EP2811298A1 - Procédé de transfert de l'énergie de résonance par émission de fluorescence pour identifier un composé de modulation de biomolécule - Google Patents

Procédé de transfert de l'énergie de résonance par émission de fluorescence pour identifier un composé de modulation de biomolécule Download PDF

Info

Publication number
EP2811298A1
EP2811298A1 EP13002949.9A EP13002949A EP2811298A1 EP 2811298 A1 EP2811298 A1 EP 2811298A1 EP 13002949 A EP13002949 A EP 13002949A EP 2811298 A1 EP2811298 A1 EP 2811298A1
Authority
EP
European Patent Office
Prior art keywords
hsa
mir
acc
source
hgnc symbol
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP13002949.9A
Other languages
German (de)
English (en)
Inventor
Jonathan Hall
Ugo Pradere
Martina Roos
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Eidgenoessische Technische Hochschule Zurich ETHZ
Original Assignee
Eidgenoessische Technische Hochschule Zurich ETHZ
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Eidgenoessische Technische Hochschule Zurich ETHZ filed Critical Eidgenoessische Technische Hochschule Zurich ETHZ
Priority to EP13002949.9A priority Critical patent/EP2811298A1/fr
Priority to PCT/EP2014/001548 priority patent/WO2014195026A2/fr
Publication of EP2811298A1 publication Critical patent/EP2811298A1/fr
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/536—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
    • G01N33/542—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with steric inhibition or signal modification, e.g. fluorescent quenching
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites

