EP3013980A1

EP3013980A1 - Method for the in vitro detection of strains of legionella pneumophila resistant to antibiotics

Info

Publication number: EP3013980A1
Application number: EP14752354.2A
Authority: EP
Inventors: Max Maurin Louis Maurin; Dominique SCHNEIDER; Lubana SHADOUD; Sophie Jarraud; Jean François TIMSIT; Jérôme ETIENNE
Original assignee: Universite Joseph Fourier Grenoble 1; Centre Hospitalier Universitaire de Grenoble
Current assignee: Universite Joseph Fourier Grenoble 1; Centre Hospitalier Universitaire de Grenoble
Priority date: 2013-06-27
Filing date: 2014-06-17
Publication date: 2016-05-04
Also published as: FR3007770A1; WO2014207347A1; FR3007770B1; US20160208316A1; US10106858B2

Abstract

The invention relates to a method for the in vitro detection of strains of Legionella pneumophila that are resistant to antibiotics, especially fluoroquinolones. The invention also relates to nucleotide probes and to a kit of reagents allowing the detection of bacterial strains of Legionella pneumophila that are resistant to antibiotics, especially of the fluoroquinolone type.

Description

METHOD OF IN VITRO DETECTION OF ANTIBIOTIC RESISTANT LEGIONELLA PENEUMOPHILA STRAINS

The present invention relates to a method for the in vitro detection of Legionella pneumophila strains resistant to antibiotics, especially fluoroquinolones. The invention also relates to nucleotide probes and a kit of reagents for the detection of bacterial strains Legionella pneumophila resistant to antibiotics, especially fluoroquinolone type.

The invention finally relates to a real-time PCR technique for the implementation of the above-mentioned method for the in vitro detection of antibiotic-resistant Legionella pneumophila strains.

Legionella pneumophila, a Gram-negative bacterium, is the main etiological agent of legionellosis, a potentially serious pneumonia in humans. Fluoroquinolones and macrolides are the first-line antibiotics for legionellosis. However, therapeutic failures are frequent and mortality remains high, on average 10 to 15%, and more than 30% in immunocompromised patients.

To date, these therapeutic failures have never been associated with resistance acquired with antibiotics in L. pneumophila. Indeed, numerous in vitro studies have not shown any evidence of acquired resistance to fluoroquinolones or macrolides in natural strains of L. pneumophila isolated from humans or isolated from the environment (Baltch AL et al, Antimicob Agents Chemother., 1998, 42 (12): 3153-6, Balch AL et al, Antimicob, Agents Chemother., 1995, 39 (8): 1661-6, Garcia MT et al, Antimicob, Agents Chemother., 2000. 44 (8): 2176-8, Higa F. et al, J. Antimicrob. Chemother. 2005; 56 (6): 1053-7; Jonas D. et al., J. Antimicrob. Chemother., 2001; 47 (2): 147-52; Onody, C. et al., J. Antimicrob. Chemother., 1997; 39 (6): 815-6).

Several authors consider that the acquisition of antibiotic resistance, in particular to fluoroquinolones, in L. pneumophila is a non-existent phenomenon (Roig J. and Rello J., J. Antimicrob Chemother., 2003; 51 (5): 1119- 29 and BS Fields et al, Clin Microbiol Rev. 2002; 15 (3): 506-26).

Macrolides and fluoroquinolones are therefore considered to be reliable antibiotics in the treatment of legionellosis (Roig J. and Rello J., J. Antimicrob Chemother., 2003; 51 (5): 1119-29 and Fields BS. al, Clin Microbiol, Rev. 2002; 15 (3): 506-26).

Only rifampicin is not recommended as monotherapy because of the very high risk of selecting resistant mutants in most bacteria.

Fluoroquinolones, broad-spectrum antibiotics, are part of the general family of quinolones, synthetic antibiotics. Fluoroquinolones are so-called second-generation quinolones in which fluorine has been added to increase the penetration of quinolone molecules into cells (up to 200-fold). Quinolones and fluoroquinolones are targeted at type II bacterial topoisomerases: gyrase DNA consisting of GyrA and GyrB proteins, and topoisomerase IV consisting of parC and parE proteins. Certain mutations affecting the genes encoding these type II topoisomerases are known to induce resistance to quinolones and fluoroquinolones in bacteria. In Gram-negative species, especially Escherichia coli, these fluoroquinolone resistance mutations mainly affect the gyrA gene encoding the GyrA protein of DNA gyrase. The resulting amino acid substitutions are located in the QRDR region (Quinolone Resistance Determining Region) of GyrA, comprising the amino acids at position 67 to 106 [Soussy CJ Quinolones and gram-negative bacteria. In Antibiogram. Courvalin P, Leclercq R, and Rice LB Eds. ESKA Publishing, ASM Press, 2010, p261-274]. The level of sensitivity to fluoroquinolones varies in the same bacterium depending on or amino acids located at these positions. However, the mutations responsible for resistance to the most frequent fluoroquinolones are those leading to a substitution at the amino acid level at positions 83, 87 or, more rarely 84, of the GyrA protein (according to the Escherichia coli count), constituting the subunit. unit A DNA gyrase. Mutations gyrA83 and gyrA87 are frequently observed in vivo [Jacoby G A. Mechanisms of resistance to quinolones. Clin Infect Dis. 2005; 41 Suppl 2: S120-6], and were reproduced in vitro [Barnard FM, Maxwell A. Interaction between DNA gyrase and quinolones: effects of alanine mutations at GyrA subunit residues Ser (83) and Asp (87). Antimicrob Agents Chemother. 2001; 45 (7): 1994-2000].

These positions are identical on the gyrA gene of L. pneumophila strain Paris (NC 006368.1). The inventors have previously shown [Almahmoud I, Kay E, Schneider D, Maurin M. Mutational paths to increased fluoroquinolone resistance in Legionella pneumophila. J Antimicrob Chemother. 2009; 64 (2): 284-93] by in vitro selection of fluoroquinolone-resistant mutants, that the key positions for fluoroquinolone resistance in L. pneumophila strain Paris also correspond to amino acids 83 and 87 of the GyrA protein.

The L. pneumophila strain of Paris (CIP 107629T) is one of the reference strains known to be sensitive to fluoroquinolones [Roch N, Maurin M. Antibiotic susceptibilities of Legionella pneumophila strain in THP-1 cells as determined by real-time PCR assay.J Antimicrob Chemother. 2005; 55 (6): 866-71]. Other strains sensitive to fluoroquinolones are described, such as L. pneumophila Philadelphia (ATCC 33152), L. pneumophila Lens (CIP 108286) and L. pneumophila Lorraine (CIP 108729).

Furthermore, the inventors have already described mutant strains resistant to fluoroquinolones previously selected in vitro and having one or more mutations gyrA83 and gyrA87 [Almahmoud I, Kay E, Schneider D, Maurin M. Mutational paths to increased fluoroquinolone resistance in Legionella pneumophila . J Antimicrob Chemother. 2009; 64 (2): 284-93]. It is L. pneumophila 1 LPPI1 (CIP107629T, namely the mutated strain at position 83 (T83I) of the gyrA gene), L. pneumophila 1 LPPI4 (CIP107629T, namely the mutated Paris strain at position 83 (T83I) and at position 87 (D87N) of the gyrA gene) and L. pneumophila 1 LPPI5 strain (CIP107629T, namely the mutated Paris strain at position 83 (T83I) and at position 87 (D87H) of the gyrA gene).

