EP3004384B1 - Method for identifying biological material and use of kit therefor - Google Patents

Description

The present invention includes a method of identifying biological material, and the use of a kit.

A. Background of the Invention

1. Problem outline: The police investigator or the public prosecutor's office sends two questions to the processor of biological traces at a crime scene: What genetic fingerprint does the footprint reveal and what biological material is involved? The genetic fingerprint is now one of the most effective tools for identifying perpetrators. It is made from the DNA isolated from the trace material. DNA is surprisingly one of the most robust biological substances. Even after several years of exposure to light, heat and moisture, it is often relatively intact and still allows the production of a genetic fingerprint. The question of the type of biological material, especially violent crime, almost always arises in the attempt to reconstruct the course of events. It is mostly about the safe identification of peripheral blood, menstrual blood, vaginal fluid, semen, saliva or skin. Often, the presence of one or more of these components must be accomplished from a mixture. If such traces have been exposed for a long time to external physical or microbiological influences, the analytical problem with the hitherto available biochemical tools is not solvable. The analysis substrate for such questions are proteins or, more recently, RNA. Because of their extraordinary sensitivity, these classes of substances are extremely unsuitable for solving forensic problems. While the meaning of the genetic fingerprint is always clear and almost always the same, the desired identification of bodily fluids can underlie a variety of specific issues. Even the detection of peripheral blood can sometimes be very difficult if the material is contaminated, has been outdoors for a long time and there are very small amounts of material. The following sections explain the procedure that is often necessary and performed in a step-by-step manner. All methods available so far are suffering from one or the other endangerment of investigation. Most methods have a more or less degrading effect on the track and in particular the DNA that one wants to use for the genetic fingerprint. Especially with tracks with little material you have to decide on which body fluid you want to investigate. The blood tests usually do not differentiate between animal and human blood. In most cases, a non-specific but sensitive test is used first, followed by a test that is as specific as possible. One of the most common conventional methods for the detection of blood is a test with the chemiluminescence luminol. The most serious disadvantage is the impairment or even the loss of the material for DNA analysis. In recent years, several approaches have been described which use multiplex assays to detect specific mRNA species in body fluids.

The document US 2006 / 0183128A1 discloses methods and genetic markers for differentiating different cell and tissue types by bisulfite treatment and single nucleotide primer extension assays, in particular for forensic investigation of the origin of a tissue sample from a crime scene.

1.1 Principle of Differential Methylation: The present invention utilizes differential methylation as a tool of body fluid analysis. It has been proven that cells through their methylation pattern can be differentiated from each other and as a substrate for analysis could use the enormously stable DNA. For this purpose, two genome-wide methylation studies were performed. In the forensic context relevant bodily fluids or tissue were studied and appropriate marker systems built up.

The differential methylation phenomenon is ideally suited for the identification and detection of bodily fluids because the analyte substrate is the comparatively stable DNA.

1.2 Methylation of DNA: In the human genome, cytosine in CpG dinucleotides is almost exclusively the target of methylation at the 5-carbon atom, yielding 5-methylcytosine (CmpG). The transfer of a methyl group from S-adenosylmethionine (SAM) to the 5'-C atom of the cytidine ring is catalyzed by DNA methyltransferases.

1.2.1 Fundamentals of DNA methylation in humans: In vertebrates, methylation is distributed virtually throughout the genome. But overall, only a small proportion of the cytosine residues are methylated, in humans about 3%, and especially in the CpG form. In the cells of the adult organism, only a small proportion of the methyl cytosines are found in the CpH context (H stands for any nucleotide). 5-methylcytosine is chemically unstable during evolutionary periods. The number of CpG groups decreases during evolution because they are constantly being converted into TpG. In some species, such as the yeast S. cerevisae and the nematode C. elegans, the DNA does not appear to be methylated at all. The bacteria limit the methylation to a part of the adenine and cytosine residues. Here, methylation acts as a defense mechanism of the host cell. - The cell's own restriction enzymes recognize and cut invading, unmethylated phage DNA on their recognition sequences. These are methylated in the host cell and thus protected.

In the vertebrate genome, the frequency of CpG-Dinkleotide is lower than statistically assumed. However, about 30,000 so-called CpG islands have been detected in the human genome (International Human Genome Sequencing Consortium, 2001). These are up to a few hundred bases long, relatively less methylated sequences, the normal, expected CpG frequency have (> 50% GC). Often these areas mark the 5 'end of a gene. Here is the promoter region of the gene, from where its activity is controlled in the cell.

But also in the introns of many genes are CpG structures. A significant proportion of CpGs are found in or near repetitive structures.

Soon after the discovery of methylation, a mechanism was proposed that would allow the inheritance of methylation patterns: A DNA methyltransferase recognizes a methyl group on one strand and methylates the strand that has just been replicated. Such a mechanism also explains the specific patterns of different cell types.

The methylation of cytosine in CpG units is not only a tool of gene expression control, but also inactivates mobile genetic elements that are planted into the genome of an organism. They may also prevent recombination between repetitive sequences - without such a function would probably give much more chomosomal abnormalities. Nevertheless, the most important task can be seen in the expression control of genes. Some authors also speculate that methylation itself does not necessarily block gene expression, but rather that other mechanisms do so, but that methylation in some way seals off this original process.

1.2.2 Differential methylation: When it is clear that methylation is part of expression control, it is also likely that the methylation is tissue or cell specific. In any case, a specific cell type should have a characteristic methylation pattern. This assumption has been confirmed in a very precise manner by using a multi-loci methylation fingerprint to characterize cell types. The highest demands on purity of the individual cell populations are made in treatment concepts in which the cells are given specific cells. It must be sure that it is really and only the cells wanted. This is true for the so-called tissue engineering eg the cartilage replacement. The in vitro grown chondrocytes must be tested for purity and character, as well as for stem cell therapy in lymphoma patients after chemotherapy or for the treatment of patients with autoimmune diseases.

These requirements are not justified by the obvious mRNA analysis. Two cells cultured under identical conditions may be in very different metabolic situations, so that their expression patterns differ greatly. The gene products selected for characterization are, in the limit, formed in undetectable amounts. Cell-specific methylation has been shown to be a robust, long-lived feature of a cell line. There is a barcode or fingerprint consisting of 4 different methylation loci that can be used to clearly characterize keratinocytes, melanocytes, adipocytes, chondrocytes, fibroblasts and mesenzymal stem cells from culture. The methylation genomes subject to cell- or tissue-specific methylation (TDMR) are distributed as differently as the CpG regions. They are found in the promoter-proximate CpG islands, in introns, and in or near repeats, but such regions are also found in the intergenic region with low CpG density. Many of these tDMR regions are conserved between mouse and human.

1.2.3 Cell-Specific Methylation - How Stable Is the Methylation Pattern Really ?: Now, for the application discussed here, the question remains, does the methylation pattern persist throughout life, or does it change throughout the course of development and later in the adult during life? Since much is speculated about the fact that in addition to the genotype and the methylation contributes to the phenotype, one must also think about the extent of interindividual variability of methylation. Even the diet could have an effect on the methylation pattern. On the other hand, the massive influence of tumors on methylation is assured. It can be assumed that the CpG islands are normally stable and preserved as such, but it could be, for example, in a CpG island individual CpGs change their degree of methylation. This would most likely not result in any phenotypic changes, but could eventually affect the analytical CpG and then interfere with the SNuPE analysis used here as evidence. That would also apply to most other detection methods, except for the NGS. Against this background, our search strategy seemed absolutely essential, namely that a large number of differentially methylated gene loci were made available by means of complete genome investigations. Only in this way can one identify the best and safest discriminators.

1.2.3.1 Methylation and development: Development and differentiation of a higher organism is thus strongly influenced and controlled by the methylation. Nevertheless, the methylation pattern of a genome as a whole changes dramatically in the course of development. The DNA in the primordial germ cells of the embryo is initially heavily methylated. In the course of development, there is a progressive demethylation. In the transition of the primordial germ cells in the gonads these are almost completely demethylated. During the development of the gonads and the emergence of the first germ cells one again observes a methylation of the genome. Thus, the DNA of mature sperm and oocytes is highly methylated. The sperm genome is more methylated than the egg cell. At an early stage, the fertilized egg is therefore highly methylated. In many genes, the methylation patterns of paternal and maternal alleles differ. Even before the implantation of the embryo, there is a general demethylation of the genome. During the pre-gastrulastadium then begins again methylation. However, the degree of methylation is now very different between the individual cell lines.

For the search for cell-specific methylation markers, the fact is important that by no means always the degree of methylation in the 5 'region of a gene correlates with its expression in a particular cell. It is quite possible that CpG regions are differentially methylated, which are not directly related to the expression of a gene. Nevertheless, the DNA in chromatin regions with active transcription differs from the DNA in inactive regions by a number of features, e.g. the degree of compression and also the methylation. Methylation of CpG islands downstream of promoters does not interfere with transcription. What is certain, however, is that the methylation of promoter regions shuts off transcription.

1.2.3.2 Age dependence of degree of methylation: Essential for the life of higher organisms is the phenotypic stability of the different cell types. To some extent, however, these specialized cells change their phenotype over the course of their ages. Changing levels of methylation could reduce or enhance the expression of genes - with fatal pathogenic consequences, but also as a normal, natural aging process. For example, an age-dependent change in the degree of methylation in IGF2 is described. Of note is the difference between global methylation and methylation in the promoter CpG islands: the former is likely to decrease with age, whereas promoter methylation decreases in some genes but increases in others. As the tissue ages, the proportion of methylation within CpG islands increases while methylation increases the loci that are outside the CpG islands are sinking. DNA methylation even varies more widely between different tissues within an organism than intraindividually, even compared to the chimpanzee genome.

A genome-wide methylation study was performed on 80 identical twin pairs aged between 3 and 50 years. In this case, the total 5mC content was determined, it was also isolated with methylation-sensitive restriction enzymes differentially methylated regions. The fragments, which each differed between two twins-one existed in the fragment and the other did not-were cloned and sequenced. Thus, the type of differentially methylated gene loci could be determined. The majority were aluminum fragments, other repetitive structures, and 13% single-copy genes. In the latter an expression analysis was connected. The significant result was that the older the twin pairs were, the more different was the methylation pattern. The methylation pattern also correlated with the expression data.

1.2.3.3 Inherent Factors Affecting the Degree of Methylation: In addition to these influencing variables explained above, such as the age of the individual being examined and the origin of a cell - germ cell or somatic - we now also know those that are individual-specific. For example, it is assumed that the genetic environment, ie the DNA sequence itself, can influence the degree of methylation of a differentially methylated CpG. Known are SNPs whose alleles - including a z. T. remote methylation site - may affect the degree of methylation. - In principle, therefore, genetic factors that control the methylation at certain loci. One recognizes two groups of such connections: on the one hand permanent and not individual-specific and on the other individual-specific. The former group includes genetic imprinting and inactivation of the X chromosome. Both are probably hard-coded within narrow limits for each species - both in terms of timing and location. The instrument of inactivation is methylation. In the second group, genetic variability affects certain methylation sites. Again, two different phenomena can be recognized: As is known from genetics itself, several basically variable loci - SNPs or other variable genetic structures - can influence the degree of methylation of a CpG or a CpG island (CGI). Since these are any combination of the alleles of the loci involved in the influence, one can consider the degree of methylation of the considered CpG in the manner of a QTL. This means that the degree of methylation can, as it were, gradually take on all values in different individuals (mQTL). This phenomenon has been proven. On the other hand, one genetic variable is observed, with one allele bringing the degree of methylation of one CpG to 0%, while the other allele causes 100% methylation. So far, only a few of these SNP / CpG pairings have been proven to be true. However, a genome-wide analysis suggests that a substantial part of the methylation of CpGs or CGI is under the control of individual genetic variables. This mechanism is called allele-specific methylation (ASM). As a result, both mQTL and ASM are quite similar: they lead to the finding that the degree of methylation of a CpG is between 0 and 100%. At ASM If the methylation values for pure cell lines should be around 0%, 50% or 100% (heterozygosity / homozygosity), all values between 0 and 100 can be expected for mQTL. A significant part of these ASM situations is caused by SNPs in the CpGs themselves, especially in the methylated CpGs by their high mutation frequency.

Some of the body fluids studied in this work consist of several different cell types. For this reason too, no Mendelian numerical ratios can be expected in the present methylation measurements.

1.2.3.4 DNA Methylation in Carcinoma Cells: The problem of aberrant methylation by tumors is of course important to the work presented because such tumor-induced deformation of the methylation pattern can create fatal errors in the application of the system to forensic issues. Whether the tumor influence on the methylation is relevant for our procedure will be clarified experimentally.

The question must be clarified from the analyst's point of view: Can a tumor, for example in lung tissue, affect the methylation pattern in body fluids or tissues that are not directly in contact with the lung tissue? Can a tumor that is in direct contact with the tissue or body fluid under investigation affect the methylation pattern of that tissue or body fluid? Does the degree of methylation of the markers under consideration change under these conditions? Such questions are particularly important when looking at blood: It is well known that methylation markers, which are used for the early detection of tumors, can also be found in peripheral blood in very distant tumors, in free DNA. This circumstance is increasingly used for early and specific tumor detection. It has been shown that the hypermethylated promoter of glutathione S-transferase P1 (GSTP1) from the patient's prostate tumor tissue is also detectable in plasma, serum, ejaculate and urine, albeit only in percentages of 36-74% of the samples.

The connection "tumor / methylation pattern" could be proven experimentally by showing that in tumor cells genome wide the methylation was lowered. This hypomethylation takes place mainly in and on the repetitive or parasitic elements of the genome.

On the other hand, one observes both regional hypermethylation and hypomethylation, especially at promoter elements in CpG islands. Such methylation effects apparently occur at a very early stage of tumorigenesis. To date, it is not clear whether these are at least in part the causes of tumorigenesis or whether one observes phenomena that are characteristic of very rapidly dividing cells. However, DNA methylation can be the cause of tumorigenesis in any case due to the increased mutagenicity at 5mC.

1.3 Body fluids are often complex mixtures: Body fluids are in many cases complex mixtures of different cell types. This additionally makes the use of differential methylation for the identification or measurement of body fluids difficult. The differentially methylated gene loci are of course cell-specific and not tissue-specific. That means, if it's the genomic An analysis on differentially methylated loci will be made, one will still try to make a special selection: best suited are loci, which are methylated in the liquid / tissue in question and not methylated in the other, in question. The degree of methylation should be as high as possible, because in the other cell types of body fluid this locus may not be methylated. If, as is the case with forensic traces, the trace consists of a mixture of body fluids, the methylation signal should still be recognizable even in very small proportions of the bodily fluid in question. If, on the other hand, the marker in the liquid in question is not methylated and methylated in the others, a mixture analysis is scarcely possible. - The locus is not completely methylated in the other fluids. This means that it is difficult to distinguish in mixtures where the signal for non-methylation comes from. Nevertheless, such markers are useful as confirmatory markers because they well characterize the liquid in question in its pure form. Because of the often existing cellular complexity of bodily fluids, the development of multiple markers has been sought and accomplished in the present work for each body fluid.

1.4 The Marker Search Strategy: Since, as shown in the previous sections, a methylation marker is at least theoretically exposed to multiple factors, a search strategy should be designed to cover as closely as possible the whole genome and all types of CpGs. At the moment, this claim is most likely met by the Infinium methylation technology 450K (Illumina). This examines around 480,000 CpGs. In contrast to the 27K version, which has already been available for some time, it also covers intergenic areas that are less densely populated with CpG. Both techniques are chip analyzes based on the same principles. Nanometer spheres carry covalently bound 23-bp single-stranded DNA sequences that both discriminate the beads and hybridize the 50 bp analytical CpG-containing fragment of the sample. At 27K, two different types of beads are used. The one binds the methylated counterpart from the sample, the other the no longer methylated counterpart after bisulfite. There is a Primerenxtension reaction, which grows either the fluorescently labeled G or at the other bead type the fluorescently labeled A. Both are marked in red. The differentiation of the beads takes place through the 23 bp sequences. At 450K, a different type of detection also takes place: a bead type and the 4 optional ddNTPs labeled with different fluorescence labeling.

In a chip analysis of this kind, a separate signal is obtained both for a methylated CpG and for a non-methylated CpG. To identify cell-specific differentially methylated CpGs, bisulfite-converted DNA samples of the fluids of interest are placed on the chip. With less complex software help you can query the methylation status of these 480,000 CpGs in a short time. The evaluation is not quantitative but also no yes-no answer. This means that the statements obtained must be confirmed by another method, especially of course on several individuals.

1.5 Bisulfite Sequencing: The classic method for this next step is bisulfite sequencing. The chemical reaction behind it is the bisulfite conversion of the DNA. The non-methylated Cs are converted into Us. In the PCR amplificates, these finally appear as T. The methylated Cs remain unchanged in the reaction.

Specifically, a reversible addition of the bisulfite ion to the C-6 atom of the cytosine ring takes place. The resulting cytosine sulfonate is modified by hydrolytic deamination to uracil sulfonate and then desulfonated by alkali action to uracil ( Figure 2 ). All unmethylated cytosines are converted to uracils. In methylated cytosines, however, the nucleophilic attack by the bisulfite anion proceeds only slowly, so that the 5-methylcytosines remain unchanged. After the bisulfite treatment, there are two single strands that are no longer complementary to each other. In the following sequence analysis of the target DNA, one can thus distinguish methylated from non-methylated CpGs. Because it is a chemical reaction, not all reaction products are converted into their final products. Bisulfited DNA often behaves slightly differently than untreated DNA, often the background of the sequencing reaction is more pronounced than that of untreated DNA. For a still meaningful analysis result one comes mostly with the help of a special software. This normalizes the signals of the sequence analysis, corrects the incomplete bisulfite reaction, and allows limited quantitative consideration.

1.6 The SNuPE analysis: A long-term, strategic goal of the work was to create a kit with the developed marker systems. Bisulfite sequencing itself is unsuitable for a diagnostic assay as needed herein. Especially after the bisulfitation reaction, Sanger sequencing can by no means serve as a quantitative detection method. In both bisulfite sequencing and single nucleotide primer extension (SNuPE), the ratio of methylated to unmethylated at the considered locus is determined. The additional benefit of the SNuPE assay over bisulfite sequencing is that, with a single methylation signal sent exclusively from label-specific fluid, the target fluid can also be detected within mixtures. It is not self-evident that all CpG sites are equally methylated within the marker locus. Often it is only a specific CpG, which ensures the distinction.

SNuPE is a primer-extension reaction in which either the ddC (methylated) is enzymatically attached to a CpG site with one fluorescent dye or the ddT (not methylated). In the case of the reverse detection direction of the SNuPE primer, it is the complementary ddG or ddA. The reaction proceeds on the basis of the SNaPshot kit system from ABI. In the FIG. 3 the principle of the SNaPshot analysis is clarified again.

The method is also suitable for quantitative measurements. Assuming a suitable target sequence of the SNuPE primer, the true methylation value of a CpG can be determined with an accuracy of plus minus 5%. The result of the fragment length measurement carried out in the DNA sequencer is evaluated by comparing the peak heights and peak areas of the methylation signal with the non-methylation signal. The method should be validated by a more direct measurement method. According to the situation, only cloning was possible or sequencing using a method of so-called New Generation Sequencing (NGS).

1.7 NGS study of the methylation Irssorten: The massively parallel sequencing of the amplificates used for the approach presented here was also used for the analysis of possible genetic interference. SNPs on the analytical CpG would possibly fake a false result or at least a significant signal variance.

Moreover, a relatively high consistency of total methylation in the promoter-associated CGIs may have been reported, but within these CGIs, the CpG responsible for gene regulation may be interindividually different. This could also lead to a falsification of the SNuPE result. Also, ASM caused by far-positioned SNPs appear to affect multiple CpGs in the CGI under consideration.

There is no indication in the literature of how SNPs affect the immediate vicinity of the analytical CpG.

To date, there is no safe method for identifying body fluid from forensic trace material. Especially when it comes to older or strong environmental influences exposed materials. This invention is based on the idea that cell-specific, differential methylation is a suitable instrument for solving the problem. Genome-wide search should identify differentially methylated loci that identify the relevant bodily fluids or tissues from forensic material. It is not clear how stable such markers really are under the expected extreme conditions. In effect and from the point of view of analytics, a methylation marker behaves like a quantitative feature. The influences determining the analyte, ie the degree of methylation of a CpG, can be assigned to different categories: Numerous methylation genotypes are parental - either the maternal or paternal homologs are inactivated by methylation. Inactivation of the X chromosome also occurs by methylation. The age of an individual determines the degree of methylation of Cp Gs. A tumor can deform the methylation pattern of cells. The corresponding DNA is widely spread in the affected organism, even if by trace via body fluids. Genetic variables seem to determine the degree of methylation of single CpGs, whole CGIs, or even gene clusters, in a previously unrecognized way.

The CpG locations identified in the body fluid analysis should be made a safe analytical basis for forensic investigations by extensive validation experiments under forensic conditions, on healthy controls, and on patients with various tumors. By massively parallel sequencing, a gold standard is created for the analysis of the considered methylation loci. With the same method possible SNP influences are examined.

This was the first time a validated molecular biology method for the analysis of body fluids from forensic material was provided.

B. Detailed Description of the Invention

Table 3 Compilation of the current marker set Marker Name Target fluid or tissue BeadChip TargetlD Blood-1 Peripheral blood 27 cg26285698 Blood 2 Peripheral blood 450 cg03363565 Mens 1 menstrual blood 450 cg09696411 Spei 1 saliva 450 cg21597595 Spei 2 saliva 27 cg15227982 Sperm-1 sperm 27 cg22407458 Sperm-2 sperm 27 cg05656364 Vag-1 vaginal 27 cg14991487 Vag-2 vaginal 27 cg03874199 Skin 1 Skin / scales 450 cg06833110

1 Peripheral blood: Two oppositely detecting markers were developed for the examination of peripheral blood. With the first marker, admixtures of other fluids in the blood can be detected. The second marker responds only to peripheral blood with a specific methylation signal.

1.2 Methylation Marker Blood-1 1.2.1 The Genort Properties

Table 4 The Genort Description of the Marker Blood-1 marker Chr CpG island Gene symbol gene Locus architecture Blood-1 16 no (63% GC) 8cg / 344bp C16orf54 Transmembrane protein c16orf54 Exon: 16orf54-001

The bloodl label is completely unmethylated in the peripheral blood. In the other body fluids (peripheral blood, menstrual blood, saliva and vaginal fluid) and skin he shows different proportions of methylation. The locus is located on band p11.2 of chromosome 16, on the minus strand, in an open-reading protein-coding gene region, which codes for a transmembrane protein c16orf54. These proteins are localized in the membrane of different cell compartments. The specific function of the protein in vivo is not known yet, nor is there a proven phenotype. Gene expression studies on normal and tumor tissues show a high expression rate in blood and kidneys and almost no expression in other tissues tested.

1.2.2 Construction of the amplificate: The 344 bp blood amplicon has no CpG islands. The average GC content in the genomic sequence of the amplicon is 63% (Table 4). It contains two known SNPs that are outside of primer binding sites. There are no frequency specifications for the two SNPs. In the course of the work, the amplicon was shortened to 176bp, so that the heavily loaded forensic samples could be more effectively amplified by shorter amplificates. From the FIG. 4 (Genomic sequence of the blood locus The CpG dinucleotides are marked in yellow, the two known SNPs are green, the primer sites are highlighted in gray (forward primer dark gray, reverse primer light gray), the two CpGs whose methylation in the SNuPE Assay is measured in red and the binding sites of the two SNuPE primers are underlined) it can be seen that two different CpG sites are used for the following SNuPE analysis.

1.2.3. Methylation Patterns - Results of bisulfite sequencing : The results of bisulfite sequencing ( FIG. 5 ; DNA methylation in the blood locus. Included are five samples of five body fluids, each column representing a sample. The lines represent the 8 analyzed CpGs within the amplicon. The percentage values of DNA methylation correspond to a color value in the continuous color transition from yellow (= 0% methylation) to blue (= 100% methylation) - corresponding to the color scale on the right side. The two analytical CpGs are surrounded by black rectangles.) Allow a direct comparison of the methylation in the individual sample groups for the investigated marker locus. The two analytical CpGs (cg68 and cg125), as well as the six remaining CpGs studied, are completely unmethylated in the peripheral blood cells. A distinction of the peripheral blood from the other body fluids sperm, saliva, vaginal fluid and menstrual blood should be possible.

1.2.4 Target region - SnuPE: The base composition of the bisulfite-converted blood sequence is relatively unbalanced with a GC content of 37%. The high proportion of A and T bases reduces the melting temperature of the primer. Since the normal SNuPE primer must not contain CpGs within its binding site, only the CpGs at least 25 to 30 bases apart were eligible for the primer design for this candidate. Of three engineered and tested SNuPE primers, two have proved to be equally good discriminators. The first extension primer Blutl-lf detects in the forward direction ( FIG. 6 ; The reaction of the forward SNuPE primer Blut1-1f. The amplicon sequence is depicted in the 3'-5 'direction. Since the amplicon is on the 1st bisulfite strand, the 3 'end of the forward primer becomes either a C (black, a) on the methylated sequence or a T (red, b) on the unmethylated amplicon Extended sequence), the second primer Blutl-2r in the reverse direction ( FIG. 7 ; The reaction of the reverse SNuPE primer Blutl-2r. The amplicon sequence is shown in the 5'-3 'direction. The reverse primer is extended at its 3 'end either by a G (blue) on the methylated sequence or by an A (green) on the unmethylated amplicon sequence.).

The two SNuPE primers differ in length by 3 bases (28 and 31 bases). Therefore, in the blood assay, the detection can be done simultaneously - as a diplex reaction - with two primers and, accordingly, the methylation can be measured at two different CG sites. The signals of both primers are in the FIG. 8 (Simultaneous detection of the Blutl-SNuPE primers 2r (blue-green) and 1f (black-red); illustration of a plot window after data evaluation with GeneMapper ID 3.2.).

Basically, the parallel analysis of two different CpGs has the advantage that in case of failure of the first target CpG by any mutations, the second CpG ensures the identification of the body fluid.

1.2.5 Detection sensitivity and reproducibility of the results: The detection was classified as stable if the template amount used in four independent analyzes both generated a PCR band in the agarose gel and if the signals from the corresponding body fluid DNA were correctly detected , The measurement series for blood 1 were performed with the target fluid - peripheral blood and additionally with menstrual blood DNA. The menstrual blood was analyzed to measure fluctuations in methylation levels in a fluid that shows methylation in the blood locus. The blood is usually unmethylated (0-3% methylation).

In both cases - measurement of peripheral blood and menstrual blood - the PCR amplificates could already be generated in the PCR when using 25pg DNA ( FIG. 9 ; Marker Blutl-2r - Detection sensitivity measurement in each of four independent analyzes of eight different concentrations of blood DNA (a) and menstrual blood DNA (b); the amounts of DNA used per PCR are listed on the abscissa.) The scattering is very high. However, with the use of 50pg DNA and more, the detection of peripheral blood is stable.

1.2.6 Detection of the target liquid in mixtures: For most traces one must assume a mixture of different body fluids. In principle, there may be a mutual influence on the methylation values. Therefore, for each marker, the respective expected methylation value was compared with the real measured value for different amounts of non-specifically detected by the marker body fluids.

DNA samples containing 100%, 80%, 60%, 40%, 20% and 0% blood DNA were prepared for this purpose. The remaining portion of the samples contained a mixture of the same concentration (20 ng / μl) consisting of the DNA of the remaining four liquids.

The calculated target methylation value of the samples with 0% peripheral blood should show 75% methylation, the target value of the pure blood sample 0% methylation. The nominal values of the samples containing 20, 40, 60 and 80% blood DNA can be found in the diagram ( FIG. 10 ; Marker Blood 1 - Measurement of peripheral blood in a fluid mixture with primers 1f (a) and 2r (b). The target value (black) corresponds to the calculated methylation value, which results from the values of the five body fluids, and the proportion of blood DNA in the respective mixed sample. The actual value (red) corresponds to the actually detected value.).

The methylation values of the two SNuPE primers 2r and 1f are smaller than calculated in the 20, 40, 60 and 80% mixed samples. In principle, however, a plausible linear decrease in methylation can be observed. At 0% and 100% blood DNA in the mixture, the expected value and the actually detected value are the same for the 1f primer. For the 2r primer, when measuring from the sample with 0% blood DNA, the detected value is higher than the set point. Overall, an influence of the blood-specific signal is observed.