Definitions

  • the present invention relates to a method for identifying a compound modulating an interaction between two biomolecules or two domains of one biomolecule, the first biomolecule or first domain comprising at least one fluorophore donor and the second biomolecule or second domain comprising at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher overlap at least partially.
  • the first and second biomolecules are selected from the group consisting of polypeptides, sugars, polynucleotides, polyamines and lipids, and more preferably the first biomolecule is selected from the group consisting of polypeptides interacting with polynucleotides and the second biomolecule is selected from the group consisting of polynucleotides, preferably4 microRNAs (miRNA).
  • miRNA microRNAs
  • the field of the invention relates to the use of Förster resonance energy transfer (FRET), which is a mechanism describing energy transfer between two chromophores.
  • FRET Förster resonance energy transfer
  • fluorophores When both chromophores are fluorescent, i.e. so-called fluorophores, the term “fluorescence resonance energy transfer” is often used instead.
  • Förster resonance energy transfer In order to avoid an erroneous interpretation of the phenomenon that is always a non-radiative transfer of energy (even when occurring between two fluorophores), the name “Förster resonance energy transfer” is preferred.
  • a fluorophore donor initially in its electronically excited state, may transfer energy to a fluorophore acceptor through non-radiative dipole-dipole coupling. The efficiency of this energy transfer is inversely proportional to the sixth power of the distance between donor and acceptor making FRET extremely sensitive to small distances.
  • FRET efficiency can be used to determine if two fluorophores are within a certain distance of each other, typically in the proximity of 1 to 10 nm. Such measurements are used as research tools in biology and chemistry. FRET is typically determined by measuring the variation in acceptor emission intensity. When the donor and acceptor are in proximity the acceptor emission will increase because of the FRET from the donor to the acceptor (sensitized emission). FRET efficiencies can also be inferred from the photobleaching rates of the donor in the-presence and absence of an acceptor.
  • FRET can be measured between a fluorophore donor and a dark quencher.
  • a dark quencher is a family of substances that absorbs emission energy from a fluorophore donor and dissipates the energy as non-UV-visible light or heat, whereas a typical "fluorescent quencher” i.e. fluorophore acceptor re-emits much of the "donated” energy as light.
  • Black hole quencher (BHQTM) dyes from Biosearch Technologies, Inc., Novato, California. USA) are examples of members of the dark quencher family. Dark quenchers such as BHQ dyes are used in molecular biology in conjunction with fluorophores. When the two are close together, e.g. 10-100 A, such as in a molecule, e.g. a protein, the donor's emission is at least partially suppressed by the quencher. This effect can be used to study molecular geometry and motion.
  • MicroRNAs are a large class of small non-coding RNAs which modulate protein translation as negative gene regulators by post-transcriptionally repressing gene expression. They are involved in cell differentiation, development and metabolism. MiRNAs can function as tumor suppressors and oncogenes. The dysregulation of miRNA expression has been linked to various human malignancies, in particular human cancers, and therefore miRNAs represent a new class of potential drug targets. Mature miRNAs are produced from long primary miRNA transcripts (pri-miRNAs) through sequential cleavages by the Micro-processor and Dicer complexes to release pre-miRNA and mature miRNA species, respectively. MiRNAs regulate the expression of a large part of the human genome by binding to partially complementary sites in the 3' UTRs of mRNAs and inhibiting protein translation or inducing deadenylation and degradation.
  • Lin28 also called Lin28a and its homologue Lin28b are one of many thousands of RNA binding proteins (RBPs, see list in appended Table 1) which bind to a specific motif (GGAG, or GNNG where N is any ribonucleotide) in pri- and pre-let-7 miRNAs inhibiting their processing and depleting cells of mature let-7.
  • RBPs RNA binding proteins
  • GGAG specific motif
  • GNNG GNNG where N is any ribonucleotide
  • Roos et al. (Poster by ETH Zürich, Institute of Pharmaceutical Sciences, Department of Applied Sciences: "Antisense oligonucleotides inhibit LIN28 binding to pre-let-7" Keystone Conference, “Noncoding RNAs in Development and Cancer", January 20-25, 2013, Vancouver, Canada ) designed and tested methoxy antisense oligonucleotides (ASO) to specifically antagonize Lin28 from binding to the terminal loop region of pre-let-7 in order to elevate processing by Dicer and Drosha in order to prevent the cell from mature let-7 loss.
  • ASOs were tested by an RNA-based competition ELISA. Kd-values of a selection of tested ASO were determined by Surface Plasmon Resonance (SPR) measurements. The two best ASOs were tested in a biochemical Dicer assay using HPCL-MS for analysis to ensure a proper pre-let-7a-2 processing by Dicer in presence of ASO.
  • SPR Surface Plasmon Resonance
  • Yeom et al. (EMBO REPORTS, 12:7, 690-696, 2011 ) teaches a method for integrating single-molecule fluorescence microscopy and immunopurification.to investigate Lin28-mediated microRNA uridylation by TUT4 (terminal uridylyl transferase 4, polyU polymerase), which also regulates let-7 microRNA biogenesis. TUT4 immunoprecipitates together with fluorescent Cy5-labelled miRNA pre-let-7. The real-time analysis of the uridylation by the TUT4 immunoprecipitates suggests that Lin28 functions as a processivity factor of TUT4 in the Lin28/TUT4/let-7 complex.
  • TUT4 terminal uridylyl transferase 4, polyU polymerase
  • WO 2009/048935 A2 discloses a method for promoting miRNA processing of pri-let-7 miRNA to mature miRNA in a human cancer cell, the method comprising contacting a cell with an agent inhibiting the activity or expression of Lin-28.
  • HTS high throughput screening
  • This objective is solved according to the present invention by a method for identifying a compound modulating an interaction between two biomolecules or two domains of one biomolecule, the first biomolecule or first domain comprising at least one fluorophore donor and the second biomolecule or second domain comprising at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher overlap at least partially, comprising the steps of
  • compound modulating an Interaction between two molecules or two domains of one biomolecule is meant to encompass any type of compound, e.g. small or large molecular weight inorganic or organic compound, amino acid, peptide, polypeptide, lipid, (poly)nucleotide, etc., that is capable of at least partially (decreasing) or fully interrupting (inhibiting) the interaction between the biomolecules or domains, or that is capable of initiating or increasing the interaction between the biomolecules or domains. In other words, the compound will decrease, interrupt, initiate or increase binding between the biomolecules or domains.