However, to date, it is accepted by the scientific community that L. pneumophila can not acquire in vivo antibiotic resistance, particularly fluoroquinolones used in clinical practice. Several factors are usually mentioned to explain this finding in L. pneumophila (Fields BS et al., Clin Microbiol Rev. 2002; 15 (3): 506-26):

1) In contrast to E. coli, L. pneumophila multiplies predominantly intracellularly in free protozoa (amoebae) in the aquatic environment or in alveolar macrophages in infected patients; this specific niche multiplication would not be conducive to the exchange of antibiotic resistance genes as has been described in many other bacteria (enterobacteria for example); 2) Unlike some E. coli strains, including enterohaemorrhagic E. coli, which have an animal reservoir in ruminants, there is no known animal reservoir for L. pneumophila. There would be no selection pressure by antibiotics used in veterinary practice or agri-food;

3) Contrary to certain E. coli strains for which human-to-human transmission, especially by fecal-oral transmission, has been reported, Legionnaires' disease is not a human-to-human transmission disease, which would further limit the chances of transmission. possible antibiotic resistant mutants.

The susceptibility of bacteria to antibiotics can be assessed by phenotypic methods, such as performing an antibiogram and determining minimum inhibitory concentrations (MICs) of antibiotics. These methods are not routinely performed for fastidiously growing bacteria such as L. pneumophila because of the impossibility of isolating the bacterial strain involved in most infected patients.

Molecular methods based on real-time PCR and PCR techniques have been developed in recent years to detect mutations in antibiotic resistance from isolated strains or directly in specimens (clinical or other mutant strains.

All the data available to date seem to indicate the in vivo inexistence of antibiotic-resistant strains of L. pneumophila in patients with legionellosis treated with these antibiotics.

Contrary to the hypotheses formulated by the scientific community, the inventors have demonstrated that the acquisition of resistance to fluoroquinolones in L. pneumophila is possible in vivo in patients infected with this pathogen. One aspect of the invention is a method of detecting L. pneumophila strains resistant to antibiotics.

Another aspect of the invention is the development of nucleotide sequences of primers and probes (tandem probes) for amplifying and specifically detecting mutations involved in antibiotic resistance in species L pneumophila.

One of the other aspects of the invention is a real-time PCR technique for determining specific mutations responsible for resistance.

Another aspect of the invention is a kit for detecting the resistance of L. pneumophila strains to fluoroquinolones to prevent therapeutic failure and high mortality in patients with legionellosis.

The present invention is based on an in vitro method for the detection of at least one bacterial strain of Legionella pneumophila resistant to antibiotics, especially of the fluoroquinolone type, in a biological sample, by the detection:

a mutation on at least one of positions 83, 84, 87 or equivalent with respect to SEQ ID NO: 1 in a GyrA protein of L. pneumophila having at least 90% identity with SEQ ID NO : 1, said mutation resulting in a mutated GyrA protein, or

a nucleic acid encoding said mutated GyrA protein,

detecting said mutation or nucleic acid encoding said mutated GyrA protein indicating the presence of at least one antibiotic-resistant bacterial legionella pneumophila strain in the sample. SEQ ID NO: 1 represents the sequence of the wild type GyrA protein of L. Pneumophila (GyrA protein of L. pneumophila strain Paris, Accession number: YP 123696.1), encoded by the nucleotide sequence SEQ ID NO: 13.

By biological sample is meant any collection of tissues, cells, organs, fluids, secretions or blood from the human or animal body, and their derivatives.

As used herein, antibiotic resistance is defined as the ability of a microorganism to resist the effects of antibiotics both in vitro and in vivo.

This resistance is usually defined by measuring the minimum inhibitory concentration (MIC) of an antibiotic against a given bacterium, according to a method validated by a reference organism, such as the European Committee on Antimicrobial Susceptibility Testing (EUCAST) in Europe [E. Matuschek, D. F. Brown J. and G. Kahlmeter. Development of the EUCAST disk diffusion antimicrobial susceptibility testing method and its implementation in routine microbiology laboratories. Clin Microbiol Infect 2014; 20: 0255-0266], or the Standard Clinical and Laboratorty Institute (CLSI) in the United States [CLSI. M07-A9: Methods for Antimicrobial Dilution Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard - Ninth Edition. Flight. 32 No. 2]. A strain is said to be resistant to an antibiotic if the MIC of this antibiotic vis-à-vis the strain is greater than a critical value defined by the same reference organism.

For the purposes of the present application, the term "equivalent position" means a nucleotide of the gyrA gene or an amino acid of the GyrA protein of the same nature and function as that described in E. coli for a given position, although the numbering of this position may be different in the species considered compared to E. coli because of a different number of nucleotides (gyrA) or amino acids (GyrA) between the two species. The term "identity" is also understood to mean the number of identical nucleotides between two sequences of the same length, determined for each position in the sequences. In the wild strains of L. pneumophila, position 83 of the GyrA protein is occupied by threonine (T), position 84 is occupied by alanine (A) and position 87 is occupied by an aspartic acid (D).

A bacterial strain of L. pneumophila according to the invention is said to be mutated since the position 83 of the GyrA protein is no longer occupied by a threonine (T), and / or since the position 84 is no longer occupied by an alanine (A), and / or when position 87 is no longer occupied by an aspartic acid (D).

A particular embodiment of the invention relates to an in vitro method for the detection of at least one bacterial strain of Legionella pneumophila resistant to antibiotics, especially of the fluoroquinolone type, in a biological sample, in which method the mutated GyrA protein is such that:

the amino acid at position 83 is different from T and the amino acids at positions 84 and 87 can correspond to any amino acid, or

said amino acid at position 84 is different from A, and the amino acids at positions 83 and 87 may correspond to any amino acid, or

said amino acid at position 87 is different from D, and the amino acids at positions 83 and 84 may correspond to any amino acid.

The expression "amino acids at positions 84 and 87 (or 83 and 87) or (83 and 84) may correspond to any amino acid" means that said amino acids may be both the amino acid present in a wild strain than any other amino acid. In the latter case, the amino acid considered therefore constitutes a mutation. A bacterial strain of L. pneumophila according to the invention having a mutated GyrA protein, can therefore contain a single mutation, a double mutation or a triple mutation.

The strains comprising a single mutation are thus mutated in position 83 or in position 84 or in position 87. Strains comprising a double mutation are therefore mutated either at positions 83 and 84, or at positions 84 and 87, or at position 83 and 87. The strains comprising a triple mutation, are therefore mutated jointly on the three positions 83; 84 and 87.

According to another embodiment of the invention, the in vitro method making it possible to demonstrate at least one bacterial strain of Legionella pneumophila resistant to antibiotics, in particular of the fluoroquinolone type, applies when the mutated GyrA protein is such that :

said amino acid at position 83 is: I, L, W, A or V and the amino acids at positions 84 and 87 may correspond to any amino acid, or - said amino acid at position 84 is: P or V and the amino acids at positions 83 and 87 can correspond to any amino acid, or

said amino acid at position 87 is: N, G, Y, H or V and the amino acids at positions 83 and 84 may correspond to any amino acid, or

said amino acid at position 83 is: I, L, W, A or V, said amino acid at position 84 is: P or V, and said amino acid at position 87 is any amino acid, or

said amino acid at position 83 is: I, L, W, A or V, said amino acid at position 87 is: N, G, Y, H or V and said amino acid at position 84 is any amino acid , or said amino acid at position 84 is: P and V, said amino acid at position 87 is: N, G, Y, H or V and said amino acid at position 83 is any amino acid, or

said amino acid at position 83 is: I, L, W, A or V, said amino acid at position 84 is: P or V and said amino acid at position 87 is: N, G, Y, H or V. When the amino acid at position 83 is mutated, the amino acids at position 84 and 87 can be the amino acids of the wild-type protein, A (alanine) and D (aspartic acid), respectively, or any other amino acid, that is, the amino acids at position 84 and 87 can also be mutated.

