EP2705161A1 - Nucleoside-triphosphate conjugate and methods for the use thereof - Google Patents

Nucleoside-triphosphate conjugate and methods for the use thereof

Info

Publication number
EP2705161A1
EP2705161A1 EP12730787.4A EP12730787A EP2705161A1 EP 2705161 A1 EP2705161 A1 EP 2705161A1 EP 12730787 A EP12730787 A EP 12730787A EP 2705161 A1 EP2705161 A1 EP 2705161A1
Authority
EP
European Patent Office
Prior art keywords
nucleotide
oligonucleotide
component
nuc
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP12730787.4A
Other languages
German (de)
French (fr)
Inventor
Claus Becker
Norbert Basler
Andreas Müller-Hermann
Petra VAN HUSEN
Dmitry Cherkasov
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genovoxx GmbH
Original Assignee
Genovoxx GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genovoxx GmbH filed Critical Genovoxx GmbH
Publication of EP2705161A1 publication Critical patent/EP2705161A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C12Q1/6874—Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation

Definitions

  • the present invention describes novel structures of nucleotide conjugates, as well as methods for their use.
  • nucleotide conjugates can be used in labeling reactions of nucleic acid chains or used in a sequencing reaction.
  • conjugates are used as reversible terminators in sequencing by the synthesis.
  • Novel nuc macromolecules are provided with new marker component structures and new features.
  • nucleotide structures make new compositions of nuc macromolecules having the basic structure described in applications Cherkasov et al WO2011050938, Cherkasov et al., WO2005044836, Cherkasov et al., WO2006097320, Cherkasov et al., WO2008043426, Cherkasov et al., DE 10356837, Cherkasov et al DE 102004009704. These applications are incorporated herein by reference and are cited in their entirety as "incorporated by reference”.
  • Nuc-macromolecules include at least one nuc-component, for example a 2 '- deoxinukleosid-triphosphate, at least one macromolecular markers and Minden a linker between this marker and the nuc-component.
  • nucleotide conjugates which contain at least one nucleoside triphosphate, at least one Oligonucleotides, and a linker between the nucleoside triphosphate and the oligonucleotide.
  • the oligonucleotide in such a nucleotide conjugate is preferably part of the label. Coupling of the linker to the nucleoside triphosphate (nuc-component of the nucleotide conjugate) can in one embodiment be carried out at the base (eg at the 5-position of the pyrimidines or at the 7-position of 7-deazapurines).
  • coupling of the linker to the terminal phosphate group of the nucleotide occurs.
  • coupling of the linker to the 3 ' position of the sugar of the nucleotide occurs (eg, to 3 ' OH group of a 2 ' deoxyribose).
  • the linker preferably includes at least one cleavable group, e.g. a disulfide group.
  • the coupling of the linker to the oligonucleotide takes place in one embodiment at the 5 ' end of the oligonucleotide. In another embodiment, the coupling of the linker to the oligonucleotide takes place at the 3 ' end of the oligonucleotide. In another embodiment, the coupling of the linker to the oligonucleotide occurs at an internal position of the oligonucleotide. In one embodiment of the invention, the composition of the oligonucleotide is chosen such that it can not bind to the nucleic acid sequences to be labeled. This can be achieved, for example, by complete or partial double strand formation within the oligonucleotide (eg hairpin strucures) or by appropriate reaction conditions.
  • the composition of the oligonucleotide is chosen such that it can bind at least to a nucleic acid sequence to be labeled.
  • a method for synthesizing nucleic acid chains is described in which at least four types of nucleotide conjugates (eg, dATP conjugate, dCTP conjugate, dGTP conjugate, dUTP conjugate) are simultaneously in contact with at least one primer template Complex and at least one DNA polymerase and incubated under conditions that allow incorporation of a complementary nucleoside triphosphate of the nucleotide conjugates to the primer.
  • nuc-macromolecules with predominantly or absolutely sequence-specific binding to a target sequence are described in Cherkasov et al WO2011050938.
  • nucleotide conjugates having enhanced binding to a nucleic acid chain to be labeled, which binding is predominantly non-sequence specific. Rather, nucleotide conjugates have the ability to bind sequence-unspecifically to several different nucleic acid chains to be labeled. Such sequence-unspecific binding of nucleotide conjugates to be labeled allows for unexpected applications. For example, significantly low concentrations of nucleotide conjugates can be used to achieve an incorporation event of a nuc-component. Use of low concentrations of nucleotide conjugates is advantageous, for example, in single-molecule analysis of nucleic acids. Low concentrations cause a significantly lower background signal. This can increase the quality of the signals in an assay.
  • this sequence-unspecific binding to nucleic acid chains takes place, for example, to form the base pairing between the oligonucleotide of the nucleotide conjugate and the nucleic acid chain to be labeled, such base pairing occurring only over a relatively short section (eg 3-15 bases) of the nucleic acid chain and therefore preferably has a low sequence specificity.
  • the sequence of the oligonucleotide within the nucleotide conjugate includes at least one sequence segment which can bind to the nucleic acid chains under base pairing.
  • this sequence portion of the oligonucleotide is single-stranded.
  • the length of this fragment is preferably selected such that the oligonucleotide can bind to the nucleic acid chain to be labeled by formation of, for example, 3 to 6, 7 to 10, 10 to 15 base pairs (continuously or else separated by non-complementary regions).
  • nucleotide conjugates are incubated with nucleic acid chains under conditions allowing for sequence-unspecific binding between them.
  • nucleotide conjugates with longer oligonucleotides eg between 15 and 50 nucleotides
  • nucleotide conjugates include positively charged portions, eg polylysine portion or polyethylenimine (PEI), which bind to the nucleic acid chains via electrostatic charge.
  • PEI polylysine portion or polyethylenimine
  • These sections may function as linkers between the nuc-component and the oligonucleotide component (eg, 2-10 lysine residues as a short peptide).
  • PNA peptide nucleic acids having a positively charged backbone may be used as the oligonucleotide within the nuc macromolecule.
  • nucleotide conjugates include proteins capable of sequence-nonspecific binding to nucleic acid chains, e.g. a single-strand binding protein.
  • nucleotide conjugates include at least one oligonucleotide for enhancing the binding to a nucleic acid chain to be labeled.
  • At least one composition of several nuc-macromolecules having the same nuc-component is used.
  • Such a composition preferably includes a same type of nuc-component, e.g. dATP analog coupled to different oligonucleotides.
  • Each of the oligonucleotides of such composition includes at least one segment of sequence capable of binding to at least one nucleic acid chain to be labeled.
  • this sequence segment is single-stranded.
  • the length of this fragment is preferably selected so that each oligonucleotide can bind to the nucleic acid chain to be labeled via formation of 3 to 20, preferably to form 3 to 10, more preferably 3 to 6 base pairs.
  • Such sequence sections may also be referred to as binding sections of the oligonucleotides. They are referred to as "B-sections.”
  • B-sections of oligonucleotides differ between individual oligonucleotides of a population of nucleotide conjugates (section B (1), B (2), B (3), etc., to B (n)
  • the composition of the B-segments within a population maps all possible variants (eg, randomized Hexamers with 4 ⁇ ⁇ variants, where (n) represents the number of nucleotide monomers in an oligonucleotide).
  • composition of the B sections within a population is restricted to a few selected variants of the oligonucleotides, wherein the number of different variants of the oligonucleotides may be between 10 and 100,000.
  • each of the oligonucleotides of such a composition includes a signal-giving or signal-conferring marker characteristic of this composition, e.g. a dye or another, for all oligonucleotides uniform sequence portion of the oligonucleotide.
  • a composition of nucleotide conjugates includes a uniform type of nuc-component, for example, a unitary nucleoside triphosphate, and a signal-pending or signal-mediated marker characteristic of that population, and a plurality of oligonucleotides.
  • Oligonucleotides within a composition differ from one another in the structure of the B segment.
  • the total number of variations of oligonucleotides within such a composition includes ranges from 4 3 to 4 50, preferably from 4 ⁇ 5 to 4 ⁇ 20, more preferably 4 6 to 4 ⁇ 15.
  • the length of the oligonucleotides is suitably chosen so that such a number of variations can be achieved.
  • such a population can bind to other single-stranded nucleic acid chains of any composition.
  • composition of nucleotide conjugates is preferably incubated with a nucleic acid chain to be labeled under reaction conditions which permit reversible binding between oligonucleotides and the nucleic acid chain to be labeled. This can be controlled, for example, by reaction temperature.
  • nucleic acid chains Under suitable temperature conditions, binding of oligonucleotides of the nuc-macromolecules and single strands of the nucleic acid chains to be labeled occurs. Nucleotide-conjugate-template complexes are formed.
  • the reaction temperature is below the Tm (eg, Tm minus 5 ° C) of potential nucleotide-conjugate template complexes.
  • Tm eg, Tm minus 5 ° C
  • the formation of nucleotide-conjugate-template complexes is preferred.
  • the reaction temperature is around the Tm (e.g., Tm plus / minus 5 ° C) of potential nucleotide-conjugate template complexes.
  • Tm e.g., Tm plus / minus 5 ° C
  • the binding within potential nucleotide-conjugate-template complexes is reversible and is formed several times and abolished thanks to reaction conditions.
  • the reaction temperature is preferably above Tm (e.g., Tm + 5 ° C) of potential nucleotide-conjugate template complexes.
  • Tm e.g., Tm + 5 ° C
  • the B portion preferably 3 to 15 base pairs
  • at least four compositions are used, each composition including nuc-macromolecules with the same nuc-component, at least one identical marker and different oligonucleotides.
  • nuc macromolecules For example, four composites of nuc macromolecules will be used, one composition including a dATP-nuk component, a second composition including a dCTP nuk component, a third composition including a dGTP nuk component, a fourth composition a dUTP Includes nuk component,
  • At least one composition of such nucleotide conjugates is brought into contact with at least one primer-template complex and at least one polymerase and incubated under conditions which reversibly bind the oligonucleotide portions of the conjugates to the single-stranded portion of the primers Matrices complexes, as well as incorporation of a complementary nucleoside triphosphate to the primer allows.
  • nucleotide conjugates eg dATP population, dCTP population, dGTP population, dUTP population
  • dATP population e.g. dATP population, dCTP population, dGTP population, dUTP population
  • dGTP population e.g. dGTP population
  • dUTP population e.g. dATP population, dCTP population, dGTP population, dUTP population
  • complex and at least one polymerase and incubated under conditions which allows a reversibe binding of the oligonucleotide portions of the conjugates to the single-stranded portion of the primer-template complexes, as well as incorporation of a complementary nucleoside triphosphate to the primer.
  • Each of said populations includes at least one nucleoside triphosphate moiety, as well as an oligonucleotide population characteristic of that nucleoside triphosphate ( Figures 4-7).
  • nucleotide conjugates may be provided with oligonucleotides that partially include self-complementary double-stranded portions and at the same time B-portions for binding to nucleic acid chains to be labeled.
  • additional nucleotides are used.
  • natural dNTP dATP, dCTP, dGTP, dTTP
  • ddNTP labeled nucleotides
  • dUTP-16-biotin can be used.
  • nuc-macromolecules are used, described in applications Cherkasov et al WO2011050938, Cherkasov et al., WO2005044836, Cherkasov et al. WO2006097320, Cherkasov et al., WO2008043426.
  • nucleotide conjugates are used in concentrations lying in the following ranges: 10 pmol / l-1 nmol / l, 1 nmol / l-10 nmol / l, 10 nmol / l-100 nmol / l, 100 nmol / l - 1 pmol / l, 1 pmol / l - 10 pmol / l, 10 pmol / l - 1 mmol / l. Particularly preferred are ranges between 10 nmol / l and 10 pmol / l. These concentrations may refer to the concentration of the nuc-component of the nucleotide conjugates.
  • nucleotide conjugates of the invention can be used in methods for the enzymatic synthesis of nucleic acid chains. Most preferably, these nucleotide conjugates are used in methods for labeling and sequencing nucleic acid chains. Examples of carrying out methods for labeling or sequencing-by-synthesis are known to a person skilled in the art.
  • such a method for sequencing nucleic acid chains includes the steps of: a) providing at least one population of extensible nucleic acid chain primer complexes (NSK primer complexes) b) incubating at least one type of nucleotide conjugate together with at least a type of polymerase with the NSK-primer complexes provided in step (a) under conditions which facilitate the incorporation of nucleotide conjugates with complementary nucleobases (nuclease).
  • NSK primer complexes extensible nucleic acid chain primer complexes
  • nucleotide conjugate having a characteristic mark.
  • the nucleic acid chains to be sequenced can be fixed to a solid phase in a random arrangement and at least some of the NSK primer complexes can be optically addressed individually (sequencing-by-synthesis method according to Helicos Biosiences or Genovoxx GmbH).
  • the nucleic acid chains to be sequenced can be fixed to a solid phase in random order and form microcolonies with identical sequences in each colony (sequencing-by-synthesis Solexa method of Illumina).
  • Macromolecular compound a molecule, or a molecular complex, or a nanocrystal or nanoparticle whose mass is between 2kDa and 20kDa, 2kDa and 50kDa, 2kDa and 100kDa, 100kDa and 200kDa, 200kDa and 100OkDa or IM Da and lOOMDa or 100MDa and 100 GDa lies.
  • macromolecular compounds are nucleic acids, such as oligonucleotides with a length of more than 7 nucleotides, polynucleotides, polypeptides, proteins or enzymes, quantum dots, polymers such as PEG, Mowiol, dextran, polyacrylate, nanogold particles but also complexes consisting of several macromolecules consist.
  • Biotin natural nucleotides
  • dATP dATP
  • dUTP dUTP
  • dyes such as Cy3, rhodamine, fluorescein
  • conventionally modified nucleotides such as biotin-16-dUTP.
  • a nuc-macromolecule in the context of this application is a chemical structure (a nucleotide analog, a nucleotide conjugate) comprising one or more nuc-components, one or more linker components and at least one Marker component includes:
  • Linker - is a linker component
  • Marker - a marker component is
  • n is a number from 1 to 100
  • Nuk - is a nucleotide or a nucleoside monomer (nuc-component)
  • Linker - Its composition is not limited as long as the substrate properties of the nucleotides are not lost. Its length is between 5 and 100 chain atoms.
  • Marker - a marker component that includes at least one nucleic acid sequence of between 3 and 200 nucleobases in length (one oligonucleotide)
  • n - a number from 1 to 100, where (n) is an average value can represent.
  • Nuk component is a substrate for nucleotide or nucleoside accepting enzyme.
  • Nuk component can be both a nucleotide and a nucleoside. In the following, in the description nucleotides are considered representative of both classes. Nucleotides can be converted into a nucleotide form by means of appropriate enzymes or chemical methods.
  • nuc-component is a nucleotide or nucleoside monomer coupled to the linker moiety.
  • nucleotide variants suitable as substrate for nucleotide-accepting enzymes can serve as nuc-component of the nuc-macromolecule so that both natural and modified nucleotides (nucleotide analogues) are suitable for the nuc-component.
  • base, sugar or phosphate moieties can be modified.
  • nucleotide modifications are known to those of skill in the art ("Nucleoside Triphosphates and their Analogs", Morteza Vaghefi, 2005, ISBN 1-57444-498-0; "Deoxynucleosides analogous to Cancer Therapy” Godefridus J. Peters, 2006, ISBN 1- Leroy B.
  • the nuc-component preferably includes a base component (base), a sugar component (sugar) and optionally a phosphate component (phosphate).
  • Base, sugar and phosphate can be modified, ie the basic structure looks similar to the natural nucleotides or nucleosides, but carries, for example, additional chemical groups. Examples of combinations of different components are known to the person skilled in the art.
  • Such nuc-components can be used in many enzymatic and chemical reactions (Wright, Wright et al., Pharmac.Ther 1990, V. 47, p 447-).
  • the nuc-component is a substrate for DNA polymerases.
  • the nuc-component is a substrate for RNA polymerases.
  • nucleotides that allow such substrate properties can be used as a nuc-component.
  • substrates for nucleotide-accepting enzymes lacking a constituent of a conventional nucleotide, eg, acyclic nucleotide analogs can also be used as a nuc-component.
  • nuc-component 1.3.3.1.1 Variations on the phosphate
  • the nuc-component is a nucleoside. In another embodiment, the nuc-component is a nucleoside monophosphate. In another embodiment, the nuc-component is a nucleoside diphosphate. In another embodiment, the nuclide component Component is a nucleoside triphosphate. Also higher phosphate derivatives (tetraphosphate, pentaphosphates, etc.) can be used.
  • the phosphate modifications mentioned can, as with nucleoside triphosphates, be located at the 5 ' position or also at other positions of the sugar part of the nucleotide, for example at the 3 ' position.
  • the phosphate moiety may include modifications, such modifications include, for example, in one embodiment, a linker (Jameson, D., et al., Methods in Enzymology 1997, V. 278, p363, A. Draganescu et al., J. Biol. Chem. 2000, v.275, 4555).
  • the phosphate component of the nuc-component includes thiotriphosphate compounds (Burges et al., PNAS 1978 v. 75, pp. 4798-).
  • the phosphate component of the nuc-component includes protected phosphate groups (e.g., phosphoramidites).
  • the phosphate component is the link between the nuc-component and the linker component of the nuc-macromolecules.
  • the nuc-component may be a nucleotide or nucleoside or its analogues occurring naturally in the nucleic acids, preferably those participating in Watson-Crick pair formation, for example adenine, guanine, thymine, cytosine, uracil, inosine, or a modified base such as eg 7-deazaadenine, 7-deazaguanine, 6-thioadenine, literature see. above.
  • the base may include modifications, such modifications include, for example, in one embodiment, a linker coupled to the base, such as an amino-propargyl linker or an amino-allyl linker, further examples of the linkers are known (Ward et al US Pat 4711955, G.
  • the linker coupled to the base is the link between the nuc-component and the linker component of the nuc-macromolecules. Further modifications to the base are shown, for example, in the catalog of Trilink Biotechnologies, Inc. San Diego, USA in "Nucleosides triphosphates and their analogs", Morteza Vaghefi, 2005 ISBN 1-57444-498-0. 1.3.3.1.3 Variations on sugar
  • the sugar component of the nucleotides which are used for example in diagnostics, therapy or research.
  • Such variations include for example, ribose, 2 '-Deoxyribose or 2', 3 '-Dideoxyribose.
  • the sugar component may include modifications (Metzger, M., et al., Nucleic Acid Research 1994, V. 22, 4259, Tsien WO 91/06678), such modifications include, for example, in one embodiment, a linker.
  • the modifying group or linker may be reversibly coupled to the sugar moiety (Hovinen et al., J. Chem. Soc.Prking Trans., 1994, pp.
  • the linker coupled to the sugar component is the link between the nuc-component and the linker component of the nuc-macromolecules.
  • the sugar component includes, for example, the following modifications: optionally, the 3 ' or the 2 ' -OH groups can be replaced by the following atoms or groups: halogen atoms, hydrogen, amino, mercapto or azido group ( Beabealashvilli et al., Biochem Biophys Acta 1986, v.868, 136-, Yuzhanov et al., FEBS Lett., 1992, v. 306, 185-).
  • the nuc-component includes acyclic nucleotide or nucleoside modifications (A.Hollow Current Pharmaceutical Design 2003 v. 9, 2567, G. Wright et al., Pharmac.Ther 1990, v. 47, pp. 447-).
  • the sugar component may include a double bond.
  • 2 '-Deoxynukleotide for example 2' -Deoxyuridin- triphosphate, 2 '-Deoxycytidin triphosphate, 2' -Deoxyadenosin triphosphate, 2 - deoxyguanosine triphosphate dUTP, dCTP, dATP and dGTP, respectively.
  • nucleotide conjugates The presence or absence of the nuc-component's ability to further couple nucleotides with a polymerase is critical to the properties of nucleotide conjugates.
  • nucleotide analogues are used as nuc-component, which occur as terminators of the enzymatic synthesis.
  • An example of this is represented by ddNTP analogs, e.g. B. 2 ', 3' dideoxy-UTP.
  • ddNTP analogs e.g. B. 2 ', 3' dideoxy-UTP.
  • a person skilled in the art will be familiar with further examples of terminators.
  • the nuc-component is connected to the linker at a coupling site.
  • the coupling site of the linker to the nuc-component is in one embodiment at the base.
  • linker is coupled to sugar (ribose or deoxyribose).
  • the linker is coupled to the terminal phosphate group of the phosphate moiety of the nuc-components.
  • connection between the linker component and the nuc-component is preferably covalent.
  • the coupling site When the coupling site is at the base, it is preferably located at positions 4 or 5 at pyrimidine bases and at positions 6, 7, 8 at the purine bases (Ward et al., US Patent 4,711,955, G. Wright et Pharmac.Ther 1990, V. 47, p 447, Hobbs et al., US Patent 5,047,519 or other linkers, eg, Klevan US Pat. 4,828,979, Seela US Pat. Hanna M. Method in Enzymology 1996 v.274, p.403, Zhu et al NAR 1994 v.22 p.3418, Jameson et al Method in Enzymology, 1997, v. 278 pp.
  • the position of the coupling site depends on the field of application of nuc macromolecules.
  • coupling sites on the sugar or on the base are preferably used.
  • the coupling to the gamma or beta-phosphate groups can be carried out, for example, if the label is to be released during the incorporation of the nuc-macromolecule.
  • the connection between the nuc-component and the linker component takes place, for example, via a coupling unit (L) which is a part of the linker component.
  • connection between the nuc-component and the linker may be resistant, eg at temperatures up to 130 ° C, for pH ranges between 1 and 14, and / or resistant to hydrolytic enzymes (eg proteases, esterases).
  • hydrolytic enzymes eg proteases, esterases
  • the connection between the nuc-component and the linker is cleavable under mild conditions. This fissile connection allows removal of the linker and marker components.
  • Your Choice is not limited, provided that it remains stable under the conditions of the enzymatic reaction, does not cause irreversible disruption of the enzymes (eg polymerase) and under mild conditions can be split off.
  • mild conditions are meant those conditions which, for example, do not destroy nucleic acid-primer complexes, for example the pH preferably being between 3 and 11 and the temperature between 0 ° C and a temperature value (x).
  • This temperature value (x) depends on the Tm of the nucleic acid-primer complex (Tm is the melting point) and is calculated, for example, as Tm (nucleic acid-primer complex) minus 5 ° C (eg Tm is 47 ° C, then the maximum Temperature at 42 ° C, under these conditions are particularly suitable ester, thioester, acetals, phosphoester, disulfide compounds and photolabile compounds as cleavable compounds).
  • said cleavable compound belongs to chemically or enzymatically cleavable or photolabile compounds.
  • chemically cleavable groups ester, thioester, tartrate, disulfide, diol (eg, -CH 2 (OH) -CH 2 (OH) -), acetal compounds are preferred (Short WO 9949082, "Chemistry of protein conjugation and crosslinking "Shan S. Wong 1993 CRC Press Inc., Herman et al Method in Enzymology 1990 V.184 S.584, Lomant et al., J. Mol. Biol., 1976 V.
  • nuc-component only one nuc-component is coupled per one nuc-macromolecule. In another embodiment of the invention, several nuc-components are coupled per nuc-macromolecule. Several nuc-components may be unitary or different, for example, with an average of from 2 to 5, 5 to 10, 10 to 25, 25 to 50, 50 to 100 nuc-components per one nuc-macromolecule.
  • linker is, inter alia, to link a nuc-component and a marker component in such a way that the substrate properties of the nuc-component for nucleotide-accepting enzymes are not lost despite coupling of a macromolecular marker.
  • linker or linker Component is used synonymously in the application and refers to the entire structural portion of the nuc macromolecule between the nuc-component and the marker component.
  • the exact linker composition is not limited and may vary. In one embodiment, the linker is preferably hydrophilic.
  • the average linker length includes the following ranges: between 2 and 5, 5 and 10, 10 to 20, 20 to 30, 30 to 40, 40 to 50, 50 to 60, 60 to 70, 70 to 80, 80 to 90, 90 to 100, 50 to 100, 100 to 1000 chain atoms (chain atoms are counted), so the average linker length is between 2 and 5, 5 and 10, 10 to 20, 20 to 30, 30 to 40, 40 to 50, 50 to 60, 60 to 70, 70 to 80, 80 to 90, 90 to 100, 50 to 100, 100 to 1000 angstroms (measured on a potentially maximally extended molecule).
  • linker components may be the same or different in length.
  • Some sections of the linker may contain rigid areas and other sections may contain flexible areas.