  • An interaction between two molecules is regularly understood to encompass covalent, ionic and "weak" bonds such as dipole-dipole interactions, ion-dipole interactions, London dispersion force, van der Waals interactions, charge transfer interactions and hydrogen bonding.
  • biomolecule indicates any molecule existing in a living cell and having a biological function in said cell as well as functional derivatives and fragments thereof.
  • Functional derivatives and fragments of a biomolecule typically share at least 10, 20, 30 or 40 %, preferably at least 50, 60, 70 or 80 %, more preferably at least 90%, most preferably at least 95 % (percent) identity with the structure of the biomolecule in nature and feature the same or a substantially similar biological function as the biomolecule in nature.
  • structural identity for polynucleotides and polypeptides can be determined by standard algorithms that calculate the percentage identity of the sequences and for polynucleotides structural identity can also be determined by hybridization assays.
  • % (percent) identity indicates the degree of relatedness among two or more nucleic acid molecules that is determined by agreement among the sequences.
  • the percentage of "identity” is the result of the percentage of identical regions in.two or more sequences while taking into consideration the gaps and other sequence peculiarities.
  • the identity of related nucleic acid molecules can be determined with the assistance of known methods. In general; special computer programs are employed that use algorithms adapted to accommodate the specific needs of this task. Preferred methods for determining identity begin with the generation of the largest degree of identity among the sequences to be compared.
  • Preferred computer programs for determining the identity among two nucleic acid sequences comprise, but are not limited to, BLASTN ( Altschul etal., J. Mol. Biol., 215, 403-410,1990 ) and LALIGN ( Huang and Miller, Adv. Appl. Math., 12, 337-357, 1991 ).
  • the BLAST programs can be obtained from the National Center for Biotechnology Information (NCBI) and from other sources (BLAST handbook, Altschul et al., NCB NLM NIH Bethesda, MD 20894).
  • nucleic acids can also be characterized in that they have the ability to hybridize to a specifically referenced nucleic acid sequence, preferably under stringent conditions.
  • a specifically referenced nucleic acid sequence preferably under stringent conditions.
  • Next to common and/or standard protocols in the prior art for determining the ability to hybridize to a specifically referenced nucleic acid sequence under stringent conditions e.g. Sambrook and Russell, Molecular cloning: A laboratory manual (3 volumes), 2001
  • a nucleic acid to hybridize to a related nucleic acid derivative or fragment is confirmed in a Southern blot assay under the following conditions: 6x sodium chloride/sodium citrate (SSC) at 45°C followed by a wash in 0.2x SSC, 0.1 % SDS at 65°C.
  • SSC 6x sodium chloride/sodium citrate
  • the percentage identity of amino acid molecules in nature to functional fragments or derivatives thereof can be determined with the assistance of known methods.
  • special computer programs are employed that use algorithms adapted to accommodate the specific needs of this task.
  • Preferred methods for determining identity begin with the generation of the largest degree of identity among the sequences to be compared.
  • Preferred computer programs for determining the identity among two amino acid sequences comprise, but are not limited to, TBLASTN, BLASTP, BLASTX or TBLASTX ( Altschul et al., J. Mol. Biol., 215, 403-410, 1990 ).
  • the BLAST programs can be obtained from the National Center for Biotechnology Information (NCBI) and from other sources (BLAST handbook, Altschul et al., NCB NLM NIH Bethesda, MD 20894).
  • a polypeptide or polynucleotide mentioned herein is meant to include any polypeptide, polynucleotide or fragment thereof that has been chemically or-genetically modified in its amino acid or nucleotide sequence, e.g. by addition, substitution and/or deletion of amino acid or nucleotide residue(s) and/or has been chemically modified in at least one of its atoms and/or functional chemical groups, e.g. by additions, deletions, rearrangement, oxidation, reduction, etc. as long as the derivative still has at least one of the biological activities of the original polypeptide or polynucleotide in nature to a measurable extent, e.g. at least about 1 to 10 % of the biological activity of the original unmodified polypeptide or polynucleotide.
  • each of the first and second biomolecules or the biomolecule with the first and second domains is selected from the group consisting of polypeptides, sugars, polynucleotides, polyamines and lipids.
  • the present invention is preferably directed to a method, wherein the first biomolecule is selected from the group consisting of polypeptides interacting with polynucleotides and the second biomolecule is selected from the group consisting of polynucleotides, preferably microRNA (miRNA).
  • the first biomolecule is selected from the group consisting of polypeptides interacting with polynucleotides
  • the second biomolecule is selected from the group consisting of polynucleotides, preferably microRNA (miRNA).
  • polypeptide interacting with polynucleotides is selected from any one of the polypeptides listed in Table 1, preferably a polypeptide interacting with miRNA, preferably selected from
  • Lin28 also referred to as Lin-28 homologue a (Lin 28a) and its homologue Lin28b are proteins encoded by the LIN28 genes [NM_024674.4 ⁇ NP_078950.1 and NM_001004317.3 ⁇ NP_001004317.1; for a review see: Viswanathan & Daley; Lin28: A MicroRNA Regulator with a Macro Role, Cell, 2010 / Lehrbach & Miska, Regulation of pre-miRNA Processing, Chapter 7, Springer 2010 / Thornton et al. How does Lin28 let-7 control development and disease, Trends in Cell Biology, 2012 )].
  • Lin28 is meant to encompass any Lin28 homologue such as homologues Lin28a and Lin28b as well as functional derivatives and fragments thereof as defined above.
  • Human Lin28a sequence information is available under ref. nos. 79729, UniProt: Q9H9Z2, NM_024674 (mRNA), NP_078950 and mouse Lin28a sequence information is available under ref. nos. 83557, UniProt: Q8K3Y3, NM_145833 (mRNA), NP_665832.
  • the cDNA-Sequence of human Lin28b from NM_001004317.3 is shown below as SEQ ID NO: 1.
  • LIN28 encodes a protein that binds to and enhances the translation of the IGF-2 (insulin-like growth factor 2) mRNA. Lin28 has also been shown to bind to the let-7 pre-miRNA and block production of the mature let-7 microRNA in embryonic stem cells.
