EP3263707A1 - Ligand du tlr8 et ses utilisations - Google Patents
Ligand du tlr8 et ses utilisations Download PDFInfo
- Publication number
- EP3263707A1 EP3263707A1 EP17168762.7A EP17168762A EP3263707A1 EP 3263707 A1 EP3263707 A1 EP 3263707A1 EP 17168762 A EP17168762 A EP 17168762A EP 3263707 A1 EP3263707 A1 EP 3263707A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- poly
- oligonucleotide
- rna
- tlr7
- ifn
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/17—Immunomodulatory nucleic acids
Definitions
- the present invention relates to the field of immunotherapy.
- the present invention provides a TLR7 ligand and its use in therapeutic applications.
- the present application provides an RNA oligonucleotide comprising a G:U wobble base pair and its use in treating disease such as viral infections, immune disorders and cancer.
- TLRs Toll like receptors
- TLR7 is expressed by plasmacytoid dendritic cells (PDCs) and by B cells, while monocytes and myeloid dendritic cells express TLR8 [9,10].
- mice deficient in TLR7 were found entirely unable to respond to ssRNA ligands, indicating that mouse TLR8 is either inactive, or has a non-immune function [11,12].
- the first defined TLR7/8 ligands were imidazoquinoline derivates and C8 and/or N7 modified analogs of guanosine, small molecules known to induce an antiviral response [11,13-15]. Most of these compounds (e.g. resiquimod R-848, 3M-003) activate both, TLR7 and TLR8.
- the first drug of this class is 5% imiquimod cream, which is approved for the topical treatment of genital warts caused by human papillomavirus (HPV), as well as of basal cell carcinoma and actinic keratosis [16].
- ORNs oligoribonucleotides
- Natural ssRNAs including mRNA and viral RNA do not present as a single strand under physiological conditions but form secondary structures in which the majority of bases are paired in double helical stems to minimize free energy [25].
- RNA secondary structure additionally contains wobble (i.e. non-canonical) base pairs formed by guanosines and uridines [26].
- G•U (guanosine•uridine) base pairs can functionally substitute for Watson-Crick base pairs, as they are nearly isomorphic, and of comparable thermodynamic stability [27].
- RNA stem structures containing G•U wobble base pairs are present in virtually all functional RNA classes and are therefore a hallmark of ssRNA secondary structure.
- unique structural, chemical and conformational characteristics mark sites containing G•U base pairs for recognition by proteins [27,28].
- RNA secondary structural elements in particular those that form G•U wobble base pairs, influence ssRNA recognition.
- short RNA stems were highly immunostimulatory, and selectively activated TLR7 when they contained at least one G•U wobble base pair.
- the G•U base pair therefore constitutes the so far unappreciated minimal structural motif sufficient to confer TLR7 agonist activity in single stranded RNA.
- TLR7 distinguishes between self and non-self RNA.
- TLR7 RNA-binding protein 7
- TLR7 RNA-binding protein 7
- the provision of such molecules allows for the provision of immunostimulatory nucleic acid molecules, which are useful for the production of type I IFN in vitro and in vivo and for treating various diseases, which can be alleviated or even eradicated by type I IFN, such as viral infections, immune disorders and cancers.
- the present invention relates to a method for preparing a RNA polynucleotide or oligonucleotide (poly/oligonucleotide), which is capable of inducing an immune response, preferably an anti-viral response, more preferably a type I IFN response, comprising the steps of:
- the present invention further relates to a single-stranded or double-stranded RNA poly/oligonucleotide comprising at least one substantially, preferably fully double-stranded section, wherein the at least one double-stranded section comprises at least one G:U base pair, and wherein the at least one double-stranded section has a stability that is comparable to that of a double-stranded section composed of at least 4, preferably 6 to 11, G:C base pairs and at least one, preferably one G:U, base pair or a fully double-stranded section composed of at least 8, preferably 10 to 21, A:U base pairs and at least one, preferably one G:U, base pair, wherein the poly/oligonucleotide is capable of inducing an immune response, preferably an anti-viral response, more preferably a type I IFN response
- the present invention further relates to single-stranded RNA poly/oligonucleotide comprising at least one substantially, preferably fully double-stranded section, wherein the at least one double-stranded section has a structure defined by the following general formula I: X n G/U V m N o W m U/G Y n (Formula I), wherein if X n is followed by G then W m is followed U, or if X n is followed by U then W m is followed by G (in order to form a wobble base pair), wherein 2 ⁇ n ⁇ 12, 2 ⁇ m ⁇ 12 and 2 ⁇ o ⁇ 12; X defines any base that forms Watson- Crick base pairs with corresponding bases in Y; V defines any base that forms Watson- Crick base pairs with corresponding bases in W in an RNA stem structure; N is any base in a loop; and wherein the total length of the RNA defined by Formula I is preferably 15 to 45 bases.
- the RNA poly/oligonucleotides of the invention is a single-stranded RNA poly/oligonucleotide comprising at least one substantially, preferably fully double-stranded section wherein the one strand or a portion of a strand that forms the at least one double-stranded section are composed of two RNA-strands having a structure defined by the following general formulas II and III, 5'X n G/U V m 3' (Formula II) 5' o W m U/G Y n 3' (Formula III), wherein G/U and U/G are selected that a wobble base pair forms, 2 ⁇ n ⁇ 12, 2 ⁇ m ⁇ 12 and 2 ⁇ o ⁇ 12; X defines any base that forms a Watson- Crick base pair with corresponding bases in Y; V defines any base that forms a Watson- Crick base pair with corresponding bases in W in an RNA stem structure; N is any base in a loop; and where
- the poly/oligonucleotide of the invention is single-stranded and may further contain, preferably consist of, a 5' portion and a 3' portion, wherein one of the portions contains, preferably consists of, n U's, and the other portion contains, preferably consists of, p G's and q A's.
- the RNA poly/oligonucleotide of the invention is a single-stranded poly/oligonucleotide which has at least one stem-and-loop structure, and the at least one double-stranded section contained therein is the stem of the at least one single-stranded poly/oligonucleotide.
- the invention further relates to the RNA poly/oligonucleotide as defined above, wherein n is greater than 100, preferably greater than 1000, more preferably greater than 2000, most preferably between 3000 and 5000.
- the invention relates to RNA poly/oligonucleotide as defined above that show selective TLR7 and/or TLR8 activity.
- the RNA poly/oligonucleotide prepared by the method defined herein or the RNA poly/oligonucleotide described herein does not contain AU base pairs and no unpaired U and shows selective TLR7 activity.
- the oligonucleotides show selective TLR7 activity without the need of complexation to an RNA poly/oligonucleotide as defined above, wherein n is greater than 100, preferably greater than 1000, more preferably greater than 2000, most preferably between 3000 and 5000.
- the RNA poly/oligonucleotide as defined above comprises one G:U base pair in each double-stranded section, and the G:U base pair is in the center of each double-stranded section.
- RNA poly/oligonucleotide showing selective TLR8 activity, wherein the G nucleoside in the G:U wobble base pair is adjacent on each side to C nucleosides.
- RNA poly/oligonucleotide comprising at least one U that is not involved in RNA base pairing, wherein the poly/oligonucleotide is capable of inducing an immune response, preferably a type I IFN response, wherein the immune response is enhanced by the addition of exogenous G nucleoside.
- the invention provides a pharmaceutical composition comprising at least one poly/oligonucleotide as defined above.
- the pharmaceutical composition further comprises at least one agent selected from an immunostimulatory agent, an anti-viral agent, an anti-bacterial agent, an anti-tumor agent, IFN- ⁇ , and IFN- ⁇ .
- the invention Further provides an in vitro method for inducing type I IFN production in a cell, comprising the steps of: contacting a cell with at least one poly/oligonucleotide as defined above, optionally mixed with a complexation agent, wherein the cell expresses TLR7 and is capable of producing an immune response, preferably an anti-viral response upon TLR7 activation.
- TLR7 was activated by genomic RNA from ssRNA viruses [4, 6, 17]. Further studies showed that short synthetic ssRNAs were able to stimulate TRL7 in a similar manner as single-stranded viral RNA [2, 6, 7, 21, 24].
- the present inventors found that it was not the GU or U content of a RNA which determines its TLR7-activating and/or IFN- ⁇ -inducing activity, rather, it was the presence of a G:U wobble base pair, in particular, a G:U base pair in the context of a double-stranded structure.
- the inventors found that a single G•U wobble base pair within otherwise non-stimulatory RNA is sufficient to provide full TLR7 agonist activity.
- G•U base pairs form naturally in the secondary structure assumed by single-stranded RNA. Elimination of the G•U wobble base pair abolished TLR7 activity even when the overall base composition was maintained.
- RNAs that form a G•U base pair are able to induce high levels of type I IFN secretion by plasmacytoid dendritic cells (PDC), but do not activate human monocytes.
- phosphodiester ORN that form a G•U base pair when hybridized with poly guanosine (pG) show high and selective TLR7 activity without the need of complexation to other reagents.
- the identification of the minimal structural motif for TLR7 allows the design of RNA-based TLR7 selective agonists that act independently of additional components comparable to CpG oligonucleotides for TLR9.
- the present inventors found that an optimal IFN- ⁇ -inducing activity was observed when a G:U base pair was placed in the center of a double-stranded structure which has stability comparable to that of a double-stranded structure formed by 4-8 G:C base pairs or 10-20 A:U base pairs in addition to the G:U base pair. Furthermore, most of the ssRNAs disclosed in the prior art, which activated TLR7 also activated TLR8 (review Heil et al., 2004).
- RNA poly- and oligonucleotides which activated TLR7 specifically without activating TLR8.
- TLR7-specific ligands are characterized by a G:U base pair in the center of a double-stranded structure which is formed by 4-8 G:C base pairs in addition to the G:U base pair.
- the present inventors found that short RNA stems were highly immunostimulatory, and selectively activated TLR7 when they contained at least one G•U wobble base pair. The G•U base pair therefore constitutes the so far unappreciated minimal structural motif sufficient to confer TLR7 agonist activity in single stranded RNA.