When the amino acid at position 84 is mutated, the amino acids at position 83 and 87 may be the amino acids of the wild-type protein, respectively T (threonine) and D (aspartic acid) or any other amino acid, that is, the amino acids at position 83 and 87 can also be mutated.

When the amino acid at position 87 is mutated, the amino acids at position 83 and 84 may be the amino acids of the wild-type protein, respectively T (Threonine) and A (Alanine) or any other amino acid, c that is, the amino acids at position 83 and 84 can also be mutated.

According to another advantageous embodiment of the invention, said in vitro method making it possible to demonstrate at least one bacterial strain of Legionella pneumophila resistant to antibiotics, in particular of the fluoroquinolone type, applies when the mutated GyrA protein is such than :

said amino acid at position 83 is: an isoleucine (I), a leucine (L), a tryptophan (W), an alanine (A) or a valine (V), said amino acid at position 84 is an alanine (A ) and said amino acid at position 87 is an aspartic acid (D), or said amino acid at position 84 is: proline (P) or valine (V) and said amino acid at position 83 is threonine (T) and said amino acid at position 87 is an aspartic acid (D), or

said amino acid at position 87 is: asparagine (N), glycine (G), tyrosine (Y), histidine (H) or valine (V) and said amino acid at position 83 is threonine (T) ) and said amino acid at position 84 is an alanine (A), or

said amino acid at position 83 is: isoleucine (I), leucine (L), tryptophan (W), alanine (A) or valine (V), said amino acid at position 84 is: proline ( P) or valine (V) and said amino acid at position 87 is an aspartic acid (D), or

said amino acid at position 83 is: an isoleucine (I), a leucine (L), a tryptophan (W), an alanine (A) or a valine (V), said amino acid in position 87 is: an asparagine ( N), a glycine (G), a tyrosine (Y), a histidine (H) or a valine (V) and said amino acid at position 84 is an alanine (A), or

said amino acid at position 84 is: proline (P) or valine (V), said amino acid at position 87 is: asparagine (N), glycine (G), tyrosine (Y), histidine ( H) or a valine (V) and said amino acid at position 83 is a threonine (T). The table below shows the set of possible mutations in amino acids, on each of the three positions 83, 84 and 87 and the corresponding codons.

Amino acid Amino acid Amino acid at position 83 at position 84 at position 87

I ATT P CCT N AAT

ATC CCC AAC

ATA CCA G GGT

CCG GGC CTT

CTC V GTT GGA

CTA GTC GGG

CTG GTA Y TAT

TTG GTG TAC Amino acid Amino acid Amino acid at position 83 at position 84 at position 87

TTA H CAT

W TGG CAC

A GCT V GTT

GCC GTC

GCA GTA

GCG GTG

V GTT

GTC

GTA

GTG

The method according to the invention allows the detection of a mutated GyrA protein which comprises the following consensus sequence: GDX _! X ₂ VYX ₃ T (SEQ ID NO: 2) wherein: X _ls X ₂ and X ₃ correspond to mutated amino acids in positions 83, 84 and 87, and

- Xi is different from T (threonine), and X ₂ and X ₃ are any amino acid, or

X ₂ is different from A (alanine), and X 1 and X 3 are any amino acid, or

- X3 is different from D (aspartic acid), and Xi and X ₂ are any amino acid.

According to a particular embodiment of the present invention, in the mutated GyrA protein, the amino acid corresponding to Xi, different from T can be an isoleucine (I), a leucine (L), a tryptophan (W), an alanine (A) or a valine (V), and X ₂ and X ₃ correspond to any amino acid, or

the amino acid corresponding to X ₂ is a proline (P) or a valine (V), and X ₁ and X ₃ correspond to any amino acid, or the amino acid corresponding to X ₃ is an asparagine (N), a glycine (G), a tyrosine (Y), a histidine (H) or a valine (V), and X ₁ and X ₂ correspond to any which amino acid, or

the amino acid corresponding to Xi, different from T, is an isoleucine (I), a leucine (L), a tryptophan (W), an alanine (A) or a valine (V), X ₂ is a proline ( P) or a valine (V) and X ₃ is any amino acid, or

the amino acid corresponding to Xi, different from T, is an isoleucine (I), a leucine (L), a tryptophan (W), an alanine (A) or a valine (V), X ₃ is an asparagine ( N), a glycine (G), a tyrosine (Y), a histidine (H) or a valine (V) and X ₂ is any amino acid, or

the amino acid corresponding to X ₂ is a proline (P) or a valine (V), X ₃ is an asparagine (N), a glycine (G), a tyrosine (Y), a histidine (H) or a valine (V) and Xi is any amino acid, or

the amino acid corresponding to Xi, different from T, is an isoleucine (I), a leucine (L), a tryptophan (W), an alanine (A) or a valine (V), X ₂ is a proline ( P) or valine (V) and X ₃ is asparagine (N), glycine (G), tyrosine (Y), histidine (H) or valine (V).

According to a particular embodiment of the present invention, the method of the invention allows the detection of a mutated GyrA protein which comprises the consensus sequence GDXiX ₂ VYX ₃ T in which:

- Xi is I, L, W, A or V, X ₂ is A and X ₃ is D, or

X ₂ is P or V, Xi is T and X ₃ is D, or

X ₃ is N, G, Y, H or V, Xi is T and X ₂ is A, or

- Xi is I, L, W, A or V, X ₂ is P or V and X ₃ is D, or

- Xi is I, L, W, A or V, X ₃ is N, G, Y, H or V and X ₂ is A, or X ₂ is P or V, X ₃ is N, G, Y, H or V and Xi is T, or

- Xi is I, L, W, A or V, X ₂ is P or V and X ₃ is N, G, Y, H or V.

According to a particular embodiment of the present invention, the method allows the detection of the sequence of the gene encoding said mutated GyrA protein. This sequence has at least one nucleotide substitution with respect to SEQ ID NO: 3 (GGGGATACAGCTGTTTATGACAC), in position equivalent to position 7, 8, 10, 11, 19, 20 or 21 with respect to SEQ ID NO : 3, where the nucleotides at positions 7 and 8 correspond to the first two nucleotides of the codon encoding the amino acid at position 83 of the GyrA protein of Legionella pneumophila, the nucleotides at positions 10 and 11 correspond to the first two nucleotides of the codon encoding the amino acid at position 84, and the nucleotides at positions 19, 20 and 21 correspond to the three nucleotides of the codon encoding the amino acid at position 87.