  • nuc-macromolecules have a short linker. Its length includes ranges between 2 to 5, 5 to 10, 10 to 20, 20 to 30, 30 to 40, 40 to 50 chain atoms.
  • linkers may carry functional groups such as amino, carboxy, mercapto, hydroxy, alkyn, isothiocyanate, aldehyde or azide groups.
  • groups can be provided in a reactive form, eg, NHS ester for carboxy group.
  • Other molecules can be coupled to these groups.
  • cross-linkers are coupled to the short linker of the nuc-component so that the resulting nuc-component can be bound to other substances, eg macromolecular linker component or marker components.
  • the linker may contain one or more units of polymers, such as amino acids, sugars, PEG units or carboxylic acids.
  • short linkers may be the coupling unit (L) of a long linker
  • cross-linkers are known to a person skilled in the art ("Chemistry of protein conjugation and crosslinking" Shan S. Wong 1993.) Many cross-linkers are commercially available, eg by Invitrogen (Lifescience Technologies, Pierce Biotech, Iris-Biotech) Examples of couplings of various substances to macromolecules, eg to oligonucleotides, are also known (Y. Singh et al Chem. Soc. Rev.
  • linker between the nuc-component and the marker component can be built up in a plurality of chemical steps Further examples of short linkers between a nuc-component and a marker are shown by the example of the connection between a nucleoside triphosphate (US Pat. NUK) and an oligonucleotide (OLN).
  • US Pat. NUK nucleoside triphosphate
  • OPN oligonucleotide
  • NUK- (CH 2 ) n -OLN NUK-A- (CH 2 ) n -OLN
  • NUK- (CH 2 ) n -B-OLN NUK- (CH 2 ) n -OLN
  • NUK- (CH CH-) n -OLN
  • NUK- (A-CH CH-) n -OLN
  • NUK- (CH CH-B-) n -OLN
  • NUK-A-CH CH- (CH 2 -) n -OLN
  • NUK - (- CH CH-CH 2 ) n -B-OLN
  • NUK - (- CH CH-CH 2 - CH 2 ) n - B-OLN
  • NUK - (- O-CH 2 -CH 2 ) n -B-OLN NUK-A - (- O-CH 2 -CH 2 ) n -OLN
  • NUK-A - (- O-CH 2 -CH 2 ) n -OLN NUK-A - (- O-CH 2 -CH 2 )
  • Nuk - is the nuk component
  • OLN - is an oligonucleotide
  • a and B include the following structural elements: -NH-, -O-, -S-, -SS-, -CO-NH-, -NH - CO-, -CO-O-, -O-CO-, -CO-S-, -S-CO-, -P (0) 2 -, -Si-, - (CH 2 -CH 2)
  • a long linker is used, with a length of more than 50 chain atoms.
  • the linker component has in its structure, for example, the following components:
  • linker component The division of the linker component into individual components is purely functional and is intended only to illustrate the structure. Depending on the perspective, individual structures of the linker can be calculated for one or the other component.
  • the coupling unit L has the function of connecting the linker component and the nuc-component. Preferred are short, unbranched compounds, from 1 to 20 atoms in length.
  • the respective structure of the coupling unit L depends on the coupling site of the linker to the nucleotide and on the respective polymer of the linker. Some examples of the coupling units L are given in Examples 1 to 33. Many conventionally modified nucleotides carry a short linker, these short linkers serve as further examples of the coupling moiety L, e.g.
  • Short linker to the base Short WO 9949082, Balasubramanian WO 03048387, Tcherkassov WO 02088382 (see also commercially available nucleotides (Amersham, Roche), short linkers to the ribose in Herrlein et al., Helvetica Chimica Acta, 1994, V. 77, p 586, Jameson et al., Methodology in Enzymology, 1997, v. 278, p363, Canard US Patent No. 5,798,210, Kwiatkowski US Pat. No. 6,254,575, Kwiatkowski WO 01/25247, Ju et al., US Patent No. 6664079, Parce WO 0050642., short linkers to phosphate groups in Jameson et al., Method in Enzymology, 1997, v. 278, p363.
  • the coupling unit L is on one side with the nuc-component covalently linked.
  • linker for example a hydrophilic polymer or directly the coupling unit T or directly the marker
  • the coupling of a polymer is explained by way of example.
  • the type of coupling depends on the type of polymer.
  • the polymer has reactive groups at its terminals, for example NH 2 (amino), OH (hydroxy), SH (mercapto), COOH (carboxy), CHO (aldehyde), acrylic or maleimide, halogen, alkyne, isothiocyanate or azide group.
  • groups can be provided in a reactive form, eg, NHS ester for carboxy group.
  • the water-soluble polymer in a preferred embodiment forms the majority of the linker component. It is a polymer, preferably hydrophilic, consisting of identical or different monomers.
  • suitable polymers include polyethylene glycol (PEG), polyamides (eg polypeptides), polysaccharides and their derivatives, dextran and its derivatives, polyphosphates, polyacetates, poly (alkylene glycols), copolymers of ethylene glycol and propylene glycol, poly (olefinic alcohols), poly (Vinylpyrrolidones), poly (hydroxyalkylmethacrylamides), poly (hydroxyalkylmethacrylates), poly (x-hydroxyacids), polyacrylic acid and its derivatives, polyacrylamides in their derivatives, poly (vinyl alcohol), polylactate acid, polyglycolic acid, poly ( epsilon-caprolactone), poly (beta-hydroxybutyrate), poly (beta-hydroxyvalerate), polydioxanone, polyethylene terephthalate), poly (malic acid), poly (tartronic acid), poly (ortho ester), polyanhydride, polycyanoacrylate, poly (
  • This polymer in one embodiment includes branched or further embodiment non-branched polymers.
  • the polymer may consist of several sections of different lengths, each section consisting of identical monomers and monomers differing in different sections. It should be obvious to a person skilled in the art that for a Macromolecular linker usually only an average mass can be determined, so that the information on the molecular weights represent an average ("macromolecules, chemical structure and syntheses", Volume 1, 4, H. Elias, 1999, ISBN 3-527-29872-X ). For this reason, no exact mass specification can often be made for nuc macromolecules.
  • the linker is bound to the nuk component on one side and to the marker component on the other side.
  • the linker can have coupling units at its ends, which fulfill this function.
  • the connection with the nuc-component has been discussed above.
  • the link between the linker and the marker components via coupling unit T Preferred are short, unbranched compounds, up to max. 20 atoms in length.
  • the respective structure of the coupling unit T depends on the coupling site on the marker component and on the particular polymer of the linker.
  • the coupling unit T is covalently bonded to the polymer.
  • the type of coupling depends on the type of polymer.
  • the polymer has reactive groups at its terminals, for example NH 2 (amino), OH (hydroxy), SH (mercapto), COOH (carboxy), CHO (aldehyde), acrylic or maleimide, halogen, alkyne, isothiocyanate or azide group.
  • groups may be in a reactive form, e.g. NHS esters for carboxy group.
  • Such polymers are commercially available (e.g., Sigma-Aldrich, Iris-Biotech, Nanocs Inc.).
  • the linker may also contain other functional groups or segments, for example one or more cleavable groups under mild conditions.
  • a cleavable linkage within the linker allows removal of a portion of the linker and the label moiety. After cleavage, a linker remains Remainder of the nuk component, examples of fissile compounds are given in section 1.3.3.1.4.
  • a marker component includes at least one oligonucleotide ( Figure 1).
  • This oligonucleotide may include DNA, PTO, RNA, PNA, LNA, or other base pairing modifications of the nucleic acid chains.
  • the oligonucleotide is partially or completely double-stranded. This can be achieved, for example, via self-complementary sections within the oligonucleotide or by hybridization of another predominantly or completely complementary oligonucleotide.
  • Such double-stranded oligonucleotide structures can prevent a polymerase from incorporating two or more nucleotide conjugates at adjacent positions one behind the other. There is a stop in the synthesis by the steric effect of the oligonucleotide.
  • Many examples of synthetic stop by hairpin structures of the templates in replication are known to one skilled in the art.
  • One surprising result of this invention is, inter alia, that such hairpin structures or also completely double-stranded oligonucleotides within a nucleotide conjugate can likewise lead to a stop.
  • the oligonucleotide includes at least one single-stranded sequence portion capable of complementary binding to single-stranded nucleic acid chains. This binding is preferably carried out by hybridization to a nucleic acid chain to be labeled.
  • the length of the section of the oligonucleotide must be adapted to the particular assay conditions. This length includes the following ranges (measured in nucleobases): 2 to 4, 4 to 6, 6 to 8, 8 to 10, 10 to 15, 15 to 20, 20 to 50, 50 to 100.
  • an oligonucleotide includes more than one such sequence portion.
  • composition of the nucleobases of this section is preferably chosen such that the differentiation ability of such a sequence section of the oligonucleotide is intentionally kept low under reaction conditions. This can be achieved, for example, by short stretches of 4 to 8 DNA nucleotide monomers and room temperature conditions.
  • low differentiation e.g. with hexamer primers.
  • the oligonucleotide includes one or more lengths of homopolymer (e.g., 5 to 50 adenosine nucleobases or 5 to 50 cytosine nucleobases, or 5 guanosine nucleobases or 5 to 50 thymidine nucleobases). Such homopolymer segments may undergo base pairing relatively non-specifically with other homopolymer-containing sequence regions.
  • the oligonucleotide includes one or more short repetitive sequence segments, e.g. 2 to 100 sections with a repeating sequence, e.g. AATCC. Also, such Reapeats can non-specifically bind to corresponding complementary sections of the nucleic acids, since their unique positioning
  • the specificity of binding to the particular nucleic acid chain may vary.
  • PNA-based oligonucleotides have a greater affinity for complementary regions than the DNA-based oligonucleotides of the same composition and length.
  • the coupling of the oligonucleotides in the nuc-macromolecule takes place in one embodiment at one of the two ends of the oligonucleotide (FIG. 11), for example at the 5 ' end or at the 3 ' end.
  • Examples of coupling of an oligonucleotide at one of its ends are known to a person skilled in the art.
  • the coupling of other components of the nuc-macromolecule eg nuc-component
  • the respective linker between a nuc-component and an oligonucleotide on one of the bases of the oligonucleotide or on a monomer of the sudily are coupled.
  • a monomer of the sudily eg on the sugar or phosphate at a DNA backbone or at an amino acid at a PNA backbone, or at the sulfur atom of a PTO backbone
  • a person skilled in the art knows various possibilities of coupling substances to an oligonucleotide at different positions.
  • the portion of the oligonucleotide which can bind nonspecifically to nucleic acid chains may be flanked at the 5 'end or at the 3 ' end by further sequence segments. These flanking regions may consist of the same monomials (eg DNA, PTO, PNA, LNA, RNA) or differ in composition from the binding portion. These flanking sequence subtypes may be in the length of 1 to 5, 5 to 10, 10 to 15, 15 to 20, 20 to 30, 30 to 100 or more than 100 nucleobases. They can serve as spacers or, for example, perform functions of the marker component, see Cherkasov et al. WO 2005044836, Cherkasov et al. WO2006097320, Cherkasov et al., WO 2008043426.
  • a linker connecting a nuc-component to the oligonucleotide may be coupled to such a flanking region.
  • the oligonucleotide may include, in part, self-complementary portions, e.g. as hairpin structures (English hairpins) or loops (Fig. 8).
  • the oligonucleotide is involved in the formation of a so-called "molecular beacon" type structure (for properties of molecular beacons: Bonnet et al., PNAS 1999, v96, 6171-.)
  • the self-complementary regions of such a molecule Beacons are typically between 4 to 6, 6 to 8, 8 to 10, 10 to 15, 15 to 30 nucleotides long, and there may be multiple self-complementary regions within an oligonucleotide, eg, 1 to 10.
  • the sequence composition of these self-complementary Sections are different, for example, and one skilled in the art will recognize oligonucleotide modifications that may affect binding to the nucleic acid chains, such as minor groove binders.
  • the 3 ' OH end of the oligonucleotide is blocked by a chemical group.
  • modifications of the 3 'OH group with oligonucleotides include, for example, the following substances: a 2 ', 3 ' -didoxy-ribose, a phosphate group, a biotin residue, an amino linker, a fluorescent dye, a peptide chain, a quencher.
  • various modifications may be incorporated into an oligonucleotide, such as an amino group, a halogen atom, an azide group, etc. In this embodiment, such an oligonucleotide can not be further extendiert by a polymerase, it has So no primer function.
  • an oligonucleotide of nuc-macromolecules include nucleic acid chains having a total length in the following ranges: from 3 to 6, 6 to 9, 9 to 12, 12 to 14, 14 to 16, 16 to 18, 18 to 20, 20 to 25, 25-30, 30-40, 40-50, 50-60, 60-70, 70-100, 100-200 nucleobases.
  • sequences of the oligonucleotides are selected such that they are unable to bind to other types of nuc-macromolecules under used reaction conditions. Each type of nuc-macromolecule thus has its own, not to other oligonucleotides complementary oligonucleotide sequence.
  • the oligonucleotide may carry additional modifications, such as signaling or signaling molecules, e.g. As dyes, fluorescent dyes or biotin, or macromolecular substances such as enzymes or nanocrystals.
  • signaling or signaling molecules e.g. As dyes, fluorescent dyes or biotin, or macromolecular substances such as enzymes or nanocrystals.
  • nucleotide conjugates include another nucleic acid chain which has sequence-specific complementary portions to the oligonucleotide portion. ( Figures 8-10). Such nucleic acid chains may be referred to as complementary oligonucleotides.
  • the complementary oligonucleotide consists of nucleobases.
  • the nucleobases such as adenine, cytosine, guanine, thymine, uracil (abbreviated as A, C, G, T, U) or their analogues coupled to a sugar-phosphate backbone in the form of DNA or RNA or their analogs, e.g. As PTO, PNA, LNA, can bind sequence-specific to the nucleic acid strands.
  • oligonucleotide consists of DNA, another from PNA, etc.
  • complementary oligonucleotides in the form of DNA are discussed in detail.
  • Other types of nucleic acid chains can be constructed and used according to the rules known to those skilled in the art, following the pattern of DNA oligonucleotides.
  • the length of the complementary oligonucleotide preferably includes the following ranges: 15 and 25, 25 to 50, 50 to 100, more than 100 base pairs.
  • the complementary oligonucleotide may be flanked at the 5 ' end or at the 3 ' end by further sequence segments which do not bind to the oligonucleotide of the nucleotide conjugate.
  • These flanking sequence subtypes may be in the length of 1 to 5, 5 to 10, 10 to 15, 15 to 20, 20 to 30, or more than 30 nucleobases in length. They can serve as spacers or Maerker.
  • a person skilled in the art is familiar with further oligonucleotide modifications which can influence the binding of complementary nucleic acid chains one after the other. Such modifications include, for. B. "Minor Groove Binder".
  • the 3 ' OH end of the complementary oligonucleotide is blocked by a chemical group.
  • modifications of the 3 'OH group with oligonucleotides are well known. For example, include the following substances: a 2 '.3' -Dideoxy- ibose, a phosphate group, a biotin residue, an amino linker, a fluorescent dye, a peptide chain, a quencher.
  • various modifications may be incorporated into an oligonucleotide, such as an amino group, a halogen atom, an azide group, etc. In this embodiment, such an oligonucleotide can not be further extendiert by a polymerase, it has So no primer function.
  • the complementary oligonucleotides may include, in part, self-complementary portions, e.g. as hairpin structures (English hairpins) or loops.
  • the antagonist oligonucleotide is involved in the formation of a so-called "molecular beacon” type structure (for properties of molecular beacons: Bonnet et al., PNAS 1999, v96, 6171-).
  • the binding of complementary oligonucleotides to nucleotide conjugates occurs prior to an incorporation reaction. In a further embodiment, the binding of complementary oligonucleotides to nucleotide conjugates takes place only after an incorporation reaction.
  • the signal domain may have a signaling function in one embodiment. In another embodiment, it has a signal-switching function. In another embodiment, it has a catalytic function. In a further embodiment, the signal domain has more than one function, but e.g. combines both signaling and a signal-switched function. Other combinations are obvious.
  • the signal domain contains components which are already bound to nuc macromolecules during the chemical synthesis, s. Examples in applications Cherkasov et al. WO 2005044836, Cherkasov et al WO2006097320, Cherkasov et al. WO 2008043426, Cherkasov et al DE 10356837, Cherkasov et al DE 102004009704.
  • the oligonucleotide of the nucleotide conjugate has a signaling function: it may include, for example, one or more fluorescent dyes.
  • the oligonucleotide of the nucleotide conjugate has a signal-transmitting function: it includes, for example, at least one biotin residue or has a sequence segment to which even more labeled oligonucleotides can bind. 1.3.3.3.4
  • the core component of the marker includes, for example, at least one biotin residue or has a sequence segment to which even more labeled oligonucleotides can bind.
  • the core component has the function of binding several structural elements of the nuc macromolecules.
  • the core component binds together multiple marker units or individual domains may be linked by means of the core component.
  • linker components can be attached to the core component.
  • the term core component is functional and is used to illustrate possible structures of nuc macromolecules. Different chemical structures that hold linker and marker units together can be called the core component.
  • connection between the linker component and the marker depends on the particular structure of the marker units or the structure of the core component.
  • the linker moiety is bound directly to the signaling or signal-mediating marker moiety.
  • the marker may consist of only one or more marker units.
  • one or more linker components are attached to the core component of the label.
  • Binding between the linker moiety and the label can be both covalent and affine.
  • Many examples are known in the art, s. e.g. "Bioconjugation: protein coupling techniques for the biomedical sciences", M. Aslam, 1996, ISBN 0-333-58375-2. “Chemistry of protein conjugation and crosslinking” Shan S. Wong 1993 CRC Press Inc.).
  • connection between the linker component and the Marker may be resistant in one embodiment, eg, at temperatures up to 130 ° C, for pH ranges between 1 and 14, and / or resistant to hydrolytic enzymes (eg, proteases, esterases).
  • hydrolytic enzymes eg, proteases, esterases
  • the connection between the nuc-component and the linker is cleavable under mild conditions.
  • the macromolecular compounds used in accordance with the invention to label nucleotides include, in some embodiments, water-soluble polymers (supra).
  • the linkers of nucmacromolecules also include water-soluble polymers (see above). It will be apparent to those skilled in the art that the assignment of individual polymers to the linker or to the label has a descriptive character.
  • a nuc macromolecule may include on average 1 to 2, 2 to 5, 5 to 10, 10 to 30, 30 to 100 nuc moieties.
  • all nuc-macromolecules have an equal number of nuc-components per one nuc-macromolecule. For example, a maximum of 4 biotin molecules can be bound per one strepavidin molecule, with a saturating concentration of nuc-linker components resulting in a uniform population of nuc macromolecules.
  • the nuc macromolecules of a population have a defined average number of nuc-components per nuc-macromolecule, but in the population itself there is a distribution of the actual population of nuc-macromolecules with nuc-components.
  • the distribution data of nuc-components per nuc-macromolecule in this case represent an average value.
  • the number of marker units in a nuc macromolecule includes the following ranges: 1 and 2, 2 and 5, 5 and 20, 20 and 50, 50 and 100, 100 and 500, 500 and 1000. 1000 and 10,000, 10,000 and 100,000, more than 100,000.
  • nuc macromolecules have a fixed number of signaling units per marker.
  • the distribution of label moieties in a nuc-macromolecule population may vary and does not necessarily have to represent constant value for each individual nuc macromolecule.
  • the nuc macromolecules can be used as substrates for enzymes.
  • Polymerases are often used in applications enzymes that use nucleotides as substrates. They are further exemplified and representative of other nucleotide-converting enzymes.
  • One of the central capabilities of polymerases is the covalent coupling of nucleotide monomers to a polymer.
  • the synthesis may be template-dependent (such as DNA or RNA synthesis with DNA- or RNA-dependent polymerases) as well as template-independent, e.g. by terminal transferases ("J Sambrook” Molecular Cloning 3rd Ed. CSHL Press 2001).
  • RNA-dependent DNA polymerases can be used, e.g. AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNAse activity. Also for Klenow fragment DNA polymerase activity is described as reverse transcriptase. For certain applications, reverse transcriptases may be largely free of RNAse activity ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory), e.g. mRNA mRNA for hybridization experiments.
  • DNA is used as substrate (eg cDNA), all DNA-dependent DNA polymerases with or without 3'-5 'exonuclease activity (DNA replication "1992 Ed A.Kornberg, Freeman and Company NY ), eg modified T7 polymerase eg of the "Sequenase Version 2" type (Amersham Pharmacia Biotech), Klenow fragment of DNA polymerase I with or without 3'-5 'exonuclease activity (New England Biolabs), T4 DNA polymerase, phi29 DNA polymerase , Polymerase Beta of various origins (Animal Cell DNA Polymerases 1983, Fry M., CRC Press Inc., commercially available from Chimerx) thermostable polymerases such as Taq polymerase (New England Biolabs), Vent Polymerase, Vent exo minus polymerase, Deep Vent Polymerase, Deep Vent exo minus Polymerase, Pfu Polymerase, Tli Polymerase, Tfl Polymerase, Tth Poly
  • polymerases which differ in their abilities of naturally occurring enzymes, eg by lack of certain activities or by improved enzymatic parameters, such as precision, processivity, etc.
  • An increasing number of companies provide such thermolabile and thermostable polymerase, which are marketed as optimized enzymes for PCR or other amplification methods or labeling methods.
  • the basic functions of the polymerases remain, however: they are able to incorporate nucleotides and thereby synthesize complementary strands.
  • Such polymerases can also be used for the methods described.
  • a corresponding optimization of the reaction conditions is known to a person skilled in the art.
  • polymerases without 5 '-3' are - preferably exonuclease activity, for example Klenow fragment exo minus, Vent exo minus ,, Bst polymerase large fragment.
  • polymerases without a 3 -5 ' exonuclease activity are preferred, eg Klenow fragment exo minus.
  • This connection may be a section in the linker and may be cleavable at one or more locations. It may be a chemically cleavable compound such as a disulfide, an ester, an acetal, oxidatively cleavable compounds (eg, linkers that include a tartrate compound) or a thioester compound (Short WO 9949082, Tcherkassov WO 02088382) , It may also be a photochemically cleavable compound as shown in (Rothschild WO 9531429).
  • It may also be an enzymatically cleavable compound (for example, a peptide or polypeptide bond, Odedra WO 0192284), cleavable by peptidases, a poly- or oligosaccharide bond, cleavable by disaccharidases), the cleavage by a specific enzyme between certain monomers the fissile places can take place.
  • an enzymatically cleavable compound for example, a peptide or polypeptide bond, Odedra WO 0192284
  • cleavable by peptidases cleavable by peptidases
  • a poly- or oligosaccharide bond cleavable by disaccharidases
  • scissile compounds are known. The coupling of such a compound is described, for example, in (Tcherkassov 02088382, Metzker et al Nucleic Acid Research 1994, V.22, page 4259, Canard et al., Gene, 1994, V. 148, 1,, Kwiatkowski US Patent 6255475 , Kwiatkowski WO 01/25247, Parce WO 0050642.).
  • a cleavable compound may be part of the linker or may form the coupling site of the linker to the nucleotide, or the linkage between the linker moiety and the macroser moiety, or the linkage between the label moieties and the core moiety.
  • DNA deoxyribonucleic acid of various origin and length e.g., oligonucleotides, polynucleotides, plasmids, genomic DNA, cDNA, ssDNA, dsDNA
  • DNA deoxyribonucleic acid of various origin and length e.g., oligonucleotides, polynucleotides, plasmids, genomic DNA, cDNA, ssDNA, dsDNA
  • Nucleotides serve as substrates for polymerases in a template-dependent synthesis reaction. They can be incorporated into a complementary strand. DNTP 2'-deoxynucleoside triphosphates or their analogues, substrates for
  • DNA polymerases and reverse transcriptases e.g. dATP, dGTP, dUTP, dTTP, dCTP, dITP or their analogues such as 7-deaza-dATP or 7-deaza-dGTP.
  • dATP dGTP
  • dUTP dUTP
  • dTTP dTTP
  • dCTP dCTP
  • dITP DNA polymerases and reverse transcriptases
  • Other analogues of natural 2'-deoxynucleoside triphosphates can also be used as substrates by DNA polymerases.
  • NTP - ribonucleoside triphosphates or their analogues substrates for RNA polymerases, UTP, CTP, ATP, GTP.
  • NT is also used for the length specification of a nucleic acid sequence, eg 1,000 NT.
