EP2723349A2 - Microrna-31 compositions and methods for use in autoimmune disease - Google Patents

Microrna-31 compositions and methods for use in autoimmune disease

Info

Publication number
EP2723349A2
EP2723349A2 EP12804592.9A EP12804592A EP2723349A2 EP 2723349 A2 EP2723349 A2 EP 2723349A2 EP 12804592 A EP12804592 A EP 12804592A EP 2723349 A2 EP2723349 A2 EP 2723349A2
Authority
EP
European Patent Office
Prior art keywords
expression
rhoa
subject
microrna
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP12804592.9A
Other languages
German (de)
French (fr)
Other versions
EP2723349A4 (en
Inventor
Yihong Yao
Nan Shen
Wei Fan
Yuanjia Tang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Renji Hospital
MedImmune LLC
Original Assignee
Shanghai Renji Hospital
MedImmune LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Renji Hospital, MedImmune LLC filed Critical Shanghai Renji Hospital
Publication of EP2723349A2 publication Critical patent/EP2723349A2/en
Publication of EP2723349A4 publication Critical patent/EP2723349A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/711Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/113Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs

Definitions

  • autoimmune conditions are associated with significant morbidity and, in some cases, mortality.
  • the symptoms of autoimmune conditions may impact the ability to work and otherwise affect the quality of life of patients.
  • SLE Systemic lupus erythematosus
  • T cells from lupus patients display a number of signaling abnormalities (Nambiar et al., 2004; Fujii et al., 2006; Kong et al, 2003; Moulton et al, 2011).
  • Interleukin-2 is a multifunctional cytokine primarily produced by T cells and is essential for T cell activation, proliferation, and contraction (Lieberman et al., 2010). It has been reported that the production of IL-2 is decreased in SLE T cells and that transcriptional regulators responsible for transcription or suppression of IL-2 production are imbalanced in SLE T cells (Lieberman et al., 2010; Tenbrock et al., 2004; Katsiari et al., 2005; Juang et al., 2005; Herndon et al, 2002; Solomou et al, 2001).
  • the present disclosure provides methods and compositions applicable to the treatment, evaluation, diagnosis, and prognosis of subjects having an autoimmune condition, such as systemic lupus erythematosus.
  • the methods provided herein are based on the correlation between microRNA-31 expression and IL-2 expression in subjects.
  • the disclosure provides a method of increasing interleukin-2 (IL-2) expression in a subject in need thereof, which subject has an autoimmune condition.
  • IL-2 interleukin-2
  • Such a method comprises administering to the subject an effective amount of a composition that increases expression of microR A-31 or decreases expression of RhoA.
  • the subject in need thereof is a subject having systemic lupus erythematosus.
  • the subject in need thereof is a subject having another autoimmune condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
  • the disclosure provides a method of increasing interleukin-2 (IL-2) expression in T cells of a subject having an autoimmune condition.
  • a method comprises contacting the T cells with an effective amount of a composition that increases expression of microRNA-31 or decreases expression of RhoA.
  • Contacting T cells may be in vivo, such as by administering a composition to a subject.
  • contacting T cells may be in vitro, such as by including a composition in a cell culture media.
  • the subject having an autoimmune condition has systemic lupus erythematosus.
  • the subject in need thereof is a subject having another autoimmune condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
  • the disclosure provides a method of treating an autoimmune condition, comprising administering to a subject in need thereof an effective amount of a composition that increases expression of microRNA-31 or decreases expression of RhoA to treat the autoimmune condition.
  • the autoimmune condition is systemic lupus erythematosus.
  • the condition is another autoimmune condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
  • the disclosure provides a method of decreasing RhoA expression in a subject having an autoimmune condition.
  • a method comprises administering to the subject an effective amount of a composition that increases expression of microRNA-31.
  • the autoimmune condition is systemic lupus erythematosus.
  • the condition is another autoimmune condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
  • the disclosure provides a method of decreasing RhoA expression in T cells of a subject having an autoimmune condition. Such a method comprises contacting the T cells with an effective amount of a composition that increases expression of microRNA-31. Contacting T cells may be in vivo, such as by administering a composition to a subject.
  • contacting T cells may be in vitro, such as by including a composition in a cell culture media.
  • the subject having an autoimmune condition has systemic lupus erythematosus.
  • the subject in need thereof is a subject having another autoimmune condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
  • the subject is a human subject. In other embodiments, the subject is a non-human subject. In certain embodiments, the subject has systemic lupus erythematosus and is experiencing symptoms of a disease flare, such as experiencing symptoms of a disease flare prior to administration of the composition. In other embodiments, the subject has systemic lupus erythematosus and is not experiencing symptoms of a disease flare, such as prior to administration of the composition. In certain embodiments, the symptoms of SLE include lupus nephritis.
  • the subject has another autoimmune condition, such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
  • another autoimmune condition such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
  • the other autoimmune condition is rheumatoid arthritis (RA) or type I diabetes.
  • the T cells contacted or acted on by the composition are activated T cells, such as activated T cells in vitro or in vivo.
  • the composition comprises a nucleic acid comprising a nucleotide sequence that increases expression of microRNA-31.
  • the composition comprises a nucleic acid comprising a nucleotide sequence that decreases expression of RhoA.
  • the composition comprises a polypeptide or small organic molecule that increases expression of microRNA-31 and/or decreases expression of RhoA. By increases or decreases expression, the disclosure contemplates embodiments in which transcript and/or protein expression are increased or decreased.
  • the composition comprises microRNA- 31 which is exogenously added.
  • microRNA-31 may correspond to naturally occurring microRNA-31 or may comprise a synthetic nucleic acid.
  • the composition comprises a short interfering nucleic acid (siNA), such as a microRNA, an siRNA or an antisense oligonucleotide.
  • siNA short interfering nucleic acid
  • the composition comprises an siNA that can hybridize to RhoA.
  • decreases expression of RhoA comprises decreases expression of RhoA transcripts. In other embodiments, decreases expression of RhoA comprises decreases expression of RhoA protein. In certain embodiments, increases expression of IL-2 comprises increases expression of IL-2 transcripts. In other embodiments, increases expression of IL-2 comprises increases expression of IL-2 protein.
  • the method further comprises one or more assay steps.
  • the method further comprises assaying expression of IL-2 in a sample taken from the subject at a time subsequent to administering the composition.
  • the method further comprises assaying expression of RhoA in a sample taken from the subject at a time subsequent to administering the composition.
  • samples may be taken by the same health care provider who or at the same institution where the therapeutic composition is administered, or such samples may be taken by different health care providers and/or at a different institution.
  • the sample used in an assaying step comprises a blood sample.
  • the assay may be performed using whole blood samples or using lymphocytes separated from the blood sample or using serum or some other component of the blood.
  • the relevant sample is prepared based on the particular assay being used.
  • the sample used in the assaying step comprises a bone marrow sample.
  • assaying expression of IL-2 comprises assaying expression of IL-2 transcripts, such as in T cells.
  • assaying expression of IL-2 comprises assaying expression of IL-2 protein in the sample.
  • assaying expression of RhoA comprises assaying expression of RhoA transcripts, such as in T cells. In other embodiments, assaying expression of RhoA comprises assaying expression of RhoA protein in the sample.
  • the disclosure provides a method.
  • the method comprises assaying the presence, absence or amount of a biomarker in a subject having an autoimmune condition, such as systemic lupus erythematosus, to whom a compound has been administered, wherein the biomarker is selected from microRNA-31, RhoA or IL-2; and determining whether the dosage or dosing regimen of the compound subsequently administered to the subject is adjusted based on the presence, absence or amount of the biomarker assayed.
  • the autoimmune condition is systemic lupus erythematosus.
  • the autoimmune condition shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
  • the subject is a human subject. In other embodiments, the subject is a non-human subject. In certain embodiments, the subject has systemic lupus erythematosus and is experiencing symptoms of a disease flare. In other embodiments, the subject has systemic lupus erythematosus and is not experiencing symptoms of a disease flare. In certain embodiments, the symptoms of SLE include lupus nephritis. In certain embodiments, the subject has another autoimmune condition, such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In certain embodiments, the other autoimmune condition is rheumatoid arthritis (RA) or type I diabetes.
  • RA rheumatoid arthritis
  • the sample used for the assaying step comprises a blood sample.
  • an assay may be performed using a whole blood sample or using lymphocytes separated from the blood sample or using serum or some other component of the blood.
  • the relevant sample is prepared based on the particular assay being used.
  • the sample used comprises a bone marrow sample.
  • assaying expression of IL-2 comprises assaying expression of IL-2 transcripts, such as in T cells.
  • assaying expression of IL-2 comprises assaying expression of IL-2 protein in the sample.
  • assaying expression of RhoA comprises assaying expression of RhoA transcripts, such as in T cells. In other embodiments, assaying expression of RhoA comprises assaying expression of RhoA protein in the sample.
  • the compound comprises a steroid or an immunosuppressive agent. In other embodiments, the compound comprises a composition of the present disclosure. In certain embodiments, the compound comprises a composition that increases microRNA-31 expression or decreases RhoA expression. In certain embodiments, the compound comprises IL- 2.
  • the biomarker examined is RhoA. In other embodiments, the biomarker examined is IL-2. In still other embodiments, a combination of one or more of the foregoing biomarkers is examined. Biomarkers may be examined at the transcript or protein level.
  • the disclosure provides a method of diagnosing an autoimmune condition, such as systemic lupus erythematosus.
  • the method comprises obtaining a sample from a subject suspected of having an autoimmune condition, such as systemic lupus
  • the subject is a human subject. In other embodiments, the subject is a non-human subject. In certain embodiments, the subject has systemic lupus erythematosus and is experiencing symptoms of a disease flare. In other embodiments, the subject has systemic lupus erythematosus and is not experiencing symptoms of a disease flare. In certain embodiments, the symptoms of SLE include lupus nephritis. In certain embodiments, the subject has another autoimmune condition, such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In certain embodiments, the other autoimmune condition is rheumatoid arthritis (RA) or type I diabetes.
  • RA rheumatoid arthritis
  • the sample used for the assaying step comprises a blood sample.
  • an assay may be performed using a whole blood sample or using lymphocytes separated from the blood sample or using serum or some other component of the blood.
  • the relevant sample is prepared based on the particular assay being used.
  • the sample used comprises a bone marrow sample.
  • assaying expression of IL-2 comprises assaying expression of IL-2 transcripts, such as in T cells.
  • assaying expression of IL-2 comprises assaying expression of IL-2 protein in the sample.
  • assaying expression of RhoA comprises assaying expression of RhoA transcripts, such as in T cells. In other embodiments, assaying expression of RhoA comprises assaying expression of RhoA protein in the sample.
  • the disclosure provides a method of monitoring treatment of an autoimmune condition, such as systemic lupus erythematosus.
  • the method comprises detecting expression of microRNA-31 or RhoA in a sample from a subject undergoing treatment for an autoimmune condition, such as systemic lupus erythematosus; and comparing the expression of microRNA-31 or RhoA to expression in a sample from the same subject obtained prior to the treatment or at an earlier time point during the treatment.
  • an increase in microRNA-31 or a decrease in RhoA in a sample obtained at a later point during treatment versus that obtained prior to treatment or at an earlier time point during treatment indicates effectiveness of the treatment, thereby monitoring the treatment.
  • the subject is a human subject. In other embodiments, the subject is a non-human subject. In certain embodiments, the subject has systemic lupus erythematosus and is experiencing symptoms of a disease flare. In other embodiments, the subject has systemic lupus erythematosus and is not experiencing symptoms of a disease flare. In certain embodiments, the symptoms of SLE include lupus nephritis. In certain embodiments, the subject has another autoimmune condition, such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In certain embodiments, the other autoimmune condition is rheumatoid arthritis (RA) or type I diabetes.
  • RA rheumatoid arthritis
  • the sample used for the assaying step comprises a blood sample.
  • an assay may be performed using a whole blood sample or using lymphocytes separated from the blood sample or using serum or some other component of the blood.
  • the relevant sample is prepared based on the particular assay being used.
  • the sample used comprises a bone marrow sample.
  • assaying expression of IL-2 comprises assaying expression of IL-2 transcripts, such as in T cells.
  • assaying expression of IL-2 comprises assaying expression of IL-2 protein in the sample.
  • assaying expression of RhoA comprises assaying expression of RhoA transcripts, such as in T cells.
  • assaying expression of RhoA comprises assaying expression of RhoA protein in the sample.
  • the disclosure provides a method of treating a subject having an autoimmune condition, such as systemic lupus erythematosus.
  • the method comprises comparing expression of microRNA-31 or RhoA from a sample taken from a subject prior to initiation of a particular treatment for the autoimmune condition to a standard range reflecting expression in samples from healthy subjects, wherein expression of microRNA-31 below the standard range or expression of RhoA above the standard range indicates susceptibility to treatment for, for example, systemic lupus erythematosus.
  • the method further comprises treating the subject with an effective amount of a composition comprising microRNA-31, siNA that hybridizes to RhoA or IL-2 protein, or another composition of the disclosure, if the subject is determined to be susceptible to treatment for systemic lupus erythematosus; detecting expression of microRNA-31 or RhoA in a post-treatment sample from the subject; and comparing expression of microRNA-31 or RhoA in the post-treatment sample to expression in the sample taken prior to initiation of the particular treatment.
  • the subject is a human subject. In other embodiments, the subject is a non-human subject. In certain embodiments, the subject has systemic lupus erythematosus and is experiencing symptoms of a disease flare. In other embodiments, the subject has systemic lupus erythematosus and is not experiencing symptoms of a disease flare. In certain embodiments, the symptoms of SLE include lupus nephritis. In certain embodiments, the subject has another autoimmune condition, such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In certain embodiments, the other autoimmune condition is rheumatoid arthritis (RA) or type I diabetes.
  • RA rheumatoid arthritis
  • the sample used for the assaying step comprises a blood sample.
  • an assay may be performed using a whole blood sample or using lymphocytes separated from the blood sample or using serum or some other component of the blood.
  • the relevant sample is prepared based on the particular assay being used.
  • the sample used comprises a bone marrow sample.
  • assaying expression of IL-2 comprises assaying expression of IL-2 transcripts, such as in T cells.
  • assaying expression of IL-2 comprises assaying expression of IL-2 protein in the sample.
  • assaying expression of RhoA comprises assaying expression of RhoA transcripts, such as in T cells. In other embodiments, assaying expression of RhoA comprises assaying expression of RhoA protein in the sample.
  • Figure 1 shows decreased expression of miR-31 in lupus patients as compared with normal control (NC) subjects.
  • A miR-31 expression in T cells, B cells and monocytes was determined by the Taqman quantitative PCR. Results are expressed as mean ⁇ SEM, normalized to the expression of B cells from three healthy donors.
  • B An independent verification of miR- 31 expression in T cells from 32 lupus patients and 11 normal controls is shown using the Taqman quantitative PCR ( ⁇ 0.0001). Results above are presented as mean ⁇ SEM. P values were determined by Mann- Whitney U test.
  • Figure 2 shows the expression of the miR-31.
  • A Taqman quantitative PCR analysis of miR-31 expression in activated primary T cells 24 hours post-transfection of miR-31 mimic or control (Ctrl).
  • B Taqman quantitative PCR analysis of miR-31 expression in activated primary T cells 24 hours post-transfection of antagomir-31 or control.
  • Figure 3 presents experimental results showing that miR-31 regulates IL-2 expression and the activity of the IL-2 promoter.
  • A Primary T cells were stimulated with PMA and ionomycin and miR-31 levels were measured at different time by the Taqman quantitative PCR. RNU48 levels were used to normalize expression. Each bar is the mean of three independent experiments.
  • B Quantitative PCR analysis of IL-2 expression in activated primary T cells 24 hours post-transfection of miR-31 mimic or control mimic (Ctrl) and antagomir-31 or antagomir- control(Ctrl). Histograms show fold changes in mRNA expression with respect to the controls after normalization with the housekeeping gene RPL13A.
  • IL-2 levels in the culture supernatant of activated primary T cells transfected with miR-31 mimic or control mimic and antagomir-31 or antagomir-control were detected by ELISA. Values in B and C are the mean ⁇ SEM for four representative healthy donors.
  • E Jurkat cells were co-transfected with miR-31 mimic or control mimic and the IL-2 promoter-luc reporter plasmid together, with pGL3-basic-luc used for normalization of transfection.
  • FIG. 4 presents experimental results identifying miR-31 as a negative regulator of RhoA expression.
  • RhoA mRNA expression levels in activated T lymphocytes transfected with either miR-31 mimic or control mimic were analyzed by RT-PCR. Data are from three independent experiments. Results are presented as mean ⁇ SEM.
  • Figure 5 shows the effect of siRNA against RhoA.
  • A Quantitative PCR analysis of RhoA expression in primary T cells post-transfection of siRNA-1, siRNA-2 or control.
  • B Immunob lot analysis of RhoA expression in primary T cells after the transfection of two siRNAs (siR-1 and siR-2) or control directed against RhoA. Results above are presented as mean ⁇ SEM. P values were determined by Mann- Whitney U test.
  • Figure 6 presents experimental results showing that siRNA-mediated knockdown of RhoA regulates IL-2 production and the activity of the IL-2 promoter.
  • A Quantitative PCR analysis of IL-2 expression in activated primary T cells 24 hours post-transfection of miR-31 mimic or control mimic and two siRNAs.
  • B IL-2 levels in the culture supernatant of activated primary T cells transfected with miR-31 mimic, control mimic, or two siRNAs were detected by ELISA. Values in A and B are the mean ⁇ SEM for three representative healthy donors.
  • Figure 7 presents experimental results identifying the roles of miR-31 , RhoA and IL-2 in activated T cells from SLE patients.
  • A The expression of miR-31 in activated T cells of 15 SLE patients and 10 normal controls (NC) was detected by the Taqman quantitative PCR.
  • B RhoA expression was quantified by RT-PCR in the samples above.
  • C IL-2 protein levels in the supernatant of activated T cells from 12 SLE patients and 10 normal controls were measured by ELISA.
  • Table 1 summarizes the clinical features of patients used in the studies presented in Figure IB.
  • Table 2 summarizes the clinical features of patients used in the studies presented in
  • SLE Systemic lupus erythematosus
  • the instant disclosure is based in part on the identification of a mechanism in autoimmune disease involving signaling via microRNA-31, RhoA and IL-2.
  • MicroRNAs are a class of single-stranded noncoding RNAs that act as key post-transcriptional regulators of gene expression (Denli et al, 2004; Gregory et al, 2004). In animals, miRNAs usually conduct imperfect base pairing with the 3' untranslated region (UTR) of target genes and regulate target gene expression by either translational inhibition, or mRNA degradation (Ambros. 2004).
  • UTR 3' untranslated region
  • the instant disclosure is based, in part, on the Examples provided below.
  • the Examples reflect studies in which under-expression of endogenous miR-31 levels was identified in SLE T cells. It was also determined that miR-31 is a positive regulator of IL-2 production in activated T cells, and that RhoA expression is inversely correlated to miR- 31 expression. This regulation appears to occur via regulation of the promoter activity of IL-2. Moreover, the expression of RhoA was significantly higher in lupus T cells compared to healthy volunteers.
  • compositions for use in any of the claimed methods contemplates the use of any such compositions of the disclosure, described based on any combination of functional and/or structural features, in any of the methods described herein.
  • compositions of the disclosure include compositions comprising, as the active ingredient, nucleic acids, polypeptides, or small organic molecules.
  • compositions of the disclosure are cellular compositions, such as a composition in which a cell that comprises and expresses a given nucleic acid or polypeptide is administered.
  • compositions of the disclosure is used to refer to any such compositions useful in the present methods, including useful in diagnostic or therapeutic methods. Any compositions of the disclosure may be used in any of the methods described herein.
  • compositions of the disclosure may be described using any of the structural and/or functional features described herein.
  • nucleic acid generally refers to a molecule (one, two or more strands) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase.
  • a nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A,” a guanine “G,” a thymine “T” or a cytosine “C”) or RNA (e.g., an A, a G, an uracil "U” or a C).
  • nucleic acid encompasses the terms “oligonucleotide” and “polynucleotide,” each as a subgenus of the term “nucleic acid.”
  • Nucleic acids as provided herein include without limitation microRNA (whether naturally occurring or synthetic), siNA, and antisense RNA.
  • Nucleic acids may, be at least, be at most, or be about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 nucleotides, or any range derivable therein, in length.
  • these lengths correspond only to the length of the functional portion of the nucleic acid moiety, but do not include the length of any vector sequence or any conjugate portion. Such lengths cover the lengths of processed miRNA or siNA, miRNA or siNA molecules, precursor miRNA or siNA, miRNA or siNA containing vectors, control nucleic acids, and other molecules, probes and primers.
  • the molecule does not include the naturally occurring molecule.
  • the exogenously provided molecule differs in, for example, sequence, length, modification, strandedness, or some other property relative to that of an endogenously occurring molecule.
  • miRNA are 19-24 nucleotides in length, while miRNA precursors are generally between 62 and 110 nucleotides in humans.
  • Nucleic acids herein provided may have regions of identity or complementarity to another nucleic acid. It is contemplated that the region of complementarity or identity can be at least 5 contiguous residues, though it is specifically contemplated that the region, is at least, is at most, or is about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750,
  • a nucleic acid may also comprise a vector, including without limitation a plasmid or virus.
  • the vector may code for a pre-processed nucleic acid molecule, or for the mature post- processed molecule (e.g., pre-processed or post-processed miRNA or siRNA).
  • a "synthetic nucleic acid” means that the nucleic acid does not have a chemical structure or sequence of a naturally occurring nucleic acid. Consequently, it is understood that the term “synthetic miRNA” refers to a “synthetic nucleic acid” that is not isolated from a cell and is artificially manufactured, but which may sometimes function in a cell or under physiological conditions.
  • stringent conditions or “high stringency” are those conditions that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but preclude hybridization of random sequences. Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are known, and are preferred for applications requiring high selectivity. Non-limiting applications include isolating a nucleic acid, such as a gene or a nucleic acid segment thereof, or detecting at least one specific mRNA transcript or a nucleic acid segment thereof, and the like.
  • Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.5 M NaCl at temperatures of about 42 °C to about 70 °C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and the presence or concentration of formamide, tetramethylammonium chloride or other solvents) in a hybridization mixture.
  • low stringency or “low stringency conditions”
  • non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 20 °C to about 50 °C.
  • the low or high stringency conditions may be further modified to suit a particular application.
  • siNA refers to a class of nucleic acid molecules capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others.
  • RNAi short interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • siRNAi short interfering oligonucleotide
  • short interfering nucleic acid short interfering modified oligonucleotide
  • ptgsRNA post-transcriptional gene silencing RNA
  • ptgsRNA post-transcriptional gene silencing RNA
  • siNA molecules can be used to epigenetically silence genes at either or both of the post-transcriptional level and the pre-transcriptional level.
  • epigenetic regulation of gene expression by siNA molecules of the technology can result from siNA mediated modification of chromatin structure to alter gene expression.
  • a siNA may be used therapeutically to mediate the level of a polypeptide or protein. This regulation may be direct or indirect, such as by inhibiting expression of a protein that is itself a repressor of a protein of interest.
  • a siNA may be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, where the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • a siNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, where the antisense and sense strands are self- complementary.
  • each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure, for example where the double stranded region is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more base pairs.
  • the antisense strand can comprise a nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand can comprise nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • a siNA can be assembled from a single oligonucleotide, where the self complementary sense and antisense regions of the siNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s).
  • a siNA can be a polynucleotide with a hairpin secondary structure, having self- complementary sense and antisense regions, where the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • a siNA can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self complementary sense and antisense regions, where the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and where the circular polynucleotide can be processed either in vivo or in vitro to generate an active siNA molecule capable of mediating RNAi.
  • a siNA comprises two strands of RNA. In certain embodiments a siNA comprises two strands of DNA. A siNA may sometimes be a hybrid, comprising one strand of RNA and one strand of DNA. One or both strands may also comprise mixed RNA and DNA.
  • a strand of a siNA may be about 5 to about 60 nucleotides in length (e.g., about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 4041, 42, 43, 4445 464748, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58 or 59 nucleotides).
  • a siNA strand sometimes may exceed 60 nucleotides.
  • a siNA may also comprise a single-stranded polynucleotide having a nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (for example, where such siNA molecule does not require the presence within the siNA molecule of nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof), where the single stranded polynucleotide can further comprise a terminal phosphate group, such as a 5 ' -phosphate or 5 ' , 3 ' -diphosphate .
  • a siNA molecule may comprise separate sense and antisense sequences or regions, where the sense and antisense regions are covalently linked by nucleotide or nonnucleotide linker molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic interactions, and/or stacking interactions.
  • a siNA molecule comprises a nucleotide sequence that is complementary to nucleotide sequence of a target gene.
  • the siNA molecule interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.
  • one or more nucleotides in an siNA are substituted with another nucleotide, are a modified base, are deleted and/or are inserted (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides in the siNA are substituted, are a modified base, are deleted and/or are inserted) relative to an unmodified reference siNA (e.g., a native siNA).
  • an unmodified reference siNA e.g., a native siNA.
  • the function of such a modified siNA in vivo or in vitro sometimes is the same as for a reference siNA, and sometimes is modified (e.g., greater or reduced).
  • a modified function typically is detectable and sometimes is within 100-fold greater (e.g., 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold greater) or 100-fold reduced (e.g., 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold reduced) of the function elicited by a reference siNA.
  • the methods of the disclosure comprise administering a composition comprising an siNA.
  • siNA molecules are exogenously added to cells or administered to patients. Such exogenously added siNA molecules are expressed following their introduction.
  • the exogenously added siNA molecules help upregulate endogenous expression of a transcript or protein.
  • expression of a particular molecule is increased by exogenously adding siNA molecules, thereby overexpression of particular molecule is cells.
  • MicroRNAs are a class of non-coding regulatory RNAs. Naturally occurring miRNAs are generally approximately from 15 to 30 nucleotides up to 80-120 nucleotides in length as precursor microRNA.
  • the term "miRNA” generally refers to a single-stranded molecule, but in specific embodiments, may also encompass a region or an additional strand that is partially (between 10 and 50% complementary across the length of the strand), substantially (greater than 50% but less than 100% complementary across length of strand) or fully complementary to another region of the same single-stranded molecule or to another nucleic acid.
  • miRNA may encompass a single-stranded, double-stranded or partially single-stranded molecule.
  • precursor miRNA may have a self-complementary region, which is up to 100% complementary.
  • microRNAs are highly conserved across a number of species while some are species specific. They regulate gene expression post-transcriptionally, primarily by associating with the 3 ' untranslated region (UTR) of their regulatory target mRNAs. MicroRNAs are implicated in cell proliferation, differentiation, and apoptosis, as well as other cellular, molecular, and developmental pathways. It is understood that some miRNA is derived from genomic sequences or a gene. In this respect, the term “gene” is used for simplicity to refer to the genomic sequence encoding the precursor miRNA for a given miRNA. However, some embodiments may involve genomic sequences of a miRNA that are involved in its expression, such as a promoter or other regulatory sequences. The term “recombinant” may be used and this generally refers to a molecule that has been manipulated in vitro or that is a replicated or expressed product of such a molecule.
  • Native miRNAs are regulatory RNAs that act as the recognition component of the complex RNA-induced Silencing Complex (RISC) riboprotein complex.
  • the genes encoding miRNAs are longer than the processed mature miRNA molecule.
  • Genomic microRNAs exist in many different forms, including individual genes, genetic clusters of multiple microRNAs, or encoded within the introns of protein coding genes. miRNAs are first transcribed as primary transcripts or pri-miRNA consisting of RNA transcripts averaging about 1.2 Kb, or within the introns of long protein coding transcripts.
  • Pri-miRs are processed by Drosha enzymes to short, roughly 70 to 120-nucleotide stem-loop structures, known as pre- or precursor miRNA in the cell nucleus. These pre-miRNAs then are processed to mature functional miRNAs in the cytoplasm by interaction with the endonucleases Argonaut, Dicer, and others to produce the RISC complex.
  • MicroRNAs generally inhibit translation or promote mRNA degradation by base-pairing to partially complementary sequences within the 3' untranslated regions (UTRs) of regulatory target mRNAs.
  • UTRs 3' untranslated regions
  • Individual messenger RNAs (mR As) can be targeted by several miRNAs, and a single miRNA can regulate multiple target mRNAs.
  • MicroRNAs can coordinately regulate a set of genes encoding proteins with related functions, providing enormous complexity and the potential of gene regulation.
  • MicroRNAs can be labeled, used in array analysis, or employed in diagnostic, therapeutic, or prognostic applications.
  • the RNA may have been endogenously produced by a cell, or been synthesized or produced chemically or by recombinant technology. They may be isolated and/or purified.
  • Human miRNA molecules often are referenced herein with the prefix "hsa-miR-". Unless otherwise indicated, miRNAs referred to in the application are human sequences, and non-human miRNA sequences can be determined and prepared from these (e.g., for applications in non-human subjects).
  • a miRNA may used that does not correspond to a known human miRNA.
  • one or more nucleotides in an miRNA are substituted with another nucleotide, are a modified base, are deleted and/or are inserted (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides in the miRNA are substituted, are a modified base, are deleted and/or are inserted) relative to an unmodified reference miRNA (e.g., a native miRNA).
  • an unmodified reference miRNA e.g., a native miRNA.
  • the function of such a modified miRNA in vivo or in vitro sometimes is the same as for the reference miRNA, and sometimes is modified (e.g., greater or reduced).
  • a modified function typically is detectable and sometimes is within 100-fold greater (e.g., 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold greater) or 100-fold reduced (e.g., 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold reduced) of the function elicited by a reference miRNA.
  • 100-fold greater e.g., 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold reduced
  • the disclosure is based on assaying the expression of microRNA-31 levels in cells or samples.
  • assaying expression the disclosure contemplates that endogenous expression levels are determined, but also contemplates assaying expression after a therapeutic intervention, in which case a combination of endogenous expression and, in certain embodiments, expression of exogenously introduced nucleic acid may be evaluated.
  • nucleic acid such as miRNA and siRNA, as appropriate. It should be understood that a nucleic acid, including a particular nucleic acid such as miR A-31 may also include nucleic acid modifications. Examples of modifications include alterations to the R A backbone, sugar or base, and various combinations thereof.
  • Any suitable number of backbone linkages, sugars and/or bases in a miR A or other nucleic acid can be modified (e.g., independently about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, up to 100% backbone linkages, sugars and/or bases are modified; or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 backbone linkages, sugars and/or bases are modified).
  • An unmodified miRNA nucleoside is any one of the bases adenine, cytosine, guanine, thymine, or uracil joined to the 1 ' carbon of beta-D-ribo-furanose.
  • a modified base is a nucleotide base other than adenine, guanine, cytosine and uracil at a 1 ' position.
  • modified bases include inosine, purine, pyridin-4-one, pyridin-2- one, phenyl, pseudouracil, 2, 4, 6-trimethoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e. g., 5-methylcytidine), 5-alkyluridines (e. g., ribothymidine), 5- halouridine (e.
  • modified bases include nitropyrrolyl (e.g., 3- nitropyrrolyl), nitroindolyl (e.g., 4-, 5-, 6-nitroindolyl), hypoxanthinyl, isoinosinyl, 2-aza-inosinyl, 7- deaza-inosinyl, nitroimidazolyl, nitropyrazolyl, nitrobenzimidazolyl, nitroindazolyl, aminoindolyl, pyrrolopyrimidinyl, difluorotolyl, 4-fluoro-6-methylbenzimidazole, 4-methylbenzimidazole, 3-methyl isocarbostyrilyl, 5 -methyl isocarbostyrilyl, 3-methyl -7-propynyl isocarbosty
  • a nucleic acid may comprise modified nucleic acid molecules, with phosphate backbone modifications.
  • backbone Non-limiting examples of backbone
  • modifications include phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl modifications.
  • a ribose sugar moiety that naturally occurs in a nucleoside is replaced with a hexose sugar, polycyclic heteroalkyl ring, or cyclohexenyl group.
  • the hexose sugar is an allose, altrose, glucose, mannose, gulose, idose, galactose, talose, or a derivative thereof.
  • the hexose may be a D- hexose, glucose, or mannose.
  • the polycyclic heteroalkyl group may be a bicyclic ring containing one oxygen atom in the ring.
  • the polycyclic heteroalkyl group is a bicyclo[2.2.1 Jheptane, a bicyclo[3.2.1 Joctane, or a bicyclo[3.3. ljnonane.