  • LIN28 In pluripotent embryonic carcinoma cells LIN28 is localized in the ribosomes, P-bodies and stress granules. LIN28 regulates the self-renewal of stem cells.
  • the LIN28 homolog lin-28 is a heterochronic gene that determines the onset of early larval stages of developmental events in Caenorhabditis elegans by regulating the self-renewal of nematode stem cells in the skin (called seam cells) and vulva (called VPCs) during development.
  • LIN28 is highly expressed in mouse embryonic stem cells and during early embryogenesis: LIN28 is also highly expressed in human embryonic stem cells and has been used to enhance the efficiency of the formation of induced pluripotent stem (ips) cells from human fibroblasts.
  • ips induced pluripotent stem
  • LIN28 overexpression in mice has been shown to cause gigantism and a delay in puberty onset, consistent with human genome-wide association studies suggesting that polymorphisms in the human LIN28B gene are associated with human height and puberty timing. Mutations in LIN28B have been found to be associated with precocious puberty.
  • Lin28 homologues are highly relevant targets for designing and screening medically useful compounds, i.e. compounds modulating the interaction of Lin28 homologues with miRNAs and other regulators of cell growth, cell differentiation and cell homeostasis.
  • the polypeptide interacting with miRNA for practicing the method of the present invention is Lin28, preferably selected from the group consisting of mammalian, preferably human, non-human primate, rodent, monkey, mouse, rat, chicken, pig, guinea pig Lin28a and Lin28b, most preferably human Lin28a or Lin28b or a functional fragment or functional derivative thereof.
  • the polynucleotide for practicing the method of the invention is a pri- or pre-miRNA or mature miRNA, preferably selected from the group consisting of hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3 hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-let-7g, hsa-let-7i and functional derivatives or fragments thereof.
  • miRNA is generally meant to include any pri- and pre-precursor molecules of the mature miRNAs, the mature miRNA as well as any functional fragments and derivatives thereof as defined above.
  • a fluorophore is a fluorescent chemical compound that can re-emit light upon light excitation. Fluorophores typically contain several combined aromatic groups, or planar or cyclic sub-structures with several ⁇ bonds.
  • a fluorophore donor according to the present invention absorbs light energy of a specific wavelength (donor excitation spectrum) and emits light at a longer wavelength (donor emission spectrum). The flurophore donor "donates" the excitation energy for the fluorophore acceptor (acceptor excitation spectrum), a fluorescent chemical that re-emits the accepted excitation energy at a longer wavelength (acceptor emission spectrum).
  • a dark quencher for practicing the method of the present invention is a substance that at least partially absorbs excitation energy from the fluorophore donor and dissipates the energy as heat.
  • Black hole quencher (BHQTM) dyes are preferred dark quenchers for practicing the method of the present invention.
  • the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are preferably spectrally paired, meaning that they are selected such that the energy spectrum emitted by the fluorophore donor (fluorophore donor emission spectrum) and the energy spectrum absorbed by the fluorophore acceptor (fluorophore acceptor excitation spectrum) or the energy absorbed by the dark quencher (quencher absorption spectrum) overlap at least partially.
  • the fluorophore donor is capable of absorbing radiation having a wavelength between about 300 nm to 900 nm, more preferably between 350 nm and 800 nm and is capable of transferring energy to the fluorophore acceptor or dark quencher acceptor.
  • the acceptor fluorophore or dark quencher is capable of absorbing radiation having a wavelength between about 300 nm to 900 nm, more preferably between 350 nm and 800 nm, and has an excitation spectra overlapping with the emission of the fluorophore donor, such that the energy emitted by the donor can excite the acceptor.
  • the acceptor fluorophore absorbs light at a wavelength which is at least 10 nm higher and more preferably at least 20 nm higher, most preferably at least 30 nm higher than the maximum absorbance wavelength of the donor fluorophore.
  • the dark quencher acceptor absorbs at least 30% of the emitted wavelength by the fluorophore donor, more preferably at least 50%, most preferably all of the emitted wavelength.
  • the spectral overlap for the fluorophore donor emission spectrum and the dark quencher absorption spectrum, preferably black hole quencher (BHQTM) absorption spectrum is at least 30, preferably at least 50, 60 or 70, more preferably at least 80, most preferably at least 95 or 100 %.
  • the at least one fluorophore donor for practicing the method of the invention is selected from fluorescent proteins and small fluorescent dye molecule,
  • Green fluorescent protein Green fluorescent protein
  • eGFP Green fluorescent protein
  • Ex max 488nm
  • Em max 509 nm
  • Green fluorescent protein(s) as used herein is generally meant to include its derivatives, preferably those selected from the group consisting of EGFP, Emerald, Superfofder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire,
  • the preferred Cy3 compound for demonstrating the method of the invention as illustrated in the examples is attached to a ribonucleotide in the miRNA by reaction with the azide (1), which has the following formula (I):
  • the at least one dark quencher is selected from the group consisting of Dabcyl, Dabsyl, Black Hole Quenchers (BHQTM) dyes, preferably BHQ-0, BHQ-1, BHQ-2 or BHQ-3, QXL quenchers, preferably QXL 490, QXL 570, QXL 610, QXL 670, or QXL 680 Iowa Black quenchers, preferably Iowa black FQ or Iowa Black RQ, and IRDyes, preferably IRDye 8b0, IRDye 800CW, IRDye 800RS, IRDye 680, IRDye 680LT, IRDye 700, or IRDye 700DX, more preferably Black Hole Quenchers (BHQTM) dyes, most preferably BHQ-1.
  • BHQTM Black Hole Quenchers
  • Black Hole Quenchers (BHQTM) dyes as used herein is meant to include any functional derivatives.
  • the preferred BHQ1 functional derivative for demonstrating the method of the invention as illustrated in the examples is attached to a ribonucleotide in the miRNA by reaction with the azide (II), which has the following formula (II):
  • the skilled person can readily select spectrally paired fluorophore donors and fluorophore acceptors or spectrally paired fluorophore donors and dark quenchers based on the known or easily measurable emission spectra for the donors, the known or easily measurable excitation spectra of the acceptors and the known or easily measurable absorption spectra of the dark quenchers.
  • the first biomolecule for practicing the invention is Lin28(a or b) and the second biomolecule is (pri or pre-)let-7a-2 or functional derivatives or fragments of these biomolecules.
