EP3068930A2 - Biomarker for melk activity and methods of using same - Google Patents
Biomarker for melk activity and methods of using sameInfo
- Publication number
- EP3068930A2 EP3068930A2 EP14862279.8A EP14862279A EP3068930A2 EP 3068930 A2 EP3068930 A2 EP 3068930A2 EP 14862279 A EP14862279 A EP 14862279A EP 3068930 A2 EP3068930 A2 EP 3068930A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- human
- ortholog
- eif4b
- melk
- phosphorylated
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57575—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving oncogenic proteins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/91—Transferases (2.)
- G01N2333/912—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/02—Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
Definitions
- MELK maternal embryonic leucine zipper kinase
- the present invention is based, at least in part, on the discovery that the level of phosphorylation of position 406 (e.g., a serine residue) of human cukaryotic initiation factor 4B (eIF4B) is a reliable biomarkcr for maternal embryonic leucine zipper kinase (MELK) activity suitable for use in measuring MELK enzymatic activity for preclinical and clinical applications.
- position 406 e.g., a serine residue
- eIF4B human cukaryotic initiation factor 4B
- MELK maternal embryonic leucine zipper kinase
- the present invention is based, at least in part, on the discovery that the level of phosphorylation of position 3 (e.g., a threonine residue) and/or position 10 (e.g., a serine residue) of human Histonc H3 and/or position 1 1 (e.g., a threonine residue) is also a reliable biomarker for MELK activity suitable for use in measuring MELK enzymatic activity or preclinical and clinical applications.
- position 3 e.g., a threonine residue
- position 10 e.g., a serine residue
- position 1 1 e.g., a threonine residue
- a method of identifying an agent which inhibits kinase or oncogenic activity of human maternal embryonic leucine zipper kinase (MELK) or an ortholog thereof comprising a) contacting a sample comprising i) human MELK or an ortholog thereof and ii) human cukaryotic initiation factor 4B (eIF4B) or an ortholog thereof, with the agent; and b) determining the ability of the agent to inhibit Scr-406 phosphorylation of human eIF4B or a corresponding phosphorylatablc amino acid in the ortholog of human eIF4B, wherein decreased phosphorylation identifies an agent which inhibits kinase or oncogenic activity of human MELK or the ortholog thereof, is provided.
- MELK human maternal embryonic leucine zipper kinase
- the inhibition of said Ser-406 phosphorylation of human eIF4B or a corresponding phosphorylatablc amino acid in an ortholog of human eIF4B is determined by comparing the amount of Ser-406 phosphorylated human elF4B or a corresponding phosphorylatablc amino acid in the ortholog of human eIF4B, in the sample relative to a control.
- the control is the amount of Ser-406 phosphorylated human clF4B or a corresponding phosphorylatablc amino acid in the ortholog of human eIF4B in the sample relative to said amount in the absence of the agent or at an earlier timcpoint after contact of the sample with the agent.
- phosphorylatable amino acid in an ortholog of human eIF4B is determined by comparing the ratio of the amount of Scr-406 phosphorylated human eIF4B, or a corresponding phosphorylatablc amino acid in the ortholog of human eIF4B, in the sample relative to the total amount of human eIF4B or ortholog thereof, to a control.
- the control is the ratio of the amount of Scr-406 phosphorylated human eIF4B or a corresponding phosphorylatablc amino acid in the ortholog of human eIF4B in the sample relative to said ratio in the absence of the agent or at an earlier timcpoint after contact of the sample with the agent.
- the method further comprises determining the amount of a protein translated from an RNA with highly structured 5'UTR, optionally wherein the protein is selected from the group consisting of cellular myclocytomatosis oncogene (c-Myc), X-linkcd inhibitor of apoptosis protein (XIAP), and ornithine decarboxylase (ODC 1 ).
- the method further comprises a step of determining whether the agent directly binds said human eIF4B or said ortholog thereof, or said human MELK or said ortholog thereof.
- the sample is selected from the group consisting of in vitro, ex vivo, and in vivo samples.
- the sample comprises cells (e.g., cancer cells, such as a cancer selected from the group consisting of any cancer in which MELK or eIF4B is amplified or overexpressed, any cancer having an activating mutation of MELK or eIF4B, and any cancer in which MELK or eIF4B is activated by other kinases).
- the cells are obtained from a subject.
- the sample is selected from the group consisting of tissue, whole blood, scrum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow.
- the amount of Ser-406 is selected from the group consisting of tissue, whole blood, scrum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow.
- phosphorylatcd human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B is determined by an immunoassay using a reagent which specifically binds with Ser-406 phosphorylated human eIF4B or corresponding
- the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human eIF4B or corresponding ortholog of human eIF4B and a detection antibody or fragment thereof which specifically binds with Ser-406
- said human eIF4B or ortholog thereof, and/or said human MELK or ortholog thereof comprises a nucleic acid sequence or amino acid sequence set forth in Table 1.
- the agent is a small molecule, or an antibody or antigen-binding fragment thereof.
- the agent decreases the amount of Ser-406 phosphorylatcd human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B by at least 50%.
- a method for assessing the efficacy of an agent for inhibiting kinase activity of human MELK or an ortholog thereof in a subject comprising a) detecting in a subject sample at a first point in time, the amount of Ser-406 phosphorylatcd human eIF4B or the amount of a human eIF4B ortholog phosphorylatcd at a corresponding amino acid of human eIF4B; b) repeating step a) during at one or more subsequent points in time after administration of the agent; and c) comparing the amount of phosphorylated human eIF4B or ortholog thereof detected in step a) with said amount detected in step b), wherein a higher amount of Ser-406 phosphory latcd human eIF4B or the amount of the human eIF4B ortholog phosphorylatcd at a corresponding amino acid of human eIF4B in the first point in time relative to at least one subsequent point in time, indicates that the agent inhibits kin
- the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatablc amino acid in the ortholog of human eIF4B is determined by an immunoassay using a reagent which specifically binds with Ser-406 phosphorylatcd human eIF4B or corresponding phosphorylatcd ortholog of human eIF4B (e.g., a
- radioimmunoassay a Western blot assay, a proximity ligation assay, an immunofluorcsencc assay, an enzyme immunoassay, an immunoprecipitation assay, a chemi luminescence assay, an immunohistochemical assay, a dot blot assay, or a slot blot assay.
- the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human eIF4B or corresponding ortholog of human eIF4B and a detection antibody or fragment thereof which specifically binds with Ser-406 phosphorylatcd human eIF4B or a corresponding phosphorylated ortholog of human eIF4B.
- the sample is selected from the group consisting of ex vivo and in vivo samples.
- the sample comprises cancer cells (e.g., cancer cells selected from the group consisting of any cancer in which MELK or eIF4B is amplified or ovcrcxprcsscd, any cancer having an activating mutation of MELK or eIF4B, and any cancer in which MELK or clF4B is activated by other kinases).
- the sample is selected from the group consisting of tissue, whole blood, scrum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow.
- the sample in step a) and/or step b) is a portion of a single sample obtained from the subject.
- the sample in step a) and/or step b) is a portion of pooled samples obtained from the subject.
- the subject has undergone treatment for cancer, has completed treatment for cancer, and/or is in remission from cancer between the first point in time and the subsequent point in time.
- said human eIF4B or ortholog thereof, and/or said human MELK or ortholog thereof comprises a nucleic acid sequence or amino acid sequence set forth in Tabic 1.
- the agent is a small molecule, or an antibody or antigen-binding fragment thereof.
- the agent decreases the amount of Ser-406 phosphorylatcd human eIF4B or a corresponding phosphorylatablc amino acid in the ortholog of human clF4B by at least 50%.
- a method of treating a subject afflicted with cancer comprising administering to the subject an agent that inhibits Ser-406 phosphorylation of human eIF4B or a corresponding phosphorylatable amino acid in an ortholog of human eIF4B, thereby treating the subject afflicted with the cancer.
- the agent is administered in a pharmaceutically acceptable formulation.
- the agent is a small molecule, or an antibody or antigen-binding fragment thereof.
- the agent directly binds said human eIF4B or the ortholog thereof, or said human MELK or the ortholog thereof.
- the cancer is selected from the group consisting of any cancer in which MELK or eIF4B is amplified or overexpressed, any cancer having an activating mutation of MELK or eIF4B, and any cancer in which MELK or eIF4B is activated by other kinases.
- said human eIF4B or ortholog thereof, and/or said human MELK or ortholog thereof comprises a nucleic acid sequence or amino acid sequence set forth in Table 1.
- the agent is a small molecule, or an antibody or antigen-binding fragment thereof.
- the agent decreases the amount of Scr-406 phosphorylatcd human eIF4B or a corresponding phosphorylatablc amino acid in the ortholog of human eIF4B by at least 50%.
- the method further comprises administering one or more additional anti-cancer agents.
- a method of determining the function or activity of human MELK or an ortholog comprising a) detecting in a sample the amount of Ser-406 phosphorylatcd human clF4B or the amount of a human eIF4B ortholog phosphorylatcd at a corresponding amino acid of human eIF4B; b) repeating step a) in the same sample or a test sample at one or more subsequent points in time after manipulation of the sample and/or manipulation of the same sample or test sample; and c) comparing the amount of phosphorylatcd human eIF4B or ortholog thereof detected in step a) with said amount detected in step b), wherein a modulated of Ser-406 phosphorylatcd human eIF4B or the amount of the human eIF4B ortholog phosphorylatcd at a corresponding amino acid of human eIF4B in the first point in time relative to at least one subsequent point in time and/or at least one subsequent manipulation of the same sample or
- the amount of Scr-406 phosphorylatcd human eIF4B or a corresponding phosphorylatablc amino acid in the ortholog of human clF4B is determined by an immunoassay using a reagent which specifically binds with Scr-406 phosphorylatcd human elF4B or corresponding phosphorylatcd ortholog of human eIF4B (e.g., a radioimmunoassay, a Western blot assay, a proximity ligation assay, an immunofluoresence assay, an enzyme immunoassay, an immunoprecipitation assay, a chemi luminescence assay, an immunohistochemical assay, a dot blot assay, or a slot blot assay).
- a radioimmunoassay e.g., a Western blot assay, a proximity ligation assay, an immunofluoresence assay, an enzyme immunoassay, an immunoprecipitation
- the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human eIF4B or corresponding ortholog of human eIF4B and a detection antibody or fragment thereof which specifically binds with Ser-406 phosphorylatcd human eIF4B or a corresponding phosphorylatcd ortholog of human eIF4B.
- the sample is selected from the group consisting of in vi/ro, ex vivo, and in vivo samples.
- the sample comprises cells or the method uses a cell-based assay.
- the cells are cancer cells selected from the group consisting of any cancer in which MELK or eIF4B is amplified or overexpressed, any cancer having an activating mutation of MELK or eIF4B, and any cancer in which MELK or eIF4B is activated by other kinases.
- the sample is selected from the group consisting of tissue, whole blood, scrum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow.
- the same sample or test sample in step a) and/or step b) is a portion of a single sample obtained from a subject.
- the same sample or test sample in step a) and/or step b) is a portion of pooled samples obtained from a subject.
- the subject has undergone treatment for cancer, has completed treatment for cancer, and/or is in remission from cancer between the first point in time and the subsequent point in time.
- said human eIF4B or ortholog thereof, and/or said human MELK or ortholog thereof comprises a nucleic acid sequence or amino acid sequence set forth in Table 1.
- the manipulation of the sample is selected from the group consisting of contacting the sample with a test agent, contacting the sample with an upstream signal of the MELK signaling pathway, and contacting the sample with a MELK inhibitor.
