EP2861735A1 - Snp markers associated with polycystic ovary syndrome - Google Patents
Snp markers associated with polycystic ovary syndromeInfo
- Publication number
- EP2861735A1 EP2861735A1 EP20120879241 EP12879241A EP2861735A1 EP 2861735 A1 EP2861735 A1 EP 2861735A1 EP 20120879241 EP20120879241 EP 20120879241 EP 12879241 A EP12879241 A EP 12879241A EP 2861735 A1 EP2861735 A1 EP 2861735A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- snp marker
- snp
- marker
- probes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the present invention relates to SNP (Single Nucleotide Polymorphism) markers associated with Polycystic Ovary Syndrome (PCOS).
- SNP Single Nucleotide Polymorphism
- PCOS Polycystic Ovary Syndrome
- the present invention further relates to probes, chips, primers and methods for detecting the SNPs. Also, the present invention relates to the use of the probes, chips and primers in predicting and diagnosing the risk of PCOS.
- PCOS is a clinical condition characterized by the presence of two or more of these features: chronic oligo-ovulation or anovulation, androgen excess and polycystic ovaries. 1 As the most common cause of anovulatory infertility , PCOS affects 6-8% childbearing-aged women. 2 ' 3 Additionally, PCOS is associated with important endocrine-metabolic derangements and a broad range of adverse sequelae, including dyslipidemia, atherosclerosis, insulin resistance and type 2 diabetes. 4"6 Insulin resistance is present in perhaps 50% of women with PCOS. 7 Among women with impaired glucose tolerance (IGT) and diabetes mellitus, about 20% were recognized at younger age to have PCOS. 8"10
- PCOS The pathogenesis of PCOS is not fully understood. Heritable tendencies have long been recognized, but complex interactions exist between genetic and environmental factors. Association studies have been conducted on at least 70 candidate genes, principally related to reproductive hormones, insulin resistance, and chronic inflammation, e.g., follicle stimulating hormone receptor ⁇ FSHR), cytochrome P450, family 11A (CYPllA), insulin receptor (INSR) and interleukin 6 (IL-6) n"15 ; however, none correlates consistently with PCOS.
- Follicle stimulating hormone receptor ⁇ FSHR follicle stimulating hormone receptor ⁇ FSHR
- CYPllA family 11A
- INSR insulin receptor
- IL-6 n interleukin 6
- the present invention relates to SNPs associated with PCOS. Particularly, the present invention provides SNP markers associated with PCOS. Furthermore, the present invention provides probes, chips, primers and methods for detecting the SNPs. Also, the present invention relates to the use of them in predicting and diagnosing the risk of PCOS.
- Another aspect of the invention provides probes for detecting the genotypes at the site N of the SNP markers of the present invention.
- Still another aspect of the invention provides a chip for detecting the genotypes at the site N of the SNP markers of the present invention, wherein the chip comprises one or more probes of the present invention.
- Still another aspect of the invention provides primers for determining the genotypes at the site N of the SNP markers of the present invention.
- Still another aspect of the invention provides a kit comprising the probes, chip or primers of the present invention for detecting the genotypes at the site N of the SNP markers.
- Still another aspect of the invention provides the use of the primers, probes, chip and kit of the present invention in the preparation of an agent for predicting or diagnosing PCOS.
- Still another aspect of the invention provides the use of the primers, probes, chip and kit of the present invention in predicting or diagnosing PCOS.
- Still another aspect of the invention provides a method of predicting or diagnosing PCOS based on the SNP markers, wherein the method comprises determining genotypes at the site N of the SNP markers of the present invention.
- Figure 1 Genome-wide Manhattan plots for the GWAS meta-analysis. Negative logio P-values are shown for SNP markers that passed quality control. The solid horizontal line indicates a P value of 10 ⁇ 5 . Markers within 50 kb of an SNP associated with PCOS are marked in red for those identified in a previous GWAS and replicated here, and in green for those first identified in the current study.
- Figure 2. Regional plots of the 3 PCOS loci from GWAS I (2pl6.3, 2p21, and 9q33.3).
- Genotyped SNPs passing quality control measures in GWAS are plotted with the P values (as -logio values) as a function of genomic position (hgl8) (a) 2pl6.3, (b) 2p21, and (c) 9q33.3. In each panel, the index association SNP is represented by a diamond.
