EP3196295A1

EP3196295A1 - Method of producing renal cells from fibroblasts

Info

Publication number: EP3196295A1
Application number: EP16152655.3A
Authority: EP
Inventors: Soeren LIENKAMP; Michael Kaminski; Sebastian Arnold; Gerd Walz
Original assignee: Albert Ludwigs Universitaet Freiburg
Current assignee: Albert Ludwigs Universitaet Freiburg
Priority date: 2016-01-25
Filing date: 2016-01-25
Publication date: 2017-07-26

Abstract

The present invention relates to a method for producing renal cells, comprising overexpressing Emx2, Hnf1b, Hnf4a and Pax8 in fibroblasts.

Description

BACKGROUND

End-stage renal disease is a major public health burden with a growing incidence of 100,000 new cases per year in the US¹. Therefore, the in vitro generation of renal cells represents a major challenge for kidney disease related research and regenerative medicine.
A number of studies have directed pluripotent cells towards a renal cell fate in vitro. Embryonic stem cells or induced pluripotent cells (iPSCs) that were cultured in the presence of defined growth factor cocktails or chemical compounds acquired renal cell characteristics^2-6. These multistep protocols aimed to recapitulate the path of renal embryonic differentiation^{3, 6} and generated self-organizing kidney-like organoids that contained segmented nephrons^2,4, which were surrounded by endothelial cells and renal interstitium⁵. In a different approach, bone-marrow-derived mesenchymal stem cells were conditioned by cell-free extracts from a proximal tubule cell line to form tubule-like cells in vitro ⁷. However, all of these approaches depend on the availability of pluri- or multipotent stem cell populations, and include intricate differentiation protocols. In addition, the use of human ESCs raises ethical concerns, and the tumorigenic risk of iPSC-derived cells currently limits their clinical use⁸.
Direct reprogramming is an alternative approach to generate desired cell types in vitro ⁹. Differentiated cells, such as fibroblasts, can be reprogrammed by defined transcription factors into organ-specific cell types bypassing a pluripotent stage. Fibroblasts have been directly reprogrammed to neurons¹⁰, oligodendrocytes^11,12, cardiomyocytes¹³, hepatocytes^14-16 or Sertoli cells¹⁷, but not yet to any renal cell type. Previously, the expression of six transcription factors, Six1, Six2, Osr1, Eya1, Hoxa11, Snai2, in combination with valproic acid treatment induces de-differentiation of a proximal tubule cell line into a precursor state¹⁸. However, this approach requires viable renal tubule cells, thus limiting its use in the majority of clinical settings of kidney disease. Direct reprogramming of fibroblasts towards a mature renal cell type has not been reported to date.

SUMMARY OF THE INVENTION

The inventors identified four transcription factors - Emx2, Hnf1b, Hnf4a and Pax8 - that convert embryonic and adult fibroblasts to induced renal tubular epithelial cells, which were termed iRECs. Reprogrammed iRECs resemble primary tubular cells in their mRNA-expression profile and show morphological and functional features of kidney tubule epithelia. They integrate into kidney organoids and form tubular structures in a decellularized kidney scaffold.
The present invention therefore relates to the following embodiments (1) to (16):

(1) A method for producing renal cells, comprising overexpressing Emx2, Hnf1b, Hnf4a and Pax8 in differentiated cells.
(2) The method of item (1), wherein the renal cells are renal tubular cells.
(3) The method of item (1), wherein the renal cells are renal tubular epithelial cells.
(4) The method of any one of the preceding items, wherein the differentiated cells are mammalian cells.
(5) The method of any one of the preceding items, wherein the differentiated cells are human cells.
(6) The method of any one of the preceding items, wherein the differentiated cells are fibroblasts.
(7) The method of item (6), wherein the fibroblasts are embryonic fibroblasts.
(8) The method of item (6), wherein the fibroblasts are adult fibroblasts.
(9) The method of any one of the preceding items, wherein said overexpressing comprises
1. (a) providing one or more nucleic acids encoding Emx2, Hnf1b, Hnf4a and Pax8; (b) introducing said one or more nucleic acids into the differentiated cells so as to obtain transduced or transfected differentiated cells; and (c) culturing said transduced or transfected differentiated cells under conditions that allow overexpression of Emx2, Hnf1b, Hnf4a and Pax8.
(10) The method of item (9), wherein said one or more nucleic acids are plasmids or vectors comprising a nucleotide sequence encoding Emx2, Hnf1b, Hnf4a, Pax8 or a combination thereof, operably linked to a promoter capable of inducing overexpression of the encoded genes.
(11) The method of any one of the preceding items, wherein said Emx2 comprises the nucleotide sequence as shown in SEQ ID NO:1 or a functional fragment thereof.
(12) The method of any one of the preceding items, wherein said Hnf1b comprises the nucleotide sequence as shown in SEQ ID NO:2 or a functional fragment thereof.
(13) The method of any one of the preceding items, wherein said Hnf4a comprises the nucleotide sequence as shown in SEQ ID NO:3 or a functional fragment thereof.
(14) The method of any one of the preceding items, wherein said Pax8 comprises the nucleotide sequence as shown in SEQ ID NO:4 or a functional fragment thereof.
(15) A renal cell obtainable by the method of any one of the preceding items.
(16) The use of the renal cell of item (15) for nephrotoxicity testing, pharmacological screening or disease modeling.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1: Systematic selection criteria identify candidate reprogramming factors.
1. (a) Schematic illustrating the strategy and criteria used to identify renal reprogramming factors. TFs: transcription factors (b) Scatter-plot depicting the absolute and relative expression levels of transcription factors in liver, brain and kidney tissue²². Factors used for successful reprogramming to hepatocytes and neurons are highlighted in red. Dashed lines indicate the level of the 50th percentile of the absolute expression and the 95th percentile of relative expression. The area boxed in red includes the 55 candidate reprogramming factors for renal cell types. (c) Representative images of in situ hybridizations of the indicated genes on E14 mouse kidney sections and stage 26 Xenopus whole-mount embryos. Scale bars, 500 µm (c).
Figure 2: Four transcription factors can induce renal cell fate in MEFs.
1. (a) Schematic of the experimental procedure used to identify renal reprogramming factors. A kidney section from adult KSP-Cre; mTOM/mGFP reporter mice shows membrane-GFP expression (mGFP) in the renal tubules and membrane-tomato red fluorescence (mTOM) in the remaining tissue. (b) MEFs derived from limbs of reporter mice were left untreated (0 factors) or transduced with the pool of 13 transcription factors (13TF) and analyzed by flow cytometry (FC) for the presence of GFP positive (GFP⁺) cells 7 days after viral transduction. Confocal images show GFP⁺ cells (green), mTOM⁺ cells (red), and nuclear staining with Hoechst (blue) (c) Percentages of GFP⁺ cells in different 13TF-1 combinations were assessed by FC; 0TF: untreated MEFs; CFP: cyan fluorescent protein. The broken line marks the average percentage of GFP⁺ cells in the pool of 13TFs. (d) Percentage of GFP⁺ cells in different 8TF-1 combinations as assessed by FC. (e) FC analysis and representative confocal image of GFP⁺ cells transduced with the pool of 4 TFs (Emx2, Hnf1b, HNf4a, Pax8). (f) FC analysis of GFP⁺ cells in MEFs overexpressing the 4TFs, combinations of three TFs, or single factors. (g) FC analysis and representative confocal image of 4TF treated cells after 31 days of culture. (h) Time course of GFP⁺ cells as determined by FC after culture for the indicated period of time. Error bars: standard error of the mean (SEM), Asterisks indicate significant differences to the positive control (13TF, 8TF and 4TF) as assessed by Student's unpaired t-test, n=3, *** p<0.001, ** p<0.01, * p<0.05, Scale bars, 100 µm (a,b,e,g)
Figure 3: iRECs exhibit epithelial properties.
1. (a) Phase contrast images of iRECs and MEFs show epithelial and mesenchymal cell morphologies, respectively. (b) Colony formation of iRECs and MEFs was assessed by crystal violet staining. (c) Quantification of colonies formed by MEFs and iRECs after 2 weeks of culture. (* p<0.05, student's t-test, n=3, Error bars: SEM) (d) Differential interference contrast (DIC) and confocal imaging: Sparsely seeded iRECs on Matrigel-coated dishes show branching tubular structures (upper panel); densely seeded iRECs display dome formation as observed in orthogonal view and by 3D reconstruction of confocal z-stacks (lower panel). (e) Immunofluorescence staining of the epithelial (ZO-1, E-Cadherin, Epcam) and mesenchymal (Vimentin) marker proteins in iRECs and MEFs. Scale bars, 50 µm (a,e), 1 cm (b), 100 µm (d).
Figure 4: iRECs resemble primary renal epithelial cells in their global gene expression pattern.
1. (a) Hierarchical clustering and heatmap image of cDNA microarray data comparing gene expression profiles of MEFs, iRECs and primary RECs isolated from Ksp-Cre; mTOM/mGFP kidneys (n=4 for each group). Blue indicates downregulation, red indicates upregulation. Clustering was performed for 1.5-fold up/downregulated genes of iRECs vs. MEFs (p<0.0005). (b) CellNet-generated heatmap with each row representing the indicated cell type or tissue and each column representing one of three independently reprogrammed iREC cultures. Values representing the classification score are color-coded (black to green). (c) Classification scores of previously published directly reprogrammed cell types and iRECs as determined by CellNet³⁰. (d) Relative mRNA expression levels of renal marker genes in MEFs, iRECs, and whole kidney lysates as determined by qRT-PCR. Significant differences were assessed by Student's unpaired t-test, n=3, *** p<0.001, ** p<0.01, * p<0.05; Error bars: SEM. (e) Transcriptional circuitry network of predicted target genes of iREC reprogramming factors (yellow circles). Blue indicates down-regulation, red indicates upregulation. (f) Immunofluorescence staining of the indicated renal tubular proteins in iRECs and MEFs. Scale bar, 50 µm (f).
Figure 5: iRECs show functional properties of renal tubular epithelial cells.
1. (a) Differential interference contrast (DIC) images of MEFs and iRECs grown in 3D Matrigel. (b) Confocal live-cell imaging of tomato red (TOM) expressing MEFs and GFP expressing iRECs grown in 3D Matrigel. Nuclei stained with Hoechst. (c) Quantification of lumen formation (%) and maximum diameter (µm) of 3D structures formed by MEFs (grey bars) and iRECs (black bars) in Matrigel. n.d.= not detectable. (d) Immunostaining of the indicated proteins in iRECs and MEFs grown in 3D Matrigel. Nuclei were stained with Hoechst. Representative confocal images show planes of maximum diameter of the spheres. (e) Transmission electron microscopy images of iRECs grown in 3D Matrigel. TJ: tight junction; M: microvilli; BML: basement membrane like matrix; N: nucleus. (f) Representative images of MEFs and iRECs incubated with alexa-647 labeled albumin for the indicated time-periods. (g) Quantification of albumin uptake in MEFs and iRECs over a 60 min time course. (h) Quantification of apoptotic cells (%) in cisplatin treated MEFs (red line) and iRECs (black line) or untreated controls. (i) Percentage of apoptotic cells in untreated, cisplatin only treated or cisplatin and cimetidine treated MEFs and iRECs. Error bars: SEM, Student's unpaired t-test, n=3, *** p<0.001, ** p<0.01, * p<0.05; Scale bars, 50 µm (a,b,d,f), 500 nm (e).
Figure 6: iRECs integrate into reaggregated renal organoids and repopulate decellularized kidneys.
1. (a) Schematic illustration of the reaggregation assay. GFP⁺ iRECs and E13 TOM⁺ kidneys were trypsin digested, mixed in a 1:10 ratio and grown on a liquid-air interface culture. (b) Confocal live-imaging of renal organoids reaggregated with either KSP-Cre GFP⁺ iRECs or GFP transduced control MEFs. The white boxed area is shown enlarged in the right panel. (c) Immunostaining of kidney organoids reaggreagated with MEFs or iRECs for the indicated proteins. (d) Schematic illustration of the repopulation assay. Wild type kidneys were decellularized with 1% SDS and injected with iRECs; confocal images and 3D reconstructions of decullarized kidneys repopulated with KSP-Cre GFP⁺ iRECs. Nuclei were stained with Hoechst. ECM: extra cellular matrix, MIP: Maximum intensity projection of confocal z-stacks. Scale bars, 50 µm (b,c), 100 µm (d).
Figure 7: Reprogramming of human fibroblasts.
1. (a) Phase contrast image and immunostaining for the indicated proteins in untreated and 4TF treated human fibroblasts. (b) Relative mRNA expression level of the indicated genes as determined by qRT-PCR. Significant differences were assessed by Student's unpaired t-test, n=3, *** p<0.001, ** p<0.01, * p<0.05; Error bars: SEM. (c) Percentage of THY-1- or EPCAM⁺ cells in mouse and human fibroblasts after treatment with 4TF as determined by flow cytometry. (d) Sorting strategy for THY-1^- and EPCAM⁺ cells in untreated and 4TF treated human fibroblasts. (e) Untreated human fibroblasts and human induced renal epithelial cells (h-iRECs) cultured in Matrigel. Shown are maximum intensity projections of confocal z-Stacks. (f) Matrigel grown h-iREC spheres stained for the indicated proteins. Scale bars, 50 µm (a), 100 µm (e), 20 µm (f).
Figure 8. Spatial and temporal expression analysis of candidate reprogramming factors in Xenopus and mouse embryos.
1. (a) Summary of whole mount in situ hybridization experiments: Spatial expression pattern. White, grey and black colored boxes indicate undetectable, weak and strong gene expression within the respective segment of the Xenopus pronephros. PT1, PT2, PT3: Proximal Tubule Segment 1, 2 and 3. IT1, IT2: Intermediate Tubule Segment 1 and 2. DT1, DT2: Distal Tubule Segment 1 and 2. CT: Connecting Tubule. (b) Summary of whole mount in situ hybridization experiments: Temporal expression pattern at stages 22, 26, 33 and 38 of Xenopus development. (c) Spatial expression pattern in mouse embryos as detected by WISH. (d) Temporal expression pattern in mouse embryos as detected by WISH.
Figure 9. iRECs can be induced with a multicistronic lentiviral vector and generated from adult tail tip fibroblasts.
1. (a) Control MEFs for FACS gate setting, TOM CTL: MEFs obtained from membrane-tomato red mice; GFP CTL: MEFs obtained from membrane-GFP mice; MIX CTL: mixture of membrane-tomato red MEFs and membrane-GFP MEFs. (b) Schematic vector map of the multicistronic construct showing the four reprogramming factors (Pax8, Hnf1 b, Emx2, Hnf4a) separated by the indicated 2A peptide sequences. pWPXLd was used as lentiviral backbone. (c) Expression control of the 2A-tagged transcription factors with an antibody against the 2A consensus motif. GFP transfected cells served as a control. (d) FACS analysis of GFP⁺ cells in KSP-Cre reporter MEFs treated with lentivirus harboring the multicistronic vector after 39 days of culture. (e) FACS analysis of GFP⁺ cells in KSP-Cre reporter post-natal tail tip fibroblasts (TTFs). (f) Immunostaining of iRECs derived from adult TTFs against the indicated proteins. (g) Relative mRNA expression levels of the indicated genes as determined by qRT-PCR in untreated and 4TF (Emx2, Hnf1b, Hnf4a, Pax8) treated MEFs. All data are represented as mean of 3 independent experiments. Error bars: SEM, Scale bars represent 50µm; Asterisks indicate significant differences as assessed by Student's unpaired t-test, *** p<0.001, ** p<0.01, * p<0.05, ns: non-significant, p>0.05.
Figure 10. Transcriptomic analysis of iRECs
1. (a) Gene ontology term analysis of 10-fold upregulated genes in iRECs compared to MEFs. (b) Median RPKM (Reads per kilobase per million mapped reads) of 10X upregulated genes in iRECs compared to MEFs in human and mouse RNAseq datasets of the indicated tissues. RNAseq data from (Cabili et al., 2011; Shen et al., 2012).