- test agent is a small molecule, or an antibody or antigen-binding fragment thereof.
- test agent decreases the amount of Scr-406 phosphorylatcd human eIF4B or a corresponding phosphorylatablc amino acid in the ortholog of human eIF4B by at least 50%.
- the inhibition of said Thr-3 phosphorylation and/or Ser- 10 phosphorylation and/or Thr-11 phosphorylation of human Histone H3, or a corresponding phosphorylatable amino acid in an ortholog of human Histone H3, is determined by comparing the amount of Thr-3 phosphorylated human Histone H3 and/or Ser- 10 phosphorylated human Histone H3 and/or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3, in the sample relative to a control.
- control is the amount of Thr-3 phosphorylated and/or Ser- 10 phosphorylated and/or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3, in the sample relative to said amount in the absence of the agent or at an earlier timcpoint after contact of the sample with the agent.
- the inhibition of said Thr-3 phosphorylation and/or Ser- 10 phosphorylation and/or Thr-11 phosphorylation of human Histone H3, or a corresponding phosphorylatable amino acid in an ortholog of human Histone H3, is determined by comparing the ratio of the amount of Thr-3 phosphorylated and/or Ser- 10 phosphorylated and/or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3, in the sample relative to the total amount of human Histone H3 or ortholog thereof, to a control.
- control is the ratio of the amount of Thr-3 phosphorylated and/or Ser- 10 phosphorylated and/or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3 in the sample relative to said ratio in the absence of the agent or at an earlier timcpoint after contact of the sample with the agent.
- the method further comprises determining the amount of a mitosis-specific protein.
- the method further comprises a step of determining whether the agent directly binds said human Histone H3 or said ortholog thereof, or said human MELK or said ortholog thereof.
- the sample is selected from the group consisting of in vitro, ex vivo, and in vivo samples.
- the sample comprises cells, such as cancer cells (e.g., cells from a cancer selected from the group consisting of any cancer in which MELK or Histone H3 is amplified or overexpressed, any cancer having an activating mutation of MELK or Histone H3, and any cancer in which MELK or Histone H3 is activated by other kinases).
- the cells arc obtained from a subject.
- the sample is selected from the group consisting of tissue, whole blood, scrum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow.
- corresponding phosphorylatable amino acid in the ortholog of human Histone H3 is determined by an immunoassay using a reagent which specifically binds with Thr-3 phosphorylated or Ser-10 phosphorylated or Thr-11 phosphorylated human Histone H3, or corresponding phosphorylated ortholog of human Histone H3.
- the immunoassay is a radioimmunoassay, a Western blot assay, a proximity ligation assay, an immunofluorcscncc assay, an enzyme immunoassay, an immunoprccipitation assay, a chcmilumincsccnce assay, an immunohistochemical assay, a dot blot assay, or a slot blot assay.
- the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human Histone H3 or corresponding ortholog of human Histone H3 and a detection antibody or fragment thereof which specifically binds with Thr-3 phosphorylated or Scr-10 phosphorylated or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylated ortholog of human Histone H3.
- the human Histone H3 or ortholog thereof, and/or said human MELK or ortholog thereof comprises a nucleic acid sequence or amino acid sequence set forth in Table 1.
- the agent is a small molecule, or an antibody or antigen-binding fragment thereof.
- the agent decreases the amount of Thr-3 phosphorylated and/or Ser- 10 phosphorylated and/or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3, by at least 50%.
- a method for assessing the efficacy of an agent for inhibiting kinase activity of human MELK or an ortholog thereof in a subject comprising: a) detecting in a subject sample at a first point in time, the amount of Thr-3 phosphorylatcd and/or Ser-10 phosphorylatcd and/or Thr-11 phosphorylatcd human Histonc H3, or the amount of a human Histonc H3 ortholog phosphorylated at a corresponding amino acid of human Histone H3; b) repeating step a) during at one or more subsequent points in time after administration of the agent; and c) comparing the amount of phosphorylated human Histone H3 or ortholog thereof detected in step a) with said amount detected in step b), wherein a higher amount of Thr-3 phosphorylated and/or Ser-10 phosphorylated and/or Thr-11 phosphorylatcd human Histone H3, or the amount of the human Histone H3 ortholog phosphorylatcd at
- the amount of Thr-3 phosphorylated and/or Ser- 10 phosphorylated and/or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3, is determined by an immunoassay using a reagent which specifically binds with Thr-3 phosphorylated human Histone H3 or Scr- 10 phosphorylated human Histone H3 or Thr-11 phosphorylated human Histone H3, or corresponding phosphorylatcd ortholog of human Histonc H3.
- the immunoassay is a radioimmunoassay, a Western blot assay, a proximity ligation assay, an immunofluorcscncc assay, an enzyme immunoassay, an immunoprecipitation assay, a chcmilumincsccncc assay, an immunohistochemical assay, a dot blot assay, or a slot blot assay.
- the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human Histonc H3 or corresponding ortholog of human Histonc H3 and a detection antibody or fragment thereof which specifically binds with Thr-3 phosphorylatcd or Ser-10 phosphorylated or Thr-11 phosphorylated human Histone H3, or a corresponding phosphorylatcd ortholog of human Histonc H3.
- the sample is selected from the group consisting of ex vivo and in vivo samples.
- the sample comprises cancer cells (e.g.
- cancer cells selected from the group consisting of any cancer in which MELK or Histonc H3 is amplified or ovcrexprcsscd, any cancer having an activating mutation of MELK or Histonc H3, and any cancer in which MELK or Histonc H3 is activated by other kinases).
- the sample is selected from the group consisting of tissue, whole blood, scrum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow.
- the sample in step a) and/or step b) is a portion of a single sample obtained from the subject.
- the sample in step a) and/or step b) is a portion of pooled samples obtained from the subject.
- the subject has undergone treatment for cancer, has completed treatment for cancer, and/or is in remission from cancer between the first point in time and the subsequent point in time.
- the human Histone H3 or ortholog thereof, and/or said human MELK or ortholog thereof comprises a nucleic acid sequence or amino acid sequence set forth in Table 1.
- the agent is a small molecule, or an antibody or antigen- binding fragment thereof.
- the agent decreases the amount of Thr-3 phosphorylatcd and/or Ser-10 phosphorylatcd and/or Thr-11 phosphorylatcd human Histone H3, or a corresponding phosphorylatablc amino acid in the ortholog of human Histone H3, by at least 50%.
- a method of treating a subject afflicted with cancer comprising administering to the subject an agent that inhibits Thr-3 phosphorylation and/or Ser-10 phosphorylation and/or Thr-11 phosphorylation of human Histone H3, or a corresponding phosphorylatablc amino acid in an ortholog of human Histone H3, thereby treating the subject afflicted with the cancer.
- the agent is administered in a pharmaceutically acceptable formulation.
- the agent is a small molecule, or an antibody or antigen-binding fragment thereof.
- the agent directly binds said human Histone H3 or the ortholog thereof, or said human MELK or the ortholog thereof.
- the cancer is selected from the group consisting of any cancer in which MELK or Histone H3 is amplified or
- the human Histone H3 or ortholog thereof, and/or said human MELK or ortholog thereof comprises a nucleic acid sequence or amino acid sequence set forth in Table 1.
- the agent is a small molecule, or an antibody or antigen-binding fragment thereof.
- the agent decreases the amount of Thr-3 phosphorylatcd and/or Ser-10 phosphorylatcd and/or Thr-11
- a method of determining the function or activity of human MELK or an ortholog comprising: a) detecting in a sample the amount of Thr-3 phosphorylatcd and/or Ser-10 phosphorylatcd and/or Thr-11 phosphorylatcd human historic H3 or the amount of a human Histone H3 ortholog phosphorylated at a corresponding amino acid of human Histone H3; b) repeating step a) in the same sample or a test sample at one or more subsequent points in time after manipulation of the sample and/or manipulation of the same sample or test sample; and c) comparing the amount of phosphorylated human Histone H3 or ortholog thereof detected in step a) with said amount detected in step b), wherein a modulated amount of Thr-3
- phosphorylated human Histone H3, or a corresponding phosphorylatable amino acid in the ortholog of human Histone H3, is determined by an immunoassay using a reagent which specifically binds with Thr-3 phosphorylatcd or Scr- 10 phosphorylatcd or Thr-11 phosphorylatcd human Histone H3, or corresponding phosphorylated ortholog of human Histone H3.
- the immunoassay is a radioimmunoassay, a Western blot assay, a proximity ligation assay, an immunofluoresence assay, an enzyme
- immunoassay an immunoprecipitation assay, a chemiluminescence assay, an
- the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human Histone H3 or corresponding ortholog of human Histone H3 and a detection antibody or fragment thereof which specifically binds with Thr-3 phosphorylatcd or Scr-10 phosphorylatcd or Thr-11 phosphorylatcd human Histone H3, or a corresponding phosphorylatcd ortholog of human Histone H3.
- the sample is selected from the group consisting of in vitro, ex vivo, and in vivo samples.
- the sample comprises cells or the method uses a cell-based assay.
- the cells arc cancer cells selected from the group consisting of any cancer in which MELK or Histone H3 is amplified or ovcrcxprcsscd, any cancer having an activating mutation of MELK or Histonc H3, and any cancer in which MELK or Histonc H3 is activated by other kinases.
- the sample is selected from the group consisting of tissue, whole blood, scrum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow.
- the same sample or test sample in step a) and/or step b) is a portion of a single sample obtained from a subject.
- the same sample or test sample in step a) and/or step b) is a portion of pooled samples obtained from a subject.
- the subject has undergone treatment for cancer, has completed treatment for cancer, and/or is in remission from cancer between the first point in time and the subsequent point in time.
- the human Histonc H3 or ortholog thereof, and/or said human MELK or ortholog thereof comprises a nucleic acid sequence or amino acid sequence set forth in Table I .
- the manipulation of the sample is selected from the group consisting of contacting the sample with a test agent, contacting the sample with an upstream signal of the MELK signaling pathway, and contacting the sample with a MELK inhibitor.
- the test agent is a small molecule, or an antibody or antigen-binding fragment thereof.
- the test agent decreases the amount of Thr-3 phosphorylatcd and/or Ser-10 phosphorylatcd and/or Thr-11 phosphorylatcd human Histonc H3, or a
- Figure 1 shows that MELK interacts with eIF4B.
- Flag-MELK was conditionally expressed in MDA-MB-468 cells. Mitotic lysatcs were subjected to anti-Flag
- the left panel shows the number of peptides recovered from the immunoprecipitatcs.
- the right panel shows validation of the interaction between MELK and eIF4B during mitosis. Note that Flag-MELK is doxycycline-induciblc.
- FIG. 2 shows the results of peptide library screening to identify an optimal substrate motif for MELK.
- the top panel shows the results of a spatially arrayed peptide library subjected to in vitro phosphorylation using recombinant full-length MELK. Each peptide contains one residue fixed at one of nine positions relative to the centrally fixed phosphoacccptor ⁇ i.e., serine or threonine). Reactions were spotted onto the membrane and the spots were exposed to a phosphor storage screen.
- the bottom panel shows a sequence logo generated using quantified and normalized data from the screen. Note that MELK has a strong selection for arginine at the -3 position relative to the phosphoacceptor site.
- FIG. 3 shows that MELK phosphorylates eIF4B at S406 in vitro.
- Recombinant full-length MELK or the kinase domain of MELK was subjected to in vitro kinase assays using immunoprccipitatcd Flag-eIF4B (wild type) or Flag-eIF4B (S406A).