  • a preferred embodiment of a functional derivative of prelet-7a-2 is shown in the examples below and designated truncated pre-let-7a-2.
  • Pre-let-7a-2 is a member of the let-7 miRNA family. It is an approx. 67 nucleotides long non-coding miRNA precursor which is produced by processing pri-let-7a-2, a long transcript of several hundred nucleotides in length, so-called pri-miRNA.
  • the pre-let-7 family is presently composed of 12 members (12 pre-cursors, but only 9 mature miRNAs).
  • let-7, let-7a, let-7a-2, etc. include the corresponding pri- and pre-precursors, mature miRNAs as well as any functional derivatives or fragments of these biomolecules, meaning pre- and pri-precursors, mature miRNA as well as any derivatives or fragments of these biomolecules having the same or a substantially similar biological activity in a living cell as the corresponding native miRNA in said cell.
  • functional derivatives of let-7, let-7a, let-7a-2, etc. comprise at least the tetranucleotide hairpin binding region for Lin28, more preferably the tetrapeptide hairpin binding region GGAG.
  • the fluorophore donor of the first biomolecule or first domain of the biomolecule is at least one green or yellow fluorescent protein and/or that the fluorophore acceptor of the second biomolecule or of the second domain of the biomolecule, preferably an miRNA, more preferably pri- or pre-let-7a-2, is at least one Cy3.
  • the fluorophore donor of the first biomolecule or first domain of the biomolecule is at least one green or yellow fluorescent protein and/or that the dark quencher of the second biomolecule or of the second domain of the biomolecule, preferably an miRNA, more preferably pri- or pre-let-7a-2, is at least one dark quencher, preferably at least one black hole quencher (BHQTM), most preferably at least one BHQ-1 or at least one BHQ-2 or a functional derivative tehreof.
  • BHQTM black hole quencher
  • the at least one fluorophore donor preferably at least one GFP, more preferably at least one EGFP
  • the at least one fluorophore acceptor preferably Cy3 and/or at least one dark quencher, preferably black hole quencher (BHQTM), more preferably BHQ1 is bound to at least one of positions 1 to 67, preferably 5 to 60, more preferably 10 to 57, most preferably one of positions 10, 19, 34 and 57 of pri- or pre-let-7a-2 or a functional fragment or derivative thereof.
  • BHQTM black hole quencher
  • Preferred examples of pri- or pre-let-7a-2 mono- and bis Cy3- or BHQ1-labeled embodiments are: Position 19 mono-Cy3-labeled (pre)-let-7a-2, Position 19 & 34-bis-Cy3-labeled (pre)-let-7a-2, Position 19 mono-BHQ1-labeled (pre)-let-7a-2, Position 10 & 34-bis-BHQ1-labeled (pre)-let-7a-2 and Position 19 & 34-bis-BHQ1-labeled (pre)-let-7a-2 as well as truncated fragments thereof.
  • the miRNA is let-7a-2 full sequence (nucleotides 1 to 67) or the truncated sequence thereof (nucleotides 10 to 57).
  • the at least one fluorophore donor preferably GFP, more preferably EGFP is bound to the N- and/or C- terminal position of Lin28a or Lin28b and the at least one fluorophore acceptor, preferably Cy3 and/or at least one dark quencher, preferably a black hole quencher (BHQTM), more preferably BHQ-1 is bound to at least one, preferably at least two of positions 10, 19, 34 and 57 of pre-let-7a-2, preferably to position 10 and 19 or positions 10 and 34.
  • BHQTM black hole quencher
  • the contacting of the first and second biomolecules or the biomolecule comprising the first and second domains with the compound of interest must be under conditions that allow for FRET (Förster Resonance Energy Transfer) between the fluorophore donor and fluorophore acceptor or the fluorophore donor and the dark quencher.
  • FRET Förster Resonance Energy Transfer
  • Conditions for molecular interactions between biomolecules such as e.g. polypeptides and nucleotides are common knowledge in the art.
  • the conditions should be chosen to facilitate covalent and/or preferably non-covalent binding of the biomolecules of interest so that the fluorophore donor(s) and the fluorophore acceptor(s) or dark quencher(s) come into a close distance of about 10 or less nanometers.
  • the conditions should preferably not denature the biomolecules or otherwise affect their natural structure and function. Also, the conditions should not reduce the FRET signal.
  • the compound of interest is identified as a compound modulating, preferably inhibiting or enhancing an interaction between the two biomolecules or the two domains of the biomolecule, if the FRET (Forster Resonance Energy Transfer) between the first and second biomolecules or the first and second domains differs in the presence of the compound of interest compared to the FRET between the first and second biomolecules or the first and second domains in the absence of the compound of interest.
  • FRET Form Resonance Energy Transfer
  • the distance of the fluorophore donor and the fluorophore acceptor or the fluorophore donor and the dark quencher will, increase, thus decreasing or abolishing the FRET. If the compound enhances the biomolecule interaction the FRET will increase.
  • the FRET in the presence and absence of the compound of interest should be compared.
  • compounds known to modulate the interaction of the first and second biomolecules or the first and second domains are used as further reference and compared to the FRET results with and without the compound of interest.
  • the method of the invention and its preferred embodiments have a number of advantages over the screening methods commonly used to identify compounds of interest that modulate, in particular reduce, inhibit, initiate or increase biomolecule interaction.
  • the inventive method is simple, it only requires contacting the compound of interest with spectrally paired biomolecules or domains under conditions suitable for biomolecule interaction and FRET, and the readout is spectral and therefore easily automated.
  • the method is particularly suitable for screening polypeptide-miRNA interactions, which represent important targets for medical treatment.
  • the method is particularly effective for Lin28 polypeptid - pre-let-7 miRNA family member interactions.
  • the combination of GFPs or YFPs with Cy3 or GFPs or YFPs with BHQ1 or BHQ-2 or functional derivatives thereof is very FRET effective in Lin28-miRNA systems.
  • double-labeling miRNA with two or even more fluorophores, preferably Cy3 greatly enhances FRET (around two times).
  • dark quenchers instead of fluorophore acceptors such as Cy3 suppressed spectral bleed through significantly.
  • the use of a black hole quencher, preferably BHQ1 abolished bleed through and maximized the FRET efficiency up to 2.5 times.