DETAILED DESCRIPTION

The present invention relates to a method for producing renal cells, comprising overexpressing Emx2, Hnf1b, Hnf4a and Pax8 in differentiated cells.
The term "differentiated cell" as used herein refers to a cell in the process of differentiating into a somatic cell lineage or having terminally differentiated. For example, embryonic cells can differentiate into an epithelial cell lining the intestine. Differentiated cells can be isolated from a fetus or a live born animal, for example.
Preferably, the differentiated cells are fibroblasts. Other suitable types of differentiated cells include cells of the mononuclear phagocyte system (MPS) (= Reticuloenothelial system) and other renal cell types.

Fibroblasts

The term "fibroblast", as used herein, refers to a cell of mesenchymal origin. Fibroblasts are found in connective tissue. Fibroblasts synthesize actin-myosin filaments, the matrix elements (collagen, reticular and elastic fibers), and glycosaminoglycans and glycoproteins, which are secreted as amorphous intercellular substance. Fibroblasts include connective-tissue stem cells, matrix- and other protein-synthesizing cells, contractile cells, and phagocytic cells. Active fibroblasts are characterized by their abundant endoplasmic reticulum (ER), Golgi complex and ribosomes.
Fibroblasts play a particularly critical role during embryogenesis. Besides synthesizing proteins, they determine the structure of the skeleton, the location of muscle cells, the growth patterns of nerve fibers and the organization of the skin. Fibroblasts accomplish these organizational functions by attaching collagenous fibrils to embryonic cells and pulling them into the proper alignment to form parts of the developing organism. During human development and throughout adulthood, fibroblasts continue to synthesize and maintain both loose and dense types of connective tissue. They migrate in response to a number of chemoattractants such as lymphokines, cytokines and growth factors and constantly remodel and repair tissues by producing various degradative and synthetic enzymes, including collagenase, and products that may modulate the function of other cells including prostaglandins, tissue plasminogen activator (tPA), complement components and superoxide dismutase. The importance of fibroblasts may be attributed to their production of collagen, the predominant extracellular component of connective tissue and the most abundant protein in the human body.
The biology of fibroblasts and matrix proteins is discussed by Postlethwaite and Kang, In: Inflammation: Basic Principles and Clinical Correlates, 2d ed, Gallin et al. (1992) Raven Press, New York, pp 747-773.
In one embodiment, the fibroblasts are embryonic fibroblasts. The term "embryonic" as used herein refers to the age when the fibroblasts are obtained, i.e. the fibroblasts are obtained from an embryo, preferably at the age of E11.5-E14.5.
In another embodiment, the fibroblasts are adult fibroblasts. The term "adult" as used herein refers to the age when the fibroblasts are obtained, i.e. the fibroblasts are obtained from an adult subject. An adult subject in accordance with this invention has an age of more than 8 weeks.
In yet another embodiment, the fibroblasts are postnatal fibroblasts. Postnatal fibroblast are typically obtained from newborn subjects shortly after birth, e.g. within one week after birth, or at about one week after birth.
The fibroblast may be identified by immunocytochemistry using one or more of the following antibodies: (i) an antibody capable of binding to vimentin, (ii) an antibody capable of binding to prolyl-4-hydroxylase, and (iii) the antibody TE-7 (commercially available from EMD Millipore, Catalog No. CBL271; see also Haynes, B.F., et al. (1984). J. Exp. Med. 159(4):1149-1168).
In embodiment A, the fibroblast carries a surface antigen that is recognized by the antibody TE-7. In embodiment B, the fibroblast expresses vimentin. In embodiment C, the fibroblast expresses prolyl-4-hydroxylase. Further aspects of the invention are combinations of embodiments A and B, A and C, B and C, and A, B and C.