1.2.7 Individual variation of methylation values: In the first round of validation, 20 samples (different subjects) of five body fluids - peripheral blood, menstrual blood, vaginal fluid, saliva and semen - were measured. This should allow the maximum dispersion of methylation values from the body fluids methylated in the locus. In addition, it was possible to check whether another fluid, except peripheral blood, can give a false positive signal. In the FIG. 11 (Marker Blut1 - box plot to spread the methylation values in 20 DNA samples from 5 body fluids, measured with SNuPE primers 1f (a) and 2r (b).) Summarizes the results of this experiment.

1.2.8 Extended Validation: For the further statistical validation of the two blood markers, an additional 80 samples of peripheral blood were used for the 20 blood samples tested for the first validation round. The results of both validation experiments were summarized. FIG. 12 (Age of peripheral blood subjects whose samples were included in the study of the two blood markers Blood1 and Blood2; 49 males and 51 females (n = 100).) Shows the age distribution of blood donors.

Four samples failed during the study. The methylation values of the 2r-SNuPE primer show a skewed distribution - most of the values (40 out of 96) show a methylation of 1.0 to 1.9 percent ( FIG. 13 ; Marker Blood1 - Distribution of methylation values of n = 96 blood samples. The values of the two SNuPE primers 2r and 1f are shown in different colors. The red bars show the results of the 1f primer and the blue ones of the 2r primer. On the abscissa, the value groups are given, with the division into groups being arbitrary, depending on the totality of the values. The ordinate lists the number of samples whose values fall into the corresponding category.). The average methylation value for the 2r primer for all blood samples is 1.3%. The lf-SNuPE primer is completely unmethylated in 90 out of 96 samples, with an average methylation value of 0.3%. An age and gender dependence was not observed.

1.2.9 Forensic validation: Forensic traces are normally exposed to various environmental influences. In order to determine the stability or reliability of a measuring system, these external influences must be simulated in corresponding control experiments. It had to be examined whether the exogenous influences impair the stability of the methylation signal in the target fluid (in this case peripheral blood), but also in the other body fluids under discussion ( FIG. 14 ; Marker Blutl-2r - Methylation results of simulated forensic traces stored under dry and humid conditions as well as externally. The storage period is 1, 2, 3 and 6 months. The values from the different aging times are differentiated by color (see legend). Peripheral blood (a), menstrual blood (b), vaginal fluid (c), saliva (d) and sperm (e). The initial methylation value of the corresponding liquid in the marker Blood1 is prefixed as t0.). Theoretically, such an effect could cause the methylation signals of the target fluid to approach those of the other body fluids.

The blood samples were stable unmethylated over 6 months both in dry and moist storage with a variation in methylation values of 0 to 3% ( Figure 14a and FIG. 15 ; Marker Blutl-2r - box plot for scattering methylation values in the trace aging experiment. All are involved Values of the corresponding liquid from the entire experiment.). In outdoor storage, higher material losses occur over time, so that some 6-month-old blood samples were not amplifiable.

1.2.10 Next Generation Sequencing: The first NGS series of measurements was designed to refine the actual methylation at the target CpGs of the SNuPE primers and thus verify the measurement accuracy of the methods used in the work. The diagram in FIG. 16 (Marker Blood1 - Comparison of methylation results from a same blood sample from four different analysis methods: bisulfite sequencing, single nucleotide primer extension, and Next Generation Sequencing with Roche454 (2769 reads) and Illumina MiSeq (47400 reads).) The values of 2r CpG are dark violet, the values of 1f-CpG are shown in light purple.) summarizes the results.

Taken together, these results indicate that the measurement of methylation by primer extension is more sensitive than with conventional Sanger sequencing.

1.2.11 Methylation Marker Blood-2 1.2.1.1 The Genort Properties

Table 5 The Genort Description of the Marker Blood-2 marker Chr CpG island Gene symbol gene Locus architecture Blood 2 16 No (47% GC) 7cg / 232bp RAB11FIP3 Rab11 Family Interacting Protein 5'UTR: RAB11FIP3

The marker Blut2 shows a methylation signal in the peripheral blood, in the other relevant body fluids it is unmethylated. The locus is located on band p13.3 of chromosome 16, on the minus strand, in an unclassified and non-coding regulatory sequence region, about 1000 bp in the 5 'direction away from the protein coding gene RAB11FIP. The Rab11 effector protein regulates vesicle transport from the endosomal recycling compartment in the plasma membrane and participates in the receptor-mediated endocytosis of the endosomes. In addition, it acts as a regulator of cell polarity. In the literature, RAB11FIP is also described as an oncogene whose overexpression has been observed in some breast tumor species (Melchor et al., 2006). Whether there is a connection between the blood 2 locus and the RAB11 gene is questionable. In any case, cis-active regulatory elements are often located a long way from their target gene, so the blood2 locus could well be related to RAB11FIP.

1.2.1.2 Construction of the amplificate: The 232 bp-long blood 2-amplicon, like blood-1, contains no CpG-islands. The average GC content in its genomic sequence is 47% (Table 5). There are three SNPs in the fragment. An SNP is located in the target sequence of the 2r-SNuPE primer. This SNP (rs73494349) has so far only been described in a single work on two investigated genotypes of an African population. The alleles C and T are indicated for the plus-strand, each with a frequency of 0.5. There are no frequency specifications for the other two SNPs.

For SNuPE analysis, two different CpGs are used in the blood 2 marker ( FIG. 17 ; Genomic sequence of the blood2 locus. The CpG dinucleotides are marked in yellow, the three known SNPs are green, the primer sites are highlighted in gray (forward primer dark gray, reverse primer light gray), the two cytosines whose methylation is measured in the SNuPE assay are marked in red and the binding sites of the two SNuPE primers are underlined.).

1.2.1.3 Methylation Patterns - Bisulfite Sequencing Results: FIG. 18 (DNA methylation at Blood 2 locus includes five samples of menstrual blood, saliva, sperm, and vaginal fluid, as well as six samples of peripheral blood, each column representing a sample.) The rows represent the 7 analyzed CpGs within the amplicon of the DNA methylation correspond to a color value in the continuous color transition from yellow (= 0% methylation) to blue (= 100% methylation) - corresponding to the color scale on the right side The two analytical CpGs are surrounded by black rectangles) shows the results of the Bisulfite sequencing including the two analytical CpGs (cg102 and cg163). The menstrual blood is weakly methylated in this locus, which is due to the proportion of peripheral blood in menstrual blood. The target CpG (cg102) of the f1-SNuPE primer shows the highest discrimination potential.

1.2.1.4 Target region - SnuPE: The bisulfite-converted sequence of the blood 2 marker has a GC content of 30%, so that even in this case the high proportion of A and T bases reduces the melting temperatures of the primers. Nevertheless, two SNuPE primers could be designed, which have proven to be good discriminators (see FIG. 17 ). The first extension primer Blut2-fl detects in the forward direction ( FIG. 19 ; The reaction of the forward SNuPE primer Blut2-f1. The amplicon sequence is depicted in the 3'-5 'direction. Since the amplicon is on the 1st bisulfite strand, the 3 'end of the forward primer becomes either a C (black, a) on the methylated sequence or a T (red, b) on the unmethylated amplicon Extended), the second primer Blut2-r2 in the reverse direction ( FIG. 20 ; Reaction of the reverse SNuPE primer Blut2-r2. The amplicon sequence is shown in the 5'-3 'direction. The r2 primer is extended at its 3 'end either by a G (blue, a) on the methylated sequence or by an A (green, b) on the unmethylated amplicon sequence.). Here, too, the simultaneous analysis of two different CpGs can provide additional analytical certainty.

The two primers are 25 and 26 bases long and can be analyzed simultaneously in a diplex approach. Due to the different sized color markers of the incorporated ddNTPs, the blue-green detecting primers have a slightly different running behavior in the POP7 polymer than the red-black detecting primers. Therefore, the distance between the two primer signals in the FIG. 21 (Simultaneous detection of the blood 2 SNuPE primers r2 (blue-green) and fl (black-red); illustration of a plot window after data evaluation with GeneMapper ID 3.2.) Larger than one base.

1.2.1.5 Detection sensitivity and reproducibility of the results: For the blood 2 marker, the series of measurements was carried out with DNA from peripheral blood. In the FIG. 22 (Marker Blut2 - Measurement of the detection sensitivity of the SNuPE primers fl (a) and r2 (b) in four independent analyzes of eight different concentrations of blood DNA, the amounts of DNA used per PCR are listed on the abscissa). are the results of the analysis repeats for the two 1f and 2r primers shown separately. The PCR amplicons could already be generated in the PCR using 25pg DNA. As stable one can look at the analysis from 500 pg DNA.

1.2.1.6 Detection of the target liquid in mixtures: For the marker Blood2, the same sample series with different blood DNA portions was used as for the marker Blood1. The rest of the samples contained an equal concentration (20ng / μl) consisting of DNA from vaginal fluid, semen and saliva.

The FIG. 23 (Marker Blood2 - measurement of peripheral blood in a fluid mixture with primers fl (a) and r2 (b)) The target value (black) corresponds to the calculated methylation value resulting from the values of the five body fluids and the proportion of blood The actual value (red) corresponds to the actually detected value.) Shows that the expected values are essentially congruent with the values measured in the mixtures. A mutual influence of the different samples does not seem to take place.

1.2.1.7 Individual distribution of methylation values: For the validation of the blood2 marker, 20 different samples of five body fluids - peripheral blood, menstrual blood, vaginal fluid, saliva and semen - were also measured in a first round. In the FIG. 24 (Marker Blut2 - box plot for the distribution of methylation values in 20 DNA samples of 5 body fluids, measured with SNuPE primer fl (a) and r2 (b)) summarizes the results of this experiment.

The values of menstrual blood overlap slightly with blood levels. The other liquids are easy to distinguish. The fl primer ( FIG. 24a ) distinguishes the peripheral blood more clearly from the other liquids and is more suitable for the detection of blood in mixtures.

1.2.1.8 Extended validation: For the further statistical validation of the blood 2 marker, the same 80 blood samples were used, which were also analyzed with the bloodl marker. The age distribution of blood donors is in the FIG. 12 displayed. The peripheral blood blood 2 results from the first validation round and this large validation were summarized below. Two samples failed during the analysis.

In the FIG. 25 (Marker Blood2 - Distribution of methylation values of n = 98 blood samples.) The values of the two SNuPE primers f1 and r2 are shown in different colors, the blue bars show the results of the fl primer and the red ones of the 2r primers the abscissa indicates the value groups, the division into groups depending on the totality of the values is chosen arbitrarily, the ordinate lists the number of samples whose values fall into the corresponding category.) the results are shown. The methylation values of both SNuPE primers f1 and r2 show a relatively good normal distribution. Most values are between 31 and 40 percent methylation. The average methylation value of both primers is 35% methylation. The scattering of f1 values ranges from 20 to 50% methylation, with r2 primers being 19 to 52% methylated. In this respect, the results are consistent with the smaller validation study.

For the determination of the outliers, twice the standard deviation from the mean was used as the statistical measure. Accordingly, all values of the fl-primer are within the tolerance range (21.4 to 48.2%). For the 2r primer (tolerance range 20.1 to 50.5%), according to this outlier definition, there are 5 values that are outside the tolerance limits. The samples with the extreme readings were repeatedly analyzed and their values confirmed.

There was no age or gender dependency.

1.2.1.9 Forensic validation: The marker Blood2 was tested on the same set of forensic samples as the other markers.

In the FIG. 26 (Marker Blood 2-fl - Methylation results of the simulated forensic traces stored under dry and humid conditions, as well as on the outside The storage period is 1, 2, 3 and 6 months The values from the different aging times are differentiated by color (see legend) Peripheral blood (a), menstrual blood (b), vaginal fluid (c), saliva (d) and sperm (e) The starting methylation value of the corresponding fluid in marker Blood2 is prefixed with t0.) The results of this experiment are for the first SNuPE primer fl shown. The methylation signal of the blood sample is relatively low at zero time with 19% methylation. This value remains almost unchanged for the blood samples when stored dry for 6 months. The blood samples stored outside show a steadily increasing methylation signal over time. A 6-month-old sample was not amplifiable - probably the material was decomposed by microbiological action ( Figure 26a ).

1.2.1.10 Next Generation Sequencing: The results from the first NGS experiment, which should serve to verify the accuracy of the methods used in the work, are available in the FIG. 28 (Marker Blood2 - Comparison of Methylation Results from a Same Blood Sample from Four Different Analysis Methods: Bisulfite Sequencing, Single Nucleotide Primer Extension, and Next Generation Sequencing with Roche454 (786 Reads) and Illumina MiSeq (7494 Reads) The values of the r2 CpG are dark violet, the values of the fl-CpG shown in light purple.). The values of the two CG sites (fl and 2r) used in the SNuPE assay show relatively comparable methylation values in all measurements. 2 Menstrual blood: Two markers have been developed for the detection of menstrual blood. The results of the second marker are not shown in this work.

2.1 Methylation Marker Mens-1 2..1.1 The Genort Properties

Table 6 The Genort Description of the Marker Mens-1 marker Chr CpG island Gene symbol gene Locus architecture Mens 1 12 Yes (69% GC) 25cg / 293bp SLC26A10 Solute Carrier Family 26 Members 10 Pseudogenes (Chloride / bicarbonate exchanger) 5'UTR: SLC26A10 in the NMD region

The marker Mens-1 is methylated in menstrual blood and endometrium. In other relevant body fluids, including peripheral blood, it is unmethylated. The Mens1 locus is located on chromosome 12 and the plus strand of band q13.3. He walks in the middle of a gene-associated processed Transcript sequence - the nonsense-mediated mRNA decay (NMD) - from the protein-encoding gene SLC26A10. The NMD is a quality control mechanism in eukaryotic cells that prevents the expression of truncated proteins by detecting premature (nonsense) stop codons in the mRNA and eliminating these erroneous transcripts. The SLC26A10 encodes a solute transport protein and belongs to the gene family SLC26 (Solute carrier family). The transport protein normally has a cellular function as a multifunctional anion exchanger for mono- and bivalent anions such as chloride and bicarbonate. However, member A10 of the SLC26 family is probably a pseudogene since it does not show an open reading frame. Many of the other intact members of the gene family have tissue-specific gene expression.

2.1.1.1 Construction of the amplificate: The 293 bp Mensl amplicon contains at least one CpG island at the 5'- end of the CpG island search program of the European Institute of Bioinformatics (http://www.ebi.ac.uk). End of the fragment. By definition, CpG islands are regions in the genome that have a GC content of at least 60% and a statistically increased density of CG dinucleotides. They are most often found within promoter regions in the 5'-UTR in front of the genes (Beck 2003). The properties of the Mens1 locus largely correspond to these data (see Table 6).

There is also a known SNP in the Mens1 fragment, but there are no frequency indications for this. For the SNuPE analysis, two adjacent CpGs are used in a single detection system ( FIG. 29 ; Genomic sequence of the Mens1 locus. The CpG dinucleotides are marked yellow, a known SNP green and the primer sites are highlighted in gray (forward primer dark gray, reverse primer light gray). The two cytosines used in the SNuPE assay to measure methylation are marked in red and the binding site of the two methylation- and non-methylation-specific SNuPE primers is underlined.)

2.1.1.2 Methylation Patterns - Results of Bisulfite Sequencing : The Color Distribution of the Endometrial Specimen in FIG. 30 (DNA methylation at the Mens1 locus includes six peri-perineal samples, one endometrial sample, six samples of menstrual blood, and five samples each of saliva, semen, and vaginal fluid.) Each column represents a sample The percentage of DNA methylation corresponds to a color value in the continuous color transition from yellow (= 0% methylation) to blue (= 100% methylation) - according to the color scale on the right side The two analytical CpGs are through outlined in black rectangles) makes it clear that the high degree of methylation of the menthol blood compared to the other body fluids in the 21 CpGs shown results from the proportion of endometrial tissue. In the latter case, CpGs 155-247 appear to be 100% methylated. The two analytical CpGs cg155 and cg170 selected for this work show a relatively high degree of methylation and, on the other hand, are completely unmethylated (0%) in the remaining four liquids.

2.1.1.3 Target region - SnuPE: The bisulfite-converted sequence of the Mensl marker has a GC content of 46% and 25 CG dinucleotides. Due to the high CpG density in the amplicon (see FIG. 29 ) no conventional extension primers could be designed. The normal primers must not contain CpGs within the binding sites so that they can bind to the sequence regardless of the methylation status. Therefore, two primers were developed, each of which specifically bind to the methylated or unmethylated Mensl amplicons. This design principle has already been described in detail in chapter 2.2.5.4. The location of the Fm and Fnm primers is in the FIG. 31 (The reaction of the sequence-specific SNuPE primers Mensl-Fm and Fnm.) The amplicon is located on the 1st bisu-strand and the amplicon sequence is shown in the 3'-5 'direction, with the methylation-specific Fm primer (a) only binding those amplicons methylated on the two underlined target CpGs and extended at its 3 'end by a G (blue) .The non-methylation-specific Fnm primer (b), on the other hand, binds to amplicons attached to the two CpGs are not methylated, and is extended by a T (red).). Both detect in the forward direction.

The methylation-specific primer Fm (blue signal) consists of 19 and the non-methylation-specific primer Fnm (red signal) of 21 bases, so that both signals are detected at a certain distance from one ( FIG. 32 ; Detection of the Mensl-SNuPE primer system. The methylation-specific Fm primer shows the blue signal and the non-methylation-specific Fnm primer the red signal. Illustration of a plot window after the data analysis with GeneMapper ID 3.2.). Assuming that the primers have equal binding affinity to their target sequence, the ratio of the two primer signals to each other will reflect the methylation status of the sample (in U.S. Pat FIG. 32 : 75% methylation).

2.1.1.4 Detection sensitivity and repeatability of results: In FIG. 33 (Marker mensl - measurement of detection sensitivity in each of four independent analyzes of eight different concentrations of menstrual blood DNA, the DNA amounts used per PCR are listed on the abscissa) the results of the sensitivity determination are shown. The measurement was performed with menstrual blood DNA. The indicated amounts were measured from four different DNA extracts.

Stable and reproducible measurements are achieved from 1000pg.

2.1.1.5 Detection of the target liquid in mixtures: A mixture analysis was carried out according to the previously described pattern to determine any mutual influence of the different liquid DNA ( FIG. 34 ; Marker Mens1 - Measurement of menstrual blood in a fluid mixture. The target value (black) corresponds to the calculated methylation value, which results from the values of the five body fluids, and the proportion of blood DNA in the respective mixed sample. The actual value (red) corresponds to the actually detected value.).

The measurement points for the methylation of the menstrual blood DNA at 20, 40 and 60% proportion of menstrual blood DNA in mixture are slightly higher than the expected values. This does not imply mutual influence of the liquids.

2.1.1.6 Individual variation of the methylation values: The degree of overlap of the individual value groups is in FIG. 35 (Marker Mensl - box plot for the distribution of methylation values in 20 DNA samples of 5 body fluids, measured with SNuPE primers F3m + F3nm.). The mean methylation status of the menstrual blood samples is 50.4%. A blood sample has shown a methylation signal of 13% and a saliva sample of 3%. The remaining samples of peripheral blood, vaginal fluid, saliva and semen are 0% methylated.

2.1.1.7 Extended Validation: To analyze the distribution of values, 96 samples from 60 subjects were examined. Some subjects did not give exact age information ( FIG. 36 ; Age of the subjects for menstrual blood (n = 60).). In the diagram of FIG. 37 (Marker Mensl - distribution of the methylation values of n = 96 menstrual blood samples (60 subjects). The abscissa indicates the value groups, the division into groups depending on the totality of the values, is arbitrarily chosen on the ordinate the number of samples whose values fall into the corresponding category) all samples were recorded, regardless of the cycle day. This was initially intended to depict the forensic reality. Nevertheless, it seems to be approximately a normal distribution. The mean value of methylation in the extended validation is 48%. From 10 persons samples were taken on day 1 until the last day of bleeding. The last day of bleeding depended on each subject's cycle days 3 through 6. This resulted in 46 scores. In the Figure 38 (Marker Mensl - Methylation values during the course of bleeding days.) The data points of bleeding days 1 to 5 are shown in the form of individual columns: 16 values for day 1, 28 values for day 2, 22 values for day 3, 15 values for the 4th day and 11 values for the 5th day The methylation values are arranged in the five bleeding-day groups of minimum value to the maximum value, the horizontal lines indicate the mean of the methylation values.) All 96 measured values are divided after the days of bleeding.

The number of values for the individual bleeding days are different, because by far most of the subjects were taken only one sample. In the majority of the subjects, day 2 was the day of the strongest bleeding, when the sample was taken. In contrast, day 5 is no longer perceived as the day of bleeding in most of the test persons; the number of values obtained is correspondingly lower. The extremely low levels of methylation (n = 12) are in most cases most likely to be artifacts, which can be explained by the nature of the sample: The marker is a differentially methylated CpG in the endometrium.

2.1.1.8 Forensic validation: The menstrual blood samples have also been subjected to the described simulated and standardized forensic influences. The methylation values of the marker remain largely stable under the forensic conditions under investigation in the target liquid menstrual blood. For a menstrual blood sample stored wet for 6 months, the methylation signal is failed ( Figure 39b ; Marker Mensl - Methylation results of the simulated forensic traces stored under dry and humid conditions, as well as externally. The storage period is 1, 2, 3 and 6 months. The values from the different aging times are differentiated by color (see legend). Peripheral blood (a), menstrual blood (b), vaginal fluid (c), saliva (d) and sperm (e). The initial methylation value of Marker Mensl is indicated as t0.). In the remaining body fluids the methylation values remain at the initial value t0. The only exception is the methylation value of a saliva sample - stored moist for 2 months - ( Figure 39d ).

2.1.1.9 Next Generation Sequencing; To what extent the SNuPE detection method reflects the actual methylation situation of a given menstrual blood sample has been tested by NGS. The methylation-specific SNuPE primer binds to the amplicon only when both CG positions - 155 and 170 - are methylated. The non-methylation-specific primer only binds to those sequences which are not methylated at both sites. The sample ( FIG. 41 ; Marker Mensl - Comparison of methylation results from a single menstrual blood sample from four different analytical methods: Bisulfite Sequencing, Single Nucleotide Primer Extension, and Next Generation Sequencing with Roche454 (977 reads) and Illumina MiSeq (4404 reads). In bisulfite sequencing, there were two separate values for CG155 and CG170; they are shown separately. In the results of the two NGS experiments, the values are shown only from those sequences methylated in the two target CpGs CG155 and CG170.) Shows 7% methylated sequences in both NGS experiments (Roche-454 and Illumina MiSeq) CG155 and unmethylated CG170 and 1% sequences with unmethylated CG155 and methylated CG170. The proportion of sequences methylated at both sites is 27% for Roche-454 and 29% for Illumina MiSeq. 3 saliva: Two markers were developed for the detection of saliva. Both markers detect saliva by the presence of a methylation signal. The first marker Spei-1 distinguishes saliva from all other body fluids. The second marker Spei-2 distinguishes saliva from vaginal fluid.

3.1 Methylation Marker Spei-1 3.1.1 The Genort Properties

Table 7 The locus description of the marker Speil marker Chr CpG island Gene symbol gene Locus architecture Spei 1 2 No (58% GC) 13cg / 211bp Sox11 Transcription factor Sox11 332500bp-5'UTR: SOX11

The marker Spei-1 shows a methylation signal in the saliva. It is completely unmethylated in other tissues tested, such as peripheral blood, menstrual blood, semen, urine vaginal fluid and skin. The Spei1 locus is located on the minus strand, on the last band p25.2 of the second chromosome. In this region, an unclassified and non-coding regulatory sequence has an elevated GC content and a zinc finger Motif. The next protein coding gene is SOX11 332500bp in the 3 'direction away from the locus. The gene belongs to the SRY (sex determinating region of Y) box related genes. The Sox proteins, like SRY, contain an HMGbox DNA-binding domain that is highly conserved in many mammals (Jay et al., 1995). The transcription factor SOX11 plays a role especially in the early embryonic development of the central nervous system and is expressed in immature neurons, but not normally in all other adult tissues. Thus, as expected, the promoter region of this gene should be methylated in all adult tissues. Decisive for the expression of the gene, however, seems to be only the CpG island immediately adjacent to the promoter. However, since the Spei1 locus is over 3 million bases away from SOX11, it is unlikely to be directly related to the regulation of the gene. The expression of the SOX11 gene in the adult organism is associated with the progression of various tumors. The upregulation of the SOX11 gene is therefore often used for diagnostic purposes for various tumors. For example, high levels of the Sox11 protein are detected in the conventional form of mast cell leukemia (cMCL), but in the mild form - with a better survival rate, but not. SOX11 also appears to be involved in the development of malignant melanoma, lung carcinoma, certain types of breast and ovarian carcinoma.

3.1.1.1 Construction of Amplicon : The 211bp Speil amplicon contains no CpG islands. The average GC content in its genomic sequence is 58% (Table 7). There are two SNPs on the plus leg. The first (rs17356301) has alleles A and G, where A is the wild-type allele. This SNP has been tested in 980 individuals from Europe, Asia and Africa. Most Europeans and all Asians have the homozygous A allele, the frequency of A / G heterozygotes is between 0.033 and 0.333 depending on the population. The second SNP (rs1722379) is located in the target sequence of the reverse primer ( Figure 42 ; Genomic sequence of the Spei1 locus. The CpG dinucleotides are marked in yellow, two known SNPs are green and the primer sites are highlighted in gray (forward primer dark gray, reverse primer light gray). The two cytosines used in the SNuPE assay to measure methylation are marked in red and the binding site of the two methylation- and non-methylation-specific SNuPE primers is underlined.). However, there is no information on the frequency of this SNP. For the SNuPE analysis, two adjacent CpGs are used in a single detection system.

3.1.1.2 Methylation Patterns - Results of Bisulfite Sequencing : The amplicon Spei1 contains 10 CpGs, which were examined for their degree of methylation in bisulfite sequencing. The greatest difference between saliva and other fluids in this study is shown by cg49 and cg82 ( FIG. 43 ; DNA methylation in the Spei1 locus. Each includes six samples of peripheral blood, menstrual blood, saliva, sperm and vaginal fluid. Each column represents a sample. The rows represent the 10 analyzed CpGs within the amplicon. The percentage values of DNA methylation correspond to a color value in the continuous color transition from yellow (= 0% methylation) to blue (= 100% methylation) - corresponding to the color scale on the right side. The two analytical CpGs are surrounded by black rectangles.). However, cg82 and cg88 are used for the SNuPE analysis. This has a reason. The CpG 49 was previously also investigated by SNuPE. Unlike in bisulfite sequencing, CpG showed methylation signals not only in saliva, but also in vaginal fluid and sperm. Therefore, the CpG 49 appeared unsuitable for a SNuPE assay. The color scale shows that these two markers differentiate saliva from the 4 remaining body fluids.

3.1.1.3 Target region - SnuPE: The bisulfite-converted sequence of the Spei1 marker has a GC content of 36% and 13 CG dinucleotides. It is clear from the results of bisulfite sequencing that the major differences in methylation status are at the 5 'end of the amplicon (in the FIG. 43 above). In order to measure the target CpGs, the detection system with two sequence-specific primers described in the Menl marker (chapters 3.4.1.4 and 2.2.5.4) was developed. These bind specifically to the methylated or unmethylated Speil amplicons and detect in the forward direction. The location of the Fm and Fnm primers is in the FIG. 50 (The reaction of the sequence-specific SNuPE primers Speil-Fm and Fnm.) The amplicon is located on the 2nd Bisu strand, the amplicon sequence is shown in the 3 'to 5' direction, and the methylation-specific Fm primer (a) only binds those amplicons methylated on the two underlined target CpGs and extended at its 3 'end by a T (red) .The non-methylation-specific Fnm primer (b), on the other hand, binds to amplicons attached to the two CpGs are not methylated, and is extended by a C (black).).

The Fm primer consists of 20 and the Fnm primer consists of 21 bases. Due to the slightly larger red fluorescent group of the ddNTPs, the red signal of the Fm primer appears to be larger than the black signal of the Fnm primer ( FIG. 45 ; Detection of the Speil-SNuPE primer system. The methylation-specific Fm primer shows the red signal and the non-methylation-specific Fnm primer the black signal. Illustration of a plot window after the data analysis with GeneMapper ID 3.2.). Assuming that the primers have equal binding affinity to their target sequence, the ratio of the two primer signals to each other will reflect the methylation status of the sample. In FIG. 45 it is 68% methylation.

3.1.1.4 Detection sensitivity and reproducibility of the results: The detection sensitivity of the system is given in FIG. 46 (Marker Spei1 - measurement of detection sensitivity in each of three independent analyzes of eight different concentrations of salivary DNA, the amounts of DNA used per PCR are listed on the abscissa.). For the Spei1 marker, the series of measurements was carried out with salivary DNA. Stable signals result from 200 pg of inserted DNA.