- TLR7 is located in the endosomal compartments of certain immune cells, immunostimulatory RNAs have to be delivered to the endosomes for them to be able to stimulate TLR7.
- Complexation or transfection reagents such as cationic polypeptides, are required for the cellular uptake and delivery of RNAs into the endosomes.
- complexation or transfection agents are required for stabilizing RNA prior to its arrival in the target cell or subcellular compartment.
- TLR7-specifc RNA ligands having phosphodiester backbone can be taken up by the cells, enter the endosomal compartments and activate TLR7 without being complexed with a complexation or transfection reagent.
- Some of these ligands are composed of a long poly-guanosine (polyG or pG) strand (3000-5000 nucleotides) and short ssRNA 6-8 nucleotides in length containing one U in the center of a stretch of 5-7 C's.
- the inventors identified the first phosphodiester RNA ligand, which selectively stimulates TLR7 on its own, and therefore obviating the need for formulation with transfection reagents such as polycations.
- TLR7-specific and highly active RNA agents which can be used for stimulating type I IFN production in vitro and in vivo and for treating or preventing diseases which can be treated or prevented by type I IFN, such as viral infections, immune disorders and cancer.
- immunostimulatory RNAs which do not require a complexation or transfection agent for delivery in vitro and in vivo offers great new research and clinical possibilities.
- oligonucleotide refers to a nucleic acid molecule having 2-100 nucleotides and "polynucleotide” refers to a nucleic acid molecule having more than 100 nucleotides. All sequences are in the 5'->3' direction unless otherwise noted. n consecutive nucleotides X is written as X n when n is an integer greater than zero. For example, XXXYXXXXXZXX is written as X 3 YX 5 ZX 2 . When n is greater than 100, X n can also be written as polyX or pX.
- the present invention provides a method for preparing an RNA polynucleotide or oligonucleotide (hereinafter “poly/oligonucleotide”) which is capable of inducing an immune response, preferably an anti-viral response, more preferably a type I IFN response, more specifically, an IFN- ⁇ response, comprising the steps of:
- the poly/oligonucleotide may be produced by any suitable means known in the art, such as chemical synthesis and in vitro transcription. In the case of a double-stranded poly/oligonucleotide, the two strands may be produced by the same or different methods.
- the ability of a poly/oligonucleotide to induce a type I IFN response can be tested by any suitable methods known in the art, such as those disclosed in the Examples.
- the present invention provides an RNA poly/oligonucleotide, which is capable of inducing an immune response, preferably an antiviral response, more preferably a type I IFN response, most preferably an IFN- ⁇ response, obtained by the method described above.
- the present invention provides a poly/oligonucleotide which comprises at least one substantially, preferably fully double-stranded section, wherein the at least one double-stranded section comprises at least one G:U base pair, and wherein at least one double-stranded section has a stability that is comparable to that of a double-stranded section composed of at least 4, preferably 6 to 11, G:C base pairs and at least one, preferably one G:U, base pair or a double-stranded section composed of at least 10, preferably 10 to 21, A:U base pairs and at least one, preferably one G:U, base pair.
- a section is fully double-stranded when the sequences of the two stretches of nucleic acid forming the section are 100% complementary to each other.
- Two nucleotides are said to be complementary to each other if they can form a base pair, either a Waston-Crick base pair (A-U, G-C) or a wobble base pair (U-G, U-A, I-A, I-U, I-C).
- substiantially fully double-stranded it is meant that the double-stranded section as defined above may contain mismatches or single base insertions up to 10% of the total number of bases, provided the that the substiantially fully double-stranded section maintains a minimal stability of the double-strand of said section.
- the stability of a substantially, preferably fully double-stranded section can be determined by a skilled person using methods known in the art.
- the stability is determined by the software DNamelt (http://www.bioinfo.rpi.edu/applications/hybrid/) based on Markham N R & Zuker M (2005) and Markham NR & Zuker M (2008).
- a substantially, preferably fully double-stranded section is 75%-125%, preferably 80-120%, more preferably 90-110%, most preferably 95-105% of that of a double-stranded section composed of at least 4, preferably 6 to 11, G:C base pairs and at least one, preferably one G:U, base pair or a section composed of at least 8, preferably 10 to 21, A:U base pairs and at least one, preferably one G:U, base pair.
- the stability of a substantially, preferably fully double-stranded section is within a range with the lower limit being 75%, preferably 80%, more preferably 90%, most preferably 95% of the stability of a double-stranded section composed of 4 G:C base pairs and one G:U base pair or a section composed of 10 A:U base pairs and one G:U base pair and the upper limit being 125%, preferably 120%, more preferably 110%, most preferably 105% of the stability of a double-stranded section composed of 8 G:C base pairs and one G:U base pair or a section composed of 20 A:U base pairs and one G:U base pair.
- each fully double-stranded section comprises only one G:U base pair in the center of the fully double-stranded section.
- the center of the section is base pair number n+1.
- the center of the section can be either base pair number n or n+1.
- the poly/oligonucleotide is a double-stranded poly/oligonucleotide.
- the double-stranded poly/oligonucleotide is fully double-stranded.
- “fully double-stranded” it is meant within the context of this preferred embodiment that the two strands forming the poly/oligonucleotide have the same length and have sequences which are 100% complementary to each other.
- one strand in the double strand contains, preferably consists of, n G's
- p equals 1 and U is in the center of the strand containing or consisting of U and C's.
- one strand in the double strand contains, preferably consists of, n U's
- p equals 1 and G is in the center of the strand containing or consisting of G and A's.
- the position of the G-U base pairs in the double stranded poly/oligonucleotides as defined herein is not limited and may be at any position well-off the center in the double stranded section, preferably the G-U base pairs are located in the center in the double stranded section.
- the double-stranded section preferably contains uridines (one or multiple) exclusively in the form of G•U base pairs.
- a fully double-stranded poly/oligonucleotide examples include: G 5 + C 2 UC 2 (CCUCC), G 6 + C 3 UC 2 (CCCUCC), G 6 + C 2 UC 3 (CCUCCC), G 7 + C 3 UC 3 (CCCUCCC), G 8 + C 4 UC 3 (CCCCUCCC), G 8 + C 3 UC 4 (CCCUCCCC), G 9 + C 4 UC 4 (CCCCUCCCC), U 11 + A 5 GA 5 , U 12 + A 6 GA 5 , U 12 + A 5 GA 6 , U 13 +A 6 GA 6 , U 14 + A 7 GA 6 , U 14 + A 6 GA 7 , U 15 + A 7 GA 7 , U 16 + A 8 GA 7 , U 16 + A 7 GA 8 , U 17 + A 8 GA 8 , U 18 +A 9 GA 8 , U 18 + A 8 GA 9 , U 19 + A 9 GA 9 , U 20 + A 10 GA 9 , U 20 +A 9 GA 10 , U 21
- the double-stranded poly/oligonucleotide is partially double-stranded.
- partially double-stranded it is meant that the two strands forming the poly/oligonucleotide have different lengths, sequences which are not 100% complementary to each other, or both.
- the fully double-stranded section is connected with a single-stranded structure at one or both ends.
- one strand in the double strand contains, preferably consists of, n G's
- n is less than or equal to 100. In another embodiment, n is greater than 100, preferably greater than 1000.
- n may be different in different poly/oligonucleotide molecules.
- a poly/oligonucleotide preparation of the present invention may contain a mixture of molecules, which have different length in the one strand which contains or consists of n G's.
- the G-containing strand is a poly-guanosine (polyG or pG) containing about 3000-5000 G's obtained by conventional enzymatic processes, such as polynucleotide phosphorylase (PNPase) enzymatic reaction.
- PNPase polynucleotide phosphorylase
- p equals 1 and U is in the center of the strand containing or consisting of U's and C's.
- one strand in the double strand contains, preferably consists of, n U's
- n is less than or equal to 100. In another embodiment, n is greater than 100, preferably greater than 1000.
- n may be different in different poly/oligonucleotide molecules.
- a poly/oligonucleotide preparation of the present invention may contain a mixture of molecules, which have different length in the one strand which contains or consists of n U's.
- the U-containing strand is a poly-uridine (polyU or pU) comprising about 3000-5000 U's obtained by conventional enzymatic processes, such as polynucleotide phosphorylase (PNPase).
- PNPase polynucleotide phosphorylase
- p equals 1 and G is in the center of the strand containing or consisting of G and A's.
- Examples of a partially double-stranded poly/oligonulceotide include:
- n is greater than 1000, more preferably greater than 3000, most preferably about 3000-5000 in the examples above.
- Gn is polyG containing about 3000-5000 G's and obtained from conventional enzymatic processes, such as polynucleotide phosphorylase (PNPase) enzymatic reaction.
- PNPase polynucleotide phosphorylase
- the poly/oligonucleotide is a single-stranded poly/oligonucleotide.
- the single-stranded poly/oligonucleotide is completely self-complementary.
- completely self-complementary it is meant that the 5' half of the molecule is 100% complementary to the 3' half of the molecule. As a result, the molecule forms a single fully double-stranded section.
- p equals 1 and U is in the center of the half containing or consisting of U and C's.
- p equals 1 and G is in the center of the half containing or consisting of G and A's.
- Examples of a completely self-complementary single-stranded poly/oligonucleotide include: C 2 UC 2 G 5 C 3 UC 2 G 6 , C 2 UC 3 G 6 , C 3 UC 3 G 7 , C 4 UC 3 G 8 , C 3 UC 4 G 8 , C 4 UC 4 G 9 , G 5 C 2 UC 2 , G 6 C 3 UC 2 , G 6 C 2 UC 3 , G 7 C 3 UC 3 , G 8 C 4 UC3, G 8 C 3 UC 4 , G 9 C 4 UC 4 , A 5 GA 5 U 11 , A 6 GA 5 U 12 , A 5 GA 6 U 12 , A 6 GAsU 13 , A 7 GA 6 U 14 , A 6 GA 7 U 14 , A 7 GA 7 U 15 , A 8 GA 7 U 16 , A 7 GAaU 16 , A 8 GA 8 U 17 , A 9 GA 8 U 18 , A 8 GA 9 U 18 , A 9 GA 9 U 19 , A 10
- the single-stranded poly/oligonucleotide has at least one stem-and-loop structure, and the at least one fully double-stranded section is the stem of the at least one single-stranded poly/oligonucleotide.