- Estimated recombination rates are plotted to reflect the local LD structure. Gene annotations were taken from the University of California Santa Cruz genome browser. LD blocks were obtained from the Hapmap project (release 22, CHB+JPT).
- FIG. 3A-3H Regional plots of the 8 newly discovered PCOS loci. Genotyped and imputed SNPs passing quality control are plotted with their meta-analysis P values (as -logio values) as a function of genomic position (NCBI Build 37). In each panel, SNPs genotyped are plotted as circles, and SNPs imputed as crosses. The index association SNP is represented in purple, Pgwas meta is for the combined results of the initial datasets, and PowAS-REP-Meta is for the combined results of the initial and follow-up datasets, represented by the diamond (for the index SNP) or a square (for another independent SNP of this region). Estimated recombination rates (taken from lOOOGenome ASI) are plotted to reflect the local LD structure. Gene annotations were taken from the University of California Santa Cruz genome browser.
- FIG. 4A-4B PCR electrophoretograms for the 45 SNP markers. Detailed Description
- single nucleotide polymorphism is a DNA sequence variation or a genetic variant that occurs when a nucleotide, e.g., adenine (A), thymine (T), cytosine (C), or guanine (G), in the genome sequence is altered to another nucleotide.
- a nucleotide e.g., adenine (A), thymine (T), cytosine (C), or guanine (G)
- SNPs are identified herein using the rs identifier numbers in accordance with the NCBI dbSNP database.
- genotype refers to a description of the alleles of a gene or genes contained in an individual or a sample. As used herein, no distinction is made between the genotype of an individual and the genotype of a sample originating from the individual.
- genotype ratio or “OR” refers to the ratio of the odds of the disease for individuals with the marker (polymorphism) relative to the odds of the disease in individuals without the marker (polymorphism).
- the invention provides SNP markers, the nucleotide sequences of which are shown as: SEQ ID NO. l, wherein N is C or T; SEQ ID NO.2, wherein N is A or G; SEQ ID NO.3, wherein N is C or T; SEQ ID NO.4, wherein N is A or C; SEQ ID NO.5, wherein N is C or T; SEQ ID NO.6, wherein N is A or C; SEQ ID NO.7, wherein N is C or T; SEQ ID NO.8, wherein N is C or T; SEQ ID NO.9, wherein N is A or G; SEQ ID NO.10, wherein N is C or T; SEQ ID NO.11, wherein N is C or T; SEQ ID N0.12, wherein N is C or T; SEQ ID N0.13, wherein N is A or G; SEQ ID N0.14, wherein N is C or T; SEQ ID N0.15, wherein N is A or G; SEQ ID NO.16, wherein N is C or
- One embodiment of this aspect provides more than one, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 SNP markers selected from the ones above.
- each SNP marker refers to a SNP which is found to be associated with PCOS.
- SNP marker and corresponding SNP relate to the same site in the nucleotide fragment. Especially when referring to the detection of the genotype at the site N of SNP marker, it should be understood that it implies the detection of the genotype at the corresponding site of the corresponding SNP, vice versa.
- the SNP for each SNP marker is listed in Table 1 below.
- the invention provides probes for detecting the genotypes at the site N of one or more SNP markers of the present invention.
- One embodiment of this aspect provides probes for each SNP marker listed in Table 1.
- AAAAAAGTATTATAGCT (SEQ ID N0.78/ SEQ ID N0.79)
- CTAGTAAAGTTTGAAA SEQ ID N0.96/ SEQ ID N0.97
- the invention provides a chip for detecting the genotypes at the site N of one or more SNP markers of the present invention, wherein the chip comprises the probes of the present invention.
- the chip is used to detect the genotypes at the site N of 45 SNP markers of the present invention. More preferably, the chip comprises the probes shown as SEQ ID NO. 46-135.
- the chip is used to detect the genotypes at the site N of SNP markers shown as SEQ ID NO. 6, 11, 22, 23, 25, 29, 30, 33, 34, 35, 37, 41, 42, 43 and 44. More preferably, the chip comprises the probes shown as SEQ ID NO. 56, 57, 66, 67, 88, 89, 90, 91, 94, 95, 102, 103, 104, 105, 110, 111, 112, 113, 114, 115, 118, 119, 126, 127, 128, 129, 130, 131, 132 and 133.