According to another embodiment of the present invention, the sequence of the nucleic acid encoding said mutated GyrA protein comprises a sequence chosen from:

SEQ ID NO: 4 (GGGGATTCAGCTGTTTATGACAC),

SEQ ID NO: 5 (GGGGATCCAGCTGTTTATGACAC),

SEQ ID NO: 6 (GGGGATGCAGCTGTTTATGACAC),

SEQ ID NO: 7 (GGGGATAAAGCTGTTTATGACAC),

SEQ ID NO: 8 (GGGGATATAGCTGTTTATGACAC),

SEQ ID NO: 9 (GGGGATAGAGCTGTTTATGACAC),

SEQ ID NO: 10 (GGGGATACAACTGTTTATGACAC),

SEQ ID NO: 11 (GGGGATACATCTGTTTATGACAC), SEQ ID NO: 12 (GGGGAT AC AC CTGTTT ATG AC AC),

SEQ ID NO: 14 (GGGGATACAGATGTTTATGACAC),

SEQ ID NO: 15 (GGGGATACAGTTGTTTATGACAC),

SEQ ID NO: 16 (GGGGATACAGGTGTTTATGACAC),

SEQ ID NO: 17 (GGGGATACAGCTGTTTATAACAC),

SEQ ID NO: 18 (GGGGATACAGCTGTTTATTACAC),

SEQ ID NO: 19 (GGGGATACAGCTGTTTATCACAC),

SEQ ID NO: 20 (GGGGATACAGCTGTTTATGTCAC),

SEQ ID NO: 21 (GGGGATACAGCTGTTTATGGCAC),

SEQ ID NO: 22 (GGGGATACAGCTGTTTATGCCAC),

SEQ ID NO: 23 (GGGGATACAGCTGTTTATGAGAC),

SEQ ID NO: 24 (GGGGATACAGCTGTTTATGAAAC),

SEQ ID NO: 25 (GGGGATTTAGCTGTTTATGACAC),

SEQ ID NO: 26 (GGGGATTTGGCTGTTTATGACAC),

SEQ ID NO: 27 (GGGGATCTTGCTGTTTATGACAC),

SEQ ID NO: 28 (GGGGATCTCGCTGTTTATGACAC),

SEQ ID NO: 29 (GGGGATCTAGCTGTTTATGACAC),

SEQ ID NO: 30 (GGGGATCTGGCTGTTTATGACAC), SEQ ID NO: 31 (GGGGATTGGGCTGTTTATGACAC),

SEQ ID NO: 32 (GGGGATGCTGCTGTTTATGACAC),

SEQ ID NO: 33 (GGGGATGCCGCTGTTTATGACAC),

SEQ ID NO: 34 (GGGGATGCGGCTGTTTATGACAC),

SEQ ID NO: 35 (GGGGATGTTGCTGTTTATGACAC),

SEQ ID NO: 36 (GGGGATGTCGCTGTTTATGACAC),

SEQ ID NO: 37 (GGGGATGTAGCTGTTTATGACAC),

SEQ ID NO: 38 (GGGGATGTGGCTGTTTATGACAC),

SEQ ID NO: 39 (GGGGATACACCCGTTTATGACAC),

SEQ ID NO: 40 (GGGGATACACCAGTTTATGACAC),

SEQ ID NO: 41 (GGGGATACACCGGTTTATGACAC),

SEQ ID NO: 42 (GGGGATACAGTCGTTTATGACAC),

SEQ ID NO: 43 (GGGGATACAGTAGTTTATGACAC),

SEQ ID NO: 44 (GGGGATACAGTGGTTTATGACAC),

SEQ ID NO: 45 (GGGGATACAGCTGTTTATAATAC),

SEQ ID NO: 46 (GGGGATACAGCTGTTTATGGTAC),

SEQ ID NO: 47 (GGGGATACAGCTGTTTATGGAAC),

SEQ ID NO: 48 (GGGGATACAGCTGTTTATGGGAC), SEQ ID NO: 49 (GGGGAT AC AGCTGTTT ATT AT AC),

SEQ ID NO: 50 (GGGGATACAGCTGTTTATCATAC),

SEQ ID NO: 51 (GGGGATACAGCTGTTTATGTTAC),

SEQ ID NO: 52 (GGGGATACAGCTGTTTATGTAAC),

SEQ ID NO: 53 (GGGGATACAGCTGTTTATGTGAC),

SEQ ID NO: 54 (GGGGATTTCGCTGTTTATGACAC),

SEQ ID NO: 55 (GGGGATATTGCTGTTTATGACAC),

SEQ ID NO: 56 (GGGGAT ATC GCTGTTT ATG AC AC),

SEQ ID NO: 61 (GGGGATTTTGCTGTTTATGACAC),

In the context of the present invention, the detection of the presence of said mutated GyrA protein or of the target nucleic acid encoding said mutated GyrA protein, including the detection of the mRNA encoded by the mutated gene, is carried out by a chosen technique. Among: western blot, northern blot, southern blot, PCR (Polymerase Chain Reaction), real-time PCR, PCR hybridization, PCR array, TMA (Transcription-Mediated Amplification), NASBA (Nucleic Acid) Sequence Based Amplification), LCR (Ligase Chain Reaction), DNA / RNA hybridization, DNA chip, DNA / RNA sequencing, dot-blot, RFLP (Restriction Fragment Length Polymorphism).

In an advantageous embodiment, the detection of the presence of said nucleic acid encoding said mutated GyrA protein is performed by real-time PCR.

Real-time PCR uses the basic principle of classical PCR (cyclic amplification of a DNA fragment, based on an enzymological reaction) with the aim of difference an amplification measured not in final but throughout the reaction, so in real time.

At each amplification cycle, the amount of DNA is measured by means of a fluorescent marker whose emission is directly proportional to the quantity of amplicons produced. This makes it possible to obtain a kinetics of the reaction and thus the quantification of the DNA whereas the conventional PCR only gives the final measurement.

The detection or quantification of the fluorescent signal in real time can be done using intercalators or probes.

The intercalant agent currently used most is SYBR® Green (Roche, Meylan, France).

With regard to probes, there are 4 different technologies, allowing the measurement of a fluorescent signal: "Taqman" or hydrolysis of probes, "HybProbes" (FRET) or hybridization of 2 probes, "Molecular Beacons" or molecular beacons. "Scorpion" or scorpion primers.

In the context of the invention, the real-time PCR is used for the detection of mutations gyrA83, 84 and / or 87, for example using two probes in tandem: a so-called anchoring probe and a so-called detection probe . In the context of the present invention, the fluorophore located on the anchoring probe is for example LCRed-640 (Roche Diagnostic), and the fluorophore located on the emission probe is for example fluorescein.

The binding of these two probes to the target DNA first leads to the excitation of the fluorophore located on the anchoring probe, then a FRET phenomenon "fluorescence resonance energy transfer" is realized, between this fluorophore and fluorescein located on the detection probe. The fluorescein then emits a fluorescence measured in real time by the apparatus, and whose intensity is proportional to the amount of amplified DNA. A melting curve, established at the end of amplification, makes it possible to determine a melting temperature characteristic of the size and the base content of the amplicon (amplified DNA).

A mutation affecting this fragment causes a downward shift of the melting temperature. The fragment tested here is delimited from the base 241 to the base 263 of gyrA of the strain L. pneumophila Paris [GGGGATACAGCTGTTTATGACAC], or from amino acid 81 to amino acid 88 of GyrA of said strain [GDTAVYDT]. It therefore includes T83, A84 and D87, which are related to fluoroquinolone resistance in L. pneumophila.

This technique shows a change in the melting temperature in case of alteration of this DNA fragment, whatever the mutation and its position. Due to natural variations of L. pneumophila in the nucleotide sequence, which can lead to other mutations, the results obtained by the method according to the invention can be confirmed by a complementary technique such as, for example, the sequencing of the amplified DNA.

However, it is easy to envisage, from the state of the art, other techniques making it possible to overcome the variations of DNA sequences at the level of the anchoring probe and / or to specifically target the mutations of unnecessary interest of a complementary step.

For example, the use of a hydrolysis probe or "Taqman", "beacon" or "scorpion" type probe could target the same region of gyrA where mutations responsible for substitutions in positions 83, 84 and 87, without the use of an anchoring probe. Examples of this type of technique are presented in the literature concerning the detection of fluoroquinolone resistance in Mycobacterium tuberculosis (Chakravorty S. et al., J Clin Microbiol. 2011; 49 (3): 932-40) or in Staphylococcus aureus (Lapierre P. et al., J Clin Microbiol 2003; 41 (7): 3246-51).