- stem-and-loop structure can be readily predicted by a person skilled in the art on the basis of the nucleotide sequence of the poly/oligonucleotide and experimentally verified by methods known in the art.
- a ssRNA oligonculeotide can be digested with a single-strand-specific RNase and analysed on a denaturing gel.
- the exact size and the sequence of the loop are not critical; it is only critical that the loop does not adversely affect the formation and the stability of the stem.
- the present invention relates to poly/oligonucleotides having a structure defined by the following general formula I: X n G/UV m N o W m U/G Y n (Formula I),
- the total length of the RNA containing the pattern of Formula I is preferably 15 to 45 bases.
- Preferred poly/oligonucleotides of the invention have a structure defined by the following general formula II and III, defining two separate RNA strands containing the cassettes: 5'X n G/U V m 3' (Formula II) 5' o W m U/G Y n 3' (Formula III),
- the total lenght of these separate RNA strands of Formula II and III is preferably 5 bases to 45 bases.
- Most preferred poly/oligonucleotides of the invention having at least one stem-and-loop structure have a structure defined by the following general formula II and III, defining two separate RNA strands containing the cassettes: 5'X n G/U V m 3' (Formula II) 5' o W m U/G Y n 3' (Formula III),
- a preferred total length of these separate RNA strands is 5 bases to 45 bases.
- RNA poly/oligonucleotide as defined above allows the generation of RNAs having TLR7 and TLR8 activity.
- p equals 1 and U is in the center of the portion containing or consisting of U and C's.
- n is greater than 100, preferably greater than 1000, more preferably greater than 3000, most preferably on the order of 3000-5000. In certain embodiments, n may be different in different molecules in a poly/oligonucleotide preparation of the present invention. In a preferred embodiment, p equals 1 and U is in the center of the portion containing or consisting of U and C's.
- p equals 1 and G is in the center of the portion containing or consisting of G and A's.
- n is greater than 100, preferably greater than 1000, more preferably greater than 3000, most preferably on the order of 3000-5000. In certain embodiments, n may be different in different molecules in a poly/oligonucleotide preparation of the present invention. In a preferred embodiment, p equals 1 and G is in the center of the portion containing or consisting of G and A's.
- Examples of a single-stranded poly/oligonucleotide having at least one stem-and-loop structure include:
- n is greater than 1000, more preferably 3000, even more preferably on the order of 3000-5000 in the examples above.
- the present invention also provides RNA poly/oligonucleotides that have the properties of activating TLR7 via the herein described G•U containing cassettes, but do not require additional facilitators of cellular uptake (e.g. lipids, poly cations, transfection reagents). These RNA poly/oligonucleotides form at least one G•U cassette when hybridized or connected via a loop to a highly G rich strand. G rich strands are either obtained by standard synthesis (preferred length 20 - 100 bp), or by enzymatic synthesis with an optimal length between 1000 and 5000 bases.
- RNA polynucleotide phosphorylase
- the present invention also provides Um + Gn which is capable of inducing an immune response, in particular anti-viral response, more particular a type I IFN response, more specifically, an IFN- ⁇ response, wherein both, m and n, are integers between 1000-5000, and wherein m is greater than or equal to n.
- These nucleic acids are generated enzymatically by Polynucleotide Phosphorylase (PNPase).
- the poly/oligonucleotide of the invention is specifically recognized by and/or specifically activates TLR7 without being recognized by or activating TLR8.
- Activitity conferred by the G:U base pair can be readily determined by testing the RNA poly/oligonucleotide of the invention (such as those consisting exclusively of G•U and G:C base pairs), whether the immune stimulatory activity is lost when either one of the following mutations is applied: a) The U of all G•U base pairs and the G of flanking G:C base pairs swap positions (in this test the overall base composition is maintained) or b) The G of all G•U base pairs is mutated to A.
- Binding of a poly/oligonucleotide to TLR7 and/or TLR8 can be readily determined by methods known in the art.
- a poly/oligonucleotide conjugated to a label e.g., a radioactive molecule, a fluorescent molecule, an enyzme
- a label e.g., a radioactive molecule, a fluorescent molecule, an enyzme
- the binding of the labelled poly/oligonucleotide to TLR7 and/or TLR8 may be determined using techniques such as gel electrophoresis, microscopy, X-ray chrystallography.
- Activation of TLR7 and/or TLR8 by a poly/oligonucleotide can also be readily determined by methods known in the art.
- TLR7 and/or TLR8 can be stimulated with a poly/oligonucleotide, and the production of type I IFN (in particular, IFN- ⁇ ) and IL-12 can be used as readouts for the activation of TLR7 and TLR8, respectively.
- PDCs obtained from wild-type, TLR7 -/- and TLR8 -/- mice are ideal for such tests.
- Activation of TLR7 and/or TLR8 upon stimulation by a poly/oligonucleotide can also readily determined by detecting Overexpression of human and/or mouse TLR7 or TLR8 in non-immune reporter cells (e.g. HEK293T cells). Gene silencing may be used to reduce TLR7/8 expression.
- G:U base pairs can be introduced without an expected penalty to the silencing activity, as long as the alterations to introduce G•U base pairs are limited to the sense strand.
- the G•U base pair containing cassettes as defined herein may also be inserted into RNAs that exert an additional function, for example siRNA, ribozymes, aptamers.
- the poly/oligonucleotide may contain any naturally-occurring, synthetic, modified nucleotides, or a mixture thereof, as long as the synthetic and/or modified nucleotides do not compromise (i.e., reduce) the type I IFN-inducing activity of the poly/oligonucleotide.
- the poly/oligonucleotide may contain any naturally-occurring, synthetic, modified internucleoside linkages, or a mixture thereof, as long as the linkages do not compromise the type I IFN-inducing activity of the poly/oligonucleotide.
- RNA poly/oligonucleotide showing selective TLR8 activity, wherein the U nucleoside in the G:U wobble base pair is adjacent on each side to G bases.
- the RNA poly/oligonucleotide showing selective TLR8 activity may be single stranded or partially double stranded.
- the RNA poly/oligonucleotide having G nucleoside in the G-U wobble base pair adjacent to C nucleoside at each side of the G:U wobble base pair forms a hairpin structure as defined herein, wherein n is between 5 and 100, preferably 20 and 100, and.
- Said RNA poly/oligonucleotide shows highly selective TLR8 activity.
- RNA poly/oligonucleotide showing selective TLR8 activity preferably has at least 2 adjacent base pairs on each side of the G:U wobble base pair.
- selective TLR8 activity means the RNA poly/oligonucleotide as defined above shows TLR8 activity but no TLR7 activity.
- TLR7-specific ligands also include poly/oligonucleotides capable of inducing an immune response that comprise at least one uridine, preferably polyuridine, that is/are not involved in RNA base pairing, wherein the immune response, preferably a type I IFN response, is enhanced by the addition of exogenous G nucleoside, whereby base pairing with guanosine nucleoside enhances the activity of uridine to activate.
- the poly/oligonucleotide may be modified covalently or non-covalently to improve its chemical stability, resistance to nuclease degradation, ability to across cellular and/or subcellular membranes, target (organ, tissue, cell type, subcellular compartment)-specificity, pharmacokinetic properties, biodistribution, or any combinations thereof.
- phosphorothioate linkage(s) and/or pyrophosphate linkage(s) may be introduced to enhance the chemical stability and/or the nuclease resistance of an RNA poly/oligonucleotide.
- the poly/oligonucleotide may be covalently linked to one or more lipophilic group(s) or molecule(s), such as a lipid or a lipid-based molecule, preferably cholesterol or a derivative thereof.
- the modification does not comprise the type I IFN-inducing activity of the poly/oligonucleotide.
- a reduction in the type I IFN-inducing activity of the poly/oligonucleotide caused by the modification is off-set by an increase in the stability and/or delivery and/or other properties as described above.
- the poly/oligonucleotide of the present invention may have one or more of the features described above in any combinations.
- the present invention also provides a poly/oligonucleotide preparation comprising at least one poly/oligonucleotide of the present invention.
- the poly/oligonucleotide preparation of the present invention may comprise two or more different poly/oligonucleotides.
- the two or more different poly/oligonucleotides comprised in the same preparation share the same fully double-stranded section and have similar structure.
- the variations in the chemical compositions of the poly/oligonucleotides in a preparation may result from the method of preparation.
- the present invention provides a pharmaceutical composition
- a pharmaceutical composition comprising at least one of the RNA polynucleotide or oligonucleotide (poly/oligonucleotide) of the invention described above and a pharmaceutically acceptable carrier.
- At least one it is meant that one or more poly/oligonucleotide preparation(s) of the same or different poly/oligonucleotide(s) can be used together.
- the pharmaceutical composition further comprises an agent, which facilitates the delivery of the poly/oligonucleotide into a cell, in particular, into the endosomal compartments of the cell.
- the delivery agent is a complexation agent, which forms a complex with the poly/oligonucleotide and facilitates the delivery of the poly/oligonucleotide into cells.
- Complexation agents are also referred to as "transfection agents" in the art. Any complexation agent, which is compatible with the intended use of the pharmaceutical composition can be employed. Examples for transfection agents are Protamine(s). Examples of complexation agents include polymers and biodegradable microspheres.
- the polymer is preferably a cationic polymer, more preferably a cationic lipid. Examples of a polymer include polyethylenimine (PEI) such as in vivo -jetPEITM (PolyPlus) and collagen derivatives.
- PEI polyethylenimine
- PolyPlus polyethylenimine
- biodegradable microspheres examples include liposomes, virosomes, stable-nucleic-acid-lipid particles (SNALPs), ISCOMATRIX ® (CSL Limited), and poly (D,L-lactide-co-glycolide) copolymer (PLGA) microspheres.
- SNALPs stable-nucleic-acid-lipid particles
- ISCOMATRIX ® CSL Limited
- PLGA poly (D,L-lactide-co-glycolide) copolymer
- the delivery agent is a virus, preferably a replication-deficient virus.