  • NT stands for nucleoside monophosphates.
  • the majority of abbreviations are formed by using the suffix "s”, “NT” stands for “nucleotide”, for example, “NTs” stands for several nucleotides.
  • Total Sequence Sum of all sequences of nucleic acid chains to be analyzed in the batch; it may originally consist of one or more NSKs.
  • the overall sequence may be parts or equivalents of another sequence or sequence populations (e.g., mRNA, cDNA, plasmid DNA with insert, BAC, YAC) and derived from one or different species.
  • Total sequence may include one or more target sequences.
  • NSKF nucleic acid chain fragment (DNA or RNA) corresponding to part of the total sequence, NSKFs - nucleic acid chain fragments. The sum of
  • NSKFs is equivalent to the total sequence.
  • the NSKFs may be fragments of total DNA or RNA sequence resulting from a fragmentation step.
  • PBS Primer binding site
  • Reference sequence an already known sequence for which the deviations in the sequence to be investigated or in the sequences to be examined (for example total sequence) are determined.
  • sequences accessible in databases may be used, e.g. from the NCBI database.
  • Nucleotide conjugates including the following components: at least one nucleotide component (nuc-component), at least one oligonucleotide and at least one linker between the nucleotide component and the oligonucleotide
  • the nucleotide component is coupled via a linker to the oligonucleotide at one of its ends. In another embodiment, the nucleotide component is coupled to the oligonucleotide via a linker at an internal position.
  • the linker is coupled to the base of the nucleotide component. In another embodiment, the linker is coupled to the sugar portion of the nucleotide component.
  • Aspect 2 Nucleotide conjugates according to aspect 1, wherein the respective linker is cleavable.
  • the linker includes a disulfide bond or a photolabile bond.
  • Aspect 3 Nucleotide conjugates according to aspect 1, wherein the oligonucleotide includes self-complementary sequence segments. These sequence sections may be from 4 to 10, 10 to 20, 20 to 40, or longer than 40 bases. Preferably, they are between 4 and 15 bases long.
  • Aspect 4 Nucleotide conjugates according to aspect 1, wherein at least one further complementary oligonucleotide is coupled to the oligonucleotide.
  • the coupling between the two oligonucleotides occurs by hybridization of complementary regions of the oligonucleotides.
  • Aspect 5 Nucleotide conjugates according to Aspects 1 to 4, wherein at least one of the oligonucleotides is specifically labeled.
  • the marker may be, for example, a fluorescent dye.
  • the 3 ' end of said oligonucleotides is blocked by a chemical group, eg a phosphate group or a dye.
  • a nucleic acid chain enzymatic synthesis composition which includes at least one of the nucleotide conjugates in the above aspects
  • a nucleic acid chain enzymatic synthesis composition including at least four types of nucleotide conjugates in the above aspects, wherein nuc-components of the nucleotide conjugates in a composition include bases or their analogues: adenine, guanine , Cytidine, uridine, and any type of these nucleotide conjugates include a marker characteristic of them.
  • a nucleic acid chain enzymatic synthesis composition comprising at least four populations of nucleotide conjugates according to the above aspects, wherein a population of nucleotide conjugates are constituted by a uniform nucleobase of the nucleotide component or its analogs (eg adenine , Guanine, cytidine, uridine).
  • a population of nucleotide conjugates having a unique nucleobase of the nuc-component includes a plurality of oligonucleotides.
  • the number of oligonucleotides in a population of nucleotide conjugates includes 4 to 50, 50 to 500, 500 to 5000, 5000 to 10,000, 10,000 to 1,000,000, more than 1,000,000. Preferably, it includes ranges of 4 to 5,000.
  • the nucleotide conjugates belonging to a population preferably have at least one marker characteristic of this population.
  • This marker in one embodiment includes a fluorescent dye. In another embodiment, this marker includes a uniform sequence portion of the oligonucleotides.
  • the oligonucleotides of a population include at least one variable sequence segment.
  • This variable sequence section differs from oligonucleotide to oligonucleotide of a population. The variety of variants in this section depends on the length of the section. The longer the sequence segment, the greater the variability in this section.
  • the plurality of variable sequence portions of the oligonucleotides of a population include all possible sequences of the nucleobases in that portion (randomized sequences). The number of possible sequence sequences depends on the length of the variable sequence segment and is calculated as 4 n, where (n) is the length of the variable segment in nucleobases.
  • one population includes 256 oligonucleotides in a variable nucleotide length of four nucleobases or 4096 oligonucleotides in a variable nucleus length of six nucleobases.
  • the variable sequence segment of the oligonucleotides is preferably single-stranded.
  • oligonucleotides of a population of nucleotide conjugates can bind to one strand of a nucleic acid chain. Such binding occurs via hybridization of a variable portion of an oligonucleotide of a population of nucleotide conjugates to a complementary sequence of a nucleic acid sequence. Thanks to the large number of variable segments within a population of oligonucleotides, a population of nucleotide conjugates has the potential to bind to nucleic acid chains of any composition.
  • Aspect 8 Methods for Enzymatic Synthesis of Nucleic Acid Chains Using Nucleotide Conjugates.
  • Kit for carrying out an enzymatic synthesis of nucleic acid chains which includes the following elements:
  • One or more types of polymerases are provided.
  • At least one kind of nucleotide conjugates At least one kind of nucleotide conjugates
  • a Method for the Sequencing of Nucleic Acid Chains by Synthesis Including the Steps of: a) Providing at Least One Population to Extensible Nucleic Acid Chain Primer Complexes (NSK Primer Complexes) b) incubation of at least one type of nucleotide conjugate together with at least one type of polymerase with the NSK primer complexes provided in step (a) under conditions permitting the incorporation of complementary nuc-components of the nucleotide conjugates, each Type of nucleotide conjugates has a characteristic of their mark.
  • a method for sequencing nucleic acid chains comprising the steps of: a) providing at least one population of extensible nucleic acid chain primer complexes (NSK primer complexes) b) incubating at least one type of nucleotide conjugate together with at least a type of polymerase having the NSK primer complexes provided in step (a) under conditions permitting the incorporation of complementary nuc-components of the nucleotide conjugates, each type of nucleotide conjugate having an oligonucleotide sequence characteristic of it.
  • NSK primer complexes extensible nucleic acid chain primer complexes
  • Nucleic acid chain is complementary and each type of nucleotide conjugates has a characteristic of their mark. c) Removal of unincorporated nucleotide conjugates from NSK primer complexes. d) Detection of signals from nucleotide conjugates incorporated into NSK primer complexes e) cleavage of the linker component and of the marker component and oligonucleotide component from the nucleotide conjugates incorporated into the NSK primer complexes f) washing of the NSK primer complexes optionally repeating steps (b) to (f), Aspect HD: A method for sequencing nucleic acid chains, comprising the steps of: a) providing at least one population of extensible nucleic acid chain primer complexes (NSK primer complexes) b) incubating at least one type of nucleotide conjugate together with at least a type of polymerase having the NSK primer complexes provided in step (a) under conditions permitting the incorporation of complementary nuc-components of the nucle
  • Conjugates can bind to the nucleic acid sequence to be sequenced and each type of nucleotide conjugates has a characteristic of their mark. c) removal of unincorporated nucleotide conjugates from the NSK
  • a method for sequencing nucleic acid chains comprising the steps of: a) providing at least one population of extensible nucleic acid chain primer complexes (NSK primer complexes) b) incubating at least four types of nucleotide conjugates together with at least a type of polymerase having the NSK primer complexes provided in step (a) under conditions permitting the incorporation of complementary nuc-components of the nucleotide conjugates, the oligonucleotide of the nucleotide conjugates including at least one single-stranded portion attached to the nucleotide
  • nucleic acid chains which includes the following steps: a) Provision of at least one population of extensible nucleic acid chain primer complexes (NSK primer complexes) b) incubation of at least four types of nucleotide conjugates together with at least one type of polymerase with the NSK primer complexes provided in step (a) under conditions permitting the incorporation of complementary nuc-components of the nucleotide conjugates, each Type of Nucleic Acid conjugates
  • Another aspect 12 of the invention relates to macromolecular nucleotide compounds according to any one of aspects 1 to 11, wherein the nuc-component includes the following structures ( Figure 12):
  • Base - is independently selected from the group of adenine, or 7-deazaadenine, or guanine, or 7-deazaguanine, or thymine, or cytosine, or uracil, or their modifications, where L is the connection between the nuc-component and the linker component (coupling unit L) and X is the coupling site of the coupling unit L at the base is i - is H
  • R 2 - is independently selected from the group H, OH, halogen, NH 2 , SH or protected OH group
  • R - is H or OH
  • R 5 - is independently selected from the group OH, or a protected OH group, a monophosphate group, or a diphosphate group, or a triphosphate group, or an alpha thiotriphosphate group.
  • Another aspect 13 of the invention relates to macromolecular nucleotide compounds according to any one of aspects 1 to 11, wherein the nuc-component includes the following structures ( Figure 12): wherein:
  • Base - is independently selected from the group of adenine, or 7-deazaadenine, or guanine, or 7-deazaguanine, or thymine, or cytosine, or uracil, or their modifications capable of enzymatic reactions
  • R x - is H
  • R 2 - is independently selected from the group H, OH, Hal, NH 2 , SH or protected OH group
  • R 3 - is independently selected from the group O-R 3 - 2 -L, P (0) m - R 3-2 -L, where m is 1 or 2, NH-R 3-2 -L, SR 3 2 -L, Si-R 3-2 -L or, wherein R 3 . 2 is the coupling site of the linker to the nucleotide and L - is the coupling unit of the linker (L).
  • R4 - is H or OH
  • R 5 - is independently selected from the group OH, or a protected OH group, a monophosphate group, or a diphosphate group, or a triphosphate group, or an alpha thiotriphosphate group.
  • nuc-component includes the following structures ( Figure 12):
  • Base - is independently selected from the group of adenine, or 7-deazaadenine, or guanine, or 7-deazaguanine, or thymine, or cytosine, or uracil, or their modifications capable of enzymatic reactions
  • R 2 - is independently selected from the group H, OH, Hal, NH 2 , SH or protected OH group
  • R 3 - is independently selected from the group H, OH, Hal, PO 3 , SH, NH 2 , O - R 3 - lf P (O) m - R 3-1 , NH-R 3 - 1 ( SR 3 i, Si-R 3 -i wherein R 3-1 is a chemically, photochemically or enzymatically cleavable group and m is 1 or 2.
  • R4 - is H or OH
  • R s - is independently selected from the group O-R5-1-L, or P- (0) 3 -R5-1-L (modified monophosphate group), or P- (0) 3 -P- (0) 3 -R 5 - ! -L (modified diphosphate group)
  • coupling unit L includes the following structural elements:
  • R 6 -A-CH CH- (CH 2 -) n -R 7
  • R 6 is - (--C-C-CH 2 -CH 2 ) n -BR 7 wherein R 6 - is the nuc-component, R 7 - is the linker radical and A and B independently include the following structural elements: -NH-, - 0-, -S-, -SS-, -CO-NH-, -NH-CO-, -CO-O-, -O-CO-, -CO-S-, -S-CO-, -P ( 0) 2 -, -Si-, - (CH 2 ) n -, a photolabile group, where n - is 1 to 5
  • Another aspect of the invention pertains to macromolecular nucleotide compounds of aspects 12 to 15 wherein the linker component includes a hydrophilic, water-soluble polymer.
  • Kit for labeling nucleic acid chains according to the method of any one of the aspects including:
  • One or more types of polymerases are provided.
  • nucleotide analogues according to aspects 1 to 16
  • Kit for labeling nucleic acid chains according to the method of one of the aspects which includes one or more of the following compositions - in the present case as a solution in concentrated or in diluted form or else as a mixture of dry substances - from the following list:
  • One or more types of polymerases are provided.
  • nucleotide analogues according to any one of aspects 1 to 16
  • o Composition for incorporation reaction including at least one required type of further nucleoside triphosphates
  • kits for amplifying and labeling nucleic acid chains according to any of the aspects including one or more elements from the following list:
  • One or more types of polymerases are provided.
  • One or more primers for the amplification of nucleic acid chains o At least one of the nucleotide analogues (nuc macromolecules), according to any one of aspects 1 to 16
  • Kit for amplification and labeling of nucleic acid chains according to one of the aspects, which includes one or more polymerases from the following list:
  • M-MLV M-MLV
  • RSV RSV
  • AMV AMV
  • RAV RAV
  • MAV HIV
  • o DNA polymerases Klenow fragment DNA polymerase, Klenow fragment exo minus DNA polymerase, T7 DNA polymerase, Sequenase 2, Vent DNA
  • Another aspect 21 Kit for labeling nucleic acid chains according to one of the aspects in which the constituents of the compositions are already pre-mixed.
  • dUTP-AA dUTP-allylamine, Jena-Bioscience or Trilink Biotechnologies
  • dCTP-PA dCTP-propargyl-amine, Jena Bioscience
  • dATP-PA 7- (3-amino-1-propynyl) -2 , deoxy- 7- deazaadenosine-5 'triphosphate) (custom synthesis of JenaBioscience)
  • dGTP-PA (7- (3-amino-l-propynyl) -2' -deoxy-7-deazaguanosine-5 'triphosphate, (custom synthesis of JenaBioscience)
  • PDTP (3- (2-pyridinyl-dithio) propionic acid, Fluka
  • Solvents were used, if necessary, in the absolute form (Fluka) or dried by standard methods.
  • the mixing ratios given are based on the volumes used (v / v).
  • the coupling of a substance can already be carried out during the chemical / enzymatic synthesis of nucleic acids (for example by using phosphoramidites or by using modified nucleotides and a polymerase or by using ligase reaction).
  • the coupling can take place via one or more intermediate steps, for example by introducing a reactive group, only after the synthesis.
  • a reactive group for example by introducing a reactive group, only after the synthesis.
  • nuc-components and oligonucleotides can be achieved by many methods. For example, many methods are known for coupling two structures that have reactive amino groups by means of a cross-linker. Oligonucleotides modified with one or more amino groups can be purchased commercially. The amino group can be present either at the 5 ' end, 3 ' end, or in the internal region of an oligonucleotide. The following examples describe amino-reactive nuc-components which are provided as precursors. Such amino-reactive nucleotides can be coupled to the oligonucleotides.
  • oligonucleotides which contain a mercapto group at one of the ends (eg from ThermoFischer Scientific Germany).
  • Other examples of introduction of reactive groups into oligonucleotides are also known to a person skilled in the art.
  • dUTP-AA 20 mg were dissolved in 1 ml of water and the pH was adjusted to 8.5 with NaOH.
  • PDTP-NHS 60 mg in 0.5 ml of methanol was added dropwise with stirring. Reaction was carried out at 40 ° C for 2 hours. The separation of excess PDTP-NHS and PDTP was carried out on preparative silica gel plates. The product, dUTP-AA-PDTP, and dUTP-AA remain on the starting line. The nucleotides were eluted from the plate with water and concentrated.
  • This dUTP analogue now carries a disulfide bond that can react with other thiols in a thiol exchange reaction and is a mildly cleavable compound.
  • nucleotide analogs 7-deaza-aminopropargyl-2 '-deoxy-guanosine triphosphate, and 7-deaza-aminopropargyl-2' -deoxy-adenosine triphosphate, 5-amino-propargyl 2 '-deoxy-cytidine triphosphate were also modified as stated above. This resulted in dGTP-PA-PDTP, dATP-PA-PDTP, dCTP-PA-PDTP correspondingly.
  • Example 2A Coupling of a Short Linker to the Base of a Nucleotide.
  • the dUTP-AA suspension was added to the PEG (9) - (NHS) 2 solution and incubated for 2 h at 37 ° C with vigorous stirring until the solution became transparent.
  • the conversion of dUTP-AA was monitored by TLC.
  • the purification of dUTP-PEG (9) -I ⁇ IHS was carried out by precipitation by diethyl ether / DMF mixture (v: v 90: 10). The pellet contains the product. The product was dissolved in DMSO and frozen.
  • dUTP-R-X analogues can be synthesized, where (R) can be any linker and (X) can be any reactive group.
  • the reactive group may, for example, react with amino groups or thio groups or carboxy groups. Examples of other commercially available short linkers (cross-linkers) are presented in the Cross-Linker Guide by Thermo Scientific, www.piercenet.com).
  • Linkers may also include a cleavable compound, eg, a reductively cleavable bond (eg, dithiobispropionic acid (NHS) 2) or an oxidatively cleavable bond (eg, tartrate (NHS) 2). Both crosslinkers were purchased from Thermo Scientific.
  • dUTP-DTBP-NHS was synthesized in a similar manner to dUTP-PEG (9) -NHS. Instead of PEG (9) - (NHS) 2, dithiobispropionic acid (NHS) 2 was used, DTBP- (NHS) 2.
  • This dUTP analog has a linker with a disulfide bond which can be cleaved under reductive conditions, eg by TCEP.
  • dUTP tartrate NHS was synthesized in a similar fashion to dUTP-PEG9-NHS. Instead of PEG (9) - (NHS) 2, tartrate (NHS) 2 was used.
  • This nucleotide has a linker with a diol bond (-CH2 (OH) -CH2 (OH) -) which can be cleaved under oxidative conditions (eg with KClO4).
  • NHS group on the linker can now be attached to amino group of another molecule, e.g. an oligonucleotide are coupled.
  • Example 2B Coupling of a short linker to the gamma-phosphate group of a nucleotide.
  • oligonucleotides having an amino group at either end may be modified with active esters (e.g., NHS esters modified).
  • active esters e.g., NHS esters modified
  • Oligo 1 was modified by excess of PDTP-NHS in a phosphate buffer / DMSO (20% DMSO), pH 8, to introduce a disulfide group at the 5 ' end of oligo 1 (PDTP oligo 1).
  • the modified oligonucleotide was purified by DEAE chromatography. Coupling of Nuc components to the oligonucleotide.
  • dUTP-AA-PDTP Ten equivalents of dUTP-AA-PDTP were added to one equivalent of PDTP oligo 1 (1 mmol / l) in a buffer solution.
  • TCEP was added to this solution (to 10 mmol / l final concentration) to form dUTP-AA-SH and SH-oligo 1.
  • saturated solution containing J 2 J 2 dissolved in K 2 SO 4 solution was added to the reaction mixture until the yellow color of J 2 remained visible. By adding J2, oxidation occurs to form disulfide bridges.
  • the product was purified by DEAE column.
  • dATP-PA-SS-Oligol dGTP-PA-SS-Oligol, dCTP-PA-SS-Oligol were similarly obtained using dGTP-PA-PDTP, dATP-PA-PDTP, dCTP-PA-PDTP instead of dUTP -AA-PDTP were used.
  • an NH2 group is coupled via C6 linker and at the 3 ' end a dye (fluorescein) is coupled (see list of sequences):
  • oligonucleotide was dissolved in a phosphate buffer, pH 8.0 (1 mmol / l). To this solution was added 5x excess of dUTP-PEG (9) -NHS dissolved in DMSO. The reaction proceeded at RT. The subsequent purification of the product was carried out via DEAE column and RP-C18 column. The product, dUTP-PEG (9) oligo2 fluorescein, was dried and then dissolved in water at 50 pmol / L concentrations and frozen.
  • dUTP-AA-SS-oligo2-fluorescein was also synthesized using dUTP-DTBP-NHS instead of dUTP-PEG (9) -NHS.
  • dUTP-ppp-SS-oligo2-fluorescein was also synthesized using NHS-DTBP-ppp-dUTP instead of dUTP-PEG (9) -NHS.
  • dUTP-ppp-PEG (9) oligo2-fluorescein was similarly synthesized using NHS-PEG (9) -ppp-dUTP instead of dUTP-PEG (9) -NHS.
  • oligonucleotides are coupled via linker to the terminal phosphate group of the nuc-component.
  • a modified oligonucleotide was purchased (order synthesis Eurofins MWG), which includes self-complementary sequence segments (oligo 4) Such an oligonucleotide may be present in solution in whole or in part as a double-stranded oligonucleotide, also called "Molecular Beacon”.
  • dUTP-DTBP-NHS As a Nuk component with a linker, dUTP-DTBP-NHS was used (see synthesis above). The oligonucleotide was dissolved in a phosphate buffer solution, pH 8, (1 mmol / l) and added to 5x equivalents of dUTP-DTBP-NHS (dissolved in DMSO). The reaction proceeds on NH2 group at the 5 ' end in good yields. The product was purified by DEAE column and RP-18 column.
  • dUTP-AA-SS-oligo-2-fluorescein / oligo 3 was synthesized (see above) and dissolved in a buffer solution. To this solution was added one equivalent of a complementary oligonucleotide having the structure:
  • the Oligo 3 can bind to the sequence of Oligo 2 complementary and thus blocks a part of Oligo2 at the 5 ' end (underlined here) 5 ' NH2-cqt acc QCQ act qct qq cac AAAAAAAAA fluorescein 3 ' phosphate ' gca ta tgg cgc cga cga ct gtg
  • the solution with dUTP-AA-SS-oligo2-fluorescein and oligo 3 (50 mmol / l Tris-HCl, pH8.0) was heated to 90 ° C for 1 min and then cooled to RT. By cooling, the two complementary sequence sections bind to each other to form a double strand.
  • a reductive cleavage of a disulfide bond for example, the following conditions can be used: TCEP 10 to 50 mmol / l pH 6.0 to 8.0 at RT for about 5 to 30 min.
  • Such cleavage can be used, for example, in cleavable nucleotide conjugates with a dithiobispropionic acid-based linker.
  • KClO 4 5 to 50 mmol / l pH 6.0 to 8.0 at RT for ca. 5 to 20 min
  • Blockage of a free SH group after the cleavage of a disulfide bond can be carried out, for example, with iodoacetamide: 0.1 to 0.5 mol / l of iodoacetamide in buffer pH 7.0 to 8.0 for about 5 to 15 min at RT.
  • the enzymatic incorporation reactions are carried out under customary conditions for the incorporation reactions of modified nuc-macromolecules.
  • the following conditions can be used:
  • MgCl 2 eg 1.5 to 10 mM (or also Mn 0.2-1 mM)
  • DMSO about 5 to 30% 17-50 nucleotides in length of primers (oligonucleotides) that have sufficient specific hybridization to the template.
  • Matrices e.g., oligonucleotides
  • Nucleotide conjugates are preferably used in concentrations between 0.1 ⁇ to 10 ⁇ .
  • Enzymatic reactions were carried out for about 2 to 60 minutes at temperatures between RT and 60 ° C.
  • Reaction buffer 1 50 mmol / l Tris HCl, pH 8.5; 50 mmol / 1 NaCl, 5 mmol / 1 MgCl 2 , glycerol 10% v / v
  • Reaction buffer 2 10 mmol / l Tris HCl, pH 8.5; 10 mmol / l NaCl, 1 mmol / l MgCl 2 , glycerol 2%, DMSO 20% v / v
  • modified Klenow exo minus the DNA polymerase I of E. coli
  • 100 ⁇ l of a buffer solution 200 mmol / l Tris-HCl buffer, pH 9.0, 60 .mu.
  • 20 ⁇ were added to a 1 mol / l aqueous iodine-acetamide solution.
  • the reaction was carried out at RT for 5 min. In this way, a selective modification of the polymerase on the SH group of the cysteine was carried out and the DTT in the producer buffer was inactivated.
  • the modified polymerase was stored at -20 ° C.
  • nucleotide conjugates were used at 2 and 0.2 pmol / L concentration (as described in legend). Modified Klenow Exo minus fragment was used (1 unit / 20 ⁇ approach). As a primer T7-19-Cy was used (1 ⁇ ⁇ ⁇ / ⁇ ). As templates oligonucleotides were used (1 ⁇ / ⁇ ), which allow a single or multiple incorporation of correspondingly complementary nucleotide conjugates. For some reactions, natural substrates (dNTPs) were added to the reaction (200 ⁇ / ⁇ ), see legend.
  • dNTPs natural substrates
  • reaction proceeded in Reactioin Buffer 1 at 37 ° C for 1 hr. Subsequently, the reaction mixture was applied to a 10% polyacrylamide gel and reaction products separated at 150 V (70 ° C). The visualization was carried out by means of a gel documentation system with UV light source.