- Robust phosphorylation of eIF4B at S406 was observed in the presence of MELK. This phosphorylation was abolished when wild type (wt) eIF4B was replaced with a mutant eIF4B (S406A).
- Figure 4 shows that MELK does not phosphorylates eIF4B at S422 in vitro.
- Recombinant full-length or kinase domain of MELK was subjected to in vitro kinase assay using immunoprecipitated Flag-eIF4B (wild type) or Flag-eIF4B (S422A). Reactions were analyzed by immunoblotting.
- FIG. 5 shows that MELK regulates phosphorylation of eIF4B at S406 in vivo.
- MELK knockdown impairs the phosphorylation of eIF4B at S406.
- MDA- MB-468 cells stably expressing tetracycline-inducible (tct-on) small hairpin MELK (shMELK) in the presence or absence of doxycyclinc were harvested through treatment of nocodazolc, and subjected to immunoblotting.
- a MELK inhibitor impairs the phosphorylation of eIF4B at S406.
- Mitotic MDA-MB-468 cells were treated for 30 min with vehicle or 200 nM OTSSP167, a MELK inhibitor (Chung et al. (2012) Oncotarget 3: 1629- 1640). Lysatcs were used for immunoblotting.
- Figure 6 shows the results of treating mitotic cells for 30 min with mTOR inhibitors (e.g., Rapamycin and Torin 1 ) versus treating such cells with MELK inhibitors (e.g.,
- Figure 7 shows that knocking down MELK or eIF4B decreases the protein abundance of XIAP, c-Myc, and ODC1 during mitosis.
- the ratio of Renilla luciferase to firefly luciferase was normalized to the value of control vector. Note that the left bar corresponds to Dox (-) and the right bar corresponds to Dox (+) for each pair of bars shown in the graph reporting relative RL/FL ratios.
- FIG. 9 shows that MELK phosphorylatcs Histonc H3 at Thr-3, Scr-10 and Thr-11 in vitro. Recombinant Histonc H3 was incubated with or without recombinant MELK
- FIG. 10 shows that knocking down MELK decreases the mitotic phosphorylation of Histonc H3 at Thr-3, Scr-10 and Thr-11, but not Scr-28.
- MDA-MB-468 cells stably transduced with tet-on shMELK were untreated or treated with doxycycline (200 ng/ml) in order to induce gene silencing. Cells were then treated with nocodazolc (200 ng/ml) for 20 hours. Mitotic cells were harvested by shake-off and cell lysatcs were subjected to immunoblotting using the indicated antibodies.
- Figure 11 shows that knocking down MELK does not affect the phosphorylation of
- Aurora kinases which arc known kinases for Histonc H3 at Scr 10.
- MDA-MB-468 cells stably transduced with tet-on shMELK were untreated or treated with doxycycline (200 ng/ml) to induce gene silencing.
- Cells were treated with nocodazolc (200 ng/ml) for 20 hours.
- Mitotic cells were harvested by shake-off and cell lysatcs were subjected to immunoblotting using the indicated antibodies.
- Figure 12 shows that a MELK inhibitor suppresses MELK-induccd
- Histonc H3 phosphorylation of Histonc H3 at Scr 10 in vitro.
- Recombinant Histonc H3 was incubated without or with recombinant MELK (kinase domain) for 30 min. at 30 °C in the absence or presence of OTSSP167 (200 ng/ml final). Reactions were terminated by adding SDS sample buffer. Samples were subjected to immunoblotting using the indicated antibodies.
- FIG. 13 shows that a MELK inhibition suppresses the mitotic phosphorylation of Histonc H3 at Thr-3, Scr-10 and Thr-11, but not Scr-28, in a concentration-dependent manner.
- Mitotic cells were harvested through nocodazolc-induccd cell cycle arrest at prometaphase (200 ng/ml nocodazolc, 20 hours).
- Cells were treated with the small chemical inhibitor of MELK, OTSSP167, for 30 min, at the indicated concentrations. Cell lysatcs were then prepared for immunoblotting.
- the methods of the present invention relate to the surprising detennination that the level of phosphorylation of position 406 (e.g. , a serine residue) of human eukaryotic initiation factor 4B (eIF4B), or a corresponding phosphorylatablc amino acid of an ortholog thereof, serves as a biomarker for MELK enzymatic (e.g., kinase) and/or oncogenic activity.
- eIF4B human eukaryotic initiation factor 4B
- MELK enzymatic e.g., kinase
- decreased phosphorylation of, for example, Ser-406 of human eIF4B corresponds with a reduction in MELK enzymatic activity (e.g., kinase activity) and MELK -mediated oncogenic effects.
- MELK enzymatic activity e.g., kinase activity
- MELK -mediated oncogenic effects e.g., MELK enzymatic activity
- the methods of the present invention also relate to the surprising determination that the level of phosphorylation of position 10 (e.g., a serine residue) of human Histonc H3, or a corresponding phosphorylatablc amino acid of an ortholog thereof, and/or the level of phosphorylation of position 1 1 (e.g., a threonine residue) of human Histonc H3, or a corresponding phosphorylatablc amino acid of an ortholog thereof, serves as a biomarker for MELK enzymatic (e.g., kinase) and/or oncogenic activity.
- MELK enzymatic e.g., kinase
- decreased phosphorylation of, for example, Thr-3 of human Histone H3 e.g., by directly or indirectly inhibiting MELK-mediated
- phosphorylation of Thr-3) and/or Scr- 10 of human Histonc H3 corresponds with a reduction in MELK enzymatic activity (e.g., kinase activity) and MELK-mcdiatcd oncogenic effects.
- MELK enzymatic activity e.g., kinase activity
- MELK-mcdiatcd oncogenic effects e.g., kinase activity
- Ser-406 of human eIF4B, Thr-3 of human Histonc H3, Ser- 10 of human Histonc H3, and/or Thr-11 of human Histonc H3, as well as any corresponding phosphorylatablc amino acid of an ortholog thereof, including in any combination thereof, arc contemplated for use according to the present invention.
- Scr-28 of human eIF4B or a corresponding phosphorylatablc amino acid of an ortholog thereof is not regulated by MELK and is not used according to the present invention.
- MELK refers to the MELK member of the protein kinase superfamily and is alternatively known as “pEG3 kinase,” “protein kinase Eg3,” “protein kinase,” and “serine/threonine-protein kinase MELK.” At least nine splice variants encoding nine distinct human MELK isoforms exist.
- Human MELK transcript variant 1 (NM_014791.3) encodes the long human MELK isoform 1 (NP_55606.1 ).
- Human MELK transcript variant 2 (NM 001256685.1) lacks an exon in the 3' coding region compared to transcript variant I, but maintains the reading frame and results in an isoform
- Human MELK transcript variant 3 (NM_001256687.1) lacks an exon in the 5' coding region compared to transcript variant 1 , but maintains the reading frame and results in an isoform (NP_001243616.1 ) that is shorter than isoform 1.
- Human MELK transcript variant 4 (NM 001256688.1 ) lacks two consecutive exons in the 5 * coding region compared to transcript variant 1 , but maintains the reading frame and results in an isoform (NP_001243617.1 ) that is shorter than isoform 1.
- Human MELK transcript variant 5 (NM_001256689.1 ) initiates translation at an alternate start codon and lacks an exon in the 5' coding region compared to transcript variant 1 and thus results in an isoform (NP_001243618.1 ) that is shorter than and has a distinct N-tcrminus from isoform 1.
- Human MELK transcript variant 6 (NM_001256689.1 ) initiates translation at an alternate start codon and lacks an exon in the 5' coding region compared to transcript variant 1 and thus results in an isoform (NP_001243618.1 ) that is shorter than and has a distinct N-tcrminus from isoform 1.
- NM_001256690.1 initiates translation at an alternate start codon and lacks two consecutive exons in the 5 * coding region compared to transcript variant 1 , but maintains the reading frame and results in an isoform (NP_(X ) 1243619.1 ) that is shorter than and has a distinct N-terminus from isoform 1.
- Human MELK transcript variant 7
- NM_001256691.1 initiates translation at an alternate start codon and lacks two exons in the 5' coding region compared to transcript variant 1 , but maintains the reading frame and results in an isoform (NP_001243620.1 ) that is shorter than and has a distinct N-tcrminus from isoform 1.
- Human MELK transcript variant 8 (NM_001256692.1) lacks three exons in the 5' coding region and initiates translation at a downstream, in-frame start codon compared to transcript variant 1 and results in an isoform (NP_001243621.1 ) that has a shorter N-terminus than isoform 1.
- human MELK transcript variant 9
- NM_001256693.1 lacks two consecutive exons in the 5' coding region and initiates translation at a downstream, in-frame start codon compared to transcript variant 1 and results in an isoform (NP_001243622.1) that has a shorter N-terminus than isoform 1.
- the protein domains and structural basis for the regulation of MELK autophosphorylation and activation of kinase activities on target proteins is known (see, at least Cao et al. (2013) PLoS One 8:e70031 and Canevari et al. (2013) Biochemistry 52:6380-6387).
- Mouse MELK nucleic acid (NM_010790.2) and amino acid (NP_034920.2) sequences are publicly available on the GenBank database maintained by the U.S. National Center for Biotechnology Information. Nucleic acid and polypeptide sequences of MELK orthologs in species other than mice and humans are also well known and include, for example, chimpanzee MELK (XM_001 169038.3, XP_001 169038.1, XM_001 168991.3, XP 001 168991.1 , XM_001 168745.3, XP_001 168745.1, XM_001 168775.3,
- XM_003951428. I XP 003951477.1 , XM_003312086.2, and XP_003312134.1
- monkey MELK XM_001 1 15076.2 and XP_001 1 15076.2
- dog MELK XM_003431578.1 , XP_003431626.1, XM_538730.3, XP_538730.2, XM_003431579.1 and
- XP_003431627.1 cow MELK (NM_001 1 1 1260.1 and NP_001 104730.1 ), rat MELK (NM_001 108662.1 and NP_001 102132.1 ), chicken MELK (NM_001031509.1 and NP_001026680.1), and zcbrafish MELK (NM_206888.2 and NP_996771.2).
- eIF4B refers to the cukaryotic translation initiation factor 4B member of the cukaryotic translation initiation factor family and is alternatively known as “EIF-4B” and "PR01843.”
- Human eIF4B nucleic acid (NM_00I417.4) and amino acid (NP_001408.2) sequences are publicly available on the GenBank database maintained by the U.S. National Center for Biotechnology Information.
- Nucleic acid and polypeptide sequences of eIF4B orthologs in species other than humans arc also well known and include, for example, mouse eIF4B (NM_145625.3 and NP_663600.2), chimpanzee eIF4B (XM_003313676.1 , XP 003313724.1 , XM_001 142097.3, and XP_001 142097.3), monkey CIF4B (NM_001 195808.1 and NP_001 182737.1), dog eIF4B (XM_853888.2,
- eIF4B NM_001035028.2 and NP_001030200.1
- rat eIF4B NM_001008324.1 and NP_001008325.1
- chicken eIF4B XM_003643408.2 and XP_003643456.2
- Ser-406 of eIF4B refers to the amino acid numbering of the human eIF4B.
- Histone H3 refers to the H3 member of the Histone family, which comprises proteins used to form the structure of nucleosomes in eukaryotic cells.
- Eukaryotes have chromatin arranged around proteins in the form of nucleosomes, which are the smallest subunits of chromatin and include approximately 146-147 base pairs of DNA wrapped around an octamcr of core histone proteins (two each of H2A, H2B, H3, and H4).
