carboxyl carbon of the non-natural amino acid.
Protocols have also been developed for chemical acylation tRNAs. This enables the incorporation of chemical functionalities that are quite distinct from native amino acids and thereby difficult to charge via the aaRS route. While several synthesis routes have been developed, they are typically low-yield and are not widely used.
Other approaches have focussed on the incorporation of non-natural amino acids during protein translation by way of assigning tRNAs having orthogonal anticodons to encode non-natural amino acids. This also requires that a translated mRNA includes corresponding "reassigned" codons at positions where non-natural amino acids are to be incorporated. The most commonly used approach for the generation of orthogonal codons is "nonsense suppression", which makes use of three stop codons in the genetic code: the amber, opal and ochre codons. In some organisms, stop codons can be read through and encode non-natural amino acids, such as the UGA codon for selenocysteine and the UAG codon for pyrrolysine. The main disadvantage of this system is the inherent reduction in protein expression yield resulting from the competition of release factors with orthogonal suppressor tRNAs.
Another approach is "frameshift suppression". A natural frameshift suppressor tRNA containing an extended anticodon loop can read as a four-base codon, such as UAGN and ACCN, and suppress the +1 frame shift. However, encoding a non-natural amino acid via four-base codons is a far less efficient approach than the use of nonsense suppression, whereby the yield of a target protein is significantly lowered by false- reading of the quadruplet-codon as a triplet. A more recent strategy for amino acid incorporation is the exclusion of certain amino acids from the genetic code (such as Phe), thereby generating "free" codons that are assignable to a non-natural amino acid. However, this leads to a reduction of the amino acid vocabulary. SUMMARY
The present invention broadly provides a method whereby tRNA anticodons can be "reassigned" from natural amino acids to non-natural moieties, such as non- natural amino acids, to enable the production of recombinant proteins that include one or a plurality of non-natural moieties, without compromising the ability to incorporate natural amino acids into the recombinant protein.
In a first aspect, the invention provides method of producing a complement of tRNAs suitable for translation of a protein comprising at least one non-natural moiety, said method including the step of substituting at least one tRNA that comprises an anticodon for a natural amino acid with at least one tRNA comprising the same anticodon reassigned to a non-natural moiety, wherein the complement of tRNAs is operable to facilitate translation of an RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety whereby the translated protein may comprise any or all of the twenty (20) natural amino acids.
Suitably, the reassigned anticodon is one of a plurality of different anticodons for the same natural amino acid.
In a second aspect, the invention provides a composition comprising a complement of tRNAs suitable for translation of a protein comprising at least one non-natural moiety, said complement comprising at least one tRNA that comprises an anticodon for a non-natural moiety reassigned from an anticodonfor a natural amino acid , wherein the complement of tRNAs is operable to facilitate translation of an RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety whereby the translated protein may comprise any or all of the twenty (20) natural amino acids.
Suitably, the reassigned anticodon is one of a plurality of different anticodons for the same natural amino acid.
In a third aspect, the invention provides a method of producing a translation system suitable for translation of a protein comprising at least one non-natural moiety, said method including producing a complement of tRNAs comprising at least one tRNA that comprises an anti-codon for a natural amino acid that has been reassigned to a non-natural moiety; and producing a transcribable RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety, wherein the mRNA may be transcribed to produce a translated protein that may comprise any or all of the twenty (20) natural amino acids.
In a fourth aspect, the invention provides a translation system suitable for translation of a protein comprising at least one non-natural moiety, said system comprising: a complement of tRNAs comprising at least one tRNA that comprises an anticodon for a natural amino acid that has been reassigned to a non-natural moiety; and a translatable mRNA which comprises a codon corresponding to the anticodon that has been reassigned to a non-natural moiety, wherein the mRNA may be transcribed to produce a translated protein that may comprise any or all of the twenty (20) natural amino acids.
In a fifth aspect, the invention provides a method of producing a recombinant protein comprising at least one non-natural moiety, said method including the step of translating an mRNA which comprises a codon corresponding to an anticodon of a tRNA that has been reassigned to a non-natural moiety in a complement of tRNAs comprising at least one tRNA that comprises an anti-codon for a natural amino acid that has been reassigned to a non-natural moiety, wherein the translated protein may comprise any or all of the twenty (20) natural amino acids.
Suitably, according to the method, composition or system according to any of the aforementioned aspects, the reassigned anticodon is fourfold or six-fold degenerate.
Suitably, according to the method, composition or system according to any of the aforementioned aspects, the reassigned anticodon is an anticodon for He, Ala, Gly, Pro, Thr, Val, Arg, Leu or Ser.
In particular embodiments of the method, composition or system according to any of the aforementioned aspects, the translated protein may comprise one or a plurality of the same or different non-natural moieties.
In a sixth aspect, the invention provides a recombinant protein produced by the method of the fifth aspect.
It will be appreciated that isolated proteins may comprise one or a plurality of same or different non-natural moieties that facilitate PEGylation, conjugation of small molecules, labelling, immobilisation, intermolecular and/or intramolecular cross-linking or other interactions, formation of higher order strucutres and/or one or more catalytic activities, although without limitation thereto. In an embodiment, the recombinant protein comprises two or more of the same or different non-natural moieties that are capable of intramolecular covalent bonding. In a particular embodiment, the recombinant protein is a macrocyclic protein.
Also provided is an mRNA molecule that encodes the recombinant protein of the sixth aspect.
It will be appreciated that the indefinite articles "a" and "an" are not to be read as singular indefinite articles or as otherwise excluding more than one or more than a single subject to which the indefinite article refers. For example, "a" protein includes one protein, one or more proteins or a plurality of proteins.
As used herein, unless the context requires otherwise, the words "comprise", "comprises" and "comprising" will be understood to mean the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Denaturing PAGE analysis of 48 in vitro synthesized t7tRNA species. The t7tRNAs are denoted by the respective single letter amino acid code (uppercase) and the 5 '-3' anticodon triplet (lowercase). Polymorphic tRNA variants are indicated by the respective numerical indeces. tRNAs for He and Trp (Igau and Wcca) were generated through auto-cleavage of the HHRz-containing RNA precursor. The asterisks above and below the corresponding tRNA-bands denote the precursor and the excised HHRz, respectively. Initiator and elongator tRNAs(Met) are prefixed with "i" and "e", respectively.
Figure 2. Principle and calibration of the affinity clamp peptide biosensor. (A) Schematic representation of experimental procedure. The RNA sequences at the top represent coding frames for RGS-peptide and its derivatives, RGSl and RGS2, the latter comprising the "insulator" codons (green) followed by the test-codon triplet (XXX, red). The resulting peptide containing the constant eight-amino-acid C- terminus and variable N-terminus binds to the biosensor composed of an autoinhibited TVMV-protease, with PDZ and FN3 domains forming the affinity clamp. Peptide binding results in a conformational change of the affinity clamp that in turn dislodges the inhibitory peptide from the active site of TVMV leading to protease activation and subsequent cleavage of the quenched reporter substrate. Q and F denote the fluorescence quencher and fluorophore groups, respectively. (B) The calibration curve for RGS-peptide obtained by assaying different concentrations of synthetic peptide in the heat-denatured E.coli extract. The initial rates were plotted against peptide concentration and the averaged data of triplicate experiments were fitted using regression coefficient (R2).
Figure 3. Cell-free translation of eGFP and RGS-peptide in tRNA-depleted E.coli lysate. (A) Native tRNA-dependent eGFP expression. (B) Analysis of the depletion efficiency of native tRNAs for each codon assessed by withholding individual t7tRNA from the t7tRNA mixture, mediating RGS peptide translation in the depleted lysate. The codon/anticodon pairs corresponding to t7tRNA that were individualy excluded are located below the corresponding bars. Elongator t7tRNAs were supplemented to a final concentration of 0.8 μΜ, with the initiator t7tRNAiMet at 1.6 μΜ and the native tRNA mixture at 1 μg/μl final concentrations.
Figure 4. The t7tRNA decoding table. Ser, Arg, and Leu, shaded in blue, are encoded by mixed codon family boxes from which two codons (N1N2N3) belong to a split and the other four to unsplit codon family boxes19. The 4- and 2-fold degenerate amino acids are shaded in green and gray, respectively. Native tRNAs and t7tRNAs are denoted by their respective anticodons (N34N35N36). The letters other than A/U/G/C in the native tRNA anticodons denote modified nucleosides55. The native and t7tRNA decoding patterns are indicated by arrow-lines from the left and right sides of the codon columns, respectively. Anticodons of the tRNAs specific for Lys, Glu, and He where modification either in anticodon or another part was essential for aminoacylation are highlighted in pink. Lys t7tRNA with U34 to C34 anticodon replacement based on tRNALys(UUU) is highlighted in red. The arrow- lines connecting t7tRNAs and the respective codons indicate the tRNA/codon combinations tested in the peptide biosensor assay. The dashed gray and black continuous arrow-lines correspond to < 10% or ^ 10% codon decoding efficiency, respectively. The associated number beside the black arrow-line indicates the calculated decoding efficiency of the t7tRNAs towards the analyzed codon as described in Fig. 11. The N34 modifications include "V"- uridine 5-oxyacetic acid, "["- 5-methyl-aminomethyluridine(mnm5U), "$"- 5-carboxymethylaminomethyl-2- thiouridine(cmnm5s2U), "S"- 5-methylaminomethyl-2-thiouridine (mnm5s2U), ")"-5- carboxymethylaminomethyl-2'-0-methyluridine (cmnm5Um), "B"- 2'-0- methylcytidine (Cm), "M"- N4-acetylcytidine (ac4C), "]"- 2-lysidine (k2C), 'Τ'- Inosine, "Q"- queuosine, and "Q*"- glutamyl-queuosine55 .
Figure 5. Analysis of the purified native tRNAs for He, Glu and Asn. (A) Analysis of purified tRNAs on the denaturing PAGE stained with SYBR green. (B- D) The activities of purified native tRNAGlu (B), tRNAAsn (C) and tRNAIle(GAU) (D) analyzed by the peptide expression assay. The final concentration of native tRNAs in the assay was 1.6μΜ.
Figure 6. sGFP expression in semi-synthetic in vitro translation system. (A) DNA templates for three sGFP ORFs of various codon compositions were expressed in tRNA-depleted lysate programmed with semi -synthetic tRNA complements or native tRNA mixture at different concentrations. (B) Expression of sGFP_T2 template in tRNA-depleted lysate supplemented with semi -synthetic tRNA mixtures lacking the indicated t7tRNAs. Corresponding codons are shown below the tRNAs where y stands for U or C and r for A or G.
Figure 7. Expression of sGFP Tl in the PURE in vitro translation system and in the tRNA-depleted S30 lysate. In vitro translation experiments were performed without tRNA(circles), with native tRNA (squares) or with semi-synthetic tRNAs (triangles).
Figure 8. Construction of DNA templates for in vitro synthesis of 48 E.coli tRNA species. (A) DNA templates for tRNAs starting with G, U or C; (B) DNA templates for tRNAs starting with A or U. These DNA templates contain a HHRz- coding sequence which auto-cleaves from the precursor after transcription releasing the tRNA. The box indicates the FIHRz-coding sequence and the arrow in the box indicates the ribozyme cleavage site; (C) A summary of 48 E.coli tRNA species defined on the table from al to dl2. The tRNA designations as per Figl and their respective gene copy number, the first base and size are shown.
Figure 9. Calibration curves for RGS-peptide derivatives GGRGS and DDRGS in the affinity clamp assay. Here the initial rates of TVMV substrate de-quenching are plotted against the concentration of the peptide and fitted to a linear equation. Figure 10. The peptide expression levels from RGS templates prefaced by various codons. Codons were placed (A) immediately downstream the AUG initiator codon or (B) downstream the two consecutive GAU codons following AUG. The prefacing codons are shown below the respective bars. Figure 11. Calculation of native tRNA depletion efficiency and t7tRNA decoding activity. Two coding frames harbouring one or two test-codons were used. For the codons corresponding to 8 amino acids of the RGS-peptide, their synonymous variants were tested within the peptide-coding frame (shown in grey). In the context of two-codon template, 2 consecutive test-codons following GAU pair were used in addition to the same codon-variant in the RGS-coding frame. For other 12 amino acids not occurring in RGS-peptide sequence one or two test-codons were placed immediately downstream the pair of consecutive GAU codons. The "xxx" in red denotes the test-codon. In vitro translation reactions with different tRNA/codon combinations were carried out in the tRNA-depleted lysate. The reaction primed with E.coli native tRNAs (1μ§/μ1 final concentration) served as positive control (∑ native tRNA). The reaction primed with incomplete t7tRNA mixture lacking individual tRNAs (∑t7(-l) tRNA mix) was used to assess the depletion efficiency of native tRNA(s) for the given test-codon using the formula displayed in the box. The difference between the reactions primed with complete (∑ t7tRNA mix) and incomplete t7tRNA mixtures was used to assess the relative activity of test-codon specific t7tRNA as well as to reveal all possible cognate or non-cognate cross- recognition events within the unsplit or split codon family boxes. For one- and two- codon templates, the concentration of the test-codon specifict7tRNAs in the cell-free translation reaction was either 1.6 for both or 6.4μΜ respectively. The full spectrum of codon/tRNAcombinations for all 20 canonical amino acids was assayed and the peptide yield was determined by the affinity clamp assay. Unless indicated, each reaction was performed in duplicates.
Figure 12. Evaluation of t7tRNA activities for Ser, Arg and Leu. A: Decoding efficiencies for the four t7tRNASer isoacceptors towards six Ser-codons were tested using one-codon template at 1.6μΜ tRNA concentration (upper) or two-codon template at 1.6μΜ (middle) and 6.4μΜ (bottom) tRNA concentrations. B: The average t7tRNA decoding efficiencies towards the most of Ser, Arg and Leu codons were calculated as the mean value of relative activities provided by one- and two- codon templates at 1.6μΜ or 6.4μΜ of t7tRNA. The exception are the codons marked with the asterisks (CGU, CGC, CGA and CUG) the native isoacceptors for which were depleted incompletely and therefore masked the signal in one-codon template experiment. Therefore, t7tRNA functionalities towards these 4 codons were tested using two-codon template and their relative decoding activities were calculated as the mean value of activities at 1.6 and 6.4μΜ of respective t7tRNA. Figure 13. Evaluation of t7tRNA decoding efficiencies for four-fold degenerate amino acids (Val, Pro, Thr, Ala and Gly). The codon-reading activities of Pro t7tRNA isoacceptors were calculated based on one-codon template reactions since the corresponding two-codon templates failed in translation. The average decoding activities for other codons marked with asterisk for which native isoacceptor was depleted only partialy were calculated based on activities measured with two-codon template only.
Figure 14. Analysis of t7tRNA decoding efficiencies for codons of 1-, 2- and 3- fold degenerate amino acids. The best-performing t7tRNA isoacceptors (see Fig. 8 for designation) as well as their relative activities are shown for each codon. The t7tRNA relative activities were calculated as in Fig. 13.
Figure 15. PAGE-analysis of native tRNAGlu isolated on different oligonucleotide matrixes. Native tRNAGlu isoacceptors were purified by the NHS- and streptavidin-resins functionalized with OligoDNAl-Glu-amine and OligoDNAl- Glu-biotin, respectively, using two buffer systems (containing TMA+ or Na+) u. The elution fractions (El and E2) were assessed on 8% denaturing PAGE for purity. The unbound tRNAs were removed by washing with 10 resin volumes of lOmM Tris- HCl (pH7.5) buffer at room temperature until the absorbance of the eluate at 260nm fell below 0.01 A260 units/ml. Target tRNA was eluted twice with 3 resin volumes of lOmM Tris-HCl (pH7.5) at 68°C.
Figure 16. Depletion of specific tRNAs from the total tRNA mixture using RNA aptamer (kissing loop) chromatography. (A) schematic representation of the base- pairing mechanism of kissing loop:tRNA complex formation (B)Flow chart for preparation of in vitro translation system depleted for a specific tRNA.. C: Measurement of GFP-synthesis following tRNA reconstitution.
Figure 17. ARS recoiling procedure.
Figure 18. Results of ARS recoiling procedure on tRNA depletion.
Figure 19. A: Cysteinylated or selemocysteinylated tRNACys(Secys) harbouring grafted GCU- or CCU-anticodons (Cys-tRNA(Cys)gcu/ccu). B: Effective suppression of single AGG-codon by Cys-tRNA(Cys)ccu in a context of translation reaction reconstituted of both all-tRNA depleted lysate and semi- synthetic tRNA complement lacking t7tRNA(Arg)ccu and primed with eGFP-coding template harbouring single AGG-codon C: Effective suppression of two consecutive AGC- codons in a translation reaction with the lysate directly depleted from endogenous tRNA(Ser)GCU using KL. D: Effective suppression of amber-codon in the eGFP- coding ORF (position 153) by pre-translationaly selenocysteinylated tRNACys harbouring grafted CUA anticodon (reaction conditions as in B). E: Purification of Secys-tRNACys (CCU-anticodon) conjugation product with BodipyFL iodoacetamide.
Figure 20. Macrocyclic peptide design by incorporation of non-natural amino acids.. (A) Reassignment of AGG codon at the position 108 of EGFP using BODIPY- tRNA-Cys in reconstituted cell-free system lacking tRNA Arg (CCU). (B) Reassignment of AGC codon at position 4 of EGFP. Left panel is a scan of SDS-PAGE loaded with EGFP purified from E.coli in vitro translation reactions. Lane 1 represents the unmodified cell-free system while lanes 2 and 3 represent the reaction in which ocutR A was replaced with Pyr ocutRNA charged with cyclooctene Lysine (COC). The COC was labelled with Atto488-tetrazine prior to purification. (C) Expression yields of EGFP with one or two reassigned Ser(AGC) or amber (TAG) codons. (D) Tetrazine ligation reaction (E) Structures of bifunctional tetrazine derivative capable of ligating two cyclooctene containing amino acids. (F) Trifunctional tetrazine derivative (G) SDS- PAGE analysis of in vitro translation mixture expressing COC-containing EGFP protein (B) cross-linked with di-tetrazine (DT). The gel was loaded with unboiled samples and scanned for EGFP fluorescence (H) Example of macrocyclic polypeptides formation using codon reassignment and copper catalysed click reaction.
Figure 21. Translation efficiency of two GFP-coding templates with either all six (6) or just one arginine codon/s changed to AGG (6 AGG or 1 AGG on the figure, respectively) in the translation reactions programmed with 3 tRNA mixtures as indicated. Total tRNA and Depl tRNA indicate the total home-isolated tRNA mixture before and after tRNAccu/ucu depletion, respectively. A third mixture contains synthetic t7tRNAccu to added a final concentration at of 5μΜ.
Figure 22. Comparative analysis of amber codon suppression efficiencies in E.coli cell-free translation system with different nnAA/o-tRNA/aaRS combinations. A: The structure of nnAAs used here. B-D: Suppression Amber suppression of A 151X template. The suppression efficiency is defined as a ratio compared to the fluorescence ofpercentage of wild type eGFP fluorescence wild type eGFP without stop codon inside its ORF. B: Incorporation of four nnAAs by three PylRS variants. The final concentrations of PylTcua, PylRS variants and nnAAs were 20μΜ, 20 μΜ and ImM, respectively. C: AzF incorporation by four MjY tRNA variants. MjYl, MjY2, MjY3 and MjY4 are corresponding to the tRNAs pAzPhel, pAzPhe2, pAzPhe3 and tRNAopt CUA in original publication 5'37. The final concentrations of MjYtRNA variants, AzFRS and AzF are 10 μΜ,10 μΜ and ImM, respectively. D: Effect of o-tRNA and o-aaRS concentrations on amber codon suppression efficiency of MjY2/ AzFRS/ AzF and PylT/PylRSAF/PrK. E: The effect of codon contexts on nnAA incorporation efficiency in two orthogonal systems. The concentration of MjY2 and AzFRS were 10μΜ for both while PylT and PylRS were used at 20 and 30 μΜ, respectively. Four templates, named A_1X, A_151X, B_1X and B_151X, were used in the analysis (sequences are shown in SI). A and B denote the template backbones with different codon biases where codon vocabulary in A is optimized for eGFP while in B it is simplified mostly utilizing the unique codon to decode each amino acid type. The numeric indicates the position of amber codon in ORF sequence. The relative activity in individual reactions is given as a percent of fluorescent intensity provided whileobtained when using EctRNATyr(cua) as a suppressor.
Figure 23. AGG reassignment to AzF in the context of four GFP ORFs. The GFP protein was expressed in cell-free system depleted of tRNA species decoding AGG codon with and without addition of MjY suppression system (MjY2/ AzFRS). The final concentrations for MjY2, AzFRS, AzF are were 10μΜ, 10 μΜ and ImM, respectively. The anticodon in Mj Y2 was changed to CCU in order to reassign AGG codon to AzF.
Figure 24. Synthesis of BPFL-tRNA for AGG and UAG-suppression. (A): HPLC purification of BPFL-conjugated tRNAs. The tRNACys bearing CUA or CCU anticodons were charged with Cys by CysRS and reacted with the iodoacetamide group on the BP-FL. Absorbance measurement at 254nm detected the ribonucleic acid while 490nm channel was used for BP-FL detection. (B-C): Analysis of labelled protein yields by fluorescence scanning and total protein yield by Western blotting of 12% PAGE gel. The BP-FL incorporation was detected on the gel after quenching eliminatingthe GFP fluorescence by boiling of the sample. The total protein was detected by Western bolting using anti-GFP antibody. The intensity of each band was calculated by ImagJ scaled to by the intensity of the faintest band that was set to 1. (B) The sGFP_T2 template harboring one AGG codon was expressed with or without addition of Biodipy-charged tRNAccu in the normal lysate or tRNA depleted lysate supplemented with indicated tRNA mixtures. (C) Comparison of BP-FL incorporation mediated through amber or AGG codon suppression. The translation reactions for AGG suppression are programmed by templates with single AGG at the 1st or 151 st GFP ORF respectively and reconstituted of tRNA-depleted lysate and total tRNA mixture lacking AGG suppressors with or without BPFL-tRNAccu suppressors. The similar reactions are performed for amber suppression but with total tRNA mixture, template harbouringharboring single amber codon and BPFL-tRNAcua suppressor.
Figure 25. Site-specific double labelled labelling of CaM for smFRET-based conformational change analysis. (A) Fluorescence scanning scans of mono- and dual- labelled CaM. Dual labelled CaM protein was prepared in the cell-free translation system reconstituted of tRNA-depleted lysate and total tRNA mixture lacking AGG suppressors. Two suppression systems, MjY2(cua)/AzFRS/AzF and BPFL-cys-tRNAccu, were supplemented for recoding UAG and AGG codon at the 1st and 149th position, respectively. AzF incorporated in the protein was then reacted with DIBO-TAMRA through copper-free click chemistry. Single labelled CaM proteins were prepared the same way but using only one suppression system while the other o-codon was decoded either by tRNATyrcua or tRNAArgccu. SDS- PAGE gel loaded with single and double labelled CaM was scanned using two chanelschannels as indicated. (B) Fluorescence emission spectra of single-labelled and double labelled CaM excited at 488 nm. The concentration of T AMRA-labelled protein was adjusted to make sure its emission fluorescence was the same as that of dual labelled protein when excited at 543nm. (C): Structural representation of CaM in Ca2+-free (PDB: 1CFC) and Ca2+-binding form (PDB: 4CLN). The green and red dots indicate the BP-FL and TAMRA installed in the CaM ORF at the 1st and 149th position, respectively. (D-E) smFRET histograms recorded of dual-labelled CaM under different conditions. (D): in 50mM Tris-HCl, 150mM NaCl buffer without Ca2+, (E): 2mM Ca2+, (F):with lOmM EDTA . The solid lines represent Gaussian fits to data using Origin software. Each peak indicates an individual conformation.