3.1.1.5 Detection of the target liquid in mixtures: This marker was also tested in mixtures of target liquid and the other body fluids. DNA samples containing 100%, 80%, 60%, 40%, 20% and 0% salivary DNA were used. The rest of the samples consisted of an equally concentrated (20ng / μl) DNA mixture of the remaining 4 liquids. The FIG. 47 (Marker Spei1 - Measurement of saliva in a liquid mixture.) The setpoint (black) corresponds the calculated methylation value, which results from the values of the five body fluids, and the proportion of blood DNA in the respective mixed sample. The actual value (red) corresponds to the actually detected value.) Shows the result of this examination. The measurement points for the methylation of salivary DNA are almost parallel to the expected values. With 0% salivary DNA in the mixture, the expected value corresponds to the actually measured value (0% methylation), so that no appreciable influence of the saliva-specific signal by other fluids can take place.

3.1.1.6 Individual variation of methylation values: The reliability of the differentiation between saliva and the remaining 4 fluids was investigated in a first validation round with 20 samples of each of the 5 fluids ( FIG. 48 ; Marker Spei1 - box plot for the distribution of methylation values in 20 DNA samples of 5 body fluids, measured with SNuPE primers Fm + Fnm. The saliva samples have a relatively broad spread and an average methylation of 46%. The lowest detected methylation value is 20%. Menstrual blood and vaginal fluid show very little scatter, peripheral blood and sperm none at all. A vaginal fluid sample has shown a methylation signal of 9%.

3.1.1.7 Extended validation: Because of the theoretically possible exogenous influencing variables , a larger validation study was carried out with 80 further samples. The samples came from the sample store of the company LFA GmbH. These are in any case samples of individuals who have given written consent to the scientific use of this material. The FIG. 49 (Age of subjects for saliva whose samples were included in the study of the two salivary markers Spei1 and Spei2, 45 males and 55 females (n = 100).) Reflects the age distribution of the entire panel of volunteers. The proportions of subjects in the different age categories are well distributed.

The saliva results of the first validation round (previous chapter, FIG. 48 ) and the extended validation with 80 samples are summarized below. A sample has failed. The results are in the FIG. 50 (Marker Spei1 - distribution of methylation values of n = 99 saliva samples.) The abscissa indicates the value groups, with the division into groups being arbitrary, depending on the totality of the values.The ordinate indicates the number of samples enumerated, whose values fall into the corresponding category.). The totality of the methylation values of the Spei1 marker is approximately normal. Most samples have 51 to 60% methylation. The average methylation value is 53%, which is higher than the average salivary samples of 46% methylation in the small validation round. For the determination of the outliers, twice the standard deviation from the mean was used as the statistical measure. Accordingly, 4 values are below the tolerance range (13.8 to 89.1%). A pronounced age-dependence of the methylation values may also be important in forensic analysis, because it may allow conclusions to be drawn regarding the age of the tracker. Gender can also influence the methylation. In the FIG. 51 (Marker Spei1 - Sex and age dependence of the methylation values The data points of the two sexes of the subjects is colored differentiated, the results of the male subjects are shown in blue and the results of the female samples are pink. The age is plotted on the abscissa. The data points have a linear trend line, which is also shown in the above mentioned gender colors.) The values from the statistical validation are differentiated according to age and gender.

The average methylation is 56% for male samples and 48% for female samples. The presentation in the FIG. 51 also shows that actually a dependence on age exists. In the forensic context, this is probably not strong enough.

3.1.1.8 Forensic Validation: The Figure 52a-e (Marker Spei1 - Methylation results of simulated forensic traces stored under dry and humid conditions, as well as externally.The storage time is 1, 2, 3 and 6 months.The values from the different aging times are differentiated (see legend) (a), menstrual blood (b), vaginal fluid (c), saliva (d), and sperm (e) The initial methylation level of marker Spei1 is marked t0.) shows the results of the forensic simulation study. The conditions correspond to the standardized procedure described in the Methods section. Under moist storage conditions, either the methylation is not maintained or the complete DNA is - probably - degraded by microbial or fungal action after 3 months in the saliva sample ( Figure 52d ). Under the other conditions - "dry" and "outside" the signals of all liquids remain stable. In the FIG. 53 (Marker Spei1 - box plot for methylation distribution in the age-aging experiment, including all values of the corresponding liquid from the entire experiment.) Shows that even after pooling all values from the aging experiment, there is no overlap between the saliva Values on the one hand and the values of blood, menstrual blood, vaginal fluid and semen on the other hand arise.

3.1.1.9 Next Generation Sequencing: NGS was used to assess the extent to which the routinely applied SNuPE detection method reflects the actual methylation situation of the Spei1 locus. The most objective measurement method at the moment is NGS because it basically determines the methylation status of the individual molecules.

In the SNuPE analysis, the methylation value of the marker is dependent on the methylation properties of the two adjacent CpGs - CG82 and CG88 - (the number indicates the position of the CpG in the amplicon). The methylation-specific Fm primer binds to the amplificate only when methylated at both CG positions 82 and 88. The non-methylation-specific Fnm primer only binds to those sequences which are not methylated at both sites. As with the marker Mens1, this raises the question - are there sequences that are methylated either only at the first or only at the second position. This question can be answered with the help of NGS. The sample from the FIG. 54 (Marker Spei1 - Comparison of Methylation Results from a Same Saliva Sample from Four Different Analysis Methods: Bisulfite Sequencing, Single Nucleotide Primer Extension, and Next Generation Sequencing with Roche and Illumina Technology.) Bisulfite sequencing gave CG82 for both positions and CG88 are two separate values, they are shown separately the results of the two NGS experiments are shown only for those sequences methylated in the two target CpGs CG82 and CG88.) shows 22% (Roche454) and 26% (Illumina MiSeq) methylated CG82 sequences in the NGS and unmethylated CG88. There were no sequences with unmethylated CG82 and methylated CG88. The proportion of sequences methylated at both sites is 33% for Roche454 and 36% for Illumina MiSeq. Thus, the lower values for SNuPE (23%) and the higher values for bisulfite sequencing (46% and 83%) are discussed in Chapter 4.5. Upon realizing that the two analytical CpGs were unequally methylated, a second methylation-specific SNuPE primer was developed, whose target sequence is methylated at position CG82 and unmethylated at position CG88.

3.1.2 Methylation Marker Spei-2 3.1.2.1 The Genort Properties

Table 8 The locus description of the marker Spei2 marker Chr CpG island Gene symbol gene Locus Architectur Food 2 10 No (55% GC) 9cg / 292bp WBP1L / OPA1L WW domain protein 1-like binding 3 'end: exon WBP1L-001 (OPA1L, C10orf26)

The marker Spei-2 distinguishes saliva and vaginal fluid from each other. It shows a methylation signal in the saliva and it is unmethylated in the vaginal fluid. In semen, peripheral blood and menstrual blood, the marker is also methylated. The Spei2 locus is located on the plus strand, on the band q24.32 of chromosome 10.

The 3 'end of the amplicon (169 of 305bp) is located in an exon of the pseudogene WBP1L (WW domain binding protein 1-like). This gene has become known as OPA1L (Outcome predictor in acute leukemia 1) since it has been used for some time for diagnostic purposes of childhood acute lymphoblastic leukemia (ALL). OPA1L expression can not be used as an independent and sole diagnostic feature for ALL. Especially in patients with intensive drug and chemotherapeutic treatment OPA1L expression was not significantly high. Furthermore, an unclassified regulatory sequence with binding sites for proteins that have a helix-turn-helix motif extends across the entire Spei2 locus.

3.1.2.2 Construction of the Amplificate: The 292bp Spei2 amplicon contains no CpG islands. The average GC content in its genomic sequence is 55% (Table 8). There are several SNPs in the section. There are no frequency data for any of these polymorphisms. Two SNPs are within CpG dinucleotides and one in the target sequence of the reverse primer ( FIG. 55 ; Genomic sequence of the Spei2 locus. The CpG dinucleotides are marked yellow, the known SNPs green and the primer sites are highlighted in gray (forward primer dark gray, reverse primer light gray). The CpG dinucleotide used in the SNuPE assay for the measurement of methylation is marked in red and the binding site of the 3r-SNuPE primer is underlined.). For the SNuPE analysis, a CpG is used which does not contain SNP.

3.1.2.3 Methylation Patterns - Bisulfite Sequencing Results: In FIG. 56 (DNA methylation at the Spei2 locus includes five samples of peripheral blood, menstrual blood, saliva, sperm, and vaginal fluid, each column representing a sample.) The lines represent the 7 analyzed CpGs within the amplicon. Methylation corresponds to a color value in the continuous color transition from yellow (= 0% methylation) to blue (= 100% methylation) - corresponding to the color scale on the right The analytical CpG is surrounded by the black rectangle.) The results of the bisulfite sequencing on 7 CpGs of the Spei2 amplicon are shown. The differences in color make it clear that the cg245 distinguishes saliva and semen from other body fluids. This CpG can also be used to differentiate vaginal fluid from all other body fluids. In vaginal fluid, it is completely unmethylated.

3.1.2.4 Target region - SnuPE: The bisulfite-converted sequence of the Spei2 marker has a GC content of 29% and 9 CpGs. The high proportion of A and T bases reduces the melting temperatures of the primers. These must be correspondingly longer to be analyzed under uniform temperature conditions with other markers together. Of three SNuPE primers tested, one primer has shown the best distinction between saliva and vaginal fluid. Therefore, in the Spei2 assay, unlike the previously described markers, methylation is measured only at a target CpG ( Figure 57 ; The reaction of the reverse SNuPE primer Spei2-3r. The amplicon is located on the 2nd Bisu strand. The amplicon sequence is shown in the 5'-3 'direction. The 3r primer is extended at its 3 'end either by a C (black, a) on the methylated sequence or by a T (red, b) on the unmethylated amplicon sequence. The SNuPE primer 3r consists of 28 bases. Upon detection of the primer, the black signal represents the proportion of methylated amplicon copies and the red signal represents the proportion of unmethylated copies in the sample. The ratio of the two primer signals to each other, reflects the methylation status of the sample (in the FIG. 58 (Detection of the Spei2-SNuPE primer 3r, illustration of a plot window after the data analysis with GeneMapper ID 3.2.) It is 73% methylation).

3.5.2.5 Detection sensitivity and reproducibility of the results: The detection sensitivity of the Spei2 marker is shown in FIG. 59 (Marker Spei2 - Detection sensitivity measurement in each of four independent analyzes of eight different concentrations of DNA from saliva (a) and DNA from vaginal fluid (b), the DNA amounts used per PCR are listed on the abscissa.). The measurement series were carried out with the target fluid - saliva and additionally with vaginal fluid. The vaginal fluid was analyzed to check if a fluid that is unmethylated in the Spei2 marker shows false-positive results at extremely low concentrations. The vaginal fluid is usually not methylated (average 5% methylation).

Stable in both liquids are the regulations from 500 pg.

3.1.2.5 Detection of the Target Liquid in Mixtures: The mixing experiment based on the same principle as previously described shows a marked decrease in the methylation values of salivary DNA compared to the expected value. Here you have to be influenced by the other liquids go out ( FIG. 60 ; Marker Spei2 - Measurement of saliva in a liquid mixture. The target value (black) corresponds to the calculated methylation value, which results from the values of the five body fluids, and the proportion of blood DNA in the respective mixed sample. The actual value (red) corresponds to the actually detected value.)

3.1.2.6 Individual variation of methylation values: as out FIG. 61 (Marker Spei2 - box plot for the distribution of methylation values in 20 DNA samples of 5 body fluids, measured with SNuPE primer 3r.), There is a complete overlap between the target liquid saliva (average 67% methylated) and sperm (average 82%) % methylated). In contrast, there is no overlap between saliva and peripheral blood, menstrual blood and vaginal fluid.

3.1.2.7 Extended validation: For the large statistical validation of the Spei2 marker, the 80 saliva samples were used, which were also analyzed with the Spei1 marker. The age distribution of the saliva subjects is in the FIG. 49 shown. The results for saliva from the first validation round and the extended validation were summarized below. Five samples failed analysis with Spei2 marker.

The methylation values of the 95 samples measured are approximately normally distributed ( FIG. 62 ; Marker Spei2 - distribution of methylation values of n = 95 saliva samples. On the abscissa, the value groups are given, with the division into groups being arbitrary, depending on the totality of the values. The ordinate lists the number of samples whose values fall into the corresponding category.)

In contrast to the marker Spei1, there is no significant dependence of the methylation values on age and sex in the Spei2 marker.

3.1.2.8 Forensic Validation: The Figure 63a-e (Marker Spei2 - Methylation results of simulated forensic traces stored under dry and humid conditions, as well as externally.The storage time is 1, 2, 3 and 6 months.The values from the different aging times are differentiated (see legend) (a), menstrual blood (b), vaginal fluid (c), saliva (d), and sperm (e) The initial methylation value of marker Spei2 is indicated as t0.) shows the results of the forensic simulation study.

The methylation levels of the Spei2 marker remain largely stable under the forensic conditions studied in saliva as well as in vaginal fluid, sperm and menstrual blood. In the case of saliva, signal failures can be observed under humid conditions and in outdoor conditions. Generally, the salivary signals get higher with time ( Figure 63d ). When examining the blood three-month-old traces show under wet conditions and outside signals higher than the blood-zero value ( Figure 63a ).

The FIG. 64 (Marker Spei2 - box plot for methylation distribution in the age-aging experiment, including all values of the corresponding fluid from the entire experiment.) Shows that except for one salivary and blood value each, the values are stable under forensic conditions stay.

3.1.2.9 Next Generation Sequencing: The marker Spei2 has also been investigated by NGS to verify the actual methylation situation of the Spei2 locus ( FIG. 65 ; Marker Spei2 - Comparison of the Methylation Results at the Target CpG (3r Detection Site) from a Same Saliva Sample from Four Different Analysis Methods: Bisulfite Sequencing, Single Nucleotide Primer Extension and Next Generation Sequencing with Roche454 (415 Reads) and Illumina (2998 Reads )).

For this marker, the measurement accuracy between bisulfite sequencing, SNuPE method, NGS-Roche 454 and NGS-Illumina seems to be very comparable. 4 vaginal fluid: Two markers have been developed for the detection of vaginal fluid. Both markers detect vaginal fluid by the presence of a methylation signal. Both markers Vag-1 and Vag-2 distinguish vaginal fluid from all other body fluids.

4.2.1 Methylation Marker Vag-1 / 1628 4.2.1.1 The Genort Properties

Table 9 The locus description of the marker Vag1 marker Chr CpG island Gene symbol gene Locus architecture Vag-1 2 Yes (58% GC) 20cg / 272bp HOXD4 Sequence specific HXD4 TF Exon: HOXD4-001

The marker Vag-1 distinguishes vaginal fluid from saliva, sperm and peripheral blood. In menstrual blood it is slightly methylated. The Vag1 locus is located on the plus strand, centrally on the long arm of chromosome 2, on the band q31.1.

The entire amplicon (272bp) is located in an exon of the HOXD4 gene whose gene product is a sequence-specific transcription factor. The homeobox (Hox) genes encode transcription factors that regulate the expression of several essential proteins encoding cell differentiation and proliferation target genes. For example, they are involved in skeletal morphogenesis and chondrocyte differentiation. The four gene clusters A, B, C and D from 9 to 11 genes are located on different chromosomes. The HOXD4 gene is predominantly expressed during development in mesodermal tissues and in the central nervous system and is responsible for the tissue-specific morphological development of extremities (Rastegar et al 2004). According to information from mRNA expression data and the UniProtKB database, this gene is ubiquitously expressed. Basically, however, the HOX genes have a complicated expression pattern and are predominantly expressed in the developmental phase of the body.

4.2.1.2 Construction of the amplificate: The 272 bp Vagl amplicon contains at least one CpG island, according to the CpG-In1 search program of the European Institute of Bioinformatics (http://www.ebi.ac.uk). The average GC content in its genomic sequence is 58% (Table 9). There are several SNPs in the section. For the first of the four SNPs there are frequency specifications. This C / T polymorphism (rs75770990) was studied in a group of 118 subjects. In the corresponding work, the C allele showed the incidence of 0.941, the T allele 0.059. A division into homozygous and heterozygous genotypes was not performed. All SNPs are outside the Primer target sequences ( FIG. 66 ; Genomic sequence of the Vag1 locus. The CpG dinucleotides are marked yellow, the known SNPs green and the primer sites are highlighted in gray (forward primer dark gray, reverse primer light gray). The CpG dinucleotide used in the SNuPE assay for the measurement of methylation is marked in red and the binding site of the 1r-SNuPE primer is underlined.)

4.2.1.3 Methylation Patterns - Bisulfite Sequencing Results: The marker used to identify the vaginal fluid was selected using only the Illumina chip analysis and the immediately following SNuPE analysis, because sequencing after bisulfitation was often found to be unreliable. It was the CpG cg38. Later in the work, bisulfite sequencing was still performed to allow a method comparison. The FIG. 67 (DNA methylation in Vag1 (AMP1628) locus includes five samples of peripheral blood, menstrual blood, saliva and semen, and six samples of vaginal fluid, each column representing a sample. The rows represent the 19 analyzed CpGs within the amplicon The percentages of DNA methylation correspond to a color value in the continuous color transition from yellow (= 0% methylation) to blue (= 100% methylation) - corresponding to the color scale on the right The analytical CpG is surrounded by the black rectangle.) shows that the distinction between the vaginal fluid of saliva, blood and semen is also very clear in sequencing. The slightest differences are between vaginal fluid and menstrual blood.

4.2.1.4 Target region - SnuPE: The bisulfite-converted sequence of the Vag1 marker has a GC content of 40% and 20 CpG dinucleotides. Especially the 3'-end of the amplicon is densely populated by CpGs. From several designed SNuPE primers, a primer has shown a good distinction between vaginal fluid and other body fluids. In the Vag1 assay, methylation is measured on only one CpG. The 1r-SNuPE primer detects methylation of the target CpG in the reverse direction ( Figure 68 ; The reaction of the reverse SNuPE primer Vagl-1r. The amplicon is located on the 1st Bisu strand. The amplicon sequence is shown in the 5'-3 'direction. The 1r primer is extended at its 3 'end either by a G (blue, a) on the methylated sequence or by an A (green, b) on the unmethylated amplicon sequence.)

The SNuPE primer 1r consists of 29 bases. He works on the conventional principle of methylation measurement by SNuPE - the extension primer is extended to either the methylated or the unmethylated base. In the detection of the primer, the blue signal represents the proportion of methylated amplicon copies and the green signal represents the proportion of unmethylated copies in the sample. The methylation percentage is calculated from the ratio of the peak of the methylation peak (blue) to the sum of the peak heights for methylation and non-methylation (in the Figure 69 (Detection of the Vagl-SNuPE primer 1r Figure of a plot window after the data analysis with GeneMapper ID 3.2) 52%).

4.2.1.5 Detection sensitivity and repeatability of results: In FIG. 70 (Marker Vag1 - Detection sensitivity measurement in each of four independent analyzes of eight different concentrations of DNA from vaginal fluid; the amounts of DNA used per PCR are on the Abscissa) is shown the result of a sensitivity and stability test with 4 samples each of a concentration.

The limit of detection is that amount of DNA from which a stable repeatability is evident. This value is 200 pg for marker Vag1. Each measurement was performed four times in this case, so you can tell if you are in the stable measurement range or not.

4.2.1.6 Detection of the target liquid in mixtures: In the mixing experiment, the vaginal marker Vag1 gave higher methylation values than the expected values. So you have to assume a mutual influence of the 5 liquid DNAs ( FIG. 71 ; Marker Vag1 - Measurement of vaginal fluid in a fluid mixture. The target value (black) corresponds to the calculated methylation value, which results from the values of the five body fluids, and the proportion of blood DNA in the respective mixed sample. The actual value (red) corresponds to the actually detected value.)

4.2.1.7 Individual variation of methylation values: In FIG. 72 (Marker Vag1 - box plot for the distribution of methylation values in 20 DNA samples of 5 body fluids, measured with SNuPE primer 1r.) The differentiation potential of the marker Vag1 compared to the other body fluids is shown. An overlap of the values is observed only in the menstrual blood.

The vaginal fluid samples have relatively broad scattering and an average methylation of 33%. The lowest detected methylation value is 15%. Peripheral blood, saliva and semen show very little scattering. The mean for menstrual blood is 16% methylation. Between the value group for the vaginal fluid and that for the menstrual blood is an approximately 10% overlap can be seen.

4.2.1.8 Extended validation: In order to obtain statistically relevant data, 55 persons were checked with the two markers Vag1 and Vag2. The age distribution of the subjects is in the FIG. 73 (Age of vaginal fluid subjects whose values were included in the study of Vag1 and Vag2 markers (n = 55).).

Since there is a clear dependence between degree of methylation and cycle time or hormone status (see Figure 75 ; Marker Vag1 - cycle time and age dependence of methylation levels. The data points of the different cycle times are differentiated by color. The results of the samples from the beginning of the cycle (n = 14) are black, the results from cycle middle / ovulation (n = 5) green, the results from cycle end (n = 20) blue and the results of the samples from women with reduced Estrogen levels (menopause or after delivery, n = 6) are shown in red. The age is plotted on the abscissa. At the data points a linear trend line is laid out, which is shown in the corresponding colors.), No normal distribution is to be expected. Most methylation values are between 41 and 50% methylation ( Figure 74 ; Marker Vag1 - Distribution of methylation values of n = 55 vaginal fluid samples. On the abscissa the value groups are given, whereby the division into groups depending on the totality of the values, is chosen arbitrarily. On the ordinate the number of samples whose values fall into the corresponding category is listed). The mean of the methylation is 39%.

Significant dependencies on cycle timing and age could be important in assessing a trail. In the Figure 75 the dependence of the methylation signal on the age and cycle day of women is shown. 41 out of 55 values are included in the diagram, as not all 55 test persons had information on the cycle day.

The methylation values are clearly dependent on the estrogen level: Menopausal or postmenopausal women show markedly reduced methylation values with a mean of 29% compared to the other three groups. The remaining groups show higher levels of methylation and their mean hardly differ (44% at the beginning of the cycle, 43% at the middle of the cycle and 43% at the end of the cycle). A significant age dependency is not observed.

4.2.1.9 Forensic Validation: The forensic simulation experiments are in Figure 76 (Marker Vag1 - Methylation results of the simulated forensic traces stored under dry and humid conditions, as well as externally, for a storage time of 1, 2, 3 and 6 months The values from the different aging times are differentiated by color (see legend) Blood (a), menstrual blood (b), vaginal fluid (c), saliva (d) and sperm (e) The initial methylation value of marker Vag1 is shown as t0.).

Apart from the methylation level of the vaginal fluid sample stored in the wet medium (Figure 76c), the values of all fluids remain relatively stable under the forensic conditions studied. A three month old saliva sample stored wet has not shown any results (Figure 76c)

Figure 77 (Marker Vag1 - box plot for methylation distribution in the age-aging experiment, including all values of the corresponding liquid from the entire experiment) shows that the methylation values do not lose their differentiation potential due to the simulated forensic conditions.

4.2.1.10 Next Generation Sequencing: To what extent the routinely applied SNuPE detection method reflects the actual methylation situation has been tested by NGS ( Figure 84 ; Marker Vag1 - Comparison of the methylation results at the target CpG (1r detection site) from a similar vaginal fluid sample from four different analysis methods: Bisulfite Sequencing, Single Nucleotide Primer Extension and Next Generation Sequencing Roche454 (1638 reads) and Illumina MiSeq (15746 Reads ).).

Bisulfite sequencing shows the lowest readings. From the evaluation method, the bisulfite sequencing of all four methods is the least accurate. The most meaningful are the two different NGS methods used. The SNuPE method may not be as accurate as NGS but the evaluation principle is much clearer and simpler than bisulfite sequencing.

4.2.2 Methylation Marker Vag-2 4.2.2.1 The Genort Properties

Table 10 The locus description of the marker Vag1 marker Chr CpG island Gene symbol gene Locus architecture Vag-2 2 Yes (57% GC) 8cg / 188bp Hoxd 12 Sequence specific TF HXD12 74bp-5'UTR: HOXD12-001

The marker Vag2 distinguishes, like the first vaginal marker Vag1, the vaginal fluid of saliva, sperm and peripheral blood. In menstrual blood he is also slightly methylated. The Vag2 locus is located on the plus strand, on chromosome 2, about 19,000 bp 5 'upstream of the vaginal locus, on the same band q31.1. Vag2 is located in the 5'UTR region of the HOXD12 gene, 74bp away from the first exon. The HOXD12 gene product is a sequence-specific transcription factor encoded as HOXD4 in the HOXD gene cluster on chromosome 2. The Hox genes are expressed during embryonic development along the autonomic axis and regulate the morphogenesis of the extremities. In the adult body, these genes control tissue or organ specificity. Disturbed expression of the Hox genes - including that of HOXD12 - is associated with the development of tumors and progression of metastases.

4.2.2.2 Construction of the amplificate: The 188 bp Vag2 amplicon contains no CpG islands. However, an island is in close proximity in the 5 'direction away from the locus. The average GC content in the genomic sequence of the amplicon is 57% (Table 10). There are 2 SNPs in the section. There are frequency indications for a second SNP, but not for the first one. The SNP rs114010776 is a G / T polymorphism and was studied in a group of 120 subjects. The G allele shows the frequency of 0.975, the T allele 0.025. Again, no division into homozygous and heterozygous genotypes was made. The second SNP is located in the target sequence of the reverse primer ( Figure 79 ; Genomic sequence of the Vag2 locus. The CpG dinucleotides are marked yellow, the two known SNPs green and the primer sites are highlighted in gray (forward primer dark gray, reverse primer light gray). The CpG dinucleotide used in the SNuPE assay for the measurement of methylation is marked in red and the binding site of the 1f-SNuPE primer is underlined.).

4.6.2.3 Target region - SnuPE: The bisulfite-converted sequence of the Vag2 marker has a GC content of 32%. Eight CpG dinucleotides are included. Also in this case, a single SNuPE primer showed the best distinction between vaginal fluid and other body fluids. Thus, Vag2 assay methylation is also measured only on a CpG. The 1f-SNuPE primer detects the methylation of the target CpG in the forward direction ( Figure 80 ; The reaction of the forward SNuPE primer Vag2-1f. The amplicon is located on the 1st Bisu strand. The amplicon sequence is depicted in the 3'-5 'direction. The IF primer is extended at its 3 'end either by a C (black, a) on the methylated sequence or by a T (red, b) on the unmethylated amplicon sequence.).

The SNuPE primer 1f consists of 27 bases. The primer works on the conventional principle of methylation measurement by SNuPE - it is extended to either the methylated or unmethylated base. Upon detection of the primer, the black signal represents the proportion of methylated amplicon copies and the red signal represents the proportion of unmethylated copies in the sample. The ratio of the two primer signals to each other, reflects the methylation status of the sample (in the FIG. 81 (Detection of the Vag2-SNuPE primer 1f. Illustration of a plot window after data evaluation with GeneMapper ID 3.2) 47% methylation).

4.2.2.4 Detection sensitivity and repeatability of results: The Figure 82 (Marker Vag2 - measurement of detection sensitivity in four independent analyzes of eight different concentrations of DNA from vaginal fluid, the amounts of DNA used per PCR are listed on the abscissa.) Shows the result of the sensitivity and stability test with 4 samples of vaginal fluid DNA a concentration.

Stable measurements can be achieved from 500 pg. Again with this marker, we define this value as the sensitivity limit.

4.2.2.5 Detection of the target liquid in mixtures: The possible mutual influence of the different body fluids is checked in the mixing experiment ( Figure 83 ; Marker Vag2 - Measurement of vaginal fluid in a fluid mixture. The target value (black) corresponds to the calculated methylation value, which results from the values of the five body fluids, and the proportion of blood DNA in the respective mixed sample. The actual value (red) corresponds to the actually detected value.)

Here, too, the measuring points for the methylation of the vaginal fluid DNA are slightly higher than the expected values.

4.2.2.6 Individual variation of methylation values: In Figure 84 (Marker Vag2 - box plot for the distribution of methylation values in 20 DNA samples of 5 body fluids, measured with SNuPE primer 1f.) Shows the differentiation potential of the marker Vag2 compared to the other body fluids. An overlap of the values is observed only in the menstrual blood.

The vaginal fluid samples have a relatively broad spread and an average methylation of 34%. The lowest methylation value here is 17%. As with the Vag1 marker, peripheral blood, saliva, and sperm show very little scattering. The mean value for menstrual blood is 16% methylation.