  • a further independent aspect of the present invention that is generally applicable to any type of molecule and which is not limited to biomolecules relates to a method for identifying a compound modulating an interaction between two molecules or two domains of one molecule, the first molecule or first domain comprising at least one fluorophore donor and the second molecule or second domain comprising at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher overlap at least partially, comprising the steps of
  • fluorophore donor is a green fluorescent protein, preferably EGFP or a yellow fluorescent protein
  • fluorophore acceptor is cy3
  • the dark quencher is a black hole quencher (BHQTM), preferably BHQ-1 or BHQ-2 or a functional derivative thereof
  • Lin28b cDNA was amplified from Lin28B Human cDNA ORF Clone (Origene) and cloned into the SacI and Sacll sites of pEGFP-C2 Vector (BD Biosciences Clontech). Primers used for cloning are: forward primer FW: TCGAGCTCAATGGCCGAAGGCGGGGCTA reverse primer RV: ATCCGCGGGTTATGTCTTTTTCCTTTTTTG AACTGAAGGCCCC.
  • HEK 293T cells/well (ATCC ATCC ® CRL-11268TM) were seeded in a 6well plate and 320 ng pEGFP-C2-Lin28b fusion plasmid was complexed with jetPEI according to manufacturer's procedure and transfected. 72h after transfection cells were checked for fluorescent protein overexpression and lysed in 500ul buffer containing 50mM Tris, 0.1 mM ZnCl2, 200mM MgCl2, 0,5 % Triton X-100 and 0.5mM TCEP. Lysis buffer was spun for 15min at 13'000 rpm and supernatant was used for further FRET assay procedures.
  • HEK 293T cells were transfected as described above. 16h post transfection medium was exchanged to medium supplemented with 1 g/l neomycin (G418, Invitrogen). Medium was exchanged every second day for 14 days. Subsequently, stable cells were trypsinized and diluted to 150 cells/ml. Monoclonal cultures were grown for two weeks in a 96 well plate and checked for proper EGFP and Lin28b overexpression.
  • Cy3 azide was prepared as follows:
  • 1-Azido-4-iodobutane 12 (148759-55-1) was prepared following the procedure of Yao et al., J. Org. Chem. 2004, 69, 1720-1722 .
  • reaction mixture was stirred at 120 °C for 4 h, cooled to room temperature and was directly purified on silica gel flash chromatography with a gradient 1% to 5% MeOH in dichloromethane to afford 2,3,3-Trimethyl-1-(4-azidobutyl)-3 H -indolium 13 as a dark oil (720 mg, 2.8 mmol, 45%).
  • 2,3,3-Trimethyl-1-(4-sulfonatobutyl)-3 H -indolium 15 was prepared following the procedure of Kvach et al., Russ. Chem. Bull. 2006, 55, 159-163 .
  • To a 25 mL round bottom flash was added successively 2,3,3-trimethylindolenine 14 (3.97g, 25 mmol, 1 equiv.) and 1,4-butanesulfone (3.47 g, 25.5 mmol, 1.02 equiv.).
  • the reaction mixture was heated to 120 °C for 4 h until the reaction solidified.
  • N-(2-azidoethyl)-N-ethylaniline 18 To a solution of 2-(N-ethylanilino)ethanol 17 (4.9 mL, 30.2 mmol) in Et 2 O (250 mL) at 0 °C was added triethylamine (4.6 mL, 33.3 mmol, 1.1 equiv.) followed by a slow addition of methane sulfonyl chloride (2.6 mL, 33.3 mmol, 1.1 equiv.). After 1 h stirring at room temperature, the white precipitate was filtered and washed with Et 2 O. The filtrate was concentrated to an oil and dissolved in 100 mL of DMSO.
  • Oligoribonucleotide synthesis Oligoribonucleotides were synthesized with regular 2'-O-TBDMS-phosphoramidites on a 50 nmol scale using.5 mg of CPG (1000A). For 2'-O-propargyl cytidine phosphoramidite, the coupling time was prolonged to 3 x 4 min. After synthesis, the CPG with the alkynyl-modified RNA was suspended in 300 ⁇ L of H 2 O/MeOH (1:1) in an Eppendorf tube.
  • the reaction mixture was shaken for 16h at 45°C in an Eppendorf shaker.
  • CPG was filtered, washed three times with 0.5mL of DMF, 0.1 N aqueous EDTA, DMF, MeCN and CHCl 3 .
  • CPG was transferred into an Eppendorf tube and treated with 200 ⁇ L of ammonia (25% in H 2 O) and 200 ⁇ L of methylamine (40 % in H 2 O) solutions for 5 h at room temperature. After filtration, the remaining RNA was washed from the solid support with 3 x 100 ⁇ L H 2 O/EtOH (1:1). To the solution was added 20 ⁇ L of 1N Tris-base and it was evaporated to dryness in a SpeedVac.
  • Desilylation was carried out by treatment with 130 ⁇ L of a mixture of NMP (60 ⁇ L), TEA (30 ⁇ L) and TEA.3HF (40 ⁇ L) at 70 °C for 90 min.
  • the reaction was quenched with trimethylethoxysilane (160 ⁇ L) for 20 min at room temperature on an Eppendorf shaker.
  • Diethylether (1 mL) was added, the mixture was vortexed and centrifuged at 4 °C for 2 min. The supernatant was taken off and the precipitate was washed twice with 1 mL diethylether, vortexed and centrifuged.
  • the oligonucleotide was dissolved in 200 ⁇ L of water and purified DMT-on by RP-HPLC.
  • the isolated product was dried in a SpeedVac, treated for 1h with 40% aq. acetic acid at room temperature, dried in a SpeedVac, dissolved in 200 ⁇ L of water and purified DMT-off by RP-HPLC.
  • Double amount of azides is used for the homo bis-labelling of RNA hairpin; for
  • the volume of DMF was increased to 100 ⁇ L and was mixed with 240 ⁇ L of a 1:1 mixture of H 2 O/MeOH before addition of the reagents
  • FRET measurements were acquired on a QuantaMaster 50 (PMI Photon Technology International) in a 500 ⁇ L Precision cell made of Quartz SUPRASIL (115F-QS, 10x2 mm, Hellma) cuvette.
  • EGFP-C2-Lin28b containing lysate was diluted with working buffer (25mM Hepes, 300mM NaCl, 0.01mM ZnCl2, 1% Topblock, 0.05% Tween and 0.5 mM TCEP) to a concentration of approximately 2 nM.
  • working buffer 25mM Hepes, 300mM NaCl, 0.01mM ZnCl2, 1% Topblock, 0.05% Tween and 0.5 mM TCEP
  • Dry cy3 or BHQ-1 labeled truncated pre-let-7a-2 (SEQ ID: NO 2: nucleotides 10 to 57) was diluted with Millipore water to a concentration of 20 ⁇ M.
  • Measurements were acquired without and with various concentrations of labeled pre-let-7a-2 of 0.313nM, 1.25nM, 5nM, 20nM and 80nM. Solutions were incubated for 30 min and their fluorescence spectra were acquired between 475-600 nm after excitation of the sample at 465 nm.
  • the Förster Resonance Energy Transfer was calculated based on the difference of the EGFP emission signal intensity (at 507nm) between the solution containing only the GFP-tagged lin28 and the solutions containing GFP-tagged lin28 and various concentra-tions of labeled pre-let-7a-2.
  • background signal of Cy3 was subtracted to get rid of the bleach through. Measurements shown represent at least biological duplicates.
  • Figs. 8 to 13 The results of the FRET measurements with mono- and bis-BHQ-1-labeled truncated pre-let-7a-2 are shown in Figs. 8 to 13 .
  • Table 1 Preferred polypeptides interacting with nucleotides (RBPs, ribonucleotide-binding polypeptides) Abbrev.
  • MI0000060 has-let-7a-1), sequence reference (MI%) hsa-let-7a-1 MI0000060 hsa-mir-149 MI0000478 hsa-mir-3149 MI0014176 hsa-let-7a-2 MI0000061 hsa-mir-150 MI0000479 hsa-mir-3150a MI0014177 hsa-let-7a-3 M10000062 hsa-mir-151a MI0000809 hsa-mir-3150b MI0016426 hsa-let-7b MI0000063 hsa-mir-151b MI0003772 hsa-mir-3151 MI0014178 hsa-let-7c MI0000064 hsa-mir-152 MI0000462 hsa-mir-3152 MI0014179 hsa-let-7d MI0000065 hsa-mir-153-1 MI0000463 hsa-mir-3153 MI0014180 hsa-let-7e MI0000066 h