Figure 26. Vector map for pOPINE CaM template. Figure 27. Translational performance of depleted commercial tRNA mixture with or without supplementation of t7tRNAccu. Two GFP-coding templates with either all or just one AGG codon, 6AGG or lAGG indicated in the figure, were tested in the translation reactions programmed with 3 tRNA mixtures. Total tRNA and Depl tRNA indicate the commercial tRNA mixture before and after tRNAccu/ucu depletion. A third mixture contains t7tRNAccu to make a final concentration at 5μΜ.
Figure 28. Alignment of four previously reported MjYtRNA species. MjYl, MjY2, MjY3 and MjY4 are corresponding to the tRNAs named pAzPhel, pAzPhe2, pAzPhe3 and tRNAopt CUA in original publications4. Unlike the sequence reported in the original paper, the N63 to N67 in the MjY2_tRNA here is "CATCG" instead of "CATCGT" (the "T" in the end appears to be erroneous in the original paper). Figure 29. The incorporation efficiency of 5 nnAAs precharged by flexizyme with their respective active group. A: The structure of five activated acid substrates for tRNA acylation by Flexizyme, including L-Propargylglycine 4-chlorobenzyl thioester (Pra-CBT), L-Azidolysine 4-chlorobenzyl thioester (Lys(N3)-CBT), L- Azidohomoalanine 4-chlorobenzyl thioester (Aha-CBT), Nε-biotinyl-L-lysine 3,5- dinitrobenzyl ester (Lys(biotin)-DBN) and L-Azidophenylalanine-cyanomethyl ester (AzF-CME). The nnAAs are shown in black while their respective active groups in red. B: The amber suppression efficiency of 5 nnAAs precharged tRNA tested by using A 151X template in the cell free translation system. The precharged tRNA was used to prime the translational reactions at 10, 20 or 30uM of final tRNA concentration. The flexizyme reaction time and the final concentration of precharged nnAA-tRNAs were indicated. Among the five nnAAs tested here, AzF demonstrated the highest translational activity. This suggested that compared to other nnAAs, the flexizyme could charge AzF very well on the o-tRNAs and this precharged AzF- tRNA was well accepted by EF-Tu and Ribosome.
Figure 30. Orthogonality of the two suppression systems, Mj Y2/AzFRS/AzF and PylT/PylRSAF/PrK, in E.coli in vitro translation systems. The reactions lacking either nn A A- substrate, o-tRNAs or enzyme were used to assess the level of nonspecific suppression on amber codon in template A 151X. The concentration of MjY2 and AzFRS were 10μΜ for both while PylT and PylRS were used at 20 and 40 μΜ, respectively. Figure 31. (A) The TAG codon in Template A 151X was reassigned to AzF. The MS/MS analysis of the identified peptides containing the nnAA incorporation site are shown. (B). The AGG codon in Template A 151R was reassigned to AzF. The MS/MS analysis of the identified peptides containing the nnAA incorporation site are shown. (C) The AGG codon in Template A IR was reassigned to AzF. The MS/MS analysis of the identified peptides containing the nnAA incorporation site are shown.
Figure 32. Structure of BPFL-tRNACys(CCU)
Figure 33. The tertiary complex of tRNA, amino acid and elongation factor. The structure of tRNATrp charged with different amino acids formed tertiary complex with elongation factor EF-Tu. A: Trp-tRNA-EFTu, B: BPFL-cys-tRNA-EFTu.
Figure 34. The ability of tRNACysccu in supporting AGG translation. Cell free translation reactions were performed in the context of tRNA-depleted lysate supplemented with semisynthetic tRNA mixtures lacking AGG-isoacceptors. The sGFP_T2 template harboring one AGG codon was expressed with or without addition of tRNA species with CCU anticodon as indicated. tRNAArgccu is the synthetic wt AGG tRNA isoacceptor and severs as a positive control.
Figure 35. Translational performance of commercial tRNA mixture used at 0.25 and 0.5μg/μl depleted for native AGC- and AGG-codon tRNA supressors (∑-a5/6,- el l) with or without supplementation of their t7tRNA counterparts: t7tRNAccu (a05) and t7tRNAgcu (c11). Two GFP-coding templates with either just one unique (eGFP xl AGC) or two consequtive (x2AGC) AGC codons at positions 4 or 4,5 both devoid of any of AGG and one template with both unique AGC (position 4) and AGG (position 151) codons (eGFP xlAGC/xlAGG) were used in the suppression experiments. For each template the translation reactions was programmed with either total tRNA mixtures lacking native isoacceptors for the desired AGC- and AGG- codons or the same mixture containing the supplemented t7tRNA analogs for both. Schematic representation of the used ORF is shown below each graph.
Figure 36. Experimental work-flow for double-sense codon labelling. CaM native ORF is shown in black, precision protease cleavage site is denoted by blue circle while affinity clam binding petidic tag is shown as brown hexagonal. XI and x2 indicate single or double-consequtive AGC-codons at the 1st or 1st and 2nd positions of CaM, respectively. Low case indicates the bias for the rest of Ser and Arg codons.
Figure 37. Site-specific double labelling of CaM. Fluorescence scanning of mono- and dual- labelled CaM. Dual labelled CaM protein was prepared in the cell- free translation system reconstituted of tRNA-depleted lysate and total tRNA mixture lacking suppressors for both AGG/AGA and AGC-codons. Two suppression systems, MjY2(gcu)/AzFRS/AzF and BPFL-cys-tRNAccu, were supplemented for decoding AGC and AGG codon at the 1 st and 151 st position, respectively. Protein harbouring AzF was either loaded on SDS-PAGE directly or subjected to the subseqent conjugation with DIBO-TAMRA through the copper-free strain-promoted cycloaddition. The two CaM-coding ORFs harbouring 1 (xlAGC) or two (x2) consequitive AGC-codons at position 1 or 1,2- in addition to a unique AGG at the 151 position were used. SDS-PAGE gel was scanned in two indicated wavelengths using two channels.
DETAILED DESCRIPTION
The present invention provides a protein translation system that allows the incorporation of non- natural moieties (e.g non- natural amino acids) into the translated protein without compromising the ability to incorporate all of the twenty (20) natural amino acids into the protein. This is achieved by reassigning one of the tRNA anticodons for amino acids that are normally decoded by at least two (2) different tRNA anticodons to a non-natural moiety, wherein at least one codon can be uniquely recognized by the reassigned anticodon and at least one another codon (i.e. from the same codon box) cannot be recognized by the reassigned anticodon. Accordingly, an mRNA for translation is engineered to comprise one or more specific codons corresponding to the reassigned tRNA anticodon(s) so that the non- natural moiety is incorporated into the translated protein at an appropriate or desired position.
In an aspect, the invention provides a method of producing a complement of tRNAs suitable for translation of a protein comprising at least one non-natural moiety, said method including the step of substituting at least one tRNA that comprises an anticodon for a natural amino acid with at least one tRNA comprising the same anticodon reassigned to a non-natural moiety, wherein the complement of tRNAs is operable to facilitate translation of an RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety whereby the translated protein may comprise any or all of the twenty (20) natural amino acids.
In another aspect, the invention provides a composition comprising a complement of tRNAs suitable for translation of a protein comprising at least one non-natural moiety, said complement comprising at least one tRNA that comprises an anticodon for a non-natural moiety reassigned from an anticodon for a natural amino acid , wherein the complement of tRNAs is operable to facilitate translation of an RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety whereby the translated protein may comprise any or all of the twenty (20) natural amino acids.
As generally used herein, a protein is a polymer comprising two (2) or more covalently linked moieties which may be natural L-amino acids and/or non-natural moieties such as non-natural amino acids. Typically, a peptide is a protein comprising no more than fifty (50) contiguous moieties. Typically a polypeptide is a protein comprising more than fifty (50) contiguous moieties.
As used herein, a "natural amino acid" is an L-amino acid that can be genetically encoded by a genome of an organism. Typically, a natural amino acid reacts at a peptidyl transferase center at a physiological range of kinetic constants. Preferably, the natural amino acid is selected from the group consisting of: alanine, asparagine, aspartate, cysteine, glycine, lysine, glutamate, glutamine, arginine, histidine, methionine, serine, threonine, valine, leucine, isoleucine, proline, tyrosine, tryptophan, phenylalanine, or a derivative of these which would normally be incorporable into a translated protein via a tRNA having an anticodon for any of these natural amino acids. Derivatives may be naturally-occurring derivatives such as post-translationally modified amino acids {e.g. selenocysteine).
As used herein, a "non-natural moiety" may be any molecule capable of incorporation into a protein translatable from an RNA template via ribosome- mediated chain elongation, with the proviso that it is not a natural amino acid as hereinbefore defined. Generally, such non-natural moieties may include non-natural amino acids, natural or synthetic chemical derivatives of natural amino acids and/or chemically-reactive moieties such as moieties capable of forming intramolecular covalent bonds. In some embodiments, subject to the above proviso, the non- natural amino acid may be any organic compound with an amine (-NH2) and a carboxylic acid (-COOH) that is capable of peptide bond formation. Non-limiting examples of non-natural moieties include D-amino acids, selenocysteine, pyrrolysine, N- formylmethionine, a-Amino-n-butyric acid, norvaline, norleucine, alloisoleucine, t- leucine, a-Amino-n-heptanoic acid, pipecolic acid, α,β-diaminopropionic acid, α,γ- diaminobutyric acid, ornithine, allothreonine, homocysteine, homoserine, β-alanine, β-amino-n-butyric acid, β-aminoisobutyric acid, γ-aminobutyric acid, a- aminoisobutyric acid, isovaline, sarcosine, N-ethyl glycine, N-propyl glycine, N- isopropyl glycine, N-methyl alanine, N-ethyl alanine, N-methyl β-alanine, N-ethyl β- alanine.
Chemical moieties that may be suitable for the formation of intramolecular covalent bonds may be any which facilitate: incorporation of two identical reactive groups that undergo homo-condensation; incorporation of two identical reactive groups that undergo condensation via bifunctional reactive groups; or incorporation of two different reactive groups that undergo hetero-condensation. Non-limiting examples include amino acid side chains or terminal amines or carboxylic acids modified by moieties such as NHS-esters, maleimidies, haloacetyls, although without limitation thereto. Reference may also be made to Chapters 14 and 15 Of Current Protocols in Protein Science Eds. Coligan et al (2001-2012) for a more detailed discussion of chemical modification of amino acids and proteins.
As generally used herein, a "tRNA" is a transfer RNA or isoacceptor RNA molecule inclusive of native and synthetic tRNA molecules. Typically, a tRNA molecule comprises a nucleotide sequence of about 60-93 nucleotides with regions of internal base pairing that results in four or five double-stranded stems and three or four single-stranded loops formed from the primary structure. The 5' and 3' termini are located at the termini of an internally base paired "acceptor stem". The 3 ' terminus comprises the nucleotide sequence CCA, the terminal "A" nucleotide being the site of aminoacylation by amino acid-specific aminoacyl tRNA synthases. The amino acid-specific anticodon is located in Loop II.
As used herein an "anticodon" is a nucleotide sequence of a tRNA molecule which corresponds to a codon in an mRNA, or its DNA precursor, that encodes a natural amino acid or serves as a translation terminator (UAA, UGA, UAG). In many cases the anticodon facilitates aminoacylation of the tRNA by the appropriate aminoacyl tRNA synthase with the correct amino acid encoded by the translatable mRNA codon to which the anticodon corresponds (exept for Ser, Ala and in some cases, Leu). In this context, the anticodon may be a 3 '-5 ' tri-nucleotide sequence that forms Watson-Crick base pairs at least at the first and second positions with the corresponding 5 '-3 ' mRNA codon sequence. Since the genetic code is degenerate there may be more than one tRNA decoding a codon box for a given amino acid. Such tRNAs decoding the same amino acid and comprising different anticodons are defined as "isoacceptors". In the case of all codons, except those encoding Met and Trp, the specificity of base-pairing between the anticodon and the mRNA codon is defined by the first two nucleotides (i.e read 3 '-5' in the anticodon and 5 '-3 ' in the mRNA codon), such that the same anticodon may correspond to two or more degenerate mRNA codons. Each of the single tRNA-isoacceptors for Asp, Asn, Cys, Glu, Gin, His, Lys, Phe and Tyr correspond to two different mRNA codons (i.e "two-fold degenerate"). I1e has two isoacceptors, one of which corresponds to a single mRNA codon (i.e "three-fold degenerate"). There are two isoacceptors for Ala, Gly, Pro, Thr and Val that correspond to respective codons in an RNA template (i.e "four-fold degenerate"). For Arg, Leu and Ser there are four or five isoacceptors that correspond to respective codons (i.e "six- fold degenerate").
Suitably, the composition disclosed herein includes at least one tRNA that comprises an anticodon reassigned from a natural amino acid to a non-natural moiety. In this context "reassigned" means that the anticodon no longer corresponds to an RNA or DNA codon that encodes its orthogonal, natural amino acid. To achieve this, any RNA translatable using the composition also comprises a corresponding codon at a position where it is intended to incorporate the non-natural moiety into the synthetised protein. By utilizing anticodons that correspond to redundant codons, the composition enables incorporation of non-natural moieties without compromising the ability to include all twenty (20) natural amino acids in a translated protein.
In principle, a reassigned anticodon according to the invention may be any that corresponds to a redundant RNA codon encoding a natural amino acid, wherein the reassigned codon is one of a plurality of different codons for the same amino acid. Suitably, amongst the redundant codons for a given amino acid there is at least one RNA codon which uniquely corresponds to the reassigned anticodon and at least one RNA codon which does not correspond to the reassigned anticodon. As will be understood by persons skilled in the art, the genetic code provides degeneracy whereby all natural amino acids other than tryptophan and methionine are encoded by more than one codon. A preferred object of the invention is to provide a protein translation system where, notwithstanding the incorporation of non- natural moieties into the protein, the ability to incorporate all of the twenty (20) non-natutal amino acids is retained. Accordingly, it is preferred that the reassigned anticodons are fourfold degenerate or six-fold degenerate, as hereinbefore described. This allows a "non-reassigned" anticodon to perform its normal role in incorporating a natural amino acid during protein translation. In a particularly preferred form, the anticodons are for Leu, Arg or Ser.
It will also be appreciated from the Examples that within each pool or complement of potentially reassignable anticodons for any particular amino acid, there may be rules or criteria that apply to the selection of appropriate anticodons for reassignment. These may include the effect of "wobble" in base-pairing, the potential for cross-recognition between tRNA anticodons and mRNA codons and/or suitability of preparing synthetic tRNA molecules comprising the reassigned anticodon. A more detailed examination of these factors is provided in the Examples.
In one embodiment, the method of producing the composition includes the steps of: (i) depleting one or more tRNAs from a complement of tRNAs suitable for translation of a protein comprising natural amino acids; and (ii) reconstituting the depleted complement of tRNAs with one or more tRNAs respectively reassigned to non-natural moieties and respectively coupled to the non-natural moieties.
In some embodiments, the complement of tRNAs in (i) is present in a cell- free translation system.
In one embodiment of step (i), substantially all tRNAs for natural amino acids are depleted from the complement of tRNAs. In a particular embodiment, depletion is by way of binding the tRNAs to ethanolamine sepharose.
In another embodiment of step (i), one or more tRNAs for natural amino acids are selectively depleted from the complement of tRNAs. In an embodiment, selective depletion is by selectively binding the one or more tRNAs to respective, specific tRNA depleting agents. Such agents may be a natural or synthetic protein, DNA, PNA etc.
In one embodiment, the tRNA depleting agent is an RNA aptamer. Suitably, each RNA aptamer forms a specific, high affinity complex with a particular tRNA. In an embodiment, the RNA aptamer comprises a nucleotide sequence which forms a high affinity complex by binding to the anticodon-containing nucleotide sequence of the target tRNA. In some embodiments, the RNA aptamer may be referred to as a "kissing loop" RNA.
In yet another embodiment, the tRNA depleting agent comprises one or plurality of single-stranded DNA oligonucleotides having nucleotide sequences specific for respective tRNAs. This embodiment is particularly useful for depletion of specific tRNAs.
In one embodiment of step (ii), the reconstituting tRNAs may comprise synthetic tRNAs, native tRNAs, or mixtures thereof (referred to herein as a "semi- synthetic tRNA complement"). Synthetic tRNAs may be made by any chemical or enzymatic method known in the art inclusive of RNA polymerase-mediated synthesis. Non-limiting examples include, SP6, SP3 and T7-mediated synthesis, although without limitation thereto. As will be described in more detail hereinafter, synthetic tRNAs for asparagine, glutamate and isoleucine are substantially non- functional. Accordingly, for the purposes of reconstitution, tRNAs for Asn, Glu and He are suitably native tRNAs, although may be substituted by engineered tRNA mutants.
In some embodiments, specific tRNAs may be obtained and used for reconstitution after selectively binding to an RNA aptamer such as a "kissing loop" RNA as hereinbefore described.
Non-natural moieties may be coupled, charged or loaded onto the reconstituting tRNA by any method known in the art. These may include use of chemical aminocylation or enzymatic aminoacylation. Non-limiting examples of enzymatic aminoacylation include the use of natural, modified aminoacyl tRNA synthases such as PylRS or variants thereof used in pyrrolysine tRNA synthase- mediated aminoacylation, Methanococcus jannaschii tyrosyl-transfer RNA synthetase (Mj TyrRS) or variants thereof, Flexizyme-mediated aminoacylation and/or aminoacylation by a cysteinyl tRNA synthase.
In embodiments relating to aminoacylation of a tRNA with a non-natural moiety by a cysteinyl tRNA synthase, a preferred embodiment provides in vitro charging of a synthetic tRNA having an anticodon reassigned to the non-natural moiety. Mutation of a wild-type cysteine tRNA anticodon reduces the affinity of the cysteinyl-tRNA synthetase for the cysteine tRNA but does not substantially reduce or inhibit the aminoacylation activity of cysteinyl tRNA synthetase in vitro where the high concentrations of reactants compensate for the reduction in affinity. The cysteine tRNA anticodon mutants are unable to be aminoacylated with cysteine in vivo (e.g in a cell-free translation system) due to the typically lower level of cysteinyl-tRNA synthetase and the presence of competing endogenous cysteine tRNAs. Accordingly, a complement of tRNAs may be produced by charging the synthetic tRNA having an anticodon reassigned to the non-natural moiety in vitro and reconstituting the tRNA complement with this synthetic tRNA, or a plurality of different tRNAs each comprising a different non-natural moiety. As will be appreciated from the foregoing, the composition disclosed herein may be suitable for use in a method or system for recombinant protein production.
Accordingly, an aspect of the invention provides a method of producing a translation system suitable for translation of a protein comprising at least one non- natural moiety, said method including producing a complement of tRNAs comprising at least one tRNA that comprises an anti-codon for a natural amino acid that has been reassigned to a non-natural moiety; and producing a transcribable RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety, wherein the mRNA may be transcribed to produce a translated protein that may comprise any or all of the twenty (20) natural amino acids.
Another aspect of the invention provides a translation system suitable for translation of a protein comprising at least one non-natural moiety, said system comprising: a complement of tRNAs comprising at least one tRNA that comprises an anticodon for a natural amino acid that has been reassigned to a non-natural moiety; and a translatable mRNA which comprises a codon corresponding to the anticodon that has been reassigned to a non-natural moiety, wherein the mRNA may be transcribed to produce a translated protein that may comprise any or all of the twenty (20) natural amino acids.
A further aspect of the invention provides a method of producing a recombinant protein comprising at least one non-natural moiety, said method including the step of translating an mRNA which comprises a codon corresponding to an anticodon of a tRNA that has been reassigned to a non-natural moiety in a complement of tRNAs comprising at least one tRNA that comprises an anti-codon for a natural amino acid that has been reassigned to a non-natural moiety, wherein the translated protein that may comprise any or all of the twenty (20) natural amino acids.
Suitably, the system and method of these aspects is for performing protein translation in vitro or an otherwise acellular or cell-free translation system. Non- limiting examples include wheat germ, insect, HeLa lysate, rabbit reticulocyte lysate, E. coli and Leishmania-based systems.
As will be understood from the foregoing, the invention is at least partly predicated on reassigning one or a plurality of redundant codons of the genetic code to encode non-natural moieties. Accordingly, the invention provides a method whereby a translatable RNA may be produced which comprises one or more codons that selectively correspond to anticodons of respective tRNAs that have been reassigned from natural amino acids to non-natural moieties.
A particular advantage of the present invention is that the translatable mRNA may comprise codons for any or all of the twenty (20) natural amino acids in addition to the one or more non-natural moieties, whereby a translated protein may comprise any or all of the twenty (20) natural amino acids in addition to the one or more non-natural moieties.
Accordingly, an aspect of the invention provides a recombinant protein produced by the method disclosed herein.
Also provided is an mRNA molecule that encodes the recombinant protein disclosed herein.
It will be appreciated that isolated proteins may comprise one or a plurality of same or different non-natural moieties that facilitate futher derivatisation such as PEGylation, conjugation of small molecules, labelling, tagging, immobilisation, intermolecular and/or intramolecular cross-linking or other interactions, formation of higher order strucutres and/or one or more catalytic activities, although without limitation thereto.
In a particular embodiment, the translated protein may comprise one or more non-natural moieties that facilitate the formation of one or more intramolecular covalent bonds. In a particular embodiment, the recombinant protein is a macrocylic protein.
By way of example, cyclic polypeptides may be useful in bioinformatics methods to design focused peptide libraries containing representatives from some or all of the structural fold classes found in nature. The availability of multiple reassigned codons in the production of proteins comprising cyclizable amino acids may facilitate the construction of libraries of macrocyclic peptides. To form covalent intramolecular bonds, the following approaches may be used: a) incorporation of two identical reactive groups that undergo homo- condensation; b) incorporation of two identical reactive groups and their condensation via bifunctional reactive groups; and c) incorporation of two different reactive groups that undergo hetero-condensation. As described herein, reassignment of tRNA anticodons provides a system for testing these approaches. A non-limiting example of constructing a test mRNA coding for a synthetic 10-mer peptide carrying Ser and Arg codons and a C-terminal affinity clamp tag will be described in more detail in the Examples.
It will be appreciated that the invention disclosed herein may be applicable to the production of any protein or peptide, or library comprising a plurality of different proteins and peptides, that incorporate moieties other than natural amino acids in targeted or selected locations, while allowing for the incorporation of natural amino acids as desired.
So that the invention may be fully understood and put into practical effect, reference is made to the following non-limiting Examples. EXAMPLES