  • Nitropyrrolyl and nitroindolyl nucleobases are members of a class of compounds known as universal bases. Universal bases are those compounds that can replace any of the four naturally occurring bases without substantially affecting the melting behavior or activity of the oligonucleotide duplex. In contrast to the stabilizing, hydrogen-bonding interactions associated with naturally occurring nucleobases, oligonucleotide duplexes containing 3 -nitropyrrolyl nucleobases may be stabilized solely by stacking interactions. The absence of significant hydrogen-bonding interactions with nitropyrrolyl nucleobases obviates the specificity for a specific complementary base. In addition, 4-, 5- and 6-nitroindolyl display very little specificity for the four natural bases. Procedures for the preparation of l-(2'-0-methykbeta.-D-ribofuranosyl)-5-nitroindole are described in Gaubert, G.;
  • Difluorotolyl is a non-natural nucleobase that functions as a universal base.
  • Difluorotolyl is an isostere of the natural nucleobase thymine. However, unlike thymine, difluorotolyl shows no appreciable selectivity for any of the natural bases.
  • Other aromatic compounds that function as universal bases are 4-fluoro-6-methylbenzimidazole and 4-methylbenzimidazole.
  • isocarbostyrilyl, and 3- methyl-7-propynyl isocarbostyrilyl are universal bases which cause only slight destabilization of oligonucleotide duplexes compared to the oligonucleotide sequence containing only natural bases.
  • nucleobases include 7-azaindolyl, 6-methyl-7-azaindolyl, imidizopyridinyl, 9-methyl-imidizopyridinyl, pyrrolopyrizinyl, isocarbostyrilyl, 7-propynyl isocarbostyrilyl, propynyl-7- azaindolyl, 2,4,5-trimethylphenyl, 4-methylindolyl, 4,6-dimethylindolyl, phenyl, napthalenyl, anthracenyl, phenanthracenyl, pyrenyl, stilbenyl, tetracenyl, pentacenyl, and structural derivates thereof.
  • compositions comprising nucleic acids also include nucleic acids containing modified, i.e. non-naturally occurring internucleoside linkages.
  • non-naturally internucleoside linkages are often selected over naturally occurring forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for other oligonucleotides or nucleic acid targets and increased stability in the presence of nucleases.
  • Oligomeric compounds of the invention can have one or more modified internucleoside linkages. As defined in this
  • oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a
  • a suitable phosphorus-containing modified internucleoside linkage is the
  • Additional modified oligonucleotide backbones (internucleoside linkages) containing a phosphorus atom therein include, for example, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates,
  • Oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof).
  • Various salts, mixed salts and free acid forms are also included.
  • a nucleotide analog may also include a "locked” nucleic acid. Certain compositions can be used to essentially “anchor” or “lock” an endogenous nucleic acid into a particular structure.
  • Anchoring sequences serve to prevent disassociation of a nucleic acid siNA complex, and thus not only can prevent copying but may also enable labeling, modification, and/or cloning of the endogenous sequence.
  • the locked structure may regulate gene expression (i.e. inhibit or enhance transcription or replication), or can be used as a stable structure that can be used to label or otherwise modify the endogenous nucleic acid sequence, or can be used to isolate the endogenous sequence, i.e. for cloning.
  • Nucleic acid molecules need not be limited to those molecules containing only RNA or DNA, but further encompass chemically-modified nucleotides and non-nucleotides.
  • the percent of non- nucleotides or modified nucleotides may be from 1% to 100% (e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% are non-nucleotides or modified nucleotides; or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 non-nucleotides or modified nucleotides in the nucleic acid).
  • a nucleic acid lacks 2'- hydroxyl (2' -OH) containing nucleotides. In certain embodiments a nucleic acid does not require the presence of nucleotides having a 2'- hydroxy group for mediating a function and as such, a nucleic acid may include no
  • nucleic acid molecules e. g., nucleotides having a 2'-OH group.
  • nucleic acid molecules that do not require the presence of ribonucleotides to support a function can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2' -OH groups.
  • nucleic acid molecules can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions.
  • microRNA also referred to herein as "miRNA”
  • biomarkers include miRNA-31 , RhoA and IL-2.
  • the use of biomarkers is discussed in more detail in subsequent sections of the application.
  • the disclosure contemplates detecting protein and/or transcript levels.
  • biomarkers can be detected using probes and primers to detect transcript levels, as well as using antibodies to detect protein levels.
  • the disclosure comprises administration of a composition comprising, as an active ingredient, a nucleic acid comprising a nucleotide sequence.
  • the methods of the disclosure involve administration of exogenous nucleic acid molecules that are expression following introduction into cells.
  • nucleic acids may be appended with one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting oligomeric compounds.
  • such modified nucleic acid compositions are prepared by covalently attaching conjugate groups to functional groups such as hydroxyl or amino groups.
  • Conjugate groups of the disclosure include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the
  • Typical conjugates groups include cholesterols, carbohydrates, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Groups that enhance the pharmacodynamic properties include groups that improve nucleic acid uptake, enhance resistance to degradation, and/or strengthen hybridization with RNA.
  • Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al, Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al, Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al, Bioorg. Med. Chem.
  • lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al, Bioorg. Med. Chem. Let., 1994, 4, 1053-1060),
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al, Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al, J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
  • nucleic acid compounds of the disclosure can have one or more moieties bound or conjugated, which facilitates the active or passive transport, localization, or
  • Cellular localization includes, but is not limited to, localization to within the nucleus, the nucleolus, or the cytoplasm.
  • Compartmentalization includes, but is not limited to, any directed movement to a cellular compartment including the nucleus, nucleolus, mitochondrion, or imbedding into a cellular membrane.
  • compositions of the disclosure may also comprise ribozymes.
  • Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single- stranded nucleic acid, such as an mRNA, to which they have a complementary region.
  • ribozymes e.g., hammerhead ribozymes; described in Haselhoff and Gerlach, 1988, Nature 334:585-591
  • a ribozyme having specificity for a nucleic acid molecule encoding, for example, RhoA can be designed based upon the nucleotide sequence of RhoA.
  • compositions comprising nucleic acids that increase miRNA-31 expression and compositions comprising nucleic acids that decrease RhoA expression.
  • Particularly suitable compositions can be used to increase expression of IL-2. It is understood that some nucleic acid compositions may function to increase endogenous expression of, for example, microRNA-31. However, in certain embodiments, expression of microRNA-31 is increased by exogenously providing to cells microRNA-31 in a form that is capable of being expressed upon introduction into cells, such as set forth in the examples.
  • an exogenously provided molecule that comprises a sequence that, upon expression, mimics that of endogenous microRNA-31 may also be referred to as a microRNA-31 mimic which is also an example of a siNA molecule.
  • a microRNA-31 mimic which is also an example of a siNA molecule.
  • the microRNA-31 mimic comprises an oligonucleotide (single stranded, double stranded, partially double stranded, etc.) comprising a sequence that corresponds to that of naturally occurring human microRNA-31 or pre-microRNA-31.
  • a composition of the disclosure comprises an siNA that inhibits expression of RhoA, such as an siRNA that hybridizes to RhoA.
  • a composition of the disclosure comprises an siNA that increases endogenous expression of microRNA-31.
  • a composition of the disclosure comprises a nucleic acid comprising a nucleotide sequence corresponding to that of microRNA-31 (either the naturally occurring sequence or a modified variant thereof) such that expression of an exogenously supplied nucleic acid increased expression of microRNA-31.
  • Nucleic acid compositions can be isolated, made and/or delivered using well known methods in the art.
  • a composition of the disclosure comprises a nucleic acid that increases microRNA-31 expression or decreases RhoA expression, said nucleic acid being part of an expression vector that expresses the nucleic acid in a suitable host.
  • nucleic acids may have promoters, for example, heterologous promoters, said promoter being inducible or constitutive, and, optionally, tissue-specific.
  • nucleic acids into a subject may be either direct, in which case the subject is directly exposed to the nucleic acid or nucleic acid-carrying vectors, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then transplanted into the subject. These two approaches are known, respectively, as in vivo or ex vivo gene therapy. Thus, in certain embodiments, disclosure includes the use of cellular compositions.
  • Isolated and/or recombinant nucleic acids can be obtained using a number of standard techniques.
  • the miRNA gene products can be chemically synthesized using one of several methods.
  • miRNA gene products are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer.
  • RNA molecules or synthesis reagents include, but are not limited to, Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, III, USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA) and Cruachem (Glasgow, UK).
  • nucleic acids such as miRNA gene products can be expressed from recombinant circular or linear DNA plasmids using any suitable promoter.
  • suitable promoters for expressing RNA from a plasmid include, but are not limited to, the U6 or HI RNA pol III promoter sequences, or the cytomegalovirus promoters.
  • Recombinant plasmids may further comprise inducible or regulatable promoters for expression of the miRNA gene products in cancer cells.
  • Nucleic acid gene products such as miRNA gene products, that are expressed from recombinant plasmids can be isolated from cultured cell expression systems by standard techniques.
  • plasmids suitable for expressing, for example, miRNA gene products methods for inserting nucleic acid sequences into a plasmid to express gene products, and methods of delivering a recombinant plasmid into cells of interest may be considered from numerous publications. See, for example, Zeng et al, Molecular Cell 9: 1327-1333 (2002);
  • miR A gene products can also be expressed from recombinant viral vectors. It is contemplated that the miRNA gene products can be expressed from two separate recombinant viral vectors, or from the same viral vector.
  • the RNA expressed from the recombinant viral vectors can either be isolated from cultured cell expression systems by standard techniques, or can be used directly to infect cells in vitro or in vivo.
  • Recombinant viral vectors may comprise sequences encoding the miRNA gene products and any suitable promoter for expressing the RNA sequences.
  • suitable promoters include, for example, the U6 or HI RNA pol III promoter sequences, or the cytomegalovirus promoters.
  • Any viral vector capable of accepting coding sequences for miRNA gene products can be used, including, but not limited to, vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (e.g., lentiviruses (LV), Rhabdo viruses, murine leukemia virus); herpes virus, and the like.
  • AV adenovirus
  • AAV adeno-associated virus
  • retroviruses e.g., lentiviruses (LV), Rhabdo viruses, murine leukemia virus
  • herpes virus and the like.
  • the tropism of the viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate.
  • Transfection methods for eukaryotic cells include, but are not limited to, direct injection of the nucleic acid into the nucleus or pronucleus of a cell; electroporation; liposome transfer or transfer mediated by lipophilic materials; receptor mediated nucleic acid delivery, bioballistic or particle acceleration; calcium phosphate precipitation, and transfection mediated by viral vectors.
  • cells can be transfected with a liposomal transfer compound (i.e., for example, DOTAP (N-[l-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methylsulfate, Boehringer-Mannheim) or an equivalent, such as Lipofectin.
  • DOTAP N-[l-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methylsulfate, Boehringer-Mannheim
  • Lipofectin i.e., for example, DOTAP (N-[l-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methylsulfate, Boehringer-Mannheim) or an equivalent, such as Lipofectin.
  • the amount of nucleic acid used is not critical to the practice of the invention; acceptable results may be achieved with 0.1-100 micro
  • compositions of the disclosure particularly nucleic acid-based compositions.
  • the composition for use in the claimed methods comprises a nucleic acid comprising or consisting of a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; optionally provided as part of a vector.
  • the nucleic acid comprises a nucleotide sequence which is an
  • compositions of the disclosure include compositions in which the active agent is a polypeptide, such as an antibody, or a small organic molecule. Any of the classes of compounds can be formulated and administered as a
  • composition or as a pharmaceutical composition.
  • Polypeptides and peptide fragments are polypeptides or peptide fragments.
  • Exemplary polypeptides or peptide fragments include wildtype, as well as variant sequences.
  • Variant polypeptides include amino acid sequences at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to a particular wild type polypeptide.
  • nucleic acids comprising nucleotide sequences that encode said
  • nucleic acid as used herein is intended to include fragments as equivalents, wherein such fragments have substantially the same function as the full length nucleic acid sequence from which it is derived.
  • Equivalent nucleotide sequences will include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants; and will, therefore, include sequences that differ from the nucleotide sequence of, for example, the native nucleotide sequence. Equivalent sequences include those that vary from a known wildtype or variant sequence due to the degeneracy of the genetic code.
  • Equivalent sequences may also include nucleotide sequences that hybridize under stringent conditions (i.e., equivalent to about 20-27 °C below the melting temperature (T m ) of the DNA duplex formed in about 1M salt) to the native nucleotide sequence. Further examples of stringent hybridization conditions include a wash step of 0.2X SSC at 65 °C. Equivalent nucleotide sequences will be understood to encode polypeptides which retain the activity of the polypeptide encoded by the native nucleotide sequence.
  • nucleotide sequences for use in the methods described herein also include sequences which are at least 60%> identical to a given nucleotide sequence.
  • the nucleotide sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or
  • Nucleic acids having a sequence that differs from nucleotide sequences which encode a particular polypeptide due to degeneracy in the genetic code are also within the scope of the invention. Such nucleic acids encode functionally equivalent peptides but differ in sequence from wildtype sequences known in the art due to degeneracy in the genetic code. For example, a number of amino acids are designated by more than one triplet. Codons that specify the same amino acid, or synonyms (for example, CAU and CAC each encode histidine) may result in "silent" mutations which do not affect the amino acid sequence. However, it is expected that DNA sequence polymorphisms that do lead to changes in the amino acid sequences will also exist. One skilled in the art will appreciate that these variations in one or more nucleotides (up to about 3-5% of the nucleotides) of the nucleic acids encoding polypeptides may exist among individuals of a given species due to natural allelic variation.
  • Antibodies can have extraordinary affinity and specificity for particular epitopes. Without being bound by theory, antibodies can inhibit or potentiate the activity of proteins and signaling pathways in cells, thereby exerting or inducing a particular affect on cells, tissues, or organisms.
  • Monoclonal or polyclonal antibodies can be made using standard protocols (See, for example, Antibodies: A laboratory manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)).
  • a mammal, such as a mouse, a hamster or rabbit can be immunized with an
  • immunogenic form of a peptide includes conjugation to carriers or other techniques well known in the art.
  • immunogenic portion of a protein can be administered in the presence of adjuvant.
  • the progress of immunization can be monitored by detection of antibody titers in plasma or serum.
  • Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies.
  • antibodies may be immunospecific for a particular protein, may be immunospecific for a particular family of proteins, or may by less immunospecific and cross- react with multiple proteins from related families of proteins.
  • immunospecific do not substantially cross-react with non-homologous protein.
  • substantially cross react is meant that the antibody has a binding affinity for a non-homologous proteins which is at least one order of magnitude, more preferably at least 2 orders of magnitude, and even more preferably at least 3 orders of magnitude less than the binding affinity of the antibody for the protein or proteins for which the antibody is immunospecific.
  • antibodies are also of particular use in diagnostic methods, such as antibodies to detect expression of IL-2 or RhoA.
  • Peptidomimetics In other embodiments, the invention contemplates that the agent is a peptidomimetic. Peptidomimetics are compounds based on, or derived from, peptides and proteins. Peptidomimetics can be obtained by structural modification of the amino acid sequence of a known protein using unnatural amino acids, conformational restraints, isosteric replacement, and the like. The subject peptidomimetics constitute the continuum of structural space between peptides and non-peptide synthetic structures.
  • Exemplary peptidomimetics can have such attributes as being non-hydro lyzable (e.g., increased stability against proteases or other physiological conditions which degrade the corresponding peptide), having increased specificity and/or potency, and having increased cell permeability for intracellular localization.
  • peptide analogs of the present invention can be generated using, for example, benzodiazepines (e.g., see Freidinger et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden,
  • amide bond of peptides.
  • surrogates for the amide bond include the following groups (i) trans-olefms, (ii) fluoroalkene, (iii) methyleneamino, (iv) phosphonamides, and (v) sulfonamides.
  • peptidomimietics based on more substantial modifications of the backbone of a peptide can be used.
  • Peptidomimetics which fall in this category include (i) retro-inverso analogs, and (ii) N-alkyl glycine analogs (so-called peptoids).
  • peptide morphing focuses on the random generation of a library of peptide analogs that comprise a wide range of peptide bond substitutes.
  • the peptidomimetic can be derived as a retro-inverso analog of the peptide.
  • Retro-inverso analogs can be made according to the methods known in the art, such as that described by the Sisto et al. U.S. Patent 4,522,752.
  • sites which are most susceptible to proteolysis are typically altered, with less susceptible amide linkages being optional for mimetic switching.
  • the final product, or intermediates thereof, can be purified by HPLC.
  • the peptidomimetic can be derived as a retro-enatio analog of a peptide.
  • Retro-enantio analogs such as this can be synthesized using commercially available D-amino acids (or analogs thereof) and standard solid- or solution-phase peptide - synthesis techniques.
  • a suitably amino-protected (t-butyloxycarbonyl, Boc) residue (or analog thereof) is covalently bound to a solid support such as chloromethyl resin.
  • the resin is washed with dichloromethane (DCM), and the BOC protecting group removed by treatment with TFA in DCM.
  • the resin is washed and neutralized, and the next Boc-protected D-amino acid is introduced by coupling with
  • DCM dichloromethane
  • trans-olefm derivatives can be made for any of the subject polypeptides.
  • a trans olefin analog can be synthesized according to the method of Y.K. Shue et al. (1987) Tetrahedron Letters 28:3225 and also according to other methods known in the art. It will be appreciated that variations in the cited procedure, or other procedures available, may be necessary according to the nature of the reagent used. It is further possible to couple the pseudodipeptides synthesized by the above method to other pseudodipeptides, to make peptide analogs with several olefmic functionalities in place of amide functionalities.
  • Still another class of peptidomimetic derivatives include phosphonate derivatives.
  • the synthesis of such phosphonate derivatives can be adapted from known synthesis schemes. See, for example, Loots et al. in Peptides: Chemistry and Biology, (Escom Science Publishers, Leiden, 1988, p. 118); Petrillo et al. in Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium, Pierce Chemical Co. Rockland, IL, 1985).
  • the peptidomimetic may incorporate the 1- azabicyclo[4.3.0]nonane surrogate (see Kim et al. (1997) J. Org. Chem. 62:2847), or an N-acyl piperazic acid (see Xi et al. (1998) J. Am. Chem. Soc. 720:80), or a 2-substituted piperazine moiety as a constrained amino acid analogue (see Williams et al. (1996) J. Med. Chem. 3 : 1345- 1348).
  • certain amino acid residues can be replaced with aryl and bi- aryl moieties, e.g., monocyclic or bicyclic aromatic or heteroaromatic nucleus, or a biaromatic, aromatic, heteroaromatic, or biheteroaromatic nucleus.
  • the compound is a small organic or inorganic molecule.
  • Small organic or inorganic molecules can agonize or antagonize the function of a particular protein or class of proteins.
  • small organic or inorganic molecule is meant a carbon contain molecule having a molecular weight less than 5000 amu, preferably less than 2500 amu, more preferably less than 1500 amu, and even more preferably less than 750, 500, or 250 amu.
  • small organic or inorganic molecules can be readily identified by screening libraries of organic molecules and/or chemical compounds to identify those compounds that have a desired function. Alternatively, single compounds or small numbers of candidate compounds can be screened individual or in combination.
  • the small molecule e.g., an inorganic or organic molecule
  • Small molecule inhibitors of RhoA are exemplary of small molecules that can be used in compositions of the disclosure. Several small molecule inhibitors are commercially available. These can themselves be used as agents or used as a starting point for medicinal chemistry to generate additional small molecule RhoA inhibitors.
  • the disclosure provides methods of diagnosing, monitoring and treating autoimmune conditions using any of the compositions of the disclosure. Any of the compositions of the disclosure described herein, may be used in subjects having or suspected of having any of the autoimmune conditions described herein. In certain embodiments, the methods provided herein are based on the correlation between micro R A-31 expression and IL-2 expression in subjects having particular autoimmune conditions.
  • the autoimmune condition is SLE or another autoimmune condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In certain
  • the autoimmune condition is systemic lupus erythematosus, either SLE during a flare or during a period of remission. In other embodiments, the autoimmune condition correlates with decreased expression of IL-2 and/or decreased expression of microRNA-31. In certain embodiments, the symptoms or signs of SLE include lupus nephritis.
  • the subject has another autoimmune condition, such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
  • the other autoimmune condition is rheumatoid arthritis (RA), type I diabetes, or an autoimmune thyroid disease.
  • the other autoimmune condition is scleroderma.
  • the autoimmune condition is correlated with decreased expression of IL-2 relative to healthy subjects.
  • autoimmune conditions including symptoms of these conditions are described below.
  • animal models that are used to evaluate diagnostics and therapeutics for autoimmune conditions. These or other animal models known in the art may be used in developing a composition of the disclosure for use in a method of diagnosis or treatment.
  • treating is meant that administration of a composition over the course of one or more doses, reduces or eliminates one or more symptoms of the condition.
  • symptom is used broadly to refer to signs and symptoms of a condition, whether observable directly by a patient or via medical testing, and also refers to the downstream complications of a disease that may be ameliorated via treatment.
  • SLE Systemic lupus erythematosus
  • Systemic lupus erythematosus is a systemic autoimmune condition that can affect any part of the body. It is a Type III hypersensitivity reaction caused, at least in part, by antibody-immune complex formation.
  • SLE most often harms the heart, joints, skin, lungs, blood vessels, liver, kidneys, and nervous system.
  • the course of the disease is unpredictable, with periods of illness (called flares) alternating with remissions
  • flares periods of illness
  • SLE General symptoms of SLE include: arthritis; fatigue; general discomfort, uneasiness or ill feeling (malaise); joint pain and swelling; muscle aches; nausea and vomiting; and skin rash. Additionally symptoms may also include: abdominal pain; blood in the urine; fingers that change color upon pressure or in the cold; numbness and tingling; and red spots on skin. In some patients, SLE has lung or kidney involvement. In some cases, patients with SLE develop a particular kidney condition called lupus nephritis. The disclosure contemplates that a subject in need may have any one or more of these symptoms, and that therapeutic benefit can be measured based on improvement in any one or more of these symptoms.
  • Dermato logical symptoms are very common, and 30% to 50% of subjects suffer from the classic malar rash, also known as butterfly rash. Some patients may exhibit thick, red scaly patches on the skin (referred to as discoid lupus). Other dermatological manifestations include alopecia; ulcers of the mouth, vagina, nasal tract, and/or urinary tract; skin lesions; and small tears in delicate tissue around the eyes.
  • Musculoskeletal Joint pain is a common symptom of SLE with an estimated 90% of patients reporting joint and/or muscle pain at some time during the course of their illness. A possible association between rheumatoid arthritis and SLE has been suggested.
  • SLE patients Up to 50% of SLE patients are anemic. Additionally, SLE patients appear to have an increased occurrence of antiphospholipid antibody syndrome, a thrombotic disorder
  • Hallmarks of antiphospholipid antibody syndrome include a prolonged partial thromboplastin time and a positive test for antiphospholipid antibodies, and the occurrence of these findings is termed "lupus anticoagulant-positive.”
  • Cardac symptoms of SLE include inflammation of parts of the heart, including the pericardium (pericarditis), the myocardium (myocarditis) and the endocardium (endocarditis).
  • pericarditis pericarditis
  • myocardium myocarditis
  • endocardium endocardium
  • SLE patients often have a variety of symptoms of lung and pleura inflammation. Such inflammation may cause pleuritis, pleural effusion, lupus pneumonitis, chronic diffuse intersititial lung disease, pulmonary hypertension, pulmonary emboli, pulmonary hemorrhage, and shrinking lung syndrome.
  • Lupus nephritis is an inflammation of the kidney, and is a severe complication of systemic lupus erythematosus (SLE). SLE is characterized by spontaneous B and T cell autoreactivity and multiorgan immune injury. In the kidney, lupus nephritis can lead to debilitating loss of function. Patients with lupus nephritis may eventually develop kidney failure and require dialysis or kidney transplantation.
  • the WHO has divided lupus nephritis into five classes based on biopsy results. This classification was defined in 1982 and revised in 1995.
  • Class I is minimal mesangial glomerulonephritis which is histologically normal on light microscopy but with mesangial deposits on electron microscopy.
  • Class II is based on a finding of mesangial proliferative lupus nephritis.
  • Class III is focal proliferative nephritis.
  • Class IV is diffuse proliferative nephritis.
  • Class V is membranous nephritis and is characterized by extreme edema and protein loss.
  • Class VI is glomerulosclerosis.
  • the disclosure contemplates treating patients having lupus nephritis categorized in any of Class I, II, III, IV, V, or VI.
  • the patient has lupus nephritis categorized in Class III or higher, in Class IV or higher, or in Class V or higher.
  • the patient has lupus nephritis categorized as Class VI.
  • Symptoms of lupus nephritis include: blood in the urine, foamy appearance to urine, high blood pressure, protein in the urine, fluid retention, and edema. Other symptoms include signs and symptoms of renal fibrosis and/or kidney failure. If left untreated, lupus nephritis may lead to kidney failure, and even end stage renal disease.
  • Lupus nephritis can be diagnosed and/or monitored using blood or urine tests, as well as by kidney biopsy. Such tests may be used to monitor improvement of symptoms during or following treatment. In certain embodiments, treatment comprises improvement in any one or more of these indica.
  • lupus nephritis can be diagnosed and/or assessed by evaluating blood and/or protein content in the urine. Treating may comprise reducing blood and/or protein content in urine, such as to normal or near normal levels.
  • Lupus nephritis can also be diagnosed and/or assessed by evaluating creatinine and/or urea level in blood, and/or by estimates of glomerular filtration rate based on creatinine score.
  • the American College of Rheumatology defines 19 neuropsychiatric syndromes in systemic lupus erythematosus, and these can occur due to affects on the central and peripheral nervous system.
  • the most common neuropsychiatric disorder in SLE patients is headache.
  • Other common symptoms include cognitive dysfunction, mood disorder, cerebrovascular, seizures, polyneuropathy, anxiety disorder and psychosis. Additional symptoms less commonly observed include acute confusion, Guillain-barre syndrome, aseptic meningitis, autonomic disorder, demyelinating syndrome, mononeuropathy, chorea, myasthenia gravis, myelopathy, cranial neuropathy and plexopathy.
  • NPSLE neuropsychiatric systematic lupus erythematosus
  • thrombocytopenia a renal disorder, particularly protein or cellular casts in the urine; a positive antinuclear antibody test; an immunological disorder, particularly a positive anti-Smith, anti- double stranded DNA or antiphospholipid test; and a neurological disorder, particularly seizures or psychosis.
  • SLE When diagnosing individual patients, a more holistic approach is used. For example, some people with antiphospholipid syndrome may have SLE without four of the above criteria. Moreover, SLE may present with symptoms and features other than those listed in the criteria.
  • the warning signs of an impending flare include increased fatigue, pain, rash, fever, abdominal discomfort, headache, and dizziness. Early recognition of warning signs and good communication with a doctor can help individuals remain active, experience less pain, and reduce medical visits.
  • Treatment can include corticosteroids, anti-malarial drugs, and nonsteroidal anti-inflammatory drugs.
  • Certain types of lupus nephritis require bouts of cytotoxic drugs, including cyclophosphamide and
  • DMARDs Disease-modifying antirheumatic drugs
  • DMARDs Disease-modifying antirheumatic drugs
  • DMARDs commonly in use are antimalarials, such as plaquenil, and immunosuppressants, such as methotexate and azathioprine.
  • Corticosteroids and immunosuppressants are also used to control the disease and prevent flares.
  • the use of steroids may result in Cushing's syndrome and other side-effects.
  • Pain management typically begins with over-the-counter drugs, such as nonsteroidal anti-inflammatories. However, to manage moderate or severe pain, mild or strong opiates may be needed.
  • the disclosure provides methods of treating SLE and/or increasing IL-2 levels in subjects having SLE by administering an effective amount of a composition of the disclosure.
  • Administering a composition of the disclosure can be used to decrease one or more symptoms of SLE and/or to decrease the frequency or severity of flares.
  • administering a composition of the disclosure is used to treat SLE in a patient with lupus nephritis.
  • treating SLE may comprise treating lupus nephritis, such as by reducing symptoms of lupus nephritis.
  • treating comprises treating the skin symptoms of SLE.
  • treating comprises reducing one or more symptoms of lupus nephritis.
  • treating comprises reducing, delaying or eliminating the need for dialysis. In certain embodiments, treating comprises reducing, delaying, or eliminating the need for kidney transplantation. In certain embodiments, treating comprises delaying or preventing progression of lupus nephritis to renal failure or end stage renal disease.
  • compositions of the disclosure may, in certain embodiments, be administered as part of a therapeutic regimen with one or more of: analgesics or other pain management medications (e.g., to help alleviate pain associated with arthritic or other symptoms), anti-inflammatory medications, steroids, immunosuppresant agents, antimalarial agents, and cytotoxic agents.
  • analgesics or other pain management medications e.g., to help alleviate pain associated with arthritic or other symptoms
  • anti-inflammatory medications e.g., to help alleviate pain associated with arthritic or other symptoms
  • steroids e.g., to help alleviate pain associated with arthritic or other symptoms
  • immunosuppresant agents e.g., to help alleviate pain associated with arthritic or other symptoms
  • antimalarial agents e.g., to help alleviate pain associated with arthritic or other symptoms
  • cytotoxic agents e.g., to help alleviate pain associated with arthritic or other symptoms
  • agents and treatment modalities that can be used in combination include diet, exercise, stress management, acupuncture, and physical therapy.
  • Other specific examples include the use of agents and therapies specific for alleviating symptoms of lupus nephritis, such as blood pressure lowering medications, protein, potassium, and/or sodium reduced diets, cytotoxic agents, and/or immunosuppresants.
  • Methods of treatment include treatment in combination with dialysis, kidney transplant, or one or more other therapies for kidney failure.
  • the disease symptoms can be replicated in animal models, and such models are readily used to confirm efficacy of a therapy or combination therapy.
  • many murine models have been developed (Foster, Relevance of Systemic Lupus Erythematosus Nepthritis Animal Models to Human Disease. Semin Nephrol. 1999, 19(1): 12-24).
  • the models make use of host- graft interactions (Bruijn et al., Murine Chronic Graft- Versus-Host Disease as a Model for Lupus Nephritis. Am J Pathol., 1988, 130(3): 639-641), transgenic mice (Takahashi et al, Suppression of Experimental Lupus Nephritis by Aberrant Expression of the Soluble E-Selectin Gene.
  • tissue samples include blood samples, bone marrow samples, and cultures of T cells generated following separation of T cells from blood samples.
  • Diabetes mellitus type 1 (Type 1 diabetes, IDDM, or, formerly, juvenile diabetes) is a form of diabetes mellitus resulting from autoimmune destruction of insulin-producing beta cells of the pancreas. The subsequent lack of insulin leads to increased blood and urine glucose.
  • Classical symptoms are polyuria, polydipsia, polyphagia and weight loss.
  • type 1 diabetes is generally fatal unless treated with insulin, and such treatment must be continued throughout the patient's life time. Even with treatment,
  • compositions of the disclosure can be used in the treatment of type I diabetes and/or to increase IL-2 expression in a subject that has type I diabetes. Without being bound by theory, use of such compositions may help stem the autoimmune attack on pancreatic cells, thus helping to reduce or eliminate the dependence on exogenous insulin. In certain embodiments, compositions of the disclosure are used in combination with insulin, but the use of such compositions reduces the frequency with which insulin injections are required and/or decreases the magnitude of spikes/dips in patient blood glucose levels.
  • the disease symptoms can be replicated in animal models, and such models are readily used to confirm efficacy of a therapy or combination therapy.
  • Rheumatoid arthritis is a long-lasting disease that can affect joints in any part of the body but most commonly the hands, wrists, and knees. With rheumatoid arthritis, the immune system mistakenly attacks itself and causes the joint lining to swell. The inflammation then spreads to the surrounding tissues, and can eventually damage cartilage and bone. In more severe cases, rheumatoid arthritis can affect other areas of the body, such as the skin, eyes, and nerves.
  • Symptoms of rheumatoid arthritis include, but are not limited to, fatigue, fever, rash, joint inflammation, pain, tenderness around the effected joints, stiffness, redness and warmth around the effected joints, and reduced range of motion.
  • Rheumatoid arthritis can occur at any age, but is commonly observed between the ages of 25 and 55. It is 2-3 times more common in women than in men. It is the second most common form of arthritis, affecting 2.1 million people in the U.S. alone.
  • Rheumatoid arthritis in some people may eventually cause the hands and feet to become misshapen as muscles weaken, tendons shrink, and the ends of bones become damaged.
  • Current therapies include medications intended to decrease pain, joint swelling, and inflammation. These medications include non-steroidal anti-inflammatory medicines, corticosteroids, anti-mitotics (methotrexate and cyclophosphamides), and anti-TNFa medications intended to systemically dampen the inflammatory response. Additional treatments include diet, exercise, and physical therapy intended to help maintain muscle strength and range of motion, thereby slowing the disabling effects of the disease.
  • compositions of the disclosure may be administered alone or as part of a therapeutic regimen with other agents useful in decreasing one or more symptoms of rheumatoid arthritis.
  • compositions of the disclosure may be used with analgesics, anti-inflammatories, and rheumatoid arthritis biological agents (e.g., Humira, Simponi, Remicade, etc.).
  • the disease symptoms can be replicated in animal models, and such models are readily used to confirm efficacy of a therapy or combination therapy.
  • BioMedCode Hellas SA makes animal models for inflammatory conditions.
  • Many of the company's models are approved by the FDA for testing potential treatments for RA.