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
EP13002949.9A 2013-06-07 2013-06-07 Procédé de transfert de l'énergie de résonance par émission de fluorescence pour identifier un composé de modulation de biomolécule Withdrawn EP2811298A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP13002949.9A EP2811298A1 (fr) 2013-06-07 2013-06-07 Procédé de transfert de l'énergie de résonance par émission de fluorescence pour identifier un composé de modulation de biomolécule
PCT/EP2014/001548 WO2014195026A2 (fr) 2013-06-07 2014-06-06 Procédé fret pour l'identification d'un composé modulateur de biomolécule

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
EP13002949.9A EP2811298A1 (fr) 2013-06-07 2013-06-07 Procédé de transfert de l'énergie de résonance par émission de fluorescence pour identifier un composé de modulation de biomolécule

Publications (1)

Publication Number Publication Date
EP2811298A1 true EP2811298A1 (fr) 2014-12-10

Family

ID=48628236

Family Applications (1)

Application Number Title Priority Date Filing Date
EP13002949.9A Withdrawn EP2811298A1 (fr) 2013-06-07 2013-06-07 Procédé de transfert de l'énergie de résonance par émission de fluorescence pour identifier un composé de modulation de biomolécule

Country Status (2)

Country Link
EP (1) EP2811298A1 (fr)
WO (1) WO2014195026A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BE1022918B1 (nl) * 2015-05-12 2016-10-17 Silvema Bvba Methode voor het identificeren van modulators van de interactie tussen kh-domein bindende microrna's en kh-domein bevattende proteïnen
EP3418348A1 (fr) * 2017-06-21 2018-12-26 Université de Strasbourg Nanoparticules polymères fluorescentes chargées avec un colorant utilisées comme nano-antenne

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006042907A1 (fr) * 2004-10-19 2006-04-27 Wallac Oy Nouvelle sonde et son utilisation dans des tests de bioaffinité
US20060257915A1 (en) * 2005-05-13 2006-11-16 Pronucleotein Biotechnologies, Llc Methods of producing competitive aptamer fret reagents and assays
WO2009048935A2 (fr) 2007-10-08 2009-04-16 Hale John T Procédé, appareil et aimant pour traiter magnétiquement des fluides

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006042907A1 (fr) * 2004-10-19 2006-04-27 Wallac Oy Nouvelle sonde et son utilisation dans des tests de bioaffinité
US20060257915A1 (en) * 2005-05-13 2006-11-16 Pronucleotein Biotechnologies, Llc Methods of producing competitive aptamer fret reagents and assays
WO2009048935A2 (fr) 2007-10-08 2009-04-16 Hale John T Procédé, appareil et aimant pour traiter magnétiquement des fluides