Renal cells

The term "renal cell", as used herein, refers to a cell having the characteristics of a kidney cell or residing within the kidney or originating from the metanephric mesenchyme or the ureteric bud.
The renal cells obtained in accordance with this invention preferably express the genes Pax2, Lhx1, Slc6a18, Slcl7a1 and/or Lrp2, and/or they show upregulation of one or more of these genes relative to the fibroblasts from which they originated.
Preferably, the renal cell is a renal tubular cell. More preferably, the renal cell expresses the marker protein "kidney-specific Cadherin", also termed Cadherin-16 (see also Thomson et al. (1995) J Biol Chem 270 (29): 17594-17601; and Shen et al. (2005) Mod Pathol. 18(7): 933-940 and references cited therein). Antibodies against Cadherin-16 are commercially available.
Most preferably, the renal cell is an epithelial renal cell, e.g. a renal tubular epithelial cell. The epithelial renal cells are typically characterized by the presence of the poteins ZO-1, E-cadherin (CDH1) and EpCAM at the membrane of the epithelial renal cells.
The epithelial renal cells preferably express Cdh1, which encodes E-cadherin, and Cdh6, and/or the expression of these genes is greater than that in the fibroblasts from which they originated.
In addition, the renal cells are preferably negative for vimentin, or at least the expression of vimentin in the renal cells is significantly lower than that in the fibroblasts from which they originated.
Unless indicated otherwise, all references to expression levels herein refer to a determination by quantitative Real-time PCR, as defined in the examples.

Transcription factors

The EMX2 gene encodes a homeobox-containing transcription factor that is the homolog to the 'empty spiracles' gene in Drosophila. Research on this gene in humans has focused on its expression in three tissues: dorsal telencephalon, olfactory neuroepithelium, and urogenetial system. It is expressed in the dorsal telencephalon during development in a low rostral-lateral to high caudal-medial gradient and is proposed to pattern the neocortex into defined functional areas. It is also expressed in embryonic and adult olfactory neuroepithelia where it complexes with eukaryotic translation initiation factor 4E (eIF4E) and possibly regulates mRNA transport or translation. In the developing urogenital system, it is expressed in epithelial tissues and is negatively regulated by HOXA10. Alternative splicing results in multiple transcript variants encoding distinct proteins.
The human ortholog of EMX2 protein has the amino acid sequence deposited under UniProtKB/Swiss-Prot accession number Q04743. Isoform 1 has the accession number Q04743-1, whereas isoform 2 has the accession number Q04743-2.
Isoform 1 is encoded by a cDNA sequence with the following details:

LOCUS NM_004098 2908 bp

DEFINITION Homo sapiens empty spiracles homeobox 2 (EMX2), transcript variant 1, mRNA.

ACCESSION NM_004098

VERSION NM_004098.3 GI:164607120

Isoform 2 is encoded by a cDNA sequence with the following details:

LOCUS NM_001165924 2723 bp

DEFINITION Homo sapiens empty spiracles homeobox 2 (EMX2), transcript variant 2, mRNA.

ACCESSION NM_001165924

VERSION NM_001165924.1 GI:260064071
Any nucleotide sequence encoding human EMX2, an ortholog thereof, or a functional fragment thereof, can be used in accordance with this invention. The nucleic acid encoding EMX2 may have a sequence identity of at least 80%, preferably of at least 90%, to the nucleotide sequence as shown in SEQ ID NO:1 [accession number NM_004098]; For reprogramming mouse fibroblasts the nucleotide sequence as shown under accession number NM_010132.2 can be used.
The Hnf1b gene encodes a member of the homeodomain-containing superfamily of transcription factors. The protein binds to DNA as either a homodimer, or a heterodimer with the related protein hepatocyte nuclear factor 1-alpha. The gene has been shown to function in nephron development, and regulates development of the embryonic pancreas. Mutations in this gene result in renal cysts and diabetes syndrome and noninsulin-dependent diabetes mellitus, and expression of this gene is altered in some types of cancer. Multiple transcript variants encoding different isoforms have been found for this gene.
The human ortholog of HNF1B has the amino acid sequence as defined under UniProtKB/Swiss-Prot accession number P35680. This includes the isoforms defined under accession numbers P35680-1, P35680-2, P35680-3, and P35680-4.
Corresponding mRNA sequences include, but are not limited to, the nucleotide sequences defined under accession numbers:

BC017714.1, XM_011546821.1, NM_006481.1, NM_000458.3, XM_011546819.1,
XM_011546822.1, XM_011525162.1, NM_001165923.3, XM_011525163.1,
XM_011525160.1, XM_011546823.1, XM_011546820.1, NM_001304286.1,
XM_011525161.1, and XM_011525164.1

Any nucleotide sequence encoding human HNF1B, an ortholog thereof, or a functional fragment thereof, can be used in accordance with this invention. The nucleic acid encoding HNF1B may have a sequence identity of at least 80%, preferably of at least 90%, to the nucleotide sequence as shown in SEQ ID NO:2 [accession number BC017714.1]. For reprogramming mouse fibroblasts the nucleotide sequence as shown under accession number NM_009330.2 can be used.
The HNF4A protein is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. Mutations in this gene have been associated with monogenic autosomal dominant noninsulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms.
The human ortholog of HNF4A has the amino acid sequence as defined under UniProtKB/Swiss-Prot accession number P41235. This includes the isoforms defined under accession numbers P41235-1, P41235-2, P41235-3, P41235-4, P41235-5, P41235-6 and P41235-7.
Corresponding mRNA sequences include, but are not limited to, the nucleotide sequences defined under accession numbers:

NM_001287182.1, NM_001030003.2, NM_175914.4, XM_005260407.2, NM_001030004.2,
NM_001287183.1, NM_178849.2, XM_011528797.1, NM_000457.4, NM_001287184.1,
NM_178850.2, NM_001258355.1 and XM_011528798.1.

Any nucleotide sequence encoding human HNF4A, an ortholog thereof, or a functional fragment thereof, can be used in accordance with this invention. The nucleic acid encoding HNF1B may have a sequence identity of at least 80%, preferably of at least 90%, to the nucleotide sequence as shown in SEQ ID NO:3 [accession number NM_000457.4]. For reprogramming mouse fibroblasts the nucleotide sequence as shown under accession number NM_008261.2 can be used.
The Pax8 gene encodes a member of the paired box (PAX) family of transcription factors. Members of this gene family typically encode proteins that contain a paired box domain, an octapeptide, and a paired-type homeodomain. This nuclear protein is involved in thyroid follicular cell development and expression of thyroid-specific genes. Mutations in this gene have been associated with thyroid dysgenesis, thyroid follicular carcinomas and atypical follicular thyroid adenomas. Alternatively spliced transcript variants encoding different isoforms have been described.
The human ortholog of PAX8 has the amino acid sequence as defined under UniProtKB/Swiss-Prot accession number Q06710. This includes the isoforms defined under accession numbers Q06710-1, Q06710-2, Q06710-3, Q06710-4 and Q06710-5.
Corresponding mRNA sequences include, but are not limited to, the nucleotide sequences defined under accession numbers:

BC001060, XM_011511792.1, NM_013951.3, NM_013952.3, NM_013953.3,
XM_011511790.1, XM_011511793.1, NM_013992.3, NM_003466.3, XM_011511794.1 and XM_011511791.1.

Any nucleotide sequence encoding human PAX8, an ortholog thereof, or a functional fragment thereof, can be used in accordance with this invention. The nucleic acid encoding PAX8 may have a sequence identity of at least 80%, preferably of at least 90%, to the nucleotide sequence as shown in SEQ ID NO:4 [accession number BC001060]. For reprogramming mouse fibroblasts the nucleotide sequence as shown under accession number NM_011040.4 can be used.
The term "overexpression" as used herein means that the expression level of a given gene in a host cell transfected with a nucleic acid encoding the gene is greater than the endogenous expression level of the gene in the non-transfected host cell. For example, if the fibroblasts transfected with an expression vector encoding Emx2 show a higher expression level of Emx2 nucleic acid than the non-transfected fibroblasts, there is overexpression of Emx2 in the transfected cells.
The expression level is preferably determined by quantitative Real-Time-PCR.
Fibroblasts may be obtained from the following sources:

Mouse embryonic Fibroblasts may be obtained from the limbs of E11.5-E14.5 embryos.
Postnatal mouse Fibroblasts may be obtained from the tail tips of about 1 week old mice.
Adult mouse fibroblasts may be obtained from the tail tips of about 8 week old mice.
Human Foreskin Fibroblasts may be obtained from the foreskin of a healthy boy, e.g. a 6 year old boy.
Human Fetal Fibroblasts may be obtained from fetal skin (commercially obtainable e.g. from ScienCell Research Laboratories)