- the invention provides primers for detecting the genotypes at the site N of one or more SNP markers of the present invention.
- the primers for each SNP marker are listed in Table 2.
- SNP marker Product length (i.e.
- AACCCAGGCAAAAAGAGAAATAG (forward) (SEQ ID NO.170) 446bp ACTGACTCTGGTTTTGCTAGGCT(reverse) (SEQ ID N0.171)
- CTCCAGGGACTGCCTCTTTCT(forward) (SEQ ID NO.178)
- AAACAAGATAGGGCTAGGCTGATT(forward) (SEQ ID NO.182)
- CTGTGGCTCACCTTGGAGATTAT forward (SEQ ID NO.190)
- the invention provides a kit for detecting the genotypes at the site N of one or more SNP markers of the present invention, wherein the kit comprises the probes, chip or the primers of the present invention.
- the kit is used to detect the genotypes at the site N of at least 15 SNP markers of the present invention.
- the kit is used to detect the genotypes at the site N of 45 SNPs of the present invention.
- the kit comprises probes shown as SEQ ID NO. 46-135.
- the kit is used to detect the genotypes at the site N of 15 SNP markers shown as SEQ ID NO. 6, 11, 22, 23, 25, 29, 30, 33, 34, 35, 37, 41, 42, 43 and 44. More preferably, the kit comprises the probes consisted of probes shown as SEQ ID NO. 56, 57, 66, 67, 88, 89, 90, 91, 94, 95, 102, 103, 104, 105, 110, 111, 112, 113, 114, 115, 118, 119, 126, 127, 128, 129, 130, 131, 132 and 133.
- the kit comprises primers for detecting the genotypes at the site N of 45 SNP markers of the present invention. More preferably, the kit comprises primers consisted of the primers shown as SEQ ID NO. 136-221.
- the kit comprises primers for determining the genotypes at the site N of 15 SNP markers of the present invention, wherein the 15 SNP markers are shown as SEQ ID NO. 6, 11, 22, 23, 25, 29, 30, 33, 34, 35, 37, 41, 42, 43 and 44.
- the kit comprises primers consisted of the primers shown as SEQ ID NO.146, 147, 152, 153, 174, 175, 176, 177, 180, 181, 188, 189, 190, 191, 196, 197, 198, 199, 200, 201, 204, 205, 212, 213, 214, 215, 216, 217, 218 and 219.
- the invention provides the use of the primers, probes, chip or kit of the present invention in the preparation of an agent for predicting or diagnosing PCOS, wherein the primers, probes, chip or kit is used to detect the genotypes at the site N of the SNP markers of the present invention.
- the genotypes at the site N of at least 15 SNP markers, preferably all 45 SNP markers of the present invention are detected.
- the genotypes at the site N of 15 SNP markers are detected, wherein the 15 SNPs are shown as SEQ ID NO. 6, 11, 22, 23, 25, 29, 30, 33, 34, 35, 37, 41, 42, 43 and 44.
- the invention provides the use of the primers, probes, chip or kit of the present invention in predicting or diagnosing PCOS, wherein the primers, probes, chip or kit is used to detect the genotypes at the site N of the SNP markers of the present invention.
- Still another aspect of the invention provides a method of predicting or diagnosing PCOS, wherein the method comprises determining genotypes at the site N of one or more SNP markers of the present invention.
- the method comprises determining genotypes at the site N of at least 15 SNP markers, preferably all 45 SNP markers of the present invention.
- the method comprises determining genotypes at the site N of 15 SNP markers, wherein the 15 SNP markers are shown as SEQ ID NO. 6, 11, 22, 23, 25, 29, 30, 33, 34, 35, 37, 41, 42, 43 and 44.
- determining genotypes at the site N of the SNP markers is performed by hybridization, for example, using the probes or chips of the present invention.
- determining genotypes at the site N of the SNP markers is performed by sequencing, for example, PCR, Real-time Quantitative PCR, or MassARRAY (Sequenom), using primers of the present invention.
- the present method comprises the following steps: extracting DNA from peripheral blood or saliva of a subject, determining genotypes at the site N of one or more SNP markers, and analyzing the results to predict the risk of PCOS or diagnose PCOS.