EXAMPLE 1
Development of a semi-synthetic protein translation system Materials and Methods
Peptide biosensor (affinity clamp) assay
The reporter peptides of different sequences, RGSIDTWV, GGRGSIDTWV, DDRGSID TW V, and the fluorescently quenched TVMV substrate peptide (5- Amino-2-nitrobenzoic acid -ETVRFQSK-7-Methoxycoumarin-4-yl), were synthesized by Mimotopes. A fusion of autoinhibited protease and the affinity clamp (peptide biosensor) was purified by ΝΪ2+-ΝΤΑ affinity chromatography and stored in 50 mM Tris-HCl, 1 M NaCl, 5 mM EDTA, 2 mM TCEP, ans 10% glycerol buffer (pH 8.0).
Typically the affinity clamp assay was carried out in buffer A of 50 mM Tris- HCl, 1 M NaCl, 1 mM DTT, and 0.5 mM EDTA (pH8.0), supplemented with 1.3 μΜ of peptide biosensor and 300 μΜ of TVMV substrate peptide. RGS-peptides were used either as a solution in the buffer or in the context of in vitro translation, and the reaction pro-gress was monitored by exciting the sample at 330 nm and recording the fluorescence changes at 405 nm for 1 h using the Synergy plate reader. A calibration plot was generated to establish the relationship between initial rates of substrate cleavage (Vmax) and known concentrations of the control peptide. Samples were assayed in triplicate.
To quantify the RGS peptide and its derivatives in a cell-free translation reaction, the S30 E. coli cell extract formulated for coupled transcription-translation and supplemented with x2 protease inhibitor cocktail (Roche) was primed with the desired peptide-coding DNA template and incubated at 32°C for 1 h. After translation, NaCl was added to the reaction mixture to the final concentration of 1 M followed by incubation at 65°C for 10 min to inactivate the endogenous proteases otherwise competing with TVMV-protease for the substrate peptide. After centrifugation at 10000 rpm for 5 min, 10 μΐ of supernatant was used for the affinity clamp assay as described above. In the context of in vitro translation reactions, the calibration plot was obtained by supplementing different amounts of synthetic peptides into the cell-free translation reaction lacking the DNA template. Preparation of tRNA-depleted lysate
The s30 E.coli extract was prepared from BL21(DE3)GOLD as described in27, and stored frozen in 10 mM Tris-Acetate(pH8.2), 14 mM Mg(OAc)2, 0.6 mM KOAc, and 0.5 mM DTT buffer at -800 before the tRNA-depletion procedure. For tRNA depletion, 2.5 ml of s30 extract was rebuffered on an NAP-25 column (GE healthcare) equilibrated with buffer B of 25 mM KC1, 10 mM NaCl, 1.1 mM Mg(OAc)2, 0.1 mM EDTA, 10 mM Hepes-KOH(pH7.5), 1 mM Mg(OAc)2), and 120 mM KOAc. After re-buffering, the lysate was incubated with 0.8-1.2 ml settled ethanola-mine-Sepharose matrix, prepared according to previous procedures28, at 40C for 30 min on an orbital shaker. Fol-lowing the incubation, the supernatant was collected and the matrix was washed with 1 ml of buffer B containing 180 mM KOAc. The flow-through was combined with the supernatant from the previous step to yield the tRNA-depleted lysate, snap frozen, and stored at -800. The cell-free translation reactions in the S30 lysate were performed at 320 following the standard protocol27 using 30 nM DNA template and Mg(OAc)2 at 10 mM final con-centration. The PURExpress® Δ (aa, tRNA) Kit (E6840S), was purchased from NEB and used according to the manufacturer's instructions.
Construction of tDNAs and plasmids for peptide and sGFP expression
The coding sequences for tRNAs were obtained from the Genomic tRNA database (GtRNAdb)29. The DNA tem-plates(tDNAs) were synthesized by 3 -step PCR (Fig. 8).
All DNA templates coding for peptide and sGFP were constructed based on pOPINE-eGFP plasmid (GenBank: EF372397.1). To construct peptide-coding DNA templates, two complementary oligonucleotides harboring Ncol and NotI restriction site overhangs were used to assemble the ORFs of the desired peptides. The concentration of oligonucleotides was adjusted to 100 μΜ, mixed in water at a 1 : 1 molar ratio followed by heating at 95 °C for 5 min, and then slowly cooled down to room temperature for annealing. The pOPINE-eGFP plasmid vectors were digested by Ncol and NotI, combined with the annealed oligonucleotides, and ligated using T4 DNA ligase. The positive clones were verified by Sanger sequencing (AGRF Brisbane).
The fragments coding for sGFP ORFs with various codon biases denoted as sGFP Tl, sGFP_T2, and sGFP_T3 were synthesized as G-blocks by IDT and cloned into the pOPINE-based plasmid following the standard Gibson cloning procedure.
T7tRNA synthesis and purification
Standard run-off t7 transcription reactions were per-formed at 320 for 2 h in
40 mM Hepes-KOH (pH7.9), 18 mM Mg(OAc)2, 2 mM Spermidine, 40 mM DTT, 5 mM each rNTP containing 0.25 μΜ DNA template, 10 μg/ml T7 polymerase, and 0.25 U/ml yeast inorganic pyrophos-phatase. For the synthesis of tRNAHis, the transcription reaction was first supplemented with 5 mM of each rATP/rCTP/rUTP and 6.8 mM rGMP for 5 min, followed by addition of 1.7 mM rGTP and incubation for 2 h. The DNA template for tRNAHis contained an additional G corresponding to -1 position in tRNA. After transcription, the reactions were diluted 5-fold into buffer C (125 mM NaOAc pH 5.2, 0.25 mM EDTA). The tRNA transcripts were purified by affinity chromatography using ethanolamine-Sepharose matrix. For 1 ml of transcription reaction, 0.2 ml of settled matrix was used. Following the 1-h incubation of the slurry at 40, the matrix with bound tRNAs was extensively washed with buffer C containing 200 mM NaOAc. t7tRNAs were eluted from the matrix into buffer C containing 2 M NaOAc. tRNA was ethanol precipitatated and the pellets were dissolved in tRNA buffer containing 1 mM MgC12 and 0.5 mM NaOAc (pH 5.0). sGFP expression by semi-synthetic tRNA mixture
Three ORFs with variable synonymous codon composi-tions coding for sGFP were synthesized commercially and cloned into pOPINE plasmid. Template 1 (Tl) had the highest codon variation, including five different synonymous codons coding for Leu, four for Val, and 3 three for Pro, Arg, Ser, and Thr (Table 4). Template 2 (T2) was designed to deliver the highest codon biases with only two synonymous codons used to encode Ser, Arg, and Leu, and one codon used to encode Val, Pro, Thr, Ala, and Gly (Table 5). Template 3 (T3) featured a medium codon variety with two codons for Ser and Arg, and several codons for Leu, Val, Pro, Thr, Ala, and Gly, as in Tl (Table 6). The proportions of individual tRNAs in the semi-synthetic tRNA mixtures were roughly proportional to their codon abundance in the sGFP ORF sequences, except for codons occurring more than 10 times and those corresponding to the least- depleted native tRNAs. These t7tRNAs in the semi -synthetic mixtures were taken at reduced proportions relative to their codon usage shown in Table 4-6. Production of sGFPs corresponding to Tl-3 in the translation reactions with semisynthetic tRNA complement was monitored on a fluorescence plate reader for 3 h at 485-nm excitation and 528-nm emission wavelengths.
Results
To construct a synthetic E. coli tRNA complement capable of supporting protein translation, we conducted in vitro run-off transcription29'30 on 48 DNA templates harboring t7 promoter followed by the corresponding tRNA-coding sequences (Fig. 8).
T7tRNA transcripts were obtained in good amounts for all tRNAs except tRNAIle(GAU) and tRNATrp(CCA) (Fig. 1). The sequences coding for these tRNAs start with adenosine, which is likely to cause high abortion rates in the early transcription phase. For these two tRNAs, a Hammerhead ribozyme (HHRz) coding sequence prefaced by a strong transcription start site was introduced upstream to the tRNA coding sequences to ensure efficient transcription followed by HHRz- mediated auto-excision (Fig. 8) 1. Denaturing PAGE analysis revealed that more than 90% of the RNA precursor was cleaved to yield the desired tRNAs (Fig. 1). Although some tRNAs, such as tRNALeu(CAA) and tRNATyr, contain additional minor bands, we obtained a major species of the expected size in all cases.
In vitro peptide expression assay
Next, we sought to devise an in vitro synthesis assay to evaluate the decoding efficiency of t7tRNAs. We conjectured that a reporter peptide corresponding to a short open reading frame (ORF) that uses a limited set of codons is advantageous over classical reporter proteins such as GFP or luciferase that require a full set of tRNAs for their synthesis.
To establish a multiplexed quantitative homogeneous peptide expression assay, we took advantage of a peptide biosensor recently developed by our group32. It is composed of an artificially engineered peptide binding domain known as the "affinity clamp"33 and an autoinhibited tobacco vein mottling virus (TVMV) protease. Binding of an 8-amino acid ligand peptide RGSIDTWV (RGS-peptide) to the biosensor triggers a conformational change resulting in protease activation, which is detected through cleavage of a quenched fluorescent TVMV substrate peptide (Fig. 2A). We demonstrated that as little as 50 nM of the peptide could be detected using this assay. The relationship between initial velocities of TVMV substrate cleavage (VmaX) and the absolute concentration of the RGS-peptide was found to be linear in the 50-400 nM range (Fig. 2B). Furthermore, the assay could be performed in an E.coli cell -free system, although this requires a cocktail of protease inhibitors to mitigate the endogenous proteolytic activity.
While binding of the RGS-peptide to the affinity clamp critically depends on a free C-terminus34'35, introducing additional amino acids at the N-terminus of the RGS-peptide is not anticipated to affect the clamp-to-peptide binding33. We confirmed this by testing two N-terminally extended synthetic peptides, GG RGSIDTWV and DD RGSIDTWV, in our assay (Fig. 9), with the calibration curves for all three peptides displaying good linearity with R2 > 0.99 (Fig. 2B and Fig. 9). We concluded that our expression assay was well suited to quantify the expression of RGS-derived peptides in the cell-free system and thus could be used to test the decoding efficiency for various isoacceptor/codon pairs. To reduce the influence of codons immediately downstream of the initiator AUG codon on translation initiation, two GAU codons were inserted between the initiator and the test codons to yield an RGS2 template (Fig. 2A). Control experiments demonstrated that such a template mediated consistent peptide expression levels regardless of the test-codon upstream of the RGS-peptide coding sequence (Fig. 10).
Characterization of tRNA depleted E.coli cell-free translation system
To obtain tRNA-depleted E.coli S30 cell extract, we modified a previously published chromatographic tRNA depletion protocol28. In this procedure, the endogenous tRNAs bind to ethanolamine-Sepharose matrix while other components required for protein synthesis remain in the flow-through. To obtain optimal tRNA depletion while retaining the translation efficiency, we optimized the potassium/magnesium concentration as well as the matrix to lysate ratio. The extent of tRNA depletion was evaluated by comparing eGFP expressions in the depleted lysate with or without adding the total native tRNA mixture. As can be seen in Figure 3A, no eGFP was produced in the absence of native tRNAs, while the addition of total native tRNA mixture restored translation to 60% of the parental lysate level. A time lag of approximately 10 minutes was observed in tRNA-depleted ly sates, possibly reflecting the time required for aminoacylation of the re-added tRNAs.
Similar to eGFP, translation of a short RGS1 template (Fig.2 A) was also tRNA-dependent. Both native tRNAs and a mixture of 9 codon-specific t7tRNA species (Table 1) restored translation to similar levels (data not shown).
The observation that synthetic tRNAs could support translation of RGS1 template was somewhat surprising considering that tRNAIle requires post- transcriptional modifications for efficient aminoacylation21. Hence, we performed a control experiment where we omitted individual t7tRNAs from the mixture and measured the translational activities in the resultant reaction mixtures. As depicted in Figure 3B, when the individual t7tRNAs for AUG(iMet), CGG(Arg), or UCC(Ser) codons were independently withheld from the t7tRNA mixture, peptide expression decreased significantly. However, when the t7tRNAs for GGC(Gly), AUC(Ile), GAC(Asp), ACC(Thr), or UGG(Trp) were excluded, some residual expression was observed, probably due to native tRNA remnants in the lysate.. The depletion efficiencies of tRNAs for CGG(Arg) and UCC(Ser) were 75-90%, indicating that these codons are more suitable for reassignment due to negligible amounts of the respective native tRNA isoacceptors remaining in the depleted lysate (with the tRNA depletion efficiency defined as 100% when no peptide was produced without the addition of selected tRNA)36. Both of these codons belong to mixed codon boxes composed of two codon families, making them particularly promising candidates for the reassignment (see below). Systematic analysis of t7tRNA functionality and specificity
The developed assay provided a platform to systematically test the entire ensemble of t7tRNAs (Fig. 2A). Yet, the initial experiments revealed residual amounts of some isoacceptors in the depleted lysate. These represented tRNAs that are abundant in E.coli, indicating a relationship between the depletion efficiency of individual tRNAs and their abundance (Table 2)10'36. The incomplete depletion of endogenous tRNAs potentially complicates the functionality test by masking the signal from their t7tRNA counterparts. However, we observed that including two consecutive codons for a particular tRNA into the template significantly enhances the adverse effect of its depletion on the peptide translation efficiency. This is likely to reflect the changes in translation kinetics at reduced tRNA concentrations previously described for low-abundance tRNAs in vivo37. Therefore, we rescreened codons with incompletely depleted isoacceptors using a reporter peptide ORF harboring two consecutive target codons. The decoding efficiency was calculated as the mean value of both one- and two-codon templates (Fig. 11). The ability of t7tRNAs to decode the 61 codons is summarized in Figure 4 and Figures 12-14.
One important aspect to consider when interpretating the assay results is the extent to which t7tRNAs could undergo modifications in the lysate. For example, crude E.coli lysate was reported to mediate formation of pseudouridine in synthetic tRNAs38. Such modifications require only isomerase activity, but not the low molecular weight substrates or cofactors potentially present in our system39. However, the modifications on N34 and N37 involve up to 20 enzymes with relay chains, as well as multiple substrates and cofactors19. Therefore, such modifications are unlikely to emerge on the synthetic tRNAs in the crude lysate without significant optimization of the system. We experimentally address this issue later in the report (see below).
Split codon family boxes
Decoding of split codon families ending on U and C such as Ser, Phe, Tyr,
His, Asn, Asp, and Cys is carried out by tRNAs with G or its modified form (Q) in the first anticodon position. The A- and G-ending codons are decoded either using modified uri uridine (Lys and Glu) or by adding isoacceptors with C in the first anticodon position (Arg, Leu, and Gin) (Fig 4 blue and grey shaded amino acids). Uridine in the former case is modified with various aminomethyl derivatives that restrict the recognition solely to A- and G-ending codons40, additionally supported by ribose 2'-0-methylation when U and C are in the first anticodon position of both Leu isoacceptors.
As compared to their native counterparts, t7tRNAs for Phe, His, Asp, and Cys were efficient (50-70%) in decoding both their cognate (C-ending) codon with Watson-Crick geometry (further referred to as "cognate-WC") (C-ending) and wobble (U-ending) codons. The t7tRNATyr(GUA) decoded UAC with -50% efficiency and UAU with less than 30%. T7tRNAHis(GUG), featuring an additional G-1C73 base pair, demonstrated an effective decoding of its cognate-WC CAC and wobble CAU codons. The t7tRNA lacking G-l was not functional in restoring peptide translation (data not shown), presumably due to failure of the aminoacylation
41
step
The t7tRNASer(GCU) recognized both AGC and AGU codons with 123 and 75%) efficiency, respectively. For Leu and Arg, two tRNA isoacceptors are responsible for decoding each split codon box, and in our assay, both Leu t7tRNAs with UAA and CAA anticodons recognized only their cognate codons via clasical WC-base pairing. This is in agreement with a previously reported restricted mode of recognition by unmodified uridine42, albeit with efficiencies of 36 and 88%>, respectively. The t7tRNAs for Arg with UCU and CCU anticodons demonstrated similar behavior in strictly recognizing their cognate-WC codons at 340 and 202% efficiency, respectively. The higher apparent activity of these t7tRNAs possibly reflected the low abundance of these isoacceptors in the native tRNA mixture36. Consistent with previous observations from the ribosome binding assay43, t7tRNAGln(UUG) could not decode its cognate-WC CAA codons. The t7tRNAGln(CUG) also could not decode CAA codons, although it could decode its cognate-WC CUG codon with 40% efficiency.
T7tRNAs for Glu(UUC), Ile(GAU), Asn(GUU), and Lys(UUU) failed to sustain peptide translation from the template comprising both their cognate-WC and wobble codons. Lack of modifications within the anticodon loops of Glu and He t7tRNAs was previously shown to prevent their aminoacylation, making them inactive in the peptide translation44'45, and t7tRNAAsn(GUU) prepared with or without the help of Hrz performed poorly in the reporter peptide synthesis. Although chimeric t7tRNALys, with the grafted anticodon and the discriminator base both derived from tRNAAsn, could be aminoacylated by AsnRS with Asn46, it still failed to support peptide expression in our assay (data not shown). In this regard, it was previously reported that tRNALys, with unmodified U34, failed to decode either of its codons due to the potential loss of structural order in the anticodon loop as well as poor stacking within the codon-anticodon duplex formed by three consecutive, least- overlapping A-U base-planes47'48. In our system, mutating U to C in the first anticodon position of t7tRNALys fully restored its decoding activity towards AAG- codon. This effect can potentially stem from the stronger stacking provided by cytidine within both the anticodon loop and the codon-anticodon helix, as well as from a higher affinity towards lysyl aaRS49.
T7tRNAs for Trp(CCA) and Met(CAU) decoded their cognate-WC codons with 46% and 61% efficiency, respectively.
Unsplit codon family boxes
With the only exception of Arg, the standard subset of 2 or 3 isoacceptors bearing G, U, and/or C in the first anticodon is employed in bacteria to decode 8 unsplit codon family boxes. Here, G34 pairs with C- and U- and C34 to exclusively mediate the decoding of G-ending synonymous codons (Fig. 4 blue and green shadings). In the peptide synthesis assay, all t7tRNA isoacceptors with G or C in the first anticodon position demonstrated specific recognition of their cognate-WC codons with efficiencies of 40 to 160% (Fig. 4). In all native tRNA isoacceptors except tRNAGly(UCC), U34 carries a 5'-oxyacetic acid modification which extends recognition beyond its cognate-WC A-ending50 to G-, U-, and C-ending codons for Val, Pro, and Ala by partially altering the nucleoside sugar pucker geometry51'52. Furthermore, t7tRNALeu(UAG) and t7tRNASer(UGA), which are presumably devoid of modifications, show strong preferences for A- and to a lower degree U-, but fail to recognize G- and C-ending codons24. The relative efficiency for tRNASer(UGA) decoding two consecutive UCU codons at 1.6 μΜ was -10%, while an increase in the isoacceptor concentration to 6.4 μΜ resulted in -70% decoding efficiency (Fig. 12A). This finding can be easily rationalized considering the lack of some post-transcriptional modifications in the tRNA body (including the anticodon loop) leads to either a reduction in affinity towards aaRS or a higher rate of dissociation of the codon-anticodon interaction and/or tRNA accommodation53 . Both of these effects could, at least partially, be compensated by the increase in tRNA concentration.
Surprisingly, t7tRNAs for Val, Pro, Thr, and Ala with most likely unmodified U34) displayed a similar codon-reading pattern to their native counterparts - i.e., these t7tRNAs not only efficiently decoded their cognate-WC A-ending codons, but also to a lower degree the U- and C-ending ones54. Decoding of G-ending codons features strong U34-G3 -mediated recognition for Val and Ala, which lack C34- bearing back-up isoacceptors. This contrasts the inefficient U34-G3 -mediated recognition for Pro and Thr (Fig.4) that is possibly mediated by the cognate-WC isoacceptors.
Native tRNAGly(UCC) differs from other tRNAs decoding unsplit boxes with U in the first anticodon position, in that it carries aminomethyl modifications at U34 (see above), which is characteristic of tRNAs decoding split codon boxes50. T7tRNAGly(UCC) is an exception to the above-described correlation as it effectively decodes C- and G-ending codons despite the existence of C34 isoacceptor for the cognate-WC decoding of the latter.
As mentioned above, decoding of four Arg codons from the unsplit family box in bacteria is unusual because it relies on two isoacceptors, one of which carries an inosine modification more common in eukaryotes. This modification enables decoding of A-, U-, and C-ending codons via base pairing with wobble and WC- geometries, respectively. The unmodified anticodon stem-loop of t7tRNA(ACG) showed almost the same affinity to its cognate-WC codon CGU, but was inefficient in binding to its wobble CGC and CGA codons56. In our study, t7tRNAArg(ACG) could efficiently decode not only U-, but also C-, A-, and, to a lower extent, G- ending codons.
The experiments described thus far demonstrate that the synthetic tRNAs could functionally replace their native counterparts in vitro for 17 amino acids. Importantly, for all tested t7tRNAs, no cross-recognition was observed either for codons from the same family coding different amino acids (Fig. 4, Ser and Arg, Leu and Phe, His and Gin, Asn and Lys) or for synonymous codons belonging to different families with the same mixed codon boxes such as Ser, Arg, and Leu. Analyzing these three amino acids with split codon families joined with unsplit codon boxes is particulary interesting because the former and the latter possess non-overlaping decoding patterns and represent potentially reassignable codons.
Isolation of native tRNAs for Glu, Asn, and Ile from the E.coli native tRNA mixture
Our results demonstrated that the majority of amino acids could be incorporated into protein by using in vitro-transcribed tRNAs. To reconstitute a tRNA mixture capable of supporting translation of proteins containing all 20 canonical amino acids, we needed to efficiently decode codons for Glu, Asn, and He. To this end, we decided to purify native tRNAs specific for these amino acids from the native tRNA mixture by DNA/RNA hybridization chromatography57'58. We tested several immobilization strategies and obtained the best results by coupling 3'- aminated oligonucleotides to NHS-sepharose (Fig. 15). All three specific tRNAs for Glu, Asn and He were successfully obtained at good purity from the native tRNA mixture by selective hybridization with oligonucleotides complementary to the D- loop and the anticodon loop of the target tRNA (Table 3). The tRNAs were eluted from the matrix by thermal denaturation and were shown to be of >90% purity by denaturing PAGE analysis (Fig. 5A).
The functionality of purified native tRNAs for Glu(SUC), Asn(QUU), and Ile(GAU), was tested as described above using templates harboring their cognate- WC or wobble codons. Two templates with consecutive GAA or GAG codons were employed to test the functionality of purified tRNAGlu(SUC), which, as shown in Figure 5B, could efficiently decode both codons. Similarly, the purified native tRNAAsn(QUC) restored the translation of templates harboring either AAU or AAC codons. The purified native tRNAIle(GAU) could only decode AUU codons with 40% efficiency, possibly due to inefficient refolding after denaturation or co- isolation of the under-modified isoacceptor variant.
Semi-synthetic protein translation system
We obtained at least one purified functional tRNA for each of the 20 canonical amino acids. To test whether this simplified tRNA complement could support synthesis of a full-length protein, we synthesized three DNA templates encoding for superfolder GFP(sGFP)59 with variable codon compositions. These templates were designed to exclude codons inefficiently decoded by synthetic tRNAs such as CCU(Pro), UAU(Tyr), CAA(Gln), and AAA(Lys) (Table 4-6). The templates were expressed in tRNA-depleted lysate supplemented with different semi -synthetic tRNA mixtures (Tables 4-6), which supported translation of all three templates with efficiencies comparable to the native tRNA mixture (Fig.6A).