- the poly/oligonucleotide to be delivered is contained in the viral capsule and the virus may be selected based on its target specificity.
- useful viruses include polymyxoviruses which target upper respiratory tract epithelia and other cells, hepatitis B virus which targets liver cells, influenza virus which targets epithelial cells and other cells, adenoviruses which targets a number of different cell types, papilloma viruses which targets epithelial and squamous cells, herpes virus which targets neurons, retroviruses such as HIV which targets CD4 + T cells, dendritic cells and other cells, modified Vaccinia Ankara which targets a variety of cells, and oncolytic viruses which target tumor cells.
- oncolytic viruses include naturally occurring wild-type Newcastle disease virus, attenuated strains of reovirus, vesicular stomatitis virus (VSV), and genetically engineered mutants of herpes simplex virus type 1 (HSV-1), adenovirus, poxvirus and measles virus.
- the poly/oligonucleotide and/or the pharmaceutical composition can be delivered into cells via physical means such as electroporation, shock wave administration, ultrasound triggered transfection, and gene gun delivery with gold particles.
- the pharmaceutical composition may further comprise another agent such as an agent that stabilizes the oligonucleotide.
- a stabilizing agent include a protein that complexes with the oligonucleotide to form an iRNP, chelators such as EDTA, salts, and RNase inhibitors.
- the pharmaceutical composition further comprises one or more pharmaceutically active therapeutic agent(s).
- a pharmaceutically active agent include immunostimulatory agents, anti-viral agents, antibiotics, anti-fungal agents, anti-parasitic agents, anti-tumor agents, cytokines, chemokines, growth factors, anti-angiogenic factors, chemotherapeutic agents, antibodies and gene silencing agents.
- the pharmaceutically active agent is selected from the group consisting of an immunostimulatory agent, an anti-viral agent and an anti-tumor agent.
- the more than one pharmaceutically active agents may be of the same or different category.
- the pharmaceutical composition may be formulated in any way that is compatible with its therapeutic application, including intended route of administration, delivery format and desired dosage.
- Optimal pharmaceutical compositions may be formulated by a skilled person according to common general knowledge in the art, such as that described in Remington's Pharmaceutical Sciences (18th Ed., Gennaro AR ed., Mack Publishing Company, 1990 ).
- the pharmaceutical composition may be formulated for instant release, controlled release, timed-release, sustained release, extended release, or continuous release.
- the pharmaceutical composition may be administered by any route known in the art, including, but not limited to, topical, enteral and parenteral routes, provided that it is compatible with the intended application.
- Topic administration includes, but is not limited to, epicutaneous, inhalational, intranasal, vaginal administration, enema, eye drops, and ear drops.
- Enteral administration includes, but is not limited to, oral, rectal administration and administration through feeding tubes.
- Parenteral administration includes, but is not limited to, intravenous, intraarterial, intramuscular, intracardiac, subcutaneous, intraosseous, intradermal, intrathecal, intraperitoneal, transdermal, transmucosal, and inhalational administration.
- a preferred route of administration is an intra or peritumoral injection.
- the pharmaceutical composition is for local (e.g., mucosa, skin) applications, such as in the form of a spray (i.e., aerosol) preparation.
- a spray i.e., aerosol
- the pharmaceutical composition may be used for prophylactic and/or therapeutic purposes.
- a spray i.e., aerosol
- aerosol i.e., aerosol
- the present invention also relates to prodrugs of the herein defined RNA poly/oligonucleotides having immune-stimmulatory activity.
- An Example for a suitable prodrug is a linear RNA which is designed to form dsRNA sections containing G•U as a central secondary structure.
- Further prodrugs of the RNA poly/oligonucleotide as defined herein include RNA poly/oligonucleotides which are chemically modified in either the G or the U in a fashion that in an organism the RNA poly/oligonucleotide is reverted to the active G and/or U, for example derivates of G and/or U that form an G•U equivalent.
- the optimal dosage, frequency, timing and route of administration can be readily determined by a person skilled in the art on the basis of factors such as the disease or condition to be treated, the severity of the disease or condition, the age, gender and physical status of the patient, and the presence or absence of previous treatment.
- the present application provides the in vitro use of the RNA poly/oligonucleotide of the invention described above.
- the present application provides the use of at least one poly/oligonucleotide for inducing an anti-viral response, in particular, a type I IFN response, more specifically, an IFN- ⁇ response, in vitro.
- the present invention provides an in vitro method for stimulating an anti-viral response, in particular, a type I IFN response, more specifically, an IFN- ⁇ response in a cell, comprising the steps of:
- the present invention provides an alternative in vitro method for stimulating an anti-viral response, in particular, a type I IFN response, more specifically, an IFN- ⁇ response in a cell, comprising the steps of: contacting a cell with at least one poly/oligonucleotide of the invention described above, which is optionally mixed with a complexation agent, wherein the cell expresses TLR7 and is capable of producing an anti-viral response upon TLR7 activation.
- the cells may express TLR7 endogenously and/or exogenously from an exogenous nucleic acid (RNA or DNA).
- the exogenous DNA may be a plasmid DNA, a viral vector, or a portion thereof.
- the exogenous DNA may be ingerated into the genome of the cell or may exist extra-chromosomally.
- the cells include, but are not limited to, primary immune cells, primary non-immune cells, and cell lines.
- Immune cells include, but are not limited to, peripheral blood mononuclear cells (PBMC), plasmacytoid dendritric cells (PDC), myeloid dendritic cells (MDC), macrophages, monocytes, B cells, natural killer cells, granulocytes, CD4+ T cells, CD8+ T cells, and NKT cells.
- PBMC peripheral blood mononuclear cells
- PDC plasmacytoid dendritric cells
- Non-immune cells include, but are not limited to, fibroblasts, endothelial cells, epithelial cells, and tumor cells. Cell lines may be derived from immune cells or non-immune cells, which do or do not express TLR7 endogenously.
- TLR7 Whether a cell expresses TLR7 can be readily determined by a skilled person using standard techniques such as western blotting, RT-PCR, and northern blotting.
- Whether a cell is capable of producing an anti-viral response upon TLR7 activation can be readily determined by a skilled person using a known TLR7 ligand and standard assays for cytokine detection such as ELISA, quantitative or semi-quantitative RT-PCR.
- the present application provides the in vivo use of the RNA poly/oligonucleotide of the invention described above.
- the present application provides at least one RNA poly/oligonucleotide for inducing an anti-viral response, in particular, a type I IFN response, more specifically, an IFN- ⁇ response, in a vertebrate animal, in particular, a mammal.
- the present application further provides at least one RNA poly/oligonucleotide for preventing and/or treating a disease and/or disorder in a vertebrate animal, in particular, a mammal, in medical and/or veterinary practice.
- the present application further provides RNA poly/oligonucleotides for enhancing humoral immunity.
- the invention also provides RNA poly/oligonucleotides enhancing antigen-specific T-cell response.
- the invention also provides at least one RNA poly/oligonucleotide for use as a vaccine adjuvant.
- the RNA poly/oligonucleotides are further useful as prophylactic or therapeutic vaccines.
- the present application provides the use of at least one RNA poly/oligonucleotide for the preparation of a pharmaceutical composition for inducing an anti-viral response, in particular, a type I IFN response, more specifically, an IFN- ⁇ response, in a vertebrate animal, in particular, a mammal.
- the present application further provides the use of at least one RNA poly/oligonucleotide for the preparation of a pharmaceutical composition for preventing and/or treating a disease and/or disorder in a vertebrate animal, in particular, a mammal, in medical and/or veterinary practice.
- the disease or disorder is one that can be prevented or treated by type I IFN.
- the diseases and/or disorders include, but are not limited to, infections, tumors/cancers, and immune disorders.
- Infections include, but are not limited to, viral infections, bacterial infections, anthrax, parasitic infections, fungal infections and prion infection.
- Viral infections include, but are not limited to, infections by hepatitis C, hepatitis B, influenza virus, herpes simplex virus (HSV), human immunodeficiency virus (HIV), respiratory syncytial virus (RSV), vesicular stomatitis virus(VSV), cytomegalovirus (CMV), poliovirus, encephalomyocarditis virus (EMCV), human papillomavirus (HPV) and smallpox virus.
- the infection is an upper respiratory tract infection caused by viruses and/or bacteria, in particular, flu, more specifically, bird flu.
- Bacterial infections include, but are not limited to, infections by streptococci, staphylococci, E. coli , and pseudomonas.
- the bacterial infection is an intracellular bacterial infection, which is an infection by an intracellular bacterium such as mycobacteria (tuberculosis), chlamydia, mycoplasma, listeria, and a facultative intracelluar bacterium such as Staphylococcus aureus.
- Parasitic infections include, but are not limited to, worm infections, in particular, intestinal worm infection.
- the infection is a viral infection or an intracellular bacterial infection.
- the infection is a viral infection by hepatitis C, hepatitis B, influenza virus, RSV, HPV, HSV1, HSV2, and CMV.
- Tumors include both, benign and malignant tumors (i.e., cancer). Cancers include, but are not limited to biliary tract cancer, brain cancer, breast cancer, cervical cancer, choriocarcinoma, colon cancer, endometrial cancer, esophageal cancer, gastric cancer, intraepithelial neoplasm, leukemia, lymphoma, liver cancer, lung cancer, melanoma, myelomas, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, sarcoma, skin cancer, testicular cancer, thyroid cancer and renal cancer.
- cancers include, but are not limited to biliary tract cancer, brain cancer, breast cancer, cervical cancer, choriocarcinoma, colon cancer, endometrial cancer, esophageal cancer, gastric cancer, intraepithelial neoplasm, leukemia, lymphoma, liver cancer, lung cancer, melanoma, myelomas,
- the cancer is selected from hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia, chronic myeloid leukemia, non-Hodgkin's lymphoma, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, renal cell carcinoma, prostate carcinoma, bladder cell carcinoma, breast carcinoma, ovarian carcinoma, non-small cell lung cancer, small cell lung cancer, hepatocellular carcinoma, basaliom, colon carcinoma, cervical dysplasia, and Kaposi's sarcoma (AIDS-related and non-AIDS related).