  • Their models include Tgl97 and Tg5433 mice.
  • Additional animal models of arthritis and rheumatoid arthritis include, but are not limited to, the models described in the following publications: Hammer et al, 1990, Cell 63: 1099-1112; Haqqi et al, 1992, PNAS 89: 1253-1255; Keffer et al, 1991, EMBO Journal 10: 4025-4031; Pelletier et al, 1997, Arthritis Rheum 40: 1012-1029; Trentham et al, 1977, Journal of
  • autoimmune thyroiditis which is also known as Hashimoto's thyroiditis or chronic lymphocytic thyroiditis
  • the thyroid gland which is a small gland at the front of the neck, becomes chronically inflamed and decreases production of the thyroid hormones triiodothyronine and thyroxine. Because these hormones are used almost everywhere in the body, autoimmune thyroid diseases can have widespread, serious effects and many symptoms.
  • autoimmune thyroiditis can be symptomless. In more serious cases, however, inflammation of the thyroid can lead to enlargement (goiter). Over time, the thyroid can suffer more damage, leading to symptoms of hypothyroidism (underactive thyroid), such as fatigue, weight gain, body aches, depression, and lethargy. Chronic autoimmune thyroid diseases can progress to significant hypothyroidism.
  • the classification of autoimmune thyroid disease (AITD) includes Hashimoto's thyroiditis (HT) or chronic autoimmune thyroiditis and its variants, Graves' disease (GD) and autoimmune atrophic thyroiditis.
  • HT is characterized by the presence of goiter, thyroid autoantibodies against thyroid peroxidase (TPO) and thyroglobulin (Tg) in serum, and varying degrees of thyroid dysfunction.
  • TPO thyroid peroxidase
  • Tg thyroglobulin
  • Th self-reactive CD4+ T lymphocytes
  • CTL CD8+ T cells
  • TSH-R thyroid-specific cytotoxic T lymphocytes
  • the methods of the present disclosure can be used in the treatment of an autoimmune thyroid disease and/or to increase IL-2 expression in patients with an autoimmune thyroid disease.
  • the methods of the disclosure are used to decrease one or more symptoms of an autoimmune thyroid disease.
  • "treating" is meant to include decreasing or eliminating one or more symptoms of an autoimmune thyroid disease.
  • compositions of the disclosure may be administered alone or as part of a therapeutic regimen with other agents useful in decreasing one or more symptoms of an autoimmune thyroid disease.
  • the disease symptoms can be replicated in animal models, and such models are readily used to confirm efficacy of a therapy or combination therapy.
  • Two exemplary mouse models are described in Volpe et al, 1993, Horm Metab Res 25: 623-627.
  • Scleroderma is a chronic autoimmune disease characterized by fibrosis, vascular alterations, and autoantibodies. There are two major forms: limited systemic scleroderma and diffuse systemic scleroderma. The cutaneous symptoms of limited systemic scleroderma affect the hands, arms and face. Patients with this form of scleroderma frequently have one or more of the following complications: calcinosis, Raynaud's phenomenon, esophageal dysfunction, sclerodactyly, and telangiectasias. Diffuse systemic scleroderma is rapidly progressing and affects a large area of the skin and one or more internal organs, frequently the kidneys, esophagus, heart and/or lungs.
  • Scleroderma affects the small blood vessels known as arterioles, in all organs.
  • arterioles small blood vessels
  • endothelial cells of the arteriole die off apoptotically, along with smooth muscle cells. These cells are replaced by collagen and other fibrous material.
  • Inflammatory cells, particularly CD4+ helper T cells infiltrate the arteriole, and cause further damage.
  • the skin manifestations of scleroderma can be painful, can impair use of the affected area (e.g., use of the hands, fingers, toes, feet, etc.) and can be disfiguring. Skin ulceration may occur, and such ulcers may be prone to infection or even gangrene. The ulcerated skin may be difficult or slow to heal. Difficulty in healing skin ulcerations may be particularly exacerbated in patients with impaired circulation, such as those with Raynaud's phenomenon.
  • the methods of the present disclosure are used to treat scleroderma and/or increase IL-2 expression in patients, for example skin symptoms of scleroderma.
  • treating scleroderma comprises treating skin ulceration, such as digital ulcers.
  • Administration of a composition of the disclosure can be used to reduce the fibrotic and/or inflammatory symptoms of scleroderma in affected tissue and/or organs.
  • treating scleroderma includes treating symptoms of the disease in any one or more of these tissues, such as by reducing fibrotic and/or inflammatory symptoms.
  • the methods of the present disclosure are used to treat scleroderma, for example lung fibrosis associated with scleroderma.
  • Administration of compositions of the disclosure can be used to reduce the fibrotic symptoms of scleroderma in lung.
  • the methods can be used to improve lung function and/or to reduce the risk of death due to scleroderma.
  • the compositions of the disclosure are used to treat scleroderma, for example kidney fibrosis associated with scleroderma.
  • Administration can be used to reduce the fibrotic symptoms of scleroderma in kidney.
  • the methods can be used to improve kidney function, to reduce protein in the urine, to reduce hypertension, and/or to reduce the risk of renal crisis that may lead to fatal renal failure.
  • the methods and compositions of the present disclosure can be used in the treatment of scleroderma.
  • Exemplary symptoms that can be treated include, but are not limited to, pain (including joint pain), swelling, skin ulceration, skin irritation, rash, loss of range of motion, and decreased ability to perform daily tasks.
  • lung function e.g., lung function can be improved
  • kidney function Improvement in any of these symptoms can be measured by, for example, decrease in the number of swollen joints, decrease in the number of painful joints, increased range of motion, increase in healing of ulcerated tissue, decrease in number and/or severity of skin ulcerations, increased ability to perform daily tasks, decreased skin involvement, decreased reliance on pain or other medication, improvement in patient self-assessment of pain or quality of life, increased lung function, decreased
  • methods of treating scleroderma include administering a composition of the disclosure as part of a therapeutic regimen along with one or more other drugs, biologies, or therapeutic interventions appropriate for scleroderma.
  • compositions of the disclosure may be administered as part of a therapeutic regimen along with one or more immunosuppressive agents, such as methotrexate, cyclophosphamide, azathioprine, and mycophenolate.
  • immunosuppressive agents such as methotrexate, cyclophosphamide, azathioprine, and mycophenolate.
  • methods of treatment may include a treatment regimen including a dietary regimen, an exercise regimen, stress management, smoking cessation, acupuncture, massage, and/or physical therapy.
  • the disease symptoms can be replicated in animal models, and such models can be readily used to confirm efficacy of a therapy or combination therapy.
  • Exemplary models include a rodent model in which scleroderma is induced by treatment with cyclosporine A (Damurban et al., Cyclosporine A-Induced Autoimmunity: An Animal Model for Human Scleroderma. J. Experimental Animal Science, 2000, 41(1-2): 22-26) or bleomycin, as well as transgenic mouse models, and graft-versus-host models (Yamamoto, Characteristics of Animal Models for Scleroderma. Current Rheumatology Reviews, 2005, 1 : 101-119; Clark, Animal Models in Scleroderma.
  • compositions of the disclosure may be used in the treatment (e.g., to reduce one or more symptoms of) any of the foregoing conditions or in the treatment of an autoimmune condition associated with dysregulation of IL-2 expression.
  • the disclosure provides diagnostic methods that may be used in vivo and/or in vitro to aid in the diagnosis, monitoring or prognosis of a subject with an autoimmune condition, or can even be used to help refine the dosage of a medication (e.g., including, but not limited to, a medication comprising a composition of the disclosure).
  • a medication e.g., including, but not limited to, a medication comprising a composition of the disclosure.
  • a biomarker selected from one or more (1, 2, 3) of microRNA- 31, RhoA or IL-2 is assayed in a subject being treated with a compound (any compound, including a composition of the disclosure).
  • the assay may be for the presence, absence or amount of a biomarker.
  • Suitable assays include quantitative PCR, ELIZA, and the like that are suitable for detecting transcript or protein expression in samples.
  • Assays may be performed on cells or on samples, such as blood sample. Based on the assay results, one may determine whether to adjust a subsequent dosage or dosing regimen of the compound. For example, if following administration of one or more doses of a microRNA-31 agonizing agent, an increase in IL-2 expression is not observed, it may be beneficial to increase the dosage or frequency of administration to achieve the desired increase in IL-2 expression.
  • the disclosure provides a method of diagnosing an autoimmune condition, such as systemic lupus erythematosus.
  • a sample is obtained from a subject suspected of having an autoimmune condition, such as SLE.
  • This sample may be, for example, a bone marrow sample, a blood sample, or a sample of cells separated from a blood sample. Sample may be isolated at a time when the subject suspected of having the condition is experiencing significant symptoms, as well as during periods where symptoms are less acute.
  • the sample is assayed for expression of microRNA-31 or RhoA, or any one or more of microRNA31 , RhoA, or IL-2.
  • Assays include assays of protein expression and transcript expression.
  • the disclosure provides a method of monitoring treatment of an autoimmune condition, such as systemic lupus erythematosus.
  • an autoimmune condition such as systemic lupus erythematosus.
  • expression of microRNA-31, IL-2, and/or RhoA is detected in a sample of a subject undergoing treatment. This expression is compared to expression of the biomarker in a sample that was obtained from the same subject either prior to initiation of this particular treatment regimen or at an earlier time point during treatment.
  • Comparison of microRNA-31 and/or RhoA and/or IL-2 expression over one or more periods of time provides a way to monitor the progress of the treatment.
  • An increase in microRNA-31 or a decrease in RhoA in a later sample indicates effectiveness of the treatment.
  • an increase in IL-2 in a later sample indicates effectiveness of the treatment.
  • the disclosure provides a method of treating a subject having an autoimmune condition, such as systemic lupus erythematosus.
  • the method comprises comparing expression of microRNA-31 or RhoA from a sample taken from a subject prior to initiation of a particular treatment to a standard range reflecting expression in samples from healthy subjects. If expression of microRNA-31 is below the standard range or expression of RhoA is above the standard range, the subject is identified as potentially suitable for treatment with a composition of the disclosure.
  • the subject is then treated with an effective amount of a composition comprising microRNA-31 , siNA that hybridizes to RhoA, IL-2 protein, or another composition of the disclosure if the subject is determined to be susceptible to treatment.
  • the method further comprises detecting expression of microRNA-31 or RhoA in a post-treatment sample from the same subject, and comparing expression of microRNA-31 or RhoA in the post-treatment sample to expression in the sample taken prior to initiation of the particular treatment.
  • the particular treatment is a microRNA-31 mimic, such as microRNA-31, a siNA that hybridizes to RhoA, or a small molecule inhibitor of RhoA.
  • diagnostic uses can be achieved, for example, by contacting a sample to be tested, optionally along with a control sample, with a reagent appropriate for detecting nucleic acid or protein.
  • the diagnostic assay is performed on a human patient or a sample from a human patient.
  • Suitable diagnostic reagents include, but are not limited to, probes and primers suitable for detecting microRNA-31 or RhoA expression, as well as antibodies suitable for detecting RhoA protein expression. Reagents may be labeled to facilitate detection and quantification in the assay, or detection may rely on the use of secondary reagents.
  • compositions of the disclosure may be used therapeutically, for example, in the treatment of human or non-human subjects. Any of the compositions described herein may be used in the treatment of any of the
  • compositions comprise, as an active ingredient, nucleic acids, polypeptide or small molecule.
  • suitable compositions comprise cellular compositions, such as cells expressing microRNA-31.
  • Exemplary methods include methods comprising contacting cells or administering to subjects a composition that increases expression of microRNA-31 or decreases expression of RhoA.
  • Such compositions can be used to, for example, increase IL-2 expression in a subject having an autoimmune condition.
  • Exemplary compositions comprise a nucleic acid comprising a nucleotide sequence that increases expression of microRNA-31 or a nucleic acid comprising a nucleotide sequence that decreases expression of RhoA.
  • Exemplary conditions that can be treated include, but are not limited to autoimmune conditions, such as SLE or other autoimmune conditions that share a mechanism of action or etiology.
  • the method comprises increasing IL-2 expression in the subjects.
  • compositions comprise, for example, a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
  • Other suitable compositions comprise, for example, a nucleic acid comprising a siNA, a nucleic acid that mimics microRNA- 31 , or an siNA that hybridizes to RhoA.
  • a nucleic acid composition may be single standed, partially double stranded or fully double stranded.
  • administration of the composition increases expression of endogenous microRNA.
  • other embodiments
  • administration of the composition comprises introduction of exogenous microRNA-31 molecules, such as oligonucleotides that express microRNA-31 following introduction into cells.
  • an effective amount is
  • the term "effective amount” refers to the amount of a therapy which is sufficient to reduce and/or ameliorate the severity and/or duration of a disease or disorder; prevent or delay the advancement of said disease or disorder; cause regression of said disease or disorder; prevent or delay the recurrence, development, or onset of one or more symptoms associated with said disease or disorder, or enhance or improve the effect(s) of another therapy. It is understood that measurable signs of effectiveness may not be observable following a single dose.
  • Treating refers to curing as well as ameliorating at least one symptom of the condition or disease, and includes administration of a composition which reduces the frequency of, or delays the onset of, symptoms of a medical condition in a subject.
  • autoimmune conditions can be monitored using methods suitable for the particular condition, such as blood tests, urine samples, self-reports of pain and fatigue, decrease in need for pain medication, X-ray, CT scan, and the like.
  • treatment may be monitored based on assessment of improvement in symptoms, such as decreased pain (e.g., patient requests/uses less pain medication), decreased reliance on supplemental oxygen, improvement in appetite, weight gain, decreased fatigue, increased mobility, and the like.
  • progress and effectiveness of treatment can be monitored using any one or more of the biomarkers microRNA-31 , RhoA or IL-2, as detailed above.
  • compositions of the disclosure are administered as part of a therapeutic regimen with one or more other agents and/or one or more other treatment modalities.
  • suitable other agents and/or treatment modalities may depend on the particular disease, condition of the patient, age of the patient, symptoms, and the like.
  • other suitable treatment modalities include, but are not limited to, surgery, dialysis, insulin therapy, diet, physical therapy, smoking cessation, oxygen therapy, ventilatory support, acupuncture, and the like.
  • other suitable agents include, but are not limited to analgesics, narcotics (such as, for pain
  • anti-inflammatories include anti-inflammatories, immunosuppressants, corticosteroids, antimalarials, and the like. Any one or more of these agents and/or modalities can be used as part of a therapeutic regimen.
  • a therapeutic method further includes an assay step in which expression of microR A-31, RhoA and/or IL-2 is evaluated in the subject following treatment with a composition of the disclosure.
  • assay steps may evaluate RNA or protein expression using suitable methods.
  • Embodiments of the disclosure include sterile pharmaceutical formulations that are useful in the context of administration of compositions to a subject and/or for use in a diagnostic setting. Moreover, various administration and delivery routes and methods may be useful. The disclosure contemplates that any of the formulations and/or routes of administration may be used with any of the compositions of the disclosure. Moreover, the disclosure contemplates that the various formulations and routes of administration may also apply to other agents, such as agents administered as part of a therapeutic regimen.
  • compositions of the present disclosure can be administered by various delivery systems.
  • Methods of administering include, but are not limited to, parenteral administration ⁇ e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous), epidural administration, topical administration, and mucosal administration ⁇ e.g. , intranasal and oral routes). Administration can be systemic or local. Note that when the formulations are administered as part of a combination therapy, the disclosure contemplates that other agents may be administered by the same or different route of administration.
  • compositions of the disclosure comprise a
  • the pharmaceutically acceptable carrier is water for injection, USP, 5% dextrose in water (D5W) or saline.
  • a water-based formulation is employed while in others, it may be lipidbased.
  • a composition comprising an active pharmaceutical agent or a nucleic acid encoding the same is in a water-based formulation.
  • the formulation is lipid based.
  • Solutions of active pharmaceutical agents described herein can be prepared as free base or pharmacologically acceptable salts. Such agents also may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose, in some embodiments. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The form is often sterile and fluid to the extent that easy syringability exists.
  • microorganisms such as bacteria and fungi.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • doses to be employed and the dosing regimen will depend on the route of administration, the specific disease to be treated, the severity of the patient's condition, the particular composition used and the like. Effective doses may be extrapolated from dose- response curves derived from in vitro or animal model test systems.
  • the formulations are pyrogen- free formulations which are substantially free of endotoxins and/or related pyrogenic substances.
  • Endotoxins include toxins that are confined inside a microorganism and are released only when the microorganisms are broken down or die.
  • Pyrogenic substances also include fever-inducing, thermostable substances (glycoproteins) from the outer membrane of bacteria and other microorganisms. Both of these substances can cause fever, hypotension and shock if administered to humans. Due to the potential harmful effects, even low amounts of endotoxins must be removed from intravenously administered pharmaceutical drug solutions.
  • FDA Food & Drug Administration
  • EU endotoxin units
  • the endotoxin and pyrogen levels in the composition are less than 10 EU/mg, or less then 5 EU/mg, or less than 1 EU/mg, or less than 0.1 EU/mg, or less than 0.01 EU/mg, or less than 0.001 EU/mg.
  • a compound (such as a composition of the disclosure or other drug) can be administered to any appropriate subject having a biomarker or needing treatment for a condition described herein.
  • Non- limiting examples of a subject include mammal, human, ape, monkey, ungulate (e.g., equine, bovine, caprine, ovine, porcine, buffalo, camel and the like), canine, feline, rodent and the like.
  • a subject may be male or female, and a drug can be administered to a subject in a particular age group, including, for example, juvenile, pediatric, adolescent, adult, and the like.
  • a composition of the disclosure or other drug in certain embodiments, comprises as an active ingredient an antibody, antibody fragment, single-chain antibody, small molecule, a nucleic acid, nucleic acid derivative, miRNA, siNA, peptide, polypeptide, and the like.
  • Various forms of miRNA or siRNA may be delivered, including post-processed miRNA or siRNA, pre-processed miRNA or siRNA or vector that encodes pre-processed or post-processed miRNA or siRNA.
  • an effective amount of a nucleic acid or an expression construct encoding the same is defined as that amount sufficient to detectably and repeatedly achieve the stated desired result, for example, to ameliorate, reduce, minimize or limit the extent of the disease or its symptoms.
  • an “effective amount” of the pharmaceutical composition generally, is defined as that amount sufficient to detectably and repeatedly achieve the stated desired result, for example, to ameliorate, reduce, minimize or limit the extent of the disease or its symptoms.
  • Drugs are administered in a manner compatible with the dosage formulation, and in such amount as may be therapeutically effective.
  • Injection of nucleic acids may be delivered by syringe or any other method used for injection of a solution, as long as the nucleic acid and any associated components can pass through the particular gauge of needle required for injection.
  • a syringe system has also been described for use in gene therapy that permits multiple injections of predetermined quantities of a solution precisely at any depth (U.S. Pat. No. 5,846,225).
  • compositions of the disclosure comprise a nucleic acid that increases microRNA-31 expression or decreases RhoA expression.
  • Such nucleic acid based compositions may, in certain embodiments, be administered by way of gene therapy.
  • Gene therapy refers to therapy performed by the administration to a subject of an expressed or expressible nucleic acid.
  • the nucleic acids (such as antisense, siRNA or microRNA) are produced and mediate a prophylactic or therapeutic effect.
  • a nucleic acid based composition is presented as part of an expression vector that expresses the nucleic acid in a suitable host.
  • nucleic acids have promoters, for example, heterologous promoters, said promoter being inducible or constitutive, and, optionally, tissue-specific.
  • Delivery of the nucleic acids into a subject may be either direct, in which case the subject is directly exposed to the nucleic acid or nucleic acid-carrying vectors, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then transplanted into the subject.
  • a composition of the disclosure comprises a cellular composition.
  • Suitable vectors include viral vectors.
  • nucleic acids can be administered as naked nucleic acids.
  • nucleic acid based compositions may, in certain embodiments, be administered by way of tansducnon/infection, DEAE-dextran-mediatedtransfection, lipofection, electroporation, and iontophoresis.
  • the disclosure provides a pharmaceutical pack or kit comprising one or more containers filled with a composition of the disclosure.
  • the disclosure provides a pharmaceutical pack or kit suitable for laboratory and/or diagnostic use.
  • the disclosure contemplates that any of the compositions described herein, such as compositions comprising a nucleic acid comprising a nucleotide sequence that increases expression of microRNA-31 or compositions comprising a nucleic acid comprising a nucleotide sequence that decreases expression of RhoA, can be packaged and sold as part of a kit.
  • Exemplary such kits are pharmaceutical kits.
  • the disclosure also provides a pharmaceutical pack or kit comprising in one or more first containers a formulation as described herein and in one or more second containers one or more other prophylactic or therapeutic agents useful for the prevention, management or treatment of an autoimmune condition, such as SLE or an autoimmune condition that has a mechanism of action or etiology similar to SLE (e.g., a condition correlated with decreased expression of IL-2 or a condition that results from misregulation of T cells).
  • an autoimmune condition such as SLE or an autoimmune condition that has a mechanism of action or etiology similar to SLE (e.g., a condition correlated with decreased expression of IL-2 or a condition that results from misregulation of T cells).
  • the formulations of the disclosure are formulated in single dose vials as a sterile formulation.
  • Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the kit may optionally contain a notice indicating appropriate use, safety considerations, and any limitations on use.
  • the kit may optionally comprise one or more other reagents, such as positive or negative control reagents, useful for the particular diagnostic or laboratory use.
  • kits that can be used in the above methods.
  • a kit comprises a composition as described herein, in one or more containers.
  • a kit comprises a composition as described herein, in one or more containers, and one or more other prophylactic or therapeutic agents useful for the prevention, management or treatment of SLE or an autoimmune condition, such as an autoimmune condition that has a mechanism of action or etiology similar to SLE (e.g., a condition correlated with decreased expression of IL-2 or a condition that results from misregulation of T cells).
  • an autoimmune condition that has a mechanism of action or etiology similar to SLE (e.g., a condition correlated with decreased expression of IL-2 or a condition that results from misregulation of T cells).
  • the kit further comprises instructions for preventing, treating, managing or ameliorating a disorder (e.g., using the formulations of the description alone or in combination with another prophylactic or therapeutic agent), as well as side effects and dosage information for such use.
  • a disorder e.g., using the formulations of the description alone or in combination with another prophylactic or therapeutic agent
  • the present disclosure also encompasses a finished packaged and labeled pharmaceutical product.
  • This article of manufacture includes the appropriate unit dosage form in an appropriate vessel or container such as a glass vial or other container that is hermetically sealed.
  • the active ingredient is sterile and suitable for administration.
  • the formulation is suitable for intravenous administration.
  • the unit dosage form is suitable for intravenous, intramuscular, intranasal, oral, topical or subcutaneous delivery.
  • the disclosure encompasses solutions, preferably sterile, suitable for each delivery route.
  • the packaging material and container are designed to protect the stability of the product during storage and shipment.
  • the products of the disclosure include instructions for use or other informational material that advise the physician, technician or patient on how to appropriately prevent or treat the condition in question.
  • the article of manufacture includes instruction means indicating or suggesting a dosing regimen including, but not limited to, actual doses, monitoring procedures, etc., and other monitoring information.
  • the disclosure provides an article of manufacture comprising packaging material, such as a box, bottle, tube, vial, container, sprayer, insufflator, intravenous (i.v.) bag, envelope and the like; and at least one unit dosage form of a pharmaceutical agent contained within said packaging material, wherein said pharmaceutical agent comprises a composition of the disclosure and wherein said packaging material includes instruction means which indicate that said composition can be used to prevent, manage, treat, and/or ameliorate one or more symptoms associated with SLE or another autoimmune condition, such as an autoimmune condition that has a mechanism of action or etiology similar to SLE (e.g., a condition correlated with decreased expression of IL-2 or a condition that results from misregulation of T cells), or one or more symptoms thereof by administering specific doses and using specific dosing regimens as described herein.
  • packaging material such as a box, bottle, tube, vial, container, sprayer, insufflator, intravenous (i.v.) bag, envelope and the like
  • a pharmaceutical agent contained
  • the disclosure also provides an article of manufacture comprising packaging material, such as a box, bottle, tube, vial, container, sprayer, insufflator, intravenous (i.v.) bag, envelope and the like; and at least one unit dosage form of each pharmaceutical agent contained within said packaging material, wherein one pharmaceutical agent comprises a composition of the disclosure and the other pharmaceutical agent comprises a prophylactic or therapeutic agent other than a composition of the disclosure, and wherein said packaging material includes instruction means which indicate that said agents can be used to treat, prevent and/or ameliorate one or more symptoms associated with SLE or another autoimmune condition, such as an autoimmune condition that has a mechanism of action or etiology similar to SLE (e.g., a condition correlated with decreased expression of IL-2 or a condition that results from misregulation of T cells), or one or more symptoms thereof by administering specific doses and using specific dosing regimens as described herein.
  • packaging material such as a box, bottle, tube, vial, container, sprayer, insufflator, intrave
  • the formulations are pyrogen-free formulations which are substantially free of endotoxins and/or related pyrogenic substances.
  • Endotoxins include toxins that are confined inside a microorganism and are released only when the microorganisms are broken down or die.
  • Pyrogenic substances also include fever-inducing, thermostable substances (glycoproteins) from the outer membrane of bacteria and other microorganisms. Both of these substances can cause fever, hypotension and shock if administered to humans. Due to the potential harmful effects, even low amounts of endotoxins must be removed from intravenously administered pharmaceutical drug solutions.
  • the Food & Drug Administration (“FDA”) has set an upper limit of 5 endotoxin units (EU) per dose per kilogram body weight in a single one hour period for intravenous drug applications (The United States Pharmacopeial Convention, Pharmacopeial Forum 26 (1):223 (2000)).
  • EU endotoxin units
  • the endotoxin and pyrogen levels in the composition are less than 10 EU/mg, or less than 5 EU/mg, or less than 1 EU/mg, or less than 0.1 EU/mg, or less than 0.01 EU/mg, or less than 0.001 EU/mg.
  • Example 1 Expression of microRNA-31
  • T cells B cells and monocytes isolated from the PBMCs of three healthy volunteers.
  • FIG. 1A miR-31 was selectively expressed in T cells, suggesting that it might play a role in T cell function.
  • Table 1 Clinical features of patients with SLE
  • a Because some patients were not examined, the number listed for the feature is less than the total number of patients.
  • b The dose of steroids presented in this article is that of prednisone. If other equivalent was taken, the dosage was converted (e.g., 40 mg methylprednisolonewas equivalent to 50 mg prednisone).
  • LN lupus nephritis
  • P/N positive/negative (for the feature listed).
  • T cells from lupus patients display numerous signaling abnormalities which may contribute to the pathogenesis of SLE (Kong et al, 2003; Moulton et al. 2011).
  • the following experiments investigated the role of miR-31 in the skewed expression of T cell-related cytokines in SLE.
  • a microRNA-31 mimic was designed and used to mimic expression of microRNA-31 and an antagomir-31 was designed and used to decrease expression of microRNA-31.
  • Appropriate control oligonucleotides were also used.
  • trans fection of these constructs into primary T cells effectively increased (for the mimic) or decreased (for the antagomir) expression of microRNA-31.
  • TCR engagement affects miR-31 expression
  • CD3 + T lymphocytes freshly purified from healthy donors were stimulated with PMA and ionomycin in a time course study.
  • miR-31 expression was induced after stimulation, reaching a peak around 12 hours.
  • luciferase reporter assay was performed to ask whether miR-31 regulated IL-2 promoter activity.
  • the IL-2 promoter was cloned into a luciferase reporter vector (named IL-2- luc).
  • IL-2- luc a luciferase reporter vector
  • miR-31 increased IL-2 promoter activity and did so in a dose-dependent manner ( Figure 3F).
  • miR-31 To gain insights into the molecular mechanism of how miR-31 regulates IL-2 production, bioinformatic tools were used to identify potential targets of miR-31.
  • the miRGen database www.diana.pcbi. upenn.edu/miRGen/v3/miRGen.html), which integrates analysis from
  • TargetScan PicTar and MiRanda
  • RhoA which has been reported to modulate IL-2 gene expression in T cell activation (Helms et al., 2007)
  • RhoA regulates IL-2 expression in T cells via RhoA
  • RNA interference techniques were used to knockdown RhoA expression.
  • Transfection with RhoA siRNA for 48 hours significantly reduced RhoA mRNA and protein levels, as reflected in Figures 5A and 5B, in a manner similar to that observed following over-expression of the miR-31 mimic.
  • RhoA enhanced the activity of the IL-2 promoter ( Figure 6C).
  • Example 5 Elevated Expression Levels of IL-2 in Activated Lupus T cells
  • miR-31 levels were manipulated to evaluate any affects on IL-2 production in T cells from SLE patients.
  • Lupus T cells were transfected with miR-31 mimic or control mimic.
  • enhanced IL-2 protein expression was observed in activated lupus T cells transfected with miR-31 as shown in Figure 7D. This is consistent with using miR-31 levels to rescue the defects in IL-2 production observed in T cells of lupus patients.
  • a Because some patients were not examined, the number listed for the feature is less than the total number of patients.
  • b The dose of steroids presented in this article is that of prednisone. If other equivalent was taken, the dosage was converted (e.g., 40 mg methylprednisolonewas equivalent to 50 mg prednisone).
  • LN lupus nephritis
  • P/N positive/negative (for the feature listed).
  • SLE activity was assessed with the SLE Disease Activity Index (SLEDAI).
  • SLEDAI SLE Disease Activity Index
  • Peripheral blood samples (10 mL) obtained from each subject were collected in tubes containing acid citrate dextrose formula A (ACD-A). The study was approved by the Research Ethics Board of Renji Hospital, Shanghai JiaoTong University, School of Medicine.
  • PBMCs Peripheral blood mononuclear cells
  • Lymphoprep Ficoll- PaqueTM PLUS GEHealthcare, Chalfont, UK
  • CD3 + T cells were purified from the fresh PBMCs by positive selection using magnetic CD3 microbeads (Miltenyi Biotec) according to the manufacturer's protocol. T lymphocyte purity was > 95% analyzed by FACSCalibur (Becton Dickinson).
  • T lymphocytes were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin, stimulated with PMA (50ng/ml, Sigma-Aldrich) and ionomycin ( ⁇ g/ml, Sigma- Aldrich) for different time at 37 °C under 5% C0 2 .
  • FBS fetal bovine serum
  • PMA 50ng/ml, Sigma-Aldrich
  • ionomycin ⁇ g/ml, Sigma- Aldrich
  • RhoA siRNA sequences referred to in (Ahmed et al., 2005), are as follows: RhoA-siRNA-1 : 5'- AAGATTATGACCGTCTGAGGC-3' (SEQ ID NO: 1); RhoA-siRNA-2: 5'- AAGGATCTTCGGA ATGATGAG-3' (SEQ ID NO: 2).
  • the miRNA-31 mimic sequence is as follows: mimic: 5'- AGGC AAGAUGCUGGC AUAGCU-3 ' (SEQ ID NO: 3).
  • Antagomir-31 and control constructs were ordered from Ribo biology (Guang dong, China).
  • the antagomir-31 sequence is as follows: antagomir: 5'- AGCUAUGCCAGCAUCUUGCCU -3' (SEQ ID NO: 4).
  • the combination of gain-of-function (mimic-induced downregulation of target genes normally inhibited by miRNA-31) and loss-of- function (antagomir-induced upregulation of target genes normally inhibited by miRNA-31) experiments demonstrated the miRNA-target relationships and allowed miRNAs functional analysis.
  • the siRNAs and miRNA-31 mimic used were double stranded molecules and the antagomir was a single stranded molecule.
  • the oligonucleotides were exogenously expressed in cells by transfecting the cells using Lipofectamine 2000 (Invitrogen).
  • RNA normalization of expression values For quantitative RT-PCR analysis of mRNA, 500ng total RNA was reverse-transcribed with the PrimeScript RT reagent Kit (Takara, Shiga, Japan). The cDNA was amplified by real-time PCR with SYBR Green (SYBR Premix Ex Taq RT-PCR kit; Takara, Shiga, Japan), and ribosomal protein L13A (RPL13A) was used as the internal control to normalize the amounts of cDNA. The TaqMan and SYBR Green assays were performed in duplicate on a 7900HT Fast Real-Time PCR instrument (Applied Biosystems). The relative expression levels were calculated using the 2- c method.
  • RPL13A forward 5'- CCTGGAGGAGAAGAGGAAAGAGA-3 ' (SEQ ID NO: 5), reverse 5'- TTGAGGACCTCTGTGTATTTGTCAA-3' (SEQ ID NO: 6).
  • RhoA forward 5'- TCTTCGG AATGATGAGC AC-3 ' (SEQ ID NO : 7), reverse 5 '-
  • CTTTGGTCTTTGCTGAACAC-3' (SEQ ID NO: 8).
  • IL-2 forward 5'- TGCCAC AATGTAC AGGATGC-3 ' (SEQ ID NO: 9), reverse 5'-
  • pGL3 -Basic Luciferase Reporter Vector (Promega) was used for generation of IL-2 promoter reporter constructs. Briefly, the 884bp promoter region (-59 to +825bp bases) was amplified by PCR from genomic DNA, the primers used were: forward 5'-CAT TCATAGTGTCCCAGGTG-3' (SEQ ID NO: 11), reverse 5 '-C ATTGTGGC AGGAGTTGAG-3 ' (SEQ ID NO: 12).
  • pGL3-Basic plasmids containing IL-2 promoter described above, miRNA oligonucleotides or siRNA and with a 50ng pRL-basic-luc vector used for normalization of transfection efficiency, were co-transfected into Jurkat cells using Lipofectamine 2000 (Invitrogen).
  • transfected cells were either left untreated or stimulated for 24 hours with PMA and ionomycin. Then, luciferase activity was assessed using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI), performed on a CENTRO XS 3 LB 960 (Berthold Technologies) instrument according to the manufacturer's protocol. The ratio of Renilla luciferase to firefly luciferase was obtained for each well. All experiments were performed in triplicate.
  • Enzyme-linked immunosorbent assay (ELISA). ELISA for IL-2 protein secreted into the cell culture supernatant was quantified using commercially available kits (Xi Tang Biology, Shanghai, China) according to the manufacturer's protocol. Western blotting. In a 6-well plate, T cells were seeded at 5x 10 6 cells/well and transfected with miRNA oligonucleotides per well for lOOnM final concentration of miR-31 mimics or control mimics and lOOnM final concentration of siRNA RhoA or controls. Six hours after transfection, T cells were added to fresh complete medium. Two days after transfection, cells were lysed and proteins were extracted.
  • SEQ ID NO: 5 (RPL13A forward primer) - CCTGGAGGAGAAGAGGAAAGAGA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Urology & Nephrology (AREA)
  • Dermatology (AREA)
  • Immunology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present disclosure provides methods for treating systemic lupus erythematosus and other autoimmune conditions.