- the PCOS patients were diagnosed according to the Rotterdam Consensus proposed in 200345. Clinical data of the patients were obtained from medical records. 01igo-/aovulation was assessed by menstrual cycles more than 35 days in length or a history of ⁇ 8 menstrual cycles in a year. Polycystic ovarian morphology was determined when >12 follicles measuring 2-9 mm in diameter were scanned in either ovary or the ovarian volume was above 10 ml. Hyperandrogenism was confirmed if there were evidences about hyperandrogenemia and/or hirsutism. Patients with other causes of oligomenorrhea or hyperandrogenism were excluded. Clinical information was collected from the cases through a full clinical checkup by physician specialists. Additional demographic information was collected from both cases and controls through a structured questionnaire. All participants provided written informed consents. The study was approved by the Institutional Ethical Committee of each hospital and was conducted according to Declaration of Helsinki principles.
- Genomic DNA was extracted from peripheral blood lymphocytes by standard procedures using Flexi Gene DNA kits (Qiagen), and was diluted to working concentrations of 50 ng/ ⁇ for genome -wide genotyping and 15-20 ng/ ⁇ for the validation study.
- Affymetrix Genome-Wide Arrays were used for discovery phase: GWAS Data Set 1 was performed using the Affymetrix Genome-Wide Human SNP Array 6.0, and Sampes of GWAS Data Set 2 were genotyped using Axiom Genome- Wide Arrays. Quality control filtering of the GWAS data was performed as follows: for the SNP 6.0 arrays whose Contrast QC was 0.4 or greater being left out of further data analysis, and for the Axiom arrarys, a Dish QC (DQC) of 0.82 or better is considered a pass. Genotype data were generated using the birdseed algorithm for SNP 6.0, and the Axiom GT1 algorithm for Axiom arrays.
- DQC Dish QC
- PCA principal components analysis
- the GWAS data sets were combined using meta-analysis.
- the meta-analysis was conducted using PLINK 23 .
- the heterogeneity across the three stages was evaluated using Q-statistic P-value.
- the Mantel-Haenszel method is used to calculate the fixed effect estimate.
- Genome -wide association analysis at the single marker level and the HWE analysis in the case-control samples were performed using PLINK 23 ; R package was used for the genome wide P value plot. The regional plots were generated using LocusZoom 24 .
- allelic association analysis was conducted using SHEsis 25 .
- the GWAS and replication data were also combined using meta-analysis using PLINK 23 .
- Conditional logistic regression was used to test for independent effects of an individual SNP 26 ' 27 .
- SNPs were found to be associated with PCOS.
- the detailed analysis information is listed in Tables 3-5.
- the SNPs represent regions, which associate with PCOS and may comprise many SNPs.
- Controlling for rs3802457, rs4385527 P GW AS -REP-Meta 87x 10 "9 , ORGWAS -REP-Meta- 0.84) shoWS independent association in conditional logistic regression analysis, and it also locates in C9orf3.
- C9orf3 is a member of the Ml zinc aminopeptidase family.
- SNP rs3802458 within C9orf3 is reported associated with the development of erectile dysfunction (ED) in African- American men following radiotherapy for prostate cancer 28 .
- ED in men and PCOS in women occurred when people develop conditions with inadequate or excessive amounts of sexual hormones.
- FSHR gene rs2268363 has been identified as the most significantly associated with ED 28 , and strong association evidence between FSHR and PCOS was also identified (discussed below).
- YAPl containing a WW domain, is a transcriptional regulator which can act both as a coactivator and a corepressor and is the critical downstream regulatory target in the Hippo signaling pathway that plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis.
- YAP overexpression alters the expression of genes associated with cell proliferation, apoptosis, migration, adhesion, and epithelial-to-mesenchymal transition 29 .
- Mice embryos with Yapl null mutation die between embryonic days E9.5 and El 0.5 due to yolk sac avasculogenesis and failure of attachment between the allantois and the chorion 30 .
- ERBB3 an activator of the phosphatidylinositol-3 -kinase/ Akt pathway, is a member of the epidermal growth factor tyrosine kinase receptor family which regulates cell survival and vesicle trafficking. ERBB3 plays a critical role in determining antigen presenting cells function 35 .