In a certain embodiment, the method of the invention comprises only steps carried out in vitro and/or ex vivo. Accordingly, no step is carried out on the living human or animal body according to this embodiment.
The method of the invention preferably comprises the steps (a) providing one or more nucleic acids encoding EMX2, HNF1b, HNF4a and PAX8; (b) introducing said one or more nucleic acids into the fibroblasts so as to obtain transduced fibroblasts; and (c) culturing said transduced fibroblasts under conditions that allow overexpression of Emx2, Hnf1b, Hnf4a and Pax8.
The nucleic acids encoding EMX2, HNF1b, HNF4a and PAX8 can be non-circular nucleic acids. Preferably, however, the nucleic acids encoding EMX2, HNF1 b, HNF4a and PAX8 are comprised in a circular nucleic acid, more preferably in a plasmid or a vector. The nucleic acids are typically operably linked to a promoter sequence which is capable of inducing gene expression in fibroblasts. Suitable promoters include, but are not limited to, CMV, EF1a, SV40, PGK1, Ubc, human beta actin, CAG, and TRE.
The nucleic acids encoding EMX2, HNF1b, HNF4a and PAX8 can be on four separate plasmids or vectors. Preferably, however, a plasmid or vector to be used in accordance with this invention comprises nucleotide sequences encoding at least two proteins selected from the group consisting of EMX2, HNF1 b, HNF4a and PAX8. In another embodiment, a plasmid or vector to be used in accordance with this invention comprises nucleotide sequences encoding at least three proteins selected from the group consisting of EMX2, HNF1 b, HNF4a and PAX8. In yet another embodiment, the plasmid or vector to be used in accordance with this invention comprises nucleotide sequences encoding the proteins EMX2, HNF1 b, HNF4a and PAX8. That is, the plasmid or vector comprises coding sequences for all of the four genes Emx2, Hnf1b, Hnf4a and Pax8 or functional equivalent thereof.
The nucleic acid, plasmid or vector can be introduced into the fibroblasts or differentiated cells using techniques that are known per se.
Methods suitable for introducing nucleic acids sufficient to achieve expression of a protein of interest into mammalian host cells are known in the art. See, for example, Gething et al., Nature, 293:620-625, 1981; Mantei et al., Nature, 281:40-46, 1979; Levinson et al. EP 117,060 ; and EP 117,058 . For mammalian cells, common methods of introducing genetic material into mammalian cells include the calcium phosphate precipitation method of Graham and van der Erb (Virology, 52:456-457, 1978) or the lipofectamine^™ (Gibco BRL) Method of Hawley-Nelson (Focus 15:73, 1993). General aspects of mammalian cell host system transformations have been described by Axel in US. Pat. No. 4,399,216 . For various techniques for introducing genetic material into mammalian cells, see Keown et al., Methods in Enzymology, 1989, Keown et al., Methods in Enzymology, 185:527-537, 1990, and Mansour et al., Nature, 336:348-352, 1988.
In some embodiments of the methods of the invention, the step of introducing nucleic acid comprises delivering the nucleic acid into the cell (e.g., a human or other animal somatic cell) with a transfection reagent. However, the invention is not limited by the nature of the transfection method utilized. Indeed, any transfection process known, or identified in the future that is able to deliver nucleic acid into cells in vitro or in vivo, is contemplated, including methods that deliver the nucleic acid into cells in culture or in a life-supporting medium, whether said cells comprise isolated cells or cells comprising a eukaryotic tissue or organ, or methods that deliver the nucleic acid in vivo into cells in an organism, such as a human, animal, plant or fungus. In some embodiments, the transfection reagent comprises a lipid (e.g., liposomes, micelles, etc.). In some embodiments, the transfection reagent comprises a nanoparticle or nanotube. In some embodiments, the transfection reagent comprises a cationic compound (e.g., polyethylene imine or PEI). In some embodiments, the transfection method uses an electric current to deliver the mRNA into the cell (e.g., by electroporation).
The nucleic acid can be introduced by transfection or transduction into the cells using a vector, such as an integrating- or non-integrating vector. Of particular interest herein are retroviral vectors. Retroviral vectors, particularly lentiviral vectors, are transduced by packaging the vectors into virions prior to contact with a cell. After introduction, the DNA segment(s) encoding the potency-determining factor(s) can be located extra-chromosomally (e.g., on an episomal plasmid) or stably integrated into cellular chromosome(s).
A viral-based gene transfer and expression vector is a genetic construct that enables efficient and robust delivery of genetic material to most cell types, including non-dividing and hard-to-transfect cells in vitro or in vivo. Viral-based constructs integrated into genomic DNA result in high expression levels. In addition to a DNA segment that encodes a transcription factor of interest, the vectors include a transcription promoter and a polyadenylation signal operatively linked, upstream and downstream, respectively, to the DNA segment. The vector can include a single DNA segment encoding a single potency-determining factor or a plurality of potency-determining factor-encoding DNA segments. A plurality of vectors can be introduced into a single cell. The vector can optionally encode a selectable marker to identify cells that have taken up and express the vector. As an example, when the vector confers antibiotic resistance on the cells, antibiotic can be added to the culture medium to identify successful introduction of the vector into the cells. Integrating vectors can be employed, as in the examples, to demonstrate proof of concept. Retroviral (e.g., lentiviral) vectors are integrating vectors; however, non-integrating vectors can also be used. Such vectors can be lost from cells by dilution after reprogramming, as desired. A suitable non-integrating vector is an Epstein-Barr virus (EBV) vector. Ren C, et al., Acta. Biochim. Biophys. Sin. 37:68-73 (2005); and Ren C, et al., Stem Cells 24:1338-1347 (2006), each of which is incorporated herein by reference as if set forth in its entirety.
The vectors described herein can be constructed and engineered using art-recognized techniques to increase their safety for use in therapy and to include suitable expression elements and therapeutic genes. Standard techniques for the construction of expression vectors suitable for use in the present invention are well-known to one of ordinary skill in the art and can be found in such publications such as Sambrook J, et al., "Molecular cloning: a laboratory manual," (3rd ed. Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 2001), incorporated herein by reference as if set forth in its entirety.
After transfection or transduction, the cells are typically cultured under suitable conditions to allow overexpression of the transfected genes. The culture period from introduction of the gene into the fibroblasts until conversion of the cells into renal cells is typically at least 5 days, preferably at least 10 days, or 5 to 30 days, preferably 10 to 20 days, e.g. 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days or 20 days.
Suitable culture conditions include, but are not limited to, those described in the examples.
The renal cells obtained by the methods described herein can then be collected or recovered for further use as shown in the examples.
Possible uses include, but are not limited to, nephrotoxicity testing, pharmacological screening or disease modeling. The diseases which can be modeled using the renal cells of the present invention include, but are not limited to, end stage renal disease, polycystic kidney disease, CAKUT, Renal cystic, interstitial and tumorous kidney diseases; Renal tubular and metabolic diseases; and Nephrolithiasis.

EXAMPLES

METHODS

Animals

Xenopus embryos were cultured and manipulated as described previously⁴⁶. In brief, female frogs were injected with 700 units of human chorionic gonadotropin (Sigma). On the next morning, oocytes were collected and in vitro fertilized. Embryos were cultured in 0.3x Mark's modified Ringer (1 M NaCl; 20 mM KCI; 10 mM MgCl₂; 20 mM CaCl₂; 50 mM HEPES pH 7.5). Staging was according to Nieuwkoop and Faber (http://xenbase.org). Qt(ROSA)26Sor ^{tm4(ACTB-tdTomato,-EGFP)Luo/J} mice were purchased from The Jackson Laboratory (#007676 Strain of origin: B6.129(Cg)) and bred with KSP-Cre/+ (#012237 B6.Cg) mice to label renal tubular epithelial cells. Mice were housed in a SPF facility with free access to chow and water and a 12 h day/night cycle. Breeding and genotyping was done according to standard procedures. All animal experiments were conducted according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals, as well as the German law for the welfare of animals and were approved by local authorities (Regierungspräsidium Freiburg X12/08J and X13/08J).

Cell Culture

Murine embryonic fibroblasts (MEFs) were obtained from limbs of E13 embryos to exclude contamination with renal tissue. Tail tip fibroblasts (TTFs) were obtained from postnatal P7 and adult (P60) mice. Tissue was minced with a scalpel and digested with 0.25% Trypsin-EDTA for 30 min at 37°C. Trypsinization was stopped by addition of MEF Medium (MEFM: Dulbecco's modified Eagle's medium (DMEM), 10% fetal bovine serum (FBS), 2mM L-glutamine, penicillin/streptomycin). After resuspension the cells were centrifuged and the pellet was resuspended in MEFM and plated on gelatine-coated 6-well plates for 3 days until they reached confluency. Postnatal human fibroblasts used for qRT-PCR analysis were derived from foreskin (HFoFs) (Ethics committee number 521/13). Fetal human dermal fibroblasts (HFeF) used for FACS, 2D and 3D immunostainings were obtained from ScienCell Research Laboratories (2300). Human cells were cultivated in DMEM, high glucose, supplemented with 10% fetal bovine serum, 2mM L-glutamine and penicillin/streptomycin. MEFs, TTFs and human fibroblasts were frozen in liquid nitrogen and used without further passaging for reprogramming experiments.

Albumin uptake assay

Cells were incubated with Alexa647 labeled albumin (1 mg/ml, Life technologies, A34785) at 37°C for 0, 2, 5, 10, 15, 30 and 60 min. After incubation cells were washed five times with ice-cold PBS to stop endocytosis. Cells were fixed with 4% PFA and imaged using a Zeiss Axiovert fluorescence microscope equipped with a 40x lens. The average fluorescence intensity from 5 visual fields per time-point was calculated using ImageJ software.

Cytotoxicity assay

MEFs and iRECs were harvested after 6, 24 and 36 hours of incubation with 60 µg/ml cisplatin (Teva) by collecting cells in the supernatant as well as attached cells obtained by trypsinization. Cisplatin treated cells and untreated controls were stained with 1 µg/ml DAPI (Invitrogen, D1306) for 5 minutes and fluorescence was measured via flow cytometry using the 405 nm laser for excitation. Dead cells were identified by comparing emission of DAPI stained cell and unstained controls using a 450/50 nm band pass filter. For cisplatin uptake inhibition experiments MEFs and iRECs were left untreated or incubated with either 6 µg/ml cisplatin alone or 6 µg/ml cisplatin and 1mM cimetidine (Sigma-Aldrich, C4522). Cells were harvested and analyzed as described above. Experiments were performed in triplicates and repeated three times.

3D cell culture

3D cell culture was performed in Matrigel as described previously⁴⁷. In brief, cells were trypsinized, passed through a 50 µm cell strainer and counted. 10,000 cells were resuspended in 100 µl growth factor reduced Matrigel (Corning, 354230) and seeded in 8-well µ-Slides (Ibidi, 80826). Matrigel was allowed to polymerize for 15 min at 37°C followed by addition of renal epithelial growth medium (Lonza, CC-3190). Cells were imaged after 7 days or when spheroid formation was apparent. For immunofluorescent stainings cells were fixed in 4% PFA.