To ensure the sGFP expresion was a direct result of sup-plementation with semi-synthetic tRNAs and to recon-firm the functionality of the individual tRNAs, we formulated tRNA mixtures lacking individual tRNAs. We then analyzed the ability of these mixtures to support synthesis of sGFP templates in a tRNA-depleted cell-free system and observed a reduction in translation ranging from several-fold to orders of magnitude (Fig. 6B). Similar to the results obtained by peptide expression assay, including the t7tRNAs coding for UCG(Ser), CGG and AGG(Arg), UUG(Leu), GGA(Gly), CCA(Pro), ACA(Thr), GUG(Val), AAG(Lys), and UUC(Phe), the semi -synthetic tRNA mixtures restored sGFP expression, thus reconfirming the functionality of the corresponding t7tRNAs. However, in contrast to the RGS-peptide expression profile, residual amounts of native tRNAs for CUA and AGC codons proved to be sufficient for sGFP expression. When only one CUA or AGC codon was present in ORF sequence of the reporter peptide, the presence of t7tRNA(UAG) and t7tRNA(GCU) in the mixture restored peptide expression to 92 and 72%, respectively (Table 2). This inconsistency possibly reflected a higher concentration of peptide transcripts as well as higher turnover rates of peptide translation compared to sGFP. In the former case, the number of elongating complexes were possibly surpassing the number of native tRNAs remaining in the lysate, while in the latter case the same tRNA could be tunneled within the same polysomal unit 7'60. When just one codon was present in the ORF, sGFP ex-pression appeared to be more sensitive to the residual amounts of corresponding native tRNAs in the depleted lysate. Unlike for the CUA and AGC codons, the expres-sion level of sGFP with only one AGG codon per ORF decreased by -90% when t7tRNA for AGG was excluded. This makes AGG the most promising codon for reassign-ment even without further optimising the depletion of native tRNAs.
The observation that full-length protein could be ex-pressed in our cell-free system prompted us to probe the role of tRNA modificaitons in protein translation. As discussed above, even though the majority of tRNAs in our system were synthetic, they could potentially undergo partial editing or modifications in the context of a translationally active lysate.
To test the effect of such putative modifications on the functionality of t7tRNAs, we repeated the above experiment using the reconstituted PURE in vitro translation system, which presumably lacks tRNA processing and modification activities. We found that semi-synthetic tRNAs sustain protein expression - yet, we observed that the relative translation efficiency of the PURE system supplemented with semi-synthetic tRNAs was only 60% compared to the native tRNA complement. This is in contrast to our observation that both native and synthetic tRNA complements performed almost equally well in depleted lysates. On the one hand, this indicates that unmodified synthetic t7tRNAs could sustain protein synthesis. On the other hand, the observed reduction in efficiency may reflect additional post-transcriptional processing of at least some t7tRNAs in the S30 extract, but not in the PURE system. Addressing this issue conclusively would require testing the functionality of individual t7tRNAs in the PURE system. This is not straightforward due to the surprisingly high levels of contaminating native tRNAs (Fig. 7).
Discussion
In this work, we established an approach for the system-atic analysis of individual tRNA functions using an in vitro translation system depleted of endogenous tRNAs. This was achieved by developing a non-radioactive assay to quantify the in vitro expression of a reporter peptide in tRNA-depleted E.coli cell- free translation systems. We demonstrated that the depleted lysate retained more than 60% of the activity of the parental lysate. Although the residual tRNA pool in depleted lysate could not sustain eGFP and RGS-peptide expression, we found that a subset of native tRNAs was not fully depleted. The developed peptide biosensor assay allowed us to estimate the depletion level of tRNA isoacceptors relative to their codons and revealed a correlation between the depletion efficiency of individual tRNAs and their abundance. Importantly, RGS1 -peptide expression was also observed in a fully recombinant E.coli PURE system primed with t7tRNA mixtures lacking individual tRNAs (data not shown). Furthermore, the PURE system assembled without exogeneous tRNAs could support the expression of full- length GFP (Fig. 7), indicating presence of the entire spectrum of contaminating tRNAs. This suggests that residual tRNAs most likely copurify with aaRSs or other components of the translational machinery 16. Therefore, efficient tRNA depletion from in vitro translation systems remains a challange.
To distinguish the activity of t7tRNAs from the endoge-nous tRNA background activity, we utilized the observa-tion that two identical, consecutive testcodons signifi-cantly sensitized the assay to the depletion of specific tRNAs. This enabled us to analyze the functionality of synthetic versions of all 48 E.coli tRNA species in our tRNA-depleted lysate.
Our results demonstrate that most of the synthetic tRNAs were efficient in supporting protein/peptide translation (Figs. 4-7). Furthermore, most of the t7tRNAs corresponding to 2- or 4-fold-degenerate amino acids decoded their cognate-WC codons with high or medium efficiency and their wobble codons with medium or low efficiency (Fig 4). In contrast, the t7tRNAs for Asn, Gln(CAA), Ile(AUC), Glu, and Lys were found to be non-functional in the affinity clamp assay.
Even though we could not exclude the partial editing and modification of synthetic tRNAs in the crude translation system, it appears unlikely that the N34 and N37 modifications, which require the activity of multiple enzymes, would occur efficiently. This notion is supported by the observation that synthesis of He, Glu, and Lys could not be supported by synthetic tRNAs, and accords with previous studies showing that modified nucleotides served as key molecular recognition features for their cognate aaRSs21. It was reported earlier that tRNALys(UUU) lacking modifications outside the anticodon loop undergoes aminoacylation at 140-fold lower efficiency62, yet, conversion of U to C in the first anticodon position restored its activity towards the AAG codon. In addition to Lys(UUU), a number of t7tRNA transcripts or their corresponding anticodon stem-loops such as Arg(UCU), Ala(UGC), Cys(GCA), Glu(UUC), and Gln(UUG) have also failed in the ribosome- mediated codon binding assay 50. With the exception of Glu(UUC) and Gln(UUG), three remaining t7tRNAs were translationally active in the affinity clamp assay. In particular, t7tRNAArg(UCU) demonstrated a 3 -fold higher activity compared to its homolog, which is presumably underrepresented in total native tRNA mix-tures (Fig. 4). Overall, the codon-anticodon interaction matrix depicted in Figure 4 shows highly similar codon recognition patterns between native and t7tRNAs, which are most likely devoid of modifications within anticodon loops. For instance, U34 in the first anticodon position of t7tRNAs decodes not only its cognate A and G, but also U and C in the third codon position with similar reading patterns to that of cmo5U in the native tRNAs for Ser, Leu, and Gly, and with an identical pattern in tRNAs for Val, Pro, Thr, and Ala. From the structural and kinetic data, it appears that the intrinsic stability of the codon-anticodon helix is less important than its proper geometry, which is sensed by the ribosome 63'56'57. These studies thus imply that the net affinity between the codon-anticodon duplex and the ribosome promotes 30S closing around the decoding center, thereby promoting tRNA accommodation and triggering the downstream steps that lead to peptide-bond formation54 . In the current study, the highly mosaic pattern of U34-N3 interactions and the lack of non-cognate cross-recognition in the split codon boxes supports the idea of higher order contextuality in the tRNA body - potentially, an additional check-point for accurate and productive decoding 56'57.
The decoding preferences shown here provide a valuable guide for identifying "orthogonal" vs. "native" codon pairs from the synonymous codons for a particular amino acid. Such pairs can either be created from the codons of different families of 6-fold-degenerate amino acids or from those derived from the unsplit codon family boxes with high wobble restrictions such as Arg, Ser, and Leu and Pro, Thr, and Gly (Table 7). This work suggests that the AGG-codon, for which native tRNA was depleted almost completely, is potentially easier to reassign than all the other codons.
We showed here that all amino acids except Ile, Glu, and Asn could be decoded by synthetic tRNAs, and that native tRNAs for these three amino acids were purified to homogeneity in a functional form. We demonstrated that the tRNA complement reconstituted with synthetic tRNAs and three specific native tRNAs could support in vitro synthesis of sGFP to comparable levels achieved with the native tRNA mixture. Although the full tRNA depletion remains a challenge, our results using the PURE system provide a clue to the origin of the contaminating tRNA pool.
Improved tRNA depletion protocols in combination with semi -synthetic tRNA complements would enable reassigning sense codons in peptides and proteins, thereby significantly expanding the toolbox of synthetic biologists and protein engineers. Further, the developed peptide expression assay in combination with the PURE system enables the impact of individual tRNA modifications on their functionality to be dissected. This should in turn answer a long standing question regarding the extent to which such modifications need to be maintained in the effort to construct the minimal cell64. Finally, the presented approach is not confined to E.coli, and can be transferred onto eukaryotic cell-free expression systems.
Additional Supporting Information
Preparation of 48 t7tRNA transcripts
We used 3-step PCR to prepare two types of DNA templates for tRNA in vitro transcription. First type was assembled by 2 forward (T7, F) and 3 reverse oligonucleotides (Rl, R2, R3) for tRNA species starting with G, U and C (Fig 8 A) while the other type was assembled from 3 forward (T7, Fl, F2) and 3 reverse oligonucleotides for tRNA species starting with A and U to generate a self- processing Hammerhead ribozyme (FIHRz) fusion constructs (Fig SIB)2. Fl primer contained the T7 promoter followed by GGGAGA sequence to reduce the transcription abortion rate, 4-10 bases complementary to 5 '-part of target tRNA and a fragment of FIFIRz-coding sequence. F2 contains FIHRz-coding sequence followed by a segment complementary to 5 '-part of tRNA. Following a 3-step PCR, the products were purified by ethanol precipitation and employed as templates for T7- transcription as described in Materials and Methods in order to obtain the desired tRNAs. Identity of 3' and 5' of t7tRNA transcripts
The generated synthetic tRNAs are expected to contain physiological 3'- hydroxyl group. Depending on the preparation method the 5'- can bear 5'- monophosphate, 5 '-triphosphate, or 5'-hydroxyl groups. The non-physiological 5'- triphosphate may be accepted by aaRS and other translational machinery 67 68 or can be processed to monophosphate in the crude lysate by the endogenous phosphatase activities, such as for instance of RNA pyrophosphohydrolase69 . In the cases where 5'-ribozyme-mediated processing of the transcript was employed, the cleaved products contain 5'-hydroxyl which has been reported not to affect the aminoacylation efficiency for tRNA transcripts of Ser, Met, Phe, Tyr, Asp66. Although 5 of the 48 tRNA genes harbouring "CAT" anticodon are assigned to Met in Genomic tRNA database6, only 3 of them actually code for Met (2 for initiator and one for elongator Met codons) while the remaining 2 code for He according to the sequences from Modomics database71.
Optimisation of the RGS templates for efficient peptide expression
To test the functionality of t7tRNA species for the codons not present in RGS-peptide sequence, the test-codons were initially inserted between the RGS- peptide sequence and the initiation codon. However, the inserted codons in the vicinity of initiator AUG could influence the translation initiation72 thereby complicating the interpretation of the results. Hence we decided to insert one or two invariable "insulator" codons following the start codon to minimise the effect of the downstream codon insertions. For this purpose, we tested four different codons of varying G/C content such as ACC for Thr, AUC for He, GGC for Gly, GAU for Asp and placed one or two of these codons between the AUG start codon and the peptide- coding frame. Among them, the template harbouring two consecutive GAU codons showed the best translation efficiency as evidenced by the affinity clamp assay while there were low or no signal from other templates (Fig 10 A). We conjectured that the peptide-terminal Asp facilitated the peptide release from the ribosome exit tunnel by conferring a net-negative charge to the former73. We constructed several DNA templates with variable codons following the two invariable GAU codons that all performed well in the affinity clamp assay regardless of the codons used (Figure 10B). Therefore, we used this parental template for testing all other codons. Optimization of native tRNA purification strategy
Preparation of the immobilized oligonucleotide matrix
The commonly used strategies for immobilization of oligoDNAs are based on biotin-streptavidin interactions74. However this robust and flexible approach was suboptimal for our purposes due to matrix instability under the denaturing conditions used for tRNA elution. Therefore, we tested immobilization chemistries based on amine-NHS and thiol-iodoacetamide conjugation.
OligoDNAs with 3 '-amine, 3 '-biotin or 3 '-thiol groups were synthesized by IDT. OligoDNAs with 3 '-thiol required reduction before immobilization, which added the complexity to the immobilisation protocol. OligoDNAs functionalized with amine, biotin and thiol at 112, 150 and 55 nmole respectively were immobilized to yield 1ml of the respective settled resins. Due to high cost, complicated protocol and low conjugation efficiency the immobilization via thiol-reaction with iodoacetyl- resin was abandoned. Since the N-hydroxysuccinimide sub-product of amine/NHS conjugation reaction had high absorbance at 260nm and strongly influenced the quantification of unbound OligoDNA, the ratio of bound vs unbound OligoDNA as a measure of conjugation extent was determined by non-denaturing PAGE of the reaction supernatants. tRNA purification
It was reported that tetramethylammonium chloride (TMA-C1) could enchance the formation of tRNA-oligoDNA hybrids75. Therefore, besides the standard hybridization buffer containing 0.9M NaCl we also tested a buffer containing 0.9M TMA-C1. From 100μg of total native tRNA mixture, around 2.25μg of tRNAGlu was purified on the amine-conjugated matrix which corresponded to 1 nmole of immobilized OligoDNA while the yield from streptavidin matrix with oligoDNA immobilized through biotin was approximately 3 -fold lower. In the latter case the eluted tRNA contained a fraction of co-eluted at elevated temperature OligoDNA migrating on the gel below the front of tRNA (marked with asterisk in Figure 15). Therefore, NHS-matrix was used for purifying the desired subset of native tRNAs. The final purification protocol based on the reported method11 was further improved by optimizing the washing steps as described in the corresponding section of Materials and Methods. All native tRNAs from the required subset except tRNAAsp were obtained at a good yield and high purity (Fig. 6).
EXAMPLE 2
Selective depletion of tRNAs using kissing loops Kissing loop (KL) binds GCU Ser isoacceptor with high affinity (5-50nM) through the formation of quasi-continuous double helix stabilized by the common stacking column between the planes of the nucleotide pairs (Fig 16A). E. coli S30 lysate can be to a large extent depleted of total tRNA by the chromatography on ethanolamine sepharose. After the depletion lysate retains -60% of translational efficiency of its parental one if supplemented by commercially available total tRNA fraction (Fig 16 B).
KL-immobilized matrix can be used either for specific tRNA-isoacceptor depletion directly from the crude lysate or indirectly by pulling the isoacceptor out of the total tRNA mixture followed by its reconstitution with all-tRNA depleted lysate (Fig (B)). GFP-synthesis in the reaction prepared using either method demonstrates -100% pausing on the codon-biased template with two-consecutive AGC-codons (Fig 16 C). For this purpose the "kissing loop" coding sequence (upper case) GGTAGTGAGGTAGTTAGCAGATACCTCACTACCaacacacacacaacacacacacaaca cacaagct with the linker (lower case) was cloned downstream the T7 promoter 3'- flanked by the Hindlll site, followed by runoff T7-transcription from the Hindlll digested plasmid. In order to obtain the KL-immobilized matrix, the KL-RNA was oxidized by sodium periodide and conjugated with the adipic acid dihydrazide- agarose beads (Sigma: A0802-50ML) accordingly to the PMID: 14652075. In the first approach two batches of lg of matrix containing ~20-25nmol of KL were incubated repetitively with 2.5ml of crude lysate buffered with 5mM Mg(OAc)2, 25mM HepesKOH (pH7.6), O. lmM EDTA 30 min at RT, followed by buffer exchange on P-10 gel-filtration columns. In the second approach 125mg of KL-beads were repetitively incubated in 200μ1 reaction volume containing 5μ1 of 30mg/ml total E. coli tRNA (Roche: 10109541001) at the same conditions, followed by precipitation of tRNA by ethanol.
It was found that tRNA(Ser)GCU isoacceptor depletion is high, although incomplete - some small tRNA fraction seems to be a part of complexes with either aminoacyl-tRNA synthetases (ARSases) or EF-Tu thus escaping the KL-trap. We attempted to achieve better depletion by undertaking "ARSase recoiling" procedure (see FIG. 17, lower panel). In this approach, translation lysate is incubated with the KL-immobilized resin in the reaction mixture described above but in addition containing 23mM of Mg(0 Ac)2, 5mM of each KOAc and KC1 in the presence of a) excess of counter-isoacceptor (tRNA(Ser)gga) (15μΜ) which is responsible for the decoding of all Ser-codons in codon-biased template except target- AGC (decoded by the isoacceptor being depleted) b) excess of other two substrates of the seryl- aminoacyl-tRNA synthetise (SerRS) such as ATP (20mM) and serine (5mM) as well as c) lmM GDP in order to dissociate the complexes of Aa-tRNA with EF-Tu. Excess of SerRS substrates accelerates the turnover kinetics of the enzyme leading to an effective isoacceptor replacement where the isoacceptor of interest tRNA(Ser)GCU is released and becomes available for KL-trap. While translating Ser-codon biased templates (FIG. 18, upper panel) comprising either no AGC -target codons (4,5tcg"-"; 4,5tcc"-"), 2-consecutive AGC-codons (4,5agc) or single target- codons at different positions (all the rest) lysates undergone "ARSase recoiling" procedure (FIG. 13, 3rd and 4th panels: green and purple bars) display higher tRNA depletion extent as compared to controls for which no "recoiling" was done (FIG. 13, blue and red bars).
EXAMPLE 3
In vitro aminoacylation
In order to carry out site-selective incorporation of uAAs, we initially established three protocols for in vitro tRNA aminoacylation. The first is based on a protocol for CysRS-mediated in vitro aminoacylation of mutant lRNA(Cys). The reactive thiol group enables rapid derivatisation of acylated tRNA(Cys) with a spectrum of maleimide- or iodoacetamide-activated reagents. Incorporation of BODIPY-Cys was obtained through this route into a unique AGG codon of EGFP We have also established pyrrolysine RS (PylRS)-mediated acylation of pyrrolysine cuAtRNA and Flexizyme- mediated tRNA aminoacylation. We demonstrated that we could incorporate Lys ε- amino that has been derivatised by trans-cyclooctene (Lys-COC) into the reassigned Ser AGC codon in an E. coli cell-free system. Importantly, we observed that incorporation of COC into a sense codon has a much smaller impact on protein expression yield compared with amber suppression.
EXAMPLE 4
Cysteinyl tRNA synthase-mediated aminoacylation Cysteinyl-tRNA synthetase (CysRS) has a contact area with the anticodon triplet of tRNA(Cys). Although the affinity of the enzyme towards the mutated tRNA is reduced it still can support high aminoacylation rates at high substrate concentrations in vitro however, we found that such mutant tRNAs were unable to undergo efficient re- acylation in the course of translation reaction due to an insufficient concentration of endogenous CysRS as well as high competing activity of wild type tRNA(Cys). This ensures that only a uAA is incorporated into the growing polypeptide chain.
The anticodon of wt t7tRNACys GCA was changed to either CCU or GCU to match the corresponding Arg - AGG or Ser - AGC codons (see FIG. 19 A). Amber- codon suppressor t7tRNACys with CUA anticodon was used to optimize the aminoacylation conditions by monitoring the fluorescence yield in the translation reaction primed with eGFP-ORF where aspartate codon at position 153 was converted to amber-stop codon. Both t7tRNAs were charged with cysteine by recombinant CysRS in vitro in the reaction containing 50mM HepesKOH (pH 8.0), ImM cysteine or 2mM selenocysteine (Secys), lOmM MgCl2, 5mM of each KOAc and KCl, 4mM ATP, 22.5μΜ tRNA, 10μΜ CysRS, 20% DMSO, 25mM DTT, 5μΜ ZnCl2, O.OOSu/μΙ of yeast inorganic pyrophosphatase and 50ug/ml BSA. Prior to reaction Secys has been reduced from selenocystine (Secis) 30 min at 37°C in the solution containing 40mM Secis, 50mM HepesKOH (pH 8.0), 1M DTT, pH has been brought to 7.5 by lOOmM KOH final. Cysteinylated or selenocysteinylated tRNA (Cys(Secys)-tRNA) was purified by phenol extraction, precipitated by ethanol and either conjugated with iodoacetamide- (maleimide-) compounds of interest in the reaction containing 50mM TrisHCl (pH8.5 or 7.2 for Secys-tRNA), lOOmM NaCl, 75% DMSO, 80uM Cys(Secys)-tRNA and ImM of iodoacetamide or maleimide derivatives or used directly for the recoding of AGG (Arg) and AGC (Ser) codons for cysteine in control reactions (see FIG. 19A). Due to both lower pKaand reduction potential for Selenocysteine residue as compared to cysteine, in the conjugation reaction we could obtain folds of magnitude higher yields of BPFL-tRNA conjugation products resulting in average 25% of original tRNA material taken for aminoacylation being converted to BPFL-Se-tRNA conjugate.
Cysteinylated or selenocysteinylated t7tRNAs bearing CCU-anticodon (cys- tRNA(Cys)ccu) were shown to maintain eGFP biosynthesis in concentration dependent manner in a context of translation reaction reconstituted of both all-tRNA depleted lysate and semi- synthetic tRNA complement lacking t7tRNA(Arg)ccu and primed with eGFP-coding template harbouring single AGG- or TAG-codon (see FIG.19B,D). Addition of non-aminoacylated tRNACysccu (FIG. 19B) failed to maintain eGFP translation causing only marginal effect when the lOuM of tRNACysccu was used compared to background translation in a negative control reaction lacking any AGG-codon suppressors ("Semi- synthetic tRNAs-1" at B). The latter suggests that the pre-translationaly aminoacylated tRNACys with altered anticodon represents a simple orthogonal system.
Cysteinylated tRNACys harbouring grafted GCU-anticodon (Cys- tRNA(Cys)gcu - see FIG. 19 A, C) was shown to effectively suppress two consecutive AGC-codons in a context of translation reaction with the lysate directly depleted from endogenous tRNA(Ser)GCU using KL(FIG. 19C).
EXAMPLE 5
Macrocyclic protein design and testing
As one aspect of this project is to create peptides with intramolecular bonds, we will test several uAAs that allow homo- and hetero-condensation. A summary of one approach is provided in FIG. 20. In the simplest case, we will use Seleno-Cysteine (Se- Cys), which spontaneously forms essentially irreversible diselenium bonds under physiological conditions. The available evidence suggests that it can be charged to tRNA(Cys) by CysRS. We will test the efficiency of Se-Cys into one or multiple codons and analyse the products for spontaneous cyclisation using mass spectroscopy and endopeptidase protection assay. We will then analyse the ability of the developed system to incorporate pairs of mutually orthogonal reactive groups.
We will construct a test mRNA coding for a synthetic 10-mer peptide carrying Ser and Arg codons and a C-terminal affinity clamp tag. Initially, two AGC codons will be included in the mRNA sequence. The construct will be expressed in a cell-free system containing cuAtRNA charged with Se-Cys or amino acids carrying azide and alkyne or more reactive trans-cyclo-octene.
The Se-Cys-containing peptides are expected to cyclise spontaneously, and the extent of reaction will be determined by mass spectrometry. In the case of azide- and alkyne-modified amino acids, catalytic Cu(I) will be added into the translation mixture to induce click reaction and formation of the internal bond. In the case of cyclo-octene, functionalised amino acid cyclisation will be achieved by the addition of reagent featuring two coupled tetrazine groups (Fig. 20E). We synthesised di-tetrazine from commercially available reagents and demonstrated that it can crosslink cyclo-octene- Lys-containing EGFP molecules (Fig. 20G). Subsequently more rigid variants featuring aromatic scaffolds functionalised by tetrazine groups will be synthesised. While the initial experiments will be carried out with reagents containing only two tetrazine groups, subsequent scaffolds with three groups will be developed (Fig. 20F). Such reagents will provide multiple crosslinks and result in highly constrained macrocyclic structures. In a control experiment, a gene lacking reassigned codons will be translated and subjected to identical conditions. The resulting products will be affinity-purified and analysed by LC-MS either in native form or following trypsin digestion to identify the new intermolecular bonds.