4.2.2.7 Extended Validation: The subject group corresponds to that used in marker Vag1 (see FIG. 73 ).

Due to the dependence of the cycle time or hormone status, which can also be observed with this marker, a normal distribution is not necessarily to be expected. In contrast to the Vagl marker, most of the values show 31 to 40% methylation ( Figure 85 ; Marker Vag2 - Distribution of methylation values of n = 55 vaginal fluid samples. On the abscissa, the value groups are given, with the division into groups being arbitrary, depending on the totality of the values. The ordinate lists the number of samples whose values fall into the corresponding category.). The mean value of methylation here is 40%.

In the FIG. 86 (Marker Vag2 - cycle time and age dependence of the methylation values.) The data points of the different cycle times are differentiated in color: the results of the samples from the beginning of the cycle (n = 13) are black, the results from cycle middle / ovulation (n = 8) green, the Results from cycle end (n = 14) blue and the results of the samples from women with low estrogen levels (menopause or after childbirth, n = 6) are shown in red. The age is plotted on the abscissa. The data points have a linear trend line shown in the corresponding colors.) Depicts the dependence of the methylation signal on women's age and cycle day. 41 out of 55 values are included in the diagram, as not all test persons had information on the cycle day.

Again, menopausal or postmenopausal women show lower levels of methylation compared to the other three groups (on average 22%). Cycle center vaginal fluid samples show the highest mean of 53%. The cycle start and cycle end samples have the same average value of 41% methylation. Thus, the Vag2 marker has a larger difference in values between the different cycle timing groups than the marker Vag1.

4.2.2.8 Forensic validation: The forensic simulation experiments are in the Figure 87 (Marker Vag2 - Methylation results of the simulated forensic traces stored under dry and humid conditions, as well as externally, for storage periods of 1, 2, 3 and 6 months The values from the different aging times are differentiated by color (see legend) Blood (a), menstrual blood (b), vaginal fluid (c), saliva (d) and sperm (e). The initial methylation level of marker Vag2 is shown as t0.).

In the case of vaginal fluid traces, the values remain stable under the forensic conditions simulated here (apart from the methylation value of the sample stored in the moist medium for 2 months (100% methylation) and a signal loss after storage for six months). Figure 87c ). The methylation values of the other liquids also differ only slightly from the zero value.

FIG. 88 (Marker Vag2 - box plot for methylation distribution in the age-aging experiment, including all values of the corresponding liquid from the entire experiment) shows that the methylation values do not lose their differentiation potential due to the simulated forensic conditions.

4.2.2.9 Next Generation Sequencing: Here too, NGS was used to check how well the SNuPE detection method reflects the actual methylation situation ( Figure 89 ; Marker Vag2 - Comparison of methylation results at the target CpG (lf detection site) from a similar vaginal fluid sample from four different analysis methods: bisulfite sequencing, single nucleotide primer extension and Next Generation Sequencing with Roche454 (949 reads) and Illumina MiSeq (9690 Reads).)

At 43%, the SNuPE reading is also slightly lower than the values of the two gold standard methods of the NGS. They are 46% for the Roche measurement and 49% for the Illumina measurement. There are no results of bisulfite sequencing for this marker.

3. 3 Sperm: For the study of sperm, two oppositely detecting markers were developed. With the first marker, admixtures of other liquids in the sperm can be detected. The second marker reacts exclusively to sperm with a specific methylation signal.

3.3.1 Methylation Marker Sperm-1 3.3.1.1 The Genort Properties

Table 11 The Genort Description of the Marker Sperm1 marker Chr CpG island Gene symbol gene Locus architecture Sperm-1 6 No (66% GC) 13cg / 217bp TCP11 T-complex protein homolog 11 5 'end: Exon TCP11-009

The marker Sperm1 is normally completely unmethylated in the male sperm. In the other body fluids (peripheral blood, menstrual blood, saliva and vaginal fluid) and skin it shows almost complete methylation. The locus is located on the p21.31 band of chromosome 6, on the plus strand. Its 5 'end (116bp) is located in an exon of the TCP11 gene. The gene encodes a testicular T-complex protein 11 - a peptide receptor for FPP (fertilization promoting peptide). The biological function of the FP peptide is to mediate capacitation (physiological maturation process of the sperm activated by the cervical fluid in the female genital tract) and acrosome reaction in the sperm head. The TCP11 gene is specifically expressed only in mature and adult testes. Gene expression studies on normal and tumor tissues show a high expression rate in normal testicular tissue and almost no expression in other tissues tested as well as in the testicular tissue in the presence of testicular carcinoma.

3.3.1.2 Construction of amplicon: The 217bp long Sperml amplicon has, the relatively high GC content defies in its genomic sequence (66%), no CpG islands (Table 11). The section contains two known SNPs that are outside primer binding sites. There are frequency indications for the second SNPs. This C / T polymorphism (rs117820670) was studied in a group of 120 subjects. In this work, the C allele showed the incidence of 0.942, the T allele 0.058. A division into homozygous and heterozygous genotypes was also not made here. For the following SNuPE analysis, a - in the amplicon relatively centrally located - CpG is used ( Figure 90 ; Genomic sequence of the sperm locus. The CpG dinucleotides are marked yellow, the two known SNPs green and the primer sites are highlighted in gray (forward primer dark gray, reverse primer light gray). The CpG dinucleotide used in the SNuPE assay for the measurement of methylation is marked in red and the binding site of the 4r-SNuPE primer is underlined.).

3.3.1.3 Methylation Patterns - Bisulfite Sequencing Results: The in FIG. 91 (DNA methylation at the Sperml locus includes five samples of peripheral blood, menstrual blood, saliva and semen, and six samples of vaginal fluid, each column representing a sample.) The rows represent the 9 analyzed CpGs within the amplicon DNA methylation values correspond to a color value in the continuous color transition from yellow (= 0% methylation) to blue (= 100% methylation) - corresponding to the color scale on the right The analytical CpG is outlined by the black rectangle) bisulfite make it probable that at this locus all CpGs allow a distinction between sperm and the other body fluids. The sharpest difference overall was shown by the CpG cg101, which is used as the analytical CpG in the SNuPE assay.

3.3.1.4 Target region - SnuPE: The bisulfite-converted sequence of the sperm marker has a GC content of 38% and 13 CpG dinucleotides are included in the amplicon. The 4r-SNuPE primer showed the best distinction between sperm and other body fluids, so in the Sperml assay methylation was measured only at a CpG. The 4r primer detects methylation of the target CpG in the reverse direction ( Figure 92 ; The reaction of the reverse SNuPE primer Sperml-4r. The amplicon is located on the 2nd Bisu strand. The amplicon sequence is shown in the 5'-3 'direction. The 4r primer is extended at its 3 'end either by a C (black, a) on the methylated sequence or by a T (red, b) on the unmethylated amplicon sequence.).

The SNuPE primer 4r consists of 24 bases. The primer works according to the conventional principle of methylation measurement by SNuPE - it is extended either to the methylated or the unmethylated base. Upon detection of the primer, the black signal represents the proportion of methylated amplicon copies and the red signal represents the proportion of unmethylated copies in the sample. The sperm marker is sperm in its target liquid - almost completely unmethylated and thus shows a single red signal ( Figure 93a ; Detection of the Sperml-SNuPE primer 4r in a semen sample (a) and a blood sample (b). Illustration of two plot windows after data analysis with GeneMapper ID 3.2). The remaining fluids - peripheral blood, menstrual blood, saliva and vaginal fluid - are methylated and show correspondingly black signals ( Figure 93b ). A mixed signal (black and red) - as can be seen in the other described markers - in this case means that in addition to semen at least one other liquid is contained in the sample.

3.3.1.5 Detection sensitivity and repeatability of results: In FIG. 94 (Marker Sperm1 - measurement of detection sensitivity in each of four independent analyzes of eight different concentrations of sperm DNA, the DNA amounts used per PCR are listed on the abscissa) is the result of the sensitivity and stability test with 4 samples of sperm DNA each Concentration shown.

The detection limit for the marker Sperm1 is 100 pg. In principle, every measurement on a biological track is carried out as triplicate measurement, so that one can recognize whether or not one is in the range for a stable measurement.

3.3.1.6 Detection of the target liquid in mixtures: The possible mutual influence of the different body fluids is checked in the mixing experiment ( FIG. 95 ; Marker sperm1 - measurement of semen in a fluid mixture. The target value (black) corresponds to the calculated methylation value, which results from the values of the five body fluids, and the proportion of blood DNA in the respective mixed sample. The actual value (red) corresponds to the actually detected value.)

The agreement between setpoint and actual value is almost perfect with the Sperml marker. No influence of the sperm specific signal is to be determined.

3.3.1.7 Individual variation of methylation values: In Figure 96 (Marker Sperm1 - box plot for the distribution of methylation values in 20 DNA samples of 5 body fluids, measured with SNuPE primer 4r.) Shows the differentiation potential of the marker Sperm1 compared to the other body fluids. An overlap of the values is not observed.

The sperm has a range of 1 to 11% and an average methylation value of 6%. The mean values of methylation in the other fluids are between 91% for saliva and 96% for peripheral blood.

3.3.1.8 Extended validation: In order to obtain statistically relevant data, a total of 91 male subjects were examined with the two semen markers Sperm1 and Sperm2. The age distribution of the subjects is in the ( FIG. 97 ; Age of semen subjects whose values were included in the study of the markers Sperm1 and Sperm2 (n = 91).).

The results of the first round of validation (previous chapter, Figure 96 ) and the large validation with another 71 samples are summarized below. Three samples have failed. The distribution of methylation values is in the Figure 98 (Marker Sperm1 - distribution of the methylation values of n = 88 sperm samples.) The abscissa indicates the value groups, with the division into groups being arbitrary, depending on the totality of the values.The ordinate indicates the number of samples enumerated, whose values fall into the corresponding category.).

The totality of the methylation values of the sperm marker corresponds to an extremely skewed distribution. Most samples have 0 to 2% methylation. The average methylation value is 8%, which is 2% higher than the mean value of semen samples in the small validation round (see Figure 96 ). Of the 88 samples that were measured, 9 showed values greater than 20% methylation. Four specimens fall outside the 2% standard deviation of 35% and thus fall into the category of statistical outlier values. The associated subjects are at the age of 25 to 35 years. The cause has been found by using the vaginal marker: The vaginal fluid is completely methylated in the sperm marker. The subjects had obviously had sexual intercourse shortly before the sample delivery. All samples were from the sperm bank of the Department of Dermatology, University of Bonn.

In the Figure 99 (Marker Sperm1 - Age dependence of methylation values Includes the values of the subjects whose age was known (n = 57) The data points are set in a linear trend line, usually showing the even increase or decrease in values.) Values are off structured according to the statistical validation by age of male subjects.

At first glance, a dependence of methylation values on age seems to exist. However, if you omit the 4 values of the statistical outliers, the regression line is completely parallel to the X axis and shows no age dependency.

3.3.1.9 Forensic validation: The forensic simulation experiments are in Figure 100 (Marker Sperm1 - Methylation results of simulated forensic traces occurring under dry and moist Conditions, as well as outside, were stored. The storage period is 1, 2, 3 and 6 months. The values from the different aging times are differentiated by color (see legend). Peripheral blood (a), menstrual blood (b), vaginal fluid (c), saliva (d) and sperm (e). The initial methylation value of marker Sperm1 is indicated as t0.).

The methylation levels of most traces of liquid are stable under simulated forensic conditions. A 3 month old blood sample shows a 50% reduced methylation signal under humid storage conditions. After a further 3 months storage under the same conditions, however, the lowered signal can not be confirmed again ( Figure 100a ). The humid environment also seems to affect the methylation of semen samples. Here it causes the opposite effect - the methylation increases over time ( Figure 100e ).

The forensic differentiation force is not lost under the forensic conditions, as out FIG. 101 (Marker Sperm1 - box plot for the spread of methylation values in the trace aging experiment, including all values of the corresponding liquid from the entire experiment.).

3.3.1.10 Next Generation Sequencing: It is not surprising from the evaluation method that bisulfite sequencing yields the most inaccurate result when compared to SNuPE and NGS ( Figur102 ; Marker Sperm1 - Comparison of methylation results at the target CpG (4r detection site) from a single semen sample from four different analysis methods: bisulfite sequencing, single nucleotide primer extension, and next generation sequencing with Roche454 (821 reads) and Illumina MiSeq (7276 Reads.)).

The difference between the values from SNuPE analysis and NGS measurement is less than 1%. By means of bisulfite sequencing, the low methylation status of the semen sample could not be detected. Here the result was 0% methylation.

3.3.2 Methylation marker Sperm-2 / Men3 3.3.2.1 The Genort Properties

Table 12 The Genort description of the marker Sperm2 marker Chr CpG island Gene symbol gene Locus architecture Sperm-2 2 No (62% GC) 7cg / 215bp VAMP8 Vasicle-Associated Membrane Protein 8 158bp-3'UTR: VAMP8-003

The marker sperm usually shows complete methylation in the male sperm. In the other body fluids (peripheral blood, menstrual blood, saliva and vaginal fluid) and skin, it is almost completely unmethylated. The Sperm2 marker thus works in the opposite direction compared to the sperm marker. The locus is located on the p11.2 band of chromosome 2, on the minus strand. Its 3 'end is 158 bp away from an exon of the gene VAMP8 (Vasicle-associated mambrane protein 8). The gene encodes an integral membrane protein (receptor) that regulates the fusion of transport vesicles with their target membrane in receptor-mediated exocytosis. For example, regulated secretion in pancreatic-specific acinar cells, mast cells, cytotoxic T lymphocytes, platelets and epithelial cells of the kidney canals are involved (Behrendorff et al., 2011). According to the protein database of the UniProt Consortium (www.uniprot.org), the VAMP8 gene is specifically expressed in platelets. The gene appears to be involved in the carcinogenesis of melanoma by down-regulating it in melanocytes. Hypomethylation of the VAMP8 gene was detected in 82% of breast tumor tissue samples.

3.3.2.2 Construction of the Amplificate: The 215 bp Sperm2 amplicon contains no CpG islands and has an average GC content of 62% (Table 12). The fragment contains two known SNPs that are outside primer binding sites. To the first SNP in FIG. 103 (Genomic sequence of the Sperm2 locus.) The CpG dinucleotides are marked in yellow, the two known SNPs are green and the primer sites are highlighted in gray (forward primer dark gray, reverse primer light gray) The CpG dinucleotide, which is present in the SNuPE Assay used for the measurement of methylation is marked in red and the binding site of the 3r-SNuPE primer is underlined.) There are frequency specifications. The C / T polymorphism (rs117820670) is on the plus strand in contrast to the Sperm2 amplicon. In a group of 180 subjects, the C allele showed the incidence of 0.907 and the T allele the frequency of 0.093. A division into homozygous and heterozygous genotypes was not made here either. For the following SNuPE analysis, a CpG located at the 3 'end of the amplicon is used.

3.3.2.3 Methylation Patterns - Results of Bisulfite Sequencing : The results of bisulfite sequencing in the FIG. 104 (DNA methylation in the Sperm2 (AMP10008) locus includes five samples of peripheral blood, menstrual blood, saliva and sperm, and six samples of vaginal fluid, each column representing a sample. The rows represent the six analyzed CpGs within the amplicon The percentages of DNA methylation correspond to a color value in the continuous color transition from yellow (= 0% methylation) to blue (= 100% methylation) - corresponding to the color scale on the right The analytical CpG is surrounded by the black rectangle.) have the analytical CpG of the SNuPE detection method cg57 as the most distinctive differentiating. It is then highly methylated in semen, while the degree of methylation in the other fluids goes to zero.

3.3.2.4 Target region - SnuPE: The bisulfite-converted sequence of the Sperm2 marker has a GC content of 33% and contains 7 CpG dinucleotides. Of three SNuPE primers tested, the 3r primer showed the best distinction between sperm and other body fluids. The 3r primer detects methylation of the target CpG in the reverse direction ( FIG. 105 ; The reaction of the reverse SNuPE primer Sperm2-3r. The amplicon is located on the 2nd Bisu strand. The amplicon sequence is shown in the 5'-3 'direction. The 3r primer is extended at its 3 'end either by a C (black, a) on the methylated sequence or by a T (red, b) on the unmethylated amplicon sequence.).

The SNuPE primer 3r consists of 17 bases and works, as well as the sperm marker, according to the conventional principle of methylation measurement by SNuPE. In the detection of the primer provides the black signal represents the proportion of methylated amplicon copies and the red signal - the proportion of unmethylated copies in the sample. The Sperm2 marker is almost completely methylated in its target liquid semen and shows in such a sample a black signal ( Figure 106a ; Detection of the Sperm2 SNuPE primer 3r in a semen sample (a) and a blood sample (b). Illustration of two plot windows after data analysis with GeneMapper ID 3.2) The remaining fluids - peripheral blood, menstrual blood, saliva and vaginal fluid - are not methylated and show corresponding red signals ( FIG. 106b ). A methylation signal in an unknown mixed sample indicates the presence of sperm.

3.3.2.5 Detection sensitivity and repeatability of results: In Figure 107 (Marker Sperm2 - measurement of detection sensitivity in each of four independent analyzes of eight different concentrations of sperm DNA, the DNA amounts used per PCR are listed on the abscissa.) The result of a sensitivity and stability test is shown with 4 samples each of a concentration ,

Stable signals are obtained with the marker Sperm2 from 100 pg of inserted DNA.

3.3.2.6 Detection of the target liquid in mixtures: The FIG. 108 (Marker Sperm2 - measurement of semen in a liquid mixture.) The setpoint (black) corresponds to the calculated methylation value, which results from the values of the five body fluids, and the proportion of blood DNA in the respective mixed sample actually detected value.) shows the result of the mixing experiment.

In the case of the marker sperm, the DNA of the other bodily fluids obviously has an influence insofar as systematically too high proportions are measured. The lower the amount of sperm DNA, the higher the deviation from the setpoint.

3.3.2.7 Individual variation of methylation values: In the FIG. 109 (Marker sperm - box plot for the distribution of methylation values in 20 DNA samples of 5 body fluids, measured with SNuPE primer 3r.) Shows the differentiation potential of the marker Sperm2 compared to the other body fluids. Also with this sperm marker no overlapping of the values is to be observed.

The sperm has a methylation value of 70 to 96% and an average value of 89%. The average methylation for the remaining fluids is between 2.7% for vaginal fluid and 7.4% for menstrual blood. Saliva shows an average of 5.4% methylation, despite a relatively broad distribution of values.

3.3.2.8 Extended validation: The same sample collective was used as for Sperm1.

The methylation values of the 91 sperm samples measured show a skewed distribution. Most samples show 91 to 99% methylation ( FIG. 110 ; Marker sperm - distribution of methylation values of n = 91 semen samples. On the abscissa the value groups are given, whereby the division into groups depending on the totality of the values, is chosen arbitrarily. The ordinate lists the number of samples whose values fall into the corresponding category.).

The average methylation value of 88.3% is only 0.7% lower than in the small validation round (see FIG. 109 ).

Of the 91 samples, 6 samples showed values below 60% methylation. Five specimens fall outside the two-standard deviation of 56% and thus fall into the category of statistical outlier values. Three of the five samples also show values of sperm1 beyond twice the standard deviation. The corresponding subjects are 28, 29 and 35 years old. These are the same people. This supports the explanation by the presence of vaginal fluid in the corresponding semen samples.

Without taking into account the outliers, there is no age dependency for this marker ( FIG. 111 ; Marker Sperm2 - Age dependence of methylation levels. Included are the values of the subjects whose age was known (n = 58). A linear trend line is placed on the data points; it usually shows the even increase or decrease of values).

3.3.2.9 Forensic Validation: The forensic simulation experiments for the marker Sperm2 are in the FIG. 112 (Marker Sperm2 - Methylation results of the simulated forensic traces stored under dry and humid conditions, as well as externally The storage periods are 1, 2, 3 and 6 months The values from the different aging times are differentiated by color (see legend) Blood (a), menstrual blood (b), vaginal fluid (c), saliva (d) and sperm (e) The initial methylation value of marker spermm2 is indicated as t0).

The exogenous influence on the degree of methylation measured with Sperm2 is greatest for the externally stored samples. Maybe that's the effect of microbes ( Figure 112e ). The blood and menstrual blood samples also show values that deviate from the normal state under moist and outdoor conditions ( FIGS. 112a and 112b ). For vaginal fluid and saliva traces, only samples that have been stored wet for 6 months show an influence on the methylation signal. The remaining readings of these fluids have no deviations from the zero value (118c and 118d).

For vaginal fluid and for saliva, there is a value (stored moist), which is in the range of sperm values ( FIG. 113 ; Marker Sperm2 - box plot for scattering methylation values in the trace aging experiment. Included are all values of the corresponding fluid from the entire experiment.).

3.3.2.10 Next Generation Sequencing: Compared to Sperm1, bisulfite sequencing in Sperm2 appears to be reliable at high methylation levels ( FIG. 114 ; Marker Sperm2 - Comparison of methylation results at the target CpG (3r detection site) from a single semen sample from four different analysis methods: bisulfite sequencing, single nucleotide primer extension, and next generation sequencing with Roche454 (426 reads) and Illumina MiSeq (1598 Reads).)

The value of the SNuPE analysis with 92% methylation is very close to the results from the NGS measurement (Roche-454: 91%, MiSeq: 88%). Bisulfite sequencing of the examined sperm sample shows the lowest methylation value of 79%.

3. 4 Skin: The idea - in addition to the five central bodily fluids, to also be able to detect and distinguish skin, came in the course of the work after numerous conversations with forensics and crime investigators. Above all, the safe detection of dander as such, so far seemed to represent a significant problem. For the detection of skin and dander, a marker Hautl was developed.

3.4.1 Methylation Marker Skin-1 3.4.1.1 The Genort Properties

Table 13 The Genort Description of the Marker Skin1 marker Chr CpG island Gene symbol gene Locus architecture Skin 1 2 No (64% GC) 12cg / 173bp MEIS1 Homeobox protein MEIS1, HOX cofactor Intron: MEIS1

The marker Hautl detects skin by a specific methylation signal. The marker is methylated in the skin samples and most skin and scalp scales. In the body fluids - peripheral blood, menstrual blood, saliva, vaginal fluid and sperm - it is unmethylated. The skin1 locus is located on band p14 of chromosome 2, on the plus strand, in the intron region of the MEIS1 gene. The 5 'end of the locus is just 820 bp away from exon 017 of the gene. The MEIS1 protein is a homeobox (HOX) cofactor. It regulates the transcription of PAX6 (paired box proteins Pax-6) and, together with PBX1 or PBX2, serves as the transcriptional activator of PF4 (Plateled Factor 4). This chemotactic cytokine acts as a growth inhibitor of endothelial cells, as a heparin neutralizing protein and as an activating factor for megakaryocytes (Okada et al., 2003). The MEIS1 protein is thus involved in hematopoiesis as well as megakaryocyte and vascular system development. It is weakly expressed in normal immunohepatopoietic tissues and the fetal liver, more abundant in the cerebellum. Differential overexpression of the gene is observed in some myeloid and lymphoblastic leukemia forms, such as acute myeloblastic leukemia. In colorectal carcinoma, hypermethylation of the MEIS1 promoter was observed, accompanied by decreased expression of the gene. Of particular importance for the course of carcinogenesis is the failure of exon 8, which appears to have the function of a tumor repressor.

3.4.1.2 Construction of the amplificate: The 173 bp long skin amplicon has no CpG islands. The average GC content in the genomic sequence is 64% (Table 13). The section contains two SNPs, one of which is in the destination sequence of the forward primer ( FIG. 115 ; Genomic sequence of the Haut1 locus. The CpG dinucleotides are marked yellow, the two known SNPs green and the primer sites are highlighted in gray (forward primer dark gray, reverse primer light gray). The two CpG dinucleotides used in the SNuPE assay to measure methylation are marked in red and the binding sites of the f and r-SNuPE primers are underlined.). This A / C polymorphism (rs116331472) shows the frequency 0.975 for the A allele (wild type) and 0.025 for the C allele in a group of 118 persons. A division into homozygous and heterozygous genotypes was not made here either. There are no frequency information for the second SNP. Two CpGs are used for the following SNuPE analysis.

3.4.1.3 Target region - SnuPE: The bisulfite-converted sequence of the Hautl label has a GC content of 50% and contains 12 CpG dinucleotides. Two SNuPE primers could be designed, which at the same time proved to be good discriminators. The first extension primer Hautl-f detects the methylation in the forward direction ( FIG. 116 ; The reaction of the forward SNuPE primer Hautl-f. The amplicon sequence is depicted in the 3'-5 'direction. Since the amplicon is located on the 1st bisulfite strand, the 3 'end of the forward primer becomes either a C (black, a) on the methylated sequence or a T (red, b) on the unmethylated amplicon Sequence extended), the second primer Hautl-r in the reverse direction ( FIG. 117 ; The reaction of the reverse SNuPE primer Hautl-r. The amplicon sequence is shown in the 5'-3 'direction. The r-primer is extended at its 3 'end either by a G (blue, a) on the methylated sequence or by an A (green, b) on the unmethylated amplicon sequence.).

The two SNuPE primers are 20 (r primer) and 23 (f primer) bases long and can be analyzed simultaneously in a diplex approach. Both primers work by the conventional principle of methylation measurement by SNuPE - they are extended to either the methylated or unmethylated base. When detecting the f-primer, the black signal represents the proportion of methylated amplicon copies and the red signal represents the proportion of unmethylated copies in the sample. In the case of the r primer, the blue signal corresponds to the proportion of methylated amplicon copies and the green signal to the proportion of unmethylated copies in the sample ( Figure 118 ; Simultaneous detection of Skin1 SNuPE primer r (blue-green) and f (black-red); Illustration of a plot window after the data analysis with GeneMapper ID 3.2.). The ratio of the two primer signals to each other (black to red and blue to green) reflects the methylation status of the sample.

3.4.1.4 Detection sensitivity and repeatability of results: In Figure 119 (Marker Hautl - Measurement of the detection sensitivity of the SNuPE primers f (a) and r (b) in in each case three independent analyzes of eight different concentrations of skin DNA, the DNA amounts used per PCR are listed on the abscissa) Result of a sensitivity and stability test with 3 samples each of a concentration shown.

Stable measurements can be achieved from 200 pg DNA.

3.4.1.5 Detection of the target liquid in mixtures: The possible influence of body fluids on the skin-specific signal is checked in the mixing experiment. DNA samples containing 100%, 80%, 60%, 40%, 20% and 0% skin DNA were used. The rest of the samples consisted of an equally concentrated (20ng / μl) DNA mixture of the 5 body fluids - peripheral blood, menstrual blood, vaginal fluid, saliva and sperm. In the Figure 120 (Marker Hautl - measurement of skin in a liquid mixture with primers f (a) and r (b).) The setpoint (black) corresponds to the calculated methylation value, which is derived from the values of the five body fluids results, and the proportion of blood DNA in the respective mixed sample. The actual value (red) corresponds to the actually detected value.) Shows the results of this study.

There was no indication of mutual influence.

3.4.1.6 Individual variation of methylation values: The measurements of the five body fluids were made on the sample extracts already used for the validation of other markers. As skin samples, 5 biopsy specimens from various forearm individuals and individual dander were used for this experiment. In FIG. 121 (Marker Hautl - box plot for the distribution of methylation values in each of 20 DNA samples of peripheral blood, menstrual blood, saliva, vaginal fluid and semen; in 5 samples from skin biopsies and 46 (in Fig. A) and 55 (in Fig. B) Samples of scalp and armpit scales measured with SNuPE primer f (a) and r (b).) Illustrate the differentiation potential of the two SNuPE primers of the Hautl marker over the five body fluids examined. No overlapping of values can be observed.

Since individual dander can originate from different skin layers, it is to be expected that also the DNA can be very heterogeneous from dandruff to dandruff regarding methylation. The values of the skin flakes range from almost 0 to 100%. On the other hand, skin biopsies show stable methylation status: 42 to 55% methylation for the f primer and 28 to 46% for the r primer. The mean methylation value of the f-primer in the skin biopsy samples is 49%, which is higher than the mean methylation of the dander (45%). In contrast, the r-primer shows an average of 35% methylation in the skin biopsy samples and an average of 51% methylation in the dander.

3.4.1.7 Extended Validation: A total of 5 skin biopsies (forearms) and 217 individual dander (scalp dandruff and dander from the forearm) from 41 different individuals were studied. In FIG. 122 (Age of subjects for skin biopsies and scalp and forearm scales whose values were included in the examination of the skin markers; 11 males and 30 females (n = 41).) Shows the age distribution of the samplers.