Description

MicroRNA-31 Compositions and Methods for Use in Autoimmune Disease Background
Autoimmune conditions are associated with significant morbidity and, in some cases, mortality. The symptoms of autoimmune conditions may impact the ability to work and otherwise affect the quality of life of patients.
Systemic lupus erythematosus (SLE) is a multifactorial autoimmune condition characterized by chronic activation of the immune system and multiple immunological phenotypes (Fairhurst et al., 2006; Anders et al., 2009). Many of the identified molecular aberrations explain certain established cell and cytokine defects in lupus. T cells from lupus patients display a number of signaling abnormalities (Nambiar et al., 2004; Fujii et al., 2006; Kong et al, 2003; Moulton et al, 2011).
Interleukin-2 (IL-2) is a multifunctional cytokine primarily produced by T cells and is essential for T cell activation, proliferation, and contraction (Lieberman et al., 2010). It has been reported that the production of IL-2 is decreased in SLE T cells and that transcriptional regulators responsible for transcription or suppression of IL-2 production are imbalanced in SLE T cells (Lieberman et al., 2010; Tenbrock et al., 2004; Katsiari et al., 2005; Juang et al., 2005; Herndon et al, 2002; Solomou et al, 2001).
Summary of the Disclosure
There is significant need for improved methods and compositions for use in the diagnosis, management and treatment of autoimmune conditions. The present disclosure provides methods and compositions applicable to the treatment, evaluation, diagnosis, and prognosis of subjects having an autoimmune condition, such as systemic lupus erythematosus. In certain embodiments, the methods provided herein are based on the correlation between microRNA-31 expression and IL-2 expression in subjects.
In a first aspect, the disclosure provides a method of increasing interleukin-2 (IL-2) expression in a subject in need thereof, which subject has an autoimmune condition. Such a method comprises administering to the subject an effective amount of a composition that increases expression of microR A-31 or decreases expression of RhoA. In certain
embodiments, the subject in need thereof is a subject having systemic lupus erythematosus. In other embodiments, the subject in need thereof is a subject having another autoimmune condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
In a second aspect, the disclosure provides a method of increasing interleukin-2 (IL-2) expression in T cells of a subject having an autoimmune condition. Such a method comprises contacting the T cells with an effective amount of a composition that increases expression of microRNA-31 or decreases expression of RhoA. Contacting T cells may be in vivo, such as by administering a composition to a subject. Alternatively, contacting T cells may be in vitro, such as by including a composition in a cell culture media. In certain embodiments, the subject having an autoimmune condition has systemic lupus erythematosus. In other embodiments, the subject in need thereof is a subject having another autoimmune condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
In a third aspect, the disclosure provides a method of treating an autoimmune condition, comprising administering to a subject in need thereof an effective amount of a composition that increases expression of microRNA-31 or decreases expression of RhoA to treat the autoimmune condition. In certain embodiments, the autoimmune condition is systemic lupus erythematosus. In other embodiments, the condition is another autoimmune condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
In a fourth aspect, the disclosure provides a method of decreasing RhoA expression in a subject having an autoimmune condition. Such a method comprises administering to the subject an effective amount of a composition that increases expression of microRNA-31. In certain embodiments, the autoimmune condition is systemic lupus erythematosus. In other
embodiments, the condition is another autoimmune condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In a fifth aspect, the disclosure provides a method of decreasing RhoA expression in T cells of a subject having an autoimmune condition. Such a method comprises contacting the T cells with an effective amount of a composition that increases expression of microRNA-31. Contacting T cells may be in vivo, such as by administering a composition to a subject.
Alternatively, contacting T cells may be in vitro, such as by including a composition in a cell culture media. In certain embodiments, the subject having an autoimmune condition has systemic lupus erythematosus. In other embodiments, the subject in need thereof is a subject having another autoimmune condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
The disclosure contemplates that the following embodiments may be applicable to any of the foregoing aspects of the disclosure and/or any of the following embodiments of the disclosure. In certain embodiments, the subject is a human subject. In other embodiments, the subject is a non-human subject. In certain embodiments, the subject has systemic lupus erythematosus and is experiencing symptoms of a disease flare, such as experiencing symptoms of a disease flare prior to administration of the composition. In other embodiments, the subject has systemic lupus erythematosus and is not experiencing symptoms of a disease flare, such as prior to administration of the composition. In certain embodiments, the symptoms of SLE include lupus nephritis. In certain embodiments, the subject has another autoimmune condition, such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In certain embodiments, the other autoimmune condition is rheumatoid arthritis (RA) or type I diabetes.
In certain embodiments, the T cells contacted or acted on by the composition are activated T cells, such as activated T cells in vitro or in vivo.
In certain embodiments of any of the foregoing, the composition comprises a nucleic acid comprising a nucleotide sequence that increases expression of microRNA-31. In certain embodiments, the composition comprises a nucleic acid comprising a nucleotide sequence that decreases expression of RhoA. In other embodiments, the composition comprises a polypeptide or small organic molecule that increases expression of microRNA-31 and/or decreases expression of RhoA. By increases or decreases expression, the disclosure contemplates embodiments in which transcript and/or protein expression are increased or decreased.
In certain embodiments of any of the foregoing, the composition comprises microRNA- 31 which is exogenously added. Such microRNA-31 may correspond to naturally occurring microRNA-31 or may comprise a synthetic nucleic acid. In certain embodiments, the composition comprises a short interfering nucleic acid (siNA), such as a microRNA, an siRNA or an antisense oligonucleotide. In certain embodiments, the composition comprises an siNA that can hybridize to RhoA.
In certain embodiments of any of the foregoing, decreases expression of RhoA comprises decreases expression of RhoA transcripts. In other embodiments, decreases expression of RhoA comprises decreases expression of RhoA protein. In certain embodiments, increases expression of IL-2 comprises increases expression of IL-2 transcripts. In other embodiments, increases expression of IL-2 comprises increases expression of IL-2 protein.
In certain embodiments of any of the foregoing, the method further comprises one or more assay steps. For example, in certain embodiments, the method further comprises assaying expression of IL-2 in a sample taken from the subject at a time subsequent to administering the composition. In other embodiments, the method further comprises assaying expression of RhoA in a sample taken from the subject at a time subsequent to administering the composition. Such samples may be taken by the same health care provider who or at the same institution where the therapeutic composition is administered, or such samples may be taken by different health care providers and/or at a different institution.
In certain embodiments, the sample used in an assaying step comprises a blood sample. For example, the assay may be performed using whole blood samples or using lymphocytes separated from the blood sample or using serum or some other component of the blood. The relevant sample is prepared based on the particular assay being used. In other embodiments, the sample used in the assaying step comprises a bone marrow sample. Regardless of the sample used for the assaying step, in certain embodiments, assaying expression of IL-2 comprises assaying expression of IL-2 transcripts, such as in T cells. In other embodiments, assaying expression of IL-2 comprises assaying expression of IL-2 protein in the sample. Similarly, regardless of the sample used for the assaying step, in certain embodiments, assaying expression of RhoA comprises assaying expression of RhoA transcripts, such as in T cells. In other embodiments, assaying expression of RhoA comprises assaying expression of RhoA protein in the sample.
In a sixth aspect, the disclosure provides a method. The method comprises assaying the presence, absence or amount of a biomarker in a subject having an autoimmune condition, such as systemic lupus erythematosus, to whom a compound has been administered, wherein the biomarker is selected from microRNA-31, RhoA or IL-2; and determining whether the dosage or dosing regimen of the compound subsequently administered to the subject is adjusted based on the presence, absence or amount of the biomarker assayed. In certain embodiments, the autoimmune condition is systemic lupus erythematosus. In other embodiments, the autoimmune condition shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells.
In certain embodiments, the subject is a human subject. In other embodiments, the subject is a non-human subject. In certain embodiments, the subject has systemic lupus erythematosus and is experiencing symptoms of a disease flare. In other embodiments, the subject has systemic lupus erythematosus and is not experiencing symptoms of a disease flare. In certain embodiments, the symptoms of SLE include lupus nephritis. In certain embodiments, the subject has another autoimmune condition, such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In certain embodiments, the other autoimmune condition is rheumatoid arthritis (RA) or type I diabetes.
In certain embodiments, the sample used for the assaying step comprises a blood sample. For example, an assay may be performed using a whole blood sample or using lymphocytes separated from the blood sample or using serum or some other component of the blood. The relevant sample is prepared based on the particular assay being used. In other embodiments, the sample used comprises a bone marrow sample. Regardless of the sample used for the assaying step, in certain embodiments, assaying expression of IL-2 comprises assaying expression of IL-2 transcripts, such as in T cells. In other embodiments, assaying expression of IL-2 comprises assaying expression of IL-2 protein in the sample. Similarly, regardless of the sample used for the assaying step, in certain embodiments, assaying expression of RhoA comprises assaying expression of RhoA transcripts, such as in T cells. In other embodiments, assaying expression of RhoA comprises assaying expression of RhoA protein in the sample.
In certain embodiments, the compound comprises a steroid or an immunosuppressive agent. In other embodiments, the compound comprises a composition of the present disclosure. In certain embodiments, the compound comprises a composition that increases microRNA-31 expression or decreases RhoA expression. In certain embodiments, the compound comprises IL- 2.
In certain embodiments, the biomarker examined is microRNA-31. In other
embodiments, the biomarker examined is RhoA. In other embodiments, the biomarker examined is IL-2. In still other embodiments, a combination of one or more of the foregoing biomarkers is examined. Biomarkers may be examined at the transcript or protein level.
In a seventh aspect, the disclosure provides a method of diagnosing an autoimmune condition, such as systemic lupus erythematosus. The method comprises obtaining a sample from a subject suspected of having an autoimmune condition, such as systemic lupus
erythematosus; and assaying in the sample expression of microRNA-31 or RhoA.
In certain embodiments, the subject is a human subject. In other embodiments, the subject is a non-human subject. In certain embodiments, the subject has systemic lupus erythematosus and is experiencing symptoms of a disease flare. In other embodiments, the subject has systemic lupus erythematosus and is not experiencing symptoms of a disease flare. In certain embodiments, the symptoms of SLE include lupus nephritis. In certain embodiments, the subject has another autoimmune condition, such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In certain embodiments, the other autoimmune condition is rheumatoid arthritis (RA) or type I diabetes.
In certain embodiments, the sample used for the assaying step comprises a blood sample. For example, an assay may be performed using a whole blood sample or using lymphocytes separated from the blood sample or using serum or some other component of the blood. The relevant sample is prepared based on the particular assay being used. In other embodiments, the sample used comprises a bone marrow sample. Regardless of the sample used for the assaying step, in certain embodiments, assaying expression of IL-2 comprises assaying expression of IL-2 transcripts, such as in T cells. In other embodiments, assaying expression of IL-2 comprises assaying expression of IL-2 protein in the sample. Similarly, regardless of the sample used for the assaying step, in certain embodiments, assaying expression of RhoA comprises assaying expression of RhoA transcripts, such as in T cells. In other embodiments, assaying expression of RhoA comprises assaying expression of RhoA protein in the sample.
In an eighth aspect, the disclosure provides a method of monitoring treatment of an autoimmune condition, such as systemic lupus erythematosus. The method comprises detecting expression of microRNA-31 or RhoA in a sample from a subject undergoing treatment for an autoimmune condition, such as systemic lupus erythematosus; and comparing the expression of microRNA-31 or RhoA to expression in a sample from the same subject obtained prior to the treatment or at an earlier time point during the treatment. In such a method, an increase in microRNA-31 or a decrease in RhoA in a sample obtained at a later point during treatment versus that obtained prior to treatment or at an earlier time point during treatment indicates effectiveness of the treatment, thereby monitoring the treatment.
In certain embodiments, the subject is a human subject. In other embodiments, the subject is a non-human subject. In certain embodiments, the subject has systemic lupus erythematosus and is experiencing symptoms of a disease flare. In other embodiments, the subject has systemic lupus erythematosus and is not experiencing symptoms of a disease flare. In certain embodiments, the symptoms of SLE include lupus nephritis. In certain embodiments, the subject has another autoimmune condition, such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In certain embodiments, the other autoimmune condition is rheumatoid arthritis (RA) or type I diabetes.
In certain embodiments, the sample used for the assaying step comprises a blood sample.
For example, an assay may be performed using a whole blood sample or using lymphocytes separated from the blood sample or using serum or some other component of the blood. The relevant sample is prepared based on the particular assay being used. In other embodiments, the sample used comprises a bone marrow sample. Regardless of the sample used for the assaying step, in certain embodiments, assaying expression of IL-2 comprises assaying expression of IL-2 transcripts, such as in T cells. In other embodiments, assaying expression of IL-2 comprises assaying expression of IL-2 protein in the sample. Similarly, regardless of the sample used for the assaying step, in certain embodiments, assaying expression of RhoA comprises assaying expression of RhoA transcripts, such as in T cells. In other embodiments, assaying expression of RhoA comprises assaying expression of RhoA protein in the sample.
In a ninth aspect, the disclosure provides a method of treating a subject having an autoimmune condition, such as systemic lupus erythematosus. The method comprises comparing expression of microRNA-31 or RhoA from a sample taken from a subject prior to initiation of a particular treatment for the autoimmune condition to a standard range reflecting expression in samples from healthy subjects, wherein expression of microRNA-31 below the standard range or expression of RhoA above the standard range indicates susceptibility to treatment for, for example, systemic lupus erythematosus. The method further comprises treating the subject with an effective amount of a composition comprising microRNA-31, siNA that hybridizes to RhoA or IL-2 protein, or another composition of the disclosure, if the subject is determined to be susceptible to treatment for systemic lupus erythematosus; detecting expression of microRNA-31 or RhoA in a post-treatment sample from the subject; and comparing expression of microRNA-31 or RhoA in the post-treatment sample to expression in the sample taken prior to initiation of the particular treatment.
In certain embodiments, the subject is a human subject. In other embodiments, the subject is a non-human subject. In certain embodiments, the subject has systemic lupus erythematosus and is experiencing symptoms of a disease flare. In other embodiments, the subject has systemic lupus erythematosus and is not experiencing symptoms of a disease flare. In certain embodiments, the symptoms of SLE include lupus nephritis. In certain embodiments, the subject has another autoimmune condition, such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In certain embodiments, the other autoimmune condition is rheumatoid arthritis (RA) or type I diabetes.
In certain embodiments, the sample used for the assaying step comprises a blood sample. For example, an assay may be performed using a whole blood sample or using lymphocytes separated from the blood sample or using serum or some other component of the blood. The relevant sample is prepared based on the particular assay being used. In other embodiments, the sample used comprises a bone marrow sample. Regardless of the sample used for the assaying step, in certain embodiments, assaying expression of IL-2 comprises assaying expression of IL-2 transcripts, such as in T cells. In other embodiments, assaying expression of IL-2 comprises assaying expression of IL-2 protein in the sample. Similarly, regardless of the sample used for the assaying step, in certain embodiments, assaying expression of RhoA comprises assaying expression of RhoA transcripts, such as in T cells. In other embodiments, assaying expression of RhoA comprises assaying expression of RhoA protein in the sample.
The disclosure contemplates that any one or more of the foregoing aspects and embodiments may be combined and/or may be combined with any of the embodiments described in the detailed description and examples.
Brief Description of the Figures and Tables
Figure 1 shows decreased expression of miR-31 in lupus patients as compared with normal control (NC) subjects. (A) miR-31 expression in T cells, B cells and monocytes was determined by the Taqman quantitative PCR. Results are expressed as mean ± SEM, normalized to the expression of B cells from three healthy donors. (B) An independent verification of miR- 31 expression in T cells from 32 lupus patients and 11 normal controls is shown using the Taqman quantitative PCR ( <0.0001). Results above are presented as mean ± SEM. P values were determined by Mann- Whitney U test.
Figure 2 shows the expression of the miR-31. (A) Taqman quantitative PCR analysis of miR-31 expression in activated primary T cells 24 hours post-transfection of miR-31 mimic or control (Ctrl). (B) Taqman quantitative PCR analysis of miR-31 expression in activated primary T cells 24 hours post-transfection of antagomir-31 or control.
Figure 3 presents experimental results showing that miR-31 regulates IL-2 expression and the activity of the IL-2 promoter. (A) Primary T cells were stimulated with PMA and ionomycin and miR-31 levels were measured at different time by the Taqman quantitative PCR. RNU48 levels were used to normalize expression. Each bar is the mean of three independent experiments. (B) Quantitative PCR analysis of IL-2 expression in activated primary T cells 24 hours post-transfection of miR-31 mimic or control mimic (Ctrl) and antagomir-31 or antagomir- control(Ctrl). Histograms show fold changes in mRNA expression with respect to the controls after normalization with the housekeeping gene RPL13A. (C) IL-2 levels in the culture supernatant of activated primary T cells transfected with miR-31 mimic or control mimic and antagomir-31 or antagomir-control were detected by ELISA. Values in B and C are the mean ± SEM for four representative healthy donors. (D) The linear correlation analysis between the expression of IL-2 and miR-31 in activated T cells of patients with lupus (n = 15). (E) Jurkat cells were co-transfected with miR-31 mimic or control mimic and the IL-2 promoter-luc reporter plasmid together, with pGL3-basic-luc used for normalization of transfection. Cells were not stimulated or stimulated with PMA and ionomycin for 24 hours and the relative promoter activity was measured by dual luciferase assay. Each bar is the mean of three independent experiments. (F) miR-31 enhanced the luciferase activity of IL-2 promoter in a dose-dependent manner. Results are from three representative experiments.
**P<0.01;***P<0.001.
Figure 4 presents experimental results identifying miR-31 as a negative regulator of RhoA expression. (A) RhoA mRNA expression levels in activated T lymphocytes transfected with either miR-31 mimic or control mimic were analyzed by RT-PCR. Data are from three independent experiments. Results are presented as mean ± SEM. (B) Immunob lot analysis of RhoA protein expression in T cells (n = 3) 48 hours post transfection of miR-31 mimic or control mimic. (C) The expression of RhoA in T cells from SLE patients (n=32) and normal controls (n=l 1) were measured by RT-PCR. Results above are presented as mean ± SEM. P values were determined by Mann- Whitney U test. (D) The linear correlation analysis between the expression of RhoA and miR-31 in primary T cells of lupus patients (n = 32).
Figure 5 shows the effect of siRNA against RhoA. (A) Quantitative PCR analysis of RhoA expression in primary T cells post-transfection of siRNA-1, siRNA-2 or control. (B) Immunob lot analysis of RhoA expression in primary T cells after the transfection of two siRNAs (siR-1 and siR-2) or control directed against RhoA. Results above are presented as mean ± SEM. P values were determined by Mann- Whitney U test.
Figure 6 presents experimental results showing that siRNA-mediated knockdown of RhoA regulates IL-2 production and the activity of the IL-2 promoter. (A) Quantitative PCR analysis of IL-2 expression in activated primary T cells 24 hours post-transfection of miR-31 mimic or control mimic and two siRNAs. (B) IL-2 levels in the culture supernatant of activated primary T cells transfected with miR-31 mimic, control mimic, or two siRNAs were detected by ELISA. Values in A and B are the mean ± SEM for three representative healthy donors. (C) Dual luciferase assay of Jurkat cells co-transfected with the reporter vectors containing the IL-2 promoter and RhoA siRNA, miR-31 mimic or control mimic with pGL3-basic-luc used for normalization of transfection. The data are shown as relative luciferase activity of miR-31 and siRNA trans fected cells with respect to the controls from three independent experiments.
Figure 7 presents experimental results identifying the roles of miR-31 , RhoA and IL-2 in activated T cells from SLE patients. (A) The expression of miR-31 in activated T cells of 15 SLE patients and 10 normal controls (NC) was detected by the Taqman quantitative PCR. (B) RhoA expression was quantified by RT-PCR in the samples above. (C) IL-2 protein levels in the supernatant of activated T cells from 12 SLE patients and 10 normal controls were measured by ELISA. (D) ELISA analysis of IL-2 expression in the culture supernatant of activated T cells from SLE patients (n=3) post-transfection of miR-31 mimic or control mimic. Results above are presented as mean ± SEM. P values were determined by Mann- Whitney U test.
Table 1 summarizes the clinical features of patients used in the studies presented in Figure IB.
Table 2 summarizes the clinical features of patients used in the studies presented in
Figure 7.
Detailed Description
(i) Overview
Systemic lupus erythematosus (SLE) is a multifactorial autoimmune disorder
characterized by chronic activation of the immune system and multiple immunological phenotypes. The instant disclosure is based in part on the identification of a mechanism in autoimmune disease involving signaling via microRNA-31, RhoA and IL-2.
MicroRNAs (miRNAs) are a class of single-stranded noncoding RNAs that act as key post-transcriptional regulators of gene expression (Denli et al, 2004; Gregory et al, 2004). In animals, miRNAs usually conduct imperfect base pairing with the 3' untranslated region (UTR) of target genes and regulate target gene expression by either translational inhibition, or mRNA degradation (Ambros. 2004).
Without being bound by theory, the instant disclosure is based, in part, on the Examples provided below. The Examples reflect studies in which under-expression of endogenous miR-31 levels was identified in SLE T cells. It was also determined that miR-31 is a positive regulator of IL-2 production in activated T cells, and that RhoA expression is inversely correlated to miR- 31 expression. This regulation appears to occur via regulation of the promoter activity of IL-2. Moreover, the expression of RhoA was significantly higher in lupus T cells compared to healthy volunteers.
(ii) Definitions
Before continuing to describe the present disclosure in further detail, it is to be understood that this disclosure is not limited to specific compositions or process steps, as such may vary. It must be noted that, as used in this specification and the appended claims, the singular form "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei- Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure.
It is convenient to point out here that "and/or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example "A and/or B" is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein.
(iii) Compositions
This section of the specification describes compositions for use in any of the claimed methods. The disclosure contemplates the use of any such compositions of the disclosure, described based on any combination of functional and/or structural features, in any of the methods described herein.
The present disclosure is based in part on the positive and negative correlations and mechanistic links between microRNA-31, RhoA and IL-2. Accordingly, the disclosure provides compositions useful in various methods, in vivo and in vitro, including therapeutic and diagnostic methods. Compositions of the disclosure include compositions comprising, as the active ingredient, nucleic acids, polypeptides, or small organic molecules. Moreover, in certain embodiments, compositions of the disclosure are cellular compositions, such as a composition in which a cell that comprises and expresses a given nucleic acid or polypeptide is administered.
The term "compositions of the disclosure" is used to refer to any such compositions useful in the present methods, including useful in diagnostic or therapeutic methods. Any compositions of the disclosure may be used in any of the methods described herein.
Furthermore, any of the compositions of the disclosure may be described using any of the structural and/or functional features described herein.
Nucleic Acid
A "nucleic acid" as used herein generally refers to a molecule (one, two or more strands) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A," a guanine "G," a thymine "T" or a cytosine "C") or RNA (e.g., an A, a G, an uracil "U" or a C). The term "nucleic acid" encompasses the terms "oligonucleotide" and "polynucleotide," each as a subgenus of the term "nucleic acid." Nucleic acids as provided herein include without limitation microRNA (whether naturally occurring or synthetic), siNA, and antisense RNA. Nucleic acids may, be at least, be at most, or be about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 nucleotides, or any range derivable therein, in length. In certain embodiments, these lengths correspond only to the length of the functional portion of the nucleic acid moiety, but do not include the length of any vector sequence or any conjugate portion. Such lengths cover the lengths of processed miRNA or siNA, miRNA or siNA molecules, precursor miRNA or siNA, miRNA or siNA containing vectors, control nucleic acids, and other molecules, probes and primers. In certain embodiments, regardless of the length of a nucleic acid, it is understood that the molecule does not include the naturally occurring molecule. For example, the exogenously provided molecule differs in, for example, sequence, length, modification, strandedness, or some other property relative to that of an endogenously occurring molecule. In many embodiments, miRNA are 19-24 nucleotides in length, while miRNA precursors are generally between 62 and 110 nucleotides in humans. Nucleic acids herein provided may have regions of identity or complementarity to another nucleic acid. It is contemplated that the region of complementarity or identity can be at least 5 contiguous residues, though it is specifically contemplated that the region, is at least, is at most, or is about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 contiguous nucleotides. In certain embodiments, regardless of the length of nucleic acid molecule used, it is understood that the nucleic acid molecule is a fragment and corresponds to something less that the full length sequence of a naturally occurring molecule.
A nucleic acid may also comprise a vector, including without limitation a plasmid or virus. The vector may code for a pre-processed nucleic acid molecule, or for the mature post- processed molecule (e.g., pre-processed or post-processed miRNA or siRNA).
As provided herein a "synthetic nucleic acid" means that the nucleic acid does not have a chemical structure or sequence of a naturally occurring nucleic acid. Consequently, it is understood that the term "synthetic miRNA" refers to a "synthetic nucleic acid" that is not isolated from a cell and is artificially manufactured, but which may sometimes function in a cell or under physiological conditions.
As used herein "stringent conditions)" or "high stringency" are those conditions that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but preclude hybridization of random sequences. Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are known, and are preferred for applications requiring high selectivity. Non-limiting applications include isolating a nucleic acid, such as a gene or a nucleic acid segment thereof, or detecting at least one specific mRNA transcript or a nucleic acid segment thereof, and the like.
Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.5 M NaCl at temperatures of about 42 °C to about 70 °C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and the presence or concentration of formamide, tetramethylammonium chloride or other solvents) in a hybridization mixture.
It is understood that these ranges, compositions and conditions for hybridization are mentioned by way of non-limiting examples only, and that the desired stringency for a particular hybridization reaction is often determined empirically by comparison to one or more positive or negative controls. Depending on the application envisioned varying conditions of hybridization may be employed to achieve varying degrees of selectivity of a nucleic acid towards a target sequence. In a non-limiting example, identification or isolation of a related target nucleic acid that does not hybridize to a nucleic acid under stringent conditions may be achieved by hybridization at low temperature and/or high ionic strength. Such conditions are termed "low stringency" or "low stringency conditions," and non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 20 °C to about 50 °C. The low or high stringency conditions may be further modified to suit a particular application.
siNA
siNA refers to a class of nucleic acid molecules capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, or epigenetics. For example, siNA molecules can be used to epigenetically silence genes at either or both of the post-transcriptional level and the pre-transcriptional level. In a nonlimiting example, epigenetic regulation of gene expression by siNA molecules of the technology can result from siNA mediated modification of chromatin structure to alter gene expression. Thus, a siNA may be used therapeutically to mediate the level of a polypeptide or protein. This regulation may be direct or indirect, such as by inhibiting expression of a protein that is itself a repressor of a protein of interest.
A siNA may be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, where the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. A siNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, where the antisense and sense strands are self- complementary. In some embodiments, each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure, for example where the double stranded region is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more base pairs.
The antisense strand can comprise a nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand can comprise nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. In some embodiments, a siNA can be assembled from a single oligonucleotide, where the self complementary sense and antisense regions of the siNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s). A siNA can be a polynucleotide with a hairpin secondary structure, having self- complementary sense and antisense regions, where the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. A siNA can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self complementary sense and antisense regions, where the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and where the circular polynucleotide can be processed either in vivo or in vitro to generate an active siNA molecule capable of mediating RNAi.
In some embodiments a siNA comprises two strands of RNA. In certain embodiments a siNA comprises two strands of DNA. A siNA may sometimes be a hybrid, comprising one strand of RNA and one strand of DNA. One or both strands may also comprise mixed RNA and DNA. In some embodiments a strand of a siNA (e.g., a strand of a siRNA) may be about 5 to about 60 nucleotides in length (e.g., about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 4041, 42, 43, 4445 464748, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58 or 59 nucleotides). A siNA strand sometimes may exceed 60 nucleotides.
A siNA may also comprise a single-stranded polynucleotide having a nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (for example, where such siNA molecule does not require the presence within the siNA molecule of nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof), where the single stranded polynucleotide can further comprise a terminal phosphate group, such as a 5 ' -phosphate or 5 ' , 3 ' -diphosphate .
In certain embodiments, a siNA molecule may comprise separate sense and antisense sequences or regions, where the sense and antisense regions are covalently linked by nucleotide or nonnucleotide linker molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic interactions, and/or stacking interactions. In certain embodiments, a siNA molecule comprises a nucleotide sequence that is complementary to nucleotide sequence of a target gene. In some embodiments, the siNA molecule interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.
In some embodiments, one or more nucleotides in an siNA are substituted with another nucleotide, are a modified base, are deleted and/or are inserted (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides in the siNA are substituted, are a modified base, are deleted and/or are inserted) relative to an unmodified reference siNA (e.g., a native siNA). The function of such a modified siNA in vivo or in vitro sometimes is the same as for a reference siNA, and sometimes is modified (e.g., greater or reduced). A modified function typically is detectable and sometimes is within 100-fold greater (e.g., 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold greater) or 100-fold reduced (e.g., 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold reduced) of the function elicited by a reference siNA. In certain embodiments, the methods of the disclosure comprise administering a composition comprising an siNA. In other words, siNA molecules are exogenously added to cells or administered to patients. Such exogenously added siNA molecules are expressed following their introduction. Without being bound by theory, in certain embodiments, the exogenously added siNA molecules help upregulate endogenous expression of a transcript or protein. In other embodiments, expression of a particular molecule is increased by exogenously adding siNA molecules, thereby overexpression of particular molecule is cells.
MicroRNA