- hairy cell leukemia chronic myelogenous leukemia, cutaneous T-cell leukemia, chronic myeloid leukemia, non-Hodgkin's lymphoma, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, renal cell carcinoma, prostate carcinoma, bladder cell carcinoma, breast carcinoma, ova
- Immune disorders include, but are not limited to, allergies, autoimmune disorders, and immunodeficiencies. Allergies inlclude, but are not limited to, respiratory allergies, contact allergies and food allergies.
- Autoimmune diseases include, but are not limited to, multiple sclerosis, diabetes mellitus, arthritis (including rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, psoriatic arthritis), encephalomyelitis, myasthenia gravis, systemic lupus erythematosis, autoimmune thyroiditis, dermatisis (including atopic dermatitis and eczematous dermatitis), psoriasis, Siogren's Syndrome, Crohn's disease, aphthous ulcer, ulceris, conjunctivitis, keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma, cutaneous lupus erythematosus, scleroderma, vaginitis, proctitis, drug eruptions, leprosy reversal reactions, erythema nodosum leprosum, allergic encephalomye
- Immunodeficiencies include, but are not limited to, spontaneous immunodeficiency, acquired immunodeficiency (including AIDS), drug-induced immunodeficiency or immunosuppression (such as that induced by immunosuppressants used in transplantation and chemotherapeutic agents used for treating cancer), and immunosuppression caused by chronic hemodialysis, trauma or surgical procedures.
- the immune disorder is multiple sclerosis.
- the poly/oligonucleotide is used in combination with a delivery agent.
- the delivery agent is a complexation agent, wherein the poly/oligonucleotide and the complexation agent form a complex.
- the delivery agent is a replication-deficient virus, wherein the poly/oligonucleotide is encapsulated in the viral capsule.
- the poly/oligonucleotide is used without a delivery agent.
- the poly/oligonucleotide, with or without a delivery agent is used in combination with one or more pharmaceutically active agents such as immunostimulatory agents, anti-viral agents, antibiotics, anti-fungal agents, anti-parasitic agents, anti-tumor agents, cytokines, chemokines, growth factors, anti-angiogenic factors, chemotherapeutic agents, antibodies and gene silencing agents.
- the pharmaceutically active agent is selected from the group consisting of an immunostimulatory agent, an anti-viral agent and an anti-tumor agent.
- the more than one pharmaceutically active agents may be of the same or different category.
- the poly/oligonucleotide with or without a delivery agent, is used in combination with an anti-viral vaccine, an anti-bacterial vaccine, and/or an anti-tumor vaccine, wherein the vaccine can be prophylactic and/or therapeutic.
- the poly/oligonucleotide can serve as a vaccine adjuvant.
- the pharmaceutical composition is for use in combination with one or more prophylactic and/or therapeutic treatments of diseases and/or disorders such as infection, tumor, and immune disorders.
- the treatments may be pharmacological and/or physical (e.g., surgery, radiation).
- the poly/oligonucleotide comprising at least one uridine that is not involved in base pairing is used in combination with exogenous G nucleoside.
- used in combination means simultaneously or consecutively by suitable route of administration as defined herein above.
- Vertebrate animals include, but are not limited to, fish, amphibians, birds, and mammals. Mammals include, but are not limited to, rats, mice, cats, dogs, horses, sheep, cattle, cows, pigs, rabbits, non-human primates, and humans. In a preferred embodiment, the mammal is human.
- the present invention is illustrated by the following Examples.
- the Examples are for illustration purpose only and shall not be construed to limit the scope of the invention.
- RNA oligonucleotides or oligoribonucleotides were obtained from Eurogentec or Biomers.
- the CpG-containg DNA oligonucleotides or oligodeoxyribonucleotides (ODNs) CpG-ODN 2216 and CpG-ODN 2336 were purchased from Invitrogen.
- Polyriboinosinic:polyribocytidilic acid (pl:C) and Homopolymers poly G/U/A was obtained from Sigma-Aldrich.
- ORNs were resuspended in sterile endotoxin-free DEPC-treated water (Invitrogen), and CpG-ODNs were resuspended in 0.9 % NaCl aqueous solution (Braun). To prevent contamination, all oligonucleotides were stored and handled under aseptic conditions. The sequences of the oligonucleotides are listed in Table I and II. Nucleic acids were suspended in sterile endotoxin free DEPC-water (Invitrogen, Düsseldorf).
- dsRNA oligonucleotides were generated by mixing two ssRNA oligonucleotides (ss ORNs) in a ratio of 1:1 (w/w) at a concentration of 1 ⁇ g/ ⁇ l. Unless indicated otherwise, nucleic acids were hybridized at a ratio of 1:1 (w/w).
- ORN and "R” are used interchangeably in the following to signify an RNA oligonucleotide.
- R805 and ORN805 refer to the same RNA oligonucleotide.
- Table I ORN Sequence (5'->3') SEQ ID NO: Figure A 8 AAAAAAAA 1 2 C 8 CCCCCCCC 2 2 G 8 GGGGGG 3 G 21 GGGGGGGGGGGGGGGGGGG 4 1,2,4,6 U 21 UUUUUUUUUUUUUUUUUUUUUUUUUUU 5 3,4 U 21 S 6 1 A 21 AAAAAAAAAAAAAAAAAAAAAAAAAAA 7 2 C 21 CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC 8 2 CCCUCC 9 2 CCCUCCC 10 2 R805 CCCCUCCC 11 2-6 CCCCCCCC 12 2 CCCCUCCCCC 13 2 CCCCCCUCCCCCCCCC 14 2 CCCCCCCCCCC
- PBMCs Human PBMCs were prepared from blood of healthy male and female donors. Fresh Buffy-Coats were obtained from the Institute of Experimental Hematology and Transfusion Medicine of the University Bonn (Bonn, Germany). PBMCs were purified by biocoll density gradient centrifugation (Biochrom AG). PDC were isolated by using the MACS CD304 (BDCA-4/Neuropilin-1)-MicroBead Kit (Miltenyi, Bergisch Gladbach). Monocytes were prepared by depleting PDC and using the Monocyte Isolation Kit II (Miltenyi). The purity of PDCs and monocytes was determined by antibody (obtained from BD Bioscience, Heidelberg and Miltenyi) staining followed by flow cytometric (FACS) analysis and was typically >90%.
- Cells were isolated from bone marrow of wild-type or TLR7 -/- mice. Cells were cultured in RPMI 1640 supplemented with 10% FCS, 0.1 mM MEM non-essential amino acids, 1mM MEM sodium pyruvate (all from Gibco), 2mM L-glutamine (Cambrex BioWhittaker), 100 U/ml Penicillin, 100 ⁇ g/ml Streptomycin (PAA Laboratories GmbH) and 20 ng/ml FMS related tyrosine kinase 3 ligand (rFLT3-L) R&D systems. After 7 days, non-adherent cells were collected and the PDCs were isolated by MACS-separation using B220-MicroBeads (Miltenyi).
- Human cells were cultured in RPMI 1640 (Gibco) supplemented with 2% human serum (Cambrex, BioWhittaker), 2 mM L-glutamine (Cambrex, BioWhittaker), 100 U/ml Penicillin and 100 ⁇ g/ml Streptomycin (PAA Laboratories GmbH) in 96-well flat-bottem plates.
- the density of human PBMCs and human monocytes was 4x10 5 cells/200 ⁇ l per well, and the density of human PDC was 4x10 4 cells/200 ⁇ l per well.
- Mouse PDCs were cultured in 96-well flat-bottom plates in RPMI 1640 supplemented with 10% FCS, 0.1 mM MEM non-essential amino acids, 1 mM MEM sodium pyruvate (all from Gibco), 2 mM L-glutamine (Cambrex BioWhittaker), 100 U/ml Penicillin and 100 ⁇ g/ml Streptomycin (PAA Laboratories GmbH).
- the density of mouse pDC was 4x10 4 cells/200 ⁇ l per well.
- Stimulations were performed in triplicate in 96-well flat-bottom plates (Nunc, Langenselbold) with a 200 ⁇ l total volume, and incubated for 20 h at 37°C, 5 % CO 2 .
- homopolymers, ORN or CpG-ODN were complexed to the polycation Poly-I-arginine (P4663 by Sigma-Aldrich) and used at a final concentration of 1 ⁇ g/ml.
- Poly I:C was transfected with TransIT-LT1 (Mirus, Madison).
- Mouse PDC were transfected with ORN or CpG-ODN using the Dotap liposomal transfection reagent (Roth, Düsseldorf).
- Human cells were cultured in RPMI 1640 (Gibco, Düsseldorf) supplemented with 2% human serum (Cambrex BioWhittaker, New Jersey), 2 mM L-glutamine (Cambrex BioWhittaker), 100 U/ml Penicillin and 100 ⁇ g/ml Streptomycin (PAA Laboratories GmbH, Pasching). Cells were plated in 96 well plates at a density of 4x10 5 cells/200 ⁇ l for human PBMC and monocytes, and 4x10 4 cells/200 ⁇ l for PDC.
- Mouse PDC were cultured in RPMI 1640 supplemented with 10 % FCS, 0,1 mM MEM non-essential amino acids, 1 mM MEM sodium pyruvate (all from Gibco), 2 mM L-glutamine (Cambrex BioWhittaker), 100 U/ml Penicillin , 100 ⁇ g/ml Streptomycin (PAA Laboratories GmbH) at a density of 4x10 4 cells/200 ⁇ l. Supernatants were removed and assayed for cytokine production.
- Wild-type mice were injected i.v. with 25 ⁇ g ORN formulated with 125 ⁇ g Dotap. Mice were bled 3h, 5 h and 8h post-injection via the tail vein. Serum was purified and the IFN- ⁇ level was measured.
- Supernatants from human or mouse cells were harvested 20 h after stimulation. If not used immediately, supernatants were frozen at -20°C until used. IFN- ⁇ and/or IL-12p70 were analysed in the supernatant by ELISA.