103 dander samples (48%) contained very little or no DNA and were not included in the study. Of the remaining 114 analyzed samples, the two SNuPE primers f and r showed no signal in 14 samples (13%). In 20 samples (18%) only one of the two primers showed a signal. The results of these 34 samples were also not included in the statistics.

Table 14 summarizes the mean methylation scores of scalp and armscale samples for the two SNuPE primers f and r. Indicated is the average of the total of the sample values (1st column), the average without 0% values (2nd column) and the average without 0% and 100% values (3rd column). The number of samples taken into account when calculating the respective average is given in the columns on the right. The last table column shows the standard deviation of the corresponding data series. <b> Table 14 markers skin1 f and r on scalp and arm dandruff- the mean methylation scores </ b> Total Number n Ø without 0% Number n Ø without 0% and 100% Number n StdABW without 0% and 100% f-head 22.8% 70 44.1% 37 38.1% 31 20.4% r-head 36.7% 60 51.1% 44 41.1% 38 18.4% farm 31.6% 16 56.2% 9 34.4% 6 12.7% r-arm 48.9% 12 55.0% 10 40.9% 7 21.5%

The results of all samples, including the 0% and 100% values, give an overview of the results FIG. 123 (Marker Hautl - Distribution of methylation values of arm and scalp scales samples The values of the two SNuPE primers f and r are shown in different colors, the red bars show the results of the f primer (86 values) and the blue ones of the r Primers (72 values) There are 14 less values of the r primer since it did not show any signal in some samples The abscissa gives the value groups, the division into groups depending on the total of the values, The ordinate indicates the number of samples whose values fall into the corresponding category.).

Both value groups - dander and dandruff have the character of a trimodal distribution, as well as the diagram containing both groups in the FIG. 123 , Since dander can contain quite different cell types, such a subdivision of the methylation values would be possible. A deeper insight into this phenomenon of trimodal distribution, however, allows the NGS analysis of skin cells (see chapter discussion 4.3). A similar picture was also shown in a case study carried out for the LKA Hessen: Of 13 dander, one showed no PCR signal at all, three were not methylated and nine were methylated.

3.4.1.9 Next Generation Sequencing: With the help of NGS, the skin marker was also used to check how well the SNuPE detection method reflects the actual methylation situation ( FIG. 124 ; Marker Hautl - Comparison of methylation results from a single skin sample from three different analysis methods: Single Nucleotide Primer Extension and Next Generation Sequencing with Roche454 (2769 reads) and Illumina MiSeq (47400 reads). The values of the f-CpG are dark violet, the values of the r-CpG are shown in light purple.).

For the skin marker, there are no results of bisulfite sequencing. Also, the values of this semiquantitative SNuPE measurement are comparable to the NGS data.

3.5 Influence of tumors on the methylation loci used: It is known that tumors can alter the methylation pattern In the control study designed here, of course, only a limited selection of tumors could be checked for their possible influence on the methylation markers that I have developed. In general, it can be assumed that an effect can only be observed in the affected tissue or body fluid. An exception could be the blood, because it carries traces of free DNA, which could of course also come from other tissues or body fluids.

The Figure 125 (Number of samples from different tumor patients (n = 34) CA = carcinoma, CLL = chronic lymphocytic leukemia, CML = chronic myeloid leukemia, MPS = myeloproliferative syndrome) reflects the number and type of tumor samples. The study was approved by the Ethics Committee of the University of Bonn and the Ethics Committee Bad Homburg.

The concept of the study was: All forms of leukemia were studied exclusively in the blood. But all 10 markers were analyzed. The esophageal tumor specimen was examined in saliva - also for all 10 markers. Endometrial, cervical and ovarian carcinoma as well as endometriosis were examined in the vaginal smear, and there for every 10 markers. The testicular tumor specimen was examined in semen for all 10 markers. Breast cancer and two forms of colon cancer - familial adenomatous polyposis (FAP) and hereditary non-polyposis-associated colorectal carcinoma (HNPCC) - were studied in blood and also using all 10 markers.

A methylation signal was considered to be affected by the tumor if the methylation level in at least one sample was outside the normal range for the corresponding fluid.

The FIG. 126 (Results of the Carcinoma Examination) The upper number indicates how many samples of the total number of samples of a tumor type examined have shown a deviation of the methylation value, the lower number in parentheses gives the difference between the measured methylation value and the average value of the marker in the Again, with the arrow indicating the direction of the deviation, if more than one sample of a tumor type were aberrant, the smallest and largest divergence are given as a range.) shows the effect of the various tumors on the methylation loci. Listed are only those markers that have shown a signal deviation in at least one tumor. In the same way, only those types of tumors were shown that had a deviation in at least one marker. The latter applies to 8 out of 12 tumor types tested. Of three colorectal cancer samples tested, one HNPCC sample showed a aberrant signal in the form of a decreased methylation value in the blood 2 marker (15% r primer, 12% f primer). The remaining 9 markers remained unremarkable in this sample. The menstrual blood marker Mens1 showed a false positive signal in a single sample - CLL blood sample from a 67-year-old patient. The same CLL sample also showed a decreased methylation signal in blood 2 and an elevated signal in the markers Spei2, Vag1, Vag2, sperm1 and skin1. The markers Blood1, Spei1 and Sperm2 remained unremarkable in this sample. The second sperm marker Sperm2 showed signal deviations only in one type of tumor (CML). The two salivary markers, the two vaginal markers and the sperm markers showed deviating signals in two or more tumor types. The methylation property of the Vag2 locus appears to be affected by most of the tumors tested (5 out of 12). Interestingly, the target CpG of the r primer in the Skin1 marker is less affected by tumor action than the target CpG of the f primer. Of all the tumors tested, CLL has the most influence on almost all markers in peripheral blood, with the exception of sperm.

The marker Blut1 showed no deviation from the expected norm value in any tumor sample. The vaginal fluid samples from the endometrial carcinoma and endometriosis patients and the sperm sample from the testicular tumor patient had no effect in any of the 10 markers.

In Table 15, frequencies of the occurrence of the examined tumor types among the German population are listed. The most common disease in the middle phase of life is endometriosis in women and HNPCC form of colorectal cancer in men. <b> Table 15 Prevalence and mean age of onset of the carcinoma forms studied. </ b> carcinoma prevalence Average age of onset Oesophageal CA 4-7: 100,000 PE 66-70 years old men more often Endometrial CA 25: 100,000 women 66-85% menopausal women Cervical CA 13.3: 100,000 women 45-55 y Ovarian CA 11.5: 100,000 women 69 y endometriosis 4000-12000: 100,000 women 36 y Testicular CA 8-10: 100,000 men 20-40 y CLL 4: 100,000 PE 70-75 years, men more often CLM 1.5: 100,000 PE 55-60 years, men more often MPS 1-2: 100,000 PE 50-60 years, men more often B-cell lymphoma 7: 100,000 PE 55-60 years, men more often Breast CA 123: 100,000 women 63 y HNPCC 200: 100,000 PE 45 y FAP 5-10: 100,000 PE 39 y

3.6 Genetic influence on methylation: For the submitted project, such influences would be of great importance because they would possibly distort the statements about the presence of certain body fluids. Although the distribution of the methylation values in the individual markers is approximately normal, each marker has outliers and of course extremes. The validation study states that such deviations are small. Because of the usually enormous processual importance of the body fluid analysis, however, it must be clarified whether and to what extent such genetic mechanisms exist at the marker loci used.

• Ein weit außerhalb des Amplikons liegendes SNP steuert die Methylierung eines CpGs oder einer CpG-Insel.
• Ein innerhalb des Amplikons liegendes SNP steuert die Methylierung eines CpGs oder einer CpG-Insel..
• Ein SNP innerhalb der SNuPE-Primer-Bindungsstelle beeinflusst das Ausmaß der Primerbindung und damit der Signalhöhe.
• Ein SNP befindet sich unmittelbar an der Position des analytischen CpGs. Damit würde direkt der Nachweis beeinträchtigt.

Conceivable and partly described in the literature are the following events:

• A far out of the amplicon SNP controls the methylation of a CpG or a CpG island.
• An SNP within the amplicon controls the methylation of a CpG or a CpG island.
• An SNP within the SNuPE primer binding site affects the extent of primer binding and thus signal level.
• An SNP is located immediately at the position of the analytical CpG. This would directly affect the evidence.

• die so genannte mQTL-Wirkung
• Allel-spezifische Methylierung
• Imprinting Effekte

Formally, one can summarize the possible influence in:

• the so-called mQTL effect
• Allele-specific methylation
• Imprinting effects

The 10 markers were analyzed in a single pool on the Illumina MiSeq. The proportions of readable per marker are in the Figure 127 (Number of generated reads from each Amplicons in library pool 813.E, performing NGS on MiSeq (Illumina); the total number of reads is 430669.). The evaluation of the 250bp-paired reads was done with the program CLC Genomisc Workbench 6.5.1.

Since the DNA of 50 different individuals was represented in each marker sample, an SNP present in at least one person would have to be seen in about 2% of the reads in homozygosity and in 1% of the reads in heterozygosity. Accordingly, we looked for deviations from the reference sequence that occurred in at least 1% of the reads and were observed in both forward and reverse sequences.

Four different constellations were investigated: SNPs, combinations of SNPs - haplotypes, small deletions / insertions and incomplete methylation.

Different types of deviations were found. Often it was insertions or deletions of single or multiple bases. Many single or multiple base transitions have been observed. Most were TC transitions on markers located on the 1st bisu-strand (Blood1, Blood2, Mensl, Vag1, Vag2, and Skin1) or AG transitions, in the markers on the 2nd Bisu-strand (Speil, Spei2, Sperm1 and Sperm2). These were positions in the amplicon sequence but outside of CpG dinucleotides. They can not be SNPs; this can be seen in the comparison of the bisulfite-converted with the genomic sequence.

3.7 The Phenomenon of Incomplete Methylation: One explanation is that the chemical reaction of bisulfite ion is incomplete at these sites. However, this alone would not explain that for some markers such incomplete bisulfitation has a significant effect on the methylation of neighboring CpGs. In the following text, these positions are referred to as unconverted cytosines.

Most variants had a frequency of about 1%. However, some of the unconverted cytosines were much more common (up to 8%). In some cases, an influence on the methylation was observed, which was due to a haplotype of certain variants and additionally an unconverted C.

3.7.1 Result - Blood 1 : A number of variants were found in the study of the marker blood 1. All were the unconverted cytosines. The most common occurred at a frequency of 1.3 to 1.7% in the 18254 Blutl reads. No influence of these sites on the methylation of the total of 9 CpGs can be observed.

3.7.2 Result - Blood 2: With marker Blood2 (18178 reads), there were no variants, apart from two adjacent unconverted cytosines. They were selected for the study because of the high frequency (7.6% and 5.7%). They exert no influence on the methylation.

In the 25901 Reads of Markerlocus Mensl a deletion was found with a frequency of 2.6% (T-91). This variant lowers the methylation of CpGs - Cg25 to Cg180- ( FIG. 128 ; Marker Mensl - Influence of Sequence Variants on Methylation. The CpG positions in the amplicon are listed in the top line. The asterisks (*) and (**) mark the two analytic ones CpGs. The second line shows the methylation, which is normally present at the individual CpGs. The following lines show the methylation values given in the reads bearing the deviation given to the left. The percentage values of the DNA methylation correspond to a color value in the continuous color transition from yellow (= 0% methylation) to blue (= 100% methylation); evaluated from 25901 reads.). The unconverted cytosine site (C-157, frequency 1.8%) lowers the methylation rate at Cg86 and Cg203, but otherwise has no effect, although it is in the target sequence ( Figure 129 ; Bisulfite-converted sequence of the marker Mensl. The CpG dinucleotides are marked yellow, the unconverted C orange, the blue deletion and the primer sites are grayed out. The binding site of the Fm and Fnm-SNuPE primers is underlined.).

3.7.3 Result - Spei1: In the 27208 Speil-Reads the in FIG. 130 (Marker Spei1 - Effect of Sequence Variants on Methylation.) The CpG positions in the amplicon are listed in the top line, the asterisks (*) and (**) indicate the two analytical CpGs, and the second line shows the methylation. The following lines show the methylation values given in the reads bearing the deviation indicated on the left: The percentages of the DNA methylation correspond to a color value in the continuous color gradient of yellow (= 0%). Methylation) to blue (= 100% methylation), evaluated from 27208 reads.) And FIG. 131 (Bisulfite-converted sequence of the marker Spei1.) The CpG dinucleotides are marked in yellow, the three SNPs red, the unconverted C orange, the position of the insertion purple, the blue deletion, and the primer sites are gray-shaded and Fnm-SNuPE primer is underlined.) Variants found. The SNP at position 176 only performed with the SNP at position 99 and could therefore only be rated as a haplotype. This is also the variant that shows the most significant effect on methylation, namely Cg103 (0% methylation versus normal 18.8%) and Cg123 (100% methylation vs. normal 19.0%). The transition to position 99 is an unconverted C. It alone exerts the same non-methylating effect on Cg103 and a weaker methylating effect on Cg123 (57.4% methylation versus normal 19.0%).

The described effects in no case affect the two analytical CpGs - Cg83 and Cg89.

3.7.4 Result - Spei2: In the 13293 Spei2-Reads the in Figure 132 (Marker Spei2 - Effect of Sequence Variants on Methylation.) The CpG positions in the amplicon are listed in the top line The asterisk (*) marks the analytical CpG The second line shows the methylation, which is usually at the individual The following lines show the methylation values given in the reads bearing the deviation indicated on the left: The percentages of DNA methylation correspond to a color value in the continuous color transition from yellow (= 0% methylation) to blue (= 100% methylation), evaluated from 13293 reads.) And Figure 133 (Bisulfite-converted sequence of the marker Spei2) The CpG dinucleotides are marked in yellow, the two unconverted C are orange, the blue deletion, the two SNPs are red, and the primer sites are gray-shaded The binding site of the Fm and Fnm-SNuPE- Primer is underlined.) Variants found. Since the Spei2 marker as well as the SpeI l marker is on the 2nd Bisu strand, an unconverted C appears as a G, with an A in place in the bisulfite-converted reference sequence.

The A deletion at position 81 shows no noticeable effects on methylation. It is at the beginning of a poly A sequence and is probably due to the analysis ( FIG. 139 ).

The SNP at position 167 is located at the G of a CpG dinucleotide (G> A transition) and is on the 2nd Bisu strand the normal state of the CpG in its unmethylated form. Accordingly, the A allele of the SNP in the unmethylated sequence can not be distinguished from the normal unmethylated CA sequence of the CpG. The evaluation included only the reads containing the A at the G site - ie reads not methylated at the Cg167. Therefore, this CpG appears in the Figure 132 as completely unmethylated. The remaining CpGs in the reads containing this bias are 21 to 43% methylated. Thus, the Cg167 in these reads is the least methylated CpG. In normal reads, however, it is the highest methylated CpG.

The SNP at position 209 is a T> C transition. The low frequency of the rare allele suggests that it is only a heterozygous affected person in the investigated pool. It exerts its effect on neighboring Cg253 (8% vs. normal 51.3%).

The analytical Cg93 is not affected or to the same extent as the remaining CpGs in the amplicon. 3.7.5 Result - Vag1: In the study of the 18000 Vagl-Reads the in Figure 134 (Marker Vag1 - Effect of Sequence Variants on Methylation.) The CpG positions in the amplicon are listed in the top line, the asterisk (*) marks the analytical CpG, the second line shows the methylation, which is normally at the individual The following lines show the methylation values given in the reads bearing the deviation indicated on the left: The percentages of DNA methylation correspond to a color value in the continuous color transition from yellow (= 0% methylation) to blue (= 100% methylation); evaluated from 18,000 reads.) And their effect on the methylation of neighboring CpGs. Remarkable is the increase in methylation by the unconverted cytosines at positions 174, 182 and 196 - between Cg85 and Cg235. A haplotype from 182 and the -T allele of the deletion at position 52 has a similar effect. A haplotype from unconverted cytosines 182 and 152 leads to complete demethylation in Cg21, Cg34 and the analytical CpG Cg37 ( Figure 134 ).

3.7.6 Result - Vag2 : For marker Vag2 (58374 reads), one deletion, two SNPs and one unconverted cytosine were investigated for their interaction with the neighboring CpGs ( FIG. 136 ; Marker Vag2 - Influence of Sequence Variants on Methylation. The CpG positions in the amplicon are listed in the top line. The asterisk (*) marks the analytic CpG. The second line shows the methylation, which is normally present at the individual CpGs. The following lines show the methylation values given in the reads bearing the deviation given to the left. The percentages of DNA methylation correspond to a color value in continuous Gradient from yellow (= 0% methylation) to blue (= 100% methylation); evaluated from 58374 reads.).

The deletion of a thymine at position 38 is at the beginning of a poly-T sequence of 8 Ts. It is located in the target sequence of the SNuPE primer ( Figure 137 ; Bisulfite-converted sequence of the marker Vag2. The CpG dinucleotides are marked yellow, the blue deletion, the two SNPs red, the unconverted C orange and the primer sites are highlighted in gray. The binding site of the 1f-SNuPE primer is underlined.). It apparently has no effect on the methylation of the 8 CpGs of the amplicon - possibly because it is a sequencing artefact.

The SNP at position 151 lowers the degree of methylation of all CpGs, except for Cg101. Most strongly, a haplotype consisting of the rarer alleles of SNPs at positions 109 and 151 and unconverted C-143 alters the degree of methylation of all CpGs in the amplicon (strongly demethylated) except for Cg101, which is 100% methylated.

The second SNP at position 151 is an A> G transition, resulting in a slightly decreased methylation of the entire region.

3.7.7 Results - Sperm1: In 50928 readings of the marker Sperm1, 5 different variants were examined for their methylation influence. Two A deletions at positions 57 and 119 are at the beginning of a poly A sequence and are probably sequencing artifacts. Two G deletions at positions 38 and 128 cause the failure of a CpG. The SNuPE detection CpG is not affected. An unconverted C with a frequency of 1.7% was also examined. No influence of the found deviations on the methylation of the total of 13 CpGs can be observed. 3.7.8 Result - Sperm

In the 46382 readings of the marker Sperm2, two deletions, two insertions, and one SNP were examined for their methylation influence. The deletions and insertions are probably sequencing artifacts (beginning of a poly A sequence). The SNP is a T> C transition with a frequency of 3.6%. None of the deviations found exerts an influence on the methylation.

3.7.9 Result - Skin1: The 200286 Reads of the marker Hautl showed 4 variants ( FIG. 138 ; Marker Hautl - Influence of sequence variants on methylation. The CpG positions in the amplicon are listed in the top line. The asterisk (*) marks the analytic CpG. The second line shows the methylation, which is normally present at the individual CpGs. The following lines show the methylation values given in the reads bearing the deviation given to the left. The percentage values of the DNA methylation correspond to a color value in the continuous color transition from yellow (= 0% methylation) to blue (= 100% methylation); evaluated from 200286 reads.). All deviations exert an enormous influence on the methylation. The insertion of a thymine between two adjacent CpGs - Cg22 and Cg25 ( FIG. 139 ; Bisulfite-converted sequence of marker Skin1. The CpG dinucleotides are marked yellow, the position of the insertion purple, the multi (di-) nucleotide variation red, two unconverted cytosines orange and the primer sites are gray highlighted. The binding sites of the two SNuPE primers are underlined.) Has a strong demethylating effect on the CpGs of the entire amplicon.

Similarly, the exchange of one guanine and one cytosine by two thymines at positions 29 and 30 also has an effect. However, this dinucleotide transition is not a true two base exchange but a single G> T transition adjacent to the unmethylated Cg30 (TpG). This haplotype occurs in 1% of the reads.

The T at position 29 was not found in the reads with the methylated Cg30. This means that the SNP occurs exclusively in reads that are not methylated at the Cg30.

Unconverted C-41 (6.2% frequency) results in all CpGs being high or fully methylated. If, on the other hand, the immediately adjacent unconverted C-42 is contained in the Read, the CpGs 5 are methylated up to a maximum of 14.5%.

3.8 Validation experiments : To validate the marker properties, a number of validation studies have been performed in this work.

3.8.1 Separation force test: For this study, the target liquid and the remaining 4 liquids were examined with the respective specific marker. For each fluid, 20 subjects were analyzed. The aim of the experiment was to determine the degree of overlap of the value group for the target fluid with the value groups of the remaining body fluids. The marker Blood1 (both SNuPE primers 1f and 2r) showed no overlap with the values of sperm, saliva, menstrual blood and vaginal fluid. The same applies to the menstrual blood marker Mens1 and the saliva marker Spei1 with respect to the other liquids. The values of blood2 (both SNuPE primers f1 and r2) in the peripheral blood overlap approximately 10% with the values of the menstrual blood samples. Including 50% of the values in the distribution (the "box" in the BoxPlot representation), there is a gap of 7% (f1) and 10% (r2) between the peripheral blood and menstrual blood groups in blood2. Spei2 overlaps with saliva completely with the sperm signal, but with no other one. The vaginal fluid marker Vag1 overlaps with vaginal fluid at 9% with the value group of menstrual blood. The marker Vag2 has 19% overlap between the two groups of values. Including 50% of the values in the distribution (the "box" in the BoxPlot plot), Vag1 has a gap of 8% between the groups of vaginal fluid and menstrual blood, with Vag2 at 14%. Both semen markers Sperm1 and Sperm2 show no overlap with the values of the other value groups.

For the development of the skin marker, there were other forensic-genetic arguments in comparison to the body fluids: Naturally, the question of the distinction to blood and other liquids is not relevant in such a trace, but the positive proof that it is skin. For this reason, no skin was used in the review of the release force of the individual markers. The skin marker itself has been checked in all other fluids, there was no overlap of values with body fluids.

Peripheral blood and vaginal fluid are natural components of menstrual blood. On the 1st to 3rd day of bleeding, the amount of blood in excreted menstrual blood is up to 50%. The overlap of the vaginal marker signals and the blood marker blood2 with the menstrual blood values does not affect the reliability of the system, because all markers are used for body fluid analysis and in this case the menstrual blood marker Mens1 makes a definite decision. It is completely unmethylated in peripheral blood and vaginal fluid (a red peak), so that a methylation signal (a blue peak) indicates only the presence of menstrual blood.

3.8.2 Detection of the specific fluid from mixtures: It is conceivable that the signal of a specific marker is falsified by the presence of the corresponding template DNA from other body fluids. Therefore, a mixing experiment was carried out for each marker, in which in addition to the DNA of the target liquid, the DNA of the four remaining body fluids (6 different concentrations) were examined for their degree of methylation.

Compared to the expected value, the methylation values from the mixture at blood 1, Spei2 z.T. decreased by up to 20%. The values of blood2, Spei1, sperm1, skin1 corresponded to the expected value. The values of Mens1, Vag1, Vag2, Sperm2 were slightly increased over the expected value in Sperm2 z.T. up to 20%.

In most fluids, the lower still detectable amount of the target fluid is about 20% of the mixture.

Especially with blood traces, it is a frequent question of an investigator, whether it is pure blood or a mixture of several body fluids. Therefore, two markers complementary to your methylation signal have been developed: Blood2 has a methylation signal only in peripheral blood. Blood1 is completely demethylated in blood and methylated in all other body fluids. That is, Blood 2 identifies blood - even in mixtures - Blood 1 indicates whether it is a blood-containing mixture or pure peripheral blood.

Also for the detection of sperm two complementary markers could be developed: sperm is highly methylated in semen (89% average) and in the other fluids it is demethylated. In this respect sperm identifies sperm also in mixtures. In contrast, Sperm1 is completely demethylated in semen and almost completely methylated in the other fluids so that it can indicate the purity of a semen sample.

3.8.3 Test for stability under forensic conditions: All markers except skin 1 have been tested in a standardized simulation test for up to 6 months. Basically, the largest changes were found in the wet samples compared to the baseline: in some cases the starting material was no longer detectable after 6 months (Mens1: 6 months, Spei1 and Spei2: 3 months, Vag2: 6 months), with Sperm1 increases after 3 months the degree of methylation. These signal changes or failures have primarily nothing to do with the detection method, but with the decay of the sample material: Under the humid conditions, microbes can also do a great deal Cause decomposition of the sample material. That is not influenceable. On the other hand, with the method developed in this work, eg sperm traces have been clearly detected, which have been stored for more than 15 years as evidence. In another experiment, it was examined whether the overlap of the value groups from the individual liquids changed in the course of the forensic storage conditions. Apart from the abovementioned extreme values of individual samples, this was not the case with any marker.

The yield and stability of RNA in simulated environmental contaminated vaginal fluid, blood, semen, and saliva tracks were examined. The influence of dry environment at room temperature, humid and warm environment, outdoor conditions (rain, sun, microorganisms) and the influence of UV rays on the samples were tested. In the work, the actual weak point of mRNA analysis is presented in numbers. If moisture is allowed during sample storage, the respective target liquid is no longer detectable after the following time periods: blood 3 days, saliva 1 day, sperm 7 days, vaginal fluid 3 days.

3.8.4 Validation with 80-100 samples per body fluid: In order to determine the reliability of the analysis method more precisely, a larger study was necessary in which the distribution character of the individual groups of values could be checked. The validation study was performed with the following numbers of samples: peripheral blood: n = 96/98, menstrual blood n = 96 (samples are from 60 subjects), saliva n = 99/95, vaginal smears n = 55, sperm n = 88/91, Scalp dandruff n = 70, armpit dandruff n = 16. Two values are given for the number n of samples when the two markers used for one fluid did not receive signals from all samples.

Blood Marker Blood 1 shows the expected skew distribution (maximum of values at 0% methylation). Blood2 is distributed almost normally. Both together perform the complementary function: marker 2 identifies peripheral blood, marker 1 indicates whether the blood is pure or a mixture. For both markers, two different primers can be used while maintaining the same quality of analysis.

Although no classification by age and after the day of menstruation was deliberately made, the menstrual blood marker Mens1 was approximately a normal distribution for the value group. During the validation study, it was found that Mens1 did not show a menstrual blood specific methylation signal in 15 out of 96 samples. Eight of these samples are from the 5th day of bleeding. The remaining 7 samples are from previous bleeding days (1 of day 1, 3 of day 2, 2 of day 3 and 1 of day 4). However, they come from tampons and not from bandages. The consequences of this for menstrual blood testing will be discussed below.

The normal menstrual period lasts for 5 to 6 days in most women. When taking birth control pills, the bleeding phase is shortened by 1 to 2 days and the amount of excreted blood decreases significantly (Mihm et al., 2011). Regardless of the duration of the bleeding, the last two bleeding days show only one blood smear and are expected to contain a lot of vaginal fluid. The amount of blood in the excreted fluid is up to 50% on heavy days of bleeding. At the last or "light" Days, the proportion of blood is reduced to about one quarter of the excreted amount of fluid (Fraser et al., 1985). Most women report the second day as the heaviest bleeding.

In the validation study, samples from the second day of bleeding also showed the highest average methylation of 50% (n = 28). It is clear from the results of bisulfite sequencing that the component of the menstrual blood responsible for the specific methylation signal originates from the endometrium. The excretion of degraded endometrial tissue decreases in the course of menstruation and is subject to individual fluctuations. This is reflected in the validation results of Mens1 due to the wide spread of methylation signals and the occasional signal loss. In this respect, bleeding day plays an important role in the forensic context. Identifying a menstrual blood trace from the 5th bleeding day as menstrual blood will not be possible in all cases with Mens1. In such borderline cases, the vaginal marker used in the method described here will allow a decision depending on the nature of the case. In the EDNAP collaborative study described above - study 4 - 75% of the laboratories achieved proof with MMP triplex in the sample from the 3rd day of bleeding, 41% on the 4th day of bleeding. With the MB triplex, it is 45% and 36%, respectively. Menstrual blood samples from the 5th day of bleeding were not included in this study.

Another reason for the failure of the methylation signal is the use of tampons for the extended validation of the marker. In a tampon, significantly more vaginal secretions are included than in a bandage. The tampon is introduced intravaginally and thus located directly at the gland exits. This relationship is confirmed in the results of the two validation studies. For the first round, 20 samples were collected on bandages - there were no signal losses. In contrast, the samples were collected on tampons for extended validation. All 15 signal failures were observed here.

The values of the two salivary markers have approximately a normal distribution. The differentiation potential is retained in this large value group. The vaginal marker Vag1 has a relatively high proportion of high methylation levels so that the entire set of values does not appear to be normally distributed. On the other hand, the values from Vag2 are almost normally distributed. The marker sperm1 does not appear normally distributed or may contain several populations. Sperm2 represents a skewed normal distribution. The methylation values of the skin marker clearly show three different populations, which can probably be explained by the findings from the NGS experiments.