- HMGA2 has previously been identified to be associated with adult stature 36 , vascular tumors including angiomyxomas and pulmonary hamartomas 37 , and Type 2 Diabetes 38 .
- a mutation in the gene can result in the "pygmy" mouse, with a significant reduction in body weight, reduced amounts of fat tissue, and infertility in both sexes 39 , which suggests its vital role in growth and reproduction.
- rs2059807 P G WAS -REP-Meta- 1.09 X 10 "8 , ORGWAS -REP-Meta-1.14. locates in the intron region of the INSR gene (MIM: 147670) ( Figure 3). Controlling for rs2059807, conditional logistic regression analysis reveals that there is no additional association signals. INSR plays an important role in insulin metabolism. The tyrosine kinase domain mutations of the insulin receptor have been shown to cause severe hyperinsulinemia and insulin resistance 41"43 . In previous studies, common SNP in INSR gene has been reported to be associated with PCOS in Han Chinese and Caucasian 44 ' 45 . Insr null mice grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers 46 .
- the top signal is rs6022786 .83 X 10 "9 , ORGWAS -REP-Meta- 1 - 13), locates in an intergenic region between genes SUMO IP 1 and ZNF217 (MIM: 602967) ( Figure 3). Controlling for rs6022786, conditional logistic regression analysis reveals that there is no additional association signals.
- SUMO IP 1 is the SUMOl pseudogene 1.
- ZNF217 zinc finger protein 217
- FSHR null mutant females are sterile with small ovaries, blocked follicular development, atrophic uterus and imperforate vagina, and null mutant males are fertile despite reduction in testis weight, oligozoospermia and reduced testosterone levels 49
- Conditional logistical regression analysis supports that the association of FSHR is independent from those previous signals in LHCGR.
- the 15 SNPs refer to SNP marker Nos. 6, 11, 22, 23, 25, 29, 30, 33, 34, 35, 37, 41, 42, 43 and 44.
- b N represents the nucleotide more correlative to PCOS in the site.
- the P is calculated by fixed effect model and P(R) is calculated by random effect model.
- detecting genotypes at the site N of at least 15 SNP markers is useful for predicting or diagnosing PCOS.
- detecting genotypes at the site N of 15 independent SNP markers of 6, 11, 22, 23, 25, 29, 30, 33, 34, 35, 37, 41, 42, 43 and 44 can also work, with less expense.
- probes should be designed to specifically hybridize with the locus of SNP, and then the hybridization could be analyzed whether SNP is present.
- An example of probes for all 45 SNPs is given just for the purpose of exemplifying, which is not intended to limit the scope of the invention.
- a person skilled in the art could easily design similar probes to hybridize with the SNPs, which all fall into the scope of the invention.
- probes should be presented in a carrier, for example, a chip, so that more than one SNP markers can be detected at a time.
- the present invention also provides a chip comprising probes detecting the SNP markers shown as SEQ ID NO. 6, 11, 22, 23, 25, 29, 30, 33, 34, 35, 37, 41, 42, 43 and 44 (i.e.
- primers should be designed forward and afterward the interested locus.
- An example of primers for all 45 SNPs (listed in Table 2) is given just for the purpose of exemplifying, which is not intended to limit the scope of the invention.
- a person skilled in the art can easily design similar primers to sequence the SNP markers, which also fall into the scope of the present invention.
- the process and agents used in the sequencing are also well known in the art.
- PCR Polymerase chain reaction
- extension primers for the SNPs were designed using the MassARRAY Assay Design 3.0 software. PCR and extension reactions are performed according to the manufacturer's instructions, and extension product sizes were determined by mass spectrometry using the Sequenom iPLEX system.
- the 45 SNP markers based on the present invention can be used to predict or diagnose PCOS. Firstly, the DNA from peripheral blood or saliva of a subject is extracted, and then, the genotypes at the site N of the SNPs are detected, for example, by hybridization with probes or chips above, or by sequencing. At last, the results will be analyzed to predict the risk of PCOS. Examples
- All the 45 SNP markers are amplified by PCR using the primers listed in Table 2. The following processes are followed for the PCR reaction.
- Figure 4 shows the electrophoretogram for all the 45 SNP markers.