MicroRNAs (also referred to interchangeably herein as "miRNAs") are a class of non-coding regulatory RNAs. Naturally occurring miRNAs are generally approximately from 15 to 30 nucleotides up to 80-120 nucleotides in length as precursor microRNA. The term "miRNA" generally refers to a single-stranded molecule, but in specific embodiments, may also encompass a region or an additional strand that is partially (between 10 and 50% complementary across the length of the strand), substantially (greater than 50% but less than 100% complementary across length of strand) or fully complementary to another region of the same single-stranded molecule or to another nucleic acid. Thus, miRNA may encompass a single-stranded, double-stranded or partially single-stranded molecule. For example, precursor miRNA may have a self-complementary region, which is up to 100% complementary.
Many microRNAs are highly conserved across a number of species while some are species specific. They regulate gene expression post-transcriptionally, primarily by associating with the 3 ' untranslated region (UTR) of their regulatory target mRNAs. MicroRNAs are implicated in cell proliferation, differentiation, and apoptosis, as well as other cellular, molecular, and developmental pathways. It is understood that some miRNA is derived from genomic sequences or a gene. In this respect, the term "gene" is used for simplicity to refer to the genomic sequence encoding the precursor miRNA for a given miRNA. However, some embodiments may involve genomic sequences of a miRNA that are involved in its expression, such as a promoter or other regulatory sequences. The term "recombinant" may be used and this generally refers to a molecule that has been manipulated in vitro or that is a replicated or expressed product of such a molecule.
Native miRNAs are regulatory RNAs that act as the recognition component of the complex RNA-induced Silencing Complex (RISC) riboprotein complex. The genes encoding miRNAs are longer than the processed mature miRNA molecule. Genomic microRNAs exist in many different forms, including individual genes, genetic clusters of multiple microRNAs, or encoded within the introns of protein coding genes. miRNAs are first transcribed as primary transcripts or pri-miRNA consisting of RNA transcripts averaging about 1.2 Kb, or within the introns of long protein coding transcripts.
Pri-miRs are processed by Drosha enzymes to short, roughly 70 to 120-nucleotide stem-loop structures, known as pre- or precursor miRNA in the cell nucleus. These pre-miRNAs then are processed to mature functional miRNAs in the cytoplasm by interaction with the endonucleases Argonaut, Dicer, and others to produce the RISC complex.
MicroRNAs generally inhibit translation or promote mRNA degradation by base-pairing to partially complementary sequences within the 3' untranslated regions (UTRs) of regulatory target mRNAs. Individual messenger RNAs (mR As) can be targeted by several miRNAs, and a single miRNA can regulate multiple target mRNAs. MicroRNAs can coordinately regulate a set of genes encoding proteins with related functions, providing enormous complexity and the potential of gene regulation.
MicroRNAs can be labeled, used in array analysis, or employed in diagnostic, therapeutic, or prognostic applications. The RNA may have been endogenously produced by a cell, or been synthesized or produced chemically or by recombinant technology. They may be isolated and/or purified. Human miRNA molecules often are referenced herein with the prefix "hsa-miR-". Unless otherwise indicated, miRNAs referred to in the application are human sequences, and non-human miRNA sequences can be determined and prepared from these (e.g., for applications in non-human subjects).
In some embodiments, a miRNA may used that does not correspond to a known human miRNA.
In some embodiments, one or more nucleotides in an miRNA are substituted with another nucleotide, are a modified base, are deleted and/or are inserted (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides in the miRNA are substituted, are a modified base, are deleted and/or are inserted) relative to an unmodified reference miRNA (e.g., a native miRNA). The function of such a modified miRNA in vivo or in vitro sometimes is the same as for the reference miRNA, and sometimes is modified (e.g., greater or reduced). A modified function typically is detectable and sometimes is within 100-fold greater (e.g., 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold greater) or 100-fold reduced (e.g., 2, 4, 6, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95-fold reduced) of the function elicited by a reference miRNA.
In some embodiments, the disclosure is based on assaying the expression of microRNA-31 levels in cells or samples. When assaying expression, the disclosure contemplates that endogenous expression levels are determined, but also contemplates assaying expression after a therapeutic intervention, in which case a combination of endogenous expression and, in certain embodiments, expression of exogenously introduced nucleic acid may be evaluated.
Nucleic Acid Modification
Any of the modifications described below may be applied to a nucleic acid, such as miRNA and siRNA, as appropriate. It should be understood that a nucleic acid, including a particular nucleic acid such as miR A-31 may also include nucleic acid modifications. Examples of modifications include alterations to the R A backbone, sugar or base, and various combinations thereof. Any suitable number of backbone linkages, sugars and/or bases in a miR A or other nucleic acid can be modified (e.g., independently about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, up to 100% backbone linkages, sugars and/or bases are modified; or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 backbone linkages, sugars and/or bases are modified). An unmodified miRNA nucleoside is any one of the bases adenine, cytosine, guanine, thymine, or uracil joined to the 1 ' carbon of beta-D-ribo-furanose.
A modified base is a nucleotide base other than adenine, guanine, cytosine and uracil at a 1 ' position. Non-limiting examples of modified bases include inosine, purine, pyridin-4-one, pyridin-2- one, phenyl, pseudouracil, 2, 4, 6-trimethoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e. g., 5-methylcytidine), 5-alkyluridines (e. g., ribothymidine), 5- halouridine (e. g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e. g. 6-methyluridine), propyne, and the like. Other non-limiting examples of modified bases include nitropyrrolyl (e.g., 3- nitropyrrolyl), nitroindolyl (e.g., 4-, 5-, 6-nitroindolyl), hypoxanthinyl, isoinosinyl, 2-aza-inosinyl, 7- deaza-inosinyl, nitroimidazolyl, nitropyrazolyl, nitrobenzimidazolyl, nitroindazolyl, aminoindolyl, pyrrolopyrimidinyl, difluorotolyl, 4-fluoro-6-methylbenzimidazole, 4-methylbenzimidazole, 3-methyl isocarbostyrilyl, 5 -methyl isocarbostyrilyl, 3-methyl -7-propynyl isocarbostyrilyl, 7-azaindolyl, 6- methyl-7-azaindolyl, imidizopyridinyl, 9-methyl-imidizopyridinyl, pyrrolopyrizinyl, isocarbostyrilyl, 7-propynyl isocarbostyrilyl, propynyl -7-azaindolyl, 2,4,5- trimethylphenyl, 4-methylindolyl, 4,6- dimethylindolyl, phenyl, napthalenyl, anthracenyl, phenanthracenyl, pyrenyl, stilbenyl, tetracenyl, pentacenyl and the like.
In some embodiments, for example, a nucleic acid may comprise modified nucleic acid molecules, with phosphate backbone modifications. Non-limiting examples of backbone
modifications include phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl modifications. In certain instances, a ribose sugar moiety that naturally occurs in a nucleoside is replaced with a hexose sugar, polycyclic heteroalkyl ring, or cyclohexenyl group. In certain instances, the hexose sugar is an allose, altrose, glucose, mannose, gulose, idose, galactose, talose, or a derivative thereof. The hexose may be a D- hexose, glucose, or mannose. In certain instances, the polycyclic heteroalkyl group may be a bicyclic ring containing one oxygen atom in the ring. In certain instances, the polycyclic heteroalkyl group is a bicyclo[2.2.1 Jheptane, a bicyclo[3.2.1 Joctane, or a bicyclo[3.3. ljnonane.
Nitropyrrolyl and nitroindolyl nucleobases are members of a class of compounds known as universal bases. Universal bases are those compounds that can replace any of the four naturally occurring bases without substantially affecting the melting behavior or activity of the oligonucleotide duplex. In contrast to the stabilizing, hydrogen-bonding interactions associated with naturally occurring nucleobases, oligonucleotide duplexes containing 3 -nitropyrrolyl nucleobases may be stabilized solely by stacking interactions. The absence of significant hydrogen-bonding interactions with nitropyrrolyl nucleobases obviates the specificity for a specific complementary base. In addition, 4-, 5- and 6-nitroindolyl display very little specificity for the four natural bases. Procedures for the preparation of l-(2'-0-methykbeta.-D-ribofuranosyl)-5-nitroindole are described in Gaubert, G.;
Wengel, J. Tetrahedron Letters 2004, 45, 5629. Other universal bases include hypoxanthinyl, isoinosinyl, 2-aza-inosinyl, 7-deaza-inosinyl, nitroimidazolyl, nitropyrazolyl, nitrobenzimidazolyl, nitroindazolyl, aminoindolyl, pyrrolopyrimidinyl, and structural derivatives thereof.
Difluorotolyl is a non-natural nucleobase that functions as a universal base. Difluorotolyl is an isostere of the natural nucleobase thymine. However, unlike thymine, difluorotolyl shows no appreciable selectivity for any of the natural bases. Other aromatic compounds that function as universal bases are 4-fluoro-6-methylbenzimidazole and 4-methylbenzimidazole. In addition, the relatively hydrophobic isocarbostyrilyl derivatives 3 -methyl isocarbostyrilyl, 5 -methyl
isocarbostyrilyl, and 3- methyl-7-propynyl isocarbostyrilyl are universal bases which cause only slight destabilization of oligonucleotide duplexes compared to the oligonucleotide sequence containing only natural bases. Other non-natural nucleobases include 7-azaindolyl, 6-methyl-7-azaindolyl, imidizopyridinyl, 9-methyl-imidizopyridinyl, pyrrolopyrizinyl, isocarbostyrilyl, 7-propynyl isocarbostyrilyl, propynyl-7- azaindolyl, 2,4,5-trimethylphenyl, 4-methylindolyl, 4,6-dimethylindolyl, phenyl, napthalenyl, anthracenyl, phenanthracenyl, pyrenyl, stilbenyl, tetracenyl, pentacenyl, and structural derivates thereof. For a more detailed discussion, including synthetic procedures, of difluorotolyl, 4-fluoro-6- methylbenzimidazole, 4-methylbenzimidazole, and other non-natural bases mentioned above, see: Schweitzer et al, J. Org Chem., 59:7238-7242 (1994).
Compositions comprising nucleic acids also include nucleic acids containing modified, i.e. non-naturally occurring internucleoside linkages. Such non-naturally internucleoside linkages are often selected over naturally occurring forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for other oligonucleotides or nucleic acid targets and increased stability in the presence of nucleases. Oligomeric compounds of the invention can have one or more modified internucleoside linkages. As defined in this
specification, oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a
phosphorus atom.
A suitable phosphorus-containing modified internucleoside linkage is the
phosphorothioate internucleoside linkage. Additional modified oligonucleotide backbones (internucleoside linkages) containing a phosphorus atom therein include, for example, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2 -5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.
A nucleotide analog may also include a "locked" nucleic acid. Certain compositions can be used to essentially "anchor" or "lock" an endogenous nucleic acid into a particular structure.
Anchoring sequences serve to prevent disassociation of a nucleic acid siNA complex, and thus not only can prevent copying but may also enable labeling, modification, and/or cloning of the endogenous sequence. The locked structure may regulate gene expression (i.e. inhibit or enhance transcription or replication), or can be used as a stable structure that can be used to label or otherwise modify the endogenous nucleic acid sequence, or can be used to isolate the endogenous sequence, i.e. for cloning.
Nucleic acid molecules need not be limited to those molecules containing only RNA or DNA, but further encompass chemically-modified nucleotides and non-nucleotides. The percent of non- nucleotides or modified nucleotides may be from 1% to 100% (e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95% are non-nucleotides or modified nucleotides; or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 non-nucleotides or modified nucleotides in the nucleic acid). In certain embodiments, a nucleic acid lacks 2'- hydroxyl (2' -OH) containing nucleotides. In certain embodiments a nucleic acid does not require the presence of nucleotides having a 2'- hydroxy group for mediating a function and as such, a nucleic acid may include no
ribonucleotides (e. g., nucleotides having a 2'-OH group). Such nucleic acid molecules that do not require the presence of ribonucleotides to support a function can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2' -OH groups. Sometimes nucleic acid molecules can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions.
Biomarkers
Provided herein are microRNA (also referred to herein as "miRNA") biomarkers, as well as other biomarkers. Particular biomarkers for use in the subject methods include miRNA-31 , RhoA and IL-2. The use of biomarkers is discussed in more detail in subsequent sections of the application. The disclosure contemplates detecting protein and/or transcript levels. By way of example, biomarkers can be detected using probes and primers to detect transcript levels, as well as using antibodies to detect protein levels.
Conjugates
In certain embodiments, the disclosure comprises administration of a composition comprising, as an active ingredient, a nucleic acid comprising a nucleotide sequence. In other words, in certain embodiments, the methods of the disclosure involve administration of exogenous nucleic acid molecules that are expression following introduction into cells. In certain embodiments, such nucleic acids may be appended with one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting oligomeric compounds. In one embodiment such modified nucleic acid compositions are prepared by covalently attaching conjugate groups to functional groups such as hydroxyl or amino groups. Conjugate groups of the disclosure include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the
pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugates groups include cholesterols, carbohydrates, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties include groups that improve nucleic acid uptake, enhance resistance to degradation, and/or strengthen hybridization with RNA. Groups that enhance the pharmacokinetic properties include groups that improve uptake, distribution, metabolism or excretion. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed Oct. 23, 1992 the entire disclosure of which is incorporated herein by reference. Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al, Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al, Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al, Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al, Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al, EMBO J., 1991, 10, 1111-1118; Kabanov et al, FEBS Lett., 1990, 259, 327-330; Svinarchuk et al, Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-0-hexadecyl-rac-glycero-3-H- phosphonate (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al, Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al, Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al, J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
Furthermore, the nucleic acid compounds of the disclosure can have one or more moieties bound or conjugated, which facilitates the active or passive transport, localization, or
compartmentalization of the oligomeric compound. Cellular localization includes, but is not limited to, localization to within the nucleus, the nucleolus, or the cytoplasm.
Compartmentalization includes, but is not limited to, any directed movement to a cellular compartment including the nucleus, nucleolus, mitochondrion, or imbedding into a cellular membrane.
Ribozymes
The compositions of the disclosure may also comprise ribozymes. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single- stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes; described in Haselhoff and Gerlach, 1988, Nature 334:585-591) can be used to catalytically cleave mRNA transcripts to thereby inhibit translation of the protein encoded by the mRNA. A ribozyme having specificity for a nucleic acid molecule encoding, for example, RhoA, can be designed based upon the nucleotide sequence of RhoA.
Regardless of the particular nucleic acid containing composition used, the disclosure contemplates compositions comprising nucleic acids that increase miRNA-31 expression and compositions comprising nucleic acids that decrease RhoA expression. Particularly suitable compositions can be used to increase expression of IL-2. It is understood that some nucleic acid compositions may function to increase endogenous expression of, for example, microRNA-31. However, in certain embodiments, expression of microRNA-31 is increased by exogenously providing to cells microRNA-31 in a form that is capable of being expressed upon introduction into cells, such as set forth in the examples. Administration of an exogenously provided molecule (single stranded, double stranded, partially double stranded, etc.) that comprises a sequence that, upon expression, mimics that of endogenous microRNA-31 may also be referred to as a microRNA-31 mimic which is also an example of a siNA molecule. In certain
embodiments, the microRNA-31 mimic comprises an oligonucleotide (single stranded, double stranded, partially double stranded, etc.) comprising a sequence that corresponds to that of naturally occurring human microRNA-31 or pre-microRNA-31.
In a specific embodiment, a composition of the disclosure comprises an siNA that inhibits expression of RhoA, such as an siRNA that hybridizes to RhoA. In another embodiment, a composition of the disclosure comprises an siNA that increases endogenous expression of microRNA-31. In other embodiments, a composition of the disclosure comprises a nucleic acid comprising a nucleotide sequence corresponding to that of microRNA-31 (either the naturally occurring sequence or a modified variant thereof) such that expression of an exogenously supplied nucleic acid increased expression of microRNA-31.
Nucleic acid compositions can be isolated, made and/or delivered using well known methods in the art. In one embodiment, a composition of the disclosure comprises a nucleic acid that increases microRNA-31 expression or decreases RhoA expression, said nucleic acid being part of an expression vector that expresses the nucleic acid in a suitable host. In particular, such nucleic acids may have promoters, for example, heterologous promoters, said promoter being inducible or constitutive, and, optionally, tissue-specific. Delivery of nucleic acids into a subject may be either direct, in which case the subject is directly exposed to the nucleic acid or nucleic acid-carrying vectors, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then transplanted into the subject. These two approaches are known, respectively, as in vivo or ex vivo gene therapy. Thus, in certain embodiments, disclosure includes the use of cellular compositions.
Isolated and/or recombinant nucleic acids, such as miRNA gene products, can be obtained using a number of standard techniques. For example, the miRNA gene products can be chemically synthesized using one of several methods. In one method, miRNA gene products are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. Commercial suppliers of synthetic RNA molecules or synthesis reagents include, but are not limited to, Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, III, USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA) and Cruachem (Glasgow, UK).
Alternatively, nucleic acids, such as miRNA gene products can be expressed from recombinant circular or linear DNA plasmids using any suitable promoter. Suitable promoters for expressing RNA from a plasmid include, but are not limited to, the U6 or HI RNA pol III promoter sequences, or the cytomegalovirus promoters. Recombinant plasmids may further comprise inducible or regulatable promoters for expression of the miRNA gene products in cancer cells.
Nucleic acid gene products, such as miRNA gene products, that are expressed from recombinant plasmids can be isolated from cultured cell expression systems by standard techniques.
Selection of plasmids suitable for expressing, for example, miRNA gene products, methods for inserting nucleic acid sequences into a plasmid to express gene products, and methods of delivering a recombinant plasmid into cells of interest may be considered from numerous publications. See, for example, Zeng et al, Molecular Cell 9: 1327-1333 (2002);
Tuschl, Nat. Biotechnol 20:446-448 (2002); Brummelkamp et al, Science 296:550-553 (2002);
Miyagishi et al, Nat. Biotechnol. 20:497-500 ((2002); Paddison et al, Genes Dev. 16:948-958 (2002); Lee et al, Nat. Biotechnol. 20:500-505 (2002); and Paul et al, Nat. Biotechnol. 20:505-
508 (2002), the entire disclosures of which are herein incorporated by reference. miR A gene products can also be expressed from recombinant viral vectors. It is contemplated that the miRNA gene products can be expressed from two separate recombinant viral vectors, or from the same viral vector. The RNA expressed from the recombinant viral vectors can either be isolated from cultured cell expression systems by standard techniques, or can be used directly to infect cells in vitro or in vivo.
Recombinant viral vectors may comprise sequences encoding the miRNA gene products and any suitable promoter for expressing the RNA sequences. Suitable promoters include, for example, the U6 or HI RNA pol III promoter sequences, or the cytomegalovirus promoters.
Any viral vector capable of accepting coding sequences for miRNA gene products (or complementary sequences thereof) can be used, including, but not limited to, vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (e.g., lentiviruses (LV), Rhabdo viruses, murine leukemia virus); herpes virus, and the like. The tropism of the viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate.
Transfection methods for eukaryotic cells include, but are not limited to, direct injection of the nucleic acid into the nucleus or pronucleus of a cell; electroporation; liposome transfer or transfer mediated by lipophilic materials; receptor mediated nucleic acid delivery, bioballistic or particle acceleration; calcium phosphate precipitation, and transfection mediated by viral vectors.
For example, cells can be transfected with a liposomal transfer compound (i.e., for example, DOTAP (N-[l-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methylsulfate, Boehringer-Mannheim) or an equivalent, such as Lipofectin. The amount of nucleic acid used is not critical to the practice of the invention; acceptable results may be achieved with 0.1-100 micrograms of nucleic acid/10. sup.5 cells. For example, a ratio of about 0.5 micrograms of plasmid vector in 3 micrograms of DOTAP per 105.
The foregoing provides detailed description of compositions of the disclosure, particularly nucleic acid-based compositions. In certain embodiments, the composition for use in the claimed methods comprises a nucleic acid comprising or consisting of a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; optionally provided as part of a vector. In certain embodiments, the nucleic acid comprises a nucleotide sequence which is an
oligonucleotide, such as an siNA molecule, that corresponds to a functional portion of a naturally occurring nucleic acid sequence. Additionally, compositions of the disclosure include compositions in which the active agent is a polypeptide, such as an antibody, or a small organic molecule. Any of the classes of compounds can be formulated and administered as a
composition or as a pharmaceutical composition.
Polypeptides and peptide fragments: In certain embodiments, the compounds are polypeptides or peptide fragments. Exemplary polypeptides or peptide fragments include wildtype, as well as variant sequences. Variant polypeptides include amino acid sequences at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to a particular wild type polypeptide.
In addition to polypeptides and peptide fragments, the present invention also
contemplates isolated nucleic acids comprising nucleotide sequences that encode said
polypeptides and fragments. The term nucleic acid as used herein is intended to include fragments as equivalents, wherein such fragments have substantially the same function as the full length nucleic acid sequence from which it is derived. Equivalent nucleotide sequences will include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants; and will, therefore, include sequences that differ from the nucleotide sequence of, for example, the native nucleotide sequence. Equivalent sequences include those that vary from a known wildtype or variant sequence due to the degeneracy of the genetic code.
Equivalent sequences may also include nucleotide sequences that hybridize under stringent conditions (i.e., equivalent to about 20-27 °C below the melting temperature (Tm) of the DNA duplex formed in about 1M salt) to the native nucleotide sequence. Further examples of stringent hybridization conditions include a wash step of 0.2X SSC at 65 °C. Equivalent nucleotide sequences will be understood to encode polypeptides which retain the activity of the polypeptide encoded by the native nucleotide sequence.
Equivalent nucleotide sequences for use in the methods described herein also include sequences which are at least 60%> identical to a given nucleotide sequence. In another embodiment, the nucleotide sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or
100%) identical to the nucleotide sequence of a native sequence.
Nucleic acids having a sequence that differs from nucleotide sequences which encode a particular polypeptide due to degeneracy in the genetic code are also within the scope of the invention. Such nucleic acids encode functionally equivalent peptides but differ in sequence from wildtype sequences known in the art due to degeneracy in the genetic code. For example, a number of amino acids are designated by more than one triplet. Codons that specify the same amino acid, or synonyms (for example, CAU and CAC each encode histidine) may result in "silent" mutations which do not affect the amino acid sequence. However, it is expected that DNA sequence polymorphisms that do lead to changes in the amino acid sequences will also exist. One skilled in the art will appreciate that these variations in one or more nucleotides (up to about 3-5% of the nucleotides) of the nucleic acids encoding polypeptides may exist among individuals of a given species due to natural allelic variation.
Antibodies: Exemplary compounds also include antibodies. Antibodies can have extraordinary affinity and specificity for particular epitopes. Without being bound by theory, antibodies can inhibit or potentiate the activity of proteins and signaling pathways in cells, thereby exerting or inducing a particular affect on cells, tissues, or organisms.
Monoclonal or polyclonal antibodies can be made using standard protocols (See, for example, Antibodies: A laboratory manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)). A mammal, such as a mouse, a hamster or rabbit can be immunized with an
immunogenic form of a peptide. Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art. An
immunogenic portion of a protein can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies. We note that antibodies may be immunospecific for a particular protein, may be immunospecific for a particular family of proteins, or may by less immunospecific and cross- react with multiple proteins from related families of proteins. Antibodies which are
immunospecific do not substantially cross-react with non-homologous protein. By not substantially cross react is meant that the antibody has a binding affinity for a non-homologous proteins which is at least one order of magnitude, more preferably at least 2 orders of magnitude, and even more preferably at least 3 orders of magnitude less than the binding affinity of the antibody for the protein or proteins for which the antibody is immunospecific.
Note that antibodies are also of particular use in diagnostic methods, such as antibodies to detect expression of IL-2 or RhoA.
Peptidomimetics : In other embodiments, the invention contemplates that the agent is a peptidomimetic. Peptidomimetics are compounds based on, or derived from, peptides and proteins. Peptidomimetics can be obtained by structural modification of the amino acid sequence of a known protein using unnatural amino acids, conformational restraints, isosteric replacement, and the like. The subject peptidomimetics constitute the continuum of structural space between peptides and non-peptide synthetic structures.
Exemplary peptidomimetics can have such attributes as being non-hydro lyzable (e.g., increased stability against proteases or other physiological conditions which degrade the corresponding peptide), having increased specificity and/or potency, and having increased cell permeability for intracellular localization. For illustrative purposes, peptide analogs of the present invention can be generated using, for example, benzodiazepines (e.g., see Freidinger et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden,
Netherlands, 1988), substituted gama lactam rings (Garvey et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988, pl23), C-7 mimics (Huffman et al. in Peptides: Chemistry and Biologyy, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988, p. 105), keto-methylene pseudopeptides (Ewenson et al. (1986) J Med Chem 29:295; and Ewenson et al. in Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985), β-turn dipeptide cores (Nagai et al. (1985) Tetrahedron Lett 26:647; and Sato et al. (1986) J Chem Soc Perkin Trans 1 : 1231), β-aminoalcohols (Gordon et al. (1985) Biochem Biophys Res Communl26:4l9; and Dann et al. (1986) Biochem Biophys Res Commun 134:71), diaminoketones (Natarajan et al. (1984) Biochem Biophys Res Commun 124: 141), and methyleneamino-modifed (Roark et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988, pl34). Also, see generally, Session III: Analytic and synthetic methods, in in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988)
In addition to a variety of sidechain replacements which can be carried out to generate the subject peptidomimetics, the present invention specifically contemplates the use of
conformationally restrained mimics of peptide secondary structure. Numerous surrogates have been developed for the amide bond of peptides. Frequently exploited surrogates for the amide bond include the following groups (i) trans-olefms, (ii) fluoroalkene, (iii) methyleneamino, (iv) phosphonamides, and (v) sulfonamides. Additionally, peptidomimietics based on more substantial modifications of the backbone of a peptide can be used. Peptidomimetics which fall in this category include (i) retro-inverso analogs, and (ii) N-alkyl glycine analogs (so-called peptoids).
Furthermore, the methods of combinatorial chemistry are being brought to bear, e.g., PCT publication WO 99/48897, on the development of new peptidomimetics. For example, one embodiment of a so-called "peptide morphing" strategy focuses on the random generation of a library of peptide analogs that comprise a wide range of peptide bond substitutes.
In an exemplary embodiment, the peptidomimetic can be derived as a retro-inverso analog of the peptide. Retro-inverso analogs can be made according to the methods known in the art, such as that described by the Sisto et al. U.S. Patent 4,522,752. As a general guide, sites which are most susceptible to proteolysis are typically altered, with less susceptible amide linkages being optional for mimetic switching. The final product, or intermediates thereof, can be purified by HPLC.
In another illustrative embodiment, the peptidomimetic can be derived as a retro-enatio analog of a peptide. Retro-enantio analogs such as this can be synthesized using commercially available D-amino acids (or analogs thereof) and standard solid- or solution-phase peptide - synthesis techniques. For example, in a preferred solid-phase synthesis method, a suitably amino-protected (t-butyloxycarbonyl, Boc) residue (or analog thereof) is covalently bound to a solid support such as chloromethyl resin. The resin is washed with dichloromethane (DCM), and the BOC protecting group removed by treatment with TFA in DCM. The resin is washed and neutralized, and the next Boc-protected D-amino acid is introduced by coupling with
diisopropylcarbodiimide. The resin is again washed, and the cycle repeated for each of the remaining amino acids in turn. When synthesis of the protected retro-enantio peptide is complete, the protecting groups are removed and the peptide cleaved from the solid support by treatment with hydrofluoric acid/anisole/dimethyl sulfide/thioanisole. The final product is purified by HPLC to yield the pure retro-enantio analog.
In still another illustrative embodiment, trans-olefm derivatives can be made for any of the subject polypeptides. A trans olefin analog can be synthesized according to the method of Y.K. Shue et al. (1987) Tetrahedron Letters 28:3225 and also according to other methods known in the art. It will be appreciated that variations in the cited procedure, or other procedures available, may be necessary according to the nature of the reagent used. It is further possible to couple the pseudodipeptides synthesized by the above method to other pseudodipeptides, to make peptide analogs with several olefmic functionalities in place of amide functionalities.
Still another class of peptidomimetic derivatives include phosphonate derivatives. The synthesis of such phosphonate derivatives can be adapted from known synthesis schemes. See, for example, Loots et al. in Peptides: Chemistry and Biology, (Escom Science Publishers, Leiden, 1988, p. 118); Petrillo et al. in Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium, Pierce Chemical Co. Rockland, IL, 1985).
Many other peptidomimetic structures are known in the art and can be readily adapted for use in designing peptidomimetics. To illustrate, the peptidomimetic may incorporate the 1- azabicyclo[4.3.0]nonane surrogate (see Kim et al. (1997) J. Org. Chem. 62:2847), or an N-acyl piperazic acid (see Xi et al. (1998) J. Am. Chem. Soc. 720:80), or a 2-substituted piperazine moiety as a constrained amino acid analogue (see Williams et al. (1996) J. Med. Chem. 3 : 1345- 1348). In still other embodiments, certain amino acid residues can be replaced with aryl and bi- aryl moieties, e.g., monocyclic or bicyclic aromatic or heteroaromatic nucleus, or a biaromatic, aromatic, heteroaromatic, or biheteroaromatic nucleus.
Small organic or inorganic molecules: In certain embodiments, the compound is a small organic or inorganic molecule. Small organic or inorganic molecules can agonize or antagonize the function of a particular protein or class of proteins. By small organic or inorganic molecule is meant a carbon contain molecule having a molecular weight less than 5000 amu, preferably less than 2500 amu, more preferably less than 1500 amu, and even more preferably less than 750, 500, or 250 amu.
Small organic or inorganic molecules can be readily identified by screening libraries of organic molecules and/or chemical compounds to identify those compounds that have a desired function. Alternatively, single compounds or small numbers of candidate compounds can be screened individual or in combination. In certain embodiments, the small molecule (e.g., an inorganic or organic molecule) is a non-peptidyl compound containing two or fewer, one or fewer, or no peptide and/or saccharide linkages.
Small molecule inhibitors of RhoA are exemplary of small molecules that can be used in compositions of the disclosure. Several small molecule inhibitors are commercially available. These can themselves be used as agents or used as a starting point for medicinal chemistry to generate additional small molecule RhoA inhibitors.
(iv) Autoimmune Conditions
The disclosure provides methods of diagnosing, monitoring and treating autoimmune conditions using any of the compositions of the disclosure. Any of the compositions of the disclosure described herein, may be used in subjects having or suspected of having any of the autoimmune conditions described herein. In certain embodiments, the methods provided herein are based on the correlation between micro R A-31 expression and IL-2 expression in subjects having particular autoimmune conditions. In certain embodiments, the autoimmune condition is SLE or another autoimmune condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In certain
embodiments, the autoimmune condition is systemic lupus erythematosus, either SLE during a flare or during a period of remission. In other embodiments, the autoimmune condition correlates with decreased expression of IL-2 and/or decreased expression of microRNA-31. In certain embodiments, the symptoms or signs of SLE include lupus nephritis.