It is also possible to specifically detect mutations expected on specific nucleotides by other techniques so as to eliminate the false positive results related to mutations unrelated to antibiotic resistance. This can be achieved in particular by the use of multiple probes, "in tandem" (Page S. et al., Antimicrob Agents Chemother., 2008; 52 (11): 4155-8 and Glocker E. et al, J. Clin Microbiol., 2004; 42 (5): 2241-6), hydrolyzed or "Taqman") (Ben Shabat M. et al., J. Clin Microbiol., 2010; 48 (8): 2909-15 and Wilson DL et al., J. Clin Microbiol., 2000; 38 (11): 3971-8), such as "locked probes" or "locked nucleic acid probes" (van Doorn HR, et al., Int., Tuberc. Lung Dis., 2008; 12 (7): 736-42). The PCR hybridization technique (Cambau E. et al., PLoS Negl Trop, Dis 2012, 6 (7): 1739) or the use of DNA microarrays (Matsuoka M. et al., J. Med. Microbiol 2008; 57: 1213-1219) also allow the specific detection of resistance mutations. These different techniques make it possible to detect single nucleotide polymorphisms (SNPs) at the level of specific DNA fragments, and thus make it possible to detect, in a targeted manner, the mutations responsible for fluoroquinolone resistance in L. pneumophila. Some of these techniques are already commercially available, for example the Xpert TB / RIF® test (Cepheid), which detects resistance to rifampicin in Mycobacterium tuberculosis using a "Phare" probe.

The method for detecting the presence of the target nucleic acid encoding said mutated GyrA protein according to the invention comprising the steps of:

a) bringing into contact a biological sample that may contain a target nucleic acid belonging to a bacterial strain of Legionella pneumophila antibiotic-resistant, with a pair of primers capable of hybridizing specifically with said target nucleic acid, and

b) when there is PCR amplification of said target nucleic acid using the pair of primers to obtain an amplification product, said amplification product comprising a sequence having at least 90% identity with the sequence SEQ ID NO: 3,

c) detecting a nucleic acid encoding the mutated GyrA protein,

When a nucleic acid encoding said mutated GyrA protein is detected, this indicates the presence of at least one bacterial strain Legionella pneumophila resistant to antibiotics in the sample.

According to the method of the present invention, the amplification product obtained in step b) is an amplicon of 259 nucleotides. This 259 nucleotide amplicon corresponds to SEQ ID NO: 57 or to any sequence having an identity percentage equal to at least 90% with the sequence SEQ ID NO: 57.

By "amplicon" is meant any amplified DNA fragment by PCR, using two primers.

In a particular embodiment of the invention, step b) of said method for detecting a target nucleic acid encoding said mutated GyrA protein, is carried out using a primer having at least 90% identity with the sequence SEQ ID NO: 58, and / or a primer having at least 90% identity with the sequence SEQ ID NO: 59.

By "primer" is meant a DNA fragment whose size is generally from 15 nucleotides to 25 nucleotides, capable of hybridizing to a strand of DNA as a template, at a given melting temperature, so as to allow the duplication of this strand of DNA. The primers used in the method according to the invention are represented by the sequences SEQ ID NO: 58 (sense primer, named LpgyrALSFw and corresponding to the following nucleic acid sequence: CCTGATGTACGTGATGGTTTAA) and SEQ ID NO: 59 (anti-virus primer). sense, named LpgyrALSRv and corresponding to the following nucleic acid sequence: GCATGGCAGCTGGAGCATCTCC), or any other nucleic acid sequence having at least 90% identity with said sequences SEQ ID NO: 58 and SEQ ID NO: 59.

In addition, step b) of said method for detecting a target nucleic acid encoding said mutated GyrA protein can be carried out using at least one nucleotide probe capable of hybridizing with the target nucleic acid. .

In another particular embodiment of the invention, the detection method requires the use of probes.

In the real-time PCR system developed by the inventors, a so-called detection probe and an anchoring probe are necessary.

The detection probe that can be used in the context of the present invention is a nucleic acid sequence represented by the sequence SEQ ID NO: 3 or by any other nucleotide sequence having at least 90% identity with the sequence SEQ ID. NO: 3 (named LpgyrALSPl). This detection probe is covalently linked to at least one marker molecule allowing its detection by a suitable device.

The marker molecule is selected from a fluorochrome or a radioactive isotope. A fluorochrome is a chemical substance capable of emitting fluorescent light after excitation. A fluorochrome useful in the context of the invention may be chosen from: fluorescein, Cy2, Cy3, Cy5, Cy7, Red613, Red640, Rhodamine, Texas Red, TRITC, Alexa Fluor, this list not being exhaustive. Preferably, the fluorochrome related to the detection probe in the context of the invention is fluorescein attached to 3 'of said probe.

The detection method according to the invention may also comprise an anchoring probe, which coupled to the detection probe allows the detection of the amplification product obtained in step b). The anchoring probe according to the invention is a nucleic acid sequence represented by the sequence SEQ ID NO: 60 (called LpgyrALSP3) or by any other nucleotide sequence having at least 90% identity with the sequence SEQ ID NO: 60.

This anchoring probe is covalently bonded to at least one marker molecule allowing its detection by a suitable device. In the context of the present invention, the 5 'end of the anchoring probe is bonded to an acceptor fluorochrome. The acceptor fluorochrome may be selected from fluorescein, Cy2, Cy3, Cy5, Cy7, Red613, Red640, Rhodamine, Red Texas, TRITC, Alexa Fluor, this list not being exhaustive. More particularly, the acceptor fluorochrome may be LightCycler® Red 640 (Roche Diagnostic).

The anchoring probe has at its 3 'end, a phosphorylation denoted "P", preventing its elongation by the DNA polymerase. . The anchoring probe is therefore in the form 5 '-LCRed640-TTGTTCGTATGGCTCAGCCTTTTTC-P-3'

The detection probe must be close to the anchor probe so that the transmission of the fluorescence signal can take place. Indeed, when the two probes are separated, the donor fluorochrome located on the detection probe emits only fluorescence background noise whereas when they are hybridized to less than 10 nucleotides of distances (= distance in nucleotides between the detection probe and the anchoring probe), the proximity of the two fluorochromes allows the transfer of the energy of the fluorochrome donor to the acceptor fiuorochrome causing the fluorescent emission of the latter (FRET: Fluorescent Resonance Energy Transfer)

According to a particular embodiment of the invention, a melting curve of the amplification product is generated after step c).

The present invention also aims at protecting a pair of primers allowing the amplification of a fragment of the Legionella pneumophila gyrA gene, comprising a primer having at least 90% identity with the sequence SEQ ID NO: 58 (LpgyrALSFw), and a primer having at least 90% identity with the sequence SEQ ID NO: 59 (LpgyrALSRv).

These pairs of primers make it possible to amplify a fragment comprising 259 nucleotides. The method according to the invention and especially the step of amplification of a fragment of the gyrA gene can be carried out with a sense primer corresponding to the sequence SEQ ID NO: 58 and an antisense primer chosen from all the sequences of nucleic acids having at least 90% identity with the sequence SEQ ID NO: 59 or with a sense primer corresponding to one of the sequences selected from the group comprising all the nucleic acid sequences having at least 90% identity with the sequence SEQ ID NO: 58 and an antisense primer corresponding to the sequence SEQ ID NO: 59 or with a sense primer corresponding to one of the sequences chosen from the group comprising all the nucleic acid sequences having at least 90 %> identity with the sequence SEQ ID NO: 58 and an antisense primer corresponding to one of the sequences selected from the group comprising all the nucleic acid sequences presenting a at least 90% identity with the sequence SEQ ID NO: 59.