- Mammalian cells have three known sequence variants of Histone H3 proteins, denoted H3.1 , H3.2 and H3.3, that arc highly conserved differing in sequence by only a few amino acids.
- Phosphorylated Histone H3 at serine 10 is a specific biomarker for mitotic cells, similar to other well-known mitosis-specific markers, such as phosphorylated MPM-2, phosphorylated retinoblastoma protein 1 (Rb), phosphorylated cdc2, BubR 1 , cyclin B 1 , cdc25c, cdk 1 , cdc27, and the like. Any serine, threonine, or tyrosine residue can be phosphorylated. In some embodiments, other possible mitosis-specific markers, such as phosphorylated MPM-2, phosphorylated retinoblastoma protein 1 (Rb), phosphorylated cdc2, BubR 1 , cyclin B 1 , cdc25c, cdk 1 , cdc27, and the like. Any serine, threonine, or tyrosine residue can be phosphorylated. In some embodiments
- phosphorylation sites include threonine 3, threonine 6, threonine 1 1 , serine 31 , tyrosine 41, serine 57, threonine 80, and threonine 107.
- Histone H3 can refer to H3.1 , H3.2, or H3.3 individually or collectively. These amino acid sequences include a methionine as residue number 1 that is cleaved off when the protein is processed. Thus, for example, serine 1 1 in the Histone H3 amino acid sequences shown in Table 1 below corresponds to serine (Scr) 10 of the present invention. These three protein variants arc encoded by at least fifteen different genes/transcripts.
- Sequences encoding the Histone H3.1 variant are publicly available as HIST1H3A (NM_003529.2; NP_003520.1 ), HIST1 H3B (NM_003537.3; NP_003528.1 ), HIST1H3C (NM_003531.2; NP_003522.1), HIST1 H3D (NM_003530.3; NP_003521.2), HIST1H3E (NM_003532.2; NP_003523.1 ), HIST1H3F (NM_021018.2; NP_066298.1 ), HIST1H3G (NM_003534.2; NP_003525.1 ), HIST1 H3H (NM_003536.2; NP_003527.1 ), HIST1 H3I (NM_003533.2; NP_003524.1), and HIST1 H3J (NM_003535.2; NP_003526.1). Sequences encoding the Hi
- HIST2H3C NM_021059.2; NP_066403.2
- HIST2H3D NM_001 123375.1 ; NP_001 1 16847.1
- Sequences encoding the Histone H3.3 variant arc publicly available as H3F3A (NM_002107.3; NP_002098.1) and H3F3B (NM_005324.3; NP_005315.1 ). Sec U.S. Pat. Publ. 2012/0202843 for additional details.
- polypeptide sequences for Histone H3 orthologs are well-known in many species, and include, for example, Histone H3.1 orthologs in mice (NM O 13550.4; NP 038578.2), chimpanzee (XM_527253.4; XP_527253.2), monkey (XM_001088298.2; XP_001088298.1 ), dog (XM_003434195.1 ; XP_003434243.1), cow (XM_002697460.1 ; XP_002697506.1 ), rat (XM_001055231.2; XP_001055231.1 ), and zebrafish (NM_001 100173.1 ;
- mice NM_ 178215.1 ; NP_835587.1 ), chimpanzee (XM_524859.4; XP_524859.2), monkey (XM_001084245.2;
- XP 001084245.1 dog (XM_003640147.1 ; XP 003640195.1 ), cow (XM_002685500.1 ; XP_002685546.1 ), rat ⁇ NM_001 107698.1 ; NP_001 101 168.1), chicken (XM_001233027.2; XP_001233028.1), and zebrafish (XM_002662732. 1 ; XP_002662778.1 ).
- Histone H3.3 orthologs in mice (XM_892026.4; XP_8971 19.3), monkey (XM_001085836.2;
- NP 446437.1 chicken (NM_205296.1 ; NP_990627.1 ), and zebrafish (NM_200003.1 ; NP 956297.1 ), arc well-known.
- Antibodies for the detection of phosphorylated H3 histone such as phosphorylated Histone H3 at Thr-3, Scr-10, Thr-11, and other
- phosphorylatablc residues of Histone H3 as well as methods for making such antibodies are known in the art.
- Ser-10 of Histone H3 refers to the amino acid numbering of the human Histone H3. Accordingly, a skilled artisan will readily understand that Ser- 10 of the human Histone H3 polypeptide is conserved across numerous species and that although those specific residues may be referenced herein, the methods of the present invention apply equally well to the corresponding residues (e.g.,
- nucleotide triplet An important and well known feature of the genetic code is its redundancy, whereby, for most of the amino acids used to make proteins, more than one coding nucleotide triplet may be employed (for example, illustrated above). Therefore, a number of different nucleotide sequences may code for a given amino acid sequence. Such nucleotide sequences arc considered functionally equivalent since they result in the production of the same amino acid sequence in all organisms (although certain organisms may translate some sequences more efficiently than they do others). Moreover, occasionally, a methylated variant of a purine or pyrimidine may be found in a given nucleotide sequence. Such methylations do not affect the coding relationship between the trinucleotide codon and the corresponding amino acid.
- nucleic acid and/or amino acid modifications can be engineered using site-directed mutagenesis and PCR-mediated mutagenesis techniques.
- nucleic acid can take any of a number of forms ⁇ e.g, DNA, mRNA, cDNA) that encode a biomarker described herein.
- biomarker nucleic acid molecules include DNA ⁇ e.g., genomic DNA and cDNA) comprising the entire or a partial sequence of a desired gene or the complement or hybridizing fragment of such a sequence.
- the biomarker nucleic acid molecules also include RNA comprising the entire or a partial sequence of a desired gene or the complement of such a sequence, wherein all thymidine residues arc replaced with uridine residues.
- a “transcribed polynucleotide” is a polynucleotide ⁇ e.g., an RNA, a cDNA, or an analog of one of an RNA or cDNA) which is complementary to or homologous with all or a portion of a mature RNA made by transcription of a biomarker of the present invention, at least in part, and normal post- transcriptional processing ⁇ e.g., splicing), if any, of the transcript, and reverse transcription of the transcript.
- normal post- transcriptional processing e.g., splicing
- identity refers to sequence similarity between two polynucleotide sequences or between two polypeptide sequences, with identity being a more strict comparison.
- percent identity or homology and “% identity or homology” refer to the percentage of sequence similarity found in a comparison of two or more polynucleotide sequences or two or more polypeptide sequences. Two or more sequences can be anywhere from 0-100% similar, or any integer value there between. Identity or similarity can be determined by comparing a position in each sequence that may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same nucleotide base or amino acid, then the molecules arc identical at that position.
- a degree of similarity or identity between polynucleotide sequences is a function of the number of identical or matching nucleotides at positions shared by the polynucleotide sequences.
- a degree of identity of polypeptide sequences is a function of the number of identical amino acids at positions shared by the polypeptide sequences.
- a degree of homology or similarity of polypeptide sequences is a function of the number of amino acids at positions shared by the polypeptide sequences.
- substantially homology refers to homology of at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or more (e.g., about 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more).
- biomarkcr nucleic acid molecules encode a protein or portion thereof which includes an amino acid sequence which is sufficiently homologous to an amino acid sequence described herein such that the protein or portion thereof maintains, for example, the ability to phosphorylatc eIF4B, to phosphorylate Histone H3, and/or the ability to be phosphorylated by MELK.
- the comparison of sequences and determination of percent homology between two sequences can be accomplished using a mathematical algorithm.
- GAP Penalty 10
- Gap Length Penalty 10.
- the percent identity between two amino acid sequences is determined using the Necdleman and Wunsch (J. Mot. Biol. (48):444-453 ( 1970)) algorithm which has been incorporated into the GAP program in the GCG software package (available online), using cither a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
- the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available online), using a
- percent identity between two amino acid or nucleotide sequences is determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4: 1 1- 17 ( 1989)) which has been incorporated into the ALIGN program (version 2.0) (available online), using a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
- nucleic acids e.g., MELK, eIF4B, and/or mRNAs translated from nucleic acids having structured 5' regions
- Methods for the production of nucleic acids include standard hybridization, PCR, and/or synthetic nucleic acid techniques.
- the nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
- a “biomarker protein” is a protein encoded by or corresponding to a biomarker of the present invention.
- the terms “protein” and “polypeptide” are used interchangeably herein.
- the protein is at least 50%, 60%, 70%, 80%, 90%, and 95% or more (e.g., 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more) homologous to the entire amino acid sequence of a MELK and/or clF4B and/or Histone H3 protein described herein.
- biologically active portions of MELK and/or eIF4B and/or Histone H3 proteins described herein are included which have at least 50%, 60%, 70%, 80%, 90%, and 95% or more (e.g., 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more) homology to a fragment of a MELK and/or eIF4B and/or Histone H3 protein described herein, e.g., a domain or motif, and that is capable of phosphorylating eIF4B, phosphorylating Histone H3, or being phosphorylatcd by MELK.
- 95% or more e.g., 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1 %, 99.
- biologically active portions comprise a domain or motif, e.g., a MELK kinase domain, eIF4B domain encompassing an amino acid residue phosphorylatablc by MELK such as a MELK-mediated phosphorylation substrate motif having an arginine at -3 amino acid residue positions relative to serine/threonine (e.g., Scr406 or Scr422 of human eIF4B), or Histone H3 domain encompassing an amino acid residue phosphorylatablc by MELK such as a human Histone H3 region comprising Serl 0.
- other biologically active portions in which other regions of the protein arc deleted, can be prepared by recombinant techniques and evaluated for one or more of the activities described herein.
- Methods for the production of proteins arc known in the art and include e.g., the expression of the protein in appropriate cells starting from a cDNA or the production by subsequent addition of amino acids to a starting amino acid (sec Current Protocols, John Wiley & Sons, Inc., New York).
- methods for the production of protein fragments arc known in the art and include the cleavage of the protein with appropriate proteases or the generation of nucleic acid fragments encoding the protein fragments and subsequent expression of the fragments in appropriate cells.
- Methods for the production of mutated proteins e.g., by exchanging and/or deleting one or more amino acids, arc known in the art.
- Methods are provided for identifying agents, such as small molecules and antibodies, which inhibit oncogenic and/or kinase activity of human MELK or an ortholog thereof, comprising: a) contacting a sample comprising i) human MELK or an ortholog thereof and ii) human cukaryotic initiation factor 4B (eIF4B) or an ortholog thereof, with the agent; and b) determining the ability of the agent to inhibit Ser-406 phosphorylation of human clF4B or a corresponding phosphorylatablc amino acid in the ortholog of human eIF4B, wherein decreased phosphorylation identifies an agent which inhibits kinase or oncogenic activity of human MELK or the ortholog thereof.
- agents such as small molecules and antibodies, which inhibit oncogenic and/or kinase activity of human MELK or an ortholog thereof, comprising: a) contacting a sample comprising i) human MELK or an ortholog thereof and ii) human cukaryotic initiation factor
- agents such as small molecules and antibodies, which inhibit oncogenic and/or kinase activity of human MELK or an ortholog thereof, comprising: a) contacting a sample comprising i) human MELK or an ortholog thereof and ii) human Histonc H3 or an ortholog thereof, with the agent; and b) determining the ability of the agent to inhibit Thr-3 phosphorylation and/or Scr-10 phosphorylation and/or Thr-11 phosphorylation of human Histonc H3, or a corresponding phosphorylatablc amino acid in the ortholog of human Histonc H3, wherein decreased phosphorylation identifies an agent which inhibits kinase or oncogenic activity of human MELK or the ortholog thereof.