  • Lane 2 dATP-PA-SS-oligol (0.2 ⁇ / ⁇ ), template 4
  • Lane 4 dATP-PA-SS-Oligol (0.2 ⁇ / ⁇ ), template 5
  • Lane 6 dCTP-PA-SS-Oligol (0.2pmol / L), template 6
  • Lane 7 dCTP-PA-SS-Oligol (2 pmol / L), template 7
  • Lane 8 dCTP-PA-SS-Oligol (0.2 ⁇ / ⁇ ), template 7
  • Lane 9 dGTP-PA-SS-Oligol (2 pmol / L), template 5, dATP, dCTP
  • Lane 10 dGTP-PA-SS-Oligol (0.2 ⁇ / ⁇ ), template 5, dATP, dCTP
  • Lane 11 dGTP-PA-SS-Oligol (2 ⁇ / ⁇ ), template 8, dATP
  • Lane 12 dGTP-PA-SS-Oligol (0.2 ⁇ / ⁇ ), template 8, dATP
  • Lane 13 dUTP-AA-SS-Oligol (2 ⁇ / ⁇ ), template 2
  • Lane 14 dUTP-AA-SS-Oligol (0.2pmol / L), template 2
  • Lane 15 dUTP-AA-SS-Oligol (2 ⁇ / ⁇ ), template 3
  • FIG. 13 shows incorporation of only one nucleotide conjugate on all matrices used (arrow A). Arrow (B) indicates the position of the labeled primer.
  • dATP-PA-SS-Oligol is incorporated only once on template 4 (homopolymer section) (Lane 1). The incorporation of a dATP-PA-SS-oligol led to the blockage of the incorporation of another dATP-PA-SS-oligol at the adjacent, complementary to the template Position (N + 1). The incorporation reaction was carried out on template 5 in this reaction.
  • dGTP-PA-SS-Oligol is only incorporated once on template 5 and 8 (lanes 9 and 11).
  • Template 5 contains the sequence -CGC- and template 8 contains the sequence -CTC-. Both template sequences thus do not contain adjacent positions for the incorporation of dG analogs.
  • incorporation of a dGTP-PA-SS-oligol blocked the incorporation of another dGTP-PA-SS-oligol at position N + 2.
  • the incorporation of dGTP-PA-SS-oligol into template 5 and 8 served as control at limiting substrate concentrations (0.2 pmol / l dGTP-PA-SS-oligol vs. 1 pmol / l T7-19-Cy3 and template ) (Lanes 10 and 12).
  • dUTP-AA-SS-Oligol is incorporated only once on template 2 (homopolymer section) (Lane 13).
  • the incorporation of a dUTP-AA-SS oligol resulted in the blockade of the incorporation of another dUTP-AA-SS oligol at the adjacent position.
  • only one dUTP-AA-SS-oligol was incorporated (Lane 15), since the template offers no further complementary bases for the incorporation of dUTP-AA-SS-oligol.
  • the incorporation of dUTP-AA-SS-oligol into template 2 was also used as control at limiting substrate concentrations (0.2 mol / l dUTP-AA-SS-oligol vs.
  • nucleotide conjugate (s) After cleavage of the oligonucleotide portion of the already incorporated nucleotide conjugate (s) and blocking of the free group with iodoacetamide now another nucleotide conjugate (n + 1) can be incorporated.
  • nucleotide conjugates e.g., dATP conjugates, dCTP conjugates, dGTP conjugates, dUTP conjugates
  • dATP conjugates e.g., dCTP conjugates
  • dGTP conjugates e.g., dGTP conjugates
  • dUTP conjugates e.g., dUTP conjugates
  • no natural nucleotides e.g., dNTPs
  • the matrices can be fixed to a solid phase. Such a reaction often results in cycles, so that the template can be washed between individual reaction steps.
  • linkers instead of dithiobis-propionic acid linkers, other linkers of similar length, e.g. Tartrate linkers, or longer linkers, e.g. PEG (9) can be used.
  • Such nucleotide conjugates also have terminating or reversibly terminating properties.
  • dUTP-AA-SS-oligo 4-fluorescein oligonucleotide contains self-complementary sequences of the type "molecular beacon"
  • Nucleotide conjugates were used in each case 1 ⁇ / ⁇ concentration. Modified Klenow Exo minus was used (1 unit / 20 ⁇ approach). The primer used was T7-19-Cy (1 or 0.2 pmol / l). As templates oligonucleotides were used (1 or 0.2 pmol / l), which allow a single (template 3) or multiple (template 2) incorporation of correspondingly complementary nucleotide conjugates. The reaction proceeded in Reactioin Buffer 1 or Reaction Buffer 2 at 37 ° C for 1 hr. Subsequently, the reaction mixture was analyzed by capillary electrophoresis (ABI 310 capillary sequencer, POP6 gel matrix). Electrophoresis was performed at 12 kV (50 ° C). Signals of Cy3 dye as well as fluorescein dye were detected. The CE electrohormograms are shown in Figs. 14-21.
  • Fig. 15 only dUTP-AA-SS-oligo 2-fluorescein / oligo 3
  • Fig. 16 only dUTP-AA-SS-oligo-4-fluorescein
  • Fig. 17 Bl dUTP-AA-SS-oligo 4-fluorescein, modified Klenow exo minus, template 2 (1 mol / l), primer T7-19-Cy3 (1 pmol / l), reaction buffer 1
  • Fig. 17 B3 dUTP-AA-SS-oligo 4-fluorescein, modified Klenow exo minus, template 2 (0.2 ⁇ / ⁇ ), primer T7-19-Cy3 (0.2 pmol / l), reaction buffer 1
  • Fig. 18 B5 dUTP-AA-SS-oligo 4-fluorescein, modified Klenow Exo minus, template 2 (0.2 ⁇ / ⁇ ), primer T7-19-Cy3 (0.2 ⁇ / ⁇ ), reaction buffer 2
  • Fig. 18 B6 dUTP-AA-SS-oligo 4-fluorescein, modified Klenow exo minus, template 3 (0.2 ⁇ / ⁇ ), primer T7-19-Cy3 (0.2 ⁇ / ⁇ ), reaction buffer 2
  • nucleotide analogs used herein have free 3 'OH groups. Potentially, additional nucleotides can be coupled to these groups by the polymerase. Arrow (A) indicates the position of the labeled primer and unincorporated nucleotide conjugates. It can be seen that the two nucleotide conjugates used are incorporated only once on a homopolymer stretch (template 2) (arrow B). Controls: primer and nucleotide conjugates alone, single incorporation of dUTP-AA-SS-oligo 4-fluorescein on template 3, example 13
  • kits include components (e.g., individual substances, compositions, reaction mixtures) necessary for carrying out enzymatic incorporation reactions with modified nuc-macromolecules of the invention.
  • composition of the kits may vary upon application, with applications ranging from simple primer extension reaction to single-molecule cyclic sequencing.
  • kits used for cyclic sequencing may include polymerases, modified IMuk macromolecules, as well as solutions to the cyclic steps.
  • kits may optionally include positive and / or negative controls, instructions for performing procedures.
  • kit components are usually provided in commercially available reaction vessels, wherein the volume of the vessels can vary between 0.2 ml and 1 l.
  • Vessel arrays eg microtiter plates, can also be loaded with components, which allows automatic supply of reagents.
  • a kit can include the following components:
  • One or more polymerases e.g. modified Klenow fragment exo minus
  • nucleotide conjugates which may be present as acid or as salts (for example, sodium, potassium, ammonium or lithium may be used as ions).
  • the nucleotide conjugates may be provided in dry form or in the form of a solution, e.g. in water or in a buffer, e.g. Tris-HCl, HEPES, borate, phosphate, acetate, or in a storage solution which may include the following components, singly or in combination:
  • o buffer Tris-HCl, HEPES, borate, phosphate, acetate in concentration, for example, between 10 mM and 200 mM
  • o salts e.g. NaCl, KCl, NH 4 Cl, MgCl 2,
  • Markers or marker units of modified nuc macromolecules in particular in the embodiments in which there is affine coupling between linker and marker or marker and Kore component.
  • Buffer compositions for enzymatic reaction, cleavage, blockade, detection, washing steps :
  • Cleavage reagents provided, for example, as a concentrated buffered solution.
  • DTT or TCEP in embodiments in which nucleotide conjugates include a linker with a cleavable disulfide bridge.
  • Modifying reagents provided eg as Concentrated Buffered Solution.
  • iodoacetamide or iodoacetate for embodiments in which the linker has a mercapto group after cleavage.
  • Detektionsreagentien eg labeled oligonucleotides that can be hybridized to nucleotide conjugates. Examples of sequences:
  • This oligonucleotide can be used, for example, in the following combinations with nuc-components:
  • Oligonucleotide portion can serve as a characteristic marker sequence for dUTP as marker component.
  • another characteristic sequence may be used.
  • a part of this oligonucleotide can serve as the binding section (B section).
  • the homopolymeric portion of this oligonucleotide (AAAAAAAAAA) is an example of variable portion. It can bind to a portion of another nucleic acid chain that includes multiple thymidine residues (e.g., TTTTTT). Under reaction conditions, e.g. Reaction buffer 1 or 2 and room temperature or 37 ° C, there is only a loose, temporary binding, since the Tm of AAAAAAAAAA is below 25 ° C. The sequence specificity is very low.
  • This oligonucleotide can be used, for example, in the following combinations with nuc-components: Coupling of a PEG linker to the base:
  • This oligonucleotide can bind to a sequence fragment of oligo 2 sequence specific.
  • the Tm of this oligonucleotide is about 70 ° C (measured in reaction buffer 1). After hybridization to oligo 2, this oligonucleotide will remain bound to oligo 2 under reaction conditions (RT or 37 ° C) and may block the interaction between oligo 2 and another, predominantly complementary, sequence to this oligo2 region.
  • This oligonucleotide may include other modifications, e.g. Fluorescent dyes.
  • dyes with an excitation spectrum e.g. Rhodamine may be between FRF and fluorescein to FRET,
  • This oligonucleotide has self-complementary sequences (underlined) and is under reaction conditions (reaction buffer 1 or 2, RT or 37 ° C) predominantly in the form of molecular beacon. The interaction of this sequence section and a further, complementary to this section nucleic acid sequence is thereby blocked or greatly reduced.
  • the homopolymeric portion of this oligonucleotide (AAAAAAAAAA) can bind to a portion of another nucleic acid chain that includes multiple thymidine residues (eg, TTTTTT or IIIIIII). Under reaction conditions, eg reaction buffer 1 or 2 and room temperature or 37 ° C, only a loose, transient binding takes place since the Tm of AAAAAAAAAA is below 25 ° C.
  • This oligonucleotide can be used, for example, in the following combinations with nucleated
  • oligo 3 By hybridizing oligo 3 to the oligonucleotides of this population, a sequence fragment (underlined) can be excluded from interaction with single-stranded nucleic acid chains. Only variable section (X) n (hexamer section) and AAAAAAAAA are available for interaction with other nucleic acid chains. Since the binding of hexamers to single-stranded nucleic acid chains under specified reaction conditions (RT to 37 ° C, reaction buffer 1 or 2) is unstable, there is only a temporary binding of nucleotide conjugates to nucleic acid sequences. Because of a short length of the variable portion, such oligonucleotides have a very low sequence specificity.
  • composition of oligonucleotides can be used, for example, in the following combinations with nuc-components:
  • Sequence segment (cqt att accqcg qct qct qq cac g) can serve as a unique characteristic marker sequence to which sequence-specific labeled oligonucleotides can be bound.
  • composition of Oligo 6 differs from Composition Oligo 5 in the arrangement of individual sequence sections.
  • the nuc-component can be separated differently from a certain portion of the oligonucleotide.
  • nuk components can be closer to the
  • TTTTTTTTTTT Homopolymer stretch
  • the complementary oligonucleotide is hybridized to the uniform oligonucleotide
  • the oligonucleotide is not complementary to the nucleic acid chain that needs to be analyzed.
  • the length of the variable section is (N) bases.
  • the unitary portions of oligonucleotides may be specific for a particular population of nucleotide conjugates (eg, oligoA sequence is consistent for all oligonucleotides within the population with the nuk component dATP, etc.).
  • the unitary portions of different nucleotide conjugates are not complementary to each other.
  • oligonucleotides with a variable section and a single segment.
  • the length of the variable section is 3 bases.
  • the unitary portions of oligonucleotides may be specific for a particular population of nucleotide conjugates.
  • the unitary portions of different nucleotide conjugates are not complementary to each other.
  • the length of the variable section is 5 bases.
  • the unitary portions of oligonucleotides may be specific for a particular population of nucleotide conjugates (eg, oligoA sequence is consistent for all oligonucleotides within the population with the nuk component dATP, etc.).
  • the unitary portions of different nucleotide conjugates are not complementary to each other.
  • Each population of nucleotide conjugates is labeled with a marker (1 to 4) characteristic of this population, eg a fluorescent dye, eg Alexa 488, Cy3, Cy5, Cy7.
  • A-C Schematic representation of nucleotide conjugates with a complementary oligonucleotide. Hybridization can occur at different positions of the complementary oligonucleotide (A: in the middle, B or C: at one of the ends). Nuk components (1).
  • E Schematic representation of nucleotide conjugates with a nuc-component (1), a linker (2) and a uniform oligonucleotide (3) which includes a label (7) (eg a fluorescence dye or a biotin residue) and a complementary one bound oligonucleotide (8), which also includes a label (eg, a fluorescence dye or a biotin residue).
  • a label eg, a fluorescence dye or a biotin residue
  • a complementary one bound oligonucleotide (8) which also includes a label (eg, a fluorescence dye or a biotin residue).
  • the two marks can be the same or different. For fluorescent dyes, they can form a FRET pair.
  • nucleotide conjugates having a nuc-component (1), a linker (2) and a long unit oligonucleotide (12) and a complementarily-bound oligonucleotide (13), wherein the hybridized oligonucleotide includes two labels (eg, a fluorescence dye or a biotin residue).
  • the two marks can be the same or different.
  • fluorescent dyes they can form a FRET pair.
  • That hybridized Oligonucleotide has a sequence portion complementary to oligonucleotide 12 and other flanking sequence regions that are not complementary to oligonucleotide 12. These flanking regions may be complementary to each other.
  • AC Schematic representation of nucleotide conjugates with a uniform nuc-component (1), a linker (2), a variable portion of the oligonucleotide (3) and a uniform portion of the oligonucleotide (4).
  • the variable portion may be positioned at the 5 ' end of oligonucleotide (A), in the middle (B) or at the 3 ' end (C) of oligonucleotide.
  • the nuk component is coupled via the linker to the 5 ' position of the oligonucleotide.
  • variable section is internally positioned and the Nuk component with the linker is also internally positioned at the 5 ' end of the variable section.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a novel method for the enzymatic marking of nucleic acid chains (target sequences) with nucleotide conjugates. Under reaction conditions, said nucleotide conjugates are able to bind to a target sequence, and can be incorporated into the complementary growing strand by way of a polymerase. The nucleotide conjugates can be used for sequencing nucleic acid chains.

Description

Nukleosid-Triphosphat-Konjugate und Methoden zu deren Anwendung Beschreibung der Erfindung Einleitung  Nucleoside Triphosphate Conjugates and Methods of Using Themes Description of the Invention Introduction
1.1 Stand der Technik und Aufgaben der Erfindung 1.1 Prior art and objects of the invention
In der modernen Biotechnologie sind hochleistungsfährige Sequenzierungsverfahren bekannt („second generation sequencing technologies", z.B. Solexa-Technologie von Illumina. Diese Verfahren basieren auf Sequenzierung durch Synthese und verwenden reversible Terminatoren. Im Zusammenhang mit der Entwicklung der Verfahren zur Sequenzierung mittels Synthese ist die Bereitstellung neuer reversibel terminierenden Nukleotid-Modifikationen von entscheidender Bedeutung. Bessere Signal- Eigenschaften spielen eine große Rolle bei der Sequenzierung besonders auf Einzelmolekülebene.  In modern biotechnology, high performance sequencing techniques are known, such as Solexa technology from Illumina, which are based on sequencing by synthesis and employ reversible terminators. In the context of the development of synthetic sequencing methods, the provision of new ones reversible terminating nucleotide modifications are crucial, and better signal properties play a major role in sequencing, especially at the single-molecule level.
1.2 Gegenstand der Erfindung 1.2 Subject of the invention
Die vorliegende Erfindung beschreibt in einer vorteilhaften Ausführungsform neue Strukturen von Nukleotid-Konjugaten, sowie Verfahren zu deren Anwendung. Solche Nukleotid-Konjugate können in Markierungsreaktionen von Nukleinsäureketten verwedet werden oder bei einer Sequenzierungsreaktion eingesetzt werden. In einer vorteilhaften Ausführungsform werden solche Konjugate als reversible Terminatoren bei einer Sequenzierung durch die Synthese verwendet. Es werden neuartige Nuk-Makromoleküle mit neuen Strukturen der Marker- Kompontente und mit neuen Funktionen bereitgestellt. Die Nukleotid-Strukturen stellen neue Kompositionen von Nuk-Makromolekülen mit der Grundstuktur, beschrieben in Anmeldungen Cherkasov et al WO2011050938, Cherkasov et al WO2005044836, Cherkasov et al WO2006097320, Cherkasov et al WO2008043426, Cherkasov et al DE 10356837, Cherkasov et al DE 102004009704. Diese Anmeldungen sind hier als Referenzen eingeschlossen und werden als„incorporated by reference" im vollen Umfang zitiert.  In an advantageous embodiment, the present invention describes novel structures of nucleotide conjugates, as well as methods for their use. Such nucleotide conjugates can be used in labeling reactions of nucleic acid chains or used in a sequencing reaction. In an advantageous embodiment, such conjugates are used as reversible terminators in sequencing by the synthesis. Novel nuc macromolecules are provided with new marker component structures and new features. The nucleotide structures make new compositions of nuc macromolecules having the basic structure described in applications Cherkasov et al WO2011050938, Cherkasov et al., WO2005044836, Cherkasov et al., WO2006097320, Cherkasov et al., WO2008043426, Cherkasov et al., DE 10356837, Cherkasov et al DE 102004009704. These applications are incorporated herein by reference and are cited in their entirety as "incorporated by reference".
Nuk-Makromoleküle schließen mindestens eine Nuk-Komponente, z.B. ein 2 ' - deoxinukleosid-triphosphat, mindestens einen makromolekularen Marker und mindens einen Linker zwischen diesem Marker und der Nuk-Komponente. Nuc-macromolecules include at least one nuc-component, for example a 2 '- deoxinukleosid-triphosphate, at least one macromolecular markers and Minden a linker between this marker and the nuc-component.
In einer vorteilhaften Ausführungsform der Erfindung, werden Nukleotid-Konjugate beschrieben, die mindestens ein Nukleosid-triphosphat, mindestens ein Oligonukleotide, sowie einen Linker zwischen dem Nukleosid-Triphosphat und dem Oligonukleotid einschließen. Das Oligonukleotid in einem solchen Nukleotid-Konjugat ist vorzugsweise ein Teil des Markers. Die Kopplung des Linkers an das Nukleosid-triphosphat (Nuk-Komponente des Nukleotid-Konjugates) kann in einer Ausführungsform an der Base erfolgen (z.B. an 5- Position der Pyrimidine oder an 7-position von 7-deazapurinen). In an advantageous embodiment of the invention, nucleotide conjugates are described which contain at least one nucleoside triphosphate, at least one Oligonucleotides, and a linker between the nucleoside triphosphate and the oligonucleotide. The oligonucleotide in such a nucleotide conjugate is preferably part of the label. Coupling of the linker to the nucleoside triphosphate (nuc-component of the nucleotide conjugate) can in one embodiment be carried out at the base (eg at the 5-position of the pyrimidines or at the 7-position of 7-deazapurines).
In einer anderen Ausführungsform erfolgt die Kopplung des Linkers an die endständige Phosphat-Gruppe des Nukleotids (z.B. Gamma-Phosphat-Gruppe bei einem Nukleosid- Triphosphat). In another embodiment, coupling of the linker to the terminal phosphate group of the nucleotide (e.g., gamma-phosphate group on a nucleoside triphosphate) occurs.
In einer anderen Ausführungsform erfolgt die Kopplung des Linkers an die 3 ' -Position des Zuckers des Nukleotids (z.B. an 3 ' -OH-Gruppe einer 2 ' -deoxi-ribose). In another embodiment, coupling of the linker to the 3 ' position of the sugar of the nucleotide occurs (eg, to 3 ' OH group of a 2 ' deoxyribose).
In einer bevorzugten Ausführungsform schließt der Linker vorzugsweise mindestens eine spaltbare Gruppe ein, z.B. eine Disulfid-Gruppe. In a preferred embodiment, the linker preferably includes at least one cleavable group, e.g. a disulfide group.
Die Kopplung des Linkers an das Oligonukleotid erfolgt in einer Ausführungsform am 5 ' -Ende des Oligonukleotids. In einer anderen Ausführungsform erfolgt die Kopplung des Linkers an das Oligonukleotid am 3 ' -Ende des Oligonukleotids. In einer anderen Ausführungsform erfolgt die Kopplung des Linkers an das Oligonukleotid an einer internen Position des Oligonukleotids. In einer Ausführungsform der Erfindung ist die Zusammensetzung des Oligonukleotides dermassen gewählt, dass es nicht an die zu markierenden Nukleinsäuresequenzen binden kann. Dies kann beispielsweise durch eine vollständige oder partielle Doppelstrang-Bildung innerhalb des Oligonukleotids erreicht werden (z.B. Haarnadel-Strukruren) oder durch entsprechende Reaktionsbedigungen. The coupling of the linker to the oligonucleotide takes place in one embodiment at the 5 ' end of the oligonucleotide. In another embodiment, the coupling of the linker to the oligonucleotide takes place at the 3 ' end of the oligonucleotide. In another embodiment, the coupling of the linker to the oligonucleotide occurs at an internal position of the oligonucleotide. In one embodiment of the invention, the composition of the oligonucleotide is chosen such that it can not bind to the nucleic acid sequences to be labeled. This can be achieved, for example, by complete or partial double strand formation within the oligonucleotide (eg hairpin strucures) or by appropriate reaction conditions.
In einer weiteren Ausführungsform der Erfindung ist die Zusammensetzung des Oligonukleotides dermassen gewählt, dass es mindestens an eine zu markierende Nukleinsäuresequenz binden kann. In einer Ausführungsform der Erfindung wird ein Verfahren zur Synthese von Nukleinsäureketten beschrieben, bei dem mindestens vier Arten von Nukleotid- Konjugaten (z.B. dATP-Konjugat, dCTP- Konjugat, dGTP- Konjugat, dUTP- Konjugat) gleichzeitig in Kontakt mit mindestens einem Primer-Matrizen-Komplex und mindestens einer DNA Polymerase gebracht werden und unter Bedingungen inkubiert, die einen Einbau eines komplementären Nukleosid-Triphosphates der Nukleotid- Konjugate an den Primer zulässt. Nuk-Makromoleküle mit vorwiegend oder absolut sequenzspezifischen Bindung an eine Zielsequenz sind in Cherkasov et al WO2011050938 beschrieben. In a further embodiment of the invention, the composition of the oligonucleotide is chosen such that it can bind at least to a nucleic acid sequence to be labeled. In one embodiment of the invention, a method for synthesizing nucleic acid chains is described in which at least four types of nucleotide conjugates (eg, dATP conjugate, dCTP conjugate, dGTP conjugate, dUTP conjugate) are simultaneously in contact with at least one primer template Complex and at least one DNA polymerase and incubated under conditions that allow incorporation of a complementary nucleoside triphosphate of the nucleotide conjugates to the primer. Nuc-macromolecules with predominantly or absolutely sequence-specific binding to a target sequence are described in Cherkasov et al WO2011050938.
Eine weitere Ausführungsform der Erfindung schließt Nukleotid-Konjugate mit einer verstärkten Bindung an eine zu markierende Nukleinsäuereketten ein, wobei diese Bindung vorwiegend nicht sequenzspezifisch erfolgt. Nukleotid-Konjugate haben vielmehr die Fähigkeit, sequenzunspezifisch an mehrere verschiedene zu markierende Nukleinsäureketten zu binden. Eine solche sequenzunspezifische Bindung von Nukleotid-Konjugaten an zu markierende ermöglicht unerwartete Anwendungsmöglichkeiten. Beispielsweise können deutlich geringe Konzentrationen von Nukleotid-Konjugaten verwendet werden, um einen Einbauereignis einer Nuk- Komponente zu erzielen. Einsatz geringer Konzentrationen von Nukleotid-Konjugaten ist beispielsweise bei Verfahren zur Einzelmolekül-Analyse von Nukleinsäuren vom Vorteil. Geringe Konzentrationen verursachen einen deutlich geringeres Hintergrundsignal. Das kann zur Steigerung der Qualität der Signale in einem Assay führen. Another embodiment of the invention includes nucleotide conjugates having enhanced binding to a nucleic acid chain to be labeled, which binding is predominantly non-sequence specific. Rather, nucleotide conjugates have the ability to bind sequence-unspecifically to several different nucleic acid chains to be labeled. Such sequence-unspecific binding of nucleotide conjugates to be labeled allows for unexpected applications. For example, significantly low concentrations of nucleotide conjugates can be used to achieve an incorporation event of a nuc-component. Use of low concentrations of nucleotide conjugates is advantageous, for example, in single-molecule analysis of nucleic acids. Low concentrations cause a significantly lower background signal. This can increase the quality of the signals in an assay.