Quantitative Real-Time PCR

Total RNA was isolated using RNeasy Universal Plus Kit (Qiagen, 73404). 1 µg of RNA was reverse transcribed using QuantiTect Reverse Transcription Kit (Qiagen, 205311). qRT-PCR was performed using 1/500 to 1/50 of the reverse transcription reaction, gene specific primers and SYBR green Takyon mastermix (Eurogentec, UF-NSCT-B0210) on a ROCHE LC480 light cycler. For each gene three biological replicates were analyzed. Every replicate was measured three times. For data analysis the 2(-Delta C(T)) method was used to calculate relative expression levels followed by statistical analysis using Student's t-test as described previously⁴⁸. The sequences of primers used are shown in Table 1.

Table 1

List of oligonucleotides used for quantitative RT-PCR analysis
Primer name	Sequence	SEQ ID NO:
Esrrg Forward	CTATGGGGTTGCATCATGTGAA		5
Esrrg Reverse	CGTCTGCGCTTTGTGATCTC		6
Hnf1a Forward	GACCTGACCGAGTTGCCTAAT	7
Hnf1a Reverse	CCGGCTCTTTCAGAATGGGT		8
Lhx1 Forward	CCCATCCTGGACCGTTTCC	9
Lhx1 Reverse	CGCTTGGAGAGATGCCCTG		10
Nr1h4 Forward	GCTTGATGTGCTACAAAAGCTG	11
Nr1h4 Reverse	CGTGGTGATGGTTGAATGTCC	12
Pax2 Forward	AAGCCCGGAGTGATTGGTG		13
Pax2 Reverse	CAGGCGAACATAGTCGGGTT	14
Tfcp2l1 Forward	GCTGGAGAATCGGAAGCTAGG		15
Tfcp2l1 Reverse	AAAACGACACGGATGATGCTC	16
Vdr Forward	GTGCAGCGTAAGCGAGAGAT	17
Vdr Reverse	GGATGGCGATAATGTGCTGTTG		18
Abcc2 Forward	GTGTGGATTCCCTTGGGCTTT	19
Abcc2 Reverse	CACAACGAACACCTGCTTGG		20
Ggt1 Forward	TTTGTCATCATCGGCCTCTGT		21
Ggt1 Reverse	CCCGTCCAATCTCTGAGCAG		22
Lrp2 Forward	ACACTTGTGGGCATTCTC	23
Lrp2 Reverse	GCAGTCATTATCACCATCAC	24
Slc6a18 Forward	TGCTTTGCCTGTTTCCTCTCA		25
Slc6a18 Reverse	ATGTCATCACAGAACCGTTTCAT		26
Slc17a1 Forward	CCAAGGACCACCCGTATATGA	27
Slc17a1 Reverse	CTTTGATTGGCAGGGATTGTCT	28
Slc23a1 Forward	AAAGCAGCATGAGGTCGTGG	29
Slc23a1 Reverse	ACTGAAGCACGTCAGGTAATG		30
Trpv4 Forward	GCCGATTGAAGACTTTGAGG		31
Trpv4 Reverse	CTACGGCACTTACCGTCACC	32
Cdh1 Forward	AAGTACATCCTCTATTCTCA		33
Cdh1 Reverse	ATTCTGATCTGTCACTGT	34
Cdh6 Forward	GCAACGGAGATTAATAACC	35
Cdh6 Reverse	TCATAGAACTCAGCAAACT		36
Cdh16 Forward	ATACCAACTACAGGTCAC		37
Cdh16 Reverse	GTCATTCTCATCTTTCACAT		38
Actb Forward	CCTTCTTGGGTATGGAATC	39
Actb Reverse	CACTGTGTTGGCATAGAG		40
Tbp Forward	AGAACAATCCAGACTAGCAGCA	41
Tbp Reverse	GGGAACTTCACATCACAGCTC	42
HNF1A Forward	AACACCTCAACAAGGGCACTC	43
HNF1A Reverse	CCCCACTTGAAACGGTTCCT	44
NR1H4 Forward	GACTTTGGACCATGAAGACCAG	45
NR1H4 Reverse	GCCCAGACGGAAGTTTCTTATT	46
TFCP2L1 Forward	CGTTTAAGCAGAACGAGAATGGG	47
TFCP2L1 Reverse	TTTCATAGGACGGCTGGTATTTC	48
CDH16 Forward	AGAATGACAACGTGCCTATCTG	49
CDH16 Reverse	GCTGACAGTCTAGTCACTTCAGT		50
EPCAM Forward	ATAACCTGCTCTGAGCGAGTG	51
EPCAM Reverse	TGCAGTCCGCAAACTTTTACTA	52
GGT1 Forward	CTGGGGAGATCCGAGGCTAT	53
GGT1 Reverse	GATGACGGTCCGCTTGTTTTC	54
LRP2 Forward	GGCCTGCTATAACACCAGTCA		55
LRP2 Reverse	ACTCATTGTGCAAGCATATCTCA	56
SLC17A1 Forward	TCTGTTCCTTTCGCTATGGATTG	57
SLC17A1 Reverse	TTGGGCAAACCATGTGGATCT	58
HSPCB Forward	TCTGGGTATCGGAAAGCAAGCC	59
HSPCB Reverse	GTGCACTTCCTCAGGCATCTTG		60

Whole-mount in situ hybridization

Whole-mount in situ hybridization of Xenopus embryos was performed at stages 22, 26, 33 and 38. Digoxigenin-UTP labeled antisense probes were used as described before⁴⁶. To generate in situ probes, plasmids were linearized and transcribed with T7 or SP6 (Roche, DIG labeling kit). Antibody against digoxigenin conjugated to alkaline phosphatase was used to detect bound probes (Roche, 11093274910). In situ hybridization of paraffin-embedded mouse kidney sections was performed as described previously⁴⁹. In brief, embryos, or dissected kidney anlagen were fixed in 4% paraformaldehyde (PFA)/phosphate buffered saline (PBS), dehydrated through ethanol series and embedded in paraffin for sectioning at 10 µm. Digoxigenin-UTP labeled antisense probes were used for in situ hybridization and Eosin counterstaining was performed according to standard protocols⁴⁹. Plasmids used for probe synthesis are available upon request from the authors.

Colony Formation Assay

Fifty cells from MEFs or iRECs were seeded in 6-well plates and allowed to grow for 14 days prior to fixation and staining with 0.1% crystal violet in a 10% ethanol solution for 15 min at room temperature. Colonies were counted by macroscopic visual inspection of cells from 3 independent experiments.

Microarray Analyses

Total RNA from CFP treated control MEFs, GFP sorted iRECs and GFP sorted primary renal KSP-Cre tubule cells was isolated using RNeasy Universal Plus Kit (Qiagen, 73404). All cells were subjected to sorting prior to RNA extraction. Total RNA samples were processed with the Affymetrix WT Plus kit (Ambion, Austin TX, USA) as described by the manufacturer. Labeled fragments were hybridized to Affymetrix WT Mouse Gene ST 1.0/2.0 arrays for 16 h at 45°C and 60 rpm in an Affymetrix hybridization oven 645. After washing and staining using the Hybridization, Wash and Stain Kit (Affymetrix, USA), the arrays were scanned with the Affymetrix GeneChip Scanner 3000 7G resulting in signal intensity values for each individual probe. CEL files were generated from the raw data with Affymetrix GeneChip Command Console Software Version 4.0. We used Partek Genomics Suite software for further analysis (Partek, Inc.). CEL files were imported including control and interrogating probes. Pre-background adjustment was set to adjust for GC Content and probe sequence and RMA background correction was performed. Arrays were normalized using Quantile normalization and probeset summarization was done using Median Polish. Probe values were log2 transformed. In order to identify differentially expressed genes between the groups we performed a 1-way ANOVA in Partek. We used Fisher's Least Significant Difference (LSD) as Contrast method. The array results are deposited at ArrayExpress (E-MTAB-3648).

Molecular cloning and lentiviral transduction

Full-length or fragments of cDNA Xenopus and mouse transcription factors were cloned from cDNA of reverse transcribed total RNA isolates from stage 39 Xenopus and E15 mouse embryonic kidneys. Gene specific primers were used to amplify the coding sequences of the transcription factors. PCR products were cloned into pWPXLd, (Addgene (#12258)). To produce lentiviruses, plasmid DNA, pMD2.G (Addgene #12559), and psPax2 (Addgene #12260) were transfected into 293T cells using Calcium Phosphate transfection. Two days after transfection cell supernatants were harvested and virus was concentrated using polyethylene glycol precipitation as described previously⁵⁰. Concentrated virus was frozen at -80°C and thawed directly before transduction of cells. For the infection of MEFs, TTFs, HFoFs and HFeFs virus concentrate was diluted 1:100 to 1:1000 in MEFM containing 10 µg/ml Polybrene and cells were incubated for 12 h. Viral infection was repeated five times. After cultivation in MEFM for 7 days, MEFs and TTFs were analyzed for GFP expression by flow cytometry. GFP positive iRECs were isolated by fluorescence activated cell sorting (FACS) 14 days after the last virus transduction and expanded for further analysis. Reprogrammed HFeFs were identified 28 days after the last transduction by sorting for CD90^- CD326⁺ cells.

Western blot analysis

Proteins were fractionated by SDS/PAGE and anti 2A-peptide antibody (ABS31, Merck Millipore) was used for protein detection by Western blot.