In certain embodiments, the subject has another autoimmune condition, such as a condition that shares one or more features with SLE, such as a shared mechanism of action, etiology, correlation with IL-2 dysregulation, or correlation with misregulation of T cells, particularly misregulation of regulatory T cells. In certain embodiments, the other autoimmune condition is rheumatoid arthritis (RA), type I diabetes, or an autoimmune thyroid disease. In certain embodiments, the other autoimmune condition is scleroderma. In certain embodiments, the autoimmune condition is correlated with decreased expression of IL-2 relative to healthy subjects.
Exemplary autoimmune conditions, including symptoms of these conditions are described below. Also provided are a few examples of animal models that are used to evaluate diagnostics and therapeutics for autoimmune conditions. These or other animal models known in the art may be used in developing a composition of the disclosure for use in a method of diagnosis or treatment. By "treating" is meant that administration of a composition over the course of one or more doses, reduces or eliminates one or more symptoms of the condition. As used herein, the term "symptom" is used broadly to refer to signs and symptoms of a condition, whether observable directly by a patient or via medical testing, and also refers to the downstream complications of a disease that may be ameliorated via treatment.
Systemic lupus erythematosus (SLE)
Systemic lupus erythematosus, often abbreviated to SLE, is a systemic autoimmune condition that can affect any part of the body. It is a Type III hypersensitivity reaction caused, at least in part, by antibody-immune complex formation.
SLE most often harms the heart, joints, skin, lungs, blood vessels, liver, kidneys, and nervous system. The course of the disease is unpredictable, with periods of illness (called flares) alternating with remissions The disease occurs nine times more often in women than in men, especially in women of child-bearing ages.
There is currently no cure for SLE, and management of symptoms has generally been limited to the use of general immunosuppression, such as with cyclophosphamide,
corticosteroids and other immunosuppresants.
General symptoms of SLE include: arthritis; fatigue; general discomfort, uneasiness or ill feeling (malaise); joint pain and swelling; muscle aches; nausea and vomiting; and skin rash. Additionally symptoms may also include: abdominal pain; blood in the urine; fingers that change color upon pressure or in the cold; numbness and tingling; and red spots on skin. In some patients, SLE has lung or kidney involvement. In some cases, patients with SLE develop a particular kidney condition called lupus nephritis. The disclosure contemplates that a subject in need may have any one or more of these symptoms, and that therapeutic benefit can be measured based on improvement in any one or more of these symptoms.
Dermatological manifestations
Dermato logical symptoms are very common, and 30% to 50% of subjects suffer from the classic malar rash, also known as butterfly rash. Some patients may exhibit thick, red scaly patches on the skin (referred to as discoid lupus). Other dermatological manifestations include alopecia; ulcers of the mouth, vagina, nasal tract, and/or urinary tract; skin lesions; and small tears in delicate tissue around the eyes.
Musculoskeletal Joint pain is a common symptom of SLE with an estimated 90% of patients reporting joint and/or muscle pain at some time during the course of their illness. A possible association between rheumatoid arthritis and SLE has been suggested.
Hematological
Up to 50% of SLE patients are anemic. Additionally, SLE patients appear to have an increased occurrence of antiphospholipid antibody syndrome, a thrombotic disorder
characterized by the presence of autoantibodies to phospholipids in the serum. Hallmarks of antiphospholipid antibody syndrome include a prolonged partial thromboplastin time and a positive test for antiphospholipid antibodies, and the occurrence of these findings is termed "lupus anticoagulant-positive."
Cardiac
Cardac symptoms of SLE include inflammation of parts of the heart, including the pericardium (pericarditis), the myocardium (myocarditis) and the endocardium (endocarditis). Atherosclerosis tends to occur more frequently in SLE patients and, when present, advances more rapidly than observed in the general population.
Pulmonary
SLE patients often have a variety of symptoms of lung and pleura inflammation. Such inflammation may cause pleuritis, pleural effusion, lupus pneumonitis, chronic diffuse intersititial lung disease, pulmonary hypertension, pulmonary emboli, pulmonary hemorrhage, and shrinking lung syndrome.
Renal
Lupus nephritis is an inflammation of the kidney, and is a severe complication of systemic lupus erythematosus (SLE). SLE is characterized by spontaneous B and T cell autoreactivity and multiorgan immune injury. In the kidney, lupus nephritis can lead to debilitating loss of function. Patients with lupus nephritis may eventually develop kidney failure and require dialysis or kidney transplantation.
The WHO has divided lupus nephritis into five classes based on biopsy results. This classification was defined in 1982 and revised in 1995. Class I is minimal mesangial glomerulonephritis which is histologically normal on light microscopy but with mesangial deposits on electron microscopy. Class II is based on a finding of mesangial proliferative lupus nephritis. Class III is focal proliferative nephritis. Class IV is diffuse proliferative nephritis. Class V is membranous nephritis and is characterized by extreme edema and protein loss. Class VI is glomerulosclerosis. The disclosure contemplates treating patients having lupus nephritis categorized in any of Class I, II, III, IV, V, or VI. In certain embodiments, the patient has lupus nephritis categorized in Class III or higher, in Class IV or higher, or in Class V or higher. In certain embodiments, the patient has lupus nephritis categorized as Class VI.
Symptoms of lupus nephritis include: blood in the urine, foamy appearance to urine, high blood pressure, protein in the urine, fluid retention, and edema. Other symptoms include signs and symptoms of renal fibrosis and/or kidney failure. If left untreated, lupus nephritis may lead to kidney failure, and even end stage renal disease.
Lupus nephritis can be diagnosed and/or monitored using blood or urine tests, as well as by kidney biopsy. Such tests may be used to monitor improvement of symptoms during or following treatment. In certain embodiments, treatment comprises improvement in any one or more of these indica. By way of example, lupus nephritis can be diagnosed and/or assessed by evaluating blood and/or protein content in the urine. Treating may comprise reducing blood and/or protein content in urine, such as to normal or near normal levels. Lupus nephritis can also be diagnosed and/or assessed by evaluating creatinine and/or urea level in blood, and/or by estimates of glomerular filtration rate based on creatinine score.
Neuropsychiatric
The American College of Rheumatology defines 19 neuropsychiatric syndromes in systemic lupus erythematosus, and these can occur due to affects on the central and peripheral nervous system. The most common neuropsychiatric disorder in SLE patients is headache.
Other common symptoms include cognitive dysfunction, mood disorder, cerebrovascular, seizures, polyneuropathy, anxiety disorder and psychosis. Additional symptoms less commonly observed include acute confusion, Guillain-barre syndrome, aseptic meningitis, autonomic disorder, demyelinating syndrome, mononeuropathy, chorea, myasthenia gravis, myelopathy, cranial neuropathy and plexopathy.
Neurological
Neural symptoms represent a significant incidence of the morbidity and mortality of SLE. The neural manifestation of lupus is known as neuropsychiatric systematic lupus erythematosus (NPSLE). One aspect of this is severe damage to the epithelial cells of the blood-brain barrier.
Systemic The most common systemic symptom of SLE is fatigue. Fatigue is probably due to a variety of factors including anemia, hypothyroidism, pain, depression, poor sleep quality, and disease activity.
The American College of Rheumatology established eleven criteria for use in classifying and operationalizing the definition of SLE in clinical trials. This classification system was not intended for use as an individual diagnostic scheme, but rather, was intended for use in clinical studies. For the purpose of identifying patients for clinical studies, a person has SLE if any 4 out of the following 11 symptoms are present simultaneously or serially on two separate occasions: molar rash; discoid rash; serositis or pericarditis; oral ulcers (including oral or nasopharyngeal); arthritis (particularly nonerosive arthritis of two or more peripheral joints); photosensitivity; a hemotologic disorder, particularly hemolytic anemia, leukopenia, lymphopenia, or
thrombocytopenia; a renal disorder, particularly protein or cellular casts in the urine; a positive antinuclear antibody test; an immunological disorder, particularly a positive anti-Smith, anti- double stranded DNA or antiphospholipid test; and a neurological disorder, particularly seizures or psychosis.
When diagnosing individual patients, a more holistic approach is used. For example, some people with antiphospholipid syndrome may have SLE without four of the above criteria. Moreover, SLE may present with symptoms and features other than those listed in the criteria.
Quality of life for SLE patients can be improved through flare prevention. The warning signs of an impending flare include increased fatigue, pain, rash, fever, abdominal discomfort, headache, and dizziness. Early recognition of warning signs and good communication with a doctor can help individuals remain active, experience less pain, and reduce medical visits.
Current treatment options for SLE include preventing flares and reducing their severity and duration, as well as management of individual symptoms. Treatment can include corticosteroids, anti-malarial drugs, and nonsteroidal anti-inflammatory drugs. Certain types of lupus nephritis require bouts of cytotoxic drugs, including cyclophosphamide and
mycophenolate.
Disease-modifying antirheumatic drugs (DMARDs) may also be used to reduce the incidence of flares, the process of the disease, and lower the need for steroid use. DMARDs commonly in use are antimalarials, such as plaquenil, and immunosuppressants, such as methotexate and azathioprine. Corticosteroids and immunosuppressants are also used to control the disease and prevent flares. However, the use of steroids may result in Cushing's syndrome and other side-effects.
Since a large percentage of people with SLE suffer from varying amounts of chronic pain, various types of medications to manage pain are often used. Pain management typically begins with over-the-counter drugs, such as nonsteroidal anti-inflammatories. However, to manage moderate or severe pain, mild or strong opiates may be needed.
In certain embodiments, the disclosure provides methods of treating SLE and/or increasing IL-2 levels in subjects having SLE by administering an effective amount of a composition of the disclosure. Administering a composition of the disclosure can be used to decrease one or more symptoms of SLE and/or to decrease the frequency or severity of flares. In certain embodiments, administering a composition of the disclosure is used to treat SLE in a patient with lupus nephritis. In such cases, treating SLE may comprise treating lupus nephritis, such as by reducing symptoms of lupus nephritis. In certain embodiments, treating comprises treating the skin symptoms of SLE. In certain embodiments, treating comprises reducing one or more symptoms of lupus nephritis. In certain embodiments, treating comprises reducing, delaying or eliminating the need for dialysis. In certain embodiments, treating comprises reducing, delaying, or eliminating the need for kidney transplantation. In certain embodiments, treating comprises delaying or preventing progression of lupus nephritis to renal failure or end stage renal disease.
The invention contemplates methods of treating SLE, including treating lupus nephritis, comprising administering a composition of the disclosure alone or as part of a therapeutic regimen combined with one or more other drugs, biologies, or other therapeutic modalities. The other modalities selected as part of a therapeutic regimen may be selected depending on the severity of the patient's disease, and the particular symptoms being primarily targeted. By way of example, compositions of the disclosure may, in certain embodiments, be administered as part of a therapeutic regimen with one or more of: analgesics or other pain management medications (e.g., to help alleviate pain associated with arthritic or other symptoms), anti-inflammatory medications, steroids, immunosuppresant agents, antimalarial agents, and cytotoxic agents. Further examples of agents and treatment modalities that can be used in combination include diet, exercise, stress management, acupuncture, and physical therapy. Other specific examples include the use of agents and therapies specific for alleviating symptoms of lupus nephritis, such as blood pressure lowering medications, protein, potassium, and/or sodium reduced diets, cytotoxic agents, and/or immunosuppresants. Methods of treatment include treatment in combination with dialysis, kidney transplant, or one or more other therapies for kidney failure.
The disease symptoms can be replicated in animal models, and such models are readily used to confirm efficacy of a therapy or combination therapy. To this end, many murine models have been developed (Foster, Relevance of Systemic Lupus Erythematosus Nepthritis Animal Models to Human Disease. Semin Nephrol. 1999, 19(1): 12-24). The models make use of host- graft interactions (Bruijn et al., Murine Chronic Graft- Versus-Host Disease as a Model for Lupus Nephritis. Am J Pathol., 1988, 130(3): 639-641), transgenic mice (Takahashi et al, Suppression of Experimental Lupus Nephritis by Aberrant Expression of the Soluble E-Selectin Gene.
Pathology International, 2002, 52(3): 175-180), and anti-DNA antibodies (Yung and Chan, Anti- DNA Antibodies in the Pathogenesis of Lupus Nephritis - The Emerging Mechanisms.
Autoimmunity Reviews, 2008, 7(4): 317-321). These and other available animal models may be used in the course of developing a diagnostic or therapeutic. Additionally, in vitro systems, such as blood and tissue samples from subjects that have been previously diagnosed with SLE can be used. Exemplary tissue samples include blood samples, bone marrow samples, and cultures of T cells generated following separation of T cells from blood samples.
Type I Diabetes
Diabetes mellitus type 1 (Type 1 diabetes, IDDM, or, formerly, juvenile diabetes) is a form of diabetes mellitus resulting from autoimmune destruction of insulin-producing beta cells of the pancreas. The subsequent lack of insulin leads to increased blood and urine glucose. Classical symptoms are polyuria, polydipsia, polyphagia and weight loss.
Currently, type 1 diabetes is generally fatal unless treated with insulin, and such treatment must be continued throughout the patient's life time. Even with treatment,
complications of low and high blood sugar may occur, including seizure, unconsciousness, and long term damage to peripheral nerves and blood vessels.
In certain embodiments, compositions of the disclosure can be used in the treatment of type I diabetes and/or to increase IL-2 expression in a subject that has type I diabetes. Without being bound by theory, use of such compositions may help stem the autoimmune attack on pancreatic cells, thus helping to reduce or eliminate the dependence on exogenous insulin. In certain embodiments, compositions of the disclosure are used in combination with insulin, but the use of such compositions reduces the frequency with which insulin injections are required and/or decreases the magnitude of spikes/dips in patient blood glucose levels.
The disease symptoms can be replicated in animal models, and such models are readily used to confirm efficacy of a therapy or combination therapy. Numerous animal models of type I diabetes exist, and many such available models are summarized in a recent review (Rees (2005) Diabetic Medicine 22: 359-370).
Rheumatoid Arthritis
Rheumatoid arthritis is a long-lasting disease that can affect joints in any part of the body but most commonly the hands, wrists, and knees. With rheumatoid arthritis, the immune system mistakenly attacks itself and causes the joint lining to swell. The inflammation then spreads to the surrounding tissues, and can eventually damage cartilage and bone. In more severe cases, rheumatoid arthritis can affect other areas of the body, such as the skin, eyes, and nerves.
Symptoms of rheumatoid arthritis include, but are not limited to, fatigue, fever, rash, joint inflammation, pain, tenderness around the effected joints, stiffness, redness and warmth around the effected joints, and reduced range of motion.
Rheumatoid arthritis can occur at any age, but is commonly observed between the ages of 25 and 55. It is 2-3 times more common in women than in men. It is the second most common form of arthritis, affecting 2.1 million people in the U.S. alone.
Rheumatoid arthritis in some people may eventually cause the hands and feet to become misshapen as muscles weaken, tendons shrink, and the ends of bones become damaged. Current therapies include medications intended to decrease pain, joint swelling, and inflammation. These medications include non-steroidal anti-inflammatory medicines, corticosteroids, anti-mitotics (methotrexate and cyclophosphamides), and anti-TNFa medications intended to systemically dampen the inflammatory response. Additional treatments include diet, exercise, and physical therapy intended to help maintain muscle strength and range of motion, thereby slowing the disabling effects of the disease.
The methods of the present disclosure can be used in the treatment of rheumatoid arthritis and/or to increase IL-2 expression in patients with rheumatoid arthritis. In certain embodiments, the methods of the disclosure are used to decrease one or more symptoms of rheumatoid arthritis. In other words, "treating" is meant to include decreasing or eliminating one or more symptoms of rheumatoid arthritis. Moreover, the disclosure contemplates that compositions of the disclosure may be administered alone or as part of a therapeutic regimen with other agents useful in decreasing one or more symptoms of rheumatoid arthritis. For example, compositions of the disclosure may be used with analgesics, anti-inflammatories, and rheumatoid arthritis biological agents (e.g., Humira, Simponi, Remicade, etc.).
The disease symptoms can be replicated in animal models, and such models are readily used to confirm efficacy of a therapy or combination therapy. Numerous animal models for rheumatoid arthritis exist in the art. By way of non-limiting example, BioMedCode Hellas SA makes animal models for inflammatory conditions. Many of the company's models are approved by the FDA for testing potential treatments for RA. Their models include Tgl97 and Tg5433 mice.
Additional animal models of arthritis and rheumatoid arthritis include, but are not limited to, the models described in the following publications: Hammer et al, 1990, Cell 63: 1099-1112; Haqqi et al, 1992, PNAS 89: 1253-1255; Keffer et al, 1991, EMBO Journal 10: 4025-4031; Pelletier et al, 1997, Arthritis Rheum 40: 1012-1029; Trentham et al, 1977, Journal of
Experimental Medicine 146: 857-868; Wooley et al., 1981, Journal of Experimental Medicine 154: 688-700. Recently, Bina and Wilder reviewed numerous available animal models for Rheumatoid arthritis. Bina and Wilder, 1999, Molecular Medicine Today 5: 367-369.
Autoimmune Thyroid Disease
Autoimmune thyroid diseases, such as autoimmune thyroiditis, which is also known as Hashimoto's thyroiditis or chronic lymphocytic thyroiditis, are conditions in which the immune system attacks the body's own thyroid gland. The thyroid gland, which is a small gland at the front of the neck, becomes chronically inflamed and decreases production of the thyroid hormones triiodothyronine and thyroxine. Because these hormones are used almost everywhere in the body, autoimmune thyroid diseases can have widespread, serious effects and many symptoms.
Mild autoimmune thyroiditis can be symptomless. In more serious cases, however, inflammation of the thyroid can lead to enlargement (goiter). Over time, the thyroid can suffer more damage, leading to symptoms of hypothyroidism (underactive thyroid), such as fatigue, weight gain, body aches, depression, and lethargy. Chronic autoimmune thyroid diseases can progress to significant hypothyroidism. The classification of autoimmune thyroid disease (AITD) includes Hashimoto's thyroiditis (HT) or chronic autoimmune thyroiditis and its variants, Graves' disease (GD) and autoimmune atrophic thyroiditis. HT is characterized by the presence of goiter, thyroid autoantibodies against thyroid peroxidase (TPO) and thyroglobulin (Tg) in serum, and varying degrees of thyroid dysfunction. During HT, self-reactive CD4+ T lymphocytes (Th) recruit B cells and CD8+ T cells (CTL) into the thyroid. Disease progression leads to the death of thyroid cells and hypothyroidism.
Both autoantibodies and thyroid-specific cytotoxic T lymphocytes (CTLs) have been proposed to be responsible for autoimmune thyrocyte depletion. In GD, the TSH-R is the most important autoantigen. Antibodies directed against it mimic the effects of the hormone on thyroid cells, stimulating autonomous production of thyroxine and triiodothyronine and causing hyperthyroidism.
The methods of the present disclosure can be used in the treatment of an autoimmune thyroid disease and/or to increase IL-2 expression in patients with an autoimmune thyroid disease. In certain embodiments, the methods of the disclosure are used to decrease one or more symptoms of an autoimmune thyroid disease. In other words, "treating" is meant to include decreasing or eliminating one or more symptoms of an autoimmune thyroid disease. Moreover, the disclosure contemplates that compositions of the disclosure may be administered alone or as part of a therapeutic regimen with other agents useful in decreasing one or more symptoms of an autoimmune thyroid disease.
The disease symptoms can be replicated in animal models, and such models are readily used to confirm efficacy of a therapy or combination therapy. Two exemplary mouse models are described in Volpe et al, 1993, Horm Metab Res 25: 623-627.
Scleroderma
Scleroderma is a chronic autoimmune disease characterized by fibrosis, vascular alterations, and autoantibodies. There are two major forms: limited systemic scleroderma and diffuse systemic scleroderma. The cutaneous symptoms of limited systemic scleroderma affect the hands, arms and face. Patients with this form of scleroderma frequently have one or more of the following complications: calcinosis, Raynaud's phenomenon, esophageal dysfunction, sclerodactyly, and telangiectasias. Diffuse systemic scleroderma is rapidly progressing and affects a large area of the skin and one or more internal organs, frequently the kidneys, esophagus, heart and/or lungs.
Scleroderma affects the small blood vessels known as arterioles, in all organs. First, the endothelial cells of the arteriole die off apoptotically, along with smooth muscle cells. These cells are replaced by collagen and other fibrous material. Inflammatory cells, particularly CD4+ helper T cells, infiltrate the arteriole, and cause further damage.
The skin manifestations of scleroderma can be painful, can impair use of the affected area (e.g., use of the hands, fingers, toes, feet, etc.) and can be disfiguring. Skin ulceration may occur, and such ulcers may be prone to infection or even gangrene. The ulcerated skin may be difficult or slow to heal. Difficulty in healing skin ulcerations may be particularly exacerbated in patients with impaired circulation, such as those with Raynaud's phenomenon. In certain embodiments, the methods of the present disclosure are used to treat scleroderma and/or increase IL-2 expression in patients, for example skin symptoms of scleroderma. In certain embodiments, treating scleroderma comprises treating skin ulceration, such as digital ulcers. Administration of a composition of the disclosure can be used to reduce the fibrotic and/or inflammatory symptoms of scleroderma in affected tissue and/or organs.
In addition to skin symptoms/manifestations, scleroderma may also affect the heart, kidney, lungs, joints, and digestive tract. In certain embodiments, treating scleroderma includes treating symptoms of the disease in any one or more of these tissues, such as by reducing fibrotic and/or inflammatory symptoms.
In certain embodiments, the methods of the present disclosure are used to treat scleroderma, for example lung fibrosis associated with scleroderma. Administration of compositions of the disclosure can be used to reduce the fibrotic symptoms of scleroderma in lung. For example, the methods can be used to improve lung function and/or to reduce the risk of death due to scleroderma.
In certain embodiments, the compositions of the disclosure are used to treat scleroderma, for example kidney fibrosis associated with scleroderma. Administration can be used to reduce the fibrotic symptoms of scleroderma in kidney. For example, the methods can be used to improve kidney function, to reduce protein in the urine, to reduce hypertension, and/or to reduce the risk of renal crisis that may lead to fatal renal failure. The methods and compositions of the present disclosure can be used in the treatment of scleroderma. Exemplary symptoms that can be treated include, but are not limited to, pain (including joint pain), swelling, skin ulceration, skin irritation, rash, loss of range of motion, and decreased ability to perform daily tasks. Further symptoms that can be treated include lung function (e.g., lung function can be improved) and kidney function. Improvement in any of these symptoms can be measured by, for example, decrease in the number of swollen joints, decrease in the number of painful joints, increased range of motion, increase in healing of ulcerated tissue, decrease in number and/or severity of skin ulcerations, increased ability to perform daily tasks, decreased skin involvement, decreased reliance on pain or other medication, improvement in patient self-assessment of pain or quality of life, increased lung function, decreased
hypertension, decreased protein in urine, etc.
In certain embodiments, methods of treating scleroderma include administering a composition of the disclosure as part of a therapeutic regimen along with one or more other drugs, biologies, or therapeutic interventions appropriate for scleroderma. In certain
embodiments, the additional drug, biologic, or therapeutic intervention is appropriate for particular symptoms associated with scleroderma. By way of example, compositions of the disclosure may be administered as part of a therapeutic regimen along with one or more immunosuppressive agents, such as methotrexate, cyclophosphamide, azathioprine, and mycophenolate.
Moreover, methods of treatment may include a treatment regimen including a dietary regimen, an exercise regimen, stress management, smoking cessation, acupuncture, massage, and/or physical therapy.
The disease symptoms can be replicated in animal models, and such models can be readily used to confirm efficacy of a therapy or combination therapy. Exemplary models include a rodent model in which scleroderma is induced by treatment with cyclosporine A (Damoiseaux et al., Cyclosporine A-Induced Autoimmunity: An Animal Model for Human Scleroderma. J. Experimental Animal Science, 2000, 41(1-2): 22-26) or bleomycin, as well as transgenic mouse models, and graft-versus-host models (Yamamoto, Characteristics of Animal Models for Scleroderma. Current Rheumatology Reviews, 2005, 1 : 101-119; Clark, Animal Models in Scleroderma. Current Rheumatology Reports, 2005, 7(2): 150-155). The disclosure contemplates that any of the compositions of the disclosure may be used in the treatment (e.g., to reduce one or more symptoms of) any of the foregoing conditions or in the treatment of an autoimmune condition associated with dysregulation of IL-2 expression. Methods of Use
In certain embodiments, the disclosure provides diagnostic methods that may be used in vivo and/or in vitro to aid in the diagnosis, monitoring or prognosis of a subject with an autoimmune condition, or can even be used to help refine the dosage of a medication (e.g., including, but not limited to, a medication comprising a composition of the disclosure).
In an exemplary method, a biomarker selected from one or more (1, 2, 3) of microRNA- 31, RhoA or IL-2 is assayed in a subject being treated with a compound (any compound, including a composition of the disclosure). The assay may be for the presence, absence or amount of a biomarker. Suitable assays include quantitative PCR, ELIZA, and the like that are suitable for detecting transcript or protein expression in samples. Assays may be performed on cells or on samples, such as blood sample. Based on the assay results, one may determine whether to adjust a subsequent dosage or dosing regimen of the compound. For example, if following administration of one or more doses of a microRNA-31 agonizing agent, an increase in IL-2 expression is not observed, it may be beneficial to increase the dosage or frequency of administration to achieve the desired increase in IL-2 expression.
By way of another example, the disclosure provides a method of diagnosing an autoimmune condition, such as systemic lupus erythematosus. As part of such a method, a sample is obtained from a subject suspected of having an autoimmune condition, such as SLE. This sample may be, for example, a bone marrow sample, a blood sample, or a sample of cells separated from a blood sample. Sample may be isolated at a time when the subject suspected of having the condition is experiencing significant symptoms, as well as during periods where symptoms are less acute. Following obtaining of the sample, the sample is assayed for expression of microRNA-31 or RhoA, or any one or more of microRNA31 , RhoA, or IL-2. Assays include assays of protein expression and transcript expression.
By way of another example, the disclosure provides a method of monitoring treatment of an autoimmune condition, such as systemic lupus erythematosus. To monitor treatment, expression of microRNA-31, IL-2, and/or RhoA is detected in a sample of a subject undergoing treatment. This expression is compared to expression of the biomarker in a sample that was obtained from the same subject either prior to initiation of this particular treatment regimen or at an earlier time point during treatment. Comparison of microRNA-31 and/or RhoA and/or IL-2 expression over one or more periods of time provides a way to monitor the progress of the treatment. An increase in microRNA-31 or a decrease in RhoA in a later sample indicates effectiveness of the treatment. Similarly an increase in IL-2 in a later sample indicates effectiveness of the treatment.
By way of further example, the disclosure provides a method of treating a subject having an autoimmune condition, such as systemic lupus erythematosus. The method comprises comparing expression of microRNA-31 or RhoA from a sample taken from a subject prior to initiation of a particular treatment to a standard range reflecting expression in samples from healthy subjects. If expression of microRNA-31 is below the standard range or expression of RhoA is above the standard range, the subject is identified as potentially suitable for treatment with a composition of the disclosure. The subject is then treated with an effective amount of a composition comprising microRNA-31 , siNA that hybridizes to RhoA, IL-2 protein, or another composition of the disclosure if the subject is determined to be susceptible to treatment.
In certain embodiments, the method further comprises detecting expression of microRNA-31 or RhoA in a post-treatment sample from the same subject, and comparing expression of microRNA-31 or RhoA in the post-treatment sample to expression in the sample taken prior to initiation of the particular treatment.
In certain embodiments, the particular treatment is a microRNA-31 mimic, such as microRNA-31, a siNA that hybridizes to RhoA, or a small molecule inhibitor of RhoA.
More generally, diagnostic uses can be achieved, for example, by contacting a sample to be tested, optionally along with a control sample, with a reagent appropriate for detecting nucleic acid or protein.
In certain embodiments of any of the foregoing, the diagnostic assay is performed on a human patient or a sample from a human patient. Suitable diagnostic reagents include, but are not limited to, probes and primers suitable for detecting microRNA-31 or RhoA expression, as well as antibodies suitable for detecting RhoA protein expression. Reagents may be labeled to facilitate detection and quantification in the assay, or detection may rely on the use of secondary reagents.
(b) Therapeutic Methods of Uses
In certain embodiments, the disclosure contemplates that compositions of the disclosure may be used therapeutically, for example, in the treatment of human or non-human subjects. Any of the compositions described herein may be used in the treatment of any of the
autoimmune conditions described herein. Suitable compositions comprise, as an active ingredient, nucleic acids, polypeptide or small molecule. Other suitable compositions comprise cellular compositions, such as cells expressing microRNA-31.
Exemplary methods include methods comprising contacting cells or administering to subjects a composition that increases expression of microRNA-31 or decreases expression of RhoA. Such compositions can be used to, for example, increase IL-2 expression in a subject having an autoimmune condition. Exemplary compositions comprise a nucleic acid comprising a nucleotide sequence that increases expression of microRNA-31 or a nucleic acid comprising a nucleotide sequence that decreases expression of RhoA.
Exemplary conditions that can be treated include, but are not limited to autoimmune conditions, such as SLE or other autoimmune conditions that share a mechanism of action or etiology. In certain embodiments, the method comprises increasing IL-2 expression in the subjects.
Suitable compositions comprise, for example, a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. Other suitable compositions comprise, for example, a nucleic acid comprising a siNA, a nucleic acid that mimics microRNA- 31 , or an siNA that hybridizes to RhoA. A nucleic acid composition may be single standed, partially double stranded or fully double stranded. In certain embodiments, administration of the composition increases expression of endogenous microRNA. In other embodiments,
administration of the composition comprises introduction of exogenous microRNA-31 molecules, such as oligonucleotides that express microRNA-31 following introduction into cells.
Regardless of the particular composition administered, an effective amount is
administered to patients. As used herein, the term "effective amount" refers to the amount of a therapy which is sufficient to reduce and/or ameliorate the severity and/or duration of a disease or disorder; prevent or delay the advancement of said disease or disorder; cause regression of said disease or disorder; prevent or delay the recurrence, development, or onset of one or more symptoms associated with said disease or disorder, or enhance or improve the effect(s) of another therapy. It is understood that measurable signs of effectiveness may not be observable following a single dose.
"Treating" a condition or disease refers to curing as well as ameliorating at least one symptom of the condition or disease, and includes administration of a composition which reduces the frequency of, or delays the onset of, symptoms of a medical condition in a subject.
In certain embodiments, progress and effectiveness of treatment is monitored during and/or following treatment. For example, autoimmune conditions can be monitored using methods suitable for the particular condition, such as blood tests, urine samples, self-reports of pain and fatigue, decrease in need for pain medication, X-ray, CT scan, and the like. Moreover, treatment may be monitored based on assessment of improvement in symptoms, such as decreased pain (e.g., patient requests/uses less pain medication), decreased reliance on supplemental oxygen, improvement in appetite, weight gain, decreased fatigue, increased mobility, and the like. Moreover, progress and effectiveness of treatment can be monitored using any one or more of the biomarkers microRNA-31 , RhoA or IL-2, as detailed above.
The disclosure provides that, in certain embodiments, the compositions of the disclosure are administered as part of a therapeutic regimen with one or more other agents and/or one or more other treatment modalities. The selection of suitable other agents and/or treatment modalities may depend on the particular disease, condition of the patient, age of the patient, symptoms, and the like. By way of example, other suitable treatment modalities include, but are not limited to, surgery, dialysis, insulin therapy, diet, physical therapy, smoking cessation, oxygen therapy, ventilatory support, acupuncture, and the like. By way of example, other suitable agents include, but are not limited to analgesics, narcotics (such as, for pain
management), anti-inflammatories, immunosuppressants, corticosteroids, antimalarials, and the like. Any one or more of these agents and/or modalities can be used as part of a therapeutic regimen.