We will generate a library of reassigned tRNAs charged with Lys or Cys carrying such groups. Specifically, we will focus on azide- and alkyne-modified amino acids and amino acids modified with trans-cyclooctene and tetrazine. The former groups form a covalent 1,4-regioisomer in the presence of Cu(I), while the latter pair reacts spontaneously to form a heterocycle. A large panel of fluorophores and affinity reagents that can be selectively conjugated to the groups above is commercially available and will be used to assess the efficiency and selectivity of the method.
EXAMPLE 6
Construction and selection of macrocyclic peptides and peptide libraries The technology disclosed herein lays the foundation for construction and selection of macrocyclic peptides. In order to integrate our macrocyclisation approach with a selection system, we will take advantage of RNA or DNA display such asCIS display,. CIS display harnesses the ability of a DNA-binding protein, Rep A, to exclusively bind back to its encoding DNA. The system supports effective library sizes over 1013 and utilises an E.coli cell-free system, which is ideally suitable for our purposes. Alternatively, this may be performed with in vitro assembled viruses or phage.
We will generate two CIS display-compatible libraries for the selection of macrocyclic binders. Our initial 10-mer library will contain available reassigned codons interlaced with tyrosines that are known to mediate the formation of high-affinity proteimprotein interfaces. The second library will be computationally designed to represent 5000 selected, covering all classes of protein folds. The codon usage will be optimised to maximise the occurrence of the reassigned codons in that library. As our initial target, we will select the C H domain of citron kinase, which has been previously identified as a targetable component of the MAP kinase pathway. The libraries cyclised through different codon reassignments will be selected on a recombinant CNH domain, and the outcomes of the selection procedures will be compared using next-generation sequencing. The peptides will then be synthesised in linear and cyclised and used in AlphaScreen and single-molecule coincidence interaction analyses. Eventually, the approach will be tested on the native Phylomer libraries of 108 variants, and the performance of the libraries will be compared by sequencing of the naive and selected libraries.
The proposed program will provide a novel approach for constructing and analysing highly diverse libraries of macrocyclic peptides. It allows large structural post- translational diversification of the resulting peptides without the need to generate a new library. This approach is likely to result in a novel platform for the generation of highly potent bioactive compounds. It will also provide scientists on the team with training in the use of bio-orthogonal chemistry and diversity-based active compound developments.
Table 1 . The t7tRNA complement for RGS1 template. The codons in RGS1 template and the respective t7tRNAs (see Fig S1 for designation) are shown. The final concentrations of initiator(iMcau) 5 and elongator tRNAs in the cell-free translation reaction were 1.6 and 0.8μΜ, respectively. For the tRNAs encoded by 2 genetic variants such as iMcau(d , 2), Tggu(d4, 5) and Vgac(d10, 1 1 ) the polymorphic isoacceptor versions were mixed in ratios corresponding to their genome copy number.
Table 2: The tRNA depletion efficiencies tested using one-codon RGS template. The depletion efficiency (DE.) for specific tRNAs corresponding to their cognate codons (codon) was calculated based on the peptide expression levels in tRNA-depleted lysate programmed by one-codon template and various tRNA mixtures using the formula shown in Fig.1 1 .
Table 3: DNA oligonucleotides (oligoDNAs) used for affinity purification of specific native tRNAs from the total native tRNA mixture. OligoDNAI and oligoDNA2 are complementary to the target tRNA sequences either spanning the D-arm down to the anticodon loop or the acceptor stem down to variable loop, respectively. The 3'-end of the oligonucleotides were modified with amine, biotin or thiol to facilitate their immobilization on the matrix. TEG denotes triethylene glycol.
Table 4 Codon composition of sGFP_Tl and its semi-synthetic tRNA complement
Table 5 Codon composition of sGFP_T2 and its semi-synthetic tRNA complement
Table 6 Codon composition of sGFP_T3 and its semi-synthetic tRNA complement
Tables 4-6 Codon compositions of three templates for sGFP and their corresponding semi-synthetic tRNA complements. The best-performing t7tRNA (for designations see Figure 8) for each codon as well as its ratio (%) in the semi-synthetic tRNA complement are shown. The synthetic tRNALys for AAG codon, Kcuu was constructed by U34 to C34 replacement in the anticodon of Kuuu. The specific native tRNAs for Asn, Glu and lie, marked with asterisk, were used in semi-synthetic tRNA mixture instead of their non-functional t7tRNA counterparts.
Table 7 Potential "orthogonal" vs "native" codon pairs derived from the systematic analysis of specific native tRNA depletion level, t7tRNA's decoding efficiency and their propensity for cross-recognition for split and unsplit codon boxes. The most promising "orthogonal" vs "native" codon pairs include codons from mixed codon family boxes (for Ser, Arg and Leu) as well as the ones from unsplit codon family boxes with high wobble restrictions (for Pro, Thr and Gly). REFERENCES
(1) O'Donoghue, P.; Ling, J.; Wang, Y.-S.; Soil, D. Nat Chem Biol 2013, 9, 594.
(2) Liu, C. C; Schultz, P. G. Annu Rev Biochem 2010, 79, 413.
(3) Hong, S. H.; Ntai, I; Haimovich, A. D.; Kelleher, N. L.; Isaacs, F. J.; Jewett, M. C. ACS Synth Biol 2014, 3, 398.
(4) Wang, Y. S.; Fang, X. Q.; Chen, H. Y.; Wu, B.; Wang, Z. Y. U.; Hilty, C; Liu, W. S. R. Acs Chem Biol 2013, 8, 405.
(5) Albayrak, C; Swartz, J. R. Nucleic Acids Res 2013, 41, 5949.
(6) Kim, J.; Seo, M. H.; Lee, S.; Cho, K.; Yang, A; Woo, K.; Kim, H. S.; Park, H. S. Anal Chem 2013, 85, 1468.
(7) Wu, B.; Wang, Z. Y.; Huang, Y.; Liu, W. S. R. Chembiochem 2012, 13, 1405.
(8) Wang, K. H.; Sachdeva, A; Cox, D. J.; Wilf, N. W.; Lang, K.; Wallace, S.; Mehl, R. A; Chin, J. W. Nat Chem 2014, 6, 393.
(9) Chen, S.; Fahmi, N. E.; Wang, L.; Bhattacharya, C; Benkovic, S. J.; Hecht, S. M. J Am Chem Soc 2013, 135, 12924.
(10) Frankel, A.; Roberts, R. W. RNA 2003, 9, 780.
(11) Kwon, I.; Kirshenbaum, K.; Tirrell, D. A. J Am Chem Soc 2003, 125, 7512.
(12) Link, A. J.; Tirrell, D. A. Methods 2005, 36, 291.
(13) Loscha, K. V.; Herlt, A. J.; Qi, R. H.; Huber, T.; Ozawa, K.; Otting, G. Angew Chem Int Edit 2012, 51, 2243.
(14) Odoi, K. A.; Huang, Y.; Rezenom, Y. H.; Liu, W. R. Plos One 2013, 8, e57035. (15) Ma, C; Kudlicki, W.; Odom, O. W.; Kramer, G.; Hardesty, B. Biochemistry 1993, 32, 7939.
(16) Forster, A. C; Tan, Z. P.; Nalam, M. N. L.; Lin, H. N.; Qu, H.; Cornish, V. W.; Blacklow, S. C. P Natl Acad Sci USA 2003, 100, 6353.
(17) Hipolito, C. J.; Suga, H. Curr Opin Chem Biol 2012, 16, 196.
(18) Grosjean, H.; de Crecy-Lagard, V.; Marck, C. Febs Lett 2010, 584, 252.
(19) El Yacoubi, B.; Bailly, M.; de Crecy-Lagard, V. Annu Rev Genet 2012, 46, 69.
(20) Jackman, J. E.; Alfonzo, J. D. Wiley Interdiscip Rev RNA 2013, 4, 35.
(21) Giege, R.; Sissler, M.; Florentz, C. Nucleic Acids Res 1998, 26, 5017.
(22) Amikura, K.; Sakai, Y.; Asami, S.; Kiga, D. ACS Synth Biol 2014, 3, 140.
(23) Kawahara-Kobayashi, A.; Masuda, A.; Araiso, Y.; Sakai, Y.; Kohda, A.; Uchiyama, M.; Asami, S.; Matsuda, T.; Ishitani, R.; Dohmae, N.; Yokoyama, S.; Kigawa, T.; Nureki, O.; Kiga, D. Nucleic Acids Res 2012, 40, 10576.
(24) Takai, K.; Takaku, H.; Yokoyama, S. Nucleic Acids Res 1996, 24, 2894.
(25) Takai, K.; Takaku, H.; Yokoyama, S. Biochem Biophys Res Commun 1999, 257, 662.
(26) Claesson, C; Samuelsson, T.; Lustig, F.; Boren, T. Febs Lett 1990, 273, 173.
(27) Schwarz, D.; Junge, F.; Durst, F.; Frolich, N.; Schneider, B.; Reckel, S.; Sobhanifar, S.; Dotsch, V.; Bernhard, F. Nat Protoc 2007, 2, 2945.
(28) Jackson, R. J.; Napthine, S.; Brierley, I. RNA 2001, 7, 765.
(29) Chan, P. P.; Lowe, T. M. Nucleic Acids Res 2009, 37, D93. (30) Beckert, B.; Masquida, B. Methods Mol Biol 2011, 703, 29.
(31) Fechter, P.; Rudinger, J.; Giege, R.; Theobald-Dietrich, A. Febs Lett 1998, 436, 99.
(32) Stein, V.; Alexandrov, K. P Natl Acad Sci USA 2014, 111, 15934. (33) Huang, J.; Makabe, K.; Biancalana, M.; Koide, A.; Koide, S. J Mol
Biol 2009, 392, 1221.
(34) Huang, J.; Koide, A; Makabe, K.; Koide, S. P Natl Acad Sci USA 2008, 105, 6578.
(35) Huang, J.; Nagy, S. S.; Koide, A; Rock, R. S.; Koide, S. Biochemistry 2009, 48, 11834.
(36) Dong, H. J.; Nilsson, L.; Kurland, C. G. J Mol Biol 1996, 260, 649.
(37) Rosenberg, A. H.; Goldman, E.; Dunn, J. J.; Studier, F. W.; Zubay, G. J Bacteriol 1993, 175, 716.
(38) Samuelsson, T.; Boren, T.; Johansen, T. I.; Lustig, F. Biol Chem 1988, 263, 13692.
(39) Spenkuch, F.; Motorin, Y.; Helm, M. RNA Biol 2014, 11, 1540.
(40) Kruger, M. K.; Pedersen, S.; Hagervall, T. G.; Sorensen, M. A. J Mol Biol 1998, 284, 621.
(41) Himeno, H.; Hasegawa, T.; Ueda, T.; Watanabe, K.; Miura, K.; Shimizu, M. Nucleic Acids Res 1989, 17, 7855.
(42) Kirino, Y.; Yasukawa, T.; Ohta, S.; Akira, S.; Ishihara, K.; Watanabe, K.; Suzuki, T. Proc Natl Acad Sci U S A 2004, 101, 15070.
(43) Agris, P. F.; Vendeix, F. A.; Graham, W. D. / Mol Biol 2007, 366, 1.
(44) Nureki, O.; Niimi, T.; Muramatsu, T.; Kanno, H.; Kohno, T.; Florentz, C; Giege, R.; Yokoyama, S. J Mol Biol 1994, 236, 710. (45) Sylvers, L. A.; Rogers, K. C; Shimizu, M; Ohtsuka, E.; Soil, D. Biochemistry 1993, 32, 3836.
(46) Shimizu, M.; Asahara, H.; Tamura, K.; Hasegawa, T.; Himeno, H. / Mol Evol 1992, 35, 436. (47) Stuart, J. W.; Gdaniec, Z.; Guenther, R.; Marszalek, M.; Sochacka,
E.; Malkiewicz, A.; Agris, P. F. Biochemistry 2000, 39, 13396.
(48) Sundaram, M; Durant, P. C; Davis, D. R. Biochemistry 2000, 39, 15652.
(49) Serra, M. J.; Turner, D. H. Methods Enzymol 1995, 259, 242. (50) Agris, P. F. Nucleic Acids Res 2004, 32, 223.
(51) Yokoyama, S.; Watanabe, T.; Murao, K.; Ishikura, H.; Yamaizumi, Z.; Nishimura, S.; Miyazawa, T. Proc Natl Acad Sci U S A 1985, 82, 4905.
(52) Yarian, C; Townsend, H.; Czestkowski, W.; Sochacka, E.; Malkiewicz, A. J.; Guenther, R.; Miskiewicz, A.; Agris, P. F. / Biol Chem 2002, 277, 16391.
(53) Wohlgemuth, I.; Pohl, C; Mittelstaet, J.; Konevega, A. L.; Rodnina, M. V. Philos TR Soc B 2011, 366, 2979.
(54) Kothe, U.; Rodnina, M. V. Mol Cell 2007, 25, 167.
(55) Sprinzl, M.; Horn, C; Brown, M.; Ioudovitch, A.; Steinberg, S. Nucleic Acids Res 1998, 26, 148.
(56) Cantara, W. A.; Bilbille, Y.; Kim, J.; Kaiser, R.; Leszczynska, G.; Malkiewicz, A; Agris, P. F. J Mol Biol 2012, 416, 579.
(57) Miyauchi, K.; Ohara, T.; Suzuki, T. Nucleic Acids Res 2007, 35, e24.
(58) Yokogawa, T.; Kitamura, Y.; Nakamura, D.; Ohno, S.; Nishikawa, K. Nucleic Acids Res 2010, 38, e89.
(59) Pedelacq, J. D.; Cabantous, S.; Tran, T.; Terwilliger, T. C; Waldo, G. S. Nat Biotechnol 2006, 24, 1170. (60) Godinic-Mikulcic, V.; Jaric, J.; Greber, B. J.; Franke, V.; Hodnik, V.; Anderluh, G.; Ban, N.; Weygand-Durasevic, I. Nucleic Acids Res 2014, 42, 5191.
(61) Shimizu, Y.; Ueda, T. Methods Mol Biol 2010, 607, 11. (62) Tamura, K.; Himeno, H.; Asahara, H.; Hasegawa, T.; Shimizu, M.
Nucleic Acids Res 1992, 20, 2335.
(63) Ogle, J. M; Murphy, F. V.; Tarry, M. J.; Ramakrishnan, V. Cell 2002, 111, 721.
(64) Forster, A. C; Church, G. M. Mol Syst Biol 2006, 2, 45. (65) Goto, Y.; Katoh, T.; Suga, H. Nat Protoc 2011, 6, 779.
(66) Fechter, P.; Rudinger, J.; Giege, R.; Theobald-Dietrich, A. Febs Lett 1998, 436, 99.
(67) Sampson, J. R. ; Uhlenbeck, O. C. Proc Natl Acad Sci U S A 1988, 85, 1033.
(68) Noren, C. J.; Anthony-Cahill, S. J.; Suich, D. J.; Noren, K. A;
Griffith, M. C; Schultz, P. G. Nucleic Acids Res 1990, 18, 83.
(69) Deana, A.; Celesnik, H.; Belasco, J. G. Nature 2008, 451, 355.
(70) Chan, P. P.; Lowe, T. M. Nucleic Acids Res 2009, 37, D93.
(71) Czerwoniec, A.; Dunin-Horkawicz, S.; Purta, E.; Kaminska, K. H.; Kasprzak, J. M.; Bujnicki, J. M.; Grosjean, H.; Rother, K. Nucleic Acids Res
2009, 37, D118.
(72) Bentele, K.; Saffert, P.; Rauscher, R.; Ignatova, Z.; Bluthgen, N. Mol Syst Biol 2013, 9, 675.
(73) Roberts, R. G. Plos Biol 2013, 11, el001509.
(74) Miyauchi, K.; Ohara, T.; Suzuki, T. Nucleic Acids Res 2007, 35, e24.
(75) Yokogawa, T.; Kitamura, Y.; Nakamura, D.; Ohno, S.; Nishikawa, K. Nucleic Acids Res 2010, 38. EXAMPLE 7
Dual protein labelling via sense codon and amber suppressor codon
Materials and methods
Materials
The non-natural amino acids, BCN (Bicyclo [6.1.0] nonyne - Lysine), TCO* (trans-Cyclooct-2-ene - L - Lysine), TCO (trans-Cyclooctene - Lysine), PrK (N- Propargyl-Lysine), were purchased from Sirius Fine Chemicals SiChem GmbH. AzF (p-azidophenylalanine) was purchased from SynChem. TAMRA DIBO Alkyne were purchased from Life Technologies Australia Pty Ltd. BODIPY® FL Iodoacetamide were from Molecular Probes®. Ethanolamine-Sepharose was prepared by coupling ethanolamine on Epoxy-activated Sepharose 6B (GE Healthcare). The Epoxy- activated sepharose 6B was washed extensively by water (~200ml per gram matrix) to remove the additives and then incubated with 1M ethanolamine at room temperature with gentle agitation overnight. Another wash by water was performed till pH close to 7. The resulted ethanolamine-sepharose matrix was stored as 20% slurry in buffer A (lOOmM KOAc, 25mM NaOAc(pH5.2), 0.25mM EDTA) with 2mM NaN3. 8 g matrix yields 100 ml 20% slurry. Cloning and purification of the orthogonal tRNA Synthetases
The protein sequence for AzFRS is derived from mutation 7 as described earlier39. The protein sequences for PylRS variants, MbBCNRS, MbTCORS 36 and MmPylRSAF 19'29, were obtained from the respective papers. The gBlocks encoding codon optimized ORFs for these proteins containing 6 His-tag at N-terminus was synthesized by IDT and subcloned into Ncol-Notl double digested pOPINE plasmid. Assembly of the digested plasmid and the desired protein gene was achieved by Gibson Assembly® Master Mix (NEB). The correct constructs were identified by sequencing. Protein expression was induced with 0.5mM isfopropyl-P-D- thiogalactopyranoside (IPTG) in Rosetta cells at 20 °C for overnight. AzFRS was purified by Ni2+ affinity chromatography using standard buffer followed by gel filtration on Superdex 200 (GE Healthcare) in PBS buffer. The MbBCNRS and MbTCORS was purified by Ni2+ affinity chromatography using modified binding buffer (50mM sodium phosphate, pH 7.4, 0.5 M NaCl, 5% Glycerol (vol/vol), lOmM MgC12, 0.1% Tween, lmM DTT, 20mM Imidazole) and elution buffer (binding buffer plus 0.5 M imidazole). The protein was further purified by gel filtration and stored in 40 mM Hepes pH7.4, 150 mM NaCl, 10 Mm MgCl2, 10% (vol/vol) glycerol, 0.5 mM TCEP, at -80 °C.
T7tRNA synthesis
The MjYl, MjY2 and MjY3 tRNA are the best three hits identified for AzF incorporation in the earlier publication37 while Mj Y4 tRNA with six mutations was described in a later report38. The sequence alignment of these four tRNAs are shown in SI (Fig 27). The optimized PylT tRNA is a U25C mutant38. The sequence of tRNATyr cua is similar as that of wild type tRNATyr except replacing the "GUC" to "CUA" anticodon. The t7 transcripts for all the above tRNA species were prepared as described before24. Basically, each DNA template, including the normal or transzyme construct, was assembled from 5 or 6 oligos (Table 8) using 3 -step PCR. The PCR products were then purified by ethanol precipitation and used for run-off transcription by T7 RNA polymerase. The transcribed tRNA were purified by affinity chromatography using ethanolamine-sepharose matrix. Specifically, 2ml transcription reaction was adjusted into buffer A condition using 10 times stock. The same volume of 20% matrix as the transcription reaction volume was added and incubated at 4° for overnight. After washing the matrix with 10ml buffer A for 4 times, the tRNAs were eluted with 2ml buffer B, 2M NaOAc (pH5.2), 0.25mM EDTA, 2.5mM Mg(OAc)2, twice and then precipitated by ethanol.
Total tRNA preparation
Total tRNA mixture was isolated from E.coli (Gold) strain by modified Zubay's method59. In brief, the total tRNA was extracted from overnight culture. The cell pellet (20g) was re-suspended in 40ml lOmM Mg(OAc)2, ImM Tris pH7.4 buffer. The nucleoside acids were then extracted by 34.4ml of liquefied phenol with vigorously agitated in cold room for 2 hrs. The extraction was repeated again by adding 10ml liquefied phenol. The aqueous phase was then collected by centrifugation at 18,000g for 30 min. RNA was precipitated with 0.05 volume 4M potassium acetate and 2 volume of 100% ethanol for overnight at -20°C. The precipitate was collected by a 10 min centrifugation at 5,000g and re-suspended in 20ml of 1 M cold NaCl. Stirred vigorously for lh in cold room to disperse the precipitate. The supernatant was collected, and extraction was repeated with 1 M NaCl. The supernatant from the two NaCl extractions was combined and precipitate by addition of 2 vol ethanol. After two repeats the crude tRNA fraction was dissolved in water.
Specific tRNA depletion in total tRNA mixture
The specific tRNA species were depleted by DNA-hybridization chromatography from the total mixture as described24. The DNA oligo which is complementary to the anticodon loop to acceptor stem was designed and synthesized with a 3 '-amine group from IDT (Table 8). These DNA oligos were immobilized on NHS-Activated Sepharose (GE) according to the manufacturer's protocol with ΟμΙ10 of 150μΜ oligo used per 1Ο0μΙ resin. 200μ1 of 5μg/μl unfractionated tRNA mixture was mixed with 2 χ hybridization buffer (20mM Tris-HCl (pH 7.6), 1.8M NaCl, 0.2mM EDTA) of the same volume and then subjected for hybridization with the oligos on the matrix. For each target tRNA, 125 μΐ settled resin with the immobilized oligoDNA was used. The suspension of tRNA mixture and matrix were heat- denatured at 65° for lOmin. After cooling down the sample slowly at room temperature, the non-hybridized tRNAs were collected by centrifugation at slightly less than 400 μΐ. 40μ1 of 1 x hybridization buffer was then used to wash the matrix and combined with the tRNAs collected from last step. All the unbound tRNAs were combined together for ethanol precipitation and dissolved in water. tRNA aminoacylation and fluorophore conjugation
The synthetic cysteine tRNAs with CCU or CUA anticodons were prepared by t7 transcription as described above. Cysteine (Cys) or Selenocysteine (Secys) was charged on these tRNA variants by recombinant cysteinyl-tRNA synthease (CysRS, SI). Firstly, 50mM Cys was pre-incubated with 50mM TCEP at 37°C for 15min in order to convert it to fully reduced form before the aminoacylation reaction. Secys has been reduced from selenocystine (Secis) 30 min at 37°C in the solution containing 40mM Secis, 50mM HepesKOH (pH 8.0), 1M DTT, pH has been brought to 7.5 by lOOmM KOH final. Meatime, tRNAs were denatured at 78° and refolded at 50 μΜ concentration in the presence of 5mM Mg2+ slowly at room temperature to maintain their maximal activity. The aminoacylation reaction was then performed in lOOmM Hepes-KOH (pH8.0), 2mM Cys or Secys, 2mM TCEP or 25mM DTT (for Secys), lOmM MgC12, 5mM KC1, 5mM KOAc,.0.1mM CTP, 4mM ATP, 22.5μΜ t7tRNACys variant, 10 μΜ CysRS, 20%DMSO, 5μΜ ZnCl2, O.OOSu/μΙ of yeast inorganic pyrophosphatase and 50ug/ml BSA at 37° for lh.
After aminoacylation, the reaction mix was diluted 4-fold into l x buffer A for ethanolamine-sepharose purification followed by phenol extraction (residual phenol was removed by 2 subsequent extraction with IV of chlorophorm/isoamyl alchohol (24: 1)) and ethanol precipitation. Conjugation reaction with BODIPY® FL Iodoacetamide (BPFL-IA) was performed in 50mM Tris-HCl (pH8.5 or 7.2 for Secys-tRNA), 80μΜ Cys-tRNA,75% DMSO, ImM BPFL-IA and lOOmM NaCl. Conjugated product (BPFL-tRNA) was precipitated by ethanol and dissolved in a minimal volume of tRNA buffer (0.5mM MgCl2, 0.5mM NaOAc pH5.0). The sample was then adjusted to l x HPLC buffer (0.1M TEAA, 1% ACN) followed purification by FIPLC on POROS® Rl 10 μπι Column (Applied Biosystems) using the following buffers: buffer C is 0.1M TEAA, 1% ACN; buffer D is 0.1M TEAA, 90% ACN, and 9min run duration with 1-20% linear gradient. After HPLC purification, the BPFL-tRNA fraction was precipitated by ethanol, re-suspended in tRNA buffer and stored at -80°.
In vitro protein translation assay
The tRNA-depleted lysate is prepared as described by ethanolamine- sepharose affinity chromatography24. DNA templates with two GFP ORFs: one of optimized codon composition for eGFP (Template A) and the other of simplified codon composition for sGFP (Template B), were used. Mutations to amber or AGG- codon were introduced either by synthesizing the whole gene fragments as gBlocks by IDT to change all the 6 Arg codons to AGG simultaneously or using PCR with the proper primers to introduce mutations with less than 3 nucleotides at the same position. The obtained fragments were cloned into the pLTE or pOPINE-based plasmids following the standard Gibson assembly cloning procedure (NEB). The correct plasmids with desired mutations were purified by Midiprep Kit (Qiagen) to ensure good quality for cell free protein translation. The sequence information of all the open reading frames used here is provided in SI.
The cell-free translation reactions for GFP production were performed following the standard protocol60 with the optimized Mg2+ at lOmM concentration. 0.35 volume of depleted lysate, same as that for the standard S30 lysate, was used in the reaction. Supplementing with other compounds were noted for each experiment. GFP production was monitored on a fluorescence plate reader (Synergy) at 30°C for 3-5 h at 485 nm excitation and 528 nm emission wavelengths.
Protein labeling
Expression of CaM with AzF and BP-FL in cell-free translation reaction: The pOPINE-CaM template, with TAG and AGG codon located at position 1 and 149 of CaM ORF respectively (Fig 27; SI), were supplemented at lOOng/μΙ in the cell-free reaction, which contains 35% (v/v) depleted lysate, depleted tRNA mixture, 10μΜ Μ]Υ2ΐΚΝΑ,10 μΜ AzFRS, ImM AzF; 10μΜ BP-tRNACysccu. The reaction was performed at 32°C for 4h. The 200 μΐ cell-free reaction was dialyzed in 12- 14kDa cutoff dialysis tube against 600ml PBS buffer for 3h twice to get rid of AzF in the translation reaction. After dialysis, the reaction volume increased to 250 μΐ. Add 16μ1 of ImM DIBO-TAMRA in the reaction to make the final concentration to 60 μΜ. The labeling reaction was performed at room temperature for 3hrs.
Purification of labeled CaM on Affinity Clamp matrix: 20 μΐ 50% affinity clamp matrix (see SI) was added to the labelling sample after spinning the reaction mixture at 5000rpm for 2min. The matrix was incubated with the sample for 30min at room temperature. The matrix was washed with 1.5ml PBS-Triton (0.1%) buffer and then with 7.5ml PBS and finally 3.2ml of cleavage buffer (50mM Tris-HCl pH8, 150mM NaCl, ImM DTT). Subsequently 40μ1 Precision protease (0.5mg/ml) was added to the matrix and incubated at 16°C for overnight. The protein was eluted with 2χ75μ1 of cleavage buffer.
Two separate reactions were performed to prepare single labelled CaM protein. To express CaM-BPFL, BPFL charged tRNAccu was supplemented to the cell-free translation system lacking native AGG tRNA species to decode AGG codon while 10μΜ tRNATyrcua was added for decoding UAG codon to Tyr. To obtain CaM-TAMRA, AzF was incorporated into protein sequence through amber suppression with MjY2 and AzFRS into the UAG codon at first position while 5μΜ synthetic tRNAArgccu was supplemented for decoding AGG codon to Arg. The AzF was then modified by DIBO-TAMRA through copper-free click chemistry as described above. smFRET experiment
smFRET experiments were performed in 50mM Tris-HCl (pH 8), 150mM NaCl, ImM DTT with ~100pM of double labeled CaM concentration. Either in the absence and presence of 2mM Ca2+ or lOmM EDTA were recorded in the smFRET experiments. 20μ1 samples, loaded on a home-made silicone plate (SYLGARD®) holding by a 70 χ 80mm coverglass, were used for each experiments. smFRET measurements were carried out at room temperature on the Zeiss LSM 710 microscope equipped with ConfoCor3 module using Apochromat 40x 1.2NA water immersion objective (Zeiss). BP-FL fluorescence was excited by 488 nm laser. Emitted light passed through the pinhole and was splited into donor and acceptor components using a 565 nm dichroic mirror; the donor and acceptor signals were further filtered by 505-540 and 580-610 nm band pass filters, respectively.
The donor and acceptor signal were simultaneously recorded for 30s, 20 repeats with 1ms bin time in each experiments. The data from 3 experiments were combined together to obtain enough events for analysis. The leakage of donor emission into the acceptor channel of free TAMRA dye were estimated in a separate experiment with 20 μΜ fluorophore concentration and calculated as 14% to correct the signals before FRET analysis. A threshold was set at 20 counts for the sum of donor and acceptor signals to filter the background noise out. The FRET efficiency were calculated as [Intensity (acceptor)-leakage from donor channel]/total intensity (Intensity (acceptor)+Intensity(donor)) and plotted as a histogram. Gaussian function was used to fit the data by Origin software (OriginLab Corp.). Results
Creating "AGG" blank codon for nnAA incorporation