- These methods are also referred to herein as drug screening assays and typically include the step of screening a candidate/test compound or agent for the ability to interact with (e.g., bind to) a MELK and/or eIF4B and/or Histonc H3 protein, to modulate the phosphorylation of eIF4B by MELK, to modulate the interaction of a phosphorylatablc residue of eIF4B with a MELK-mediatcd intracellular signaling target, to modulate the phosphorylation of Histonc H3 by MELK, and/or to modulate the interaction of a phosphorylatablc residue of Histonc H3 with a MELK-mediated intracellular signaling target.
- a candidate/test compound or agent for the ability to interact with (e.g., bind to) a MELK and/or eIF4B and/or Histonc H3 protein, to modulate the phosphorylation of eIF4B by MELK, to modulate the interaction of a phospho
- Test compounds or agents which have one or more of these abilities can be used as drugs to treat disorders characterized by aberrant, abnormal, and/or unwanted MELK and/or eIF4B and/or Histonc H3 nucleic acid expression and/or protein activity, such as cancer.
- Candidate/test compounds include, for example, small organic and inorganic molecules (e.g., molecules obtained from
- antibody agents that, for example bind to MELK in a manner that modulates phosphorylation of a residue by MELK, modulates eIF4B activity normally driven by MELK-mediated phosphorylation, and/or modulates Histonc H3 activity normally driven by MELK-mediated phosphorylation, can be useful agents.
- modulatory agents such as aptamers, antisense RNA, siRNA, that are capable of interacting with MELK nucleic acids and/or proteins to affect MELK-mediated phosphorylation of eIF4B or Histone H3 (see, at least Chung et al. (2012) 3: 1629-1640; WO 2013/109388; WO 2012/016082; WO 2013/045539; each of which is incorporated herein in its entirety by this reference.
- sample tissue sample
- subject sample subject cell or tissue sample
- specimen each refer to a collection of similar cells obtained from a tissue of a subject or subject either as in vitro (e.g., cultured), ex vivo, or in vivo (e.g., isolated primary cells) samples.
- the source of the tissue sample may be solid tissue as from a fresh, frozen and/or preserved organ, tissue sample, biopsy, or aspirate; blood or any blood constituents; bodily fluids such as whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow, amniotic fluid, peritoneal fluid or interstitial fluid; or cells from any time in gestation or development of the subject.
- the tissue sample may contain compounds that arc not naturally intermixed with the tissue in nature such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics or the like.
- the sample may further comprise cancer cells, such as ovarian, lung, breast, and multiple myeloma cancer cells or any cancer in which MELK and/or eIF4B and/or Histonc H3 is amplified or ovcrexpresscd, has an activating mutation, or is activated by other kinases.
- cancer cells such as ovarian, lung, breast, and multiple myeloma cancer cells or any cancer in which MELK and/or eIF4B and/or Histonc H3 is amplified or ovcrexpresscd, has an activating mutation, or is activated by other kinases.
- subject and “patient” are used interchangeably.
- the terms “subject” and “subjects” refer to an animal, e.g., a mammal including a non-primate (e.g., a cow, pig, horse, donkey, goat, camel, cat, dog, guinea pig, rat, mouse, sheep) and a primate (e.g., a monkey, such as a cynomolgous monkey, gorilla, chimpanzee and a human).
- a non-primate e.g., a cow, pig, horse, donkey, goat, camel, cat, dog, guinea pig, rat, mouse, sheep
- a primate e.g., a monkey, such as a cynomolgous monkey, gorilla, chimpanzee and a human.
- inhibitor refers to a statistically significant decrease in a metric of interest, such as the reduction of Thr-3 phosphorylatcd and/or Ser- 10-phosphorylatcd and/or Thr-11- phosphorylatcd Histone H3, Ser-406-phosphorylated eIF4B, MELK enzymatic activity (e.g., kinase activity), cancer progression, and the like.
- Such statistically significant decrease can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more relative to a control
- a test compound administered and analyzed according to the methods described herein can comprise a bona fide inhibitor of MELK enzymatic activity (e.g., kinase activity) by decreasing Ser-406-phosphorylated eIF4B amounts, Thr-3 phosphorylatcd Histonc H3 amounts, Scr- 10-phosphorylatcd Histonc H3 amounts, and/or Thr-11 -phosphorylatcd Histonc H3 amounts by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more relative to that of no MELK ligand administration or over a given amount of time.
- MELK enzymatic activity e.g., kinase activity
- the term "MELK inhibitor” is a substance, such as a small molecule, antibody, antisense nucleic acid, small interfering nucleic acid, which interferes with the phosphorylation of human eIF4B at Ser-406 or at a corresponding phosphorylation site in an eIF4B ortholog thereof, the phosphorylation of human Histone H3 at Thr-3 or at a corresponding phosphorylation site in a Histonc H3 ortholog thereof, the phosphorylation of human Histonc H3 at Scr- 10 or at a corresponding phosphorylation site in a Histone H3 ortholog thereof, and/or the phosphorylation of human Histone H3 at Thr- I I or at a corresponding phosphorylation site in a Histone H3 ortholog thereof.
- MELK inhibitors are well known in the art, such as OTSSP 167, siomycin A, thiostrepton, and anti-MELK antibodies are disclosed, for example, in Chung el al. (2012) Oncotarget 3:1629-1640; WO 2013/045539; WO 2013/109388; and WO 2012/016082; each of which is incorporated in its entirety herein by this reference.
- altered amount of a biomarker or altered level of a biomarker refers to increased or decreased expression, modification, and/or activity of a biomarker of the present invention, at least in part in a sample as compared to that in a control sample.
- the amount of a biomarker in a subject is "significantly" higher or lower than the normal amount of a biomarker, if the amount of the biomarker is greater or less, respectively, than the normal level by an amount greater than the standard error of the assay employed to assess amount, or at least two, three, four, five, ten or more times that amount.
- the amount of the biomarker in the subject can be considered "significantly" higher or lower than the normal amount if the amount is at least about two, at least about three, at least about four, or at least about five times, higher or lower, respectively, than the normal amount of the biomarker (e.g., in a control sample or the average expression level of the biomarkcrs of the present invention in several control samples).
- “Likely to,” as used herein, refers to an increased probability, that an item, object, thing or person will occur such as at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%,
- an agent that is likely to inhibit MELK-mcdiatcd phosphorylation of eIF4B has an increased probability of inhibiting Scr-406 phosphorylation of human eIF4B or a corresponding phosphorylatable amino acid in an ortholog of human eIF4B.
- an agent that is likely to inhibit MELK-mediatcd phosphorylation of Histone H3 has an increased probability of inhibiting Thr-3 phosphorylation, Ser-10
- Test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring dcconvolution; the 'one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection.
- biological libraries include biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring dcconvolution; the 'one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection.
- the biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K.S. ( 1997) Anticancer Drug Des. 12: 145).
- the inhibition of Scr-406 phosphorylation of human eIF4B or a corresponding phosphorylatable amino acid in an ortholog of human eIF4B is determined by comparing the amount of Ser-406 phosphorylatcd human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human clF4B, in the sample relative to a control.
- the control can be the amount of amount of Scr-406 phosphorylatcd human eIF4B or a corresponding phosphorylatable amino acid in the ortholog of human eIF4B in the sample relative to said amount in the absence of the agent or at an earlier timcpoint after contact of the sample with the agent.
- the phosphorylation level of eIF4B is generally determined by measuring the amount of phosphorylatcd elF4B protein and, optionally, of unphosphorylated eIF4B, and normalizing the amount of phosphorylated protein to the total protein in the sample being analyzed.
- the calculated response phosphorylation level in the presence of the test compound and the basal or background phosphorylation levels e.g., in the absence of the test compound or at a earlier timcpoint after test compound
- the discriminatory time point, or predetermined time after administering the test compound to cells can be selected to achieve a calibrated statistically significant difference between Ser-406 phosphorylation levels in the sample relative to controls.
- the difference may be maximal at the predetermined time but that is not required and depends on other parameters of the test.
- the calculation of ratios as described herein is beneficial in providing useful comparative numbers, calculation of absolute differences between phosphorylated eIF4B levels upon administration of test compounds relative to controls, and between test subjects and control subjects, could also be employed and would be effective.
- the methods described above can further comprise determining the amount of determining the amount of a protein translated from an mRNA with highly structured 5' untranslated region (5'UTR), optionally wherein the protein is selected from the group consisting of cellular myelocytomatosis oncogene (c-Myc), X- linkcd inhibitor of apoptosis protein (XIAP), and ornithine decarboxylase (ODC 1).
- c-Myc cellular myelocytomatosis oncogene
- XIAP X- linkcd inhibitor of apoptosis protein
- ODC 1 ornithine decarboxylase
- RNA with structured 5'UTR encoding oncogenic proteins, such as c-Myc, XIAP (X-linked inhibitor of apoptosis protein), ODC (ornithine decarboxylase), VEGF, HIF-1 alpha, and the like (see, at least Bert et al. (2006) RNA 12: 1074- 1083).
- Phosphorylation is a biochemical reaction in which a phosphate group is added to Scr, Thr or Tyr residues of a protein and is catalyzed by protein kinase enzymes.
- Phosphorylation normally modifies the functions of target proteins, often causing activation.
- phosphorylation is only a transient process that is reversed by other enzyme called phosphatases. Therefore, protein phosphorylation levels change over time and can be evaluated in a number of well-known manners, including, for example, by immunological approaches. For example, the amount of Ser-406 phosphorylated human eIF4B or a corresponding phosphorylatable amino acid in an ortholog of human eIF4B is determined by an immunoassay using a reagent which specifically binds with Ser-406 phosphorylated human eIF4B or corresponding
- Such an immunoassay comprise a number of well known forms, including, without limitation, a radioimmunoassay, a Western blot assay, an immunofluorescence assay, an enzyme immunoassay, an immunoprccipitation assay, a chemiluminescence assay, an immunohistochemical assay, a dot blot assay, or a slot blot assay.
- the enzyme immunoassay is a sandwich enzyme immunoassay using a capture antibody or fragment thereof which specifically binds with human eIF4B or corresponding ortholog of human eIF4B and a detection antibody or fragment thereof which specifically binds with Ser-406 phosphorylated human eIF4B or a corresponding phosphorylated ortholog of human eIF4B.
- Such an enzyme immunoassay is particularly advantageous because identifying differences in protein levels between related kinase family members or isoforms given the relatively high homology between kinases among themselves and also among their phosphorylated forms.
- Immunological reagents for identifying eIF4B in both phosphorylated and non- phosphorylatcd forms, as well as for detecting MELK are well known in the art and can be generated using standard techniques, such as by inoculating host animals with appropriate eIF4B phosphor-peptides.
- Such anti-MELK, anti-eIF4B, and/or anti-phospho-eIF4B antibody reagents ⁇ e.g., monoclonal antibody) can be used to isolate and/or determine the amount of the respective proteins such as in a cellular lysatc.
- Such reagents can also be used to monitor protein levels in a cell or tissue, e.g., white blood cells or lymphocytes, as part of a clinical testing procedure, e.g., in order to monitor an optimal dosage of an inhibitory agent.
- Detection can be facilitated by coupling ⁇ e.g., physically linking) the antibody to a detectable substance.
- detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
- suitable enzymes include horseradish peroxidase, alkaline phosphatase, ⁇ -galactosidase, or acetylcholinesterase;
- suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin;
- suitable fluorescent materials include umbclliferonc, fluorescein, fluorescein isothiocyanatc, rhodaminc, dichlorotriazinylaminc fluorescein, dansyl chloride or phycoerythrin;
- an example of a luminescent material includes luminol;
- bioluminescent materials include lucifcrasc, luciferin, and aequorin, and examples of suitable radioactive material include
- the screening assays described above can further be adapted to identify candidate/test compounds which modulate ⁇ e.g., stimulate or inhibit) the interaction (and most likely MELK and eIF4B oncogenic activity as well) between an eIF4B protein and a target eIF4B protein with which the eIF4B protein normally interacts or modulates to verify that MELK-mcdiatcd enzymatic activity has been reduced in accordance with the reduced amounts of phosphorylated eIF4B levels.
- target molecules or substrates include certain protein encoded by mRNA with structured 5'UTR, such as those described further herein.
- the invention provides assays for screening candidate/test compounds which interact with ⁇ e.g. , bind to) MELK and/or eIF4B and/or Histone H3 protein.
- Binding compound shall refer to a binding composition, such as a small molecule, an antibody, a peptide, a peptide or non-peptide ligand, a protein, an
- oligonucleotide an oligonucleotide analog, such as a peptide nucleic acid, a lectin, or any other molecular entity that is capable of specifically binding to a target protein or molecule or stable complex formation with an analytc of interest, such as a complex of proteins.
- Boding moiety means any molecule to which molecular tags can be directly or indirectly attached that is capable of specifically binding to an analytc.
- Binding moieties include, but arc not limited to, antibodies, antibody binding compositions, peptides, proteins, nucleic acids and organic molecules having a molecular weight of up to about 1000 daltons and containing atoms selected from the group consisting of hydrogen, fluoride, carbon, oxygen, nitrogen, sulfur and phosphorus.
- the assays are cell-based assays.
- the cell for example, can be of mammalian origin expressing MELK and/or eIF4B and/or Histone H3, e.g., a cancer cell.
- the assays are cell-free assays which include the steps of combining a MELK and/or eIF4B and/or Histone H3 protein or a biologically active portion thereof, and a candidate/test compound, e.g. , under conditions which allow for interaction of (e.g., binding of) the candidate/test compound to the MELK and/or eIF4B and/or Histone H3 protein or biologically active portion thereof to form a complex, and detecting the formation of a complex, in which the ability of the candidate compound to interact with (e.g., bind to) the MELK and/or eIF4B and/or Histone H3 polypeptide or biologically active fragment thereof is indicated by the presence of the candidate compound in the complex.
- a candidate/test compound e.g.
- Formation of complexes between the MELK and/or eIF4B and/or Histone H3 protein and the candidate compound can be quantitated, for example, using standard immunoassays. Such analyses would identify test compounds as MELK and/or eIF4B and/or Histone H3 ligands.
- a fusion polypeptide can be provided which adds a domain that allows the polypeptide to be bound to a matrix.
- glutathione-S-transfcrase-MELK, - Histone H3, and/or -eIF4B fusion polypeptides can be adsorbed onto glutathione scpharosc beads (Sigma Chemical, St.
- the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of MELK-, Histonc H3-, and/or eIF4B-binding polypeptide found in the bead fraction quantitated from the gel using standard electrophoretic techniques.
- MELK and/or eIF4B and/or Histone H3 or its target molecule can be immobilized utilizing conjugation of biotin and streptavidin.
- Biotinylatcd MELK and/or eIF4B and/or Histonc H3 molecules can be prepared from biotin-NHS (N-hydroxy-succinimidc) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, III.), and immobilized in the wells of strcptavidin-coatcd 96 well plates (Pierce Chemical).
- antibodies reactive with MELK and/or eIF4B and/or Histone H3, but which do not interfere with binding of the polypeptide to its target molecule can be derivatized to the wells of the plate, and MELK and/or eIF4B and/or Histone H3 trapped in the wells by antibody conjugation.
- preparations of a MELK- and/or elF4B-binding polypeptide and a candidate compound are incubated in the MELK- and/or eIF4B- and/or Histone H3- prcscnting wells of the plate, and the amount of complex trapped in the well can be quantitated.
- Methods for detecting such complexes include immunodetection of complexes using antibodies reactive with the MELK and/or eIF4B and/or Histonc H3 target molecule, or which arc reactive with MELK and/or clF4B and/or Histonc H3 polypeptide and compete with the target molecule; as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the target molecule.
- a method for assessing the efficacy of an agent for inhibiting kinase activity of human MELK or an ortholog thereof in a subject comprising: a) detecting in a subject sample at a first point in time, the amount of Scr-406 phosphorylatcd human eIF4B or the amount of a human eIF4B ortholog phosphorylatcd at a corresponding amino acid of human eIF4B; b) repeating step a) during at one or more subsequent points in time after administration of the agent; and c) comparing the amount of phosphorylatcd human eIF4B or ortholog thereof detected in step a) with said amount detected in step b), wherein a higher amount of Scr-406 phosphorylatcd human eIF4B or the amount of the human clF4B ortholog phosphorylatcd at a corresponding amino acid of human eIF4B in the first point in time relative to at least one subsequent point in time, indicates that the
- a method for assessing the efficacy of an agent for inhibiting kinase activity of human MELK or an ortholog thereof in a subject comprising: a) detecting in a subject sample at a first point in time, the amount of Thr-3 phosphorylated, Ser-10 phosphorylated, and/or Thr-11 phosphorylated human Histone H3, or the amount of a human Histone H3 ortholog phosphorylated at a corresponding amino acid of human Histone H3; b) repeating step a) during at one or more subsequent points in time after administration of the agent; and c) comparing the amount of phosphorylated human Histone H3 or ortholog thereof detected in step a) with said amount detected in step b), wherein a higher amount of Thr-3
- time course shall refer to the amount of time between an initial event and a subsequent event.
- time course may relate to a subject's disease and may be measured by gauging significant events in the course of the disease, wherein the first event may be diagnosis and the subsequent event may be proliferation, metastasis, etc.
- kinase assays to determine inhibition of phosphorylation effects can be performed according to well-known methods in the art.
- assays for determining MELK kinase activity are well known in the art (sec, for example, the publications described herein and incorporated by reference in their entirety).
- MELK can be incubated with a suitable substrate in a buffer allowing phosphorylation of eIF4B or Histone H3. Phosphorylation of the substrate can be detected using a labeled phosphate group, such as the use of the radioactive label 32 P present as the ATP source in the buffer.
- the assays arc easily amenable to high through-put technologies using robotics and automated processes.
- the MELK kinase activity can be assayed using a synthetic substrate, such as a peptide library.
- MELK activity can also be assayed by detecting downstream targets of the kinase such as those described herein.
- Scr-406-phosphorylatcd eIF4B can be analyzed according to any of the methods and using any of the samples described herein (e.g., single subject samples or pooled subject samples).
- Candidate compounds which produce a statistically significant change in phosphorylated-eIF4B-dependent responses e.g., inhibition of human eIF4B
- phosphorylation at Ser-406 or a corresponding phosphorylatable amino acid residue in an eIF4B ortholog thereof can be identified.
- Such statistically significant changes can be measured according to a number of criteria and/or relative to a number of controls.
- significant modulation of phosphorylation of Ser-406 can be assessed if the output under analysis is inhibited by 1.1-, 1.2-, 1 .3-, 1.4-, 1.5-, 1.6-, 1.7-, 1.8-, 1.9-, 2.0-, 2.1 -, 2.2-, 2.3-, 2.4-, 2.5-, 2.6-, 2.7-, 2.8-, 2.9-, 3.0-, 3.1-, 3.2-, 3.3-, 3.4-, 3.5-, 3.6-, 3.7-, 3.8-, 3.9-,
- the subject has undergone treatment for cancer, has completed treatment for cancer, and/or is in remission from cancer.
- Thr-3 phosphorylatcd, Ser-10 phosphorylatcd, and/or Thr-11 phosphorylatcd Histone H3, or a corresponding phosphorylatable amino acid in an ortholog of human Histone H3, and modulation (e.g., inhibition) thereof can similarly be identified and/or analyzed.
- cancer refers to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, and certain characteristic morphological features. Cancer cells are often in the form of a tumor, but such cells may exist alone within an animal, or may be a non-tumorigenic cancer cell, such as a leukemia cell. As used herein, the term “cancer” includes prcmalignant as well as malignant cancers. Cancers include, but are not limited to, B cell cancer, e.g..
- the heavy chain diseases such as, for example, alpha chain disease, gamma chain disease, and mu chain disease, benign monoclonal gammopathy, and immunocytic amyloidosis, melanomas, breast cancer, lung cancer, bronchus cancer, colorectal cancer, prostate cancer, pancreatic cancer, stomach cancer, ovarian cancer, urinary bladder cancer, brain or central nervous system cancer, peripheral nervous system cancer, esophageal cancer, cervical cancer, uterine or endometrial cancer, cancer of the oral cavity or pharynx, liver cancer, kidney cancer, testicular cancer, biliary tract cancer, small bowel or appendix cancer, salivary gland cancer, thyroid gland cancer, adrenal gland cancer, osteosarcoma, chondrosarcoma, cancer of hematological tissues, and the like.
- the heavy chain diseases such as, for example, alpha chain disease, gamma chain disease, and mu chain disease, benign monoclonal gammopathy, and immunocytic amyloidosis
- cystadenocarcinoma head and neck cancers, including non-small cell lung cancer
- NSCLC squamous cell carcinoma
- pancreatic cancer pancreatic cancer
- colon cancer pancreatic cancer
- prostate cancer and/or gliomas
- Treatment refers to the administration of an agent that inhibits the ability of 1) MELK to phosphorylatc eIF4B and/or Histone H3 and/or 2) the ability of eIF4B or Histone H3 to be phosphorylatcd by MELK, to cause a cancer to be ameliorated, to extend the expected survival time of the subject and/or time to progression of a cancer or the like.
- Responsiveness to “respond” to treatment, and other forms of this verb, as used herein, refer to the reaction of a subject to treatment with an agent capable of inhibiting the ability of 1 ) MELK to phosphorylate eIF4B or Histone H3 and/or 2) the ability of eIF4B or Histone H3 to be phosphorylatcd by MELK.
- a subject responds to treatment of the subject or cell thereof with an agent if the assayed condition is modulated by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more relative to that of no administration of the agent or over a given amount of time.
- MELK and/or eIF4B and/or Histone H3 inhibitors described herein can be used to treat cancer.
- a method of treating a subject afflicted with cancer comprising administering to the subject an agent that inhibits Ser-406 phosphorylation of human clF4B or a corresponding phosphorylatablc amino acid in an ortholog of human eIF4B, for example an agent that specifically modulates Scr-406 phosphorylation, thereby treating the subject afflicted with the cancer.
- an agent that inhibits Ser-406 phosphorylation of human clF4B or a corresponding phosphorylatablc amino acid in an ortholog of human eIF4B for example an agent that specifically modulates Scr-406 phosphorylation, thereby treating the subject afflicted with the cancer.
- such MELK and/or eIF4B and/or Histone H3 inhibitors can also be used to determine the efficacy, toxicity, or side effects of treatment with such an agent.
- These methods of treatment generally include the steps of administering modulators in a pharmaceutical composition, as described further below, to a subject in need of such treatment, e.g., a subject with cancer or at risk for developing cancer.
- the term "administering" is intended to include routes of administration which allow the agent to perform its intended function of inhibiting the ability of M ELK to phosphorylatc eIF4B, the ability of eIF4B to be phosphorylated by MELK, the ability of MELK to phosphorylate Histone H3, and/or the ability of Histone H3 to be phosphorylated by MELK.
- routes of administration examples include injection (subcutaneous, intravenous, parenterally, intraperitoneally, intrathecal, etc.), oral, inhalation, and transdermal.