In einer Ausführungsform erfolgt diese sequenzunspezifische Bindung an Nukleinsäureketten beispielsweise unter Ausbildung der Basenpaarung zwischen dem Oligonukleotid des Nukleotid-Konujgates und der zu markierende Nukleinsäurekette, wobei eine solche Basenpaarung nur über einen relativ kurzen Abschnitt (z.B. 3 - 15 Basen) der Nukleinsäurekette erfolgt und daher vorzugsweise eine geringe Sequenzspezifität hat. In dieser Ausführungsform der Erfindung schließt die Sequenz des Oligonukleotides innerhalb des Nukleotid-Konjugates mindestens einen Sequenzabschnitt, der an die Nukleinsäureketten unter Basenpaarung binden kann. Vorzugsweise ist dieser Sequenzabschnitt des Oligonukleotids einzelsträngig. Die Länge dieses Fragments ist vorzugsweise so gewählt, dass das Oligonukleotid über Ausbildung von beispielsweise 3 bis 6, 7 bis 10, 10 bis 15 Basenpaaren (durchgehend oder auch getrennt durch nicht komplementäre Bereiche) an die zu markierende Nukleinsäuekette binden kann. In one embodiment, this sequence-unspecific binding to nucleic acid chains takes place, for example, to form the base pairing between the oligonucleotide of the nucleotide conjugate and the nucleic acid chain to be labeled, such base pairing occurring only over a relatively short section (eg 3-15 bases) of the nucleic acid chain and therefore preferably has a low sequence specificity. In this embodiment of the invention, the sequence of the oligonucleotide within the nucleotide conjugate includes at least one sequence segment which can bind to the nucleic acid chains under base pairing. Preferably, this sequence portion of the oligonucleotide is single-stranded. The length of this fragment is preferably selected such that the oligonucleotide can bind to the nucleic acid chain to be labeled by formation of, for example, 3 to 6, 7 to 10, 10 to 15 base pairs (continuously or else separated by non-complementary regions).
In einer weiteren Ausführungsform werden Nukleotid-Konjugate mit Nukleinsäureketten unter Bedingungen inkubiert, die eine sequenzunspezifische Bindung zwischen ihnen zulässt. Beispielswiese können Nukleotid-Konjugate mit längeren Oligonukleotiden (z.B. zwischen 15 und 50 Nukleotiden) an Nukleinsäureketten unter nicht stingenten Bedingungen wenig sequenzspezifisch binden. In einer weiteren Ausführungsform der Erfindung schließen Nukleotid-Konjugate positiv geladene Abschnitte, z.B. polylysine-Abschnitt oder Polyethylenimin (PEI), welche an die Nukleinsäureketten über elektrostatische Ladung binden. Diese Abschnitte können als Linker zwischen der Nuk-Komponente und der Oligonukleotid- Komponente funktionieren (z.B. 2-10 Lysin-Reste als kurzes Peptid). Beispielsweise können Peptid-Nuklein-Säuren (PNA) mit einem positiv geladenen Rückgrad als Oligonukleotid innerhalb des Nuk-Makromoleküls verwendet werden. In another embodiment, nucleotide conjugates are incubated with nucleic acid chains under conditions allowing for sequence-unspecific binding between them. For example, nucleotide conjugates with longer oligonucleotides (eg between 15 and 50 nucleotides) to nucleic acid chains under non-stringent conditions little sequence-specific binding. In another embodiment of the invention, nucleotide conjugates include positively charged portions, eg polylysine portion or polyethylenimine (PEI), which bind to the nucleic acid chains via electrostatic charge. These sections may function as linkers between the nuc-component and the oligonucleotide component (eg, 2-10 lysine residues as a short peptide). For example, peptide nucleic acids (PNA) having a positively charged backbone may be used as the oligonucleotide within the nuc macromolecule.
In einer weiteren Ausführungsform der Erfindung schließen Nukleotid-Konjugate Proteine ein, die in der Lage sind an Nukleinsäureketten sequenzunspezifisch zu binden, z.B. ein Single-Strand-Binding Protein. In another embodiment of the invention, nucleotide conjugates include proteins capable of sequence-nonspecific binding to nucleic acid chains, e.g. a single-strand binding protein.
Zur Anschaulichkeit werden in dieser Anmeldung Varianten der Nukleotid-Konjugate in Details beschrieben, die mindestens ein Oligonukleotid zur Verstärkung der Bindung an eine zu markierende Nukleinsäurekette einschließt. For the sake of clarity, variants of the nucleotide conjugates are described in detail in this application, which includes at least one oligonucleotide for enhancing the binding to a nucleic acid chain to be labeled.
In einer weiteren Ausführungsform der Erfindung wird mindestens eine Komposition aus mehreren Nuk-Makromolekülen mit gleicher Nuk-Komponente verwendet. Eine solche Komposition schließt vorzugsweise eine gleiche bzw. einheitliche Art der Nuk- Komponente ein, z.B. dATP-Analog, die an unterschiedliche Oligonukleotide gekoppelt ist. In a further embodiment of the invention, at least one composition of several nuc-macromolecules having the same nuc-component is used. Such a composition preferably includes a same type of nuc-component, e.g. dATP analog coupled to different oligonucleotides.
Jedes der Oligonukleotide aus solchen Komposition schließt mindestens einen Sequenzabschnitt ein, der an mindestens eine zu markierende Nukleinsäurekette binden kann. Vorzugsweise ist dieser Sequenzabschnitt einzelsträngig. Die Länge dieses Fragments ist vorzugsweise so gewählt, dass jedes Oligonukleotid über Bildung von 3 bis 20, vorzugsweise unter Bildung von 3 bis 10, noch bevorzugter unter Bildung von 3 bis 6 Basenpaaren an die zu markiertende Nukleinsäuekette binden kann.  Each of the oligonucleotides of such composition includes at least one segment of sequence capable of binding to at least one nucleic acid chain to be labeled. Preferably, this sequence segment is single-stranded. The length of this fragment is preferably selected so that each oligonucleotide can bind to the nucleic acid chain to be labeled via formation of 3 to 20, preferably to form 3 to 10, more preferably 3 to 6 base pairs.
Solche Sequenzabschnitte können auch als Bindungsabschnitte der Oligonukleotide genannt werden. Sie werden als„B-Abschnitte" bezeichnet. Solche B-Abschnitte von Oligonukleotiden unterscheiden sich zwischen einzelnen Oligonukleotiden einer Population von Nukleotid-Konjugaten (Abschnitt B( l), B(2), B(3) usw. bis B(n)). In einer Ausführungsform der Erfindung bildet die Zusammensetzung der B-Abschnitte innerhalb einer Population sämtlich mögliche Varianten ab (z.B. randomisierte Hexamere mit 4Λη Varianten, wobei (n) die Anzahl der Nukleotid-Monomere in einem Oligonukleotid darstellt). In einer weiteren Ausführungsform der Erfindung wird die Zusammensetzung der B-Abschnitte innerhalb einer Population auf einige ausgewälte Varianten der Oligonukleotide beschränkt, wobei die Anzahl der verschiedenen Varianten der Oligonukleotdie zwischen 10 und 100.000 liegen kann. Such sequence sections may also be referred to as binding sections of the oligonucleotides. They are referred to as "B-sections." Such B-sections of oligonucleotides differ between individual oligonucleotides of a population of nucleotide conjugates (section B (1), B (2), B (3), etc., to B (n) In one embodiment of the invention, the composition of the B-segments within a population maps all possible variants (eg, randomized Hexamers with 4 Λ η variants, where (n) represents the number of nucleotide monomers in an oligonucleotide). In a further embodiment of the invention, the composition of the B sections within a population is restricted to a few selected variants of the oligonucleotides, wherein the number of different variants of the oligonucleotides may be between 10 and 100,000.
Weiterhin schließt jedes der Oligonukleotide einer solchen Komposition einen für diese Komposition charakteristischen signal-gebenden oder signal-vermittelnden Marker ein, z.B. einen Farbstoff oder einen weiteren, für alle Oligonukleotide einheitlichen Sequenzabschnitt des Oligonukleotids.  Furthermore, each of the oligonucleotides of such a composition includes a signal-giving or signal-conferring marker characteristic of this composition, e.g. a dye or another, for all oligonucleotides uniform sequence portion of the oligonucleotide.
Zusammenfassend, schließt eine Komposition von Nukleotid-Konjugaten eine einheitliche Art der Nuk-Komponente, z.B. ein einheitliches Nukleosid-Triphosphat, und einen für diese Population charakteristischen signal-gebenen oder signal- vermitteldnen Marker, und eine Vielzahl von Oligonukleotiden ein. Oligonukleotide innerhalb einer Komposition unterscheiden sich untereinander in der Struktur des B- Abschnitts. Die Gesamtzahl der Variationen von Oligonukleotiden innerhalb einer solchen Komposition schließt Bereiche von 4 3 bis 4 50, vorzugsweiese von 4Λ5 bis 4Λ20, noch bevorzugter 4 6 bis 4Λ 15 ein. Die Länge der Oligonukleotide ist entsprechend so gewählt, dass eine solche Anzahl an Variationen erreicht werden kann. Beispielsweise bei der Länge von 3 Basen des B-Abschnitts beträgt die Komplexität der Population 64 (=4Λ3), bei der Länge von 4 Basen des B-Abschnitts beträgt die Komplexität der Population 256 (=4 4), bei der Länge von 5 Basen des Abschnitt B beträgt die Komplexität der Population 1024 (=4 5), bei der Länge von 6 Basen des Abschnitt B beträgt die Komplexität der Population 4096 (=4 6) usw. In summary, a composition of nucleotide conjugates includes a uniform type of nuc-component, for example, a unitary nucleoside triphosphate, and a signal-pending or signal-mediated marker characteristic of that population, and a plurality of oligonucleotides. Oligonucleotides within a composition differ from one another in the structure of the B segment. The total number of variations of oligonucleotides within such a composition includes ranges from 4 3 to 4 50, preferably from 4 Λ 5 to 4 Λ 20, more preferably 4 6 to 4 Λ 15. The length of the oligonucleotides is suitably chosen so that such a number of variations can be achieved. For example, for the length of 3 bases of the B-section, the complexity of the population is 64 (= 4Λ3 ), for the length of 4 bases of the B-section the complexity of the population is 256 (= 4 4), for the length of 5 bases of section B, the complexity of the population is 1024 (= 4 5), for the length of 6 bases of section B the complexity of the population is 4096 (= 4 6), etc.
Durch eine vollständige Abdeckung von potenziellen Kombinationen der Basenabfolge innerhalb der Komposition kann eine solche Population an weitere einzelsträngige Nukleinsäuereketten mit beliebiger Zusammensetzung binden. By fully covering potential combinations of base sequence within the composition, such a population can bind to other single-stranded nucleic acid chains of any composition.
Die genannte Komposition von Nukleotid-Konjugaten wird vorzugsweise mit einer zu markierenden Nukleinsäurekette unter Reaktionsbedingungen inkubiert, die eine reversible Bindung zwischen Oligonukleotiden und der zu markierenden Nukleinsäurekette zulassen. Dies kann man beispielsweise durch Reaktions- Temperatur steuern.  The said composition of nucleotide conjugates is preferably incubated with a nucleic acid chain to be labeled under reaction conditions which permit reversible binding between oligonucleotides and the nucleic acid chain to be labeled. This can be controlled, for example, by reaction temperature.
Unter geeigneten Temperatur-Bedingungen kommt es zu Bindung von Oligonukleotiden der Nuk-Makromolekülen und Einzelsträngen der zu markierenden Nukleinsäureketten. Es entstehen Nukleotid-Konjugat-Matrizen-Komplexe.  Under suitable temperature conditions, binding of oligonucleotides of the nuc-macromolecules and single strands of the nucleic acid chains to be labeled occurs. Nucleotide-conjugate-template complexes are formed.
In einer Ausführungsform liegt die Reaktionstempertur unter der Tm (z.B. Tm minus 5°C) von potenziellen Nukleotid-Konjugat-Matrizen-Komplexen. Unter solchen Bedingungen wird die Ausbildung von Nukleotid-Konjugat-Matrizen-Komplexe bevorzugt. In one embodiment, the reaction temperature is below the Tm (eg, Tm minus 5 ° C) of potential nucleotide-conjugate template complexes. Among such Conditions, the formation of nucleotide-conjugate-template complexes is preferred.
In einer weiteren Ausführungsform liegt die Reaktionstempertur um die Tm (z.B. Tm plus / minus 5°C) von potenziellen Nukleotid-Konjugat-Matrizen-Komplexen. Unter solchen Bedingungen liegt ein Gleichgewicht zwischen der Bildung und Auflösung von Nukleotid-Konjugat-Matrizen-Komplexe. Dies ermöglicht einen regen Austausch an Nukleotid-Konjugaten an einer Matrize. Die Bindung innerhalb von potenziellen Nukleotid-Konjugat-Matrizen-Komplexen ist reversibel und wird mehrmals gebildet und aufgehoben dank Reaktionsbedingungen. In another embodiment, the reaction temperature is around the Tm (e.g., Tm plus / minus 5 ° C) of potential nucleotide-conjugate template complexes. Under such conditions there is a balance between the formation and dissolution of nucleotide-conjugate-template complexes. This allows a lively exchange of nucleotide conjugates on a template. The binding within potential nucleotide-conjugate-template complexes is reversible and is formed several times and abolished thanks to reaction conditions.
In einer weiteren Ausführungsform liegt die Reaktionstempertur vorzugsweise über Tm (z.B. Tm + 5°C) von potenziellen Nukleotid-Konjugat-Matrizen-Komplexen. Durch eine relativ kurze Strecke des B-Abschnitts (vorzugsweise 3 bis 15 Basen-Paaren) ist eine solche Bindung zwischen einem Oligonukleotid und einer weiteren einzelsträngigen Nukleinsäuerekette nicht besonders stabil. Dies ermöglicht einen regen Austausch von Nukleotid-Konjugaten an einer zu markierenden Nukleinsäurekette. In einer weiteren Ausführungsform der Erfindung werden mindestens vier Kompositionen verwendet, wobei jede Komposition Nuk-Makromoleküle mit gleicher Nuk-Komponente, mindestens einem gleichen Marker und unterschiedlichen Oligonukleotiden einschließt. Es werden beispielsweise vier Kompositonen von Nuk- Makromolekülen verwenden, wobei eine Komposition eine dATP-Nuk-Komponente einschließt, eine zweite Komposition eine dCTP-Nuk-Komponente einschließt, eine dritte Komposition eine dGTP-Nuk-Komponente einschließt, eine vierte Komposition eine dUTP-Nuk-Komponente einschließt, In another embodiment, the reaction temperature is preferably above Tm (e.g., Tm + 5 ° C) of potential nucleotide-conjugate template complexes. By a relatively short stretch of the B portion (preferably 3 to 15 base pairs), such a bond between an oligonucleotide and another single-stranded nucleic acid chain is not particularly stable. This allows a lively exchange of nucleotide conjugates on a nucleic acid chain to be labeled. In a further embodiment of the invention, at least four compositions are used, each composition including nuc-macromolecules with the same nuc-component, at least one identical marker and different oligonucleotides. For example, four composites of nuc macromolecules will be used, one composition including a dATP-nuk component, a second composition including a dCTP nuk component, a third composition including a dGTP nuk component, a fourth composition a dUTP Includes nuk component,
In einer weiteren Ausführungsform der Erfindung wird mindestens eine Komposition solcher Nukleotid-Konjugate in Kontakt mit mindestens einem Primer-Matrizen- Komplex und mindestens einer Polymerase gebracht und unter Bedingungen inkubiert, die eine reversibe Bindung der Oligonukleotid-Anteile der Konjugate an den einzelsträngigen Abschnitt der Primer-Matrizen-Komplexe, sowie einen Einbau eines komplementären Nukleosid-Triphosphates an den Primer zulässt. In a further embodiment of the invention, at least one composition of such nucleotide conjugates is brought into contact with at least one primer-template complex and at least one polymerase and incubated under conditions which reversibly bind the oligonucleotide portions of the conjugates to the single-stranded portion of the primers Matrices complexes, as well as incorporation of a complementary nucleoside triphosphate to the primer allows.
In einer weiteren Ausführungsform der Erfindung werden mindestens vier Kopositionen von Nukleotid-Konjugaten (z.B. dATP-Population, dCTP-Population, dGTP-Population, dUTP-Population) in Kontakt mit mindestens einem Primer-Matrizen- Komplex und mindestens einer Polymerase gebracht und unter Bedingungen inkubiert, die eine reversibe Bindung der Oligonukleotid-Anteile der Konjugate an den einzelsträngigen Abschnitt der Primer-Matrizen-Komplexe, sowie einen Einbau eines komplementären Nukleosid-Triphosphates an den Primer zulässt. Jede der genannten Populationen schließt mindestens ein Nukleosid-Triphosphat-Anteil, sowie eine für dieses Nukleosid-Triphosphat charakteristische Oligonukleotid-Population ein (Fig. 4-7) In a further embodiment of the invention, at least four co-positions of nucleotide conjugates (eg dATP population, dCTP population, dGTP population, dUTP population) are brought into contact with at least one primer template matrix. Complex and at least one polymerase and incubated under conditions which allows a reversibe binding of the oligonucleotide portions of the conjugates to the single-stranded portion of the primer-template complexes, as well as incorporation of a complementary nucleoside triphosphate to the primer. Each of said populations includes at least one nucleoside triphosphate moiety, as well as an oligonucleotide population characteristic of that nucleoside triphosphate (Figures 4-7).
Einzelne Ausführungsformen der Erfindung lassen sich untereinader kombinieren, so dass Strukturen von Nukleotid-Konjugaten bereitgestellt werden können, die vorteilhaften Kombinationen einschließen. Beispielsweise können Nukleotid-Konjugate mit Oligonukleotiden bereitgestellt werden, die teilweise selbstkomplementräre doppeltsträngige Abschnitte einschließen und gleichzeitig B-Abschnitte zur Bindung an zu markierende Nukleinsäureketten. In einer Ausführungsform werden noch weitere Nukleotide verwendet. Beispielsweise können natürliche dNTP (dATP, dCTP, dGTP, dTTP) oder deren Analoga (z.B. ddNTP) oder markierte Nukleotdie (z.B. dUTP-16-Biotin) verwendet werden. Individual embodiments of the invention may be combined with one another to provide structures of nucleotide conjugates that include beneficial combinations. For example, nucleotide conjugates may be provided with oligonucleotides that partially include self-complementary double-stranded portions and at the same time B-portions for binding to nucleic acid chains to be labeled. In one embodiment, additional nucleotides are used. For example, natural dNTP (dATP, dCTP, dGTP, dTTP) or their analogs (e.g., ddNTP) or labeled nucleotides (e.g., dUTP-16-biotin) can be used.
In einer weiteren Ausführungsform werden noch weitere Nuk-Makromoleküle verwendet, beschrieben in Anmeldungen Cherkasov et al WO2011050938, Cherkasov et al WO2005044836, Cherkasov et al WO2006097320, Cherkasov et al WO2008043426. In a further embodiment, further nuc-macromolecules are used, described in applications Cherkasov et al WO2011050938, Cherkasov et al., WO2005044836, Cherkasov et al. WO2006097320, Cherkasov et al., WO2008043426.
In einer bevorzugten Ausführungsform werden Nukleotid-Konjugate in Konzentrationen eingesetzt, die in folgenden Bereichen liegen : 10 pmol/l - 1 nmol/l, 1 nmol/l - 10 nmol/l, 10 nmol/l - 100 nmol/l, 100 nmol/l - 1 pmol/l, 1 pmol/l - 10 pmol/l, 10 pmol/l - 1 mmol/1. Besonders bevorzugt sind Bereiche zwischen 10 nmol/l und 10 pmol/l. Diese Konzentrationen können sich auf die Konzentration der Nuk- Komponente der Nukleotid-Konjugate beziehen. In a preferred embodiment, nucleotide conjugates are used in concentrations lying in the following ranges: 10 pmol / l-1 nmol / l, 1 nmol / l-10 nmol / l, 10 nmol / l-100 nmol / l, 100 nmol / l - 1 pmol / l, 1 pmol / l - 10 pmol / l, 10 pmol / l - 1 mmol / l. Particularly preferred are ranges between 10 nmol / l and 10 pmol / l. These concentrations may refer to the concentration of the nuc-component of the nucleotide conjugates.
Die erfindungsgemäßen Nukleotide-Konjugaten können in Verfahren zur enzymatischen Synthese von Nukleinsäuereketten verwendet werden. Besonders bevorzugt werden diese Nukleotid-Konjugate in Verfahren zur Markierung und zur Sequenzierung von Nukleinsäuereketten verwendet. Beispiele für Durchführung von Verfahren zur Markierung oder zur Sequenzierung-durch-Synthese sind einem Fachmann bekannt. Beispielsweise schließt ein solches Verfahren zur Sequenzierung von Nukleisäureketten, das folgende Schritte ein: a) Bereitstellung von mindestens einer Population an extensionsfähigen Nukleinsäureketten-Primer-Komplexen (NSK-Primer-Komplexe) b) Inkubation von mindestens einer Art der Nukleotid-Konjugate zusammen mit zumindest einer Art der Polymerase mit den im Schritt (a) bereitgestellten NSK-Primer-Komplexen unter Bedingungen, die den Einbau von Nukleotid-Konjugate mit komplementären Nukleobasen (Nuk-The nucleotide conjugates of the invention can be used in methods for the enzymatic synthesis of nucleic acid chains. Most preferably, these nucleotide conjugates are used in methods for labeling and sequencing nucleic acid chains. Examples of carrying out methods for labeling or sequencing-by-synthesis are known to a person skilled in the art. For example, such a method for sequencing nucleic acid chains includes the steps of: a) providing at least one population of extensible nucleic acid chain primer complexes (NSK primer complexes) b) incubating at least one type of nucleotide conjugate together with at least a type of polymerase with the NSK-primer complexes provided in step (a) under conditions which facilitate the incorporation of nucleotide conjugates with complementary nucleobases (nuclease).
Komponenten) zulassen, wobei jede Art der Nukleotid-Konjugate eine für sie charakteristische Markierung besitzt. c) Entfernung der nicht eingebauten Nukleotid-Konjugate von den NSK- Primer-Komplexen d) Detektion der Signale von in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugaten e) Abspaltung der Linker-Komponente sowie der Marker-Komponente von den in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugaten f) Waschen der NSK-Primer-Komplexe gegebenenfalls Wiederholung der Schritte (b) bis (f), Components), each type of nucleotide conjugate having a characteristic mark. c) Removal of Unincorporated Nucleotide Conjugates from the NSK Primer Complexes d) Detection of Signals from Nucleotide Conjugates Incorporated into the NSK Primer Complexes e) Cleavage of the Linker Component as well as the Marker Component from those into the NSK Primer complexes incorporated nucleotide conjugates f) washing of the NSK primer complexes optionally repeating steps (b) to (f),
In einer Ausführungsform können die zu sequenzierenden Nukleinsäureketten an eine feste Phase in zufälliger Anordnung fixiert sein und zumindes ein Teil der NSK-Primer- Komplexen optisch einzeln adressierbar ist (Sequenzierung-durch-Synthese Verfahren nach Helicos Biosiences oder Genovoxx GmbH). In one embodiment, the nucleic acid chains to be sequenced can be fixed to a solid phase in a random arrangement and at least some of the NSK primer complexes can be optically addressed individually (sequencing-by-synthesis method according to Helicos Biosiences or Genovoxx GmbH).