We recently demonstrated almost complete depletion of native arginine isoacceptors for AGG codon from E.coli lysate24. We demonstrated that this lysate failed to support the translation of a sfGFP ORF containing a single AGG-codon while addition of synthetic tRNAccu restored its translation. The main drawback of this the original approach is the requirement to formulate a semi-synthetic tRNA mixture from the individual tRNA species. We therefore decided to test an alternative approach where the target tRNA was is selectively depleted from the total native tRNA mixture by DNA-hybridization chromatography25. For this purpose the total tRNA was isolated from BL21(Gold) E.coli strain or obtained commercially. The DNA oligonucleotides complementary to nucleotides of tRNAccu/ucu were used for their chromatographic depletion from the total tRNA mixture. The translation efficiency of tRNA mixtures before and after tRNAccu/ucu depletion were tested by the ability to support translation of GFP templates with one or six AGG codons (Fig 21 and Fig. 27). In the former case, the rest of arginine codons in the total tRNA mixture depleted of AGG-decoding isoacceptors resulted in only negligible background translation observed for 1 AGG template or no detectable translation for 6AGG template (Fig 21 and Fig 27). Supplementing the reactions with t7tRNAccu restored translation at the level comparable to the one provided by total tRNA mixtures before depletion. We defined tRNA depletion efficiency as 1- (RFU (Depl. tRNA)/RFU(Depl. tRNA +t7tRNAccu)). Using this assessment criteria the depletion efficiency for in-house produced tRNA mixtures range from 89% to 94% while for commercially-purchased ones from 62% to 88% calculated based on 1AGG- and 6AGG-templates respectively. In-house produced tRNA mixture was used for all subsequent experiments.
Comparing the efficiency of o-tRNA/aaRS pairs for nnAA incorporation
After demonstrating that AGG codon was freed for reassignment we wanted to identify the best tRNA charging system as well as the suitable nnAAs for AGG- reassignment and dual protein labelling. Therefore we decided to test the ability of the available o-tRNA/aaRS pairs based on to suppress amber codon in the in vitro translation reaction, suppression to find the best tRNA charging system as well as the suitable nnAAs for future combination with AGG-reassignment for dual protein labelling purpose. The recently developed bio-orthogonal reaction between strained alkenes/alkynes and tetrazine, known as inverse electron-demand Diels-Alder cycloaddition, displays the rate constant several orders faster higher than the earlier versions of this reaction26. One of the bioorthgonal reactants, Tetrazine, is a chromophore quencher and its derivated BODIPY probes show more than 1000-fold turn-on fluorescence after conjugation with the protein27, which makes the following removal of unreacted dye much easier and less stringent than the conventional dyes. Therefore, genetic incorporation of strained alkenes/alkynes would be an ideal strategy to achieve fast, selective and "turn on" protein labelling with tetrazine fluorophores. The plasticity of the active site of the PylRS enabled incorporation of a large number of nnAAs into proteins 19,28-35, including strained alkyne and alkene, either BCN, TCO or TCO*(Fig 22A). Three evolved PylRS variants BCNRS36, TCORS36 and PylRSAF19 that feature a number of unique mutations have been reported to mediate incorporation of these nnAAs in vivo. We set out to compare the efficiency of these enzymes towards several substrates in the context of an in vitro translation system.
We tested the recombinant forms of PylRS variants for their ability to support in vitro synthesis of eGFP synthesis from the template containing amber- codon at 151 position (A 151X, SI) in the presence of an evolved o-tRNA harboring U25C mutation in its anticodon stem (PylT)14 and nnAA-substrates BCN, TCO or TCO*. Another nnAA PrK (Fig. 22 A) for also used for azide-coupling known to be accommodated and charged to tRNA by wt MbPylRS30 and he ORF are belonging to CGN codon family box, MmPylRS5, was also tested. Surprisingly, the efficiency of UAG suppression by BCN, TCO and TCO* was very low (Fig 22B). Neither of these large aliphatic alkynes or alkenes could be incorporated by either of three PylRS mutants with efficiency above 5%. BCNRS showed the highest suppression efficiency with BCN and TCO* at 3% and 2%. PylRSAF demonstrated the best suppression efficiency in combination with TCO at 3%. Surprisingly, while BCNRS and TCORS essentially failed to incorporate PrK, PylRSAF charged it with 13% efficiency despite its enlarged amino acid binding pocket designed for the bulky cycloaliphatic groups confirming earlier reports29;. The latter confirms the promiscuity of engineered PylRS variant to various substrates reported in a comprehensive study35
TyrRS from M. jannaschii is another widely used orthogonal tRNA charging enzyme engineered to mediate incorporation of a range of benzyl side-chain analogs including tetrazine derivative at one or multiple sites2'13'22. p-Azido-L-phenylalanine (AzF, Fig 22A) and the respective engineered version of MjTyrRS -AzFRS39 were chosen based on the reports of their successful application for the amber-codon suppression in vivo and in vitro. Among tested substrates AzF showed the best amber-codon incorporation efficiency when used in combination with the flexizyme (eFx) charging system (Fig 29). This indirectly points not only to the high acylation rate but also at the compatibility of the acylated tyrosine-analog with the EF-Tu. The importance of the latter as rate limiting step in nnAA incorporation is often underestimated. Several optimized o-tRNAs were evolved for AzFRS in in vivo selection campaigns thus we decided to compare their activity in vitro. We found the MjY2 to support AzF incorporation with highest efficiency of 81% (Fig 22C). It performed slightly better than MjY4 and 1.8 and 4.6 times more efficient than MjYl and MjY3, respectively. Although MjYl displayed the best performance in the selection experiments37, was less efficient compared to MjY2 in our assay.
Following the individual characterization we compared MjY2/ AzFRS/ AzF and PylT/PylRSAF/PrK systematically. Firstly, the o-tRNA and aaRS were titrated into the translation reaction to determine the effect of their concentration on eGFP expression yield from the template harbouring amber codon at 151 position (A_151X). When tRNA concentration was kept constant at 20 μΜ, the GFP yield increased with AzFRS concentration up to 10 μΜ, while for PylRS it did not saturate even at 30μΜ (Fig 22D). When the concentrations of AzFRS or PylRS were kept constant at 20μΜ and 30uM, respectively, the protein yield reached plateau at 5-10 μΜ of MjY2 tRNA or 20μΜ of PylT tRNA and declined at higher concentrations of both (Fig 23 A). The o-tRNA concentrations supporting half maximum protein yield were 1.5μΜ and 8 μΜ for MjY2tRNA and PylT, respectively. The maximal yield for MjY system reached 8570RFU with 20 μΜ of MjY2 tRNA and 10 μΜ of AzFRS while 30μΜ of both PylRSAF and PylT could support the GFP translation only to 43% of the level achieved with MjTyrRS system.
As the suppression efficiency at amber-codon is context dependence three additional GFP-coding ORFs with single TAG codon located at different positions were designed and GFP yields between two suppression systems were compared (Fig 22D). The reactions lacking either nnAA-substrate, o-tRNA or enzyme were used to assess the level of non-specific suppression (Fig 30; SI). E. coli T7-transcribed tyrosine tRNA with grafted CUA anticodon (EctRNATyr(cua)) known for its efficient amber codon suppression was used as a positive control. The relative activity provided by o-systems were calculated as the percentages of fluorescence in positive control (Fig 23E).
As shown in Fig 22E, MjY system consistently outperformed PylT system in
TAG codon suppression regardless of the template context. For the template subset A the relative suppression efficiencies in both systems were found to be consistently higher for the proximal TAG-codon (position 1). Surprisingly, for the B subset, the position preference has reversed favoring the distal (position 151) over proximal amber-codon which for PylRS o-system indicated no suppression at all (Fig 23B). Overall, the average activity of MjY o-system as compared to PylRS was 1.2-3 folds higher (without taking into account the failure of PylRS system in some case) and much less context-dependent (Fig 22E).
Reassigning AGG codon to AzF
Our previous analysis findings indicateddemonstrate that the orthogonal MjY tRNA charging o-system mediated mediates high level of AzF incorporation at amber-codon. MjTyrRS missing is lacking a major anticodon-binding domain suggested indicating that the anticodon triplets were are not essential for efficient tRNA recognition^. However converting G to C in the first anticodon position (amber suppressor) or mutating all three anticodon nucleotides (ATG-suppressor) were reported to cause result in around 100 and 900-fold loss in aminoacylation efficiency, respectively 40. Since the Amber amber suppressor constructed based on Mj o-tRNA gave high suppressionis very efficiencyefficient, we decided to change its anticodon to test its corresponding AGG-codon suppressor by changing the anticodon to CCU thereby targeting it to AGG codon while which could potentially creating a requirement for much higher o-tRNA/enzyme concentrations in the charging reaction.
We set out to evaluate the possibility of reassigning AGG codon to AzF by combining the lysate lacking isoacceptors for AGG codon with MjY2(ccu) /AzFRS and AzF, we set out to evaluate the possibility of reassigning AGG codon to AzF. To this end we converted the single amber-codon into AGG in both codon-biased template subsets A and B (SI) while the remaining arginines in the ORF were encoded by the CGN family codons family for simultaneous monitoring of context effects (Fig 23 and SI for sequence information). The depletion degrees of native AGG isoacceptors for A 151R, A IR, B 151R, B 1R were found to be 75%, 80%, 93% and 84%, respectively (Equation 1). For the 151R and 1R supplementation of the reaction with MjY2(ccu)/ AzFRS resulted in 4.2 and 5.2-fold increase in fluorescence for A subset whileand 18.4 and 7.2-fold increase for B subsets. This indicated indicats that more than 80% of GFP protein was modified with AzF in all cases. Mass spectroscopy analysis of the translational products demonstrated that most of the protein had AzF incorporated at the AGG-defined position with very negligiblea minor fraction harboring Arg at this site (Fig 32B-C). Surprisingly even though GUA=>CCU conversion results in an anticodon different from the wt at every position and leads to a likely loss of a hydrogen bond with changing U to C3541 the AGG-suppressor here maintained high suppression activity as its amber suppressor counterpart.
Genetic encoding of Bodipy-FL nnAA derivative
The successful reassignment of AGG to AzF by MjY o-system provided us with a second orthogonal codon which oncethat could be combined with UAG could potentially be used for doubletwo-site incorporation of nnAAs. However, the choice of the second nnAA chemically orthogonal to AzF is problematic due to the low incorporation efficiency of strained alkynes and alkenes and cross-reactivity between PrK as an alternative click-chemistry tag and AzF. Therefore, we chose to tested a new strategy that combines both direct incorporation of a fluorescent nnAA and a click-chemistry compatible nnAA-tag for further conjugation with a FRET-forming fluorophore. Such "pseudo-one-pot" labelling approach implying only with only one post-translational conjugation/purificationderivatisation step would significantly simplify the entire is significantly simpler all previously published dual labeling procedures.
Due to their size the Fluorophorefluorophore-bearing amino acid analogs can hardly be aminoacylated by aaRS with low efficiency precluding their co- translational useco-translationally due to size limitations. Therefore co-translational supplementing supplementation of pre-charged tRNAs pre-charged with fluorescent amino acid is necessaryprovides an alternative approach. Several strategies have were developed for pre-charging tRNA with the nnAAs. One involves ligation of chemically prepared aminoacylated dinucleotide to a truncated tRNA lacking 3 '-CA dinucleotide42. This method involving multi-step protocols is technically challenging. In an alternative approach flexizyme, a tRNA acylation ribozyme, was developed to charge nnAAs on tRNAs in vitro43. Although in principle this approach is straightforward, its relies on multi-step chemical synthesis and the charging efficiency varies significantly towards different nnAAs and It is expensive as multi-step chemical synthesis that requires a copious amount of fluorescent dye and the dye bulkiness can likely cause steric hindrance preventing the correct orientation of the reactive groups. Another approach involves functional group coupling to the enzymatically aminoacylated tRNA through the reactive amino acid side chain such as a sulfhydryl group of cysteine44 or ε-amino group of lysine residues45. We chose to use cysteine residue as the conjugation tag providing theas its modification results in the shortest aliphatic spacer as well as lack of editing domains in its corresponding cysteinyl-tRNA synthetase (CysRS) 46'47.
Out of a wide range of commercially available sulfhydryl-reactive fluorescent compounds we chose to use the smallest Bodipy FL fluorophore (BPFL) iodoacetamide. As improper accommodation of esterified nnAA by EF-Tu or its engineered forms quite often poses a barrier for its efficient incorporation either at the level of ternary complex formation or dissociation of nnAA-tRNA on the ribosome48, thermodynamic compensation hypothesis demands compatibility between tRNA-body and esterified amino acids for productive incorporation49. We therefore performed in silico analysis of EF-Tu structure to establish the acceptiable liker length and fluorophore size. For instance while the commercially available BPFL attached to tRNA(Lys) amino-ester backbone through the 8-mer spacer performed visually well in protein labelling, the affinity for EF-Tu of otherwise identical BPFL-pyrrolyl analog was 30-fold lower than of wt Lys-tRNA(Lys)48. The efficiency of incorporation of the biotin attached through 17-mer spacer could be rescued by swapping to tRNA(Ala) body tightly binding EF-Tu50. As it seemed difficult from above to predict how ring size and spacer length would influence binding of esterified nnAA to EF-Tu we set out to roughly estimate the capacity of EF-Tu towards accommodating the BPFL/cysteinyl-tRNA conjugate where 5-mer spacer separates BPFL ring from the amino-ester backbone (Fig 32, SI). In line with this, we manually fitted BPFL in the place of Trp into the known structure51 adjusting the spacer length to 5-mer as well (Fig 33, SI). In the obtained model BPFL was occupying the pocket without any significant steric clashes in a slightly different orientation as Trp, and moreover there seemed to remain some room for spacer extension. Even though, from the model BPFL-cysteine derivative seemed most likely to be accommodated by EFTu at least to some extent thus contributing some negative free binding energy, this energy is very hard to rank relatively to Cys itself or aromatic amino acid residues whose distribution by affinity is very broad 52'53. Therefore for conjugation with BPFL we chose to keep wt T-stem and natural affinity of tRNA(Cys) to EFTu ranging dependent on used algorithm from moderate to tight reciprocally compensating weak to moderate binding of Cys. t7tRNA(Cys) variants harboring either CUA or CCU anticodons were aminoacylated and conjugated to BPFL and yielding BPFL-cys-tRNA and the conjugation products were then purified by FIPLC at with -15-20% final yield (Fig 24 A). Next we supplemented introduced the purified BP-cys-tRNAccu in the cell freeinto in vitro translation mixture lacking isoacceptors for AGGreaction with semisynthetic t7tRNA mixture lacking the respective isoacceptors for co-translational single-site protein labelling via AGG-suppression using sGFP_T2 template24. The reaction was primed by eGFP template with a single AGG codon and the The yield of labelled protein versus total protein produced in both undepleted "parental" lysate and tRNA-depleted lysate programmed by different tRNA mixtures (Fig 24B) was compared. The yield of labelled protein was increased 1.4 times while the relative labelling efficiency was 10 times higher in tRNA-reconstituted system as compared to wt lysate (Fig 24B, lane 3 and 4 with BP-tRNA). The BPFL-tRNA less favorably competes with the native tRNA for decoding the AGG codon in normal lysate due to the presence of the native AGG-isoacceptors even though they are in low abundance abundant in the native tRNA pool54. Almost no sGFP was produced in the cell-free system with semi- synthetic t7tRNA complement lacking the AGG isoacceptor (Fig 24B, lane 3 without BP-tRNA). The expression of sGFP could be restored upon addition of BPFL-Cys-tRNAccu, indicating that virtually all expressed polypeptide incorporated BP-fluorophore. We concluded that BP-FL charged tRNA was compatible with the host translational machinery including both the elongation factor and the ribosome. Cys-tRNAccu discharged from nnAA during translation underwent negligible co-translational recharging with cysteine (Fig 34, SI). The system's orthogonality is probably due to relatively low concentration of endogenous CysRS and highly reduced kcat/Km of the AGG-suppressor entailing resulting in unfavorable competition with endogeneousendogenous wt tRNA(Cys) since CysRS relies on anticodon (in particular: G35C36) as is an important identity element in tRNA recognition by CysRS recognition47.
We compared Amber amber and AGG codon-mediated BP-FL incorporation efficiency by using on four templates, B_1X(151X) and B_1R(151R), harboring either single amber or AGG codon at the 1st and 151st position of GFP ORF (Fig 24C, SI for detailed discussion). The translation reactions reconstituted of from tRNA depleted lysate and total tRNA mixture lacking AGG isoacceptors were supplemented with purified BPFL-cys-tRNAs suppressors and primed with their respective templates. AGG suppression gave 1.8 and 4 times consistently higher BP- FL incorporation, 1.8 and 4 times on the 1st and 151st position respectively, than amber suppression. This indicates the lesslow competition from the native tRNA isoacceptors for AGG codon compared to that of release factor for mediated translation termination on amber codon. We concluded that BP-FL charged tRNA was more compatible with AGG in the codon contexts we tested here.
Dual protein labelling via combination of AGG and amber codon reassignment
As described in the introduction the current strategies for site-specific dual protein labeling with the FRET-forming dye pair rely on introduction of two bio- orthogonal groups which are genetically incorporated into the protein sequence followed by two respective conjugation reactions to another groups delivering the FRET forming fluorophores7'19. The requirement for carefully control reactivity of the functional groups in these nnAAs and fluorophores makes this approach technically challenging. Since BP-FL could be incorporated into protein sequence co-translationally, installation of the 2nd fluorophore would become more straightforward without manywith little restrictions in the choice of the second genetically encoded nnAAs. We tested this approach by synthesizing Calmodulin (CaM), a regulator protein of cellular functions, with a bio-orthogonal reactive group (AzF) and fluorophore-b earing aminoacid (BPFL-Cys) installed at 1st and 149th position via amber- and AGG-codon reassignment respectively. TAMRA, a that forms a FRET forming dye with pair with BPFL, was then introduced into protein directly via copper-free click chemistry. This reaction can be processed carried out either on pure the protein or in the cell-free reaction context and avoid the side effect of protein aggregation or oxidation caused by metal catalyst which was required in the copper-catalyzed azide-alkyne huisgen cycloaddition (CuAAC). Fluorescence gel scanning demonstrates confirned successful installation of two FRET probes in CaM protein (Fig 25A, first lane).
Excitation at 488nm of double labelled CaM revealed two distinct peaks on in the fluorescence emission spectra (Fig 25B). The 512nm peak corresponds to emission of BP-FL while the other peak at 575nm reflects emission of TAMRA. In contrast, CaM proteins monolabled with BP-FL or TAMRA show low emission at 575nm in their fluorescence emission spectra when excited at 488nm. The concentration of CaM protein single-labelled with TAMRA single-labelled CaM protein was pre-adjusted to equalize its maximum emission fluorescence to that of double labelled protein when excited at 543nm (acceptor excitation wavelength). When both samples were excited at 488nm, the emission fluorescence at 575nm of double labeled protein was much higher than that of TAMRA single-labelled protein. This indicates the energy transfer from donor fluorophore BP-FL to acceptor fluorophore TAMRA in double labeled CaM and confirms the successful double labelling.
To demonstrate the application of smFRET in protein conformational change analysis, we titration the dual labelled CaM protein with Ca2+ and EDTA (Fig 25D- F). The dual-labelled CaM was purified from the cell free translation in a buffer condition without Ca2+. Its smFRET histogram shows two peaks, one is centered at 0.2 while the other at 0.55. They represent two conformations in the purified sample which we assume one is in Ca2+-free and the other in Ca2+-binding form. The cell- free expressed CaM is probably contaminated with trace amount of calcium and triggered the conformational change of some CaM protein in the sample. After adding 2mM Ca2+ in the sample, the second peak disappeared and emerged with the first one. This confirmed that the first peak at around 0.2 is the calcium bound form. When adding EDTA in the sample, the first peak decreased obviously which indicated some Ca2+ was stripped from the CaM protein. This data is consistent with the structural information that the two fluorophores in the 1st and 149th position of CaM are closer in Ca2+-free form (high FRET efficiency) than Ca2+-binding form (Fig 25C).
Discussion
We describe here aa new strategy for reassigning Arg AGG sense codon to an uAA in E.coli in vitro translation system. To achieve that we took advantage of the recently developed E.coli translation system depleted of the endogenous tRNAs24. We now developed novel procedure for removing selected tRNAs from the total tRNA mixture by DNA-hybridization chromatography. Unlike the previously reported reconstitution approach using semi- synthetic tRNA complement, the developed tRNA-depletion method is straightforward and efficient. We were able to achieve almost complete depletion of the native isoacceptors for AGG codon making it suitable for reassignment. Without tRNAccu supplementation, no protein translation was observed using GFP template with 6 AGG codons while only minimal GFP expression was observed on the template containing one 1 AGG codon template. Upon addition of synthetic tRNAccu, the GFP protein expression increased to the levels comparable to that of the wild type system. This validates sense codon reassignment strategy and opens up a way for creation of potentially large number of new orthogonal codons.
The open nature of cell-free translation system enables the direct control over the concentrations and the identities of its components. We took advantage of this feature to compare several orthogonal tRNA/aaRS systems including Pyl and MjTyr system in their ability to support incorporation of nnAAs into in vitro translated protein. We evaluated several reported PylRS variants by their ability to mediate incorporation of nnAAs including BCN, TCO, TCO* and PrK. We were particularly interested in the first three non-natural amino acids due to their high reactivity and bioorthogonality26. Surprisingly, none of them appeared to be good substrates for the tested PylRS variants. These results revealed an unexpected inconsistency with the in vivo data on UAG suppression where efficient incorporation of these nnAAs was confirmed by MS analysis19'36. In contrast, PylRSAF could efficiently decode UAG codon with PrK with relatively high efficiency and can be further modified through copper-catalysed click chemistry. This indicates that the aminoacyl-tRNA synthetases evolved by in vivo selection may not be optimal especially for thesefor large aliphatic alkynes or alkenes. PylRS variants in general are multi- substrate enzymes with high degree of substrate-induced inter-domain dynamics rearrangements, therefore Therefore mutagenesis of the substrate binding pocket can on another hand entailmay result in reduction of overall amino-acylation kinetic by several hundred fold35. We observed precipitation of these PylRS based enzymes during the purification step. The instability of these PylRS variants in buffer conditions causes an extra barrier for in vitro application although magnesium, high concentration salt and glycerol could help maintain these proteins in soluble form to some extent. This is consistent with some in vivo data which suggested PylRS were poorly expressed, prone to misfolding and required optimizations of codon usage and expression conditions in E.coli for nnAA incorporation14.
When analysing MjTyr system we found that MjY2 was best most efficient in coding AzF functionalities, although the MjYl was screened identified as the most efficient in vivo31 and MjY4(tRNAOptCUA) was employed in the most recent work38. The evolutionary pressure ensures that in the native system all aa-tRNAs show similar affinity towards elongation factor (EF-Tu) by combining amino acid side chains with different tRNA bodies49'55. Therefore, in order to achieve the best nnAA incorporation efficiency, it is desirable to optimize the wild type o-tRNA sequence to work in concert with the chosen target nnAAs to achieve optimal affinity to EF-Tu.