- Detecting genotypes at the site N of 15 SNP markers by sequencing and the 15 SNP markers are shown as SEQ ID NO. 6, 11, 22, 23, 25, 29, 30, 33, 34, 35, 37, 41, 42, 43 and 44.
- the primers used are listed in Table 2.
- the PCR product is precipitated by 25 ⁇ . PEG (22%, w/v) and 2 ⁇ NaCl (5 M) at room temperature. Then the plate is stored at 4 ° C for 30 minutes. The left-over PEG was washed by 80 of 75% ethanol three times by centrifugation at 4 ° C .
- the purified DNA was dissolved in 5 ⁇ ddH 2 Q.
- the initial denaturation procedure is performed by a rapid thermal ramp to 96 ° C and lasts for 1 minute. 25 cycles of reactions are performed with denaturation for 10 seconds over 96 ° C , annealing for 5 seconds over 50 ° C and extention for 4 minutes over 60 ° C . Rapid thermal ramp to 4 ° C is performed. And the product is hold until ready to purify.
- Each well is added 10 ⁇ HI-DI formamide and denatured at 95 ° C for 5 minutes.
- the precipitated DNA is loaded on ABI 3730 XL genetic analyzer for capillary electrophoresis.
- Clean up the High Pie iPLEX Gold Reaction Products The cleanup of high plex iPLEX Gold reaction products involves adding water and then Clean Resin to the sample microtiter plate. Spread Clean Resin onto the 384-well dimple plate. Add nanopure water to each well of the 384-well sample microtiter plate. Add Clean Resin to the 384-well sample microtiter plate.
- the ACQUIRE module controls the MassARRAY Analyzer Compact (Compact) to acquire spectra from SpectroCHIPs. As each SpectroCHIP is processed by the Compact, the spectral data is automatically processed and saved to the MassARRAY database.
- Compact MassARRAY Analyzer Compact
- the method involves 15 SNP markers which are most associated with PCOS and the credibility thereof is higher.
- the detecting process can be more easily carried out with less expense.
- Kandaraki E Christakou C
- Diamanti-Kandarakis E Metabolic syndrome and polycystic ovary syndrome... and vice versa.
- Pruim, R.J. et al. LocusZoom regional visualization of genome-wide association scan results. Bioinformatics 26, 2336-2337 (2010).
- SNPs single nucleotide polymorphisms
- Tumor suppressor LATSl is a negative regulator of oncogene YAR Journal of Biological Chemistry 283, 5496-5509 (2008).
- Morin-Kensicki E.M. et al. Defects in yolk sac vasculogenesis, chorioallantoic fusion, and embryonic axis elongation in mice with targeted disruption of Yap65. Molecular and cellular biology 26, 77-87 (2006). Barrett, J.C. et al. Genome-wide association study and meta-analysis find that over 40 loci affect risk of type 1 diabetes. Nature genetics 41, 703-707 (2009).
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CN2012/077095 WO2013189015A1 (en) | 2012-06-18 | 2012-06-18 | Snp markers associated with polycystic ovary syndrome |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP2861735A1 true EP2861735A1 (en) | 2015-04-22 |
| EP2861735A4 EP2861735A4 (en) | 2016-02-24 |
Family
ID=49768005
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP12879241.3A Withdrawn EP2861735A4 (en) | 2012-06-18 | 2012-06-18 | SNP MARKERS ASSOCIATED WITH POLYKYSTIC OVAIRE SYNDROME |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP2861735A4 (en) |
| CN (1) | CN104411824B (en) |
| WO (1) | WO2013189015A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109022565B (en) * | 2017-06-12 | 2022-02-11 | 山大生殖研发中心有限公司 | MicroRNA biomarkers for polycystic ovary syndrome and their applications |
| CN108846260B (en) * | 2018-06-28 | 2021-09-10 | 北京百迈客生物科技有限公司 | Genetic map construction method and device for genetic segregation population |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003223726A1 (en) * | 2002-04-22 | 2003-11-03 | Northwestern University | Genetic marker for endocrine disorders |
| US20090208928A1 (en) * | 2004-05-27 | 2009-08-20 | Reposo Ramirez-Lorca | Method and device for the in vitro detection of polycystic ovarian syndrome (pcos) and pathologies involving cardiovascular risk |
| EP2576787B1 (en) * | 2010-05-31 | 2017-05-03 | Shandong University | Snps associated with polycystic ovary syndrome, chips comprising the same and use thereof |