In einer Ausführungsform können die zu sequenzierende Nukleinsäureketten an eine feste Phase in zufälliger Anordnung fixiert sein und bilden Mikrokolonien mit identischen Sequenzen in jeder Kolonie (Sequenzierung-durch-Synthese Solexa- Verfahren von Illumina). In one embodiment, the nucleic acid chains to be sequenced can be fixed to a solid phase in random order and form microcolonies with identical sequences in each colony (sequencing-by-synthesis Solexa method of Illumina).
Der Ablauf von solchen Verfahren ist einem Fachmann bekannt. 1.3 Detaillierte Beschreibung der Erfindung Definitionen und Begriffe The course of such processes is known to a person skilled in the art. 1.3 Detailed Description of the Invention Definitions and Terms
1.3.1 Makromolekulare Verbindung - ein Molekül, oder ein Molekülkomplex, oder ein Nanokristall oder ein Nanoteilchen, dessen Masse zwischen 2kDa und 20kDa, 2kDa und 50kDa, 2kDa und lOOkDa, lOOkDa und 200kDa, 200kDa und lOOOkDa oder IM Da und lOOMDa oder 100 MDa und 100 GDa liegt. Beispiele für makromolekulare Verbindungen sind Nukleinsäuren, wie Oligonukleotide mit einer Länge von mehr als 7 Nukleotiden, Polynukleotide, Polypeptide, Proteine oder Enzyme, Quantum Dots, Polymere wie PEG, Mowiol, Dextran, Polyacrylat, Nanogold-Partikel aber auch Komplexe, die aus mehreren Makromolekülen bestehen.  1.3.1 Macromolecular compound - a molecule, or a molecular complex, or a nanocrystal or nanoparticle whose mass is between 2kDa and 20kDa, 2kDa and 50kDa, 2kDa and 100kDa, 100kDa and 200kDa, 200kDa and 100OkDa or IM Da and lOOMDa or 100MDa and 100 GDa lies. Examples of macromolecular compounds are nucleic acids, such as oligonucleotides with a length of more than 7 nucleotides, polynucleotides, polypeptides, proteins or enzymes, quantum dots, polymers such as PEG, Mowiol, dextran, polyacrylate, nanogold particles but also complexes consisting of several macromolecules consist.
1.3.2 Niedermolekulare Verbindung - ein Molekül oder ein Molekülkomplex, dessen Masse kleiner 2000 Da (2kDa) beträgt, z.B. Biotin, natürliche Nukleotide, dATP, dUTP, viele Farbstoffe, wie Cy3, Rhodamine, Fluorescein und konventionell modifizierte Nukleotide, wie Biotin-16-dUTP. 1.3.2 Low molecular weight compound - a molecule or molecular complex whose mass is less than 2000 Da (2kDa), e.g. Biotin, natural nucleotides, dATP, dUTP, many dyes such as Cy3, rhodamine, fluorescein, and conventionally modified nucleotides such as biotin-16-dUTP.
1.3.3 Ein Nuk-Makromolekül (ein Nukleotid-Konjugat) im Sinne dieser Anmeldung ist eine chemische Struktur (ein Nukleotid-Analog, ein Nukleotid- Konjugat), die eine oder mehrere Nuk-Komponenten, eine oder mehrere Linker- Komponenten und zumindest eine Marker-Komponente einschließt: 1.3.3 A nuc-macromolecule (a nucleotide conjugate) in the context of this application is a chemical structure (a nucleotide analog, a nucleotide conjugate) comprising one or more nuc-components, one or more linker components and at least one Marker component includes:
(Nuk-Linker)n-Marker wobei : (Nuk linker) n marker where:
Nuk - eine Nuk-Komponente ist  Nuk - a nuk component is
Linker - eine Linker-Komponente ist  Linker - is a linker component
Marker - eine Marker-Komponente ist  Marker - a marker component is
n - eine Zahl von 1 bis 100 ist n is a number from 1 to 100
Nuk - ein Nukleotid- oder ein Nukleosid-Monomer ist (Nuk-Komponente)Nuk - is a nucleotide or a nucleoside monomer (nuc-component)
Linker - Seine Zusammensetzung ist nicht eingeschränkt, solange die Substrat- Eigenschaften der Nukleotide nicht verloren gehen. Seine Länge liegt zwischen 5 und 100 Kettenatome. Linker - Its composition is not limited as long as the substrate properties of the nucleotides are not lost. Its length is between 5 and 100 chain atoms.
Marker - eine Marker-Komponente, die mindestens eine Nukleinsäuresequenz mit der Länge zwischen 3 und 200 Nukleobasen Einschließt (ein Oligonukleotid) Marker - a marker component that includes at least one nucleic acid sequence of between 3 and 200 nucleobases in length (one oligonucleotide)
n - eine Zahl von 1 bis 100, wobei (n) einen durchschnittlichen Wert darstellen kann. n - a number from 1 to 100, where (n) is an average value can represent.
Weitere Beispiele für Synthesen und Verwendung von Nuk-Makromolekülen sind in Anmeldungen Cherkasov et al WO2011050938, Cherkasov et al WO 2005044836, Cherkasov et al WO2006097320, Cherkasov et al WO 2008043426, Cherkasov et al DE 10356837, Cherkasov et al DE 102004009704 angegeben. Further examples of syntheses and use of nuc-macromolecules are given in applications Cherkasov et al. WO2011050938, Cherkasov et al., WO2005044836, Cherkasov et al. WO2006097320, Cherkasov et al., WO 2008043426, Cherkasov et al DE 10356837, Cherkasov et al DE 102004009704.
1.3.3.1 Nuk-Komponente 1.3.3.1 Nuc component
Nuk-Komponente ist ein Substrat für Nukleotid- bzw. Nukleosid-akzeptierendes Enzym. Nuk-Komponente kann sowohl ein Nukleotid als auch ein Nukleosid darstellen. Im Folgenden werden bei der Beschreibung Nukleotide stellvertretend für beide Klassen betrachtet. Nukleotiside können mittels entsprechender Enzyme oder chemischer Methoden in eine Nukleotidform umgewandelt werden. In einer Ausführungsform ist Nuk-Komponente ein Nukleotid- oder ein Nukleosid- Monomer, das mit der Linker-Komponente gekoppelt ist. Prinzipiell können alle als Substrat für Nukleotid-akzeptierende Enzyme geeigneten konventionellen Nukleotid- Varianten als Nuk-Komponente des Nuk-Makromoleküls dienen, so dass sowohl natürliche als auch modifizierte Nukleotide (Nukleotid-Analoga) für die Nuk- Komponente in Frage kommen. Bei modifizierten Nukleotiden können Base-, Zuckeroder Phosphat-Teile modifiziert werden. Viele Beispiele für Nukleotid-Modifikationen sind dem Fachmann bekannt („ Nucleoside Triphosphates and their Analogs", Morteza Vaghefi, 2005, ISBN 1-57444-498-0; "Deoxynucleoside analogs in Cancer therapy" Godefridus J. Peters, 2006, ISBN 1-58829-327-0; "Chemistry of nucleosides and nucleotides" Leroy B. Townsend, 1991, ISBN 0-306-43646-9; "Advanced organic chemistry of nucleic acids", 1994, Shabarova, ISBN 3-527-29021-4; "Nucleotide Analogs" Scheit, 1980, ISBN 0-471-04854-2; "Nucleoside and Nucleic Acid Chemistry", Kisakürek 2000, "Anti-HIV Nucleosides" Mitsuya, 1997, "Nucleoside Analogs in cancer therapy", Cheson, 1997) im Text werden auch weitere Beispiele für die Modifikationen der Nukleotide angegeben.  Nuk component is a substrate for nucleotide or nucleoside accepting enzyme. Nuk component can be both a nucleotide and a nucleoside. In the following, in the description nucleotides are considered representative of both classes. Nucleotides can be converted into a nucleotide form by means of appropriate enzymes or chemical methods. In one embodiment, nuc-component is a nucleotide or nucleoside monomer coupled to the linker moiety. In principle, all conventional nucleotide variants suitable as substrate for nucleotide-accepting enzymes can serve as nuc-component of the nuc-macromolecule so that both natural and modified nucleotides (nucleotide analogues) are suitable for the nuc-component. For modified nucleotides, base, sugar or phosphate moieties can be modified. Many examples of nucleotide modifications are known to those of skill in the art ("Nucleoside Triphosphates and their Analogs", Morteza Vaghefi, 2005, ISBN 1-57444-498-0; "Deoxynucleosides analogous to Cancer Therapy" Godefridus J. Peters, 2006, ISBN 1- Leroy B. Townsend, 1991, ISBN 0-306-43646-9, "Advanced Organic Chemistry of Nucleic Acids", 1994, Shabarova, ISBN 3-527-29021-4 "Nucleotide Analogs" Scheit, 1980, ISBN 0-471-04854-2, "Nucleosides and Nucleic Acid Chemistry", Kisakürek 2000, "Anti-HIV Nucleosides" Mitsuya, 1997, "Nucleoside Analogs in Cancer Therapy", Cheson, 1997 ) in the text also other examples of the modifications of the nucleotides are given.
Die Nuk-Komponente schließt vorzugsweise eine Base-Komponente (Base), eine Zucker-Komponente (Zucker) und wahlweise eine Phosphat-Komponente (Phosphat) ein. Base, Zucker und Phosphat können modifiziert sein, d.h. die Grundstruktur sieht den natürlichen Nukleotiden oder Nukleosiden ähnlich, trägt aber beispielsweise zusätzliche chemische Gruppen. Beispiele für Kombinationen aus verschiedenen Komponenten sind dem Fachmann bekannt. Solche Nuk-Komponenten können in vielen enzymatischen und chemischen Reaktionen eingesetzt werden (G. Wright et al. Pharmac.Ther. 1990, V. 47, S. 447-). In einer bevorzugten Ausführungsform, ist die Nuk-Komponente ein Substrat für DNA- Polymerasen. In einer anderen Ausführungsform, ist die Nuk-Komponente ein Substrat für RNA-Polymerasen. Variationen von Nukleotiden, die solche Substrat-Eigenschaften zulassen, können als Nuk-Komponente eingesetzt werden. Beispielsweise, Substrate für Nukleotid-akzeptierende Enzyme, denen ein Bestandteil eines konventionellen Nukleotids fehlt, z.B. azyklische Nukleotid-analoga, können ebenfalls als Nuk- Komponente eingesetzt werden. 1.3.3.1.1 Variationen am Phosphat The nuc-component preferably includes a base component (base), a sugar component (sugar) and optionally a phosphate component (phosphate). Base, sugar and phosphate can be modified, ie the basic structure looks similar to the natural nucleotides or nucleosides, but carries, for example, additional chemical groups. Examples of combinations of different components are known to the person skilled in the art. Such nuc-components can be used in many enzymatic and chemical reactions (Wright, Wright et al., Pharmac.Ther 1990, V. 47, p 447-). In a preferred embodiment, the nuc-component is a substrate for DNA polymerases. In another embodiment, the nuc-component is a substrate for RNA polymerases. Variations of nucleotides that allow such substrate properties can be used as a nuc-component. For example, substrates for nucleotide-accepting enzymes lacking a constituent of a conventional nucleotide, eg, acyclic nucleotide analogs, can also be used as a nuc-component. 1.3.3.1.1 Variations on the phosphate
In einer Ausführungsform stellt die Nuk-Komponente ein Nukleosid dar. In einer anderen Ausführungsform stellt die Nuk-Komponente ein Nukleosid-Monophosphat dar. In einer anderen Ausführungsform stellt die Nuk-Komponente ein Nukleosid- Diphosphat dar. In einer weiteren Ausführungsform stellt die Nuk-Komponente ein Nukleosid-Triphosphat dar. Auch höhere Phosphat-Derivate (Tetraphosphat, Pentaphosphate usw.) können verwendet werden.  In one embodiment, the nuc-component is a nucleoside. In another embodiment, the nuc-component is a nucleoside monophosphate. In another embodiment, the nuc-component is a nucleoside diphosphate. In another embodiment, the nuclide component Component is a nucleoside triphosphate. Also higher phosphate derivatives (tetraphosphate, pentaphosphates, etc.) can be used.
Die genannten Phosphatmodifikationen können wie bei Nukleosid-Triphosphaten an der 5 ' -Position oder auch an anderen Positionen des Zucker-Teils des Nukleotides sitzen, beispielsweise an der 3 ' -Position. The phosphate modifications mentioned can, as with nucleoside triphosphates, be located at the 5 ' position or also at other positions of the sugar part of the nucleotide, for example at the 3 ' position.
Wahlweise kann die Phosphat-Komponente Modifikationen einschließen, solche Modifikationen schließen beispielsweise in einer Ausführungsform einen Linker ein (D. Jameson et al. Methods in Enzymology 1997, V. 278, S. 363-, A. Draganescu et al. J. Biol.Chem. 2000 v.275, 4555-). In einer weiteren Ausführungsform schließt die Phosphat-Komponente der Nuk-Komponente Thiotriphosphat-Verbindungen ein (Burges et al. PNAS 1978 v. 75, S. 4798-). Optionally, the phosphate moiety may include modifications, such modifications include, for example, in one embodiment, a linker (Jameson, D., et al., Methods in Enzymology 1997, V. 278, p363, A. Draganescu et al., J. Biol. Chem. 2000, v.275, 4555). In a further embodiment, the phosphate component of the nuc-component includes thiotriphosphate compounds (Burges et al., PNAS 1978 v. 75, pp. 4798-).
In einer weiteren Ausführungsform schließt die Phosphat-Komponente der Nuk- Komponente geschützte Phosphat-Gruppen (z.B. Phosphoroamidite) ein.  In another embodiment, the phosphate component of the nuc-component includes protected phosphate groups (e.g., phosphoramidites).
In einer Ausführungsform stellt die Phosphat-Komponente die Verbindung zwischen der Nuk-Komponente und der Linker-Komponente der Nuk-Makromoleküle dar. In one embodiment, the phosphate component is the link between the nuc-component and the linker component of the nuc-macromolecules.
1.3.3.1.2 Variationen an der Base 1.3.3.1.2 Variations on the Base
Die Nuk-Komponente kann ein in der Natur in den Nukleinsäuren vorkommendes Nukleotid oder Nukleosid oder seine Analoga darstellen, vorzugsweise die an Watson- Crick-Paarbildung teilnehnem, beispielsweise Adenin, Guanin, Thymin, Cytosin, Uracil, Inosin, oder eine modifizierte Base, wie z.B. 7-Deazaadenin, 7-Deazaguanin, 6-Thio- adenin, einschließen, Literatur s. oben. Wahlweise kann die Base Modifikationen einschließen, solche Modifikationen schließen beispielsweise in einer Ausführungsform einen an die Base gekoppelten Linker wie beispielsweise ein Amino-propargyl-Linker oder ein Amino-Allyl-Linker ein, weitere Beispiele für die Linker sind bekannt (Ward et al. US Pat 4711955, G. Wright et al. Pharmac.Ther. 1990, V. 47, S. 447-, Hobbs et al. US Patent 5.047.519 oder andere Linker z.B. Klevan US Pat. 4,828,979, Seela US pat. 6211158, US pat. 4804748, EP 0286028, Hanna M. Method in Enzymology 1996 v.274, S.403, Zhu et al. NAR 1994 v.22 S.3418, Jameson et al. Method in Enzymology, 1997, v. 278, S. 363-, Held et al. Nucleic acid research, 2002, v. 30 3857-, Held et al. Nucleosides, nucleotides & nucleic acids, 2003, v. 22, S. 391, Short US Pat. 6579704, Odedra WO 0192284). In einer Ausführungsform stellt der an die Base gekoppelte Linker die Verbindung zwischen der Nuk-Komponente und der Linker-Komponente der Nuk-Makromoleküle dar. Weitere Modifikationen an der Base sind beispielsweise im Katalog von Trilink Biotechnologies, Inc. San Diego, USA, dargestellt bzw. in "Nucleoside triphosphates and their analogs", Morteza Vaghefi, 2005 ISBN 1-57444- 498-0. 1.3.3.1.3 Variationen am Zucker The nuc-component may be a nucleotide or nucleoside or its analogues occurring naturally in the nucleic acids, preferably those participating in Watson-Crick pair formation, for example adenine, guanine, thymine, cytosine, uracil, inosine, or a modified base such as eg 7-deazaadenine, 7-deazaguanine, 6-thioadenine, literature see. above. Optionally, the base may include modifications, such modifications include, for example, in one embodiment, a linker coupled to the base, such as an amino-propargyl linker or an amino-allyl linker, further examples of the linkers are known (Ward et al US Pat 4711955, G. Wright et al., Pharmac.Ther 1990, V. 47, p 447, Hobbs et al. US Patent 5,047,519 or other linkers such as Klevan US Pat. 4,828,979, Seela US Pat. 6,211,158, US Pat. 4,804,448, EP 0286028, Hanna M. Method in Enzymology 1996 v.274, p.403, Zhu et al., NAR 1994 v.22 p.3418, Jameson et al., Methodology in Enzymology, 1997, v. 278, pp. 363-, Held et al., Nucleic acid research, 2002, v. 30, 3857, Held et al., Nucleosides, nucleotides & Nucleic acids, 2003, v. 22, p. 391, Short US Pat. 6579704, Odedra WO 0192284). In one embodiment, the linker coupled to the base is the link between the nuc-component and the linker component of the nuc-macromolecules. Further modifications to the base are shown, for example, in the catalog of Trilink Biotechnologies, Inc. San Diego, USA in "Nucleosides triphosphates and their analogs", Morteza Vaghefi, 2005 ISBN 1-57444-498-0. 1.3.3.1.3 Variations on sugar
Dem Fachmann sind verschiedene Variationen der Zucker-Komponente der Nukleotide bekannt, die z.B. in der Diagnostik, Therapie oder Forschung eingesetzt werden. Solche Variationen schließen z.B. Ribose , 2 ' -Deoxyribose oder 2 ' ,3 ' -Dideoxyribose ein. Wahlweise kann die Zucker-Komponente Modifikationen einschließen (M. Metzger et al. Nucleic Acid Research 1994, V. 22, 4259-, Tsien WO 91/06678), solche Modifikationen schließen beispielsweise in einer Ausführungsform einen Linker ein. Die modifizierende Gruppe oder Linker kann beispielsweise reversibel an die Zucker- Komponente gekoppelt sein (Hovinen et al. J.Chem.Soc.Prking Trans. 1994, S. 211-, Canard US Pat. 5798210, Kwiatkowski US Pat. 6255475, Kwiatkowski WO 01/25247, Ju et al. US Pat. 6664079, Fahnestock et al. WO 91066678, Cheeseman US Pat. 5302509, Parce et al. WO 0050642, Milton et al. WO 2004018493, Milton et al. 2004018497). The skilled worker is aware of various variations of the sugar component of the nucleotides, which are used for example in diagnostics, therapy or research. Such variations include for example, ribose, 2 '-Deoxyribose or 2', 3 '-Dideoxyribose. Optionally, the sugar component may include modifications (Metzger, M., et al., Nucleic Acid Research 1994, V. 22, 4259, Tsien WO 91/06678), such modifications include, for example, in one embodiment, a linker. For example, the modifying group or linker may be reversibly coupled to the sugar moiety (Hovinen et al., J. Chem. Soc.Prking Trans., 1994, pp. 211-, Canard US Pat., 5,798,210, Kwiatkowski, USPat. 6,254,575, Kwiatkowski WO 01/25247, Ju et al., US Pat., 6664079, Fahnestock et al., WO 91066678, Cheeseman, US Pat., 5,302,509, Parce et al, WO 0050642, Milton, et al., WO 2004018493, Milton et al., 2004018497).
In einer Ausführungsform stellt der an die Zucker-Komponente gekoppelte Linker die Verbindung zwischen der Nuk-Komponente und der Linker-Komponente der Nuk- Makromoleküle dar.  In one embodiment, the linker coupled to the sugar component is the link between the nuc-component and the linker component of the nuc-macromolecules.
In einer weiteren Ausführungsform schließt die Zuker-Komponente z.B. folgende Modifikationen ein : wahlweise kann die 3 ' - oder die 2 ' -OH-Gruppen durch folgende Atome oder Gruppen ersetzt werden : Halogenatome, Wasserstoff, Amino-, Merkapto- oder Azido-Gruppe (Beabealashvilli et al. Biochem Biophys Acta 1986, v.868, 136-, Yuzhanov et al. FEBS Lett. 1992 v. 306, 185-). In a further embodiment, the sugar component includes, for example, the following modifications: optionally, the 3 ' or the 2 ' -OH groups can be replaced by the following atoms or groups: halogen atoms, hydrogen, amino, mercapto or azido group ( Beabealashvilli et al., Biochem Biophys Acta 1986, v.868, 136-, Yuzhanov et al., FEBS Lett., 1992, v. 306, 185-).
In einer weiteren Ausführungsform schließt die Nuk-Komponente azyklische Nukleotid- oder Nukleosid-Modifikationen ein ( A. Holy Current Pharmaceutical Design 2003 v. 9, 2567-, G. Wright et al . Pharmac.Ther. 1990, V. 47, S. 447-). In einer weiteren Ausführung kann die Zucker-Komponente eine Doppeltbindung einschließen. In another embodiment, the nuc-component includes acyclic nucleotide or nucleoside modifications (A.Hollow Current Pharmaceutical Design 2003 v. 9, 2567, G. Wright et al., Pharmac.Ther 1990, v. 47, pp. 447-). In a further embodiment, the sugar component may include a double bond.
In der Anmeldung werden 2 ' -Deoxynukleotide, beispielsweise 2 ' -Deoxyuridin- Triphosphat, 2 ' -Deoxycytidin-Triphosphat, 2 ' -Deoxyadenosin-Triphosphat, 2 - Deoxyguanosin-Triphosphat als dUTP, dCTP, dATP und dGTP bezeichnet. In the application, are 2 '-Deoxynukleotide, for example 2' -Deoxyuridin- triphosphate, 2 '-Deoxycytidin triphosphate, 2' -Deoxyadenosin triphosphate, 2 - deoxyguanosine triphosphate dUTP, dCTP, dATP and dGTP, respectively.
Anwesenheit oder Abwesenheit der Fähigkeit der Nuk-Komponente zur weiteren Kopplung von Nukleotiden durch eine Polymerase ist entscheidend für die Eigenschaften von Nukleotid-Konjugaten. The presence or absence of the nuc-component's ability to further couple nucleotides with a polymerase is critical to the properties of nucleotide conjugates.
In einer vorteilhaften Ausführungsform der Erfindung werden Nukleotid-Analoga als Nuk-Komponte eingesetzt, die als Terminatoren der enzymatischen Synthese auftreten. Ein Beispiel dafür stellen ddNTP-Analoga dar, z. B. 2 ' ,3 ' -dideoxy-UTP. Einem Fachmann sind weitere Beispiele für Terminatoren bekannt. In an advantageous embodiment of the invention, nucleotide analogues are used as nuc-component, which occur as terminators of the enzymatic synthesis. An example of this is represented by ddNTP analogs, e.g. B. 2 ', 3' dideoxy-UTP. A person skilled in the art will be familiar with further examples of terminators.
1.3.3.1.4 Kopplung der Nuk-Komponente und Linker 1.3.3.1.4 Coupling of the nuc-component and linker
Die Nuk-Komponente ist an einer Kopplungsstelle mit dem Linker verbunden. Die Kopplungsstelle des Linkers an die Nuk-Komponente liegt in einer Ausführungsform an der Base.  The nuc-component is connected to the linker at a coupling site. The coupling site of the linker to the nuc-component is in one embodiment at the base.
In einer anderen Ausführungsform wird Linker an Zucker (Ribose bzw. Deoxyribose) gekoppelt.  In another embodiment, linker is coupled to sugar (ribose or deoxyribose).
In einer anderen Ausführungsform der Erfindung wird der Linker an der endständigen Phosphat-Gruppe des Phosphat-Anteils der Nuk-Komponenten gekoppelt.  In another embodiment of the invention, the linker is coupled to the terminal phosphate group of the phosphate moiety of the nuc-components.
Die Verbindung zwischen der Linker-Komponente und der Nuk-Komponente ist vorzugsweise kovalent. The connection between the linker component and the nuc-component is preferably covalent.