Immunofluorescent stainings

Cells were washed twice with PBS and fixed in 4% paraformaldehyde for 15 min at room temperature. For permeabilization the cells were incubated with PBST (0.1% Triton-X-100 in PBS) for 10 min at room temperature. After blocking for 1 h with 2% horse serum, 5% BSA, 1% goldfish gelatin in PBS cells were incubated with primary antibody for 60 min at room temperature and subsequently with a secondary fluorescence-conjugated antibody for 60 min at room temperature in the dark. DNA was stained with Hoechst 33342 diluted 1:2,000 in PBS. Primary and secondary antibodies were diluted in PBS containing 10% of the blocking solution. Antibodies used for immunofluorescent staining were as follows: β-Catenin (Santa-Cruz, sc7199, 1:100), E-Cadherin (Invitrogen, 13-1900, 1:100), Epcam (Abcam, ab71916, 1:100), Laminin (Sigma, L9393, 1:100), LTL (Biozol, B-1325, 1:100), Megalin (Santa-Cruz, sc16478, 1:100), Na⁺K⁺-ATPase (Abcam, ab7671, 1:100), PAX2 (Abcam, ab37129, 1:100), Phalloidin (Mol. Probes, A22287, 1:100), TRPV4 (Alomone, acc-034, 1:100), Vimentin (Sigma, V2258), ZO-1 (Santa-Cruz, sc33725, 1:100).
The following secondary antibodies were used: Goat anti rat Alexa-633 (Life Technologies, A-21094, 1:500), Goat anti rabbit Alexa-647 (Life Technologies, A-21245, 1:500), Goat anti mouse Alexa-647 (Life Technologies, A-21235, 1:500), Donkey anti goat Alexa-647 (Life Technologies, A-21447, 1:500)

Flow cytometry

For flow cytometry analyses, cells were harvested, resuspended in FACS buffer (PBS supplemented with 3% FBS and 5 mM EDTA), filtered through a 50 µm cell strainer and analyzed by the 13-color LCR Fortessa FACS analyzer (Becton Dickinson). For the selection of GFP positive cells the ARIA III cell sorter (Becton Dickinson) was used. Data were analyzed by FlowJo (FlowJo LLC) or FACS DIVA (Becton Dickinson) software. For sorting of CD90^- CD326⁺ mouse and human cells the following antibodies were used according to the manufacturer's instructions: anti-mouse CD90 Alexa 647 (Biolegend, 105317), anti-mouse CD326 BV421 (BD Bioscience, 563214), anti-human CD90 FITC (MACS Miltenyi Biotec, 130-097-930), anti-human CD326 BV421 (BD Bioscience, 563180).

Kidney reaggregation

Kidney reaggregation was performed as described previously⁵¹. In brief, 20 E13 embryonic mouse kidneys were harvested and digested. 80,000 embryonic kidney cells were mixed with 8,000 iRECs or control cells and pelleted by centrifugation. The pellet was transferred to a low-binding PCR tube and allowed to aggregate overnight at 37°C. Next day the cell aggregates were transferred to a transwell filter (Costar, 3450) and cultured for 4 days at 37°C, 5% CO₂. Reaggregates were fixed in 4% PFA, stained and imaged by confocal microscopy.

Recellularization of decellularized kidneys

For recellularization experiments⁴⁰ cadaveric kidneys from adult wild-type rats were flushed 10 times with heparinized PBS (10 U/ml; Sigma H3393) followed by incubation in 1% SDS (Roth 2326.3) in PBS for three days until decellularization was observed. During this time kidneys were repeatedly flushed with 1% SDS in PBS every 6 to 12 h. Subsequently, decellularized kidneys were rinsed 5 times with PBS containing penicillin/ streptomycin and 100 µg/ml Normocin (Invivogen). Seeding of iRECs into the organ scaffolds was performed by injection of 10⁶ trypsinized cells with a 25G needle and subsequent cultivation in MEFM for 14 days.

Imaging

Confocal imaging was performed using a LSM-I-NLO2 510 META microscope equipped with a 25x/0.8 LD LCI-Plan-Apochromat objective (both Carl Zeiss). Excitation of the fluorophores (Hoechst 33342, GFP, Tomato, Alexa647) was performed with a two photon laser at 740 nm, and a single photon laser at 488 nm, 561 nm and 633 nm, respectively. Image analysis was performed using ZEN (Zeiss) and Imaris (Bitplane) software.

Transmission electron microscopy

3D cultures of MEFs and iRECs were fixed in 4% PFA and 1% glutaraldehyde in 0.1 M phosphate buffer for 1 h at room temperature. After washing in 0.1 M PB cultures were contrasted using 1% OsO₄ (Sigma-Aldrich, Germany) for 45 minutes and 1% uranyl acetate (Polysciences, Germany) in 70% ethanol. After dehydration cultures were flat embedded in Durcupan (Sigma-Aldrich, Germany). Ultrathin sections (40 nm thickness) were analyzed using a Philipps CM 100 transmission electron microscope.

Data analysis

Quantitative expression data²² for all transcription factors across various human tissues was analyzed to identify candidate reprogramming factors. Relative expression was determined as the absolute expression in the target tissue divided by the median of all other tissues. Transcriptional circuitry analysis was performed as previously described³³ and the online platform http://www.regulatorynetworks.org/ was used to retrieve predicted transcriptional targets of reprogramming factors. Differential expression values between MEFs and iRECs of the microarray experiments were mapped to each target and visualized using Cytoscape⁵². CellNet scores were calculated by the online platform http://cellnet.hms.harvard.edu/ ³⁰. For comparison of differentially regulated genes to published RNAseq data, the raw data^{31, 32} was mapped to 10 fold differentially regulated genes between iREC and MEFs based on microarray analysis. For GO-term analysis of molecular function, 10 fold differentially regulated genes were analyzed using the DAVID-platform⁵³. Statistical analysis was performed using SigmaStat and graphs were made with GraphPadPrism. Data analysis was performed with Microsoft Excel.

RESULTS

Identification of Renal Cell Fate Inducing Transcription Factors

To define criteria for the unbiased selection of candidate kidney reprogramming factors (Fig. 1a), we analyzed quantitative mRNA expression data of all known transcription factors across different adult human tissues²² (Fig. 1b). Previously reported reprogramming factors were expressed at high absolute levels in their target tissue and showed high relative expression in comparison to other tissues. Based on these criteria a set of 55 candidate kidney reprogramming factors could be defined.
Core regulators of renal identity are likely to have an evolutionary conserved function during early nephrogenesis. Central aspects of Xenopus laevis pronephros development and function exhibit remarkable similarities to mammalian kidney development²³. Therefore, we performed a comparative in situ hybridization screen of orthologous genes to the 55 human candidate factors in Xenopus (Fig. 1c and 8). 38 genes showed a distinct expression in the pronephros; 18 were detected at the earliest analyzed time point (stage 22). Comparable early and tissue-restricted expression during mouse metanephros development was detected in embryonic day 12 (E12) to E17 kidney anlagen (Fig. 1c) and by comparison to published expression data ^24-26. Thus, 38 factors with early and evolutionary conserved expression during renal development were included in subsequent analysis.
As a third selection criterion for potential reprogramming factors, genes associated with congenital renal disease in humans or renal loss-of-function phenotypes in mouse were considered essential and non-redundant for renal development. This stepwise selection further reduced the number of potential reprogramming factors to 13 candidates that were functionally tested for their potency to induce renal cell fate.

Emx2, Hnf1b, Hnf4a and Pax8 Convert Fibroblasts into iRECs.

First, we tested if individual or combinations of candidate reprogramming factors could direct mammalian cells towards renal cell fate. Because candidate factors were predicted based on expression data from whole kidneys, we focused on tubule epithelial cells that constitute the major cell type of the kidney.
To detect a fate switch towards tubule cell identity, we crossed mice harboring Cre-recombinase under control of the renal tubule-specific cadherin-16 promoter (Cdh16/Ksp-Cre (kidney specific protein)) to mice with a membrane-tandem dimer tomato red/membrane-GFP (mTOM/mGFP) dual fluorescent reporter²⁷. In resulting mice Cre-mediated recombination leads to the expression of membrane GFP specifically in renal tubular epithelial cells, while non Cre-expressing cells maintain red fluorescence (Fig. 2a). We isolated mouse embryonic fibroblasts (MEFs) from limbs of E13 embryos carrying the reporter system to exclude potential contamination with renal precursor cells. Next, we expressed candidate transcription factors in isolated MEFs by lentiviral transduction and analyzed GFP reporter-expression by flow cytometry (Fig. 2a and 9a).
When a cocktail of all 13 candidate factors was transduced, 0.1% of cells expressed GFP one week after transduction (Fig. 2b). To determine the minimal set of factors required for kidney-fate induction, we systematically removed individual candidates from the pool of 13 transcription factors (13TF-1; Fig. 2c). Withdrawal of Foxc1, Gata3, Hnf1a, Lhx1, and Tfap2b increased the percentage of GFP-positive cells. Consequently, these factors were excluded from the following experiments (8TF-1; Fig. 2d). Removal of each of the four factors Emx2, Hnf1b, Hnf4a, and Pax8, either from the pools of 13 or 8 factors significantly reduced the percentage of GFP-positive cells (Figs. 2c,d). Conversely, the combined expression of these four factors significantly increased the average percentage of GFP-positive cells to 0.6%.
Importantly, none of the four factors could induce reporter activity when overexpressed individually (Figs. 2e,f). Of note, the percentage of GFP-positive cells increased to 11% five weeks after lentiviral transduction (Figs. 2g,h).
Next, we tested, if the expression of all four transcription factors from a single vector would be sufficient for reprogramming. Multicistronic expression ensures defined stoichiometric expression and can enhance reprogramming efficiency for in vivo applications²⁸. Here, on average 5.4% of cells were GFP-positive 39 days after lentiviral transduction (Figs. 9b,c,d), suggesting that the multicistronic expression of four factors can induce cell type conversion. To evaluate if postnatal fibroblasts could similarly be used for reprogramming, tail-tip fibroblasts of postnatal day 7 (P7) and adult mice were transduced with four transcription factors. The detection of GFP-positive cells indicated that reprogramming towards renal epithelial fate was not limited to embryonic fibroblasts (Figs. 9e,f).
In conclusion, a combination of four factors (i.e. Emx2, Hnf1b, Hnf4a, Pax8) is sufficient to activate renal tubule specific reporter expression in embryonic, and postnatal fibroblasts. We therefore termed these cells induced renal tubular epithelial cells (iRECs).

iRECs Show Epithelial Characteristics

To characterize iRECs, GFP-positive cells were isolated by fluorescence-activated cell sorting (FACS) and expanded in culture. iRECs exhibited a characteristic epithelial morphology and formed a tight epithelial layer when grown to confluency (Fig. 3a). Sparsely seeded cells formed colonies after 2 weeks of culture, suggesting that iRECs have the capacity of clonogenic proliferation¹⁷ (Figs. 3b,c). iRECs cultured in serum-reduced renal epithelial-growth medium on Matrigel-coated dishes formed branched epithelial structures (Fig. 3d). Densely grown iRECs frequently exhibited dome-like structures (Fig. 3d), a characteristic feature of renal epithelial cells indicative of directed transport of solutes and water influx²⁹.
Next, we analyzed epithelial cell adhesion molecules with a strong expression in renal tubule cells. Both Cdh1 and Cdh6 transcripts, and as expected from Ksp-Cre reporter activation, Cdh16 (Ksp) were robustly expressed in iRECs (Fig. 9g).
In addition, immunostaining for ZO-1, E-cadherin (CDH1) and EPCAM demonstrated membrane localization of these epithelial marker proteins in iRECs, but not in MEFs (Fig. 3e). In contrast, the intermediate filament protein vimentin, marking mesenchymal cells, was present in MEFs, but absent in iRECs. Thus, iRECs acquired epithelial cell identity during reprogramming, and had generally lost their mesenchymal phenotype.

iRECs Resemble Primary Tubule Cells in their Expression Profile.