- the human IFN- ⁇ ELISA was purchased from Bender MedSystems (Vienna), and the human IL-12p70 ELISA from BD Biosciences. Murine IFN- ⁇ in the supernatants of stimulated mouse cells or in mice sera was measured by the mouse IFN- ⁇ ELISA Kit (PBL Biomedical Laboratories).
- Results are expressed as mean ⁇ standard error of mean (s.e.m.). Group comparisons were carried out using a two-tailed Student's t-test with an expected unequal variance.
- Example 1 Poly uridine (polyU, pU)-stimulated IFN- ⁇ induction is enhanced by the formation of double strands via G:U base pairing.
- PBMCs Human peripheral blood mononuclear cells
- purified PDCs were stimulated with pU, pG, either in the form of an ssRNA or dsRNA
- ssRNA Single stranded
- ds double stranded
- polyU was found to stimulate IFN- ⁇ production from both human PBMCs ( Fig.
- Example 2 The presence of a single G:U base pair in RNA stem structure is sufficient to induce high levels of type I IFN.
- 21mer ORNs were designed by the inventors comprising A's and one or two G(s).
- the pairing with oligo A 21 nucleotides in length (A 21 ) led to a reduction in the IFN- ⁇ -inducing activity of pU and the pairing with oligo G 21 nucleotides in length (G 21 ) led to an increase in the IFN- ⁇ -inducing activity of pU, further supporting a contribution of G•U base pairs.
- RNA oligonucleotides of different lengths consisting of A's around a central G, and tested whether the number of neighbouring base pairs influenced the IFN- ⁇ -inducing activity of the G:U base pair.
- a range of ORNs having 7-8 A's flanking the central G, showed IFN- ⁇ -inducing activity ( Figure 2B ).
- the G•U containing dsRNA pU+R1602 was selected for subsequent experiments ( Figure 2A ).
- ORNs consisting of two stretches of C's around a central U were designed by the inventorsSurprisingly, the highest IFN- ⁇ -inducing activity was observed when pG was paired with ORNs containing 2-5 C's flanking the central G; any further increase in the number of flanking C's resulted in a drastic decrease and eventual abolishment of the IFN- ⁇ -inducing activity of the partially double-stranded RNA ( Figure 2C ).
- IFN- ⁇ -inducing activity of partially double stranded RNAs formed by pG and ORN805 (CCCCUCCC) mixed at different weight ratios was tested.
- pG and ORN805 were mixed at a ratio of 1:1 (w/w)
- a step-wise reduction in the amount of ORN805 would be expected to result in a step-wise increase in abundance of single-stranded structures.
- maximal IFN- ⁇ -inducing activity was maintained up to a pG:ORN805 ratio of 20:1 (w/w).
- IFN- ⁇ -inducing activity was maintained down to a ratio of 100:1 which corresponds to one G•U base pair in 80 to 100 bases of RNA. This indicates that few short RNA stems (8mer) containing very few G•U wobble base pairs within long ssRNA are sufficient for detection by TLR7 in PDC.
- ssRNAs comprising short double-stranded structures containing G:U base pairs, rather than dsRNAs, are capable of inducing the production of type I IFN from human PBMCs and PDCs.
- Type I IFN production in response to ssRNA oligonucleotides in both, human and mouse, PDCs has been shown to depend on TLR7 [7].
- Toll-like receptors able to recognize nucleic acid ligands are located in the endosomal compartment and their activation can be blocked by chloroquine, which inhibits the acidification of the endosomes.
- chloroquine which inhibits the acidification of the endosomes.
- the recognition of nucleic acids by cytosolic helicases such as RIG-I (retinoic inducible gene I) and MDA-5 (melanoma differentiation antigen 5) are not sensitive to chloroquine (Gitlin L et al, 2006).
- mice were prepared to confirm the requirement of TLR7; consistent with the results in human immune cells ( Figure 1 and 2 ).
- pG:pU and pG+R805 were used to induce IFN- ⁇ in murine PDC derived from bone marrow cultures in vitro ( Figure 3B ).
- Addition of R1602 strongly enhanced IFN- ⁇ levels.
- Injection of G•U containing RNAs in complex with Dotap in mice in vivo induced a systemic type I IFN response ( Figure 3C ).
- RNA ligands activate both TLR7 and TLR8 As a result, stimulation of PBMCs with these RNA ligands leads to TLR7-dependent production of IFN- ⁇ in PDCs as well as TLR8-dependent production of IL-12 mostly in monocytes (review Bekeredjan-Ding et al, 2005 and 2006). Therefore, the ability of different RNA molecules to induce IFN- ⁇ in PDC and IL-12 in monocytes ( Figure 4A and B ) was compared. The cytokine production in human PDCs and monocytes in response to a published RNA ligand (9.2s) and RNA containing G:U base pairs was measured.
- ORNs that contained a single uridine, form a duplex or a stem loop structure but do not form a G•U wobble base pair did not induce IFN- ⁇ , confirming the strict G•U wobble base pair specificity of selective TLR7 ligands ( Figure 5A, B ).
- chemical modification of the uridine within R805 to pseudouridine or 2'-O-Me-Uridine largely abrogated activity of the complex with pG ( Figure 5 C) .
- TLR7 and 8 recognize different molecular motifs and it is possible to design TLR7-specific RNA ligands.
- RNA containing G:U base pairs stimulates human PDC in the absence of transfection reagents.
- RNA oligonucleotides Stimulation of TLR7 by RNA oligonucleotides has been shown to depend on the use of complexation or transfection reagents, which facilitate the cellular uptake and delivery of RNA ligands to TLR7 which is confined to the endosomal compartment.
- complexation with poly-cations protects RNA from degradation (review Diebold SS et al, 2004, Heil et al, 2004 and Heil et al 2003). Naked RNA is inherently unstable because its phosphodiester backbone is susceptible to both alkaline hydrolysis and degradation by ubiquitous RNases.
- polyG+R805 is the first example of a phosphodiester RNA, which is able to stimulate TLR7 without complex formation with a transfection reagent.
- Fluorescence microscopy indicates that, indeed, polyG+R805 entered the endosomal compartments of monocytes without the aid of any complexation agent ( Fig. 6B ).
- Human PDC were isolated from PBMC by MACS enrichment using BDCA-4 Microbeads. 40.000 PDC per well of a 96 well plate were stimulated with 200 ng pU (A, C) or with U21s (B) complexed to Poly-L-Arginine.
- A, B At the same time guanosine-nucleosides (G) in different concentrations (0.005 mM, 0.05 mM or 0.25 mM) were added to stimulated or untreated PDCs.
- G guanosine-nucleosides
- C Different nucleosides (G, cytidine (C), uridine (U) or adenosine (A)) were added in a concentration of 0.25 mM to stimulated or untreated PDCs.
- Example 7 Evidence that some RNA hairpins containing G•U base pairs act as selective TLR8 agonists.
- PBMC peripheral blood mononuclear cells
- RNAs shown in (B) in complex with Poly-l-Arginine.
- IFN-a IFN-a
- IL-12 p70 and IL-6 were measured in the supernatants by cytokine Elisa.
- R2151 CGCGCGCGCAGAAGCGUGCGC and R2152 CGCGUGCGCAGAAGCGCGCGCGC are examples for selective TLR8 agonists. These data show, that also cells expressing TLR8, as for example human monocytes, can selectively be activated by RNA oligos that contain a single uridine in a G•U wobble base pair. In this case, RNA sequences that showed selective TLR8 activation the U involved in the G•U base pair was preferentially flanked by G on either side.
- Example 8 In cells that express both functional TLR7 and TLR8 RNAs containing G•U wobble base pairs retain TLR7 selective activity.
- THP-1 cells were maturated with 300ng/ml PMA for 4 h in a 10cm dish, then harvested, washed with PBS twice and plated at 100.000 cells/well of a 96well Plate.
- PMA activated THP-1 cells express TLR8, and upon stimulation with IFN-g (100 U/ml) for 8 h also upregulate functional TLR7 (adapted from Gantier et al. TLR7 is involved in sequence-specific sensing of single-stranded RNAs in human macrophages. J Immunol (2008) vol. 180 (4) pp. 2117-24 ).
- THP-1 cells were stimulated with the small molecule agonists R848 (TLR7/8 agonist) CI087 (TLR7 agonist), or RNAs R2153, R2116 (TLR7 agonists) R2127 (inert), and 9.2s (TLR7/8 agonist). After 20 h TNF-a was measured in the culture supernatant by ELISA.
- TLR7/8 agonist small molecule agonists R848 (TLR7/8 agonist) CI087 (TLR7 agonist), or RNAs R2153, R2116 (TLR7 agonists) R2127 (inert), and 9.2s (TLR7/8 agonist). After 20 h TNF-a was measured in the culture supernatant by ELISA.
- B Knock-down of TLR7 using 3 different lentiviral shRNA constructs in PMA/IFN-g treated THP-1 cells represses TLR7 but not TLR8 mRNA. THP-1 cells were infected with
- THP-1 cells were treated as described in A and harvested after 8h treatment with IFN-g. RNA was extracted and TLR7/8 expression normalized to GAPDH levels was analyzed by SYBR Green real-time RT-PCR.
- C THP-1 cells treated as in described in (B) were stimulated with small molecule agonists (R848, CI087 and CI075[TLR8 agonist]), or the indicated RNAs in complex with Poly-l-Arginine (R2161 CGCCUGGGCAGAAGCCCGGGC).
- TNF-a was measured in the culture supernatant by ELISA.