For forensic aspects, significant age and / or gender dependency would be significant. Only the two salivary markers show a slight dependence on age and sex. However, the correlation is not strong enough for forensic considerations, for example, on the course of events.

3.9 Influence of tumors on the reliability of the system: Since tumors have an influence on the methylation pattern, a number of patients were tested to see whether the existence of a tumor leads to a false-positive or a false-negative result in the forensic body fluid or tissue identification. Based on the results and tumor prevalence (see Table 15), an assessment of the quantitative significance of this potential perturbation factor should be made.

In the work, 12 different, relatively common forms of cancer have been studied, which seemed relevant from their organ of appearance in connection with a body fluid under discussion. This was about:
Esophageal carcinoma - saliva; Ovarian carcinoma, endometrial carcinoma, cervical carcinoma, endometriosis - vaginal fluid; Testicular carcinoma - sperm / seminal fluid; CLL, B-cell lymphoma, CML, MPS, breast cancer and two forms of colorectal cancer (peripheral blood) In menstrual blood, only one sample was available from a patient with cervical carcinoma.

In each fluid, all markers were examined. For some tumors, a deviation in the specific methylation marker from the expected normal value was found in the respective body fluid / tissue:
One of the 7 CLL samples tested showed a 19 to 22% reduction in the specific signal in the blood 2 marker. The methylation signal of the same sample was also noticeable in the other markers. The sample is from a 67-year-old patient.

• Es ist nachgewiesen worden, dass im Tumorgewebe selbst das Methylierungsmuster an vielen Stellen verändert ist.
• Entartete Zellen können in die betrachtete Körperflüssigkeit gelangen - je mehr sie mit dem Tumor in Berührung kommt.
• Die hier entwickelten Marker können bei manchen Tumoren von Zellen stammen, die selbst von der Entartung betroffen sind.
• Freie DNA des Tumorgewebes kann in Körperflüssigkeiten gelangen. Bei den Blutmarkern wäre eine Beeinflussung des Methylierungsgrads im Blut durch Bluttumoren bzw. dabei betroffenen Zellen nicht überraschend gewesen, weil der Marker-Locus mit seinem charakteristischen, die Körperflüssigkeit identifizierenden Methylierungsgrad möglicherweise in einem betroffenen Zelltyp liegt. Beim Hodentumor wäre in der Samenflüssigkeit die Präsenz freier DNA aus Tumorgewebe denkbar, in welchem der Methylierungsgrad des Markerlocus stark verändert ist. Auch bei Speiseröhrencarcinom hätte freie DNA mit stark verändertem Methylierungsmuster am Marker-Genort stören können.

The two cervical carcinoma samples showed a 13 to 17% reduction in the vaginal marker Vag1. One of the two samples also showed a 12% lowered methylation signal in the second marker Vag2. The smear sample, which produced aberrant signals in both markers, contained an outwardly visible amount of blood as the patient underwent surgery. In this respect, the proportion of DNA from the vaginal fluid was diluted by the DNA from the peripheral blood. The other tumors tested showed no deviation in the specific methylation marker. Possible levels of deformation of the methylation pattern:

• It has been demonstrated that in tumor tissue itself, the methylation pattern is altered in many places.
• Degenerate cells can enter the body fluid in question - the more it comes into contact with the tumor.
• The markers developed here can in some tumors come from cells that are themselves affected by the degeneration.
• Free DNA of tumor tissue can get into body fluids. In the case of blood markers, it would not have been surprising to affect the degree of methylation in the blood by blood tumors or the cells affected thereby, because the marker locus with its characteristic degree of methylation, which identifies the body fluid, possibly lies in an affected cell type. In the case of the testicular tumor, the presence of free DNA from tumor tissue would be conceivable in the seminal fluid, in which the degree of methylation of the marker locus is greatly altered. Even with esophageal carcinoma, free DNA with a strongly altered methylation pattern at the marker locus could have interfered.

In almost all patients with CLL, CML, MPS, B-cell lymphoma, the vaginal marker in the blood showed deviations from the norm. This means that a crime scene blood trace from which one would have no prior information would be identified by a blood marker as blood, for example, the second blood marker would provide the information that it is pure peripheral blood. The vaginal marker would indicate vaginal fluid. - In itself no false positive result, but a conflict.

Loci Vag1 and Vag2 are located within the gene cluster HOXD. Vag1 lies within an exon of the HOXD4 gene and Vag2 in the 5'UTR region of the HOXD12 gene. The HOX genes have 39 members in 4 gene clusters. They code for various transcription factors that, among other things, control the cellular differentiation of mature leukocytes during hematopoiesis. It is known that some HOX genes are involved in the development of various types of tumors, including various types of leukemia. They have both tumor suppressor and oncogene activity, depending on the tissue. In the initiation and progression of the tumor, epigenetic changes play a crucial role

The greatest impact is in patients with chronic lymphocytic leukemia in the Vag2 marker. All seven samples tested here have a methylation signal in the peripheral blood.

There is no evidence of tumor-related false-positive or false-negative analysis results from this study. Nevertheless, the generally high procedural importance of a body fluid analysis requires a conservative estimate of the error rate. In the relevant forensic considerations age group for women and men (20 to 64 years), one must assume a prevalence of all cancers of approximately 370,000 affected persons for 2014 (Cancer Registry Robert Koch Institute, 2013). Statistically every 170th tracker would be a tumor patient. In the 10 types of cancer we have examined, we see no evidence of false-positive or false-negative statements, but especially in the various forms of leukemia, possibly contradictory statements in the measurement of various body fluids. Such conflicts are recognizable. Even if you include the latter in the error analysis, you would come to a statement security of about 99.5%.

3.10 Influence of sequence variants and unconverted cvtosines on the reliability of the system: The markers blood1 and blood2 show no sequence variants with effects on the methylation of the respective CpG clusters.

In Marker Mens1, a deletion (T-91) was found, which probably reduces the degree of methylation considerably, but does not really reduce the analysis quality (frequency 2.6% of reads).

Marker Spei1 shows no influence on the analytical CpG.

In marker Spei2, a sequence variant has been detected in 14.7% of the reads (SNP G> A 167), which leads to a decreased methylation of the analytical CpG. Again, the detection power of the marker is not really limited.

In the marker Vag1, a haplotype of two unconverted Cs (182, 152) results in complete demethylation of the analytical CpG and two other neighboring CpGs. Remarkably, on the other hand, most of the other CpGs are higher methylated than in the normal sequence. The frequency this haplotype is about 1%. The conversion rate of the DNA is more than 99% for the kit used for the work (EpiTect Plus DNA Bisulfite Kit, Qiagen). In this respect, an incomplete bisulfite conversion as a reason for this phenomenon can not be ruled out. However, one would have to wonder why the conversion is incomplete only at these two sites and this exerts such a strong effect on methylation in the adjacent sequence.

A similar phenomenon is observed in the marker Vag2: A haplotype consisting of two sequence variants and one unconverted C (109, 143, 151) results in almost complete demethylation of the entire CpG cluster. The frequency of this haplotype is also about 1%.

• kein PCR-Produkt
• PCR-Produkt, aber 0-2% Methylierungsignal
• PCR-Produkt und 24-87% Methylierungssignal
• PCR-Produkt und 100% Methylierungssignal

For the skin marker skin1, 2 sequence variants and 2 unconverted cytosines were detected, all of which exert extreme influence on the methylation of the entire CpG cluster - including the analytical CpG (Ins-T25 ^ 26, MNV-TT29 ^ 30, unconverted C-41, and C-42). Insertion (T25 ^ 26) and dinucleotide variation (TT29 ^ 30) lead to almost complete demethylation, C41 strongly increases the methylation of the entire CpG cluster, while C42 leads to a slight decrease. The validation study with 111 dandruff and scalp scales actually reflects these relationships. While the skin biopsies were expected to yield stable methylation signals with both primers, four clearly distinguishable data groups were observed in the scales:

• no PCR product
• PCR product but 0-2% methylation signal
• PCR product and 24-87% methylation signal
• PCR product and 100% methylation signal

The initial assumption that the different value groups (2-4) are methylation signals of different cell types was discarded after evaluation of the NGS results: Here is a clear example of ASM allele-specific methylation (Shoemaker et al ). From a classical genetic point of view and assuming that the sequence variants act exclusively in cis orientation, however, the percentage with 0% methylation signals is surprisingly high.

The described NGS study shows that the genetic effects described in the literature for brain tissue in the form of sequence variants also exist in the differentially methylated gene loci discussed in this work. In most cases, they have the character of mQTLs (Deng et al., 2009) because a sequence variant only gradually alters the degree of methylation on one or more CpGs. By contrast, the skin marker is obviously ASM.

Surprising is the effect that some unconverted cytosines exert on neighboring methylation.

It is now known that in addition to the methyl group at least three other types of modification at the cytosine bases in the DNA exist. The 5-hydroxymethylcytosine (5-hmC) is formed from the 5-mC after conversion catalyzed by the so-called ten-eleven translocation (TET) hydroxylases becomes. Further oxidation steps of 5-hmC lead to the formation of oxidation derivatives 5-formylcytosine (5-fC) and 5-carboxylcytosine (5-caC) (Dawson & Kouzarides 2012). 5-hydroxymethylcytosine is the best known DNA modification after 5 mC. It occurs mainly in the Purkinje cells of the brain and the embryonic stem cells. Here, its proportion is up to 20% of all cytosines within CG dinucliotides. In other tissues, the 5-hmC is also found to a lesser extent. The key function of 5-hmC is the regulation of transcription on several levels. Among other things, it is actively and passively involved in the process of DNA demethylation. In addition, all the oxidation derivatives of 5-methylcytosine appear to have some unexplored epigenetic signaling functions. It was found that the methylated and the hydroxymethylated cytosine can not be distinguished from each other after bisulfite treatment. In addition, several consecutive 5-hmC's appear to interfere with the activity of the Taq polymerase and thus interfere with the amplification of the 5 hmC regions in the bisulfited DNA.

In mammalian DNA, both the conventional 5-mC and the 5-hmC are most common in the context of CG dinucleotides, but not exclusively. The methylated cytosine may also be located at the so-called CpH sites, where H is A, T or C. In embryonic stem cells (ES), approximately 25% of methylated cytosines are located outside the CpGs. Even in induced pluripotent stem cells, oocytes and brain cells, methylcytosine is present in appreciable amounts in the non-CpG context. In smaller amounts, non-CpG methylation was also detected in somatic tissues such as skeletal muscle and placenta. The sequence context in which the non-CpG methylcytosine is located appears to be variable. In ES, it occurs most frequently in CAG trinucleotides. In human brain cells it is a CAC sequence. In the DNA of male germ cells, a total of 23% of the methylated cytosines were observed outside of CpG sites. The most common non-CpG dinucleotide sequence was CpA (9.8% of all methylated dinucleotides), the least frequently found - CpC.

The unconverted cytosines, which in this work have shown an influence on the neighboring methylation, are located in front of different bases. Striking, however, is the base, which stands in front of the unconverted cytosine. Out of a total of 6 cytosines in the markers Vag1, Vag2 and Skin1, 4 are found in front of a guanine and 2 in front of a cytosine. The other unconverted cytosines found in this work, which did not show any effect on methylation, are also all in front of a G or C.

Thus, the NGS experiments of this work reveal two types of effects on the degree of methylation of a CpG: On the one hand, sequence variants that behave genetically in their intra- and inter-individual occurrence - they emerge in a specific frequency in a population and they are in the affected one Organism in all cells heterozygous or homozygous, and on the other hand, the unconverted, methylation-relevant cytosines, which could be cell-specific in each individual and there, because it is an epigenetic phenomenon.

3.11 Brief description of the method: With the aid of a variant of the primer extension method, namely the so-called SNuPE method (Single Nucleotide Primer Extension), methylation loci are investigated which are methylated in body fluid A and in body fluids B, C, D , E are not methylated. The genomic DNA to be examined is subjected to the bisulfiting reaction. In this case, methylated C remains unchanged C, while the unmethylated C is converted to U in the first step and into T in the subsequent reaction. From the double-stranded genomic DNA sequence, 4 different bisulfite DNA strands are formed at the end. Depending on the base distribution in the bisulfited sequence, either the 1st or the 2nd Bisu strand is better suited for the position of the SNuPE primer. The schematic representation of the bisulfite conversion and the various variants of a methylated and unmethylated C to detect is in the Figure 142 shown.

The reaction product is first amplified at this locus by PCR in such a way that the methylation / discrimination site (CpG site) in the amplificate has the greatest possible distance to the next methylation site. The single-stranded DNA in the next step is allowed to hybridize to a DNA primer that ends just in front of the target CpG site. This system is simultaneously provided with a polymerase and different fluorescently labeled ddNTPs. Only that ddNTP that is complementary to the first base after the end of the primer on the template strand prolongs the primer by one more base. This first base is either a C or a T on the first bisulfite strand - a C if this C was previously methylated, a T if the C was not previously methylated. On the second bisulfite strand, it is either a G or an A - a G if the C was previously methylated, an A if the C was not previously methylated. Since this is an epigenetic phenomenon, the quantitative distribution between such a C and a T can in principle have any value: the C can be completely methylated, so that only one labeled ddGTP would be incorporated; it is not methylated at all, then only a labeled ddATP would be incorporated. - In between, however, just all other conditions are possible.

Although the products of the SNuPE primer extension are the same length, they can be neatly separated in a capillary electrophoresis (DNA) sequencer. In this way it can finally be determined how high the proportion of methylation at the target -CpG is. The ratio of "methylated" to "unmethylated" is used in the method for identifying body fluid from forensic material presented herein. The prerequisite for the functioning of the method is the selection of a suitable, differentially methylated CpG site in the genome.

The method is in Figure 141 in the form of a block diagram. It also lists the recommended materials for the procedure.

To confirm the results of the analysis, we use two complementary methylation markers for two body fluids - peripheral blood and sperm. In the case of methylation, the first locus indicates the presence of the required body fluid; if not methylated, the sample to be tested is any other body fluid.

The second specific marker is unmethylated in the body fluid in question and methylated in the other.

3.2 Identifying gene loci for differential methylation: Gene loci have been identified in two genome-wide studies. Both studies have been performed with the Illumina chip system (Infinum HumanMethylation27 BeadChip, Infinum HumanMethylation450 BeadChip). Two pooled DNA samples from each of the body fluids in question were placed on the chip. The first chip experiment examined more than 27,000 CpG sites in the genome, compared with over 485,000 in the second. After rescue, the regions of the following CpG sites were sequenced. The positions described in detail in the next section proved particularly suitable.

3.3 The methylation markers 3.3.1 Peripheral blood Peripheral blood marker: blood-1

Surname Markers for Marker statement Genomic locus AMP size SNuPE primer size SNP: Blut1-2r + 1f AMP: Blut1_o / p (Bisu-strand I) Peripheral blood Blood unM; Rest meth C16orf54: Single-pass membrane protein 139 bp 32 bp (2r) 344 bp 24bp (1f)

• Amplicon genomic sequence (SEQ ID NO: 1)
  > Chromosome: GRCh37: 16: 29757100: 29757443: -1
  
• Amplicon - Bisu-converted sequence (SEQ ID NO: 50)
  

primer Genomic sequence

AMP_Blut1-o TGGGTTGCTTTGGAAACAAACA (SEQ ID NO: 12) AMP_Blut1-p CCTCTGCACCCCTCCTGGG (SEQ ID NO: 13) SNP_Blut1-2r CTAAGAGGTGCAGGCTTGGAGGGTGCAGGGC (SEQ ID NO: 14) SNP_Blut1-1f GGGGCACAGTTGCCCAGCAACAGG (SEQ ID NO: 15)

Bisu-Seauenz

AMP_Blut1-o TGGGTTGTTTTGGAAATAAATA AMP_Blut1-p CCTCTACACCCCTCCTAAA SNP_Blut1-2r CTAAAAAATACAAACTTAAAAAATACAAAAC SNP_Blut1-1f GGGGTATAGTTGTTTAGTAATAGG

Meaning of the peaks

blue methylated green unmethylated black methylated red unmethylated

Peripheral blood marker: blood-2

Surname Markers for Marker statement Genomic locus AMP size SNuPE primer size SNP: blood2-f + r2 Peripheral blood Blood meth; Rest unclassified regulatory features; 5'-UTR of RAB11FIP3 232 bp 25 bp (f) AMP: Blut2_o / p (Bisu-strand 1) 24 bp (r2)

• Amplicon genomic sequence (SEQ ID NO: 2)
  > chromosomes: GRCh37: 16: 474399: 474630: -1
  
• Amplicon - Bisu-converted sequence (SEQ ID NO: 51)
  

primer Genomic sequence

AMP_Blut2-o CATAATTTGTATCAGGGAAATGA (SEQ ID NO: 16) AMP_Blut2-p TCCCTCACATTCCTTTTCC (SEQ ID NO: 17) SNP_Blut2-f GCAGCTTTGGCAAGAACCAAAGGAA (SEQ ID NO: 18) SNP_Blut2-r2 CCATGTACCCTGGGATTCTGCCAC (SEQ ID NO: 19)

Bisu sequence

AMP_Blut2-o TATAATTTGTATTAGGGAAATGATGA AMP_Blut2-p TCCCTCACATTCCTTTTCC SNP_Blut2-f GTAGTTTTGGTAAGAATTAAAGGAA SNP_Blut2-r2 CCATATACCCTAAAATTCTACCAC

The marker Blood2 consists of two SNuPE primers, i. 2 different CpG sites are analyzed in the marker amplicon. The location of the two primers is underlined in the above sequence.

Meaning of the peaks

blue methylated green unmethylated black methylated red unmethylated

3.3.2 Menstrual blood Menstrual blood marker: Mens-1

Surname Markers for Marker Aussape Genomic locus AMP size SNuPE primer size SNP: Mens1-F3m + nm menstrual blood Men Meth; Rest unclassified regulatory features; 5'-UTR of SLC26A10 320 bp 18 bp (F3m) AMP: Mens1_o / v.2p (Bisu-Stamg 1) 19 bp (F3nm)

• Amplicon genomic sequence (SEQ ID NO: 3)
  > Chromosome: GRCh37: 12: 58013390: 58013709: 1
  
• Amplicon - Bisu-converted sequence (SEQ ID NO: 52)
  
  

primer Genomic sequence

AMP_Mens1-o GACCAGGCTCAGGGAAGCTCTCAC (SEQ ID NO: 20) AMP_Mens1-p-V.2 GCCCTCTAGAGCTTGTGCTCCC (SEQ ID NO: 21) SNP_Mens1-F3M GGCGCCTGCTGCTGGCTC (SEQ ID NO: 22) SNP_Mens1-F3nm GCGCCTGCTGCTGGCTCGG (SEQ ID NO: 23)

Bisu-Seauenz

AMP_Mens1-o GATTAGGTTTAGGGAAGTTTTTAT AMP_Mens1-p-v.2 ACCCTCTAAAACTTATACTCCC SNP_Mens1-F3M GGCGTTTGTTGTTGGTTC SNP_Mens1-F3nm GTGTTTGTTGTTGGTTTGG.

Meaning of the peaks

blue methylated red unmethylated

Menstrual blood marker: Mens-2

Surname Markers for Marker statement Genomic locus AMP size SNuPE primer size SNP: Mens2-f AMP: Mens2_q / r (Bisu-strand 2) menstrual blood Men Meth; Rest MGAT1-023, 3'-end in exon 291 bp 26 bp (f)

• Amplicon genomic sequence (SEQ ID NO: 4)
  > Chromosome: GRCh37: 5: 180230890: 180231180: 1
  
• Amplicon - Bisu converted sequence (SEQ ID NO: 53)
  
  

primer Genomic sequence

AMP_Mens2-q CTGCCATGTGATCAGGACCCA (SEQ ID NO: 24) AMP_Mens2-r GCTGCTGAGGCTTGAAGGACA (SEQ ID NO: 25) SNP_Mens2-f ACTAACTTGTTTCTACATGAAACCAC (SEQ ID NO: 26)

Bisu-Seauenz

AMP_Mens2-q CTACCA TATAATCAAACCCA AMP_Mens2-r GTTGTTGAGGTTTGAAGGATA SNP_Mens2-f ACTAACTTATTTCTACATAAAACCAC

Meaning of the peaks

blue methylated green unmethylated

3.3.3 Saliva Markers for saliva: Spei-1

Surname Markers for Marker statement Genomic locus AMP-size SNuPE primer size SNP: Spei1-Fm + nm AMP: Spei1_q / r (Bisu-strand 2) saliva Spei Meth; Rest Unclassified regulatory feature; 3'-UTR of SOX 11 211 bp 22 bp (Fm) 24 bp (Fnm)

• Amplicon genomic sequence (SEQ ID NO: 5)
  > Chromosome: GRCh37: 2: 5506107: 5506316: -1
  
• Amplicon - Bisu-converted sequence (SEQ ID NO: 54)
  
  

primer Genomic sequence

AMP_Spei1-q CTACAGAGATAAGTATGAATGTGAGG (SEQ ID NO: 27) AMP_Spei1-r CTCTGGTGGCCTGGGGCCCA (SEQ ID NO: 28) SNP_Spei1-Fm CTTTCACAACGCTCACG (SEQ ID NO: 29) SNP_Spei1-Fnm CTTCTTTCACAACGCTCACGT (SEQ ID NO: 30)

Bisu sequence

AMP_Spei1-q CTACAAAAATAAATATAAATATAAAA AMP_Spei1-r TTTTGGTGGTTTGGGGTTTA SNP_Spei1-Fm CTTTCACAACGCTCACG SNP_Spei1-Fnm CTTCTTTCACAACACTCACAT,

Meaning of the peaks

red methylated black unmethylated

Markers for saliva: Spei-2

Surname Markers for Marker statement Genomic locus AMP-size SNuPE primer size SNP: Spei2-3r AMP: Spei2_q / r (Bisu strand 2) saliva Spei Meth; Vag unM 5'-end in exon of WBPIL-001 (C10orf26) 292 bp 28 bp

• Amplicon genomic sequence (SEQ ID NO. 6)
  > Chromosome: GRCh37: 10: 104535870: 104536161: 1
  
• Amplicon - Bisu-converted sequence (SEQ ID NO: 55)
  
  

primer Genomic sequence

AMP_Spei2-q ATTTCCCCCTTGGCAGACAG (SEQ ID NO: 31) AMP_Spei2-r AAAAGGAAAGGCATCCTGCAAGAG (SEQ ID NO: 32) SNP_Spei2-3r GAGCAGGCACACTGTCTCCTGCTCTCCT (SEQ ID NO: 33)

Bisu sequence

AMP_Spei2-q ATTTCCCCCTTAACAAACAA AMP_Spei2-r AAAAGGAAAGGTATTTTGTAAGAG SNP_Spei2-3r GAGTAGGTATATTGTTTTTTGTTTTTTT

Meaning of the peaks

black methylated red unmethylated

3.3.4 vaginal fluid Marker for vaginal fluid: Vag-1

Surname Markers for Marker statement Genomic locus AMP-size SNuPE primer size SNP: Vag1-1r AMP: Vag1_o / p (Bisu-strand 1) Vaginal fluid Vag meth; Spei + rest unM In Exon of HOXD4-001 (Sequence-specific TF which is part of a developmental regulatory system that provides cells with specific positional identities on the anterior posterior axis; Expressed in the developing limb buds 272 bp 29 bp

• Amplicon genomic sequence (SEQ ID NO: 7)
  > Chromosome: GRCh37: 2: 176987283: 176987554: 1
  
• Amplicon - Bisu-converted sequence (SEQ ID NO: 56)
  

primer Genomic sequence

AMP_Vag1-o GGCACATGGACCTGGGCCTG (SEQ ID NO: 34) AMP_Vag1-p AGTTGCTGAGGGTGCCACTGGAAGACAT (SEQ ID NO: 35) SNP_Vag1-1r TGATTAAAAAAAATCATCAACATAAGC (SEQ ID NO: 36) Bisu sequence AMP_Vag1-o GGTATATGGATTTGGGTTTG AMP_Vag1-p AATTACTAAAAATACCACTAAAAAACAT SNP_Vag1-1r TAATTAAAAAAAAAATCATCAACATAAAC

Meaning of the peaks

blue methylated green unmethylated

Marker for vaginal fluid: Vag-2

Surname Markers for Marker statement Genomic locus AMP-size SNuPE primer size SNP: Vag2-1f AMP: Vag2_NEWo / p (Bisu-strand 1) Vaginal fluid Vag meth; Spei + rest unM 5'-UTR of HOXD12 188 bp 27 bp

• Amplicon genomic sequence (SEQ ID NO: 8)
  > Chromosome: GRCh37: 2: 176964196: 176964383: 1
  
• Amplic n Bisu Conversion Sequence (SEQ ID NO: 57)
  

primer Genomic sequence

AMP_Vag2-NEWO ACCAAGAAGAGTCCCAGGGGACAC (SEQ ID NO: 38) AMP_Vag2-p TTTCCCCCCCTTCAGAGT (SEQ ID NO: 38) SNP_Vag2-1f ACACTTGGGCAGAGTCACCCTCTTGCC (SEQ ID NO: 39)

Bisu sequence

AMP_Vag2-NEWO ATTAAGAAGAGTTTTAGGGGATAT AMP_Vag2-p TTTCCCCCCCTTCAAAAT SNP_Vag2-1f ATATTTGGGTAGAGTTATTTTTTTGTT

Meaning of the peaks

black methylated red unmethylated

3.3.5 sperm Marker for sperm: sperm-1

SNP: Sperm1-4r AMP: Sperm1_NEWq / r (Bisu-strand 2) sperm Sperm unM: rest meth 3'-end in exon of TCP11 009 (T-complex protein 11 homologous; May play an important role in sperm function and fertility.) Single-pass membrane protein . Tissue specificity: Expressed only in fertile adult testis.) 217 bp 24 bp

• Amplicon genomic sequence (SEQ ID NO: 9)
  > Chromosome: GRCh37: 6: 35109309: 35109525: 1
  
• Amplicon - Bisu-converted sequence (SEQ ID NO: 58)
  
  

primer Genomic sequence

AMP_Sperm1-newq CATGCATGGGGCTTTTCTTCAGGCTGT (SEQ ID NO: 40) AMP_Sperm1-r AAAGGCAAGGGCTAGAGCCCAG (SEQ ID NO: 41) SNP_Sperm1-4r CTTCTCCCACATGTGAGGAAAGAG (SEQ ID NO: 42)

Bisu sequence

AMP_Sperm1-q CATACATAAAACTTTTCTTCAAACTAT AMP_Sperm1-r AAAGGTAAGGGTTAGAGTTTAG SNP_Sperm1-4r TTTTTTTTATATGTGAGGAAAGAG

Meaning of the peaks

black methylated red unmethylated

Marker for sperm: sperm-2

Surname Markers for Marker statement Genomic locus AMP-size SNuPE primer size I.SNP: Sperm2-3r AMP: Sperm2_q / NEWr (Bisu-strand 2) sperm Sperm meth; Rest 3'-UTR of VAMP8 (Vesicle-associated membrane protein 8) Involved in the targeting and / or fusion of vesicles to their target membrane Involved in dense-granule secretion in platelets Plays a role in regulated enzyme secretion in pancreatic acinar cells Involved in the abscission of the mid-body during cell division, which leads to completely separate daughter cells., Involved in the homotypic fusion of early and late endosomes, Tissue specificity: Platelets). 215 bp 17 bp 26 bp

• Amplicon genomic sequence (SEQ ID NO: 10)
  > Chromosome: GRCh37: 2: 85804931: 85805145: -1
  
• Amplicon - Bisu-converted sequence (SEQ ID NO: 59)
  

primer Genomic sequence

AMP_Sperm2-q GCTGGAATCTGAACTGGGAACTGCCC (SEQ ID NO: 43) AMP_Sperm2-newr ATAGCTCTGAGCTGTCCTGGCAGGTG (SEQ ID NO: 44) SNP_Sperm2-3r GTGGGGAGCTGGGCTTC (SEQ ID NO: 45)

Bisu sequence

AMP_Sperm2-q ACTAAAATCTAAACTAAAAACTACCC AMP_Sperm2-newr ATAGTTTTGAGTTGTTTTGGTAGGTG SNP_Sperm2-3r GTGGGGAGTTGGGTTTT

Meaning of the peaks

black methylated red unmethylated

3.3.6 skin Markers for skin, dander and dandruff: Skin-1

Surname Markers for Marker statement Genomic locus AMP-size SNuPE primer size SNP: skin1-f + r2 AMP: Hau1_o / p (bisu-strand 1) Skin (sheds) Skin meth: balance unM Intron region of MEIS1 173 bp 23 bp (f) 20 bp (r2)

• Amplicon genomic sequence (SEQ ID NO: 11)
  > Chromosome: GRCh37: 2: 66673252: 66673424: 1
  
• Amplicon - Bisu-converted sequence (SEQ ID NO: 60)
  

primer Genomic sequence

AMP_Haut1-o GAGGGGGGCCATGATGCTAG (SEQ ID NO: 46) AMP_Haut1-p TAAAGTCTAGCAACTGGGTGGCCAGGC (SEQ ID NO: 47) SNP_Haut1-f TGAGCCTGTTTGGCTTCAGAGAA (SEQ ID NO: 48) SNP_Haut1-r2 CCCAAGGGCCCCT AGAACAC (SEQ ID NO: 49)

Bisu sequence

AMP_Haut1-o GAGGGGGGTTATGATGTTAG AMP_Haut1-p TAAAATCTAACAACTAAATAACCAAAC SNP_Haut1-f TGAGTTTGTTTGGTTTTAGAGAA SNP_Haut1-r2 CCCAAAAACCCCTAAAACAC

Meaning of the peaks

blue methylated green unmethylated black methylated red unmethylated

definitions

Before the present invention will be described in detail below, it is to be understood that the invention is not limited to the particular preferred methods, procedures, and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention, which will be limited only by the appended claims. Unless otherwise stated herein, all technical and scientific terms have the same meanings as commonly understood by one of ordinary skill in the art. As used in the description and appended claims, the singular form includes "a" and "the" plural references, unless the context clearly forces another conclusion.