Further, we compared the amber codon context on decoding efficiency by the best combinations of two orthogonal translational systems, MjY2/AzFRS/AzF and PylT/PylRSAF/PrK. MjTyr system performed consistently better than Pyl system in all the four codon contexts we tested here. The relative efficiency of MjTyr system ranged from 55% to 97% in decoding UAG codon. In contrast, the suppression efficiency of PylT/PylRS/PrK varied and in some cases failed to mediate GFP translation. These results are consistent with the previous findings that some positions of ORFs are suppressed easier than others56'57 and indicate that context effect is reduced when highly efficient o-aaRS/tRNA pairs are used.
High orthogonality of heterogeneous tRNA/aaRS/nnAA is a key issue determining the specificity and fidelity of codon reassignment. Our results demonstrated that orthogonality of Pyl suppression system is higher than that of MjY system in E.coli (Fig 30) as in the latter case we observed incorporation of the canonical aromatic amino acids, Tyr, Phe, Trp in the absence of AzF. However, after supplementing AzF in translation system, the canonical amino acid mis- incorporation became negligible (Fig 31) suggesting that the MjTyrRS optimized for a specific nnAA had low efficiency in accepting other substrates. Although broad substrate specificity has advantages for incorporation of nnAAs with similar structures, it also increases misincorporation when more than one nnAAs needs to be incorporated. The ratio of each matured tRNAs and their cognate aaRSs are evolutionary balanced to ensure the translational fidelity and efficiency.
We demonstrated MjY suppression system not confined to amber suppression but is also well compatible for with AGG-reassignment to AzF when combined with our newly developed cell free system lacking the AGG-native isoacceptors.The low sensitivity of MjTyrRS to the tRNA anticodon triplets of MjTyrRS enables its future use for reassigning reassignment to other sense codons. Besides AzF, AGG codon could be reassigned to BP-FL fluorophore directly, which would significantly simplify the labelling procedure, by using precharged BPFL- Cys-tRNAccu. The discharged tRNAccu was is poor substrate of CysRS due to the altered anticodon and underwent negligible co-translational recharging with cysteine. This maintained maintaines the system's fidelity. Further optimization of the tRNA body in the context of esterified BPFL-Cys for interaction withsequence to enhance its compatibility with the esterified BPFL-Cys to be better accommodated by EF-Tu would increase the decoding efficiency.
We took advantage of the above described observations to develop a new approach for construction of for site-selective proteins protein labelled labelling with two FRET-forming probes. To avoid difficulties associated with balancing the selectivity of two labelling reactions We we decided to incorporate one fluorophore co-translationally in the protein sequence to avoid difficulties associated with balancing the selectivity of two labelling reactions. We combined the most efficient MjTyr suppression system with the BPFL-pre-charged tRNA to reassign amber and AGG codon, respectively. Followed by copper-free click chemistry, TAMRA dye was further installed into protein sequence by copper-free click chemistry through the reaction with azido-group accomplished within several minutes. By using this strategy, we site-specifically installed BP-FL and TAMRA into calmodulin protein. Single molecule FRET analysis shows dramatically change of its conformation upon calcium binding to calcium confirming the efficient and site selective dye incorporation. The developed approach potentially allows creation of large number of orthogonal codons and their modification with versatile functional groups. Furthermore this approach can be directly transferred to eukaryotic cell-free systems. This sets our approach apart from methods based on the use of fully reconstituted in vitro translation systems such as PURE system which although being relatively easily produced for prokaryotic translational machinery brings in almost unmanageable complexity when transferred to eukaryotic systems. Yet our recent analysis demonstrated that E.coli cell-free system could express only 10% of human cytosolic proteins in non- aggregated form while eukaryotic systems performed much better58. Therefore transferring our approach onto a eukaryotic system would enable smFRET analysis of complex multidomain eukaryotic proteins and protein complexes currently poorly accessible to this method. SUPPLEMENTARY INFORMATION (SI)
Nucleotide sequences encoding proteins
(1) Temple A (eGFP template with GenBank number of KJ541667.1, based on pLTE vector) ATG ACAG TAATGTATAAAG TCTGTAAAG ACATTAAACACG TAAGTG AAACCATG G AG ATCXXXTCG AGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAA CGG CCACAAG TTCAG CGTGTCCG G CG AG G G CG AG G G CG ATG CCACCTACG G CAAG CTG ACCCTG A AGTTCATaGCACCACCGGCAAGCTGCCCGTGCCaGGCCCACCCTCGTGACCACCaGACCTACGG CGTG CAGTGCTTCAG CCG CTACCCCG ACCACATG AAG CAG CACG ACTTCTTCAAGTCCG CCATG CCC G AAG G CT ACG TCCAG G AG CG CACCATCTTCTTC AAG G ACG ACG G CAACTACAAG ACCCG CG CCG A G GTG ,AAG TTCG AG G G CG AC ACCCTG G TG AACCG CATCG AG CTG AAG G G CATCG ACTTC AAG G AG G ACG G C AAC ATCCTG G G G C AC AAG CTG G AGTACAACT ACAACAG CC ACAACG TCTATATCATG G CCG ACAAG CAG AAG AACG G CATCAAG GTG AACTTCAAG ATCCG CCACAACATCG AG G ACG G CAG CGTG CAG CTCG CCG ACC ACTACCAGC AG AACACCCCCATCG GCG ACGG CCCCGTG CTG CTG CCCG ACAAC CACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTG CTGGAGTTCGTGACCGCCGCCGGGATCAaCTCGGCATGGACGAGCTATACAAGGAGCAGAAGCT G ATCTCG G AG G AG G ATCTG CAAG CTTGTCG ACCTCTAG AG G ATCCCCG G G G CTAA
Template A contains SITS protein, eGFP construct and myc tag from N- to C-term. it is used as a parental template to prepare the following derivatives:
(a) GFP with 6AGG codons (Ail 6 Arg codons in this construct are changed to AGG);
(b) A. 1X: TAG codon was introduced at the N-term of eGFP construct (the 1st red codon)
(c) A_151X: TAT(Tyr codon) was changed to TAG codon at the 151st position of eGFP construct (the 2nd red codon)
(d) A_1R: AGG codon was introduced at the N-term of eGFP construct (the 1st red codon)
(e) A__151R: TAT(Tyr codon) was changed to AGG codon at the 15.1st position of eGFP construct (the 2rId red codon)
(2) Template B (sGFP template, based on pOPINE vector with GenBank number of
EF372397.1).)
ATG AC AG AAC A G AAG TTG ATCTCG G AAG AAG ATTTG XXXTCG AAG G G AG AAG AATTG TTTAC AG G AGTGGTGCCAATCTTGGTGGAATTGGACGGAGATGTGAACGGACACAAGTTCTCGGTGCGTGGAG AAGGAGAAGGAGACGCGACAAACGGAAAGTTGACATTGAAGTTCATCTGCACAACAGGAAAGTTG CCAGTG CCATG G CCAACATTG GTG ACAACATTG ACATACGG AGTG CAGTG CTTTTCG CGTTACCCAG ATCACATGAAGCGTCATGACTTCTTCAAGTCGGCGATG CCAGAAGGATACGTGCAGGAACGTACAA TCTCG TTCAAG G ACG ACG G AACATAC AAG AC ACG TG CG G AAGTG AAG TTCG AAG G AG ACACATTG GTG AATC G TATTG AATTG A AG G G AATC G ACTTC AAG G AG G ATG G AAAC ATTTTG GGACACAAGTTG G AGTACAACTTCAACTCG C AC AACG TG XXX ATCAC AG CGG ACAAG CAG AAG AACG G AATCAAG G C
GAACTTCAAGATTCGTCACAACGTGGAGGACGGATCGGTGCAGTTGGCGGATCACTACCAGCAGA ATACACCAATTGGAGATGGACCAGTGTTGTTGCCAGACAATCACTACTTGTCGACACAGTCGGTGTT GTCGAAGGACCCAAACGAAAAGCGTGACCACATGGTGTTGTTGGAATTTGTGACAGCGGCGGGAA TTACACATG G AATG G ACG AATTG TAC AAG G G AG G ATTG G AG GTGTTG TTCCAG G G ACCAG G ACGT G G ATCG ATCG ACACATG G GTGTG ATG ATG A
Template B contains myc tag, sGFP construct, prescission cleavage site and RGS peptide tag from !S!- to C-term. it is used as a parental template to prepare the following derivatives:
(a) B__1X: TAG codon was Introduced at the N-term of sGFP construct (the 1st red codon)
(b) B__151X: TATJTyr codon) was changed to TAG codon at the 151st position of sGFP construct (the 2nd red codon)
}c) b_lR: AGG codon was introduced at the N-term of sG FP construct (the 1st red codon) (d) B__151R: TAT{Tyr codon) was changed to AGG codon at the 151st position of sGFP construct (the 2"d red codon (3) sGFP_T2
ATGTCGAAGGGAGAAGAATTGTTCACAGGAGTGGTGCCAATCTTGGTGGAATTGGACGGAGATGT GAACGGACACAAGTTCTCGGTGCGGGGAGAAGGAGAAGGAGACGCGACAAACGGAAAGTTGACA TTGAAGTTCATCTGCACAACAGGAAAGTTGCCAGTGCCATGGCCAACATTGGTGACAACATTGACA TACG G AGTG CAG TG CTTTTCG CG GTACCCAG ATCACATG AAG CG G CATG ACTTCTTC AAG TCG G CG ATG CC AG AAG G ATACGTG CAG G AACG G ACAATCTCG TTCAAG G ACG ACG G AACATACAAG ACAAG
GGCGGAAGTGAAGTTCGAAGG AG ACACATTGGTGAATCGG ATTG AATTG AAGGGAATCGACTTCA AG G AGG ATGG AAAC ATTTTG G G ACAC AAGTTG G AGTACAACTTC AACAG CCACAACGTGTACATCA CAG CG G ACAAG CAG AAG AACG G AATCAAG G CG AACTTCAAG ATTCG G CACAACGTG G AG G ACG G ATCG G TG CAGTTG G CG G ATCACTACC AG CAG AATACACCAATTG G AG ATG G ACCAGTGTTGTTG CC AGACAATCACTACTTGTCGACACAGTCGGTGTTGTCGAAGGACCCAAACGAAAAGCGGGACCACAT G GTG CT ATTG G AATTTGTG AC AG CG G CG G G AATTACACATG G AATG G ACG AATTG TACAAG
Template SGFP T21 only contains open reading frame for sGFP protein. Arginines in this protein are encoded by AGG codon at 108 position (shown in red) while the rest of them are by CGG codon.
(4) CaM
ATG G.A ACAG AAG CTG ATTTCCG AAG AGG ATCTG G G ATAGG ATCAG CTG ACG G AAG AG CAG ATCG C GGAATTCAAGGAAGCGTTCTCCCTGTTCGACAAGGACGGAGACGGAACGATTACGACGAAGGAAC TGGGAACGGTGATGCGTTCCCTGGGACAGAATCCGACGGAAGCGGAGCTGCAGGACATGATCAAC G AAGTG G ATG CG G ACG G A AACG G AACG ATTG ACTTCCCG G AATTCCTG ACG ATG ATG G CG CGTAA
GATGAAGGATACGGACTCCG AAG AGG AAATCCGTG AAG CGTTTCGTGTGTTCGACAAGG ATGG AA ATGGATACATTTCCGCGGCGGAGCTGCGTCACGTGATGACGAACCTGGGAGAGAAGCTGACGGAC GAAGAGGTGGACGAAATGATTCGTGAAGCGGACATTGACGGAGACGGACAGGTGAATTACGAAG AGTTCGTGCAGATGATGACGGCGAGGGGAGGACTGGAGGTGCTGTTCCAGGGACCGGGACGTGG ATCCATCG ACACGTG GGTGTG ATGATGA
CaM template contains myc tag, CaM protein, prescission cleavage site and RGS peptide tag from N- to C-term as shown in the vector map.
Materials and Methods
Recombinant cysteinyl-tRNA synthease production: The gene fragment for CysRS was amplified by colony PCR on E.coli BL21(DE3) strain and cloned into pET28 vector with the C-terminal His-tag and purified by standard affinity chromotography. Protein expression was induced with 0.5mM isfopropyl-P-D-thiogalactopyranoside (IPTG) in BL21(DE3)RIL cells at 20 °C for overnight. CysRS was purified by Ni2+ affinity chromatography using standard buffer followed by gel filtration on Su- perdex 200 (GE Healthcare) in buffer: 50mM Hepes-KOH, pH8, 150mM NaCl and lmM DTT.
Affinity clamp matrix preparation: C-terminal Cys were added into sequence of the affinity clamp protein (pdz-fibronectin Fusion Protein, PDB: 3CH8 A). The purified protein with C-terminal Cys was immobilized on Iodoacetyl Gel (UltraLink®) using manufacture's protocol.
tRNA charging by flexizyme for amber suppression: The acylation reaction were performed as described before62. 1 volume of 250 μΜ o-tRNA was mixed with the same volume of 50μΜ Fx (250 μΜ) and 3 volume of water. The mixture was then heated at 95° for 5min with constant agitation at 1200rpm and cooled down slowly at room temperature. After adding 1 volume of 0.5M Hepes (pH7.9) and 2 volume of 3M MgCl2, the mixture was put on ice for 2min and followed by addition of 2V of nnAA substrate(lOOmM) (in 100% DMSO or 100% ACN). The reactions were incubated at 10° with agitation for the given periods of time (2.5, 5 or lOh). Flexizyme acylation reactions were stopped and used to prime the translational reactions.
MS analysis: The modified proteins were purified on nano-trap matrix and then eluted with lxSDS PAGE loading buffer. After running the gel, the desired bands were cut and digested with trypsin. The resulting peptides were then analyzed by LC-MS/MS. Results and Discussion
Although a commercial tRNA mixture demonstrated ~ 2-fold less efficiency than that produced herein in supporting translation of 1AGG sGFP template, it displayed 3 -fold higher activity towards supporting the translation of eGFP template with 6AGG codons at saturating concentrations (Fig 21 and Fig 27). This indicates a greater proportion of native rare AGG-codon isoacceptors in the commercial mixture. Addition of t7tRNAccu to the depleted in-house produced tRNA mixture resulted in 5-fold increase in translation activity as compared to original total tRNA mixture (Fig 21). This confirmed our assumption that at appropriate age of cell culture the fraction of low abundant tRNA species for decoding AGG codon is biased favorably for codon reassignment purposes.
In order to ensure translational fidelity, the exogenous tRNA/aaRS pairs should be orthogonal to the endogenous ones. We evaluated the translational fidelity of Mj Y2/ AzFRS/ AzF and PylT/PylRSAF/PrK in E.coli cell free translation system. Template A 151X was translated in the cell free reaction by supplementing with different combinations of o-tRNA/aaRS/nnAA. ForMjTyr system, exclusion of either tRNA or aaRS, no protein was translated. However, when AzF was excluded from the reaction around 10% of protein was produced. It indicates that AzFRS could charge MjY2tRNA with canonical amino acids for amber suppression. We also found that with the increasing concentration of AzFRS the ability to charge MjtRNA with canonical amino acids increased (data not shown). To exam this issue, the proteins produced without and with AzF were purified by affinity chromatography on nano-trap matrix and load for SDS-PAGE gel. The corresponding band was cut and digested using trypsin. The resulting peptides were then analyzed using LC-MS/MS to assess the identity of the amino acid at the desired position. MS spectrum analysis of the GFP products without AzF supplementation showed some aromatic amino acids, Phe, Tyr and Trp, were incorporated on TAG codon (data not shown). In the GFP151AzF sample, wild type peptide was negligible and more than 80% of the protein contained AzF (Fig 32A). The AzF incorporation could also be confirmed by following TAMRA incorporation through DIBO-TAMRA.
The orthogonality of PylT/PylRSAF pair is better than Mj Y2/ AzFRS pair. Exclusion either nnAA, PylT or PylRS, no detectable fluorescence was observed. However, when supplementing the reaction with MjY2 tRNA, the protein yield increased slightly which indicated MjYtRNA may be misacylated by PylRS with Prk. The ratio of each matured tRNAs and their cognate aaRSs are evolutionary balanced to ensure the translational fidelity and efficiency. Therefore, when the 21st and 22nd o-tRNA/aaRS pairs are introduced into the translation system, care must be taken to avoid cross-recognition.
We compared Amber and AGG codon-mediated BP-FL incorporation efficiency by using four templates harbouring either single AGG or single amber codon at the 1st and 151st GFP ORF (Fig 25C). The yield of BP-FL labelled protein on ITAG was 3.7 times that of 151TAG while on 1AGG was 1.2 times that of 151 AGG. The suppression efficiency on the 1st position is consistently higher than the 151st position for both amber and AGG codon. The relative total protein yield was represented by band intensity on the western blot. If we assume the full length protein for 15 ITAG suppression (Fig 25 C, lane 3, anti-GFP) was directly due to BP- FL incorporation, then the band intensity ratio of BP-FL/anti-GFP (upper band) should be considered as 100% labelling efficiency. The fluorescence/total protein ratio for 1AGG suppression (Fig 25C, lane 2) was obviously higher than that for 15 ITAG which indicates more than 100% labelling efficiency and is not possible. Therefore, some unspecific incorporation was in the full length band for 15 ITAG suppression. It not only consists of products with BP-FL, but with some other non- fluorescent amino acid. The highest probability is Cys which was incorporated into protein through the discharged tRNACyscua at the late stage of protein translation derived from the BPFL-tRNA suppressor. This unspecific incorporation is context dependent since the fluorescence/total protein ratio for ITAG (3.7/1=3.7) is around 8 times higher than that for 151TAG (1/(1+1.1)=0.48). Therefore it is not straightforward to estimate the AGG labelling efficiency from the TAG labelling efficiency derived from the ratio of full length/ (full length and truncation). However, the labelling efficiency here for IT AG: 1 AGG: 15 ITAG: 1 AGG is 4:7: 1 :4. AGG suppression gave consistently higher BP-FL incorporation, 1.8 and 4 times on the 1st and 151st position respectively, than amber suppression. This indicates the less competition from the native tRNA isoacceptors for AGG codon compared to that of release factor for termination on amber codon. We concluded that BP-FL charged tRNA was more compatible with AGG codon in the contexts we tested here.
Note: 2 forward (T7, F) and 3 reverse oligonucleotides (Rl, R2, R3) are used for assembly of standard tRNA template while 3 forward (T7, Fl, F2) and 3 reverse oligonucleotides for generating a self-processing Hammerhead ribozyme (HH Rz) fusion constructs(REF). Oligos for depletion of native isoacceptors in the total mixture contain 3'-amine for immobilization on the NHS-activated matrix. REFERENCES
(1) Crick, F. H. Mol Biol 1968, 38, 367.
(2) Liu, C. C; Schultz, P. G. Annu Rev Biochem 2010, 79, 413.
(3) O'Donoghue, P.; Ling, J.; Wang, Y. S.; Soil, D. Nature chemical biology 2013, 9, 594.
(4) Odoi, K. A.; Huang, Y.; Rezenom, Y. H.; Liu, W. R. Plos One 2013, 8, e57035.
(5) Wan, W.; Huang, Y.; Wang, Z. Y.; Russell, W. K.; Pai, P. J.; Russell, D. H.; Liu, W. R. Angew Chem Int Edit 2010, 49, 3211.
(6) Neumann, H.; Wang, K. H.; Davis, L.; Garcia- Alai, M.; Chin, J. W. Nature 2010, 464, 441.
(7) Wang, K. H.; Sachdeva, A; Cox, D. J.; Wilf, N. W.; Lang, K.; Wallace, S.; Mehl, R. A; Chin, J. W. Nat Chem 2014, 6, 393.
(8) Wu, B.; Wang, Z.; Huang, Y.; Liu, W. R. Chembiochem 2012, 13, 1405.
(9) Krishnakumar, R. ; Prat, L.; Aerni, H. R.; Ling, J. Q.; Merryman, C; Glass, J. I; Rinehart, J.; Soil, D. Chembiochem 2013, 14, 1967.
(10) Lee, B. S.; Shin, S.; Jeon, J. Y.; Jang, K. S.; Lee, B. Y.; Choi, S.; Yoo, T. H. ACS chemical biology 2015, 10, 1648.
(11) Mukai, T.; Yamaguchi, A.; Ohtake, K.; Takahashi, M.; Hayashi, A.; Iraha, F.; Kira, S.; Yanagisawa, T.; Yokoyama, S.; Hoshi, H.; Kobayashi, T.; Sakamoto, K. Nucleic acids research 2015, 43, 8111.
(12) Zeng, Y.; Wang, W.; Liu, W. S. R. Chembiochem 2014, 15, 1750.
(13) Dumas, A.; Lercher, L.; Spicer, C. D.; Davis, B. G. Chem. Sci. 2015, 6, 50.
(14) Chatterjee, A.; Sun, S. B.; Furman, J. L.; Xiao, H.; Schultz, P. G. Biochemistry 2013, 52, 1828.
(15) Sasmal, P. K.; Carregal-Romero, S.; Han, A. A.; Streu, C. N.; Lin, Z.; Namikawa, K.; Elliott, S. L.; Koster, R. W.; Parak, W. J.; Meggers, E. Chembiochem 2012, 13, 1116. (16) Iwane, Y.; Hitomi, A.; Murakami, H.; Katoh, T.; Goto, Y.; Suga, H. Nat Chem 2016.
(17) Quast, R. B.; Mrusek, D.; Hoffmeister, C; Sonnabend, A.; Kubick, S. Febs Lett 2015, 589, 1703.
(18) Michalet, X.; Weiss, S.; Jager, M. Chem Rev 2006, 106, 1785.
(19) Nikic, I; Plass, T.; Schraidt, O.; Szymanski, J.; Briggs, J. A. G.; Schultz, C; Lemke, E. A. Angew Chem Int Edit 2014, 53, 2245.
(20) Sachdeva, A.; Wang, K. H.; Elliott, T.; Chin, J. W. Journal of the American Chemical Society 2014, 136, 7785.
(21) Albayrak, C; Swartz, J. R. Nucleic acids research 2013, 41, 5949.
(22) Loscha, K. V.; Herlt, A. J.; Qi, R.; Huber, T.; Ozawa, K.; Otting, G. Angewandte Chemie 2012, 51, 2243.
(23) Wan, W.; Tharp, J. M.; Liu, W. R. Biochimica et biophysica acta 2014, 1844, 1059.
(24) Cui, Z.; Stein, V.; Tnimov, Z.; Mureev, S.; Alexandrov, K. J Am
Chem Soc 2015, 137, 4404.
(25) Yokogawa, T.; Kitamura, Y.; Nakamura, D.; Ohno, S.; Nishikawa, K. Nucleic acids research 2010, 38, e89.
(26) Lang, K.; Chin, J. W. ACS chemical biology 2014, 9, 16.
(27) Carlson, J. C; Meimetis, L. G.; Hilderbrand, S. A.; Weissleder, R.
Angewandte Chemie 2013, 52, 6917 '.
(28) Mukai, T.; Kobayashi, T.; Hino, N.; Yanagisawa, T.; Sakamoto, K.; Yokoyama, S. Biochem Biophys Res Commun 2008, 371, 818.
(29) Yanagisawa, T.; Ishii, R; Fukunaga, R.; Kobayashi, T.; Sakamoto, K.; Yokoyama, S. Chem Biol 2008, 15, 1187.
(30) Nguyen, D. P.; Lusic, H.; Neumann, H.; Kapadnis, P. B.; Deiters, A.; Chin, J. W. J Am Chem Soc 2009, 131, 8720.
(31) Lang, K.; Davis, L.; Torre s-Kolbus, J.; Chou, C. J.; Deiters, A.; Chin, J. W. Nat Chem 2012, 4, 298.
(32) Lang, K.; Davis, L.; Wallace, S.; Mahesh, M.; Cox, D. J.; Blackman,
M. L.; Fox, J. M.; Chin, J. W. J Am Chem Soc 2012, 134, 10317.
(33) Seitchik, J. L.; Peeler, J. C; Taylor, M. T.; Blackman, M. L.; Rhoads, T. W.; Cooley, R. B.; Refakis, C; Fox, J. M.; Mehl, R. A. Journal of the American Chemical Society 2012, 134, 2898. (34) Wang, Y. S.; Fang, X.; Wallace, A. L.; Wu, B.; Liu, W. R. Journal of the American Chemical Society 2012, 134, 2950.
(35) Guo, L. T.; Wang, Y. S.; Nakamura, A.; Eiler, D.; Kavran, J. M; Wong, M.; Kiessling, L. L.; Steitz, T. A.; O'Donoghue, P.; Soil, D. Proc Natl Acad Sci U SA 2014, 111, 16724.
(36) Lang, K.; Davis, L.; Wallace, S.; Mahesh, M.; Cox, D. J.; Blackman, M. L.; Fox, J. M.; Chin, J. W. Journal of the American Chemical Society 2012, 134, 10317.
(37) Guo, J. T.; Melancon, C. E.; Lee, H. S.; Groff, D.; Schultz, P. G. Angew Chem Int Edit 2009, 48, 9148.
(38) Young, T. S.; Ahmad, I; Yin, J. A; Schultz, P. G. J Mol Biol 2010, 395, 361.
(39) Chin, J. W.; Santoro, S. W.; Martin, A. B.; King, D. S.; Wang, L.; Schultz, P. G. Journal of the American Chemical Society 2002, 124, 9026. (40) Steer, B. A; Schimmel, P. J Biol Chem 1999, 274, 35601.
(41) Tsunoda, M.; Kusakabe, Y.; Tanaka, N.; Ohno, S.; Nakamura, M.; Senda, T.; Moriguchi, T.; Asai, N.; Sekine, M.; Yokogawa, T.; Nishikawa, K.; Nakamura, K. T. Nucleic acids research 2007, 35, 4289.
(42) Hecht, S. M.; Alford, B. L.; Kuroda, Y.; Kitano, S. The Journal of biological chemistry 1978, 253, 4517.
(43) Goto, Y.; Katoh, T.; Suga, H. Nat Protoc 2011, 6, 779.
(44) Gubbens, J.; Kim, S. J.; Yang, Z.; Johnson, A. E.; Skach, W. R. Rna 2010, 16, 1660.
(45) Johnson, A. E.; Woodward, W. R.; Herbert, E.; Menninger, J. R. Biochemistry 1976, 15, 569.
(46) Newberry, K. J.; Hou, Y. M.; Perona, J. J. Embo J 2002, 21, 2778.
(47) Hauenstein, S.; Zhang, C. M.; Hou, Y. M.; Perona, J. J. Nat Struct Mol Biol 2004, 11, 1134.
(48) Mittelstaet, J.; Konevega, A. L.; Rodnina, M. V. Journal of the American Chemical Society 2013, 135, 17031.
(49) Schrader, J. M.; Chapman, S. J.; Uhlenbeck, O. C. Proc Natl Acad Sci U S A 2011, 108, 5215.
(50) Ieong, K. W.; Pavlov, M. Y.; Kwiatkowski, M.; Ehrenberg, M.; Forster, A. C. Rna-a Publication of the Rna Society 2014, 20, 632. (51) Voorhees, R. M.; Schmeing, T. M.; Kelley, A. C; Ramakrishnan, V. Science 2010, 330, 835.
(52) Asahara, H.; Uhlenbeck, O. C. P Natl Acad Sci USA 2002, 99, 3499.
(53) Asahara, H.; Uhlenbeck, O. C. Biochemistry 2005, 44, 11254.
(54) Dong, H. J.; Nilsson, L.; Kurland, C. G. J Mol Biol 1996, 260, 649.
(55) LaRiviere, F. J.; Wolfson, A. D.; Uhlenbeck, O. C. Science 2001, 294, 165.
(56) Bossi, L.; Ruth, J. R. Nature 1980, 286, 123.
(57) Pott, M.; Schmidt, M. J.; Summerer, D. ACS chemical biology 2014, 9, 2815.
(58) Gagoski, D.; Polinkovsky, M. E.; Mureev, S.; Kunert, A.; Johnston, W.; Gambin, Y.; Alexandrov, K. Biotechnology and bioengineering 2016, 113, 292.
(59) Zubay, G. J Mol Biol 1962, 4, 347.
(60) Schwarz, D.; Junge, F.; Durst, F.; Frolich, N.; Schneider, B.; Reckel,
S.; Sobhanifar, S.; Dotsch, V.; Bernhard, F. Nat Protoc 2007, 2, 2945.
(61) Cui, Z.; Stein, V.; Tnimov, Z.; Mureev, S.; Alexandrov, K. Journal of the American Chemical Society 2015, 137, 4404.
(62) Goto, Y.; Katoh, T.; Suga, H. Nat Protoc 2011, 6, 779.
(63) Guo, J. T.; Melancon, C. E.; Lee, H. S.; Groff, D.; Schultz, P. G.
Angew Chem Int Edit 2009, 48, 9148.
(64) Young, T. S.; Ahmad, I; Yin, J. A.; Schultz, P. G. J Mol Biol 2010, 395, 361.
EXAMPLE 8
Dual protein labelling via two sense codons
Specific depletion of total tRNA mixture for AGG and AGC native tRNA suppressors Combining both procedures for specific tRNA depletion based on anticodon loop specific tRNA aptamer (as per Example 2) followed by the one based on tRNA- specific DNA oligonucleotide (as per Example 7 "Specific tRNA depletion in total tRNA mixture") we generated total tRNA mixture highly depleted for serine tRNA GCU-isoacceptor (el l) and for both arginine CCU/UCU isoaccptors (a05/06). In suppression experiment both tRNAs were shown to be depleted to a high extent (Fig 35). Dual protein labelling via two sense codons
Site-specific incorporation of AzF and BP-FL into CaM and eGFP via AGC and AGG-codons in the cell-free translation reaction primed with the respective templates with different codon biases: The pOPINE-CaM templates, with single or double AGC and single AGG codon located at positions 1 (1 and 2) and 151 respectievely of CaM ORF (Fig. 36), were supplemented at lOOng/μΙ in the cell-free reaction, which contains 35% (v/v) depleted lysate, depleted tRNA mixture, 12.5μΜ MjY2tRNAgcu, 10 μΜ AzFRS, I mM AzF; 16μΜ BP-tRNACysccu. The reaction was performed at 28°C for 3h. The translated product from 200 μΐ cell-free reaction was immobilized on Affinity-clamp resin beads (see Example 7). Resin with the immobilized translation product was washed with 25mM Tris (pH7.5), 0.25M NaCl, 0.1% Triton X-100 buffer to remove free AzF from the translation reaction, followed by addition of DIBO-TAMRA to ImM final concentration in two original reaction volumes of PBS. After lh conjugation at RT the beads were washed to remove unconjugated TAMRA-dye and the aliqoute of beads corresponding to a protein obtained from lOul of translation reaction has been eluted with 95 °C heated x2 SDS-PAGE sample buffer and resolved on SDS-PAGE (Fig 37).
Throughout the specification, the aim has been to describe the preferred embodiments of the invention without limiting the invention to any one embodiment or specific collection of features. Various changes and modifications may be made to the embodiments described and illustrated without departing from the present invention.
The disclosure of each patent and scientific document, computer program and algorithm referred to in this specification is incorporated by reference in its entirety.