- Data shown are representative of 2 (A) or 3 (B, C) independent experiments. These data show that the strictly TLR7 selective activation via RNA oligos containing an immune stimulatory G•U base pairs is maintained even when functional TLR8 is expressed within the same cell.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP09003837 | 2009-03-17 | ||
EP10709804.8A EP2408918B8 (fr) | 2009-03-17 | 2010-03-17 | Ligand du tlr7 et ses utilisations |
Related Parent Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP10709804.8A Division EP2408918B8 (fr) | 2009-03-17 | 2010-03-17 | Ligand du tlr7 et ses utilisations |
EP10709804.8A Division-Into EP2408918B8 (fr) | 2009-03-17 | 2010-03-17 | Ligand du tlr7 et ses utilisations |
Publications (1)
Publication Number | Publication Date |
---|---|
EP3263707A1 true EP3263707A1 (fr) | 2018-01-03 |
Family
ID=42174496
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP10709804.8A Active EP2408918B8 (fr) | 2009-03-17 | 2010-03-17 | Ligand du tlr7 et ses utilisations |
EP17168762.7A Withdrawn EP3263707A1 (fr) | 2009-03-17 | 2010-03-17 | Ligand du tlr8 et ses utilisations |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP10709804.8A Active EP2408918B8 (fr) | 2009-03-17 | 2010-03-17 | Ligand du tlr7 et ses utilisations |
Country Status (5)
Country | Link |
---|---|
US (1) | US10174326B2 (fr) |
EP (2) | EP2408918B8 (fr) |
AU (1) | AU2010225129A1 (fr) |
CA (1) | CA2744346A1 (fr) |
WO (1) | WO2010105819A1 (fr) |
Families Citing this family (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA3045944A1 (fr) | 2016-12-07 | 2018-06-14 | Progenity, Inc. | Procedes, dispositifs et systemes de detection du tractus gastro-intestinal |
CA3046019A1 (fr) | 2016-12-14 | 2018-06-21 | Progenity Inc. | Traitement d'une maladie du tractus gastro-intestinal avec un modulateur tlr |
AU2018240421A1 (en) | 2017-03-24 | 2019-09-26 | BioNTech SE | Methods and compositions for stimulating immune response |
AU2020328855A1 (en) | 2019-08-14 | 2022-03-03 | CureVac SE | RNA combinations and compositions with decreased immunostimulatory properties |
WO2021174024A1 (fr) | 2020-02-28 | 2021-09-02 | First Wave Bio, Inc. | Méthodes de traitement de la colite auto-immune iatrogène |
EP3909612A1 (fr) | 2020-05-12 | 2021-11-17 | Life Science Inkubator Betriebs GmbH & Co. KG | Composition de nanoparticules |
JP2023532717A (ja) | 2020-07-02 | 2023-07-31 | ヴィーブ ヘルスケア カンパニー | 長期作用型抗レトロウイルス剤を用いたhivウイルス寛解の達成方法 |
CN117203340A (zh) | 2021-04-16 | 2023-12-08 | 基因泰克公司 | 优化的tlr7配体及其用途 |
WO2024077351A1 (fr) * | 2022-10-12 | 2024-04-18 | Pharmorage Pty Limited | Oligonucléotides modifiés |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007062107A2 (fr) * | 2005-11-25 | 2007-05-31 | Coley Pharmaceutical Gmbh | Oligoribonucleotides immunostimulateurs |
WO2008139262A2 (fr) * | 2006-10-26 | 2008-11-20 | Coley Pharmaceutical Gmbh | Oligoribonucléotides et leurs utilisations |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040073380A1 (en) * | 2001-07-10 | 2004-04-15 | Puglisi Joseph D. | Structural targets in hepatittis c virus ires element |
US8153141B2 (en) | 2002-04-04 | 2012-04-10 | Coley Pharmaceutical Gmbh | Immunostimulatory G, U-containing oligoribonucleotides |
EP4082551A1 (fr) * | 2006-08-08 | 2022-11-02 | Rheinische Friedrich-Wilhelms-Universität Bonn | Structure et utilisation d'oligonucléotides 5'-phosphate |
EP2250183A4 (fr) | 2008-02-14 | 2012-07-25 | Michael Paul Marie Gantier | Molécules de petit arni immunostimulatrices |
-
2010
- 2010-03-17 EP EP10709804.8A patent/EP2408918B8/fr active Active
- 2010-03-17 WO PCT/EP2010/001686 patent/WO2010105819A1/fr active Application Filing
- 2010-03-17 CA CA2744346A patent/CA2744346A1/fr not_active Abandoned
- 2010-03-17 US US13/130,630 patent/US10174326B2/en active Active
- 2010-03-17 AU AU2010225129A patent/AU2010225129A1/en not_active Abandoned
- 2010-03-17 EP EP17168762.7A patent/EP3263707A1/fr not_active Withdrawn
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007062107A2 (fr) * | 2005-11-25 | 2007-05-31 | Coley Pharmaceutical Gmbh | Oligoribonucleotides immunostimulateurs |
WO2008139262A2 (fr) * | 2006-10-26 | 2008-11-20 | Coley Pharmaceutical Gmbh | Oligoribonucléotides et leurs utilisations |
Non-Patent Citations (46)
Title |
---|
"Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING COMPANY |
ALEXOPOULOU L; HOLT AC; MEDZHITOV R; FLAVELL RA: "Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3", NATURE, vol. 413, 2001, pages 732 - 738, XP002968529, DOI: doi:10.1038/35099560 |
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 2007, JOHN WILEY & SONS, NEW YORK |
BARCHET W; KRUG A; CELLA M; NEWBY C; FISCHER JA; DZIONEK A; PEKOSZ A; COLONNA M: "Dendritic cells respond to influenza virus through TLR7- and PKR-independent pathways", EUR J IMMUNOL, vol. 35, 2005, pages 236 - 242, XP002371478, DOI: doi:10.1002/eji.200425583 |
BARRAT FJ; MEEKER T; GREGORIO J; CHAN JH; UEMATSU S; AKIRA S; CHANG B; DURAMAD O; COFFMAN RL: "Nucleic acids of mammalian origin can act as endogenous ligands for Toll-like receptors and may promote systemic lupus erythematosus", J EXP MED, vol. 202, 2005, pages 1131 - 1139, XP002380606, DOI: doi:10.1084/jem.20050914 |
BEKEREDJIAN-DING I; ROTH SI; GILLES S; GIESE T; ABLASSER A; HORNUNG V; ENDRES S; HARTMANN G: "T cell-independent, TLR-induced IL-12p70 production in primary human monocytes", J IMMUNOL, vol. 176, 2006, pages 7438 - 7446 |
BEKEREDJIAN-DING IB; WAGNER M; HORNUNG V; GIESE T; SCHNURR M; ENDRES S; HARTMANN G: "Plasmacytoid dendritic cells control TLR7 sensitivity of naive B cells via type I IFN", J IMMUNOL, vol. 174, 2005, pages 4043 - 4050, XP009129421 |
CHUANG TH; ULEVITCH RJ: "Cloning and characterization of a sub-family of human toll-like receptors: hTLR7, hTLR8 and hTLR9", EUR CYTOKINE NETW, vol. 11, 2000, pages 372 - 378, XP009000971 |
COLIGAN ET AL.: "Current Protocols in Immunology", 2007, JOHN WILEY & SONS, NEW YORK |
DIEBOLD SS; KAISHO T; HEMMI H; AKIRA S; REIS E SOUSA C: "Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA", SCIENCE, vol. 303, 2004, pages 1529 - 1531, XP002675306, DOI: doi:10.1126/science.1093616 |
DIEBOLD SS; MASSACRIER C; AKIRA S; PATUREL C; MOREL Y; REIS E SOUSA C: "Nucleic acid agonists for Toll-like receptor 7 are defined by the presence of uridine ribonucleotides", EUR J IMMUNOL, vol. 36, 2006, pages 3256 - 3267, XP008101287, DOI: doi:10.1002/eji.200636617 |
DIEBOLD SS; MONTOYA M; UNGER H; ALEXOPOULOU L; ROY P; HASWELL LE; AL-SHAMKHANI A; FLAVELL R; BORROW P; REIS E SOUSA C: "Viral infection switches non-plasmacytoid dendritic cells into high interferon producers", NATURE, vol. 424, 2003, pages 324 - 328, XP055077021, DOI: doi:10.1038/nature01783 |
E. L. J. M. SMITS ET AL: "The Use of TLR7 and TLR8 Ligands for the Enhancement of Cancer Immunotherapy", THE ONCOLOGIST, vol. 13, no. 8, 11 August 2008 (2008-08-11), pages 859 - 875, XP055185106, ISSN: 1083-7159, DOI: 10.1634/theoncologist.2008-0097 * |
EBERLE F; GIESSLER K; DECK C; HEEG K; PETER M; RICHERT C; DALPKE AH: "Modifications in Small Interfering RNA That Separate Immunostimulation^ from RNA Interference", J IMMUNOL, vol. 180, 2008, pages 3229 - 3237, XP055036591, DOI: doi:10.4049/jimmunol.180.5.3229 |
FORSBACH A; NEMORIN JG; MONTINO C; MULLER C; SAMULOWITZ U; VICARI AP; JURK M; MUTWIRI GK; KRIEG AM; LIPFORD GB ET AL.: "Identification of RNA Sequence Motifs Stimulating Sequence-Specific TLR8-Dependent Immune Responses", J IMMUNOL, vol. 180, 2008, pages 3729 - 3738, XP002775830 * |
FORSBACH A; NEMORIN JG; MONTINO C; MULLER C; SAMULOWITZ U; VICARI AP; JURK M; MUTWIRI GK; KRIEG AM; LIPFORD GB ET AL.: "Identification of RNA Sequence Motifs Stimulating Sequence-Specific TLR8-Dependent Immune Responses", J IMMUNOL, vol. 180, 2008, pages 3729 - 3738, XP055244494, DOI: doi:10.4049/jimmunol.180.6.3729 |
GANTIER ET AL.: "TLR7 is involved in sequence-specific sensing of single-stranded RNAs in human macrophages", J IMMUNOL, vol. 180, no. 4, 2008, pages 2117 - 24, XP055025782, DOI: doi:10.4049/jimmunol.180.4.2117 |
GITLIN L; BARCHET W; GILFILLAN S; CELLA M; BEUTLER B; FLAVELL RA; DIAMOND MS; COLONNA M: "Essential role of mda-5 in type IIFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus", PROC NATL ACAD SCI USA, vol. 103, 2006, pages 8459 - 8464, XP002633798, DOI: doi:10.1073/pnas.0603082103 |