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL ET AL.: "BLAST handbook", NCB NLM NIH
HUANG; MILLER, ADV. APPL. MATH., vol. 12, 1991, pages 337 - 357
KLOSTERMEIER DAGMAR ET AL: "A three-fluorophore FRET assay for high-throughput screening of small-molecule inhibitors of ribosome assembly", NUCLEIC ACIDS RESEARCH, INFORMATION RETRIEVAL LTD, vol. 32, no. 9, 17 May 2004 (2004-05-17), pages 2707 - 2715, XP002379791, ISSN: 0305-1048, DOI: 10.1093/NAR/GKH588 *
KVACH ET AL., RUSS. CHEM. BULL., vol. 55, 2006, pages 159 - 163
LEHRBACH; MISKA: "Regulation of pre-miRNA Processing", 2010, SPRINGER
ROOS ET AL.: "Noncoding RNAs in Development and Cancer", 20 January 2013, INSTITUTE OF PHARMACEUTICAL SCIENCES, article "Antisense oligonucleotides inhibit LIN28 binding to pre-let-7"
SAMBROOK; RUSSELL, MOLECULAR CLONING: A LABORATORY MANUAL, vol. 3, 2001
THORNTON ET AL.: "How does Lin28 let-7 control development and disease", TRENDS IN CELL BIOLOGY, 2012
VISWANATHAN ET AL., NAT GEN, vol. 41, 2009, pages 843
VISWANATHAN; DALEY: "Lin28: A MicroRNA Regulator with a Macro Role", CELL, 2010
YAO ET AL., J. ORG. CHEM., vol. 69, 2004, pages 1720 - 1722
YEOM ET AL., EMBO REPORTS, vol. 12, no. 7, 2011, pages 690 - 696

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BE1022918B1 (nl) * 2015-05-12 2016-10-17 Silvema Bvba Methode voor het identificeren van modulators van de interactie tussen kh-domein bindende microrna's en kh-domein bevattende proteïnen
EP3418348A1 (fr) * 2017-06-21 2018-12-26 Université de Strasbourg Nanoparticules polymères fluorescentes chargées avec un colorant utilisées comme nano-antenne
WO2018234431A1 (fr) * 2017-06-21 2018-12-27 Universite De Strasbourg Nanoparticules polymères fluorescentes chargées de colorants en tant que nano-antenne
CN110892040A (zh) * 2017-06-21 2020-03-17 斯特拉斯堡大学 作为纳米天线的负载染料的荧光聚合物纳米颗粒
US11549886B2 (en) 2017-06-21 2023-01-10 Universite De Strasbourg Dye-loaded fluorescent polymeric nanoparticles as nano-antenna

Also Published As

Publication number Publication date
WO2014195026A3 (fr) 2015-03-19
WO2014195026A2 (fr) 2014-12-11

Similar Documents

Publication Publication Date Title
US10612026B2 (en) Pharmaceutical composition for treating cancer comprising microrna as active ingredient
US9284554B2 (en) Micro-RNA scaffolds and non-naturally occurring micro-RNAs
Shao et al. Photoactive molecules for applications in molecular imaging and cell biology
Bartoszewski et al. The unfolded protein response (UPR)-activated transcription factor X-box-binding protein 1 (XBP1) induces microRNA-346 expression that targets the human antigen peptide transporter 1 (TAP1) mRNA and governs immune regulatory genes
Lim et al. Discovery of a small-molecule inhibitor of protein–microRNA interaction using binding assay with a site-specifically labeled Lin28
US11041201B2 (en) Methods for detection of RNase activity
Mallam et al. Systematic discovery of endogenous human ribonucleoprotein complexes
US20140370545A1 (en) Reengineering mRNA Primary Structure for Enhanced Protein Production
US20100021914A1 (en) Oligonucleotides for modulating target rna activity
JP2013126996A (ja) 筋細胞増殖及び分化を調節するマイクロｒｎａ
Zhang et al. Caged circular siRNAs for photomodulation of gene expression in cells and mice
Aghanoori et al. MiRNA molecular profiles in human medical conditions: connecting lung cancer and lung development phenomena
Wang et al. Live-cell RNA imaging with metabolically incorporated fluorescent nucleosides
Wang et al. SP1‐SYNE1‐AS1‐miR‐525‐5p feedback loop regulates Ang‐II‐induced cardiac hypertrophy
Warminski et al. Amino-functionalized 5′ cap analogs as tools for site-specific sequence-independent labeling of mRNA
Hu et al. Quantitative proteomics reveals diverse roles of miR-148a from gastric cancer progression to neurological development
Lanz et al. The acidic C-terminal tail of the GyrA subunit moderates the DNA supercoiling activity of Bacillus subtilis gyrase
Dahan et al. SNP detection in mRNA in living cells using allele specific FRET probes
EP2811298A1 (fr) Procédé de transfert de l'énergie de résonance par émission de fluorescence pour identifier un composé de modulation de biomolécule
Gao et al. A DNA tetrahedron nanoprobe-based fluorescence resonance energy transfer sensing platform for intracellular tumor-related miRNA detection
Gu et al. Living-cell microRNA imaging with self-assembling fragments of fluorescent protein-mimic RNA aptamer
Li et al. A proteomic view of Caenorhabditis elegans caused by short-term hypoxic stress
Zheng et al. Real-time functional bioimaging of neuron-specific microRNA dynamics during neuronal differentiation using a dual luciferase reporter
Xu et al. In situ imaging miRNAs using multifunctional linear DNA nanostructure
Kollárová Regulation of gene expression at posttranscriptional levels.

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20130607

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20150611