Claims

1. A method of producing a complement of tRNAs suitable for translation of a protein comprising at least one non-natural moiety, said method including the step of substituting at least one tRNA that comprises an anticodon for a natural amino acid with at least one tRNA comprising the same anticodon reassigned to a non-natural moiety, wherein the complement of tRNAs is operable to facilitate translation of an RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non-natural moiety whereby the translated protein may comprise any or all of the twenty (20) natural amino acids.
2. The method of Claim 1, which includes one or more of the steps of: (i) depleting one or more tRNAs from a complement of tRNAs suitable for translation of a protein comprising natural amino acids; and (ii) reconstituting the depleted complement of tRNAs with one or more tRNAs respectively reassigned to non-natural moieties and respectively coupled to the non- natural moieties.
3. The method of Claim 2, wherein in step (i), substantially all tRNAs for natural amino acids are depleted from the complement of tRNAs.
4. The method of Claim 2, wherein in step (i), one or more tRNAs for natural amino acids are selectively depleted from the complement of tRNAs.
5. The method of Claim 2, Claim 3 or Claim 4, wherein at step (ii), the reconstituting tRNAs comprise synthetic tRNAs, native tRNAs, or mixtures thereof.
6. A composition comprising a complement of tRNAs suitable for translation of a protein comprising at least one non-natural moiety, said complement comprising at least one tRNA that comprises an anticodon for a natural amino acid reassigned to a non-natural moiety, wherein the complement of tRNAs is operable to facilitate translation of an RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non- natural moiety whereby the translated protein may comprise any or all of the twenty (20) natural amino acids.
7. A method of producing a translation system suitable for translation of a protein comprising at least one non-natural moiety, said method including producing a complement of tRNAs comprising at least one tRNA that comprises an anticodon for a natural amino acid that has been reassigned to a non-natural moiety; and producing a transcribable RNA which comprises a codon corresponding to the anticodon that has been reassigned to the non- natural moiety, wherein the mRNA may be transcribed to produce a translated protein that may comprise any or all of the twenty (20) natural amino acids.
8. A translation system suitable for translation of a protein comprising at least one non-natural moiety, said system comprising: a complement of tRNAs comprising at least one tRNA that comprises an anticodon for a natural amino acid that has been reassigned to a non-natural moiety; and a translatable mRNA which comprises a codon corresponding to the anticodon that has been reassigned to a non-natural moiety, wherein the mRNA may be transcribed to produce a translated protein that may comprise any or all of the twenty (20) natural amino acids.
9. A method of producing a recombinant protein comprising at least one non- natural moiety, said method including the step of translating an mRNA which comprises a codon corresponding to an anticodon of a tRNA that has been reassigned to a non-natural moiety in a complement of tRNAs comprising at least one tRNA that comprises an anticodon for a natural amino acid that has been reassigned to a non-natural moiety, wherein the translated protein may comprise any or all of the twenty (20) natural amino acids.
10. The composition, method or system of any one of the preceding claims, wherein the reassigned anticodon is one of a plurality of different anticodons that is normally for a natural amino acid.
11. The composition, method or system of any preceding claim, wherein the aminoacyl-tRNA is synthesized in vitro.
12. The composition, method or system of Claim 11, wherein the tRNA is produced using an RNA synthetase.
13. The composition, method or system of Claim 12, wherein the tRNA is aminoacylated using an RNA synthetase.
14. The composition, method or system of Claim 13, wherein the RNA synthetase is selected from PylRS or variants thereof suitable for pyrrolysine tRNA synthase-mediated aminoacylation; Methanococcus jannaschii tyrosyl-transfer RNA synthetase (Mj TyrRS) or variants thereof; Flexizyme; and a cysteinyl tRNA synthetase.
15. The composition, method or system of Claim 14, wherein the tRNA comprising the reassigned anticodon is a mutant cysteine tRNA.
16. The composition, method or system of Claim 15, wherein the aminoacyl- tRNA is synthesized in vitro using a cysteinyl tRNA synthase.
17. The composition, method or system of Claim 16, wherein the mutant cysteine tRNA cannot be recharged by an endogenous cysteinyl tRNA synthetase.
18. The method, composition or system of any preceding claim, wherein the reassigned anticodon is an anticodon that is four-fold or six-fold degenerate.
19. The method, composition or system of any preceding claim, wherein the reassigned anticodon is an anticodon for He, Ala, Gly, Pro, Thr, Val, Arg,
Leu or Ser.
20. The method, composition or system of any preceding claim, wherein the complement of tRNAs comprises two or more different anticodons that normally encode respective natural amino acids, re-assigned to respective non-natural moieties.
21. The method, composition or system of any preceding claim wherein the complement of tRNAs comprises at least one tRNA that comprises an anticodon that is not for a natural amino acid, wherein said anticodon has been re-assigned to a non-natural moiety.
22. The method, composition or system of Claim 21, wherein said anticodon that has been reassigned to said non-natural moiety is an amber suppressor anticodon.
23. A recombinant protein produced by the method of any one of Claims 9-22.
24. The recombinant protein of Claim 23, which comprises one or a plurality of same or different non-natural moieties that facilitate PEGylation, conjugation of small molecules, labelling, immobilisation, intermolecular and/or intramolecular cross-linking or other interactions, formation of higher order strucutres and/or one or more catalytic activities.
25. The recombinant protein of Claim 23 which comprises two or more of the same or different non-natural moieties that are capable of intramolecular covalent bonding.
26. The recombinant protein of Claim 23, Claim 24 or Claim 25 which is a macrocyclic protein.
27. A protein library comprising a plurality of recombinant proteins according to any one of Claims 23-26.
28. An mRNA that encodes the recombinant protein of any one of Claima 23-26, or that encodes at least one of the plurality of recombinant proteins in the protein library according to Claim 27.
EP16771096.1A 2015-03-27 2016-03-29 Platform for non-natural amino acid incorporation into proteins Withdrawn EP3274459A4 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2015901121A AU2015901121A0 (en) 2015-03-27 Platform for non-natural amino acid incorporation into peptides
PCT/AU2016/050239 WO2016154675A1 (en) 2015-03-27 2016-03-29 Platform for non-natural amino acid incorporation into proteins

Publications (2)

Publication Number Publication Date
EP3274459A1 true EP3274459A1 (en) 2018-01-31
EP3274459A4 EP3274459A4 (en) 2018-08-22

Family

ID=57003719

Family Applications (1)

Application Number Title Priority Date Filing Date
EP16771096.1A Withdrawn EP3274459A4 (en) 2015-03-27 2016-03-29 Platform for non-natural amino acid incorporation into proteins

Country Status (5)

Country Link
US (1) US20180171321A1 (en)
EP (1) EP3274459A4 (en)
JP (1) JP2018509172A (en)
CN (1) CN107614689A (en)
WO (1) WO2016154675A1 (en)

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW202446781A (en) 2011-12-28 2024-12-01 日商中外製藥股份有限公司 Method for producing peptide compounds
CA2873793C (en) * 2012-05-18 2022-02-22 Medical Research Council Methods of incorporating an amino acid comprising a bcn group into a polypeptide using an orthogonal codon encoding it and an orthorgonal pylrs synthase
EP4166664A1 (en) 2015-03-13 2023-04-19 Chugai Seiyaku Kabushiki Kaisha Modified aminoacyl-trna synthetase and use thereof
WO2017151997A1 (en) * 2016-03-04 2017-09-08 President And Fellows Of Harvard College Methods for making polypeptides including d-amino acids
JP7187323B2 (en) 2017-01-31 2022-12-12 中外製薬株式会社 Method for synthesizing peptide in cell-free translation system
KR20250007021A (en) 2017-06-09 2025-01-13 추가이 세이야쿠 가부시키가이샤 Method for synthesizing peptide containing n-substituted amino acid
KR102930465B1 (en) 2017-11-02 2026-02-25 더 위스타 인스티튜트 오브 아나토미 앤드 바이올로지 A method for constructing a stop codon through genetic reassignment using ACE-tRNA
WO2019117274A1 (en) 2017-12-15 2019-06-20 中外製薬株式会社 Method for producing peptide, and method for processing bases
WO2019193416A1 (en) * 2018-04-03 2019-10-10 The University Of Queensland Oligonucleotide-mediated sense codon reassignment
WO2020040840A2 (en) 2018-06-01 2020-02-27 Northwestern University Expanding the chemical substrates for genetic code reprogramming
US20220002370A1 (en) 2018-09-27 2022-01-06 Xilio Development, Inc. Masked cytokine polypeptides
EP3878836B1 (en) 2018-11-07 2025-07-23 Chugai Seiyaku Kabushiki Kaisha O-substituted serine derivative production method
WO2020111238A1 (en) 2018-11-30 2020-06-04 中外製薬株式会社 Deprotection method and resin removal method in solid-phase reaction for peptide compound or amide compound, and method for producing peptide compound
EP3904568A4 (en) * 2018-12-26 2024-03-20 Chugai Seiyaku Kabushiki Kaisha MUTATED TRNA FOR CODON EXPANSION
JP7495420B2 (en) 2019-02-20 2024-06-04 ノヴォ ノルディスク アー/エス Aminoacyl-tRNA synthetases and uses thereof
EP3939962A4 (en) 2019-03-15 2022-12-28 Chugai Seiyaku Kabushiki Kaisha METHOD FOR PREPARING AN AROMATIC AMINO ACID DERIVATIVE
CN111850020B (en) * 2019-04-25 2021-05-07 苏州鲲鹏生物技术有限公司 Introduction of Unnatural Amino Acids into Proteins Using a Plasmid System
BR112022007535A2 (en) 2019-11-07 2022-07-12 Chugai Pharmaceutical Co Ltd CYCLIC PEPTIDE COMPOUND HAVING KRAS INHIBITORY ACTION
JPWO2021261577A1 (en) * 2020-06-25 2021-12-30
WO2022115865A2 (en) 2020-11-25 2022-06-02 Xilio Development, Inc. Tumor-specific cleavable linkers
US20250263696A1 (en) * 2021-02-18 2025-08-21 Tsinghua University Protein translation system
KR20240032941A (en) * 2021-07-07 2024-03-12 아지노모토 가부시키가이샤 Secretion production method for proteins containing non-natural amino acids
JP2024533596A (en) * 2021-09-17 2024-09-12 アブサイ コーポレイション Transfer RNA composition and use in the production of proteins containing non-standard amino acids

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE60226411D1 (en) * 2001-01-25 2008-06-19 Anthony C Forster METHOD AND COMPOSITIONS FOR PEPTIDE, PROTEIN AND PEPTIDOMIMETIC SYNTHESIS
JP2004533827A (en) * 2001-05-17 2004-11-11 アールフス・ユニバーシティー Improved vector for gene therapy
US7741071B2 (en) * 2003-12-18 2010-06-22 The Scripps Research Institute Selective incorporation of 5-hydroxytryptophan into proteins in mammalian cells
WO2006135096A1 (en) * 2005-06-14 2006-12-21 Gifu University Method of site specifically introducing tyrosine analogue into protein
JP5798489B2 (en) * 2009-01-12 2015-10-21 ストロ バイオファーマ, インコーポレイテッド Monocharge system for selectively introducing unnatural amino acids into proteins using in vitro protein synthesis system
JP5725467B2 (en) * 2010-08-27 2015-05-27 国立大学法人 東京大学 New artificial translation synthesis system
JP6440055B2 (en) * 2013-05-10 2018-12-19 国立大学法人 東京大学 Method for producing peptide library, peptide library, and screening method
US20160115487A1 (en) * 2013-05-29 2016-04-28 Bradley C. Bundy Cell-free synthetic incorporation of non-natural amino acids into proteins

Also Published As

Publication number Publication date
WO2016154675A1 (en) 2016-10-06
EP3274459A4 (en) 2018-08-22
CN107614689A (en) 2018-01-19
US20180171321A1 (en) 2018-06-21
JP2018509172A (en) 2018-04-05

Similar Documents

Publication Publication Date Title
US20180171321A1 (en) Platform for a non-natural amino acid incorporation into proteins
JP7292442B2 (en) Modified aminoacyl-tRNA synthetase and uses thereof
US20200199579A1 (en) Rapid Display Method in Translational Synthesis of Peptide
Cui et al. Cell-free approach for non-canonical amino acids incorporation into polypeptides
JP5119444B2 (en) Multi-purpose acylation catalyst and its use
JP7079018B6 (en) Modification of the D and T arms of tRNA to enhance uptake of D-amino acids and β-amino acids
Cui et al. Semisynthetic tRNA complement mediates in vitro protein synthesis
EP2952582A1 (en) Flexible display method
US20130078671A1 (en) Incorporation of two different noncanonical amino acids into a single protein
EP4410982A1 (en) Method for producing polypeptide, tag, expression vector, method for evaluating polypeptide, method for producing nucleic acid display library, and screening method
US6440695B1 (en) Method for producing diverse libraries of encoded polypeptides
Zhou et al. Non‐canonical amino acids for engineering peptides and proteins with new functions
US20240384267A1 (en) Compositions and methods for multiplex decoding of quadruplet codons
CN115867648A (en) Expanding chemical substrates for genetic code reprogramming to include long-chain carbon and cyclic amino acids
US20220002719A1 (en) Oligonucleotide-mediated sense codon reassignment
JP2017216961A (en) Non-natural amino acid-containing peptide library
EP4389890A1 (en) Trna, aminoacyl-trna, polypeptide synthesis reagent, unnatural amino acid incorporation method, polypeptide production method, nucleic acid display library production method, nucleic acid/polypeptide conjugate, and screening method
JP7566294B2 (en) Modification of the T stem of tRNA to enhance the incorporation of N-methyl amino acids
Exner Incorporation of novel noncanonical amino acids in model proteins using rational and evolved variants of Methanosarcina mazei pyrrolysyl-tRNA synthetase
US20040038273A1 (en) Bifunctional tRNA for in vitro selection
WO2015115661A1 (en) Method for producing peptides having azole-derived skeleton
US20060252051A1 (en) Method for producing diverse libraries of encoded polymers
Katoh Engineering the Ribosomal Translation System to Introduce Non‐proteinogenic Amino Acids into Peptides
Hegazy et al. Semisynthetic Enzymes
Suga et al. In vitro synthetic biology of the genetic code: its development and applications

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20171025

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20180720

RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 15/67 20060101AFI20180716BHEP

Ipc: C12P 21/02 20060101ALI20180716BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20200709

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20221001