Next, we assessed the global transcriptional profile of iRECs in comparison to FACS-isolated primary renal tubule cells from P7 Ksp-Cre mTOM/mGFP mice and MEFs. Hierarchical clustering analysis of microarray data indicated that iRECs more closely resembled primary renal tubular epithelial cells than MEFs (Fig. 4a).
Recently, a quantitative measure for the degree to which engineered cells resemble their target tissue was introduced (CellNet)³⁰. Calculation of this classification score is based on gene regulatory network activation and extends from 0 (no similarity) to 1 (indistinguishable). CellNet analysis revealed that iRECs more closely resemble kidney tissue than any other cell types (Fig. 4b), except for some residual fibroblast signature. iRECs possessed a mean classification score of 0.30, similar to the score of directly converted neurons (0.34) and cardiomyocytes (0.27) (Fig. 4c). Thus, the degree of similarity of iRECs to their native counterparts matches other previous reprogramming approaches.
We further assessed the expression of kidney-specific marker genes by qRT-PCR (Fig. 4d). The transcriptional regulators of kidney development Pax2 or Lhx1, the highly kidney specific amino acid transporter Slc6a18, the organic anion transporter Slcl7a1 and the receptor protein Lrp2 were strongly upregulated, confirming the microarray expression analysis.
To investigate the main transcriptional changes during reprogramming to iRECs, expression levels of genes that were differentially regulated in our dataset were analyzed in various mouse and human tissues using published RNA-sequencing expression datasets^{31, 32}. Genes that were 10-fold upregulated in iRECs versus MEFs were most abundantly expressed in kidney samples, while down-regulated genes were strongly expressed in MEFs (Fig. 10a). Gene ontology (GO) analysis revealed that categories associated with transmembrane transport activity were significantly enriched in 10-fold upregulated genes (Fig. 10b), consistent with the elevated expression of tubular expressed ion channels and transporters in iRECs (Fig. 4d). We concluded that the mRNA expression profile of iRECs is most similar to that of renal tissue.
To explore how the combinatorial actions of the 4TFs regulate target gene expression and initiate the transcriptional circuitry of iRECs, we retrieved 164 putative direct target genes of the four reprogramming factors from published gene-regulatory networks³³ and analyzed their expression levels in iRECs in comparison to MEFs (Fig. 4e). Interestingly, prominent regulators of renal tubule development, such as Pax2, Lhx1, and Hnf1a were strongly induced targets of at least one of the four reprogramming factors. The nephron progenitor marker Osr1 was down-regulated in iRECs and primary tubule cells compared to MEFs, suggesting that iRECs represent differentiated cells rather than renal progenitors. Collectively, these analyses indicate that the combinatorial action of the four reprogramming factors regulate the expression of a limited set of downstream transcription factors that may additionally contribute to the reprogramming and maintenance of iRECs.
Next, we sought to determine if high mRNA transcript levels of renal tubular genes in iRECs were also reflected by protein expression. The alphal subunit of the Na⁺/K⁺-ATPase (ATP1A1) contributes to blood pressure regulation by controlling sodium excretion³⁴. ATP1A1 was detected at the lateral membrane in iRECs, consistent with its subcellular localization and function in vivo (Fig. 4f). Immunostaining for the transcription factor PAX2 showed nuclear staining, whereas Aquaporin 1 (AQP1) was detected at the membrane (Fig. 4f). Thus, upregulated mRNA in iRECs resulted in translation and correct subcellular targeting of the analyzed proteins.

iRECs Display Morphological and Functional Characteristics of Renal Tubular Epithelial Cells.

Next, we characterized the behavior of iRECs in a three dimensional extracellular matrix. iRECs consistently formed spheres with a central lumen when grown in Matrigel 3D culture (Figs. 5a,b,c). In contrast, MEFs only formed irregular and unstructured conglomerates without obvious organization. iREC-derived spheres exhibited a robust apico-basal polarization with apical localization of tight junction protein ZO-1, apical actin accumulation indicated by phalloidin staining, and basolateral localization of β-catenin (Fig. 5d). Similarly, the localization of Na⁺/K⁺-ATPase alpha1 was detected basolaterally in iRECs, while megalin (LRP2) showed apical localization (Fig. 5d), consistent with their subcellular localization in renal tubular epithelial cells. The mechanosensory channel TRPV4 was detected predominantly at the apical membrane. Staining for the mesenchymal marker vimentin was completely absent from iREC spheres (Fig. 5d).
In addition, we performed ultrastructural analysis of 3D spheres by transmission electron microscopy. iRECs appeared as polarized cuboidal epithelial cells, established complex tight junctions and extended multiple luminal microvilli from their apical surface (Fig. 5e). Spheres were surrounded by a tight and electron-dense extracellular matrix, reminiscent of basement membrane material (Fig. 5e). The apolipoprotein-receptor megalin (LRP2) mediates the endocytotic uptake of proteins, including albumin³⁵. Based on its prominent expression, we tested iRECs for their uptake of fluorescently labeled albumin. Fluorescence intensity was significantly increased in iRECs compared to MEFs (Figs. 5f,g), indicating that iRECs possess endocytotic activity.
Cisplatin, a commonly used chemotherapeutic drug, has major nephrotoxic side effects by damaging renal tubular cells³⁶. To test whether iRECs exhibit cisplatin sensitivity we incubated MEFs and iRECs with 60 µM cisplatin for up to 36 h. Apoptosis was significantly increased in Cisplatin treated iRECs in comparison to MEFs (Fig. 5h). Cisplatin uptake into renal tubular cells is mediated in part by the organic cation transporter 2 (Oct2)³⁷. Notably, cisplatin induced toxicity in iRECs could be decreased by incubation with 1 mM of Cimetidine, a known inhibitor of Oct2³⁸ (Fig. 5i). Collectively, the functional features of iRECs are reminiscent of renal tubular epithelial cells and indicate that iRECs can be employed for renal toxicity testing.

iRECs Integrate into Renal Organoids and Form Tubular Structures in Decellularized Kidneys.

Single cell suspensions of embryonic kidney cells can reaggregate and self-organize into renal organoids including embryonic renal structures such as ureteric bud and early tubules³⁹. To test if iRECs share this potential, E13 embryonic kidneys constitutively expressing mTomato were disintegrated to single-cell suspension, and mixed with GFP-expressing iRECs or MEFs, followed by reaggregation and culture (Fig. 6a). While MEFs failed to integrate into tubular structures and were predominantly found in the stroma or were even excluded from the aggregates, iRECs integrated into tubule epithelial structures (Fig. 6b). Immunostaining for laminin demonstrated that iRECs shared a continuous basement membrane layer with neighboring epithelial cells (Fig. 6c). The proximal tubule marker LTL and megalin were similarly found in iRECs and in native tubule cells demonstrating that iRECs were differentiated and polarized within the renal microenvironment (Fig. 6c). Thus, iRECs can participate in the formation of self-organizing kidney organoids.
Finally, we asked if iRECs would also assemble into tubules in the absence of other cell types, only guided by the structure of extracellular matrix (ECM). Decellularized kidneys with intact three-dimensional ECM were thus used as guidance scaffold⁴⁰. iRECs grew into long, and partially convoluted tubules within decellularized kidneys (Fig. 6d). Thus, iRECs have the potential to repopulate a kidney scaffold along preformed guidance structures in the absence of other cell types.

Induction of human renal epithelial cells.

Next we tested if human fibroblasts could also be reprogrammed towards a renal cell fate. Combined overexpression of EMX2, HNF1B, HNF4A, and PAX8 in human fibroblasts resulted in cells with epithelial morphology similar to murine iRECs (Fig. 7a). 4TF treated human cells showed marker expression comparable to iRECs, including membranous β-Catenin, nuclear PAX2, and positive staining for proximal tubule specific LTL (Fig. 7a). mRNA levels of renal transcription factors, adhesion molecules and transporters were upregulated after 4TF treatment as compared to fibroblasts (Fig. 7b).
Due to the lack of a genetically encoded reporter to indicate renal tubule cell fate in human cells, we enriched reprogrammed human fibroblast based on their expression of epithelial markers. Expression of 4TFs in both mouse and human cells reduced the fibroblasts marker THY-1 (CD90) as determined by flow cytometry (Fig. 7c). In contrast, the epithelial cell adhesion molecule EPCAM (CD326) was upregulated (Fig. 7c) both in mouse iRECs and human reprogrammed cells. We therefore enriched human iRECs (h-iRECs) by sorting for CD90^- CD326⁺ four weeks after lentiviral infection (Fig. 7d). Sorted h-iRECs formed spheroids in Matrigel, similar to their mouse counterparts (Fig. 7e). The spheroids were polarized, as indicated by apical actin accumulation and basolateral β-Catenin expression (Fig. 7f). While the frequency of lumen formation was lower and the overall size of human derived spheroids was smaller in comparison to mouse iRECs, the expression of EMX2, HNF1B, HNF4A, and PAX8 could similarly reprogram human fibroblasts into renal epithelial like cells (h-iRECs).