- the injection can be bolus injections or can be continuous infusion.
- the agent can be coated with or disposed in a selected material to protect it from natural conditions which may
- the agent may be administered alone, or in conjunction with a pharmaceutically acceptable carrier.
- the agent also may be administered as a prodrug, which is converted to its active form in vivo.
- an agent inhibiting the ability of MELK to phosphorylate eIF4B and/or the ability of eIF4B to be phosphorylated by MELK is that amount necessary or sufficient to inhibit the ability of MELK to phosphorylate elF4B and/or the ability of eIF4B to be phosphorylated by MELK in the subject or population of subjects as measured, for example, by the levels of Ser-406-phosphorylated human eIF4B or a corresponding phosphorylatablc residue in an eIF4B ortholog thereof according to the methods described above.
- the same analysis applies to inhibiting the ability of MELK to phosphorylatc Histone H3 and/or the ability of Histone H3 to be phosphorylated by MELK.
- the effective amount can vary depending on such factors as the type of therapeutic agcnt(s) employed, the size of the subject, or the severity of the disorder.
- Treatment can be initiated with smaller dosages that arc less than the effective dose of the compound. Thereafter, in one embodiment, the dosage should be increased by small increments until the optimum effect under the circumstances is reached. For convenience, the total daily dosage may be divided and administered in portions during the day if desired.
- the effectiveness of any particular agent to treat cancers can be monitored by comparing two or more samples obtained from subjects undergoing cancer treatment.
- a first sample is obtained from the subject prior to beginning therapy and one or more samples during treatment.
- a baseline of expression of cells from subjects with cancer prior to therapy is determined and then changes in the baseline state of expression of cells from subjects with cancer is monitored during the course of therapy.
- two or more successive samples obtained during treatment can be used without the need of a prc-trcatmcnt baseline sample.
- the first sample obtained from the subject is used as a baseline for determining whether the expression of cells from subjects with metabolic disorders is increasing or decreasing.
- MELK and/or elF4B and/or Histone H3 inhibitors can be administered in pharmaceutically acceptable compositions which comprise a therapeutically-effective amount of the inhibitor formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents.
- formulations can be adapted for ( 1 ) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, pastes; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension; (3) topical application, for example, as a cream, ointment or spray applied to the skin, buccal, or sublingual surfaces; (4) intravaginally or intrarcctally, for example, as a pessary, cream or foam; or (5) nasal/aerosol, for example, as an aqueous aerosol, liposomal preparation or solid particles containing the compound, based on well-known methods in the pharmaceutical arts.
- oral administration for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, pastes
- parenteral administration for example, by subcutaneous
- phrases "pharmaceutically acceptable” is employed herein to refer to those agents, materials, compositions, and/or dosage forms which arc, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
- phrases "pharmaccutically-acccptablc carrier” as used herein means a pharmaccutically-acccptablc material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject chemical from one organ, or portion of the body, to another organ, or portion of the body.
- Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject.
- materials which can serve as pharmaceutical ly-acceptable carriers include: ( 1 ) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymcthyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipicnts, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and
- polyethylene glycol polyethylene glycol
- esters such as ethyl oleate and ethyl lauratc
- agar agar
- buffering agents such as magnesium hydroxide and aluminum hydroxide
- alginic acid 16
- pyrogen- free water 17.
- isotonic saline 18.
- Ringer's solution (19) ethyl alcohol;
- phosphate buffer solutions and (21) other non-toxic compatible substances employed in pharmaceutical formulations.
- pharmaceutically-acccptablc salts refers to the relatively non-toxic, inorganic and organic acid addition salts of the agents that reduce the phosphorylation levels of PKC-iota and/or activity encompassed by the invention. These salts can be prepared in situ during the final isolation and purification of the agents, or by separately reacting a purified agents agent in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed.
- Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfatc, phosphate, nitrate, acetate, valerate, oleate, palmitatc, stcaratc, lauratc, benzoate, lactate, phosphate, tosylatc, citrate, malcatc, fumaratc, succinate, tartrate, nap thy late, mesylate, glucoheptonate, lactobionate, and laurylsulphonatc salts and the like (Sec, for example, Bcrge et al. ( 1977) "Pharmaceutical Salts", J. Pharm. Sci. 66: 1 - 19).
- the methods described herein can further comprise treating subjects with MELK and/or eIF4B and/or Histonc H3 inhibitors in addition to administering one or more additional anti-cancer agents and/or use samples from subjects exposed to such anti-cancer agents.
- Anti -cancer agents arc well known to the skilled artisan and include, without limitation, chemotherapy and radiation, as well as immunotherapy, hormone therapy, and gene therapy using nucleic acid molecules and/or proteins that arc linked to the initiation, progression, and/or pathology of a tumor or cancer.
- Chemotherapy includes the administration of a chemotherapeutic agent.
- a chemotherapeutic agent may be, but is not limited to, those selected from among the following groups of compounds: platinum compounds, cytotoxic antibiotics,
- antimetabolities anti-mitotic agents, alkylating agents, arsenic compounds, DNA topoisomerase inhibitors, taxanes, nucleoside analogues, plant alkaloids, and toxins; and synthetic derivatives thereof.
- exemplary compounds include, but are not limited to, alkylating agents: cisplatin, trcosulfan, and trofosfamidc; plant alkaloids: vinblastine, paclitaxcl, docctaxol; DNA topoisomerase inhibitors: tcniposidc, crisnatol, and mitomycin; anti-folates: methotrexate, mycophenolic acid, and hydroxyurea; pyrimidine analogs: 5- fluorouracil, doxifluridine, and cytosine arabinoside; purine analogs: mercaptopurine and thioguanine; DNA antimetabolites: 2'-deoxy-5-fluorouridine, aphidicolin gly
- compositions comprising one or more chemotherapeutic agents (e.g., FLAG, CHOP) may also be used.
- FLAG comprises fludarabine, cytosine arabinoside (Ara-C) and G-CSF.
- CHOP comprises cyclophosphamide, vincristine, doxorubicin, and prednisone.
- PARP e.g., PARP-1 and/or PARP-2
- inhibitors are well known in the art (e.g., Olaparib, ABT-888, BSI-201 , BGP-15 (N-Gcne Research Laboratories, Inc.); INO-1001 (Inotck Pharmaceuticals Inc.); PJ34 (Soriano el a/., 2001 ; Pachcr el a/., 2002b); 3-aminobcnzamide (Trcvigcn); 4-amino-l ,8-naphthalimidc;
- the chemotherapeutic agents arc platinum compounds, such as cisplatin, carboplatin, oxaliplatin, ncdaplatin, and iproplatin.
- platinum compounds such as cisplatin, carboplatin, oxaliplatin, ncdaplatin, and iproplatin.
- Other antineoplastic platinum coordination compounds are well known in the art, can be modified according to well-known methods in the art, and include the compounds disclosed in U.S. Pat. Nos. 4,996,337, 4,946,954, 5,091 ,521, 5,434,256, 5,527,905, and 5,633,243, all of which arc incorporated herein by reference.
- chemotherapeutic agents arc illustrative, and arc not intended to be limiting.
- Radiation therapy can also comprise an additional anti-cancer agent.
- the radiation used in radiation therapy can be ionizing radiation.
- Radiation therapy can also be gamma rays, X-rays, or proton beams.
- Examples of radiation therapy include, but arc not limited to, external-beam radiation therapy, interstitial implantation of radioisotopes (1-125, Pd- 103, Ir- 192), intravenous administration of radioisotopes such as strontium-89, thoracic radiation therapy, intraperitoneal i2 P radiation therapy, and/or total abdominal and pelvic radiation therapy.
- the radiation therapy can be administered as external beam radiation or teletherapy wherein the radiation is directed from a remote source.
- the radiation treatment can also be administered as internal therapy or
- brachytherapy wherein a radioactive source is placed inside the body close to cancer cells or a tumor mass.
- photodynamic therapy comprising the administration of photosensitizers, such as hematoporphyrin and its derivatives, Vertoporfin (BPD-MA), phthalocyanine, photosensitizer Pc4, dcmcthoxy-hypocrcllin A; and 2BA-2- DMHA.
- photosensitizers such as hematoporphyrin and its derivatives, Vertoporfin (BPD-MA), phthalocyanine, photosensitizer Pc4, dcmcthoxy-hypocrcllin A; and 2BA-2- DMHA.
- Additional anti-cancer agents include immunotherapy, hormone therapy, and gene therapy.
- Such therapies include, but are not limited to, the use of antisense polynucleotides, ribozymes, RNA interference molecules, triple helix polynucleotides and the like, where the nucleotide sequence of such compounds are related to the nucleotide sequences of DNA and/or RNA of genes that are linked to the initiation, progression, and/or pathology of a tumor or cancer.
- oncogenes, growth factor genes, growth factor receptor genes, cell cycle genes, DNA repair genes, and others may be targeted in such therapies.
- Immunotherapy may comprise, for example, use of cancer vaccines and/or sensitized antigen presenting cells. Immunotherapy can also involve derepression of immunoinhibitory pathways, such as by targeting PD-Ll , PD-L2, PD-1, CTLA-4, and the like.
- the immunotherapy can involve passive immunity for short-term protection of a host, achieved by the administration of an antibody directed against a cancer antigen or disease antigen ⁇ e.g., administration of a monoclonal antibody, optionally linked to a
- Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines.
- Hormonal therapeutic treatments can comprise, for example, hormonal agonists, hormonal antagonists ⁇ e.g., flutamidc, bicalutamidc, tamoxifen, raloxifene, lcuprolidc acetate (LUPRON), LH-RH antagonists), inhibitors of hormone biosynthesis and processing, and steroids ⁇ e.g., dcxamcthasonc, retinoids, deltoids, betamethasone, Cortisol, cortisone, prednisone, dehydrotcstostcronc, glucocorticoids, mincralocorticoids, estrogen, testosterone, progestins), vitamin A derivatives ⁇ e.g., all-trans rctinoic acid (ATRA)); vitamin D3 analogs; anti gestagens (e.g., mifepristone, onapristone), or antiandrogens (e.g., cyprotcronc acetate).
- hormonal antagonists
- anti-cancer therapy used for cancers whose phenotype is determined by the methods of the invention can comprise one or more types of therapies described herein including, but not limited to, chemotherapeutic agents,
- immunotherapeutics include anti-angiogenic agents, cytokines, hormones, antibodies,
- combination therapies can comprise one or more chemotherapeutic agents and radiation, one or more chemotherapeutic agents and immunotherapy, or one or more chemotherapeutic agents, radiation and chemotherapy.
- Example 1 Materials and Methods For Examples 2-3
- Human eIF4B was cloned from the reverse transcription products of total RNA extracted from human mammary epithelial cells (HMECs), using the primers (forward: ATGGCGGCCTCAGCAAAAAAG; reverse: CTATTCGGCATAATCTTCTC). The 1.8 kb PCR product was then used as template for amplifying Flag-tagged or HA-taggcd eIF4B with restriction sites. The constructs (pWzl-Flag-eIF4B, pTrcx-eIF4B-HA) were verified by sequencing. Site-directed mutagenesis of eIF4B was performed using QuickChangc XL (Stratagenc), and all mutant constructs were confirmed by sequencing.
- HMECs human mammary epithelial cells
- oligonucleotides were annealed and ligatcd with digested pLKO vector.