The present invention also aims at protecting a kit of reagents allowing the detection of bacterial strains Legionella pneumophila resistant to antibiotics, in particular of the fluoroquinolone type, comprising at least one pair of primers allowing the amplification of the fragment of interest, namely the amplicon of 259 nucleotides corresponding to the sequence SEQ ID NO: 59 and at least one probe chosen from those represented by the sequences SEQ ID NO: 3 and SEQ ID NO: 60, which are the detection and anchoring probes.

The detection method according to the invention may be used for the diagnosis of an infection with antibiotic-resistant bacteria Legionella pneumophila, including fluoroquinolone type, in a patient.

For this, from a sample of a patient likely to present strains of L. pneumophila resistant to antibiotics, the method of detection of gyrA gene mutated by real-time PCR is implemented. Such a sample may in particular be a collection of secretions from the respiratory tract, but also blood, serum, plasma, urine, tissue biopsies (examples: pulmonary or pleural biopsies), various puncture fluids (examples: cerebrospinal fluid, articular fluid, pleural fluid) and various suppurations (eg pulmonary abscess)

The detection method according to the invention may be used for determining or predicting the efficacy of a fluoroquinolone treatment in a patient infected with the bacterium Legionella pneumophila.

Indeed, in view of any therapeutic failure in patients with legionellosis, the detection method according to the invention may be implemented to ensure that the patient does not exhibit resistance to fluoroquolone antibiotics, so as to modify the treatment plan if applicable.

LEGENDS OF FIGURES Figure 1:

FIG. 1 represents the melting curves obtained for a fluoroqumolone-sensitive L. pneumophila Paris strain (melting temperature of 59 ° C.), for a mutant gyrA83 (mp 56.6 ° C) and for a double mutant gyrA83 + gyrA87 (melt temperature 50 ° C).

Figure 2:

Figure 2 shows the real-time PCR amplifications of the gyrA gene in different Legionella species. The bacterial inoculum tested for each species is standardized beforehand.

Figure 3:

Figure 3 shows the melting peaks obtained for four strains of L. pneumophila and three other species of Legionella.

Figure 4:

Figure 4 shows the melting peaks obtained for 2 strains of L. pneumophila Paris and 21 strains belonging to other species of Legionella.

Figure 5:

Figure 5 shows the LP-gyrA RT-PCR melting curves showing a melting temperature (Tm) of 59 ° C for L. pneumophila Paris, and for most respiratory samples from patients with legionellosis. Samples 1-2 and 2-2 instead show a decrease of about 4-5 ° C in the Tm suggesting a mutation of the gyrA gene.

Figure 6:

FIG. 6 represents the sequencing results of the gyrA gene for the L. pneumophila Paris strain sensitive to fluoroquinolones, and for the respiratory samples taken in patients 1 and 2, ie before treatment with fluoroquinolones (1-1 and 2- 1) or at different times during treatment with these antibiotics (1-2, 2-2, 2-3, and 2-4). EXAMPLES

Example 1: Amplification of the GGGGATACAGCTGTTTATGACAC fragment of the gyrA gene (ID: 3119437) of the L. pneumophila strain PARIS (Genbank NC 006368.1, SEQ ID NO: 13), a fragment encoding the amino acids bound to fluoroquinolone resistance.

The primers described below make it possible to amplify and detect a fragment of the L. pneumophila gyrA gene (gyrA gene: SEQ ID NO: 1).

Primer meaning 'LpgyrALSFw': 5 '-CCTGATGTACGTGATGGTTTAA-3'

(SEQ ID NO: 58)

"LpgyrALSRv" antisense primer: 5 '-GCATGGCAGCTGGAGCATCTCC-3'

(SEQ ID NO: 59)

"LpgyrALSPl" detection probe: 5 '-GGGGATACAGCTGTTTATGACAC-Fluo-3' (SEQ ID NO: 3)

"LpgyrALSP3" anchor probe: 5'-LCRed640-

TTGTTCGTATGGCTCAGCCTTTTTC-P-3 '(SEQ ID NO: 60)

The detection method is based on a real-time PCR, using FRET technology (Fluorescence Resonance Energy Transfer). In this system, two probes are used, one of which carries 3 'of a transmitting fluorochrome and the other 5' of an acceptor fluorochrome. The probes are selected to hybridize to their target sequences spaced from each other by 1 to 5 nucleotides. When the two probes are separated, the donor fluorochrome emits only fluorescence background noise whereas when they are hybridized to less than 10 nucleotides apart, the proximity of the two fluorochromes allows the transfer of the energy of the fluorochrome donor to the fluorocarbon acceptor causing the fluorescent emission of the latter (FRET: Fluorescent Resonance Energy Transfer). The fluorescence acquisition is then measured, proportional to the amount of DNA synthesized, at the time of hybridization. The anchor probe contains LCRed-640 fluorophore (Sigma Aldrich, L'Isle dAbeau

Chesnes 38297 Saint-Quentin Fallavier, France) in 5 minutes. The detection probe contains fluorescein 3 '. Fluorescence emission is detected in real time by the amplification apparatus. A melting curve is established at the end of amplification and makes it possible to determine a melting temperature characteristic of the size and the base content of the amplicon. A mutation affecting this fragment causes a downward shift of the melting temperature. The fragment tested here goes from the nucleotide located at position 241 to the nucleotide located at position 263 of L. pneumophila gyrA Paris.

[GGGGATACAGCTGTTTATGACAC], from amino acid 81 to amino acid 88 of GyrA from L. pneumophila Paris [GDTAVYDT]. It therefore includes positions T83, A84 and

D87, which are related to fluoroquinolone resistance in L. pneumophila.

The primers used make it possible to obtain an amplicon of 259 bp (SEQ ID No. 57).

The amplification is carried out under the conditions below, on a Light-Cycler type device (Roche Diagnostics, Meylan, France).

M IX (Oncenlralion Volume for a Concentration

init ial the final CK

detection

Probe 2p \ lol l 0.4ρ ο! / Μ (...

anchor

DNA extract

Final volume 20 iiL Program Temperature Duration Number of Acquisition Modes Cycles

UDG Ambient 5min 1 None

. II II II II II

Denaturation 95 ° C 10min 1

initial

Disinfection 95 ('10sec None

l l> ri (i (ion 55 (1 Single Oscc

Klongation 72 1 5 sec

Melting curve

Cooling 40 C 30sec 1

The results are given in FIG. 1. The single mutant gyrA 83 has a melting temperature of 56.6 ° C., the double mutant gyrA $ 3 + gyrA% 7 has a melting temperature of 50 ° C., whereas the unmutated Paris strain has a melting temperature of 59 ° C.

Example 2 Evaluation of the Sensitivity and Specificity of the RT-PCR LP-gyrA Test

The sensitivity and specificity of the LP-gyrA RT-PCR assay was evaluated on a large number of strains.