For any methods of treating involving administering a combination of agents and/or therapies, such conjoint treatment may be achieved by way of the simultaneous, sequential or separate dosing of the individual components of the treatment. In certain embodiments, a therapeutic method further includes an assay step in which expression of microR A-31, RhoA and/or IL-2 is evaluated in the subject following treatment with a composition of the disclosure. Such assay steps may evaluate RNA or protein expression using suitable methods.
(vii) Dosage and Administration
Embodiments of the disclosure include sterile pharmaceutical formulations that are useful in the context of administration of compositions to a subject and/or for use in a diagnostic setting. Moreover, various administration and delivery routes and methods may be useful. The disclosure contemplates that any of the formulations and/or routes of administration may be used with any of the compositions of the disclosure. Moreover, the disclosure contemplates that the various formulations and routes of administration may also apply to other agents, such as agents administered as part of a therapeutic regimen.
Various delivery systems are known and can be used to administer a composition of the present disclosure. Methods of administering include, but are not limited to, parenteral administration {e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous), epidural administration, topical administration, and mucosal administration {e.g. , intranasal and oral routes). Administration can be systemic or local. Note that when the formulations are administered as part of a combination therapy, the disclosure contemplates that other agents may be administered by the same or different route of administration.
In a specific embodiment, the compositions of the disclosure comprise a
pharmaceutically acceptable carrier. In a preferred embodiment, the pharmaceutically acceptable carrier is water for injection, USP, 5% dextrose in water (D5W) or saline.
In certain formulations, a water-based formulation is employed while in others, it may be lipidbased. In particular embodiments, a composition comprising an active pharmaceutical agent or a nucleic acid encoding the same is in a water-based formulation. In other embodiments, the formulation is lipid based.
Solutions of active pharmaceutical agents described herein can be prepared as free base or pharmacologically acceptable salts. Such agents also may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose, in some embodiments. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The form is often sterile and fluid to the extent that easy syringability exists. It may be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
The precise dose to be employed and the dosing regimen will depend on the route of administration, the specific disease to be treated, the severity of the patient's condition, the particular composition used and the like. Effective doses may be extrapolated from dose- response curves derived from in vitro or animal model test systems.
In certain embodiments, particularly in the case of formulations intended for
administration to humans, the formulations are pyrogen- free formulations which are substantially free of endotoxins and/or related pyrogenic substances. Endotoxins include toxins that are confined inside a microorganism and are released only when the microorganisms are broken down or die. Pyrogenic substances also include fever-inducing, thermostable substances (glycoproteins) from the outer membrane of bacteria and other microorganisms. Both of these substances can cause fever, hypotension and shock if administered to humans. Due to the potential harmful effects, even low amounts of endotoxins must be removed from intravenously administered pharmaceutical drug solutions. The Food & Drug Administration ("FDA") has set an upper limit of 5 endotoxin units (EU) per dose per kilogram body weight in a single one hour period for intravenous drug applications (The United States Pharmacopeial Convention, Pharmacopeial Forum 26 (1):223 (2000)). When therapeutic proteins are administered in amounts of several hundred or thousand milligrams per kilogram body weight, as can be the case with antibodies, even trace amounts of harmful and dangerous endotoxin must be removed. In certain specific embodiments, the endotoxin and pyrogen levels in the composition are less than 10 EU/mg, or less then 5 EU/mg, or less than 1 EU/mg, or less than 0.1 EU/mg, or less than 0.01 EU/mg, or less than 0.001 EU/mg. A compound (such as a composition of the disclosure or other drug) can be administered to any appropriate subject having a biomarker or needing treatment for a condition described herein. Non- limiting examples of a subject include mammal, human, ape, monkey, ungulate (e.g., equine, bovine, caprine, ovine, porcine, buffalo, camel and the like), canine, feline, rodent and the like. A subject may be male or female, and a drug can be administered to a subject in a particular age group, including, for example, juvenile, pediatric, adolescent, adult, and the like. A composition of the disclosure or other drug, in certain embodiments, comprises as an active ingredient an antibody, antibody fragment, single-chain antibody, small molecule, a nucleic acid, nucleic acid derivative, miRNA, siNA, peptide, polypeptide, and the like. Various forms of miRNA or siRNA may be delivered, including post-processed miRNA or siRNA, pre-processed miRNA or siRNA or vector that encodes pre-processed or post-processed miRNA or siRNA.
Methods as presented herein include, without limitation, the delivery of an effective amount of a nucleic acid or an expression construct encoding the same. An "effective amount" of the pharmaceutical composition, generally, is defined as that amount sufficient to detectably and repeatedly achieve the stated desired result, for example, to ameliorate, reduce, minimize or limit the extent of the disease or its symptoms. In some embodiments there may be a step of monitoring the biomarkers to evaluate the effectiveness of treatment and to control toxicity.
Drugs are administered in a manner compatible with the dosage formulation, and in such amount as may be therapeutically effective. Injection of nucleic acids may be delivered by syringe or any other method used for injection of a solution, as long as the nucleic acid and any associated components can pass through the particular gauge of needle required for injection. A syringe system has also been described for use in gene therapy that permits multiple injections of predetermined quantities of a solution precisely at any depth (U.S. Pat. No. 5,846,225).
In a specific embodiment, compositions of the disclosure comprise a nucleic acid that increases microRNA-31 expression or decreases RhoA expression. Such nucleic acid based compositions may, in certain embodiments, be administered by way of gene therapy. Gene therapy refers to therapy performed by the administration to a subject of an expressed or expressible nucleic acid. In this embodiment of the disclosure, the nucleic acids (such as antisense, siRNA or microRNA) are produced and mediate a prophylactic or therapeutic effect.
Any of the methods for gene therapy available in the art can be used according to the present disclosure. Exemplary methods are described below. For general reviews of the methods of gene therapy, see Goldspiel et al, 1993, Clinical Pharmacy 12:488; Wu and Wu, 1991, Biotherapy 3 :87; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62: 191; May, 1993, TIBTECH 11 : 155. Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), Current Protocols in
Molecular Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and
Expression, A Laboratory Manual, Stockton Press, NY (1990).
In one embodiment, a nucleic acid based composition is presented as part of an expression vector that expresses the nucleic acid in a suitable host. In particular, such nucleic acids have promoters, for example, heterologous promoters, said promoter being inducible or constitutive, and, optionally, tissue-specific.
Delivery of the nucleic acids into a subject may be either direct, in which case the subject is directly exposed to the nucleic acid or nucleic acid-carrying vectors, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then transplanted into the subject.
Thus, in certain embodiments, a composition of the disclosure comprises a cellular composition. These two approaches are known, respectively, as in vivo or ex vivo gene therapy. Suitable vectors include viral vectors. In other embodiments, nucleic acids can be administered as naked nucleic acids. Moreover, nucleic acid based compositions may, in certain embodiments, be administered by way of tansducnon/infection, DEAE-dextran-mediatedtransfection, lipofection, electroporation, and iontophoresis.
(viii) Articles of Manufacture
The disclosure provides a pharmaceutical pack or kit comprising one or more containers filled with a composition of the disclosure. Similarly, the disclosure provides a pharmaceutical pack or kit suitable for laboratory and/or diagnostic use. The disclosure contemplates that any of the compositions described herein, such as compositions comprising a nucleic acid comprising a nucleotide sequence that increases expression of microRNA-31 or compositions comprising a nucleic acid comprising a nucleotide sequence that decreases expression of RhoA, can be packaged and sold as part of a kit. Exemplary such kits are pharmaceutical kits.
The disclosure also provides a pharmaceutical pack or kit comprising in one or more first containers a formulation as described herein and in one or more second containers one or more other prophylactic or therapeutic agents useful for the prevention, management or treatment of an autoimmune condition, such as SLE or an autoimmune condition that has a mechanism of action or etiology similar to SLE (e.g., a condition correlated with decreased expression of IL-2 or a condition that results from misregulation of T cells).
In an exemplary embodiment, the formulations of the disclosure are formulated in single dose vials as a sterile formulation. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
In the case of kits sold for laboratory and/or diagnostic use, the kit may optionally contain a notice indicating appropriate use, safety considerations, and any limitations on use. Moreover, in the case of kits sold for laboratory and/or diagnostic use, the kit may optionally comprise one or more other reagents, such as positive or negative control reagents, useful for the particular diagnostic or laboratory use.
The present disclosure provides kits that can be used in the above methods. In one embodiment, a kit comprises a composition as described herein, in one or more containers. In another embodiment, a kit comprises a composition as described herein, in one or more containers, and one or more other prophylactic or therapeutic agents useful for the prevention, management or treatment of SLE or an autoimmune condition, such as an autoimmune condition that has a mechanism of action or etiology similar to SLE (e.g., a condition correlated with decreased expression of IL-2 or a condition that results from misregulation of T cells).
Preferably, the kit further comprises instructions for preventing, treating, managing or ameliorating a disorder (e.g., using the formulations of the description alone or in combination with another prophylactic or therapeutic agent), as well as side effects and dosage information for such use.
The present disclosure also encompasses a finished packaged and labeled pharmaceutical product. This article of manufacture includes the appropriate unit dosage form in an appropriate vessel or container such as a glass vial or other container that is hermetically sealed. In the case of dosage forms suitable for parenteral administration the active ingredient is sterile and suitable for administration. In certain embodiments, the formulation is suitable for intravenous administration. In a preferred embodiment, the unit dosage form is suitable for intravenous, intramuscular, intranasal, oral, topical or subcutaneous delivery. Thus, the disclosure encompasses solutions, preferably sterile, suitable for each delivery route.
As with any pharmaceutical product, the packaging material and container are designed to protect the stability of the product during storage and shipment. Further, the products of the disclosure include instructions for use or other informational material that advise the physician, technician or patient on how to appropriately prevent or treat the condition in question. In other words, the article of manufacture includes instruction means indicating or suggesting a dosing regimen including, but not limited to, actual doses, monitoring procedures, etc., and other monitoring information.
Specifically, the disclosure provides an article of manufacture comprising packaging material, such as a box, bottle, tube, vial, container, sprayer, insufflator, intravenous (i.v.) bag, envelope and the like; and at least one unit dosage form of a pharmaceutical agent contained within said packaging material, wherein said pharmaceutical agent comprises a composition of the disclosure and wherein said packaging material includes instruction means which indicate that said composition can be used to prevent, manage, treat, and/or ameliorate one or more symptoms associated with SLE or another autoimmune condition, such as an autoimmune condition that has a mechanism of action or etiology similar to SLE (e.g., a condition correlated with decreased expression of IL-2 or a condition that results from misregulation of T cells), or one or more symptoms thereof by administering specific doses and using specific dosing regimens as described herein.
The disclosure also provides an article of manufacture comprising packaging material, such as a box, bottle, tube, vial, container, sprayer, insufflator, intravenous (i.v.) bag, envelope and the like; and at least one unit dosage form of each pharmaceutical agent contained within said packaging material, wherein one pharmaceutical agent comprises a composition of the disclosure and the other pharmaceutical agent comprises a prophylactic or therapeutic agent other than a composition of the disclosure, and wherein said packaging material includes instruction means which indicate that said agents can be used to treat, prevent and/or ameliorate one or more symptoms associated with SLE or another autoimmune condition, such as an autoimmune condition that has a mechanism of action or etiology similar to SLE (e.g., a condition correlated with decreased expression of IL-2 or a condition that results from misregulation of T cells), or one or more symptoms thereof by administering specific doses and using specific dosing regimens as described herein.
In certain embodiments, particularly in the case of pharmaceutical kits comprising formulations intended for administration to humans, the formulations are pyrogen-free formulations which are substantially free of endotoxins and/or related pyrogenic substances. Endotoxins include toxins that are confined inside a microorganism and are released only when the microorganisms are broken down or die. Pyrogenic substances also include fever-inducing, thermostable substances (glycoproteins) from the outer membrane of bacteria and other microorganisms. Both of these substances can cause fever, hypotension and shock if administered to humans. Due to the potential harmful effects, even low amounts of endotoxins must be removed from intravenously administered pharmaceutical drug solutions. The Food & Drug Administration ("FDA") has set an upper limit of 5 endotoxin units (EU) per dose per kilogram body weight in a single one hour period for intravenous drug applications (The United States Pharmacopeial Convention, Pharmacopeial Forum 26 (1):223 (2000)). In certain specific embodiments, the endotoxin and pyrogen levels in the composition are less than 10 EU/mg, or less than 5 EU/mg, or less than 1 EU/mg, or less than 0.1 EU/mg, or less than 0.01 EU/mg, or less than 0.001 EU/mg.
Examples
The disclosure is now described with reference to the following examples. These examples are provided for the purpose of illustration only and the disclosure should in no way be construed as being limited to these examples but rather should be construed to encompass any and all variations which become evident as a result of the teachings provided herein. In general terms, the present disclosure employs, unless otherwise indicated, conventional techniques of molecular biology, chemistry, biochemistry, biophysics, recombinant DNA technology, and immunology. Of course, it will be appreciated that specific listing or description of particular equipment and reagents used, sizes, manufacturer, etc., is not to be considered limiting on the current disclosure unless specifically stated to be so. It will be further appreciated that other equipment and reagents which perform similarly may be readily substituted.
Example 1 - Expression of microRNA-31 We measured the expression levels of miR-31 in T cells, B cells and monocytes isolated from the PBMCs of three healthy volunteers. As shown in Figure 1A, miR-31 was selectively expressed in T cells, suggesting that it might play a role in T cell function.
We then investigated the expression of miR-31 in T cells obtained from 32 SLE patients and 11 normal controls (NC) and found that miR-31 was significantly down-regulated in SLE patients relative to controls as shown in Figure IB ( <0.0001). Further information regarding the subjects used for these studies is provided in Table 1.
Table 1: Clinical features of patients with SLE
Characteristic Control (n = 11) SLE (n = 32)
Sex,No. of male/female 1/10 3/29
Age (y) 30.1± 1.080 36.7±3.134
Anti-dsDNA [P/N (n)a] NA 16/9
LN [P/N (n)]. NA 20/8
Medications
Steroids (n)b taking
<10 mg/d NA 13
lO^tO mg/d NA 13
40 mg/d NA 6
Secondary agents0 [P/N (n)] NA 22/10
Values are presented as mean±SD, except where indicated otherwise.
a. Because some patients were not examined, the number listed for the feature is less than the total number of patients. b. The dose of steroids presented in this article is that of prednisone. If other equivalent was taken, the dosage was converted (e.g., 40 mg methylprednisolonewas equivalent to 50 mg prednisone).
c. Some patients were receiving secondary antirheumatic agents, including chloroquine, cyclophosphamide, methotrexate, and azathioprine.
LN, lupus nephritis; P/N, positive/negative (for the feature listed).
Example 2 - Correlation Between Expression of microRNA-31 and IL-2
T cells from lupus patients display numerous signaling abnormalities which may contribute to the pathogenesis of SLE (Kong et al, 2003; Moulton et al. 2011). The following experiments investigated the role of miR-31 in the skewed expression of T cell-related cytokines in SLE. As part of these experiments, a microRNA-31 mimic was designed and used to mimic expression of microRNA-31 and an antagomir-31 was designed and used to decrease expression of microRNA-31. Appropriate control oligonucleotides were also used. As reflected in Figure 2 A and 2B, trans fection of these constructs into primary T cells effectively increased (for the mimic) or decreased (for the antagomir) expression of microRNA-31. Successful ectopic expression or silencing of miR-31 in primary T cells was verified with TaqMan quantitative PCR, which showed that the overexpression or inhibition of miR-31 following transfection resulted in a 50-fold increase or 25-fold decrease in miR-31 expression, respectively (Figure 2). Given the efficacy of these reagents in modulating expression of miR-31 , they were used to further study signaling in these cells.
To evaluate whether TCR engagement affects miR-31 expression, CD3+ T lymphocytes freshly purified from healthy donors were stimulated with PMA and ionomycin in a time course study. As shown in Figure 3 A, miR-31 expression was induced after stimulation, reaching a peak around 12 hours.
Given that T cell activation through TCR results in enhanced induction of IL-2, the potential modulation of IL-2 production by miR-31 was evaluated. To address this question, human primary T cells were transfected with miR-31 mimics or control mimics and then activated with PMA and ionomycin for 24 hours. IL-2 mRNA levels in the cells and IL-2 protein levels in the supernant were measured by RT-PCR and ELISA, respectively. As shown in Figure 3B and 3C, the miR-31 mimic increased IL-2 expression at both the mRNA and protein levels, while silencing of the endogenous miR-31 via transfection with the inhibitory
oligonucleotide antagomir-31 decreased IL-2 production. Consistent with these results, a positive correlation between the expression levels of miR-31 and IL-2 in activated lupus T cells (n=15) was also observed, as shown in Figure 3D.
A luciferase reporter assay was performed to ask whether miR-31 regulated IL-2 promoter activity. The IL-2 promoter was cloned into a luciferase reporter vector (named IL-2- luc). Jurkat cells co-transfected with IL-2-luc and miR-31 mimic or control, were stimulated with PMA and ionomycin. As shown in Figure 3E, miR-31 increased IL-2 promoter activity and did so in a dose-dependent manner (Figure 3F). Taken together, the above data suggest that miR-31 promotes IL-2 production through enhancing the activity of the IL-2 promoter.
Additionally, the relationship between IL-2 and miR-31 was consistently observed in samples from lupus patients. Example 3 - RhoA in T cells
To gain insights into the molecular mechanism of how miR-31 regulates IL-2 production, bioinformatic tools were used to identify potential targets of miR-31. The miRGen database (www.diana.pcbi. upenn.edu/miRGen/v3/miRGen.html), which integrates analysis from
TargetScan, PicTar and MiRanda, generated a list of predicted miR-31 targets. RhoA, which has been reported to modulate IL-2 gene expression in T cell activation (Helms et al., 2007), was a candidate target of miR-31 in this system.
To evaluate whether miR-31 inhibits the expression of RhoA in T cells, primary T cells were transfected with miR-31 mimic or control, and the expression of RhoA was measured by both RT-PCR and western blotting. RT-PCR demonstrated that miR-31 inhibited the expression of RhoA mRNA (Figure 4A). Western blotting analysis revealed that transfection of miR-31 resulted in a reduction of RhoA protein (Figure 4B). Given that miR-31 expression level in SLE samples was significantly lower than in samples from NC, we investigated whether RhoA expression was increased in SLE T cells. T cells from 32 SLE patients and 11 NC showed that RhoA mRNA was significantly up-regulated in SLE T cells (Figure 4C). Furthermore, a linear correlation analysis demonstrated that the expression of RhoA mRNA correlated negatively with the expression of miR-31 in primary T cells of patients with lupus (Figure 4D). Taken together, the above data suggest that miR-31 targets RhoA in human primary T cells and RhoA mRNA expression is significantly higher in lupus T cells compared to NC.
Example 4 - Inhibition of RhoA Expression
To test the hypothesis that miR-31 regulates IL-2 expression in T cells via RhoA, the effects of inhibition of RhoA were examined in this system to evaluate whether such inhibition would have the equivalent effect as the over-expression of miR-31. RNA interference techniques were used to knockdown RhoA expression. Transfection with RhoA siRNA for 48 hours significantly reduced RhoA mRNA and protein levels, as reflected in Figures 5A and 5B, in a manner similar to that observed following over-expression of the miR-31 mimic.
Primary T cells were then transfected with siRNA to RhoA or with the miR-31 mimic for 48 hours, and stimulated by PMA and ionomycin for 24 hours. After transfection and stimulation, IL-2 expression was measured. In agreement with the effect of the miR-31 mimic, knockdown of RhoA resulted in marked increase of expression of both IL-2 mRNA and its protein (Figures 6A and 6B). Further evaluation supports the conclusion that knockdown of
RhoA enhanced the activity of the IL-2 promoter (Figure 6C).
Example 5 - Elevated Expression Levels of IL-2 in Activated Lupus T cells
Considering that miR-31 was induced in activated T cells and regulated IL-2 production by targeting RhoA, we investigated the expression levels of miR-31 , RhoA, and IL-2 in activated T cells isolated from 15 SLE patients and 10 normal controls (NC). Further information regarding the subjects used for these studies is provided in Table 2. The results revealed that miR-31 and IL-2 expression in activated T cells from SLE patients were lower than that observed in NC, while the expression of RhoA was higher (Figures 7A, B, and C).
To further explore this relationship, miR-31 levels were manipulated to evaluate any affects on IL-2 production in T cells from SLE patients. Lupus T cells were transfected with miR-31 mimic or control mimic. After 24 hour stimulation by PMA and ionomycin, enhanced IL-2 protein expression was observed in activated lupus T cells transfected with miR-31 as shown in Figure 7D. This is consistent with using miR-31 levels to rescue the defects in IL-2 production observed in T cells of lupus patients.
Table 2: Clinical features of patients with SLE
Characteristic Control (n = 10) SLE (n = 15)
Sex,No. of male/female 1/9 1/14
Age (y) 26.5±1.243 30.2±4.357
Anti-dsDNA [P/N (n)a] NA 6/5
LN [P/N (n)]. NA 9/6
Medications
Steroids (n)b taking
<10 mg/d NA 2
10^10 mg/d NA 7
>40 mg/d NA 6
Secondary agents' [P/N (n)]. NA 10/5
Values are presented as mean±SD, except where indicated otherwise.
a. Because some patients were not examined, the number listed for the feature is less than the total number of patients. b. The dose of steroids presented in this article is that of prednisone. If other equivalent was taken, the dosage was converted (e.g., 40 mg methylprednisolonewas equivalent to 50 mg prednisone).
c. Some patients were receiving secondary antirheumatic agents, including chloroquine, cyclophosphamide, methotrexate, and azathioprine. LN, lupus nephritis; P/N, positive/negative (for the feature listed).
Materials and Methods
The following summarizes certain materials and methods utilized in conducting the foregoing examples 1-5.
Patients and healthy controls. All SLE patient samples were obtained from the
Department of Rheumatology of Renji Hospital (Shanghai, China) and met at least four of the American College of Rheumatology 1982 revised criteria for SLE. SLE activity was assessed with the SLE Disease Activity Index (SLEDAI). The healthy controls from healthy volunteers had no history of autoimmune diseases or immunosuppressive therapy and were matched with the patients for age, sex, and race. All participants were from the Chinese Han population.
Peripheral blood samples (10 mL) obtained from each subject were collected in tubes containing acid citrate dextrose formula A (ACD-A). The study was approved by the Research Ethics Board of Renji Hospital, Shanghai JiaoTong University, School of Medicine.
Isolation of CD3+ T cells. Peripheral blood mononuclear cells (PBMCs) were separated from the heparinized whole blood by density gradient centrifugation on Lymphoprep Ficoll- Paque™ PLUS (GEHealthcare, Chalfont, UK). CD3+ T cells were purified from the fresh PBMCs by positive selection using magnetic CD3 microbeads (Miltenyi Biotec) according to the manufacturer's protocol. T lymphocyte purity was > 95% analyzed by FACSCalibur (Becton Dickinson).
Cell culture and stimulation condition. Purified T lymphocytes were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin, stimulated with PMA (50ng/ml, Sigma-Aldrich) and ionomycin (^g/ml, Sigma- Aldrich) for different time at 37 °C under 5% C02. Jurkat, a T cell leukemia line, was grown in RPMI 1640 medium (Life Technologies, Rockville, MD) containing 10% FBS and 1% penicillin/
streptomycin at 37 °C under 5%> C02. Jurkat cells also were stimulated with PMA (50ng/ml) and ionomycin (^g/ml).
miRNA mimics, small interfering RNA and antagomirs. Small interfering RNA (siRNA) and miRNA mimics were synthesized by Genepharma (Shanghai, China). RhoA siRNA sequences referred to in (Ahmed et al., 2005), are as follows: RhoA-siRNA-1 : 5'- AAGATTATGACCGTCTGAGGC-3' (SEQ ID NO: 1); RhoA-siRNA-2: 5'- AAGGATCTTCGGA ATGATGAG-3' (SEQ ID NO: 2). The miRNA-31 mimic sequence is as follows: mimic: 5'- AGGC AAGAUGCUGGC AUAGCU-3 ' (SEQ ID NO: 3). Antagomir-31 and control constructs were ordered from Ribo biology (Guang dong, China). The antagomir-31 sequence is as follows: antagomir: 5'- AGCUAUGCCAGCAUCUUGCCU -3' (SEQ ID NO: 4). The combination of gain-of-function (mimic-induced downregulation of target genes normally inhibited by miRNA-31) and loss-of- function (antagomir-induced upregulation of target genes normally inhibited by miRNA-31) experiments demonstrated the miRNA-target relationships and allowed miRNAs functional analysis. For the foregoing oligonucleotides, the siRNAs and miRNA-31 mimic used were double stranded molecules and the antagomir was a single stranded molecule. The oligonucleotides were exogenously expressed in cells by transfecting the cells using Lipofectamine 2000 (Invitrogen).
Transfection. Human primary T cells were rested in RPMI 1640 for 2 hours, then transfected with miRNA or siRNA oligonucleotides using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. Six hours after transfection, T cells were added to fresh complete medium (RPMI 1640 medium supplemented with 10% FBS). After 24 hours, cells were stimulated with PMA and ionomycin for up to 24 hours at 37 °C under 5% C02. For inhibition of miR-31 , human primary T cells were resuspended in serum- free opti-DMEM medium (GIBCO) and transfected with 500 nM antagomir-31 or control scrambled antagomir. After six hours of transfection, RPMI medium supplemented with 500nM antagomir was added and cells were stimulated 24 hours later as described above.
Quantitative PCR. Total RNA was isolated with TRIzol reagent (Invitrogen). To quantify miRNA, the RNA (20ng) samples were reverse transcribed using the TaqMan®
MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). TaqMan MicroRNA assays were used according to the manufacturer's recommendations (Applied Biosystems) for real-time PCR. RNU48 (U48) was used as endogenous control for
normalization of expression values. For quantitative RT-PCR analysis of mRNA, 500ng total RNA was reverse-transcribed with the PrimeScript RT reagent Kit (Takara, Shiga, Japan). The cDNA was amplified by real-time PCR with SYBR Green (SYBR Premix Ex Taq RT-PCR kit; Takara, Shiga, Japan), and ribosomal protein L13A (RPL13A) was used as the internal control to normalize the amounts of cDNA. The TaqMan and SYBR Green assays were performed in duplicate on a 7900HT Fast Real-Time PCR instrument (Applied Biosystems). The relative expression levels were calculated using the 2- c method. The following custom primers were used for SYBR Green-based real-time PCR: RPL13A, forward 5'- CCTGGAGGAGAAGAGGAAAGAGA-3 ' (SEQ ID NO: 5), reverse 5'- TTGAGGACCTCTGTGTATTTGTCAA-3' (SEQ ID NO: 6). RhoA, forward 5'- TCTTCGG AATGATGAGC AC-3 ' (SEQ ID NO : 7), reverse 5 '-
CTTTGGTCTTTGCTGAACAC-3' (SEQ ID NO: 8). IL-2, forward 5'- TGCCAC AATGTAC AGGATGC-3 ' (SEQ ID NO: 9), reverse 5'-
GCCTTCTTGGGC ATGTAAAA-3 ' (SEQ ID NO: 10). Other primers were commercially available and/or correspond to published sequences. Alternative primers can be readily generated.
Cloning of reporter constructs, transient transfection and luciferase assays. pGL3 -Basic Luciferase Reporter Vector (Promega) was used for generation of IL-2 promoter reporter constructs. Briefly, the 884bp promoter region (-59 to +825bp bases) was amplified by PCR from genomic DNA, the primers used were: forward 5'-CAT TCATAGTGTCCCAGGTG-3' (SEQ ID NO: 11), reverse 5 '-C ATTGTGGC AGGAGTTGAG-3 ' (SEQ ID NO: 12).
The forward and reverse primers created Mlu I and Xho I sites respectively, and PCR products were ligated into the pGL3-Basic plasmid according to manufacturer's instructions. Jurkat cells were seeded at l x lO6 cells/well in a 24-well plate and transfected 2 hours later. pGL3 -basic luciferase reporter plasmids (lug) containing IL-2 promoter described above, miRNA oligonucleotides or siRNA and with a 50ng pRL-basic-luc vector used for normalization of transfection efficiency, were co-transfected into Jurkat cells using Lipofectamine 2000 (Invitrogen). After 24 hour recovery period, transfected cells were either left untreated or stimulated for 24 hours with PMA and ionomycin. Then, luciferase activity was assessed using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI), performed on a CENTRO XS3 LB 960 (Berthold Technologies) instrument according to the manufacturer's protocol. The ratio of Renilla luciferase to firefly luciferase was obtained for each well. All experiments were performed in triplicate.
Enzyme-linked immunosorbent assay (ELISA). ELISA for IL-2 protein secreted into the cell culture supernatant was quantified using commercially available kits (Xi Tang Biology, Shanghai, China) according to the manufacturer's protocol. Western blotting. In a 6-well plate, T cells were seeded at 5x 106 cells/well and transfected with miRNA oligonucleotides per well for lOOnM final concentration of miR-31 mimics or control mimics and lOOnM final concentration of siRNA RhoA or controls. Six hours after transfection, T cells were added to fresh complete medium. Two days after transfection, cells were lysed and proteins were extracted. Supernatants were then subjected to sodium dodecylsulfate-polyacrylamide gel electrophoresis, blotted with the indicated antibodies, and detected with Luminol/Enhancer Solution (Pierce, Rockford, IL). Western blotting of RhoA and Tublin were performed using mouse anti-RhoA antibody (Santa Cruz, CA,1 :200) and rabbit anti- Tublin antibody (Santa Cruz, CA, 1 :5,000). The volume tools of the software Quantity One (Bio-Rad) were used to quantitate the protein bands, according to the manufacturer's manual.
Data analysis. Data were analyzed using Prism 4 software, version 4.03 (GraphPad Software, San Diego, CA). The nonparametric Mann- Whitney test was used to compare gene expression between 2 groups, while an unpaired Student's t-test was used to compare reporter gene activity. P values (2 -tailed) less than 0.05 were considered statistically significant.
Sequence Listing
SEQ ID NO: 1 (RhoA - siRNA-1) - AAGATTATGACCGTCTGAGGC
SEQ ID NO: 2 (RhoA - siRNA-2) - AAGGATCTTCGGAATGATGAG
SEQ ID NO: 3 (miRNA-31 mimic) - AGGCAAGAUGCUGGCAUAGCU
SEQ ID NO: 4 (miRNA-31 antagomir) - AGCUAUGCCAGCAUCUUGCCU
SEQ ID NO: 5 (RPL13A forward primer) - CCTGGAGGAGAAGAGGAAAGAGA
SEQ ID NO: 6 (RPL13A reverse primer) - TTGAGGACCTCTGTGTATTTGTCAA
SEQ ID NO: 7 (RhoA forward primer) - TCTTCGGAATGATGAGCAC
SEQ ID NO: 8 (RhoA reverse primer) - CTTTGGTCTTTGCTGAACAC
SEQ ID NO: 9 (IL-2 forward primer) - TGCCACAATGTACAGGATGC
SEQ ID NO: 10 (IL-2 reverse primer) - GCCTTCTTGGGCATGTAAAA
SEQ ID NO: 11 (promoter forward primer) - CAT TCATAGTGTCCCAGGTG
SEQ ID NO: 12 (promoter reverse primer) - CATTGTGGCAGGAGTTGAG References
Fairhurst et al. (2006) Adv Immunol 92: 1-69.
Anders et al. (2009) Trends Mol Med 15(12): 553-561.
Nambiar et al. (2004) Methods Mol Med 102: 31-47.
Fujii et al. (2006) Autoimmune Rev 5(2): 143-144.
Kong et al. (2003) Ann NY Acad Sci 987: 60-67.
Moulton et al. (2011) Arthritis Res Ther 13(2): 207.
Lieberman et al. (2010) J Biomed Biotechnol Article ID 740619 (6 pages) [doi:
10.1155/2010/740619]
Tenbrock et al. (2004) Int Rev Immunol 23(3-4): 333-345.
Katsiari et al. (2005) J Clin Invest 115(11): 3193-3204.
Juang et al. (2005) J Clin Invest 115(4): 996-1005.
Herndon et al. (2002) Clin Immunol 103(2): 145-153.
Solomou et al. (2001) J Immunol 166(6): 4216-4222.
Denli et al. (2004) Nature 432(7014): 231-235.
Gregory et al. (2004) Nature 432(7014): 235-240.
Ambros. (2004) Nature 431(7006): 350-355.
Pauley et al. (2009) J Autoimmun 32(3-4): 189-194.
Lu et al. (2010) Cell 142(6): 914-929.
O'Connell et al. (2010) Immunity 33(4): 607-619.
Pauley et al. (2008) Ann NY Acad Sci 1143: 226-239.
Tang et al. (2009) Arthritis Rheum 60(4): 1065-1075.
Pan et al. (2010) J Immunol 184(12): 6773-6781.
Zhao et al. (2011) Arthritis Rheum 63(5): 1376-1386.
Yu et al. (2010) Cell Mol Immunol 7(3): 198-203.
Stittrich et al. (2010) Nat Immunol 1 1(11): 1057-1062.
Yu et al. (2009) Development 136(9): 1497-1507.
Curtale et al. (2010) Blood 115(2): 265-273.
Thai et al. (2007) Science 316 (5824): 604-608.
Rodriguez et al. (2007) Science 316(5824): 608-611.
Ahmed et al. (2005) Mol Cell Neurosci 28(3): 509-523.
Helms et al. (2007) J Leukoc Biol 82(2): 361-369.
Valastyan et al. (2009) Cee 137(6): 1032-1046.
Katsiari et al. (2006) Autoimmune Rev 5(2): 118-121.
Setoguchi et al. (2005) J Exp Med 201(5): 723-735.
Fontenot et al. (2005) Nat Immunol 6(11): 1142-1151.
Crispin et al. (2009) autoimmune Rev 8(3): 190-195.
Gomez-Martin et al. (2009) Autoimmune Rev 9(1): 34-39.
Nambiar et al. (2003) J Immunol 170(6): 2871-2876.
Nambiar et al. (2003) Arthritis Rheum 48(7): 1948-1955.
Bodor et al. (2007) J Leukoc Biol 81(1): 161-167.
Bodor et al. (2000) J Leukoc Biol 67(6): 774-779.
Bodor et al. (1998) J Biol Chem 273(16): 9544-9551.
Garcia et al. (2005) J Proteome Res 4(6): 2032-2042.
Hu et al. (2008) J Rheumatol 35(5): 804-810.
Creighton et al. (2010) Cancer Res 70(5): 1906-1915. Schmidt et al. (2004) Lupus 13(5): 348-352.
Hagiwara et al. (2000) Cytokine 12(7): 1035-1041.
Blenman et al. (2006) Lab Inves 86(11): 1136-1148.
Prud'homme. (2000) J Gene Med 2(4): 222-232.
Incorporate by Reference
All publications and patents mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent was specifically and individually indicated to be incorporated by reference.
While specific aspects of the subject disclosure have been discussed, the above specification is illustrative and not restrictive. Many variations of the disclosure will become apparent to those skilled in the art upon review of this specification and the claims below. The full scope of the disclosure should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.