-
2012
- 2012-06-18 EP EP12879241.3A patent/EP2861735A4/en not_active Withdrawn
- 2012-06-18 WO PCT/CN2012/077095 patent/WO2013189015A1/en not_active Ceased
- 2012-06-18 CN CN201280074086.1A patent/CN104411824B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104411824A (en) | 2015-03-11 |
| CN104411824B (en) | 2017-12-26 |
| EP2861735A4 (en) | 2016-02-24 |
| WO2013189015A1 (en) | 2013-12-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8685647B2 (en) | SNP markers associated with polycystic ovary syndrome | |
| US20220056529A1 (en) | Identification of pediatric onset inflammatory bowel disease loci and methods for use thereof for the diagnosis and treatment of the same | |
| WO2008070074A2 (en) | Genetic markers of schizophrenia | |
| US20130324416A1 (en) | Methods and Compositions for Correlating Genetic Markers with Cardiovascular Disease | |
| CN103865997B (en) | The qualification of hypertension susceptible gene group | |
| US20120276084A1 (en) | Predicting Risk of Age-Related Macular Degeneration | |
| KR20110106244A (en) | Single Base Polymorphism for Prognostic Diagnosis of Hepatocellular Carcinoma | |
| CN106834501A (en) | To the fat related mononucleotide polymorphism site of Children in China and its application | |
| KR20170051747A (en) | Single nucleotide polymorphism markers for determining of probability of skin wrinkle and use thereof | |
| CN104411824B (en) | The SNP marker related to Stein-Leventhal syndrome | |
| WO2008128233A1 (en) | Methods and compositions concerning the vegfr-2 gene (kinase domain receptor, kdr) | |
| JP2005529608A (en) | Haplotype-based genetic analysis method to determine the risk of developing insulin resistance, coronary artery disease and other phenotypes | |
| CN108753945A (en) | With Children in China obesity and/or the relevant SNP site of hypertriglyceridemia and its application | |
| US9752195B2 (en) | TTC8 as prognostic gene for progressive retinal atrophy in dogs | |
| CN107022613A (en) | A kind of SNP mark related to non-syndromic deafness diagnosis and its application | |
| KR101092580B1 (en) | WCAN polymorphism marker for gastric cancer susceptibility prediction and method for predicting gastric cancer susceptibility using same | |
| CN111139295B (en) | SNP marker related to non-syndromic polyodontogenesis diagnosis and application thereof | |
| JP5416962B2 (en) | How to determine the risk of developing photosensitivity to drugs | |
| CN101871003A (en) | Kit and primers for predicting the susceptibility of type 2 diabetes in Chinese | |
| CN101676404A (en) | A method and agent for forecasting II type diabetes susceptibility using mitochondrion ND2 gene SNP | |
| Zheng et al. | Family-based association study of the MCF2L2 gene and polycystic ovary syndrome | |
| US20120028827A1 (en) | Method for determining a risk, for a subject, of suffering from atopic dermatitis or severity of atopic dermatitis for a subject suffering from atopic dermatitis and method for using a single-nucleotide polymorphism rs12313273 as a biomarker for determining the development or severity of atopic dermatitis | |
| US20080194419A1 (en) | Genetic Association of Polymorphisms in the Atf6-Alpha Gene with Insulin Resistance Phenotypes | |
| US20090220954A1 (en) | Methods of diagnosing cardiovascular disease | |
| AU2013202634B2 (en) | Method of identifying disease risk factors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20150108 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: ZHAO, HAN Inventor name: GENG, LING Inventor name: HE, LIN Inventor name: MA, JINLONG Inventor name: CHEN, ZIJIANG Inventor name: ZHAO, YUERAN Inventor name: YOU, LI Inventor name: SHI, YONGYONG |
|
| DAX | Request for extension of the european patent (deleted) | ||
| RA4 | Supplementary search report drawn up and despatched (corrected) |
Effective date: 20160125 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C12Q 1/68 20060101ALI20160119BHEP Ipc: C12N 15/11 20060101AFI20160119BHEP |
|
| 17Q | First examination report despatched |
Effective date: 20161222 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20170503 |