"Complementary" as used in this specification refers to a nucleotide sequence which has base pairing through covalent bonds to a region of a target nucleic acid sequence. According to the canonical Watson-Crick base pairing, adenine (A) pairs with thymine (T) and guanine (G) with cytosine (C). If RNA is present, thymine is replaced by uracil (U). Thus, A is complementary to T and G is complementary to C. In RNA, A to U is complementary. Usually, "complementary" refers to a nucleotide sequence that is at least partially complementary. The term "complementary" may also include duplexes that are completely complementary, with each nucleotide from one strand being complementary to each nucleotide in the other strand at the corresponding positions. In some cases, a nucleotide may be partially complementary to a target in which not all nucleotides are complementary to each nucleotide in the target nucleic acid at the appropriate position. For example, a primer may be completely complementary (100%) to the target nucleic acid, or the primer and target nucleic acid sequence have a degree of complementarity that is less than complete (eg, 70%, 75%, 80%, 85%, 90%, 95%, 99%).

The PCR reaction (polymerase chain reaction) is used to amplify a short, well-defined part of a DNA strand. This may be a gene or only a part of a gene or non-coding sequences. Unlike living organisms, the PCR process can only copy relatively short DNA segments. In a standard PCR, this can be up to about three thousand base pairs (3 kbp) long DNA fragments. With the help of certain polymerase mixtures, further additives in PCR and optimal conditions, even fragments with a length of more than 20-40 kbp can be amplified. In its current application areas, PCR requires several basic components. These are: The original DNA containing the section to be amplified (template), two primers to set the starting point of DNA synthesis on the two single strands of DNA, thereby limiting the area to be duplicated from both sides, a DNA Polymerase which is not destroyed at high temperatures to replicate (copy) the specified portion (eg, Taq polymerase), deoxyribonucleoside triphosphates, the building blocks for the DNA strand synthesized by the DNA polymerase, Mg 2+ ions, for function the polymerase essential and buffer solutions which ensure a suitable for the DNA polymerase chemical environment. The polymerase chain reaction takes place in a so-called thermocycler. This machine heats and cools the reaction vessels in it precisely to the temperature needed for each step. To prevent evaporation, a tight-fitting reaction vessel or oil layer is used on the reaction mixture. Any condensation in the lid of the vessel is prevented by a heatable device lid (over 100 ° C).

The term "sequence determination" as used in this specification refers to a variety of methods for determining the exact location of nucleotides in a DNA or RNA molecule, in other words, determining the location of the four bases - adenine, guanine, cytosine and thymine - in a DNA strand, or uracil instead of thymine in the case of RNA. DNA sequencing can be used to sequence the individual genes, larger genetic regions (eg Gene clusters or operon clusters), whole chromosomes or entire genomes. Sequencing can provide for the arrangement of individual nucleotides in DNA or RNA isolated from cells of animals, plants, bacteria, archaea or virtually from any other source of genetic information.

Preferred embodiments

1. a) Detektion des Methylierungstatus durch Bisulfit-Behandlung und Sequenzierung einer aus einem biologischen Material aus der Vergleichsgruppe extrahierten DNA
2. b) Detektion des Methylierungstatus durch Bisulfid-Behandlung und Sequenzierung einer aus einem weiteren biologischen Material aus der Vergleichsgruppe extrahierten DNA
3. c) Auswählen einer Position die bei der durch den Schritt a) erhaltenen DNA entweder methyliert oder unmethyliert vorliegt und bei der durch den Schritt b) erhaltenen DNA entgegengesetzt entweder unmethyliert oder methyliert vorliegt und
4. d) Auswählen der Nuleinsäuren, dass sie zu der Position der DNA im biologischen Material entweder komplementär oder teilweise komplementär sind.

The invention also relates to a method according to claim 1. In a broader sense, this is also a method for finding nucleic acids for the identification of biological material which contains DNA from a comparison group, comprising the following steps:

1. a) detection of the methylation status by bisulfite treatment and sequencing of a extracted from a biological material from the comparison group DNA
2. b) detection of methylation status by bisulfide treatment and sequencing of a DNA extracted from another biological material from the control group
3. c) selecting a position which is either methylated or unmethylated in the DNA obtained by step a) and in the DNA obtained by step b) is either present in unmethylated or methylated form and
4. d) selecting the nucleic acids to be either complementary or partially complementary to the position of the DNA in the biological material.

Advantageously, steps b) to d) for other biological materials from the comparison group will be repeated. Further advantageously, the biological material is selected from the group: liquid or solid biopsy or stemming therefrom, a tissue sample, in particular a skin sample, a body fluid sample, preferably a whole blood sample, a plasma sample, a serum sample, in particular a sample of peripheral blood, a menstural blood sample, a saliva sample, a sperm sample, a vaginal fluid sample, a smear of an epithelial surface, a sputum sample, a stool sample, an ejaculate sample, a lymph fluid sample, a bronchial lavage sample, a stomach ulcer fluid sample, a pleural cavity fluid sample, a cerebrospinal fluid sample, a urine sample, a tear sample , a sweat sample, pleural effusion sample, meningeal fluid sample, gland fluid sample, nipple aspirate fluid, spinal fluid sample, conjunctival fluid sample, small intestinal fluid sample, pancreatic juice sample or bile fluid. In particular, a tissue sample may be an epithelial tissue sample, in particular a surface and gland epithelial tissue sample, a connective and supporting tissue sample, in particular a bone, cartilage and adipose tissue sample, a muscle tissue sample or a nerve tissue sample, in particular a brain or spinal cord tissue sample.

One aspect of the invention relates to nucleic acids for the identification of biological material comprising DNA from a control group, wherein the nucleic acids are either complementary or partially complementary to a position of the DNA in the biological material and either methylated or unmethylated this position for a sample material from a control group present and for all other sample materials from the comparison group opposite either unmethylated or methylated.

The nucleic acids are selected from the group consisting of SEQ ID NO: 1-11.

Another aspect of the invention relates to an oligonucleotide that is complementary or partially complementary to the nucleic acids.

This is advantageously selected from the group SEQ ID NO .: 13-49.

It is also advantageous if the ratio is determined by separation of the DNA with ddGTP and ddATP by capillary electrophoresis.

The sample material is a track carrier.

In this case, the track carrier may consist of a mixture of at least two biological materials. Another aspect of the invention relates to the use of a kit according to claim 8.

Examples

Example 1: Collection of biological sample material: For the first round of validation, samples were collected from 20-30 different subjects per relevant body fluid. As a result, a large validation study was carried out because of the many parameters that can influence the level of methylation. For this purpose, samples of each body fluid were taken from another 70-80 subjects. The samples for peripheral blood, saliva and skin have been collected by about 600 people.

Example 2: DNA Extraction: Menstrual blood as well as salivary and vaginal smears were analyzed using the DNeasy® Blood & Tissue Kit or the QIamp® DNA Mini Kit, both from Qiagen, according to the standard protocol for dried blood / body fluid. Samples processed (QIAamp® DNA Mini and Blood Mini Handbook, 2007). For this, the bandage or tampon pieces or the cotton wool were used by the swab sticks.

The peripheral blood was extracted using the QIamp ® DNA Mini Kit according to the Liquid Blood / Body Fluids protocol.

The sperm samples were also processed with the QIamp ® DNA Mini Kit following the same protocol for liquid blood / body fluids. In addition, 20 μl of 1M DTT (dithiothreitol) were added for the duration of the lysis.

For the extraction of the individual dander, the SwabSolution ™ from Promega was used.

A change of the standard protocol was made here only with the sperm samples. Since the spermatozoa, especially the sperm heads, are very resistant, they are more difficult to lyse. Therefore, they are incubated with the proteinase K and the AL buffer instead of only 10 min, overnight at 56 ° C to ensure complete lysis of spermatozoa. In addition, 20 μl of 1M DTT are added for the duration of the lysis.

The sample material may be swabs, bandages or skin particles. These were first cut into the smallest possible pieces and provided with 180 μl ATL buffer and 20 μl proteinase K in a 1.5 ml Eppendorf cap. This mixture is vortexed and at 56 ° C in the thermomixer incubated until complete lysis. Binding and swabs were incubated for 1 h. Subsequently, 200 μl of AL buffer were pipetted in, vortexed and 200 μl of ethanol (> 99.8%) were added. To maximize DNA yield, 1μl of SwabSolution was pipetted to the skin samples. This mix was then heated to 70 ° C for 90 minutes and then cooled to 8 ° C. For the following bisulfitation, each mix was made up to 40μl with distilled water. Example 3: DNA Quantification and Qualification: UV / Vis spectrophotometry was determined in a Nanodrop ™ ND-1000 from NanoDrop Technologies . Here, the absorbance (optical density = OD) of the nucleic acid solution is measured at 260 and 280 nm.

The bisulfite conversion was carried out with the Kits Epi Tect Plus Bisulfite Kit and the EpiTect® 96 Bisulfite Kit (Qiagen) according to the manufacturer's protocol ( EpiTect Plus Bisulfite Conversion Handbook, 2010 and EpiTect 96 Bisulfite Handbook, 2009 ). Each 40μl of DNA extracts were mixed with 85μl in dissolved bisulfite mix and 15μl Protection Buffer (to protect the DNA from the alkaline reaction medium) to a total volume of 140μl and in the Thermo-Cycler the following incubation program (approx 5h duration): Program parameters duration temperature (1) denaturation 5 min 95 ° C (2) incubation 25 min 60 ° C (3) denaturation 5 min 95 ° C (4) incubation 85 min 60 ° C (5) denaturation 5 min 95 ° C (6) incubation 175 min 60 ° C (7) Keep cooling ∞ 20 ° C

To purify the converted DNA, 310 .mu.l of buffer BL (mixed with 1 .mu.g of carrier RNA if necessary) were pipetted in, the samples were vortexed, 150 .mu.l of ethanol (.gtoreq.99.8%) added and vortexed again. This approach was transferred to the DNA binding columns (MinElute-Spin Colums) and centrifuged. This was followed by a wash step with Buffer BW and a wash step with Buffer BD. The latter buffer serves for desulfonation and should act on the column-bound DNA membrane for 15 minutes before centrifuging the columns again. After two more washes with buffer BW and one with pure ethanol (≥99.8%), the bisulfite-converted DNA was eluted with elution buffer EB.

The amount of elution buffer used was dependent on the concentration of the DNA extract used and on the objective of the experiment. For example, in the standard validation samples, a concentration of 50 ng / μl in 40 μl extract, 2000ng DNA was expected. These were eluted with 60μl of elution buffer and accordingly contained ca. 33ng / μl Bisu DNA.

3.2. Bisulfite: The DNA samples were bisulfited using Qiagen's EpiTect® 96 bisulfite kit . Since the DNA concentration in the extracts of all samples used was in the range of 1ng - 2μg / μl, the standard protocol could be found in the kit manufacturer's manual be used. The use of carrier RNA, which improves the binding of very small amounts of DNA to the EpiTect 96 plates, can be dispensed with in fresh liquid / tissue samples.

Example 4: Search for candidate markers and primer design:

4.1 Illumina - Infinium HumanMethylation-27 and -450 BeadChip: Two genome-wide discovery analyzes were performed with the Infinium Methylation Assay - Infinium HumanMethylation27 and 450 BeadChip to comprehensively examine all CpG sites in the genome, including those outside the CpG islands - performed by Illumina.

For each body fluid (peripheral blood, menstrual blood, saliva, semen and vaginal fluid), 8 DNA samples of 50ng / μl concentration were pooled into 2 samples, re-measured and bisulfited. In addition to the ten sample pools, two endometrial samples were tested in the first experiment, and in each case an endometrial, skin, penile mucosa and sperm-free seminal fluid sample were tested in the second experiment. The 1st study was performed on the Methylation27 BeadChip, the 2nd analysis on the Methylation450 BeadChip.

The methylation results are available as an Excel file. The table rows list the individual ClusterCGs of the chip (27,580 clusters on the 27BeadChip and over 485,000 clusters on the 450BeadChip). Each cluster measures the methylation status of a given CpG in the genome. The columns contain, in addition to various cluster information (chromosome number, locus coordinates, strand information, RefGene name and accession, genomic sequence etc., and, if applicable, CpG island name and SNP number) the methylation values 0 to 1 (AVG_Beta value) of the measured DNA samples. These represent the percentage methylation value of the measured CpGs. These numbers were used to search for those CG clusters that met predefined differentiation criteria.

4.2 Candidate selection: The necessary property for a suitable marker locus was - the methylation status should be at most different in the target fluids / tissues from that of the other fluids. In order to be able to use this marker later for the detection of the specific body fluid also within mixtures, an additional condition had to be given - the remaining fluids should be completely unmethylated in the locus and only the target fluid should be methylated. In this case, a methylation signal would detect the presence of the target fluid in an unknown mixture, regardless of which and how many other fluids / tissues are mixed. On the other hand, one locus may be completely unmethylated in the target fluid, but more or less methylated in all other tissues. Then, it was a suitable marker candidate to indicate by the methylation signal unknown admixtures of other body fluids in the target fluid.

Accordingly, in the methylation results, the Illumina chips were searched for those clusterCGs which were methylated in the target fluid / tissue and unmethylated in the remaining body fluids or vice versa. The AVG values above 0.4 were considered methylated and values below 0.05 defined as unmethylated. Table 1 shows an example of two reciprocal peripheral blood candidates. The upper candidate (# 320596) is methylated on average over 50% in blood and less than 5% in other fluids. The lower candidate (# 23060), on the other hand, is unmethylated in blood (below 3%) and in other samples, 50 to 95% methylated. <b> Table 1 Methylation values of two blood candidates from the Illumina 450HeudChip </ b> peripheral blood menstrual blood Vaginal fluid saliva sperm endometrium index ClusterCG-10 Ø AVG_Beta Ø AVG_Beta Ø AVG_Beta Ø AVG_Beta Ø AVG_Beta Ø AVG_Beta 320596 cg17525495 0.53592230 0.3676791 0.02070355 0.04307932 0.01693343 0.0606476 23060 cg23093496 0.02836053 0.49814470 0.73879040 0.50809840 0.94879920 0.8654272

To find the best CG clusters for these selection principles, the Excel formula "AND" was used. In doing so, certain conditions are formulated for a line, and if true, marked TRUE. This function can be used for all rows in the table.

The highest-discrimination candidate clusters in the result table (approximately 50 bases) of the candidate clusters were used in the BLAST search program on the Ensembl Genome browser web page. The resulting genomic sequences of the candidate regions, about 300 bases before and after the sequence fragment sought, were examined for further properties. Exclusion criteria at this stage were, first, trapped repeat sequences in the immediate vicinity of the target CpG. This was checked with the help of the online program Repeat-Masker. Second, the candidate sequences were checked for integrated known SNPs. For this purpose, a search was carried out in the SNP database. Assay primers were designed on the sequences sorted out in this first round of control.

The developed candidate assays were each tested in groups. The detailed investigations were carried out on the samples, which were also analyzed on the Illumina chip. If the discrimination potential in these samples was confirmed, other samples were included in further analysis.

4.3 Design of the Amplification Primers: After bisulfite treatment, there are two single strands that are no longer complementary to each other. These are the result of the two complementary strands of genomic DNA. For the primer design, the genomic DNA sequence is initially virtually bisulfite-converted. There is a special online tool called Biq-Analyzer. If you use the forward strand for the conversion you get the 1st Bisu strand. If one converts the complementary reverse strand, it becomes the second Bisu strand. The primer design always takes place at the forward (5 '→ 3') strand on both the 1st and 2nd Bisu strands. Thus, the primers for one and the same bisulfited DNA locus can be constructed on two different sequences. See also FIG. 139 ,

The base distribution in the two Bisu strands is not identical. One strand is GC-rich, the other AT-rich. This has an effect on the melting temperature of the primer. The higher the GC content of the oligonucleotide, the higher its melting temperature and the higher the annealing temperature be chosen in the PCR. The melting temperature (T _m ) of a DNA duplex is defined as the temperature at which 50% of the duplex is in single-stranded form. It depends on length, base composition, salt concentration of the PCR reaction and the concentration of the oligonucleotide. The primers bind to the target sequence as long as their melting temperature is reached. In the PCR, one usually selects a temperature which is about 3 ° C below the calculated melting temperature, so that an annealing of the primer is ensured to the target sequence.

For PCR to proceed under uniform conditions, the melting temperatures of all amplification primers should be approximately the same for all markers. For this reason, and because of the unbalanced base distribution in the two bisulfited DNA strands, either the 1st or 2nd strand was better suited for the primer design.

• Schmelztemperatur T_M = 57-58°C; T_M [Primer Fwd] = T_M [Primer Rev]
• Die Primersequenzen müssen außerhalb von CpGs liegen, damit sowohl methylierte als auch demethylierte DNA-Moleküle amplifiziert werden können.
• Die Amplikons sollten maximal 300 bp lang sein, damit die PCR auch mit degradierter DNA funktioniert.
• Die Länge der Primer sollte zwischen 17 und 30bp liegen.
• Die Primer-Sequenz wird stets in 5'→3'-Richtung geschrieben; somit werden die reversen Primer als reverse Komplementär-Sequenz angegeben
• Die Primer dürfen keine Homodimer- und Heterodimerstrukturen ausbilden (Selbstdimerisierung:
  • ΔG > - 5 kcal/mol, Heterodimerisierung: ΔG > -8 kcal/mol)

The following criteria were considered in the design of the amplification primers:

• Melting temperature T _M = 57-58 ° C; T _M [Primer Fwd] = T _M [Primer Rev]
• The primer sequences must be outside of CpGs so that both methylated and demethylated DNA molecules can be amplified.
• The amplicons should be a maximum of 300 bp long, so that the PCR also works with degraded DNA.
• The length of the primer should be between 17 and 30bp.
• The primer sequence is always written in 5 '→ 3'direction; thus, the reverse primers are given as the reverse complementary sequence
• The primers must not form homodimer and heterodimer structures (self-dimerization:
  • ΔG> - 5 kcal / mol, heterodimerization: ΔG> -8 kcal / mol)

The melting temperature and the dimerization energy of the primers were calculated using the online program Oligoanalyzer ( http://eu.idtdna.com/analyzer/applications/oligoanalyzer ).

The following reaction parameters were entered into oligoanalyzer: Oligo concentration: 0.25 μM; Na ⁺ conc. = 50mM; Mg ⁺⁺ = 2.5mM; dNTP = 0.2 mM.

4.4 Design of the SNuPE primer: The single nucleotide primer extension method is based on the oligonucleotide ending one nucleotide in front of the position of the variable or discriminating target base. In the SNaPshot reaction, the polymerase then extends the primer at its 3 'end by a single ddNTP complementary to the polymorphic base. The target base is the methylated C or unmethylated T of the CpG dinucleotide, previously measured on the Illumina chip in the selected candidate cluster. The SNuPE primer can be designed for detection as both a forward and a reverse primer. He should end with his 3'-end always in front of the discriminating base. In Figure 140 Figure 1 depicts a methylated and an unmethylated example sequence of a first Bisu strand and the location of the possible forward and reverse primers for the target CpG (marked yellow and green). In this case, the discriminating base is C or T in the upper 5'-3 'forward strand, and G or A in the lower complementary 3'-5'-reverse strand, respectively. In the second Bisu strand, it would be G / A in the 5'-3 'strand and C / T in the 3'-5' strand. Unfortunately, it is mostly in amplicons With high CpG density, it is not always possible to position the primer so that it reaches the desired base. The target sequence of the primer must not contain any CpGs, since a variable base is present at this point. The primer would then have a mismatch in the binding site in either the methylated or unmethylated sequence and could not specifically bind to the corresponding sequences.

For such challenging amplicons, an alternative detection system has been developed that outsmarted and even exploited the problem with CpGs in the primer binding site. The necessary condition for the system is - two or more CpGs must be included in the primer target sequence. The methylation content is not measured with a standard SNuPE primer, but with two sequence-specific primers - a methylation-specific and a non-methylation-specific primer. The former only binds to methylated DNA molecules. The second primer binds at the same site but unmethylated DNA copies. Both primers are later analyzed simultaneously in a reaction approach. They must therefore be of different lengths and end with the 3 'end in front of two different bases. In Figure 141 (Schematic representation of the location of a methylation- and a non-methylation-specific primer of the alternative SNuPE detection system) is the construction of two sequence-specific forward primers spanning two CpGs. The methylation-specific primer, which binds to methylated DNA copies, is later detected as a blue signal in the analysis of the SnaPshot products. Due to the length difference of 2bp, the non-methylation-specific primer achieves a different running behavior, which is shown in a separate red signal.

The SNuPE primers were also assayed for the necessary properties using the oligoanalyzer, using the same concentration data as for the amplification primers. The conditions of primer length and homodimerization energy were also identical. The desired melting temperature T _{M of} the oligonucleotides was 58 to 60 ° C. See also Figure 140 ,

Example 5: Methylation analysis by bisulfite sequencing: The bisulfite sequencing method makes it possible to determine the methylation status of all cytosines in CpG dinucleotides of a DNA amplificate. The bisulfite conversion ensures the distinction between methylated and non-methylated cytosines. The latter appear as TpG dinucleotides in the sequence. These differences are determined after Sanger sequencing by comparing the results with the starting sequence using a special software.

Using bisulfite sequencing, it was possible to obtain an overview of the methylation status of the individual CpG sites within the marker loci.

5.1 PCR amplification: For certain amplification primers, a reaction composition with a higher MgCl ₂ concentration proved optimal in order to avoid non-specific PCR products. Other primers have worked better in a PCR mix without additional MgCl ₂ addition. Therefore, the PCR protocol includes two different compositions. All primers were needed for amplification at a concentration of 4.5 pmol.

Two names are used for each marker. The second name represents a systematic name for the patent application. <b> Table 2 Old and New Marker Labels </ b> Original name New name proof of 1572 Blood-1 Peripheral blood Blut4 Blood 2 Peripheral blood Men8 Mens 1 menstrual blood 21867 Mens 2 menstrual blood Spei7 Spei 1 saliva 1622 Spei 2 saliva 1628 Vag-1 vaginal SpVa1 Vag-2 vaginal Men1 Sperm-1 sperm Men3 Sperm-2 sperm Haut1 Skin 1 Skin (scales) Sprm1 Closed-1 Sex (male, female) Sprm3 Closed-2 Male blood / semen

The amplification primers bear the names of the abbreviated primers "AMP" and the names of the two forward and reverse primers, depending on the Bisu strand where the amplification takes place ("o" and "p" for the two primers on the 1st Bisu strand, "q" and "r" for those on the 2nd Bisu strand).

5.1.1. Reaction Mixtures (Vairante 1): For the primers Blood1, Blood2, Spei1, Spei2, Vag1, Vag2, Sperm1 and Skin1 , the reaction mixture consists of the following components: component Volume per reaction in μl water 14,30 PCR buffer 10x 2.50 MgCl (25mM) 2.00 dNTP mix (2.5 pmol each) 2.00 Hot Start Taq 0.20 Primer (4.5 pmol) 3.00 Bisulfited DNA 1.00

The primers Mens1, Mens2 and Seprm1 , on the other hand, are more effective under the following conditions. component Volume per reaction in μl water 18,10 PCR buffer 10x 2.50 dNTP mix (25 pmol each) 0.20 Hot Start Taq 0.20 Primer (4.5 pmol) 3.00 Bisulfited DNA 1.00

The PCR program for the amplification in turn is the same for all markers and is structured as follows: PCR conditions (1) denaturation 15 sec 95 ° C (2) denaturation 1 min 95 ° C (3) annealing 45 sec 56 ° C (4) elongation 1 min 72 ° C → go to (2) 9 x (5) denaturation 1 min 95 ° C (6) Annealing 45 sec 55 ° C (7) elongation 1 min 72 ° C → go to (5) 15x (8) denaturation 1 min 95 ° C (9) Annealing 45 sec 54 ° C (10) elongation 1 min 72 ° C → go to (8) 14 x (11) elongation 10 min 72 ° C (12) Cool down ∞ 8 ° C

5.1.1. Reaction Mixtures (Variant 2): For the primers Blood 1, Blood 2, Spei-1, Spei-2, Vag-1, Vag-2, Sperm-1 and Skin-1, the reaction mixture (New) is as follows composed: PCR component - new composition Volume per reaction (μl) water 14,30 PCR buffer 10x 2.50 MgCl ₂ (25mM) 2.00 dNTP mix (2.5 pmol each) 2.00 Hot Start Taq polymerase (Qiagen) 0.20 Primer (4.5 pmol) 3.00 Bisulfited THEN 1.00

The primers Mens-1, Mens-2, Seprm-2, Geschl-1 and Geschl-2, however, are more effective under the following conditions (Alt). PCR component - Old composition Volume per reaction in μl water 18,10 PCR buffer 10x 2.50 dNTP mix (25 pmol each) 0.20 Hot Start Taq polymerase (Qiagen) 0.20 Primer (4.5 pmol) 3.00 Bisulfited THEN 1.00

The original PCR program was modified according to the touchdown principle. In the following PCR protocol, the annealing temperature is lowered from 56 ° C to 54 ° C in 3 steps. The PCR program is the same for all markers since all primers have an approximately equal melting point of 58 ° C. Cyding parameters (1) denaturation 15 minutes 95 ° C (2) denaturation 1 min 95 ° C (3) annealing 45 sec 56 ° C (4) elongation 1 min 72 ° C → go to (2) 9 x (5) denaturation 1 min 95 ° C (6) Annealing 45 sec 55 ° C (7) elongation 1 min 72 ° C → go to (5) 15x (8) denaturation 1 min 95 ° C (9) Annealing 45 sec 54 ° C (10) elongation 1 min 72 ° C → go to (8) 14 x (11) elongation 10 min 72 ° C (12) Cool down ∞ 8 ° C

5.2 Enzymatic Purification of the PCR Products: For each 5 μl of product to be purified, 1.0 μL alkaline phosphatase FastAP ( 1 U / μL), 0.25 μL ExoI (10 U / μL), 0.5 μL buffer (10 × conc.) And 0 , 25μl of water mixed and pipetted. The temperature program for the thermal cycler starts at 37 ° C for 90 minutes. The mixture is then heated to 85 ° C for 15 minutes and finally cooled to 8 ° C.

5.3 Sequencing Reaction: For Sanger sequencing of the amplification products, the commercial Kit BigDye® Terminator Cycle Sequencing Kit v1.1 from Applied Biosystems by Life Technologies was used. In addition to the dNTPs already included in the kit, another dNTP solution (0.1pmol) was added to the reaction. Thus, the strongly shifted base shares in the bisulfited DNA strands were compensated. Cycling parameters (1) denaturation 2 min 96 ° C (2) denaturation 30 sec 96 ° C (3) annealing 15 sec 55 ° C (4) elongation 4 min 60 ° C → go to (2) 24 x (5) Cool down ∞ 4 ° C

5.4 Sequencing of the Marker Amplificates: To remove the remaining free components from the sequencing reaction, the DTR V3 96-well short plate kit from EdgeBio was used. The cleaning plates were prepared according to the manufacturer's protocol, the reaction batches were applied to the gel bed of the plate and centrifuged at 850 G for 5 min. The purified sequencing products were mixed with 10 μl Hi-Di formamide and denatured at 90 ° C for 3 minutes. The capillary electrophoretic separation of the fluorescently labeled DNA fragments was carried out in an ABI 3730 DNA Analyzer with settings for the Standard Sequencing Run Module with 36 cm array, the POP-7 Performance Polymer as separation medium and the BigDye Set E. The primary data analysis was carried out with the ABI Sequencing Analysis Software v5.2 in conjunction with the KB Basecaller and later with the program ESME.