REFERENCES:

1. USRD United States Renal Data System. Annual Data Report: Epidemiology of Kidney Disease in the United States. National Institutes of Health, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD. (2014).
2. Morizane, R. et al. Nephron organoids derived from human pluripotent stem cells model kidney development and injury. Nat Biotech advance online publication (2015).
3. Taguchi, A. et al. Redefining the in vivo origin of metanephric nephron progenitors enables generation of complex kidney structures from pluripotent stem cells. Cell Stem Cell 14, 53-67 (2014).
4. Takasato, M. et al. Directing human embryonic stem cell differentiation towards a renal lineage generates a self-organizing kidney. Nat Cell Biol 16, 118-126 (2014).
5. Takasato, M. et al. Kidney organoids from human iPS cells contain multiple lineages and model human nephrogenesis. Nature advance online publication (2015).
6. Xia, Y. et al. Directed differentiation of human pluripotent cells to ureteric bud kidney progenitor-like cells. ).
7. Papadimou, E. et al. Direct Reprogramming of Human Bone Marrow Stromal Cells into Functional Renal Cells Using Cell-free Extracts. Stem Cell Reports (2015).
8. Knoepfler, P.S. Deconstructing stem cell tumorigenicity: a roadmap to safe regenerative medicine. Stem Cells 27, 1050-1056 (2009).
9. Xu, J., Du, Y. & Deng, H. Direct lineage reprogramming: strategies, mechanisms, and applications. Cell Stem Cell 16, 119-134 (2015).
10. Vierbuchen, T. et al. Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463, 1035-1041 (2010).
11. Najm, F.J. et al. Transcription factor-mediated reprogramming of fibroblasts to expandable, myelinogenic oligodendrocyte progenitor cells. ).
12. Yang, N. et al. Generation of oligodendroglial cells by direct lineage conversion. ).
13. leda, M. et al. Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. Cell 142, 375-386 (2010).
14. Du, Y. et al. Human hepatocytes with drug metabolic function induced from fibroblasts by lineage reprogramming. Cell Stem Cell 14, 394-403 (2014).
15. Huang, P. et al. Induction of functional hepatocyte-like cells from mouse fibroblasts by defined factors. Nature 475, 386-389 (2011).
16. Sekiya, S. & Suzuki, A. Direct conversion of mouse fibroblasts to hepatocyte-like cells by defined factors. Nature 475, 390-393 (2011).
17. Buganim, Y. et al. Direct reprogramming of fibroblasts into embryonic Sertoli-like cells by defined factors. Cell Stem Cell 11, 373-386 (2012).
18. Hendry, C.E. et al. Direct transcriptional reprogramming of adult cells to embryonic nephron progenitors. J Am Soc Nephrol 24, 1424-1434 (2013).
19. Heinaniemi, M. et al. Gene-pair expression signatures reveal lineage control. ).
20. Pereira, C.F., Lemischka, I.R. & Moore, K. Reprogramming cell fates: insights from combinatorial approaches. Ann N Y Acad Sci 1266, 7-17 (2012).
21. Lang, A.H., Li, H., Collins, J.J. & Mehta, P. Epigenetic landscapes explain partially reprogrammed cells and identify key reprogramming genes. ).
22. Ravasi, T. et al. An atlas of combinatorial transcriptional regulation in mouse and man. Cell 140, 744-752 (2010).
23. Raciti, D. et al. Organization of the pronephric kidney revealed by large-scale gene expression mapping. Genome Biol 9, R84 (2008).
24. Harding, S.D. et al. The GUDMAP database--an online resource for genitourinary research. Development 138, 2845-2853 (2011).
25. McMahon, A.P. et al. GUDMAP: the genitourinary developmental molecular anatomy project. J Am Soc Nephrol 19, 667-671 (2008).
26. Yu, J. et al. Identification of molecular compartments and genetic circuitry in the developing mammalian kidney. Development 139, 1863-1873 (2012).
27. Shao, X., Somlo, S. & Igarashi, P. Epithelial-specific Cre/lox recombination in the developing kidney and genitourinary tract. ).
28. Riddell, J. et al. Reprogramming committed murine blood cells to induced hematopoietic stem cells with defined factors. Cell 157, 549-564 (2014).
29. Valentich, J.D., Tchao, R. & Leighton, J. Hemicyst formation stimulated by cyclic AMP in dog kidney cell line MDCK. ).
30. Cahan, P. et al. CellNet: network biology applied to stem cell engineering. Cell 158, 903-915 (2014).
31. Cabili, M.N. et al. Integrative annotation of human large intergenic noncoding RNAs reveals global properties and specific subclasses. ).
32. Shen, Y. et al. A map of the cis-regulatory sequences in the mouse genome. Nature 488, 116-120 (2012).
33. Neph, S. et al. Circuitry and dynamics of human transcription factor regulatory networks. Cell 150, 1274-1286 (2012).
34. Jaitovich, A. & Bertorello, A.M. Salt, Na+,K+-ATPase and hypertension. Life Sci 86, 73-78 (2010).
35. Cui, S., Verroust, P.J., Moestrup, S.K. & Christensen, E.I. Megalin/gp330 mediates uptake of albumin in renal proximal tubule. Am J Physiol 271, F900-907 (1996).
36. Pabla, N. & Dong, Z. Cisplatin nephrotoxicity: mechanisms and renoprotective strategies. Kidney international 73, 994-1007 (2008).
37. Ciarimboli, G. et al. Cisplatin nephrotoxicity is critically mediated via the human ).
38. Yonezawa, A. et al. Association between tubular toxicity of cisplatin and expression of organic cation transporter rOCT2 (Slc22a2) in the rat. Biochemical pharmacology 70, 1823-1831 (2005).
39. Unbekandt, M. & Davies, J.A. Dissociation of embryonic kidneys followed by reaggregation allows the formation of renal tissues. Kidney Int 77, 407-416 (2010).
40. Song, J.J. et al. Regeneration and experimental orthotopic transplantation of a bioengineered kidney. Nat Med 19, 646-651 (2013).
41. Nam, Y.J. et al. Induction of diverse cardiac cell types by reprogramming fibroblasts with cardiac transcription factors. Development 141, 4267-4278 (2014).
42. Wernig, M. et al. A drug-inducible transgenic system for direct reprogramming of multiple somatic cell types. ).
43. Yoo, A.S. et al. MicroRNA-mediated conversion of human fibroblasts to neurons. Nature 476, 228-231 (2011).
44. Murphy, S.V. & Atala, A. 3D bioprinting of tissues and organs. Nat Biotechnol 32, 773-785 (2014).
45. Lau, S., Rylander Ottosson, D., Jakobsson, J. & Parmar, M. Direct neural conversion from human fibroblasts using self-regulating and nonintegrating viral vectors. Cell Rep 9, 1673-1680 (2014).
46. Lienkamp, S. et al. Inversin relays Frizzled-8 signals to promote proximal pronephros development. Proc Natl Acad Sci U S A 107, 20388-20393 (2010).
47. Giles, R.H., Ajzenberg, H. & Jackson, P.K. 3D spheroid model of mIMCD3 cells for studying ciliopathies and renal epithelial disorders. Nat Protoc 9, 2725-2731 (2014).
48. Schmittgen, T.D. & Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. ).
49. Nagy, A.G., M.; Vintersten, K.; Behringer, R. [Production of chimeras]. Manipulating the mouse embryo. A laboratory manual. 3rd edition., in Cold Spring Harbor Laboratory Press 453-506 (2003).
50. Kutner, R.H., Zhang, X.Y. & Reiser, J. Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors. ).
51. Xia, Y. et al. The generation of kidney organoids by differentiation of human pluripotent cells to ureteric bud progenitor-like cells. Nat Protoc 9, 2693-2704 (2014).
52. Shannon, P. et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. ).
53. Huang da, W., Sherman, B.T. & Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. ).

Claims

A method for producing renal cells, comprising overexpressing Emx2, Hnf1b, Hnf4a and Pax8 in differentiated cells.
The method of claim 1, wherein the renal cells are renal tubular cells.
The method of claim 1, wherein the renal cells are renal tubular epithelial cells.
The method of any one of the preceding claims, wherein the differentiated cells are fibroblasts.
The method of claim 4, wherein the fibroblasts are embryonic fibroblasts.
The method of claim 4, wherein the fibroblasts are adult fibroblasts.
The method of any one of the preceding claims, wherein said overexpressing comprises (a) providing one or more nucleic acids encoding Emx2, Hnf1b, Hnf4a and Pax8; (b) introducing said one or more nucleic acids into the differentiated cells so as to obtain transduced or transfected cells; and (c) culturing said transduced or transfected cells under conditions that allow overexpression of Emx2, Hnf1b, Hnf4a and Pax8.
The method of claim 7, wherein said one or more nucleic acids are plasmids or vectors comprising a nucleotide sequence encoding Emx2, Hnf1b, Hnf4a, Pax8 or a combination thereof, operably linked to a promoter capable of inducing overexpression of the encoded genes.
The method of any one of the preceding claims, wherein said Emx2 comprises the nucleotide sequence as shown in SEQ ID NO:1 or a functional fragment thereof.
The method of any one of the preceding claims, wherein said Hnf1b comprises the nucleotide sequence as shown in SEQ ID NO:2 or a functional fragment thereof.
The method of any one of the preceding claims, wherein said Hnf4a comprises the nucleotide sequence as shown in SEQ ID NO:3 or a functional fragment thereof.
The method of any one of the preceding claims, wherein said Pax8 comprises the nucleotide sequence as shown in SEQ ID NO:4 or a functional fragment thereof.
A renal cell obtainable by the method of any one of the preceding claims.
The use of the renal cell of claim 13 for nephrotoxicity testing, pharmacological screening or disease modeling.