GORDEN KB; GORSKI KS; GIBSON SJ; KEDL RM; KIEPER WC; QIU X; TOMAI MA; ALKAN SS; VASILAKOS JP: "Synthetic TLR agonists reveal functional differences between human TLR7 and TLR8", J /MMUNO/, vol. 174, 2005, pages 1259 - 1268, XP009163641, DOI: doi:10.4049/jimmunol.174.3.1259 |
HATTERMANN K; PICARD S; BORGEAT M; LECLERC P; POULIOT M; BORGEAT P: "The Toll-like receptor 7/8-ligand resiquimod (R-848) primes human neutrophils for leukotriene B4, prostaglandin E2 and platelet-activating factor biosynthesis", FASEB J, vol. 21, 2007, pages 1575 - 1585 |
HEIL F; AHMAD-NEJAD P; HEMMI H; HOCHREIN H; AMPENBERGER F; GELLERT T; DIETRICH H; LIPFORD G; TAKEDA K; AKIRA S ET AL.: "The Toll-like receptor 7 (TLR7)-specific stimulus loxoribine uncovers a strong relationship within the TLR7, 8 and 9 subfamily", EUR J IMMUNOL, vol. 33, 2003, pages 2987 - 2997, XP055413780, DOI: doi:10.1002/eji.200324238 |
HEIL F; HEMMI H; HOCHREIN H; AMPENBERGER F; KIRSCHNING C; AKIRA S; LIPFORD G; WAGNER H; BAUER S: "Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8", SCIENCE, vol. 303, 2004, pages 1526 - 1529, XP002775831 * |
HEIL F; HEMMI H; HOCHREIN H; AMPENBERGER F; KIRSCHNING C; AKIRA S; LIPFORD G; WAGNER H; BAUER S: "Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8", SCIENCE, vol. 303, 2004, pages 1526 - 1529, XP002775831, DOI: doi:10.1126/science.1093620 |
HEMMI H; TAKEUCHI O; KAWAI T; KAISHO T; SATO S; SANJO H; MATSUMOTO M; HOSHINO K; WAGNER H; TAKEDA K ET AL.: "A Toll-like receptor recognizes bacterial DNA", NATURE, vol. 408, 2000, pages 740 - 745 |
HORNUNG V; GUENTHNER-BILLER M; BOURQUIN C; ABLASSER A; SCHLEE M; UEMATSU S; NORONHA A; MANOHARAN M; AKIRA S; DE FOUGEROLLES A ET A: "Sequence-specific potent induction of IFN-alpha by short interfering RNA in plasmacytoid dendritic cells through TLR7", NAT MED, vol. 11, 2005, pages 263 - 270 |
HORNUNG V; ROTHENFUSSER S; BRITSCH S; KRUG A; JAHRSDORFER B; GIESE T; ENDRES S; HARTMANN G: "Quantitative expression of toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides", J IMMUNOL, vol. 168, 2002, pages 4531 - 4537, XP002438973 |
JUDGE AD; SOOD V; SHAW JR; FANG D; MCCLINTOCK K; MACLACHLAN I: "Sequence-dependent stimulation of the mammalian innate immune response by synthetic siRNA", NAT BIOTECHNOL, vol. 23, 2005, pages 457 - 462 |
JURK M; HEIL F; VOLLMER J; SCHETTER C; KRIEG AM; WAGNER H; LIPFORD G; BAUER S: "Human TLR7 or TLR8 independently confer responsiveness to the antiviral compound R-848", NAT IMMUNOL, vol. 3, 2002, pages 499, XP009000821, DOI: doi:10.1038/ni0602-499 |
KADOWAKI N; HO S; ANTONENKO S; MALEFYT RW; KASTELEIN RA; BAZAN F; LIU YJ: "Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens", J EXP MED, vol. 194, 2001, pages 863 - 869, XP002218082 |
KRIEG AM; VOLLMER J: "Toll-like receptors 7,8, and 9: linking innate immunity to autoimmunity", IMMUNOL REV, vol. 220, 2007, pages 251 - 269, XP009155261, DOI: doi:10.1111/j.1600-065X.2007.00572.x |
KRUG A; LUKER GD; BARCHET W; LEIB DA; AKIRA S; COLONNA M: "Herpes simplex virus type 1 activates murine natural interferon-producing cells through toll-like receptor 9", BLOOD, vol. 103, 2004, pages 1433 - 1437 |
LAU CM; BROUGHTON C; TABOR AS; AKIRA S; FLAVELL RA; MAMULA MJ; CHRISTENSEN SR; SHLOMCHIK MJ; VIGLIANTI GA; RIFKIN IR ET AL.: "RNA-associated autoantigens activate B cells by combined B cell antigen receptor/Toll-like receptor 7 engagement", J EXP MED, vol. 202, 2005, pages 1171 - 1177, XP055095217, DOI: doi:10.1084/jem.20050630 |
LEE J; CHUANG TH; REDECKE V; SHE L; PITHA PM; CARSON DA; RAZ E; COTTAM HB: "Molecular basis for the immunostimulatory activity of guanine nucleoside analogs: activation of Toll-like receptor 7", PROC NATL ACAD SCI U S A, vol. 100, 2003, pages 6646 - 6651, XP002307483, DOI: doi:10.1073/pnas.0631696100 |
LUND J; SATO A; AKIRA S; MEDZHITOV R; IWASAKI A: "Toll-like receptor 9-mediated recognition of Herpes simplex virus-2 by plasmacytoid dendritic cells", J EXP MED, vol. 198, 2003, pages 513 - 520 |
LUND JM; ALEXOPOULOU L; SATO A; KAROW M; ADAMS NC; GALE NW; IWASAKI A; FLAVELL RA: "Recognition of single-stranded RNA viruses by Toll-like receptor 7", PROC NATL ACAD SCI USA, vol. 101, 2004, pages 5598 - 5603, XP002725552, DOI: doi:10.1073/pnas.0400937101 |
MA Y; LI J; CHIU I; WANG Y; SLOANE JA; LU J; KOSARAS B; SIDMAN RL; VOLPE JJ; VARTANIAN T: "Toll-like receptor 8 functions as a negative regulator of neurite outgrowth and inducer of neuronal apoptosis", J CELL BIOL, vol. 175, 2006, pages 209 - 215 |
MASQUIDA B; WESTHOF E: "On the wobble GoU and related pairs", RNA, vol. 6, 2000, pages 9 - 15 |
MATHEWS DH; TURNER DH: "Prediction of RNA secondary structure by free energy minimization", CURR OPIN STRUCT BIOL, vol. 16, 2006, pages 270 - 278, XP024959986, DOI: doi:10.1016/j.sbi.2006.05.010 |
PALECANDA A; KOBZIK L: "Receptors for unopsonized particles: the role of alveolar macrophage scavenger receptors", CURR MOL MED, vol. 1, 2001, pages 589 - 595 |
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOUR LABORATORY, NEW YORK |
SCHEEL B; TEUFEL R; PROBST J; CARRALOT JP; GEGINAT J; RADSAK M; JARROSSAY D; WAGNER H; JUNG G; RAMMENSEE HG ET AL.: "Toll-like receptor-dependent activation of several human blood cell types by protamine-condensed mRNA", EUR J IMMUNOL, vol. 35, 2005, pages 1557 - 1566, XP002462636, DOI: doi:10.1002/eji.200425656 |
SIOUD M: "Single-stranded small interfering RNA are more immunostimulatory than their double-stranded counterparts: a central role for 2'-hydroxyl uridines in immune responses", EUR J IMMUNOL, vol. 36, 2006, pages 1222 - 1230, XP002432282, DOI: doi:10.1002/eji.200535708 |
UEMATSU S; AKIRA S: "Handb ExpPharmacol", 2008, article "Toll-Like receptors (TLRs) and their ligands", pages: 1 - 20 |
VARANI G; MCCLAIN WH: "The G x U wobble base pair. A fundamental building block of RNA structure crucial to RNA function in diverse biological systems", EMBO REP, vol. 1, 2000, pages 18 - 23 |
WAGSTAFF AJ; PERRY CM: "Topical imiquimod: a review of its use in the management of anogenital warts, actinic keratoses, basal cell carcinoma and other skin lesions", DRUGS, vol. 67, 2007, pages 2187 - 2210, XP009158526, DOI: doi:10.2165/00003495-200767150-00006 |
XU D; LANDON T; GREENBAUM NL; FENLEY MO: "The electrostatic characteristics of G.U wobble base pairs", NUCLEIC ACIDS RES, vol. 35, 2007, pages 3836 - 3847 |
Also Published As
Publication number | Publication date |
---|---|
WO2010105819A1 (fr) | 2010-09-23 |
CA2744346A1 (fr) | 2010-09-23 |
AU2010225129A1 (en) | 2010-09-23 |
EP2408918B8 (fr) | 2017-08-30 |
US10174326B2 (en) | 2019-01-08 |
EP2408918A1 (fr) | 2012-01-25 |
US20110250175A1 (en) | 2011-10-13 |
EP2408918B1 (fr) | 2017-05-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2408918B1 (fr) | Ligand du tlr7 et ses utilisations | |
US10036021B2 (en) | 5′ triphosphate oligonucleotide with blunt end and uses thereof | |
EP3045536B1 (fr) | Oligonucléotide de triphosphate 5 avec extrémité franche et utilisations associées | |
US9381208B2 (en) | Structure and use of 5′ phosphate oligonucleotides | |
US8815503B2 (en) | Compositions and methods for immunostimulatory RNA oligonucleotides | |
Hornung et al. | RNA recognition via TLR7 and TLR8 | |
EP2655623B1 (fr) | Molecule d'acide nucleique non codants immunomodulateurs | |
EP3600342B1 (fr) | Procédé de conception de ligands rig-i | |
Jurk et al. | Immunostimulatory potential of silencing RNAs can be mediated by a non-uridine-rich toll-like receptor 7 motif | |
EP1920775B1 (fr) | Oligonucleotide 5'triphosphate induisant une réaction antivirale | |
US8318924B2 (en) | Immunostimulatory siRNA molecules |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
AC | Divisional application: reference to earlier application |
Ref document number: 2408918 Country of ref document: EP Kind code of ref document: P |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR |
|
17P | Request for examination filed |
Effective date: 20180703 |
|
RBV | Designated contracting states (corrected) |
Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR |
|
17Q | First examination report despatched |
Effective date: 20181128 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20200122 |