- On a collection of L. pneumophila strains sensitive to fluoroquinolones;

Fluoroquinolone-resistant mutants previously selected in vitro and having one or more mutations gyrA83 and gyrA87; Species Strain

Legionella pneumophila 1 LPP11 CIP107629T + mutation gyrA83 (T83I)

CIP107629T + mutations gyrA83 (T83I) and

Legionella pneumophila 1 LPPI4

gyrA87 (D87N)

CIP107629T + mutations gyrA83 (T83I) and

Legionella pneumophila 1 LPPI5

gyrA87 * (D87H)

On a collection of strains belonging to different species of Legionella other than L. pneumophila;

Species Strain

Legionella Parisiensis ATCC 35299

Legionella Parisiensis ATCC 700174

Legionella longbeachae ATCC 33462

Legionella longbeachae ATCC 33485

Legionella bozemanii ATCC 33217

Legionella bozemanii ATCC 35545

Legionella jordanis ATCC 700762

Legionella jordanis ATCC 33624

Legionella tucsonensis ATCC 4918

Legionella gormanii ATCC 33297

Legionella maceachernii ATCC 35300

Legionella anisa ATCC 35290

Legionella lansingensis ATCC 49751

Legionella dumoffi ATCC 35280

Legionella oakridgensis ATCC 33761

Legionella oakridgensis ATCC 700515

Legionella wadsworthii ATCC 33877 Species Strain

Legionella mackelia ATCC E1 3525

Legionella birmingham ATCC 700709

Legionella hackeliae ATCC 35999

Legionella birmingham ATCC 73702

Legionella micdadei ATCC 33218

Legionella donaldsonii ATCC LC878

Legionella feeleii sg1 ATCC 35072

Legionella feeleii sg2 ATCC 35849

Legionella feeleii ATCC 700514

On a collection of bacterial clinical strains not belonging to the genus Legionella, and potentially responsible for respiratory tract infections in humans

Species Strain

Staphylococcus aureus ATCC 12598

Staphylococcus aureus ATCC 29737

Staphylococcus epidermidis ATCC 14990

Enterococcus faecium CIP 54.32

Corynebacterium jeikeium CIP 82.51

Streptococcus pyogenes ATCC 19615

Streptococcus mitis ATCC 49456

Streptococcus pneumoniae ATCC 6303

Streptococcus pneumoniae ATCC 49619

Bacillus subtilis ATCC 6633

Escherichia coli ATCC 25922

Escherichia coli ATCC 35218

Serratia marcescens CIP 103551 Species Strain

Citrobacter koseri ATCC 27156

Klebsiella pneumoniae ATCC 23357

Pseudomonas aeruginosa CIP 5933

Acinetobacter baumanii ATCC 19606

Figure 2 shows that the test sensitively and specifically detects the targeted fragment of the L. pneumophila gyrA gene. The defined primers preferentially amplify the L. pneumophila gyrA fragment. However, for a number of amplification cycles greater than or equal to 35, an amplification signal may be observed for other species of this kind.

Nevertheless, Figure 3 shows that the test allows, on the basis of the melting curves, to distinguish between L. pneumophila strains (Paris, Philadelphia, Lorraine and Lens strains) and the strains of three other Legionella species. In addition, the fusion temperatures of Legionella strains belonging to non-pneumophila species are higher than those obtained for L. pneumophila.

Similarly, Figure 4 shows that 21 strains of Legionella belonging to species other than L. pneumophila have higher melting temperatures than that of L. pneumophila strain Paris, with the exception of strains of species L longbeachea which have a melting peak around 50 ° C. Nevertheless, they can not be confused with the melting curves of the gyrA mutants because of their profile in triple melting peaks (50 ° C, 60 ° C, 65 ° C).

The analytical sensitivity of the RT-PCR-LPgyrA test was tested on a series of 10 dilutions of DNA of L. pneumophila Paris, from a bacterial inoculum of 8.6 × 10 ⁷ bacteria. Table 1 shows the results of this analysis. A suspension containing 9 copies of genomes / assay allows reproducible amplification. if: C - S i ylîÇ GP iiiiitiiiiii

Ξ 1 Bianc gyrA; Tiéeatif control

\\ 2 DNA gyrA strain Paris Standard 1 .27 8.60E7 9.30E7

i E2 3 DNA gyrA 10-1 Standard 15.25 1.07E7 9.30E6

\ E3 i 4 DNA gyrA 10-2 Standard 20.04 8.72E5 9.30E5

DNA gyrA 10-3 Standard 24.08 9.53E 9.30E4 j

E 6 DNA gyra 0-4 Standard 1.02E4 9.3QE3 j

E3 7 gyrA 10-5 DNA; Standard 31.49 9.74E2 9.30E2

i ES i S DNA gyrA 10-6 Standard 34.S7 9.67E1 9.30E1

E 9 DNA gyrA 10-7 Standard 38.19 8.73EQ 9.3OE0 i E3 i 10 DNA gyrA 10-8 Standard 9.30E-1

ΕΞ i 1 DNA gyrA 10-9 Standard 9.30E-2 d

Table 1: Amplification of the L. pneumophila Paris gyrA gene from a series of dilutions of a bacterial inoculum of 8.6 × 10 ⁷ bacteria (per test). Example 3 Evaluation of the Relevance of the LP-gyrA RT-PCR Test on Airway Samples of Patients With Legionellosis Due to L. pneumophila

Based on the sputum analysis of 82 legionellosis patients, the presence of resistant L. pneumophila gyrA83 was detected. Figure 5 shows the melting curves obtained on the basis of samples from patients with legionellosis. For two patients (1 and 2), the melting curves (1-2 and 2-2) obtained from clinical samples collected after implementation of the antibiotic treatment with a fluoroquinolone, show a melting peak of about 55 ° vs. This lower peak than that of the control L. pneumopihla wild Paris (non-mutated) evokes the presence of at least one mutation in the QRDR of gyrA in the strain of L. pneumophila infecting each of these patients.

In order to confirm the results obtained for these two patients, the QRDR of the gyrA gene of the infectious L. pneumophila strain was amplified and sequenced directly from a clinical specimen because of the impossibility of isolating this strain. culture. Two DNA sequencing methods were used: the classical Sanger method and a high-throughput sequencing method to measure the percentage of mutants relative to the non-mutated population in the clinical sample of each of the two patients. .

In the patient 1, the sequence 1-1 obtained from a clinical specimen collected before treatment with a fluoroquinolone, has no mutation compared to the Paris strain. After treatment with a fluoroquinolone, there is a mixture of DNA sequences (ACA / ATC, Y = CouT) (sequence 1-2), which shows the simultaneous presence of sensitive bacteria and fluoroquinolone-resistant bacteria by substitution Thr83Ile in position 83 of the GyrA protein.

For patient 2, the DNA sequence before treatment with fluoroquinolone (sequence 2-1) is wild-type (non-mutated). In this patient, a strain of L. pneumophila could be isolated in culture from this same clinical specimen. The fact that this strain was well sensitive to fluoroquinolones was confirmed, in terms of pheno typical (antibiogram) and because of the absence of gyrA mutation after amplification and sequencing of this gene from the strain. On the other hand, at different times of treatment with a fluoroquinolone in this patient 2, it has been demonstrated on three successive samples the appearance of a mutated gyrA sequence (ATA instead of ACA) (sequences 2- 2, 2- 3, 2-4) resulting in the same Thr83Ile substitution responsible for resistance to fluoroquinolones in L. pneumophila.

High throughput sequencing data confirmed in vivo selection of L. pneumophila gyrA83 mutants in both patients during fluoroquinolone treatment. Figure 7 shows for patient 2 a progressive increase in the percentage of mutants compared to the non-mutated population, i.e. progressive replacement of a population of fluoroquinolone-sensitive L. pneumophila by a population that is predominantly resistant to these antibiotics.

All these data confirm the possibility of selecting fluoroquinolone-resistant strains of L. pneumophila in patients infected with this pathogen and treated with one of these antibiotics. They also validate the relevance of the RT-PCR LP-gyrA test, developed to detect these resistances from an isolated strain or directly from clinical samples.

Claims

In vitro method for the detection of at least one bacterial strain of Legionella pneumophila resistant to antibiotics, especially of the fluoroquinolone type, from an isolate obtained in culture or directly in a biological sample, by detecting:

a nucleic acid encoding said mutated GyrA protein, detecting said mutation or nucleic acid encoding said mutated GyrA protein indicating the presence of at least one bacterial strain Legionella pneumophila resistant to antibiotics, in the sample.