Wenn die Kopplungsstelle an der Base liegt, so befindet sie sich vorzugsweise an den Positionen 4 oder 5 bei Pyrimidin-Basen und an den Positionen 6,7,8 bei den Purin- Basen (Ward et al . US Pat 4711955, G. Wright et al. Pharmac.Ther. 1990, V. 47, S. 447-, Hobbs et al. US Patent 5.047.519 oder andere Linker z.B. Klevan US Pat. 4,828,979, Seela US pat. 6211158, US pat. 4804748, EP 0286028, Hanna M. Method in Enzymology 1996 v.274, S.403, Zhu et al. NAR 1994 v.22 S.3418, Jameson et al. Method in Enzymology, 1997, v. 278, S. 363-, Held et al . Nucleic acid research, 2002, v. 30 3857-, Held et al. Nucleosides, nucleotides & nucleic acids, 2003, v. 22, S. 391, Short US Pat. 6579704, Odedra WO 0192284). Weitere Beispiele für Modifikationen an der Base sind in "Nucleoside triphosphates and their analogs", Morteza Vaghefi, 2005 ISBN 1-57444-498-0; angegeben. Am Zucker können die Positionen 2 " , 3 ' , 4 ' oder 5 ' die Kopplungsstellen darstellen. Die Kopplung an die Phosphatgruppen kann beispielweise an der alpha, beta, oder gamma-Phosphatgruppe erfolgen. Beispiele für die Kopplungsstelle an der Base sind in Short WO 9949082, Balasubramanian WO 03048387, Tcherkassov WO 02088382 (siehe auch kommerziell erhältliche Nukleotide (Amersham, Roche, Trilink Technologies, Jena Bioscience), an der Ribose in Herrlein et al. Helvetica Chimica Acta, 1994, V. 77, S. 586, Jameson et al. Method in Enzymology, 1997, V. 278, S. 363, Canard US Pat. 5798210, Kwiatkowski US Pat. 6255475, Kwiatkowski WO 01/25247, Parce WO 0050642., an Phosphatgruppen in Jameson et al. Method in Enzymology, 1997, V. 278, S. 363 beschrieben. When the coupling site is at the base, it is preferably located at positions 4 or 5 at pyrimidine bases and at positions 6, 7, 8 at the purine bases (Ward et al., US Patent 4,711,955, G. Wright et Pharmac.Ther 1990, V. 47, p 447, Hobbs et al., US Patent 5,047,519 or other linkers, eg, Klevan US Pat. 4,828,979, Seela US Pat. Hanna M. Method in Enzymology 1996 v.274, p.403, Zhu et al NAR 1994 v.22 p.3418, Jameson et al Method in Enzymology, 1997, v. 278 pp. 363-, Held et al Nucleic acid research, 2002, v. 30 3857-, Held et al., Nucleosides, nucleotides & Nucleosides, 2003, v. 22, p. 391, Short US Patent 6579704, Odedra WO 0192284). Further examples of modifications to the base are in "Nucleoside triphosphates and their analogs", Morteza Vaghefi, 2005 ISBN 1-57444-498-0; specified. On sugar, the positions 2 " , 3 ' , 4' or 5 'represent the coupling points. The coupling to the phosphate groups can be carried out, for example, on the alpha, beta or gamma phosphate group. Examples of the coupling site to the base are described in Short WO 9949082, Balasubramanian WO 03048387, Tcherkassov WO 02088382 (see also commercially available nucleotides (Amersham, Roche, Trilink Technologies, Jena Bioscience), on the ribose in Herrlein et al., Helvetica Chimica Acta, 1984, V. 77, p. 586, Jameson et al., Methodology in Enzymology, 1997, V. 278, p 363, Canard, US Pat., 5798210, Kwiatkowski, US Patent 6255475, Kwiatkowski WO 01/25247, Parce WO 0050642. , to phosphate groups in Jameson et al., Method in Enzymology, 1997, v. 278, p363.
Die Position der Kopplungsstelle hängt vom Einsatzgebiet der Nuk-Makromoleküle ab. So werden beispielsweise für Markierungen von Nukleinsäuren, die am Nukleinsäurestrang verbleiben soll, vorzugsweise Kopplungsstellen am Zucker oder an der Base verwendet. The position of the coupling site depends on the field of application of nuc macromolecules. Thus, for example, for labeling of nucleic acids which is to remain on the nucleic acid strand, coupling sites on the sugar or on the base are preferably used.
Die Kopplung an die Gamma- oder Beta-Phosphatgruppen kann beispielsweise dann erfolgen, wenn die Markierung beim Einbau des Nuk-Makromoleküls freigesetzt werden soll. Die Verbindung zwischen der Nuk-Komponente und der Linker-Komponente erfolgt beispielsweise über eine Kopplungseinheit (L), die ein Teil der Linker-Komponente ist. The coupling to the gamma or beta-phosphate groups can be carried out, for example, if the label is to be released during the incorporation of the nuc-macromolecule. The connection between the nuc-component and the linker component takes place, for example, via a coupling unit (L) which is a part of the linker component.
Die Verbindung zwischen der Nuk-Komponente und dem Linker kann in einer Ausführungsform widerstandsfähig sein, z.B. bei Temperaturen bis zu 130°C, für pH- Bereiche zwischen 1 und 14, und/oder resistent gegen hydrolytische Enzyme (z.B. Proteasen, Esterasen) sein. In einer anderen Ausführungsform der Erfindung ist die Verbindung zwischen der Nuk-Komponente und dem Linker unter milden Bedingungen spaltbar. Diese spaltbare Verbindung ermöglicht die Entfernung der Linker- und der Marker- Komponenten. Dies kann beispielsweise in den Verfahren der Sequenzierung durch die Synthese von Bedeutung sein, wie Pyrosequencing, BASS (Canard et al. US Patent 5.798.210, Rasolonjatovo Nucleosides & Nucleotides 1999, V.18 S.1021, Metzker et al. NAR 1994, V.22, S.4259, Welch et al. Nucleosides & Nucleotides 1999, V.18, S.19, Milton et al. WO 2004018493, Odedra at al. WO 0192284) oder Single molecule sequencing, Tcherkassov WO 02088382. Ihre Wahl ist nicht eingeschränkt, sofern sie unter den Bedingungen der enzymatischen Reaktion stabil bleibt, keine irreversible Störung der Enzyme (z.B. Polymerase) verursacht und unter milden Bedingungen abgespalten werden kann. Unter "milden Bedingungen" sind solche Bedingungen zu verstehen, die zum Beispiel Nukleinsäure-Primer-Komplexe nicht zerstören, wobei z.B. der pH- Wert vorzugsweise zwischen 3 und 11 und die Temperatur zwischen 0°C und einem Temperaturwert (x) liegt. Dieser Temperaturwert (x) hängt von der Tm des Nukleinsäure-Primer-Komplexes (Tm ist der Schmelzpunkt) und wird beispielsweise als Tm (Nukleinsäure-Primer-Komplex) minus 5°C errechnet (z.B. Tm ist 47°C, dann liegt die maximale Temperatur bei 42°C; unter diesen Bedingungen eignen sich besonders Ester-, Thioester-, Acetale, Phosphoester-, Disulfid-Verbindungen und photolabile Verbindungen als spaltbare Verbindungen). In one embodiment, the connection between the nuc-component and the linker may be resistant, eg at temperatures up to 130 ° C, for pH ranges between 1 and 14, and / or resistant to hydrolytic enzymes (eg proteases, esterases). In another embodiment of the invention, the connection between the nuc-component and the linker is cleavable under mild conditions. This fissile connection allows removal of the linker and marker components. This may be important, for example, in the methods of sequencing by synthesis, such as Pyrosequencing, BASS (Canard et al., US Patent 5,798,210, Rasolonjatovo Nucleosides & Nucleotides 1999, V.18 S.1021, Metzker et al., NAR 1994, V.22, p.4259, Welch et al., Nucleosides & Nucleotides 1999, V.18, p.19, Milton et al., WO 2004018493, Odedra et al., WO 0192284), or single molecule sequencing, Tcherkassov WO 02088382. Your Choice is not limited, provided that it remains stable under the conditions of the enzymatic reaction, does not cause irreversible disruption of the enzymes (eg polymerase) and under mild conditions can be split off. By "mild conditions" are meant those conditions which, for example, do not destroy nucleic acid-primer complexes, for example the pH preferably being between 3 and 11 and the temperature between 0 ° C and a temperature value (x). This temperature value (x) depends on the Tm of the nucleic acid-primer complex (Tm is the melting point) and is calculated, for example, as Tm (nucleic acid-primer complex) minus 5 ° C (eg Tm is 47 ° C, then the maximum Temperature at 42 ° C, under these conditions are particularly suitable ester, thioester, acetals, phosphoester, disulfide compounds and photolabile compounds as cleavable compounds).
Vorzugsweise gehört die genannte spaltbare Verbindung zu chemisch oder enzymatisch spaltbaren oder photolabilen Verbindungen. Als Beispiele von chemisch spaltbaren Gruppen sind Ester-, Thioester-, Tartrat-, Disulfid-, Diol- (z.B.-CH2(OH)-CH2(OH)-), Acetal-Verbindungen bevorzugt (Short WO 9949082,„Chemistry of protein conjugation and crosslinking" Shan S. Wong 1993 CRC Press Inc., Herman et al. Method in Enzymology 1990 V.184 S.584, Lomant et al. J.Mol.Biol. 1976 V.104 243, "Chemistry of carboxylic acid and esters" S.Patai 1969 Interscience Publ., Pierce Katalog). Beispiele für photolabile Verbindungen können in folgenden Literaturstellen gefunden werden: Rothschild WO 9531429, "Protective groups in organic synthesis" 1991 John Wiley & Sons, Inc., V. Pillai Synthesis 1980 S. l, V. Pillai Org. Photochem. 1987 V.9 S.225, Dissertation „Neue photolabile Schutzgruppen für die lichtgesteuerte Oligonucleotidsynthese" H.Giegrich, 1996, Konstanz, Dissertation „Neue photolabile Schutzgruppen für die lichtgesteuerte Oligonucleotidsynthese" S.M. Bühler, 1999, Konstanz).. Preferably, said cleavable compound belongs to chemically or enzymatically cleavable or photolabile compounds. As examples of chemically cleavable groups, ester, thioester, tartrate, disulfide, diol (eg, -CH 2 (OH) -CH 2 (OH) -), acetal compounds are preferred (Short WO 9949082, "Chemistry of protein conjugation and crosslinking "Shan S. Wong 1993 CRC Press Inc., Herman et al Method in Enzymology 1990 V.184 S.584, Lomant et al., J. Mol. Biol., 1976 V. 104 243," Chemistry of carboxylic acid and esters "S.Patai 1969 Interscience Publ., Pierce Catalog). Examples of photolabile compounds can be found in the following references: Rothschild WO 9531429" Protective groups in organic synthesis "1991 John Wiley & Sons, Inc., V. Pillai Synthesis 1980 S. l, V. Pillai Org. Photochem., 1987 V.9 p.225, Dissertation "New Photolabile Protecting Groups for Light-Controlled Oligonucleotide Synthesis" H.Giegrich, 1996, Konstanz, Dissertation "New Photolabile Protecting Groups for Light-Controlled Oligonucleotide Synthesis" SM Buhler, 1999, Constance) ..
1.3.3.1.5 Zahl der gekoppelten Nuk-Komponenten 1.3.3.1.5 Number of coupled nuc components
In einer Ausführungsform der Erfindung ist pro ein Nuk-Makromolekül nur eine Nuk- Komponente gekoppelt. In einer anderen Ausführungsform der Erfindung sind mehrere Nuk- Komponenten pro Nuk-Makromolekül gekoppelt. Mehrere Nuk-Komponenten können einheitlich oder unterschiedlich sein, wobei beispielsweise durchschnittlich 2 bis 5, 5 bis 10, 10 bis 25, 25 bis 50, 50 bis 100 Nuk-Komponenten pro ein Nuk- Makromolekül gekoppelt sein können.  In one embodiment of the invention, only one nuc-component is coupled per one nuc-macromolecule. In another embodiment of the invention, several nuc-components are coupled per nuc-macromolecule. Several nuc-components may be unitary or different, for example, with an average of from 2 to 5, 5 to 10, 10 to 25, 25 to 50, 50 to 100 nuc-components per one nuc-macromolecule.
1.3.3.2 Linker-Komponente 1.3.3.2 Linker component
Die Funktion des Linkers ist, unter anderem, eine Nuk-Komponente und eine Marker- Komponente in Art und Weise zu verbinden, dass die Substrateigenschaften der Nuk- Komponente für nukleotid-akzeptierende Enzyme trotz Kopplung eines makromolekularen Markers nicht verloren gehen. Die Bezeichnung Linker oder Linker- Komponente wird synonym in der Anmeldung verwendet und bezieht sich auf den gesamten strukturellen Abschnitt des Nuk-Makromoleküls zwischen der Nuk- Komponente und der Marker-Komponente. Die genaue Linkerzusammensetzung ist nicht eingeschänkt und kann variieren. In einer Ausführungsform ist der Linker vorzugsweise hydrophil. The function of the linker is, inter alia, to link a nuc-component and a marker component in such a way that the substrate properties of the nuc-component for nucleotide-accepting enzymes are not lost despite coupling of a macromolecular marker. The term linker or linker Component is used synonymously in the application and refers to the entire structural portion of the nuc macromolecule between the nuc-component and the marker component. The exact linker composition is not limited and may vary. In one embodiment, the linker is preferably hydrophilic.
1.3.3.2.1 Linker-Länge 1.3.3.2.1 Linker length
Die durchschnittliche Linkerlänge schließt folgende Bereiche ein : zwischen 2 und 5, 5 und 10, 10 bis 20, 20 bis 30, 30 bis 40, 40 bis 50, 50 bis 60, 60 bis 70, 70 bis 80, 80 bis 90, 90 bis 100, 50 bis 100, 100 bis 1000 Ketten-Atome (gezählt werden Ketten- Atome), somit beträgt die durchschnittliche Linker-Länge zwischen 2 und 5, 5 und 10, 10 bis 20, 20 bis 30, 30 bis 40, 40 bis 50, 50 bis 60, 60 bis 70, 70 bis 80, 80 bis 90, 90 bis 100, 50 bis 100, 100 bis 1000 Angström (gemessen an einem potenziell maximal ausgestrecktem Molekül).  The average linker length includes the following ranges: between 2 and 5, 5 and 10, 10 to 20, 20 to 30, 30 to 40, 40 to 50, 50 to 60, 60 to 70, 70 to 80, 80 to 90, 90 to 100, 50 to 100, 100 to 1000 chain atoms (chain atoms are counted), so the average linker length is between 2 and 5, 5 and 10, 10 to 20, 20 to 30, 30 to 40, 40 to 50, 50 to 60, 60 to 70, 70 to 80, 80 to 90, 90 to 100, 50 to 100, 100 to 1000 angstroms (measured on a potentially maximally extended molecule).
Falls ein Nuk-Makromolekül mehrere Linker-Komponenten einschließt, können diese Linker-Komponenten untereinander gleiche oder auch unterschiedlich lang sein. If a nuc macromolecule includes multiple linker components, these linker components may be the same or different in length.
Einige Abschnitte des Linkers können rigide Bereiche enthalten und andere Abschnitte können flexible Bereiche enthalten. Some sections of the linker may contain rigid areas and other sections may contain flexible areas.
1.3.3.2.2 Kurzer Linker 1.3.3.2.2 Short Linker
In einer bevorzugten Form haben Nuk-Makromoleküle einen kurzen Linker. Seine Länge schließt Bereiche zwischen 2 bis 5, 5 bis 10, 10 bis 20, 20 bis 30, 30 bis 40, 40 bis 50 Kettenatomen ein. Solche Linker können funktionelle Gruppen tragen, wie beispielsweise Amino-, Carboxy-, Mercapto-, Hydroxygruppen, Alkyn-, Isothiocyanat-, Aldehyd- oder Azid-Gruppe. Solche Gruppen können in einer reaktiven Form, z.B. NHS-Ester für Carboxy-Gruppe, bereitgestellt werden. An diese Gruppen können weitere Moleküle gekoppelt werden. In einer Ausführungsform werden Cross-Linker an den kurzen Linker der Nuk-Komponente gekoppelt, so dass die resultierende Nuk- Komponente an weitere Substanzen gebunden werden kann, z.B. an makromolekulre Linker-Komponente oder Marker-Komponenten. Beispiele von kurzen Linkern gekoppelt an Nukleotide sind dem Fachmann bekannt ("Nucleoside triphosphates and their analogs", Morteza Vaghefi, 2005 ISBN 1-57444-498-0, Ward et al. US Pat 4711955, G. Wright et al. Pharmac.Ther. 1990, V. 47, S. 447-, Hobbs et al. US Patent 5.047.519 oder andere Linker z.B. Klevan US Pat. 4,828,979, Seela US pat. 6211158, US pat. 4804748, EP 0286028, Hanna M. Method in Enzymology 1996 v.274, S.403, Zhu et al. NAR 1994 v.22 S.3418, Jameson et al. Method in Enzymology, 1997, v. 278, S. 363-, Held et al. Nucleic acid research, 2002, v. 30 3857-, Held et al. Nucleosides, nucleotides & nucleic acids, 2003, v. 22, S. 391, Short US Pat. 6579704, Odedra WO 0192284). Der Linker kann eine oder mehrere Einheiten von Polymeren enthalten, wie beispielsweise Aminosäuren, Zucker, PEG-Einheiten oder Carbonsäuren. Weitere Beispiele für kurze Linker kann die Kopplungseinheit (L) eines langen Linkers dienen s.u. Beispiele für Cross-Linker sind einem Fachmann bekannt („Chemistry of protein conjugation and crosslinking" Shan S. Wong 1993). Viele Cross-Linker sind kommerziell erhältlich, z.B. von Invitrogen (Lifescience Technologies, Pierce Biotech, Iris-Biotech). Beispiele von Kopplungen von verschiedenen Substanzen an Makromoleküle, z.B. an Oligonukleotide sind ebenfalls bekannt (Y.Singh et al Chem.Soc.Rev.2010, 39, 2054-). Es ist für einen Fachmann offensichtlich, dass der Linker zwischen der Nuk- Komponente und der Marker-Komponente in mehreren chemischen Schritten aufgebaut werden kann. Noch weitere Beispiele für kurze Linker zwischen einer Nuk-Komponente und einem Marker sind am Beispiel der Verbindung zwischen einem Nukleosidtriphsophat (NUK) und einem Oligonukleotid (OLN) dargestellt. In a preferred form nuc-macromolecules have a short linker. Its length includes ranges between 2 to 5, 5 to 10, 10 to 20, 20 to 30, 30 to 40, 40 to 50 chain atoms. Such linkers may carry functional groups such as amino, carboxy, mercapto, hydroxy, alkyn, isothiocyanate, aldehyde or azide groups. Such groups can be provided in a reactive form, eg, NHS ester for carboxy group. Other molecules can be coupled to these groups. In one embodiment, cross-linkers are coupled to the short linker of the nuc-component so that the resulting nuc-component can be bound to other substances, eg macromolecular linker component or marker components. Examples of short linkers coupled to nucleotides are known to those skilled in the art ("Nucleoside triphosphates and their analogs", Morteza Vaghefi, 2005 ISBN 1-57444-498-0, Ward et al., US Pat 4711955, G. Wright et al., Pharmac 1990, V. 47, p 447-, Hobbs et al., US Patent 5,047,519 or other linkers, eg, Klevan US Pat. 4,828,979, Seela US Pat. 6,211,158, US Pat. 4,804,448, EP 0286028, Hanna M. Method Enzymology 1996 v.274, p.403, Zhu et al NAR 1994 v.22 p.3418, Jameson et al., Method in Enzymology, 1997, v. 278, P. 363-, Held et al. Nucleic acid research, 2002, v. 30, 3857, Held et al. Nucleosides, nucleotides & nucleic acids, 2003, v. 22, p. 391, Short US Pat. 6579704, Odedra WO 0192284). The linker may contain one or more units of polymers, such as amino acids, sugars, PEG units or carboxylic acids. Further examples of short linkers may be the coupling unit (L) of a long linker Examples of cross-linkers are known to a person skilled in the art ("Chemistry of protein conjugation and crosslinking" Shan S. Wong 1993.) Many cross-linkers are commercially available, eg by Invitrogen (Lifescience Technologies, Pierce Biotech, Iris-Biotech) Examples of couplings of various substances to macromolecules, eg to oligonucleotides, are also known (Y. Singh et al Chem. Soc. Rev. 2010, 39, 2054-) It is obvious to a person skilled in the art that the linker between the nuc-component and the marker component can be built up in a plurality of chemical steps Further examples of short linkers between a nuc-component and a marker are shown by the example of the connection between a nucleoside triphosphate (US Pat. NUK) and an oligonucleotide (OLN).
NUK-NH-OLN, NUK-O-OLN, NUK-S-OLN, NUK-SS-OLN, NUK-CO-NH-OLN, NUK- NH-CO-OLN, NUK-CO-O-OLN, NUK-O-CO-OLN, NUK-CO-S-OLN, NUK-S-CO-OLN,NUK-NH-OLN, NUK-O-OLN, NUK-S-OLN, NUK-SS-OLN, NUK-CO-NH-OLN, NUK-NH-CO-OLN, NUK-CO-O-OLN, NUK- O-CO-OLN, NUK-CO-S-OLN, NUK-S-CO-OLN,
NUK-(P(0)2)n-OLN, NUK-Si-OLN, NUK-(CH2)n-OLN, NUK- (P (O) 2 ) n-OLN, NUK-Si-OLN, NUK- (CH 2 ) n -OLN,
NUK-(CH2)n-OLN, NUK-A-(CH2)n-OLN, NUK-(CH2)n-B-OLN, NUK- (CH 2 ) n -OLN, NUK-A- (CH 2 ) n -OLN, NUK- (CH 2 ) n -B-OLN,
NUK-(CH = CH-)n-OLN, NUK-(A-CH=CH-)n-OLN, NUK-(CH = CH-B-)n-OLN, NUK- (CH = CH-) n -OLN, NUK- (A-CH = CH-) n -OLN, NUK- (CH = CH-B-) n -OLN,
NUK-A-CH=CH-(CH2-)n-OLN, NUK-(-CH=CH-CH2)n-B-OLN, NUK-(-CH =CH-CH2- CH2)n-B-OLN, NUK-(-0-CH2-CH2)n-B-OLN, NUK-A-(-0-CH2-CH2)n-OLN, NUK-A-(-NUK-A-CH = CH- (CH 2 -) n -OLN, NUK - (- CH = CH-CH 2 ) n -B-OLN, NUK - (- CH = CH-CH 2 - CH 2 ) n - B-OLN, NUK - (- O-CH 2 -CH 2 ) n -B-OLN, NUK-A - (- O-CH 2 -CH 2 ) n -OLN, NUK-A - (-
0-CH2-CH2)n-B-OLN, NUK-(C=C-)n-OLN, NUK-(A-C=C-)n-OLN, NUK-(C=C-B-)n- OLN, NUK-A-C-.C-(CH2-)n-OLN, NUK-(-C=C-CH2)n-B-OLN, NUK-(-C=C-CH2-CH2)n- B-OLN, wobei Nuk - die Nuk-Komponente ist, OLN - ein Oligonukleotid ist und A und B folgende strukturelle Elemente einschließen : -NH-, -O-, -S-, -SS-, -CO-NH-, -NH- CO-, -CO-O-, -O-CO-, -CO-S-, -S-CO-, -P(0)2-, -Si-, -(CH2)n-, eine photolabile Gruppe, wobei n - gleich 1 bis 5 ist Diese Beispiele sind lediglich zur Anschaulichung dargestellt, ohne die Struktur des Linkers einzuschränken. 1.3.3.2.3 Langer Linker 0-CH 2 -CH 2) n -B-OLN, nuc (C = C-) n -OLN, nuc (AC = C-) n -OLN, nuc (C = CB) n - OLN, NUK-AC-C- (CH 2 -) n-OLN, NUK - (- C =C-CH 2 ) n -B-OLN, NUK - (- C =C-CH 2 -CH 2 ) n -B -OLN, wherein Nuk - is the nuk component, OLN - is an oligonucleotide, and A and B include the following structural elements: -NH-, -O-, -S-, -SS-, -CO-NH-, -NH - CO-, -CO-O-, -O-CO-, -CO-S-, -S-CO-, -P (0) 2 -, -Si-, - (CH 2 ) n -, a photolabile Group, where n - is 1 to 5 These examples are presented for illustration only, without limiting the structure of the linker. 1.3.3.2.3 Long Linker
In einer weiteren bevorzugten Ausführungsform der Erfindung wird ein langer Linker eingesetzt, mit einer Länge von mehr als 50 Ketten-Atomen. Die Linker-Komponente hat in ihrer Struktur beispielsweise folgende Bestandteile:  In a further preferred embodiment of the invention, a long linker is used, with a length of more than 50 chain atoms. The linker component has in its structure, for example, the following components:
1) Kopplungseinheit L 1) coupling unit L
2) hydrophiles bzw. wasserlösliches Polymer  2) hydrophilic or water-soluble polymer
3) Kopplungseinheit T  3) coupling unit T
Die Aufteilung der Linker-Komponente in einzelne Bestandteile ist rein funktionell und soll lediglich der Anschaulichkeit der Struktur dienen. Je nach Betrachtungsweise können einzelne Strukturen des Linkers zum einen oder zum anderen Bestandteil gerechnet werden. The division of the linker component into individual components is purely functional and is intended only to illustrate the structure. Depending on the perspective, individual structures of the linker can be calculated for one or the other component.