5.5 Data analysis: ESME analysis: The analysis of ABI-basecaller sequences in the form of ab1 files was performed using software developed by Epigenomics (ESME). Using this program, the methylation status is estimated by the ratio of the superimposed C and T signals at each CpG site.

For the analysis, the abl sequence files as well as the marker sequences used for the amplicon design in text format are needed. First, the software normalizes the cytosine signals in the sequence, as these are usually scaled disproportionately in direct bisulfite sequencing to the other three types of signals. Thereafter, the bisulfite sequence is aligned with the respective reference sequence. Subsequently, the average DNA methylation values are calculated by evaluating C and T signals at CpG positions. The calculated values are presented in the form of a yellow-blue color scale (from yellow = 0% methylated to blue = 100% methylated) in an overview matrix. The individual CpGs are arranged in the rows per amplicon and the individual samples in the columns. In addition, ESME creates image files of the individual sequences and a text table with the methylation values of the analyzed CpGs in the sequences. With the aid of the image files, the correctness of the specified percentage methylation can be checked and, if necessary, corrected in the text table. The corrected table can be converted to the corrected matrix. Example 6: The SNuPE Assay: Already at an early stage of the work, the measurement of methylation using single nucleotide primer extension has been found to be the method of choice. Their advantage is that only one specific - the most discriminating CpG in the marker amplicon - can be targeted. This makes the method relatively easy to validate.

The SNuPE assay consists of several steps. The PCR amplification and the subsequent enzymatic purification of the PCR products are identical to the corresponding steps for bisulfite sequencing. This is followed by the actual SNaPshot reaction with specific SNuPE primers, a second purification step and the detection of the marker signals by capillary electrophoresis. In the Figure 142 the preparation steps and the individual steps of the assay and the necessary reagents / commercial kits are summarized.

6.1 PCR amplification and enzymatic purification of the PCR products: The PCR and the subsequent enzymatic purification of the amplificates were carried out according to the same protocol as in the bisulfite sequencing.

6.2 SNaPshot reaction: The purified PCR products were used in the SNaPshot reaction. This was done with the SNaPshot Multiplex Kit by Applied Biosystems by Life Technologies according to the manufacturer's protocol. The principle of this reaction is similar to that of PCR - it also occurs in the three steps denaturation, annealing and elongation. The difference is that the elongation occurs only around the one base which is complementary to the discriminating base. Single-base elongation of the extension primer occurs by incorporation of one of the four types of fluorescently labeled ddNTPs included in the kit reaction mix along with the polymerase and buffer. Into the reaction were used per liter of SNuPE primer and 3 μl of enzymatically purified PCR products.

The reaction mixture for this PCR consisted of 3 μl of the purified sample, 2 μl of the extension primer, 4 μl water and 1 μl of the 2x SNaPshot reaction mix contained in the kit. The extension primers used were previously diluted to a concentration of 1 pmol / μl.

The temperature steps were carried out as follows: Cycling parameters (1) denaturation 10 sec 96 ° C (2) Annealing 7 sec 55 ° C (3) elongation 30 min 60 ° C → go to (1) 24 x (4) cool down ∞ 4 ° C

6.3 Enzymatic purification of SNaPshot products

Variant 1: In order to obtain a clear color signal in the subsequent analysis in the sequencer, it is necessary to remove the remaining ddNTPs from the PCR mix. For this purpose, 1 μl of Fast-AP (1 U / μL) and 1 μl of Fast buffer (10 × conc) were pipetted into the entire mix. The temperature program in the thermocycler is identical to that of the first enzymatic purification.

Variant 2: To the entire reaction mix, 1 μl of Fast-AP (1 U / μL) and 1 μl of Fast buffer (10 × conc.) Were added. The temperature program in the thermocycler starts at 37 ° C for 60 minutes. Thereafter, the enzyme is heat-denatured at 75 ° C for 15 minutes and then the reaction mixture is cooled to 8 ° C.

6.4 Detection of marker signals

Variant 1: Prior to analysis in the sequencer, 1 μl of the purified sample was mixed with 9 μl formamide Hi-Di and 0.25 μl LS120 as internal length standard. Alternatively, deionized water may be used instead of the formamide.

This mixture was first denatured for 3 min at 90 ° C to separate the amplificates into single strands.

Variant 2: Prior to analysis in the ABI 3730 Sequencer, 1 μl of the purified sample was spiked with 9 μl Formamide Hi-Di and 0.25 μl internal length standard GeneScan ™ 120 LIZ ™. The run module needed for the analysis contained as a template the manufacturer module HTSNP36_POP7, with the settings for the 36cm array, the POP-7 Performance Polymer as separation medium and the G5-RCT Dye Set. Before analysis in the apparatus, the mixture was first denatured at 90 ° C for 3 minutes.

6.5 Data analysis using GeneMapper Software: The evaluation of the marker signals was performed using the ABI software GeneMapper v3.7 or v3.2 GeneMapper ID. First, the raw data were analyzed by entering the appropriate settings for length standard GS120Liz and Analysis Method - SNaPshot Default. Then all samples of a record in the sample list were selected and the correct methylation and / or non-methylation signals marked in the individual plot windows. The area and height values for the marked peaks were exported as a text table and edited in Excel 2007.

For the calculation of the percent methylation value of the sample, the height and area of the methylation signal were set in relation to the total height of the two methylation and non-methylation signals. From the two methylation values resulting from peak height and peak area, the average was then formed.

Example 7: Next Generation Sequencing: The actual NGS analysis was performed on the Roche 454 Genome Sequencer GS FLX + and Illumina MiSeq devices.

7.1 Primer constructs and PCR: All markers (blood 1 and 2, Mens-1 and 2, SpeI-1 and 2, Vag-1 and 2, Sperm-1 and 2, and Skin-1) were included in the study except the two Sex markers, included. Both forward and reverse amplicons of the eleven markers should be analyzed together in a single pool. For this, the 22 amplification primers were given their own specific barcode. For the preparation of the NGS-suitable primer constructs, the 22 primers at their 5 'end were replaced by 6 or 8 base barcode (6-base barcode for forward primers and 8-base barcode for reverse primers) and a 2- to 8-base linker added ( FIG. 143 Basic Construction of Length and Bar Code-Differentiated Primer Constructs for NGS) The short DNA linkers were designed for each primer such that all 22 forward and reverse amplicons differed in length by at least two bases. This is especially important when analyzing for Roche-454 Sequencer when all samples are pooled in a single NGS run. For two different amplicons containing longer base homopolymers in the sequence and of equal length, both could be read as a single sequence. The Illumina technology in this case is much less sensitive to base homopolymers.

The amplification PCR was performed according to the own standard protocol (old PCR composition), with only 3 instead of 1 μl template. For amplification, a Taq polymerase should normally be used which leaves blunt DNA ends since blunt ends of the amplicon are required for the ligation of the adapters in the subsequent steps. Many Taq polymerases often attach an additional dATP or other random nucleotide to the end of the synthesized duplex after each elongation step - also the Qiagen product used here.

Bisulfite DNA samples, which were already analyzed with SNuPE, were used for all three test series. To clarify the first question - to what extent can the methylation results from the different detection methods be confirmed in the NGS analysis - samples were used which were measured both with SNuPE and with bisulfite sequencing.

7.2 Purification of the PCR products with magnetic beads: Two kits were available for the purification of the PCR products with magnetic beads - AMP Clean / CleanPCR (GC Biotech) and Agencourt AM-Pure XP (Beckman Coulter). Both work on the same principle. The implementation was carried out according to the manufacturer's protocol.

The volume of the beads solution used can be varied from 1.3 to 1.8 times, based on the sample volume. Using 1.8 times the volume, all DNA molecules from the sample are bound to the beads. This amount is used to concentrate the samples. To separate the primer or adapter dimers from the reaction, 1.3 times the sample volume is used. Thus, only the longer DNA fragments (over 100 bp) are held firmly to the beads and the shorter ones are removed in the course of the washing steps. At the end elution was carried out with 15 μl elution buffer EB (Qiagen).

7.3 Fluorometric quantification of PCR products: PCR products were analyzed using Qubit 2.0 Fluorometer (Invitrogen) and the associated Qubit ™ dsDNA High Sens (HS) assay kit suitable for measuring 0,2-100ng dsDNA quantified. The procedure was carried out according to the work instructions of the kit.

7.4 Setting the Equimolarity: The individual marker amplificates must be equimolar for analysis. The optimal total amount for both systems is about 500ng. Accordingly, approximately 45.5ng per marker should be used. The total volume had to be concentrated by magnetic beads to 15 μl for the subsequent PCR.

7.5 Final Repair Reaction: In this step, the supernatant amplicon ends generated by the Taq polymerase during amplification are filled with dATPs for later adapter ligation (A-tailing). Two different DNA polymerases are involved in this reaction. The Klenow DNA polymerase has only a 3 '->5' exonuclease function but no 5 '→ 3' polymerase activity and is active at 25 ° C. It breaks down the protruding, single-stranded 3 'ends. The ordinary T4 Taq polymerase, which is only active at a higher temperature, fills the ends with dATPs with its 5 '→ 3' function, since only this variety of deoxynucleotide triphosphates is contained in the end repair buffer.

The reaction for Roche 454 was after the References to the Fragment End Repair Protocol in the Roche Rapid Library Preparation Method Manual (2010) , Prepared and carried out. The approach for Illumina MiSeq was processed according to the protocol for NEBext End Prep in the NEBNext Ultra DNA Library Prep kit for Illumina - Instruct1 (2013) by New England Biolabs .

7.6 Ligation of library-specific adapter: After addition of the 3'-adenine overhang, the TA ligation of the specific adapter was performed at the ends of the amplicons - in both analysis methods using a T4 DNA ligase (NEB). The adapters contain a specific recognition sequence that later allows the library to map to the bioinformatic processing of NGS reads. In addition, a binding site for the universal primer is used in the adapter sequences, which are used in the subsequent enrichment PCR.

The reactions were also carried out according to the instructions in the manufacturer's protocol (see above). Following the ligation, the pool was cleaned twice with magnetic beads to completely remove the unbound adapters. In order to simplify the binding of the beads to the magnet, the reaction volume was first made up to 100 μl with water. The beads solution was used in 1.3 times volume so that the adapter dimers are not bound under any circumstances. After the first purification step, elution was carried out with 100 μl of water. At the end of the second purification, the library products were eluted with 20 μl EB buffer.

7.7 Enrichment of Library Fragments and Homogenization: This PCR is used to homogenize and enrich the ligation products and is performed with universal primers that bind to the target sequence in the adapters. Again, the reactions were carried out according to the manufacturer's specifications. The participating Dream Taq polymerase (ThermoScientific) amplifies fragments up to 20kb and can also incorporate modified bases. After PCR, the library was again cleaned with 1.3-fold volume of Magnetic Beads solution , eluted with 15 μl of EB buffer and then quantified fluorometrically using Qubit and the High Sens Kit .

7.8 Quality control: In the quality PCR, the completeness of the pool and the accuracy of the previous measurements are checked. The quantification results calculate the dilution factor for the use of the pool in the PCR. It should be used as exactly as possible 1 x 10 ⁸ molecules per μl in the PCR. These are later to show in the agarose gel the same band intensity as those with tested positive controls which contain precisely this concentration of molecules. Two reactions with library DNA as template, two positive controls and two negative controls were set up and amplified as follows: Cycling parameters (1) denaturation 1 min 95 ° C (2) denaturation 30 sec 95 ° C (3) annealing 1 min 60 ° C (4) elongation 1 min 72 ° C → go to (2) 19 x (5) elongation 10 min 72 ° C (6) Cool down ∞ 4 ° C

After the PCR, in each case 1 μl of exonuclease I (NEB) was added to the individual reactions, and the mixture was incubated at 37 ° C. for 30 min. Subsequently, 10 μl of the purified products were mixed with 5 μl 1xTE buffer and 3 μl orange dye and separated together with two high and low range ladders in a 1.5% agarose gel. The bands of the library samples should be similar in intensity to the two positive controls. In addition, the amplicons from the pool, if different in size, should be recognizable in individual bands. In parallel with the control on the agarose gel, 1μl of the purified library products were measured in the Agilent 2100 Bioanalyzer plate agarometer (Agilent Technologies) using the accompanying DNA Series II kit, according to the manufacturer's protocol. This technique provides a high resolution analysis of the PCR fragments by capillary electrophoretic separation and simultaneously determines the concentration of the measured sample. Direct quantification is done using the FAM tag of the adapter and a supplied standard.

7.9 Sequencing: The library of the first set of experiments - to verify the methylation values from the SNuPE measurements - was sequenced on both the Roche 454 Genome Sequencer GS FLX + and the Illumina MiSeq. For the 454 technique, 20000 reads (Lib 601.B) and for Illumina 100000 250bp-paired end reads were aimed for (Lib 601.C). The experiment to search for possible methylation-influencing sequence variants was carried out exclusively with the Illumina technology (Lib 813.A), with each 100000 250bp-paired-End Reads per library were sought. The sequence data were according to the library-specific adapter sequences and 22 different marker-specific forward and reverse bare codes, and evaluated using the Geneious and CLC Genomics Workbench 6 software.

Example 8: Validation of the methylation markers: The best SNuPE methylation markers were tested for detection limit, repeatability and detection limit of liquids in mixed samples. The experiments were carried out specifically for the individual markers. The description can be found in the corresponding chapters in the results section.

8.1 Forensic validation: For all markers and all five body fluids, long-term stability was tested under forensic conditions. The forensic validation of the skin marker was performed separately. This was tested on forearm and scalp scales as well as dander from real casework.

Up to 6 months, the samples were exposed to heat, moisture, sunlight and the action of soil (microbes).

1. 1) Trockene Umgebung: bei Raumtemperatur gelagert, lichtgeschützt in Plastik-Tüten (Figur 144a))
2. 2) Feuchte Umgebung: bei Raumtemperatur gelagert, lichtgeschützt in Exsikkator (Figur 144b))
3. 3) Außenbedingungen: wetterbedingte Umgebung (Sonne, Regen, Mikroorganismen) auf Erde gelagert (Figur 144c))

Three different environmental conditions were simulated:

1. 1) Dry environment: stored at room temperature, protected from light in plastic bags ( Figure 144a ))
2. 2) Humid environment: stored at room temperature, protected from light in desiccator ( Figure 144b ))
3. 3) Outdoor conditions: weather-related environment (sun, rain, microorganisms) stored on soil ( Figure 144c ))

Six identical sets of traces - consisting of peripheral blood, menstrual blood, saliva, sperm and vaginal fluid - were prepared. For the blood, menstrual blood and semen traces 50μl each of the liquid were used. Vaginal fluid and saliva tracks were made as abrasions. The trace kits were stored in the three species described above for up to six months. The first set was edited and analyzed directly. The methylation values of the markers from the first analysis at time 0 were compared with the values from the following months.

SEQUENCE LISTING

• <110> Klaus, Olek
• <120> Method for finding nucleic acids, nucleic acids and oligonucleotides complementary thereto for identification of biological material, and methods for identifying biological material and kit
• <130> P04055 / DI
• <160> 60
• <170> PatentIn version 3.5
• <210> SEQ ID NO 1
  <211> LENGTH: 344
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Amplicon Blut1, genomic sequence
• <400> SEQUENCE: 1
  
• <210> SEQ ID NO 2
  <211> LENGTH: 232
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Amplicon Blood 2, genomic sequence
• <400> SEQUENCE: 2
  
  
• <210> SEQ ID NO 3
  <211> LENGTH: 320
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Amplicon Mens1, genomic sequence
• <400> SEQUENCE: 3
  
• <210> SEQ ID NO 4
  <211> LENGTH: 291
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Amplicon Mens2, genomic sequence
• <400> SEQUENCE: 4
  
• <210> SEQ ID NO 5
  <211> LENGTH: 211
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Amplicon Speil, genomic sequence page 2
• <400> SEQUENCE: 5
  
• <210> SEQ ID NO 6
  <211> LENGTH: 292
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Amplicon Spei2, genomic sequence
• <400> SEQUENCE: 6
  
• <210> SEQ ID NO 7
  <211> LENGTH: 272
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Amplicon Vag1, genomic sequence
• <400> SEQUENCE: 7
  
• <210> SEQ ID NO 8
  <211> LENGTH: 188
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Amplicon Vag2, genomic sequence
• <400> SEQUENCE: 8
  
• <210> SEQ ID NO 9
  <211> LENGTH: 217
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Amplicon Sperm1, genomic sequence
• <400> SEQUENCE: 9
  
• <210> SEQ ID NO 10
  <211> LENGTH: 215
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Amplicon sperm, genomic sequence
• <400> SEQUENCE: 10
  
  
• <210> SEQ ID NO 11
  <211> LENGTH: 173
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Amplicon Skin1, genomic sequence
• <400> SEQUENCE: 11
  
• <210> SEQ ID NO 12
  <211> LENGTH: 22
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Blut1-o
• <400> SEQUENCE: 12
  tgggttgctt tggaaacaaa about 22
• <210> SEQ ID NO 13
  <211> LENGTH: 19
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Blut1-p
• <400> SEQUENCE: 13
  cctctgcacc cctcctggg 19
• <210> SEQ ID NO 14
  <211> LENGTH: 31
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Blut1-2r
• <400> SEQUENCE: 14
  ctaagaggtg caggcttgga gggtgcaggg c 31
• <210> SEQ ID NO 15
  <211> LENGTH: 24
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Blutl-lf
• <400> SEQUENCE: 15
  ggggcacagt tgcccagcaa cagg 24
• <210> SEQ ID NO 16
  <211> LENGTH: 23
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Blut2-o
• <400> SEQUENCE: 16
  cataatttgt atcagggaaa tga 23
• <210> SEQ ID NO 17
  <211> LENGTH: 19
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Blut2-p
• <400> SEQUENCE: 17
  tccctcacat tccttttcc 19
• <210> SEQ ID NO 18
  <211> LENGTH: 25
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Blut2-f
• <400> SEQUENCE: 18
  gcagctttgg caagaaccaa aggaa 25
• <210> SEQ ID NO 19
  <211> LENGTH: 24
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Blut2-r2
• <400> SEQUENCE: 19
  ccatgtaccc tgggattctg ccac 24
• <210> SEQ ID NO 20
  <211> LENGTH: 24
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Mens1-o
• <400> SEQUENCE: 20
  gaccaggctc agggaagctc tcac 24
• <210> SEQ ID NO 21
  <211> LENGTH: 22
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Mens1-pV.2
• <400> SEQUENCE: 21
  gccctctaga gcttgtgctc cc 22
• <210> SEQ ID NO 22
  <211> LENGTH: 18
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Mensl-F3m
• <400> SEQUENCE: 22
  ggcgcctgct gctggctc 18
• <210> SEQ ID NO 23
  <211> LENGTH: 19
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Mens1-F3nm
• <400> SEQUENCE: 23
  gcgcctgctg ctggctcgg 19
• <210> SEQ ID NO 24
  <211> LENGTH: 21
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Mens2-q
• <400> SEQUENCE: 24
  ctgccatgtg atcaggaccc a 21
• <210> SEQ ID NO 25
  <211> LENGTH: 21
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Mens2-r
• <400> SEQUENCE: 25
  gctgctgagg cttgaaggac a 21
• <210> SEQ ID NO 26
  <211> LENGTH: 26
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Mens2-f
• <400> SEQUENCE: 26
  actaacttgt ttctacatga aaccac 26
• <210> SEQ ID NO 27
  <211> LENGTH: 26
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Spei1-q
• <400> SEQUENCE: 27
  ctacagagat aagtatgaat gtgagg 26
• <210> SEQ ID NO 28
  <211> LENGTH: 20
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Speil-r
• <400> SEQUENCE: 28
  ctctggtggc ctggggccca 20
• <210> SEQ ID NO 29
  <211> LENGTH: 17
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Spei1-Fm
• <400> SEQUENCE: 29
  ctttcacaac gctcacg 17
• <210> SEQ ID NO 30
  <211> LENGTH: 21
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Spei1-Fnm
• <400> SEQUENCE: 30
  cttctttcac aacgctcacg t 21
• <210> SEQ ID NO 31
  <211> LENGTH: 20
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Spei2-q
• <400> SEQUENCE: 31
  atttccccct tggcagacag 20
• <210> SEQ ID NO 32
  <211> LENGTH: 24
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Spei2-r
• <400> SEQUENCE: 32
  aaaaggaaag gcatcctgca agag 24
• <210> SEQ ID NO 33
  <211> LENGTH: 28
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Spei2-3r
• <400> SEQUENCE: 33
  gagcaggcac actgtctcct gctctcct 28
• <210> SEQ ID NO 34
  <211> LENGTH: 20
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Vag1-o
• <400> SEQUENCE: 34
  ggcacatgga cctgggcctg 20
• <210> SEQ ID NO 35
  <211> LENGTH: 28
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Vag1-p
• <400> SEQUENCE: 35
  agttgctgag ggtgccactg gaagacat 28
• <210> SEQ ID NO 36
  <211> LENGTH: 29
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Vag1-1r
• <400> SEQUENCE: 36
  tgattaaaaa aaaaatcatc aacataagc 29
• <210> SEQ ID NO 37
  <211> LENGTH: 24
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Vag2-NEWo
• <400> SEQUENCE: 37
  accaagaaga gtcccagggg acac 24
• <210> SEQ ID NO 38
  <211> LENGTH: 18
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Vag2-p
• <400> SEQUENCE: 38
  tttccccccc ttcagagt 18
• <210> SEQ ID NO 39
  <211> LENGTH: 27
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Vag2-1f
• <400> SEQUENCE: 39
  acacttgggc agagtcaccc tcttgcc 27
• <210> SEQ ID NO 40
  <211> LENGTH: 27
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Sperm1-NEWq
• <400> SEQUENCE: 40
  catgcatggg gcttttcttc aggctgt 27
• <210> SEQ ID NO 41
  <211> LENGTH: 22
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Sperm1-r
• <400> SEQUENCE: 41
  aaaggcaagg gctagagccc ag 22
• <210> SEQ ID NO 42
  <211> LENGTH: 24
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Sperm1-4r
• <400> SEQUENCE: 42
  cttctcccac atgtgaggaa agag 24
• <210> SEQ ID NO 43
  <211> LENGTH: 26
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Sperm2-q
• <400> SEQUENCE: 43
  gctggaatct gaactgggaa ctgccc 26
• <210> SEQ ID NO 44
  <211> LENGTH: 26
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Sperm2-NEWr
• <400> SEQUENCE: 44
  atagctctga gctgtcctgg caggtg 26
• <210> SEQ ID NO 45
  <211> LENGTH: 17
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Sperm2-3r
• <400> SEQUENCE: 45
  gtggggagct gggcttc 17
• <210> SEQ ID NO 46
  <211> LENGTH: 20
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Haut1-o
• <400> SEQUENCE: 46
  gaggggggcc atgatgctag 20
• <210> SEQ ID NO 47
  <211> LENGTH: 27
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer AMP_Haut1-p
• <400> SEQUENCE: 47
  taaagtctag caactgggtg gccaggc 27
• <210> SEQ ID NO 48
  <211> LENGTH: 23
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Hautl-f
• <400> SEQUENCE: 48
  tgagcctgtt tggcttcaga gaa 23
• <210> SEQ ID NO 49
  <211> LENGTH: 20
  <212> TYPE: DNA
  <213> ORGANISM: Homo sapiens
  <223> OTHER INFORMATION: Primer SNP_Hautl-r2
• <400> SEQUENCE: 49
  cccaagggcc cctagaacac 20
• <210> SEQ ID NO: 50
  <211> 344
  <212> DNA
  <213> Homo sapiens
• <400> SEQUENCE 50
  
• <210> SEQ ID NO: 51
  <211> 232
  <212> DNA
  <213> Homo sapiens
• <400> SEQUENCE 51
  
• <210> SEQ ID NO: 52
  <211> 320
  <212> DNA
  <213> Homo sapiens
• <400> SEQUENCE 52
  
• <210> SEQ ID NO: 53
  <211> 291
  <212> DNA
  <213> Homo sapiens
• <400> SEQUENCE 53
  
• <210> SEQ ID NO: 54
  <211> 211
  <212> DNA
  <213> Homo sapiens
• <400> SEQUENCE 54
  
• <210> SEQ ID NO: 55
  <211> 292
  <212> DNA
  <213> Homo sapiens
• <400> SEQUENCE 55
  
• <210> SEQ ID NO: 56
  <211> 272
  <212> DNA
  <213> Homo sapiens
• <400> SEQUENCE 56
  
• <210> SEQ ID NO: 57
  <211> 188
  <212> DNA
  <213> Homo sapiens
• <400> SEQUENCE 57
  
• <210> SEQ ID NO: 58
  <211> 217
  <212> DNA
  <213> Homo sapiens
• <400> SEQUENCE 58
  
• <210> SEQ ID NO: 59
  <211> 215
  <212> DNA
  <213> Homo sapiens
• <400> SEQUENCE 59
  
• <210> SEQ ID NO: 60
  <211> 173
  <212> DNA
  <213> Homo sapiens
• <400> SEQUENCE 60
  

Claims (7)

1. A method for identifying bodily fluids and tissues from sample material which is a trace carrier, said method comprising the following steps:

   a) extracting DNA from a provided sample containing the DNA to be examined,

   b) performing bisulfite conversion of the extracted DNA.

   c) multiplying the reaction product by PCR,

   d) optionally purifying the DNA from step c),

   e) hybridising oligonucleotides that are effective as single nucleotide primer extension (SNuPE) primer and that are complementary or partially complementary to nucleic acids that are either complementary or partially complementary to a position of the DNA in the biological material, this position being present either in methylated or unmethylated form for a sample material from a comparison group and being present either in unmethylated or methylated form conversely for all further sample materials from the comparison group, wherein the nucleic acids are selected from the group consisting of SEQ ID NO: 1-11, and enzymatic primer extension of DNA from step d) with fluorescence-labelled ddGTP or ddATP,

   f) detecting the DNA from step e).
2. The method according to claim 1, characterised in that the biological material is selected from the following group:
   liquid or solid biopsy or originating therefrom, a tissue sample, in particular a skin sample, a bodily fluid sample, preferably a whole blood sample, a plasma sample, a serum sample, in particular a sample from peripheral blood, a menstrual blood sample, a saliva sample, a semen sample, a vaginal fluid sample, a swap of an epithelial surface, a sputum sample, a stool sample, an ejaculate sample, a lymph fluid sample, a bronchial lavage sample, a sample of abdominal fluid, a sample of fluid from the pleural cavity, a sample of cerebrospinal fluid, a urine sample, a tear sample, a sweat sample, pleural effusion sample, meningeal fluid sample, glandular fluid sample, nipple aspirate fluid, spinal fluid sample, conjunctival fluid sample, small intestine fluid sample, pancreatic juice sample or bile fluid.
3. The method according to claim 1 or 2, characterised in that in step e) an extension with ddGTP and ddATP is performed and the ratio of DNA with ddGTP and ddATP is determined.
4. The method according to claim 3, characterised in that the ratio is determined by separating DNA with ddGTP and ddATP by capillary electrophoresis.
5. The method according to any one of the preceding claims, characterised in that the trace carrier consists of a mixture of at least two biological materials from the group according to claim 2.
6. The method according to any one of the preceding claims, characterised in that the oligonucleotides are selected from the group SEQ ID NO: 12-49.
7. Use of a kit, comprising

   a) reagents for extracting nucleic acids,

   b) reagents for performing bisulfite conversion of the extracted DNA,

   c) reagents for purifying the DNA from step b,

   d) oligonucleotides that are effective as SNuPE primer and that are complementary or partially complementary to nucleic acids that are either complementary or partially complementary to a position of the DNA in the biological material, wherein this position is present either in methylated or unmethylated form for a sample material from a comparison group, wherein the nucleic acids are selected from the group consisting of SEQ ID NO: 1-11,

   e) an enzyme for enzymatic primer extension of DNA, and

   f) fluorescence-labelled ddNTP for the detection of bodily fluids and tissues, wherein the sample material is a trace carrier.

Images