2) Method according to claim 1, wherein the mutated GyrA protein is such that:

3) Method according to claim 1 or 2, wherein the mutated GyrA protein is such that:

said amino acid at position 83 is: I, L, W, A or V and the amino acids at positions 84 and 87 may correspond to any amino acid, or said amino acid at position 84 is: P or V and the amino acids at positions 83 and 87 may correspond to any amino acid, or

said amino acid at position 83 is: I, L, W, A or V, said amino acid at position 87 is: N, G, Y, H or V, and said amino acid at position 84 is any acid amine, or

said amino acid at position 84 is: P and V, said amino acid at position 87 is: N, G, Y, H or V, and said amino acid at position 83 is any amino acid, or

said amino acid at position 83 is: I, L, W, A or V, said amino acid at position 84 is: P or V, and said amino acid at position 87 is: N, G, Y, H or V, in particular in which the mutated GyrA protein is such that:

said amino acid at position 83 is: I, L, W, A or V, said amino acid at position 84 is A and said amino acid at position 87 is D, or

said amino acid at position 84 is: P or V, and said amino acid at position 83 is T and said amino acid at position 87 is D, or

said amino acid at position 87 is: N, G, Y, H or V, and said amino acid at position 83 is T and said amino acid at position 84 is A, or

said amino acid at position 83 is: I, L, W, A or V said amino acid at position 84 is: P or V, and said amino acid at position 87 is D, or

said amino acid at position 83 is: I, L, W, A or V, said amino acid at position 87 is: N, G, Y, H or V, and said amino acid at position 84 is A, or said amino acid at position 84 is: P or V, said amino acid at position 87 is: N, G, Y, H or V, and said amino acid at position 83 is T.

The method of claim 1, wherein said mutated GyrA protein comprises the consensus sequence:

GDX _! X ₂ VYX ₃ T (SEQ ID NO: 2), wherein:

X ₁ , X ₂ and X ₃ correspond respectively to the amino acids mutated at positions 83, 84 and 87, and

- Xi is different from T, and X ₂ and X ₃ are any amino acid, or

X ₂ is different from A, and X ₁ and X ₃ are any amino acid, or

X ₃ is different from D, and X ₁ and X ₂ are any amino acid.

5) Method according to claim 4, wherein:

- Xi is I, L, W, A or V, and X ₂ and X ₃ correspond to any amino acid, or

X ₂ is P or V, and X ₁ and X ₃ are any amino acid, or

X ₃ is N, G, Y, H or V, and X ₁ and X ₂ correspond to any amino acid, or

- Xi is I, L, W, A or V, X ₂ is P or V and X ₃ is any amino acid, or

- Xi is I, L, W, A or V, X ₃ is N, G, Y, H or V and X ₂ is any amino acid, or

X ₂ is P or V, X ₃ is N, G, Y, H or V and X 1 is any amino acid, or

- Xi is I, L, W, A or V, X ₂ is P or V and X ₃ is N, G, Y, H or V. In particular wherein:

- Xi is I, L, W, A or V, X ₂ is A and X ₃ is D, or X ₂ is P or V Xi is T and X ₃ is D, or

X ₃ is N, G, Y, H or V, Xi is T and X ₂ is A, or

- Xi is I, L, W, A or V, X ₂ is P or V and X ₃ is D, or

- Xi is I, L, W, A or V, X ₃ is N, G, Y, H or V and X ₂ is A, or

X ₂ is P or V, X ₃ is N, G, Y, H or V and Xi is T.

6) Method according to any one of claims 1 to 5, wherein the sequence of said gene encoding said mutated GyrA protein has at least one nucleotide substitution with respect to SEQ ID NO: 3, in position equivalent to the position 7, 8, 10, 11, 19, 20 or 21 with respect to SEQ ID NO: 3,

where the nucleotides at positions 7 and 8 correspond to the first two nucleotides of the codon encoding the amino acid at position 83 of the GyrA protein of Legionella pneumophila, the nucleotides at positions 10 and 11 correspond to the first two nucleotides of the codon encoding the amino acid at position 84, and the nucleotides at positions 19, 20 and 21 correspond to the three nucleotides of the codon encoding the amino acid at position 87. and in particular in which the sequence of said nucleic acid encoding said mutated GyrA protein comprises a sequence chosen from sequences SEQ ID NO: 4 to 12 and SEQ ID NO: 14 to 56.

7) Method according to any one of claims 1 to 6, the detection of the presence of said mutated GyrA protein or the target nucleic acid encoding said mutated GyrA protein being carried out by a technique chosen from: western blot, northern blot, Southern blot, PCR, real-time PCR, PCR hybridization, PCR array, TMA, NASBA, CSF, DNA / RNA hybridization, DNA chip, DNA / RNA sequencing, the dot-blot, the RFLP (Restriction fragment length polymorphism) technique, in particular wherein said detection of the presence of said target nucleic acid encoding said mutated GyrA protein is performed by real-time PCR.

8) Method according to any one of claims 1 to 7, said method comprising the steps of:

a) contacting a biological sample that may contain a target nucleic acid belonging to an antibiotic-resistant bacterial strain of Legionella pneumophila, with a pair of primers capable of specifically hybridizing with said target nucleic acid, and b) when there is PCR amplification of said target nucleic acid using the pair of primers to obtain an amplification product, said amplification product comprising a sequence having at least 90% identity with the sequence SEQ ID NO: 3:

c) detecting a nucleic acid encoding the mutated GyrA protein, detecting a nucleic acid encoding said mutated GyrA protein indicating the presence of at least one bacterial strain Legionella pneumophila resistant to antibiotics, in the sample, and in particular wherein said amplification product obtained in step b) corresponds to a sequence having at least 90% identity with the sequence SEQ ID NO: 57, and in particular wherein step b) is carried out using a primer having at least 90% identity with the sequence SEQ ID NO: 58, and / or a primer having at least 90% identity with the sequence SEQ ID NO: 59, and in particular in which a melting curve of said amplification product is generated after step c).

9) Method according to claim 8, wherein the detection of said amplification product obtained in step b) is carried out using at least one nucleotide probe capable of hybridizing with the target nucleic acid, in particular wherein said nucleotide probe has at least 90% identity with the sequence SEQ ID NO: 3 and in particular wherein said detection probe having at least 90% identity with the sequence SEQ ID NO: 3 is used with at least one anchoring probe having at least 90% identity with the sequence SEQ ID NO: 60.

10) Nucleotide probe comprising a nucleic acid molecule having at least 90

% identity with the sequence SEQ ID NO: 3,

said nucleotide probe being in particular linked by a covalent bond to at least one marker molecule allowing its detection by a suitable device, said marker molecule being in particular chosen from a fluorochrome or a radioactive isotope.

11) Nucleotide probe comprising a nucleic acid molecule having at least 90

% identity with the sequence SEQ ID NO: 60 linked by a covalent bond to a fluorochrome.

12) Pair of primers allowing the amplification of a fragment of the gyrA gene of

Legionella pneumophila comprising a primer having at least 90% identity with the sequence SEQ ID NO: 58, and a primer having at least 90 identity with the sequence SEQ ID NO: 59.

13) Reagent kit for the detection of bacterial strains Legionella pneumophila resistant to antibiotics, especially fluoroquinolone type, comprising at least a pair of primers as defined in claim 12 and at least one probe as defined in claims 10 to 11 . 14) Use of the method defined according to any one of claims 1 to 9 for the diagnosis of an infection with an antibiotic resistant bacteria Legionella pneumophila, including fluoroquinolone type, in a patient, or for the determination or prediction of the efficacy of fluoroquinolone therapy in a patient infected with Legionella pneumophila.