Claims

We Claim:
1. A method of increasing interleukin-2 (IL-2) expression in a subject in need thereof, comprising administering to the subject an effective amount of a composition that increases expression of microRNA-31 or decreases expression of RhoA, wherein the subject in need thereof is a subject having systemic lupus erythematosus.
2. A method of increasing interleukin-2 (IL-2) expression in T cells of a subject having systemic lupus erythematosus, comprising contacting the T cells with an effective amount of a composition that increases expression of microRNA-31 or decreases expression of RhoA.
3. A method of treating systemic lupus erythematosus, comprising administering to a subject in need thereof an effective amount of a composition that increases expression of microRNA-31 or decreases expression of RhoA to treat the autoimmune condition.
4. A method of decreasing RhoA expression in a subject in need thereof, comprising administering to the subject an effective amount of a composition that increases expression of microRNA-31, wherein the subject in need thereof is a subject having systemic lupus erythematosus.
5. A method of decreasing RhoA expression in T cells of a subject having systemic lupus erythematosus, comprising contacting the T cells with an effective amount of a composition that increases expression of microRNA-31.
6. The method of any of claims 1-5, wherein the subject having systemic lupus
erythematosus is experiencing symptoms of a disease flare.
7. The method of any of claims 1-5, wherein the subject having systemic lupus
erythematosus is not experiencing symptoms of a disease flare.
8. The method of claim 6 or 7, wherein the subject's symptoms include lupus nephritis.
9. The method of claim 2 or 5, wherein the T cells are activated T cells in vitro.
10. The method of any of claims 1-9, wherein the composition comprises a nucleic acid comprising a nucleotide sequence that increases expression of microRNA-31.
11. The method of any of claims 1-10, wherein the composition comprises a nucleic acid comprising a nucleotide sequence that decreases expression of RhoA.
12. The method of claim 10 or 11 , wherein the composition comprises microRNA-31.
13. The method of claim 10 or 11, wherein the composition comprises a short interfering nucleic acid (siNA).
14. The method of claim 13, wherein the composition comprises a siNA that can hybridize to RhoA.
15. The method of any of claims 1-14, wherein decreases expression of RhoA comprises decreases expression of RhoA transcripts.
16. The method of any of claims 1-15, wherein decreases expression of RhoA comprises decreases expression of RhoA protein.
17. The method of claim 1 or 2, wherein increases expression of IL-2 comprises increases expression of IL-2 transcripts.
18. The method of claim 1, 2 or 17, wherein increases expression of IL-2 comprises increases expression of IL-2 protein.
19. The method of any of claims 1-18, wherein the method further comprises assaying expression of IL-2 in a sample taken from the subject at a time subsequent to administering the composition.
20. The method of any of claims 1-19, wherein the method further comprises assaying expression of RhoA in a sample taken from the subject at a time subsequent to administering the composition.
21. The method of claim 19 or 20, wherein the sample comprises a blood sample.
22. The method of any of claims 19-21, wherein assaying expression of IL-2 comprises assaying expression of IL-2 transcripts in T cells.
23. The method of any of claims 19-21, wherein assaying expression of IL-2 comprises assaying expression of IL-2 protein in the sample.
24. The method of claim 20 or 21, wherein assaying expression of RhoA comprises assaying expression of RhoA transcripts in T cells.
25. The method of claim 20 or 21, wherein assaying expression of RhoA comprises assaying expression of RhoA protein in the sample.
26. A method comprising, assaying the presence, absence or amount of a biomarker in a subject having systemic lupus erythematosus to whom a compound has been administered, wherein the biomarker is selected from microRNA-31 , RhoA or IL-2; and determining whether the dosage or dosing regimen of the compound subsequently administered to the subject is adjusted based on the presence, absence or amount of the biomarker assayed.
27. The method of claim 26, wherein the subject having systemic lupus erythematosus is experiencing symptoms of a disease flare.
28. The method of claim 26, wherein the subject having systemic lupus erythematosus is not experiencing symptoms of a disease flare.
29. The method of any of claims 26-28, wherein the compound comprises a steroid or an immunosuppressive agent.
30. The method of any of claims 26-28, wherein the compound comprises a composition that that increases microRNA-31 or decreases RhoA.
31. The method of any of claims 26-28, wherein the compound comprises IL-2.
32. A method of diagnosing systemic lupus erythematosus, comprising obtaining a sample from a subject suspected of having systemic lupus erythematosus; and assaying in the sample expression of microRNA-31 or RhoA.
33. The method of claim 32, wherein the subject suspected of having systemic lupus erythematosus is not experiencing symptoms of a disease flare.
34. A method of monitoring treatment of systemic lupus erythematosus comprising detecting expression of microRNA-31 or RhoA in a sample from a subject undergoing treatment for systemic lupus erythematosus; and comparing the expression of microRNA-31 or RhoA to expression in a sample from the same subject, which sample was obtained prior to the treatment or at an earlier time point during the treatment; wherein an increase in microRNA-31 or a decrease in RhoA in a sample obtained at a later point during treatment versus that obtained prior to treatment or at an earlier time point during treatment indicates effectiveness of the treatment, thereby monitoring the treatment.
35. A method of treating a subject having systemic lupus erythematosus comprising comparing expression of microRNA-31 or RhoA from a sample taken from a subject prior to initiation of a particular treatment for systemic lupus erythematosus to a standard range reflecting expression in samples from healthy subjects, wherein expression of microRNA-31 below the standard range or expression of RhoA above the standard range indicates susceptibility to treatment for systemic lupus erythematosus; treating the subject with an effective amount of a composition comprising microRNA-31 , siNA that hybridizes to RhoA or IL-2 protein if the subject is determined to be susceptible to treatment for systemic lupus erythematosus; detecting expression of microRNA-31 or RhoA in a post-treatment sample from the subject; and comparing expression of microRNA-31 or RhoA in the post-treatment sample to expression in the sample taken prior to initiation of the particular treatment.
EP12804592.9A 2011-06-27 2012-06-26 Microrna-31 compositions and methods for use in autoimmune disease Withdrawn EP2723349A4 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161501482P 2011-06-27 2011-06-27
PCT/US2012/044197 WO2013003346A2 (en) 2011-06-27 2012-06-26 Microrna-31 compositions and methods for use in autoimmune disease

Publications (2)

Publication Number Publication Date
EP2723349A2 true EP2723349A2 (en) 2014-04-30
EP2723349A4 EP2723349A4 (en) 2015-01-14

Family

ID=47424764

Family Applications (1)

Application Number Title Priority Date Filing Date
EP12804592.9A Withdrawn EP2723349A4 (en) 2011-06-27 2012-06-26 Microrna-31 compositions and methods for use in autoimmune disease

Country Status (8)

Country Link
EP (1) EP2723349A4 (en)
JP (1) JP2014521600A (en)
KR (1) KR20140066671A (en)
AU (1) AU2012275552A1 (en)
BR (1) BR112013033794A2 (en)
CA (1) CA2841158A1 (en)
RU (1) RU2014102217A (en)
WO (1) WO2013003346A2 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021104208A1 (en) * 2019-11-26 2021-06-03 中国科学院上海营养与健康研究所 Endogenous small rna molecular target for preventing skin aging and premature aging and application thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1432724A4 (en) * 2002-02-20 2006-02-01 Sirna Therapeutics Inc INTERFERENCE MEDIATION INHIBITION OF GENE RNA FROM MAP KINASE
CN101376910B (en) * 2007-08-27 2012-01-11 中国科学院上海生命科学研究院 Use of miRNA genes in systemic lupus erythematosus disease diagnose and treatment
CA2745919A1 (en) * 2008-12-05 2010-06-10 Whitehead Institute For Biomedical Research Compositions and methods relating to mir-31

Also Published As

Publication number Publication date
JP2014521600A (en) 2014-08-28
WO2013003346A3 (en) 2013-02-28
RU2014102217A (en) 2015-08-10
CA2841158A1 (en) 2013-01-03
KR20140066671A (en) 2014-06-02
AU2012275552A1 (en) 2014-02-06
WO2013003346A2 (en) 2013-01-03
BR112013033794A2 (en) 2019-09-24
EP2723349A4 (en) 2015-01-14

Similar Documents

Publication Publication Date Title
RU2604489C2 (en) Treatment of apolipoprotein-a1 related diseases by inhibition of natural antisense transcript to apolipoprotein-a1
EP2370580B1 (en) Treatment of sirtuin 1 (sirt1) related diseases by inhibition of natural antisense transcript to sirtuin 1
EP2111449B1 (en) H19 silencing nucleic acid agents for treating rheumatoid arthritis
US9789132B2 (en) Methods targeting miR-128 for regulating cholesterol/lipid metabolism
CN101376910A (en) Use of miRNA genes in systemic lupus erythematosus disease diagnose and treatment
CA2599524C (en) Materials and methods for treatment of allergic disease
WO2013003346A2 (en) Microrna-31 compositions and methods for use in autoimmune disease
WO2011061194A1 (en) Inhibitors of centrosomal clustering
US20220282257A1 (en) Method of modulating adiposity
WO2020171889A1 (en) Blocking lipid accumulation or inflammation in thyroid eye disease
HK1162574B (en) Treatment of sirtuin 1 (sirt1) related diseases by inhibition of natural antisense transcript to sirtuin 1
HK1162574A (en) Treatment of sirtuin 1 (sirt1) related diseases by inhibition of natural antisense transcript to sirtuin 1

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20140116

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 31/7088 20060101AFI20141128BHEP

Ipc: C12N 15/113 20100101ALI20141128BHEP

A4 Supplementary search report drawn up and despatched

Effective date: 20141212

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20150723