- the sequences for scramble, sh-eIF4B- l , sh-eIF4B-2 arc GTGGACTCTTGAAAGTACTAT,
- Retroviruses were generated by transacting HEK293T cells with retroviral plasmids and packaging DNA. Generally, 1.6 ⁇ g pWzl DNA, 1.2 ⁇ g pCG-VSVG and 1.2 ⁇ g pCG-gap/pol, 12 ul lipid of Mctafcctcnc Pro (Biontcx) were used. DNA and lipid were diluted in 300 ⁇ PBS respectively and mixed. After 15 minutes (min.) of incubation, they were added to one 6-cm dish that was seeded with 3 million HEK293T cells one day earlier. Viral supernatant was collected 48 hours (h) and 72 hours post-transfection.
- the supernatant was filtered through 0.45 ⁇ membrane, and was added to target cells in the presence of 8 ⁇ polybrene (Millipore).
- Lentiviruses were generated with a similar approach with the exception of HEK.293T cells that were transfected with 2 ⁇ g pLKO DNA, 1.5 Mg pCMV-dR8.91, and 0.5 Mg pMD2-VSVG. Cells were selected with antibiotics starting 72 h after initial infection. Puromycin and blasticidin were used at the final concentration s of 1.5 Mg/ml and 4 Mg/ml respectively. c. Immunoblotting
- nocodazolc For treatment with nocodazolc, cells were refreshed with medium containing nocodazolc (200 ng/ml). Twenty hours after treatment, floating mitotic cells were harvested by gental shake-off. For drug treatment, cells were seeded in multi-well plate, in the presence of OTSSP167 (ChemExpress, HY 15512; 10 mM stock made in DMSO).
- the membrane was blocked with 5% non-fat milk and was then incubated with primary antibodies overnight at 4°C. After washing, the membrane was incubated with fluorophorc-conjugatcd secondary antibodies for 1 h at room temperature. The membrane was then washed and scanned with an Odyssey® Infrared scanner (Li-Cor Biosciences).
- Flag-tagged eIF4B or Flag-eIF4B was transfected into HEK293T cells (4 ⁇ g DNA for cells in one 60 mm dish). Thirty-six hours after transfection, cells were lysed with IP buffer ( 100 mM NaCl, 50 mM Tris, pH 7.5, 0.5% NP-40, 0.5% Sodium dcoxycholatc, supplemented with protcasc/phosphatasc inhibitor cocktail). Ly sates were cleared via incubating with anti-mouse IgG conjugated to magnetic beads (4°C, 30 min), and then immunoprccipitatcd with anti-Flag M2 magnetic beads (Sigma) (4°C, 120 min).
- the beads with bound antigens were washed 5 times with IP buffer. Beads during the last wash were aliquoted into 1.5 ml microcentrifuge tubes. After removal of IP buffer, the beads were washed once with Ix kinase buffer without ATP (5 mM Tris, pH 7.5, 5 mM - ⁇ glycerophosphate, 2 mM dithiothreitol, 0. 1 mM Na3V04, 10 mM MgC12; Cell Signaling). After the wash, 40 ⁇ l x kinase buffer with 200 mM ATP was added to each tube, followed by 5 ul buffer without or with 500 ng recombinant MELK.
- Ix kinase buffer without ATP 5 mM Tris, pH 7.5, 5 mM - ⁇ glycerophosphate, 2 mM dithiothreitol, 0. 1 mM Na3V04, 10 mM MgC12; Cell Signal
- eIF4B stimulates the hclicasc activity of cIF4A for unwinding the secondary structure of 5'UTR of mRNA (Dmitriev et al. (2003) Mo/. Cell Biol. 23:8925- 8933 and Shahbazian el al. (2010) Mol. Cell Biol. 30 1478- 1485).
- Many of these mRNAs encode oncogenic proteins, such as c-Myc, XIAP (X-linked inhibitor of apoptosis protein) and ODC (ornithine decarboxylase).
- MELK-mediated S406 phosphorylation of eIF4B during mitosis is functionally important for the optimal translation of mRNAs with highly structured 5 'UTR, many of which are known to be oncogenic, such as c-Myc, XIAP, and ODC 1.
- MELK is a novel kinase that regulates eIF4B during mitosis and thereby mediates the translation of mRNAs that harbor structured 5'-UTR and are important for the survival and proliferation of cancer cells.
- the level of eIF4B phosphorylation mediated by MELK is a target engagement biomarker for MELK oncogenic activity useful for preclinical and clinical applications.
- MELK is a kinase that phosphorylates human Histone H3 at least at Thr3, Scr 10 and Thrl 1 , but not Scr28, and that Histonc H3 orthologs in other species arc similarly phosphorylated due to the highly conserved sequence and structural composition of the Histonc H3 polypeptide region harboring the phosphorylation site (Table 3).
- MELK is a novel kinase that regulates Histonc H3 phosphorylation during mitosis and is therefore potentially important for the proliferation of cells (e.g., cancer cells).
- the level of Histonc H3 phosphorylation mediated by MELK is a target engagement biomarker for MELK oncogenic activity useful for preclinical and clinical applications.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pathology (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Zoology (AREA)
- Hematology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Physics & Mathematics (AREA)
- Biophysics (AREA)
- Veterinary Medicine (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Cell Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Food Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361902877P | 2013-11-12 | 2013-11-12 | |
| US201461954046P | 2014-03-17 | 2014-03-17 | |
| PCT/US2014/065173 WO2015073509A2 (en) | 2013-11-12 | 2014-11-12 | Biomarker for melk activity and methods of using same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP3068930A2 true EP3068930A2 (en) | 2016-09-21 |
| EP3068930A4 EP3068930A4 (en) | 2017-10-04 |
Family
ID=55867713
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP14862279.8A Withdrawn EP3068930A4 (en) | 2013-11-12 | 2014-11-12 | Biomarker for melk activity and methods of using same |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP3068930A4 (en) |
| CN (1) | CN106232878A (en) |
| AU (1) | AU2014348780B2 (en) |
| CA (1) | CA2928464A1 (en) |
| WO (1) | WO2015073509A2 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN120741858A (en) * | 2025-08-20 | 2025-10-03 | 四川大学华西医院 | Use of reagents for detecting epigenetic modified H3T3 and use of epigenetic modified H3T3 inhibitors |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2004264936A1 (en) * | 2003-08-14 | 2005-02-24 | Exelixis, Inc. | MELKs as modifiers of the RAC pathway and methods of use |
| EP2574929A1 (en) * | 2011-09-28 | 2013-04-03 | IMG Institut für medizinische Genomforschung Planungsgesellschaft M.B.H. | Marker in diagnosing prostate cancer (PC) |
| CN103173527A (en) * | 2011-12-22 | 2013-06-26 | 上海生物芯片有限公司 | Application of MELK gene |
| CN104968345B (en) * | 2012-01-19 | 2018-05-08 | 肿瘤疗法科学股份有限公司 | 1,5-Naphthyridine Derivatives and MELK Inhibitors Containing 1,5-Naphthyridine Derivatives |
-
2014
- 2014-11-12 EP EP14862279.8A patent/EP3068930A4/en not_active Withdrawn
- 2014-11-12 CN CN201480072848.3A patent/CN106232878A/en active Pending
- 2014-11-12 WO PCT/US2014/065173 patent/WO2015073509A2/en not_active Ceased
- 2014-11-12 CA CA2928464A patent/CA2928464A1/en not_active Abandoned
- 2014-11-12 AU AU2014348780A patent/AU2014348780B2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2015073509A2 (en) | 2015-05-21 |
| WO2015073509A8 (en) | 2016-05-26 |
| WO2015073509A3 (en) | 2016-01-14 |
| AU2014348780A1 (en) | 2016-06-02 |
| EP3068930A4 (en) | 2017-10-04 |
| CA2928464A1 (en) | 2015-05-21 |
| CN106232878A (en) | 2016-12-14 |
| AU2014348780B2 (en) | 2018-12-13 |
| AU2014348780A8 (en) | 2016-06-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8129131B2 (en) | Pin1 as a marker for abnormal cell growth | |
| Roig et al. | Active Nercc1 protein kinase concentrates at centrosomes early in mitosis and is necessary for proper spindle assembly | |
| Ma et al. | Dual‐specificity tyrosine phosphorylation–regulated kinase 3 loss activates purine metabolism and promotes hepatocellular carcinoma progression | |
| Cheng et al. | A mitotic NADPH upsurge promotes chromosome segregation and tumour progression in aneuploid cancer cells | |
| AU2689095A (en) | Diagnostics and treatments for cancers expressing tyrosine phosphorylated crkl protein | |
| US7087392B2 (en) | Antiproliferative SgK reagents and methods | |
| US20040265931A1 (en) | HAUSP-Mdm2 interaction and uses thereof | |
| EP2628011B1 (en) | Ilk gene as marker for erlotinib treatment | |
| US20230139516A1 (en) | Ripk2 inhibition for the treatment of cancer | |
| KR20070091602A (en) | F53-dependent and non-dependent tumor suppressor mediators and their use | |
| US10254283B2 (en) | Biomarker for MELK activity and methods of using same | |
| WO2015073509A2 (en) | Biomarker for melk activity and methods of using same | |
| CA2392917C (en) | Pin1 as a marker for abnormal cell growth | |
| US9977026B2 (en) | Detection of elevated levels of phosphorylated MCM and method of increasing MCM phosphorylation capacity | |
| US20230357430A1 (en) | Rnf167 and castor1 as novel mtor targets | |
| WO2012058201A2 (en) | Method for determining activators of excitatory synapse formation | |
| US20250195628A1 (en) | Analytical method and therapeutical agent for use in combination with l-asparaginase in tumour therapy | |
| Xie et al. | KAT8-catalyzed lactylation contributes to eEF1A2-mediated protein synthesis and colorectal carcinogenesis | |
| WO2012173841A1 (en) | Biomarker for pkc-iota activity and methods of using same | |
| Pita¹ et al. | CDK4 phosphorylation status and rational use for combining | |
| CN117899217A (en) | Application of TRIM32 as target in preparing or screening medicines for enhancing radiation sensitivity | |
| Cai | Part I: Steroid Receptor CO-Activator 3 (SRC-3) Expression in Lung Cancer and its Role in Regulating Cancer Cell Survival and Proliferation; Part II: Development of Phosphospecific Peptoid Ligand | |
| AU2005209659A1 (en) | Pin1 as a marker for abnormal cell growth | |
| AU1934701A (en) | Pin1 as a marker for abnormal cell growth | |
| JPWO2007046538A1 (en) | Method for ubiquitination of a common subunit of RNA polymerase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20160610 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| DAX | Request for extension of the european patent (deleted) | ||
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61K 31/7088 20060101ALI20170516BHEP Ipc: G01N 33/574 20060101ALI20170516BHEP Ipc: C12N 15/113 20100101ALI20170516BHEP Ipc: C12N 9/12 20060101ALI20170516BHEP Ipc: C40B 20/00 20060101ALI20170516BHEP Ipc: G01N 33/573 20060101ALI20170516BHEP Ipc: A61K 38/12 20060101ALI20170516BHEP Ipc: C40B 30/08 20060101AFI20170516BHEP |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20170831 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61K 31/7088 20060101ALI20170825BHEP Ipc: G01N 33/574 20060101ALI20170825BHEP Ipc: C12N 15/113 20100101ALI20170825BHEP Ipc: C12N 9/12 20060101ALI20170825BHEP Ipc: G01N 33/573 20060101ALI20170825BHEP Ipc: C40B 20/00 20060101ALI20170825BHEP Ipc: C40B 30/08 20060101AFI20170825BHEP Ipc: A61K 38/12 20060101ALI20170825BHEP |
|
| 17Q | First examination report despatched |
Effective date: 20181112 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20191210 |