Die Kopplungseinheit L hat die Funktion, die Linker-Komponente und die Nuk- Komponente zu verbinden. Bevorzugt sind kurze, unverzweigte Verbindungen, von 1 bis 20 Atome in der Länge. Die jeweilige Struktur der Kopplungseinheit L hängt von der Kopplungsstelle des Linkers an das Nukleotid und von dem jeweiligen Polymer des Linkers ab. Einige Beispiele für die Kopplungseinheiten L sind in Beispielen 1 bis 33 angegeben. Viele konventionell modifizierte Nukleotide tragen einen kurzen Linker, diese kurzen Linker dienen als weitere Beispiele für die Kopplungseinheit L, z.B. kurze Linker an der Base: Short WO 9949082, Balasubramanian WO 03048387, Tcherkassov WO 02088382(siehe auch kommerziell erhältliche Nukleotide (Amersham, Roche), kurze Linker an der Ribose in Herrlein et al. Helvetica Chimica Acta, 1994, V. 77, S. 586, Jameson et al. Method in Enzymology, 1997, V. 278, S. 363, Canard US. Pat. 5798210, Kwiatkowski US Pat. 6255475, Kwiatkowski WO 01/25247, Ju et al. US Pat. 6664079, Parce WO 0050642., kurze Linker an Phosphatgruppen in Jameson et al. Method in Enzymology, 1997, V. 278, S. 363 . The coupling unit L has the function of connecting the linker component and the nuc-component. Preferred are short, unbranched compounds, from 1 to 20 atoms in length. The respective structure of the coupling unit L depends on the coupling site of the linker to the nucleotide and on the respective polymer of the linker. Some examples of the coupling units L are given in Examples 1 to 33. Many conventionally modified nucleotides carry a short linker, these short linkers serve as further examples of the coupling moiety L, e.g. short linker to the base: Short WO 9949082, Balasubramanian WO 03048387, Tcherkassov WO 02088382 (see also commercially available nucleotides (Amersham, Roche), short linkers to the ribose in Herrlein et al., Helvetica Chimica Acta, 1994, V. 77, p 586, Jameson et al., Methodology in Enzymology, 1997, v. 278, p363, Canard US Patent No. 5,798,210, Kwiatkowski US Pat. No. 6,254,575, Kwiatkowski WO 01/25247, Ju et al., US Patent No. 6664079, Parce WO 0050642., short linkers to phosphate groups in Jameson et al., Method in Enzymology, 1997, v. 278, p363.
Noch weitere Beispiele für die Kopplungseinheit L sind nachfolgend angegeben: R6-NH-R7, R6-0-R7, R6-S-R7, R6-SS-R7, R6-CO-NH-R7, R6-NH-CO-R7, R6-CO-0-R7,Still further examples of the coupling unit L are given below: R 6 -NH-R 7 , R 6 -O-R 7 , R 6 -SR 7 , R 6 -SS-R 7 , R 6 -CO-NH-R 7 , R 6 -NH-CO-R 7 , R 6 -CO-O-R 7 ,
R6-0-CO-R7, R6-CO-S-R7, R6-S-CO-R7, R6-P(0)2-R7, R6-Si-R7, R6-(CH2)n-R7, R6-(CH2)n-R7, R6-A-(CH2)n-R7, R6-(CH2)n-B-R7, R 6 -O-CO-R 7 , R 6 -CO-SR 7 , R 6 -S-CO-R 7 , R 6 -P (O) 2 -R 7 , R 6 -Si-R 7 , R 6 - (CH 2 ) n -R 7 , R 6 - (CH 2 ) n -R 7 , R 6 -A- (CH 2 ) n -R 7 , R 6 - (CH 2 ) n -BR 7 ,
R6-(CH=CH-)n-R7/ R6-(A-CH=CH-)n-R7, R6-(CH = CH-B-)n-R7, R 6 - (CH = CH-) n -R 7 / R 6 - (A-CH = CH-) n -R 7 , R 6 - (CH = CH-B-) n -R 7 ,
R6-A-CH=CH-(CH2-)n-R7, R6-(-CH=CH-CH2)n-B-R7, R6-(-CH=CH-CH2-CH2)n-B-R7, R6-(C^C-)n-R7, R6-(A-OC-)n-R7, R6-(C--C-B-)n-R7, R 6 -A-CH = CH- (CH 2 -) n -R 7 , R 6 - (- CH = CH-CH 2 ) n -BR 7 , R 6 - (- CH = CH-CH 2 -CH 2 ) n -BR 7 , R 6 - (C 1 -C 4 ) n -R 7 , R 6 - (A-OC-) n -R 7 , R 6 - (C - CB-) n -R 7 ,
R6-A-C=C-(CH2-)n-R7, R6-(-OC-CH2)n-B-R7, R6-(-C=C-CH2-CH2)n-B-R7, wobei R6 - die Nuk-Komponente ist, R7 - de Polymer ist und A und B folgende strukturelle Elemente einschließen : -NH-, -O-, -S-, -SS-, -CO-NH-, -NH-CO-, - CO-O-, -O-CO-, -CO-S-, -S-CO-, -P(0)2-, -Si-, -(CH2)n-, eine photolabile Gruppe, wobei n - gleich 1 bis 5 ist Die Kopplungseinheit L ist auf einer Seite mit der Nuk-Komponente kovalent verbunden. Auf der anderen Seite können weitere Teile des Linkers, z.B. ein hydrophiles Polymer oder direkt die Kopplungseinheit T oder direkt der Marker gebunden werden. Im Folgenden, wird die Kopplung eines Polymers, als Bestandteil des Linkers exemplarisch erläutert. Die Art der Kopplung hängt von der Art des Polymers ab. In bevorzugter Form hat das Polymer an seinen Enden reaktive Gruppen, beispielsweise NH2 (Amino), OH (Hydroxy), SH (Mercapto), COOH (Carboxy), CHO (Aldehyd), Acryl- oder Maleimid, Halogen-, Alkyn-, Isothiocyanat- oder Azid-Gruppe. Solche Gruppen können in einer reaktiven Form, z.B. NHS-Ester für Carboxy-Gruppe, bereitgestellt werden. Solche Polymere sind käuflich erwerblich (z.B. Fluka, Iris-Biotech, Nanocs inc, Pierce Biotech). Einige Varianten für die Kopplung von Polymeren an die Kopplungseinheiten sind unter Beispielen angegeben. Das wasserlösliche Polymer bildet in einer bevorzugten Ausführungsform den Hauptanteil der Linker-Komponente. Es ist ein Polymer, vorzugsweise hydrophil, bestehend aus gleichen oder unterschiedlichen Monomeren. Beispiele für geeignete Polymere stellen Polyethylen-glycol (PEG), Polyamide (z.B. Polypeptide), Polysaccharide und deren Derivate, Dextran und seine Derivate, Polyphosphate, Polyacetate, Poly(alkyleneglycole), Kopolymere aus Ethylenglycol und Propylenglycol, Poly(olefinische Alkohole), Poly(Vinylpyrrolidone), Poly(Hydroxyalkylmethacrylamide), Poly(Hydroxyalkylmethacrylate), Poly(x-Hydroxy-Säuren), Poly-Acrylsäure und ihre Derivate, Poly-Acrylamide in ihre derivate, Poly(Vinylalkohol), Polylactat Säure, polyglycolic Säure, Poly(epsilon-caprolactone), Poly(beta-hydroxybutyrate), Poly(beta- hydroxyvalerate), Polydioxanone, Polyethylene terephthalate), Poly(malic Säure), Poly(tartronic Säure), Poly(ortho ester), Polyanhydride, Polycyanoacrylate, Poly(phosphoester), Polyphosphazene, Hyaluronidate, Polysulfones. R 6 -AC = C- (CH 2 -) n -R 7 , R 6 - (- OC-CH 2 ) n -BR 7 , R 6 - (- C = C-CH 2 -CH 2 ) n -BR 7 , wherein R 6 is the nuc-component, R 7 is the polymer and A and B are as follows include structural elements: -NH-, -O-, -S-, -SS-, -CO-NH-, -NH-CO-, -CO-O-, -O-CO-, -CO-S-, -S-CO-, -P (O) 2 -, -Si-, - (CH 2 ) n -, a photolabile group, where n - is 1 to 5 The coupling unit L is on one side with the nuc-component covalently linked. On the other hand, further parts of the linker, for example a hydrophilic polymer or directly the coupling unit T or directly the marker can be bound. In the following, the coupling of a polymer, as a constituent of the linker, is explained by way of example. The type of coupling depends on the type of polymer. In preferred form, the polymer has reactive groups at its terminals, for example NH 2 (amino), OH (hydroxy), SH (mercapto), COOH (carboxy), CHO (aldehyde), acrylic or maleimide, halogen, alkyne, isothiocyanate or azide group. Such groups can be provided in a reactive form, eg, NHS ester for carboxy group. Such polymers are commercially available (eg Fluka, Iris-Biotech, Nanocs inc, Pierce Biotech). Some variants for the coupling of polymers to the coupling units are given by way of examples. The water-soluble polymer in a preferred embodiment forms the majority of the linker component. It is a polymer, preferably hydrophilic, consisting of identical or different monomers. Examples of suitable polymers include polyethylene glycol (PEG), polyamides (eg polypeptides), polysaccharides and their derivatives, dextran and its derivatives, polyphosphates, polyacetates, poly (alkylene glycols), copolymers of ethylene glycol and propylene glycol, poly (olefinic alcohols), poly (Vinylpyrrolidones), poly (hydroxyalkylmethacrylamides), poly (hydroxyalkylmethacrylates), poly (x-hydroxyacids), polyacrylic acid and its derivatives, polyacrylamides in their derivatives, poly (vinyl alcohol), polylactate acid, polyglycolic acid, poly ( epsilon-caprolactone), poly (beta-hydroxybutyrate), poly (beta-hydroxyvalerate), polydioxanone, polyethylene terephthalate), poly (malic acid), poly (tartronic acid), poly (ortho ester), polyanhydride, polycyanoacrylate, poly (phosphoester ), Polyphosphazenes, hyaluronidates, polysulfones.
Dieses Polymer schließt in einer Ausführungsform verzweigte oder weiteren Ausführungsform nicht verzweigte Polymere ein. Das Polymer kann aus mehreren unterschiedlich langen Abschnitten bestehen, wobei jeder Abschnitt aus gleichen Monomeren besteht und Monomere in unterschiedlichen Abschnitten unterschiedlich sind. Einem Fachmann sollte naheliegend erscheinen, dass für einen makromolekularen Linker meistens nur eine durchschnittliche Masse bestimmt werden kann, so dass die Angaben zu den Molmassen einen Mittelwert darstellen ("Makromoleküle, Chemische Struktur und Synthesen", Band 1, 4, H. Elias, 1999, ISBN 3-527-29872-X). Aus diesem Grund kann für Nuk-Makromoleküle oft keine exakte Massenangabe gemacht werden. This polymer in one embodiment includes branched or further embodiment non-branched polymers. The polymer may consist of several sections of different lengths, each section consisting of identical monomers and monomers differing in different sections. It should be obvious to a person skilled in the art that for a Macromolecular linker usually only an average mass can be determined, so that the information on the molecular weights represent an average ("macromolecules, chemical structure and syntheses", Volume 1, 4, H. Elias, 1999, ISBN 3-527-29872-X ). For this reason, no exact mass specification can often be made for nuc macromolecules.
1.3.3.2.4 Linker-Kopplung in einem Nuk-Makromolekül 1.3.3.2.4 Linker coupling in a nuc macromolecule
Der Linker ist an einer Seite an die Nuk-Komponente und auf der anderen Seite an die Marker-Komponente gebunden. Dazu kann der Linker an seinen Enden Kopplungseinheiten haben, die diese Funktion erfüllen. Die Verbindung mit der Nuk- Komponenten wurde oben erörtert. Die Verbindung zwischen dem Linker und der Marker-Komponenten erfolgt über Kopplungseinheit T. Bevorzugt sind kurze, unverzweigte Verbindungen, bis max. 20 Atome in der Länge. Die jeweilige Struktur der Kopplungseinheit T hängt von der Kopplungsstelle an der Marker-Komponente und von dem jeweiligen Polymer des Linkers. Die Kopplungseinheit T ist mit dem Polymer kovalent verbunden. Die Art der Kopplung hängt von der Art des Polymers ab. In bevorzugter Form hat das Polymer an seinen Enden reaktive Gruppen, beispielsweise NH2 (Amino), OH (Hydroxy), SH (Mercapto), COOH (Carboxy), CHO (Aldehyd), Acryl- oder Maleimid, Halogen-, Alkyn-, Isothiocyanat- oder Azid-Gruppe. Solche Gruppen können in einer reaktiven Form, z.B. NHS-Ester für Carboxy-Gruppe, bereitgestellt werden.. Solche Polymere sind kommerziell erhältlich (z.B. Sigma-Aldrich, Iris- Biotech, Nanocs Inc., ). Einige Beispiele für die Kopplungseinheiten L sind angegeben in Cherkasov et al WO 2005044836, Cherkasov et al WO2006097320, Cherkasov et al WO 2008043426, Cherkasov et al DE 10356837, Cherkasov et al DE 102004009704. Weitere Beispiele für die chemische und affine Kopplungen s. in der Literatur: "Nucleoside triphosphates and their analogs", Morteza Vaghefi, 2005 ISBN 1-57444- 498-0; „Chemistry of protein conjugation and crosslinking" Shan S. Wong 1993, "Bioconjugation : protein coupling techniques for the biomedical sciences", M . Aslam, 1996.  The linker is bound to the nuk component on one side and to the marker component on the other side. For this purpose, the linker can have coupling units at its ends, which fulfill this function. The connection with the nuc-component has been discussed above. The link between the linker and the marker components via coupling unit T. Preferred are short, unbranched compounds, up to max. 20 atoms in length. The respective structure of the coupling unit T depends on the coupling site on the marker component and on the particular polymer of the linker. The coupling unit T is covalently bonded to the polymer. The type of coupling depends on the type of polymer. In preferred form, the polymer has reactive groups at its terminals, for example NH 2 (amino), OH (hydroxy), SH (mercapto), COOH (carboxy), CHO (aldehyde), acrylic or maleimide, halogen, alkyne, isothiocyanate or azide group. Such groups may be in a reactive form, e.g. NHS esters for carboxy group. Such polymers are commercially available (e.g., Sigma-Aldrich, Iris-Biotech, Nanocs Inc.). Some examples of the coupling units L are given in Cherkasov et al. WO 2005044836, Cherkasov et al. WO2006097320, Cherkasov et al. WO 2008043426, Cherkasov et al DE 10356837, Cherkasov et al DE 102004009704. Further examples of the chemical and affine couplings s. in the literature: "Nucleoside triphosphates and their analogs", Morteza Vaghefi, 2005 ISBN 1-57444-498-0; "Chemistry of protein conjugation and crosslinking" Shan S. Wong 1993, "Bioconjugation: protein coupling techniques for biomedical sciences", M. Aslam, 1996.
Der Linker kann auch andere funktionelle Gruppen, bzw. Abschnitte enthalten, beispielsweise eine oder mehrere unter milden Bedingungen spaltbare Gruppen s. Anmeldungen Cherkasov et al WO 2005044836, Cherkasov et al WO2006097320, Cherkasov et al WO 2008043426, Cherkasov et al DE 10356837, Cherkasov et al DE 102004009704. The linker may also contain other functional groups or segments, for example one or more cleavable groups under mild conditions. Cherkasov et al. WO 2005044836, Cherkasov et al WO2006097320, Cherkasov et al. WO 2008043426, Cherkasov et al DE 10356837, Cherkasov et al DE 102004009704.
Eine spaltbare Verbindung innerhalb des Linkers ermöglicht eine Entfernung eines Teils des Linkers und der Marker-Komponente. Nach der Spaltung verbleibt ein Linker- Rest an der Nuk-Komponente, Beispiele für spaltbare Verbindungen sind im Abschnitt 1.3.3.1.4 angegeben. A cleavable linkage within the linker allows removal of a portion of the linker and the label moiety. After cleavage, a linker remains Remainder of the nuk component, examples of fissile compounds are given in section 1.3.3.1.4.
1.3.3.3 Marker-Komponente 1.3.3.3 Marker component
Beispiele für Signal-gebende Marker-Komponente und die Zusammensetzung der Marker— Komponente von Nuk-Makromolekülen sind in Anmeldungen Cherkasov et al WO 2005044836, Cherkasov et al WO2006097320, Cherkasov et al WO 2008043426 angegeben, Oligonukleotid-Anteil des Nukleotid-Konjugates Examples of signal-generating marker component and the composition of the marker component of nuc-macromolecules are given in applications Cherkasov et al. WO 2005044836, Cherkasov et al., WO2006097320, Cherkasov et al., WO 2008043426, oligonucleotide portion of the nucleotide conjugate
In einer Ausführungsform schließt eine Marker-Komponente mindestens ein Oligonukleotid ein (Fig. 1). Dieses Oligonukleotid kann DNA, PTO, RNA, PNA, LNA oder auch weitere, zur Basenpaarung fährige Modifikationen der Nukleinsäureketten einschließen. In one embodiment, a marker component includes at least one oligonucleotide (Figure 1). This oligonucleotide may include DNA, PTO, RNA, PNA, LNA, or other base pairing modifications of the nucleic acid chains.
In einer Ausführungsform ist das Oligonukleotid teilweise oder vollständig doppesträngig. Dies kann beispielsweise über selbstkomplementäre Abschnitte innerhalb des Oligonukleotids erreicht werden oder durch Hybridisierung eines weiteren vorwiegend oder vollständig komplementären Oligonukleotids. In one embodiment, the oligonucleotide is partially or completely double-stranded. This can be achieved, for example, via self-complementary sections within the oligonucleotide or by hybridization of another predominantly or completely complementary oligonucleotide.
Solche doppelsträngige Oligonukleotid-Strukturen können eine Polymerase daran hindern, zwei und mehr Nukleotid-Konjugate an benachbarten Positionen hintereinader einzubauen. Es kommt zu einem Stopp in der Synthese durch die sterische Wirkung des Oligonukleotids. Viele Beispiele eines Synthese-Stopps durch Haarnadel-Strukturen der Matrizen bei einer Replikation sind einem Fachmann bekannt. Ein überraschendes Ergebnis dieser Erfindung liegt unter anderem darin, dass solche Haarnadelstrukuren oder auch vollständig doppelsträngige Oligonukleotide innerhalb eines Nukleotid-Konjugats ebenfalls zu einem Stopp führen können. Such double-stranded oligonucleotide structures can prevent a polymerase from incorporating two or more nucleotide conjugates at adjacent positions one behind the other. There is a stop in the synthesis by the steric effect of the oligonucleotide. Many examples of synthetic stop by hairpin structures of the templates in replication are known to one skilled in the art. One surprising result of this invention is, inter alia, that such hairpin structures or also completely double-stranded oligonucleotides within a nucleotide conjugate can likewise lead to a stop.
Nach Spaltung des Linkers eines eingebauten Nukleotid-Konjugats kann ein solches sterisches Hindernis entfernt werden, so dass Polymerase die Synthese fortsetzen kann. In einer Ausführungsform der Erfindung schließt das Oligonukleotid mindestens einen einzelsträngigen Sequenzabschnitt ein, der komplementär an einzelsträngige Nukleinsäureketten binden kann. Diese Bindung erfolgt vorzugsweise über Hybridisierung an eine zu markierende Nukleinsäurekette. Die Länge des Abschnittes des Oligonukleotids muss an die jeweiligen Assay-Bedingungen angepasst werden. Diese Länge schließt folgende Bereiche ein (gemessen in Nukleobasen) : 2 bis 4, 4 bis 6, 6 bis 8, 8 bis 10, 10 bis 15, 15 bis 20, 20 bis 50, 50 bis 100. After cleavage of the linker of a built-in nucleotide conjugate, such a steric barrier can be removed so that polymerase can continue the synthesis. In one embodiment of the invention, the oligonucleotide includes at least one single-stranded sequence portion capable of complementary binding to single-stranded nucleic acid chains. This binding is preferably carried out by hybridization to a nucleic acid chain to be labeled. The length of the section of the oligonucleotide must be adapted to the particular assay conditions. This length includes the following ranges (measured in nucleobases): 2 to 4, 4 to 6, 6 to 8, 8 to 10, 10 to 15, 15 to 20, 20 to 50, 50 to 100.
In einer weiteren Ausführungsform schließt ein Oligonukleotid mehr als einen solchen Sequenzabschnitt ein.  In another embodiment, an oligonucleotide includes more than one such sequence portion.
Die Zusammensetzung der Nukleobasen dieses Abschnitts ist vorzugsweise dermassen gewählt, dass die Differenzierungsfähigkeit eines solchen Sequenzabschnitts des Oligonukleotids unter Reaktionsbedingungen absichtlich gering gehalten wird. Dies kann beispielsweise durch kurze Strecken von 4 bis zu 8 DNA Nukleotid- Monomeren und Raumtemperatur-Bedingungen erreicht werden. Fachmann kennt ähnliche Beispiele einer geringen Differenzierung, z.B. mit Hexamer-Primern.  The composition of the nucleobases of this section is preferably chosen such that the differentiation ability of such a sequence section of the oligonucleotide is intentionally kept low under reaction conditions. This can be achieved, for example, by short stretches of 4 to 8 DNA nucleotide monomers and room temperature conditions. One skilled in the art knows similar examples of low differentiation, e.g. with hexamer primers.
In einer anderen Ausführungsform schließt das Oligonukleotid eine oder mehrere Strecken von Homopolymeren ein (z.B. 5 bis 50 Adenosin-Nukleobasen oder 5 bis 50 Cytosin-Nukleobasen oder 5 Guanosin-Nukleobasen oder 5 bis 50 Thymidin- Nukleobasen). Solche Homopolymer-Strecken können mit anderen Homopolymer- enthaltenden Sequenzbereichen relativ unspezifisch eine Basenpaarung eingehen. In einer weiteren Ausführungsform schließt das Oligonukleotid eine oder mehrere kurze repetitive Sequenzabschnitte ein, z.B. 2 bis 100 Abschnitte mit einer sich wiederholenden Sequenz, z.B. AATCC. Auch solche Reapeats können an entsprechend komplementäre Abschnitte der Nukleinsäuren realtiv unspezifisch binden, da ihre eindeutige Positionierung In another embodiment, the oligonucleotide includes one or more lengths of homopolymer (e.g., 5 to 50 adenosine nucleobases or 5 to 50 cytosine nucleobases, or 5 guanosine nucleobases or 5 to 50 thymidine nucleobases). Such homopolymer segments may undergo base pairing relatively non-specifically with other homopolymer-containing sequence regions. In a further embodiment, the oligonucleotide includes one or more short repetitive sequence segments, e.g. 2 to 100 sections with a repeating sequence, e.g. AATCC. Also, such Reapeats can non-specifically bind to corresponding complementary sections of the nucleic acids, since their unique positioning
Je nach Natur des Oligonukleotid-Anteils (also z,B, DNA, PTO, RNA, PNA oder LNA) kann die Spezifität der Bindung an die jeweilige Nukleinsäurekette variieren. Einem Fachmann ist beispielsweise bekannt, dass PNA-basierte Oligonukleotide eine stärkere Affinität zu komplementären Bereichen aufweisen, als die DNA-basierte Oligonukleotide der gleichen Zusammensetzung und Länge. Die Kopplung des Oligonukleotide im Nuk-Makromolekül erfolgt in einer Ausführungsform an einem der beiden Enden des Oligonukleotids (Fig 11), z.B. am 5 ' -Ende oder am 3 ' -Ende. Beispiele für Kopplung eines Oligonukleotides an einem seiner Enden sind einem Fachmann bekannt. In einer anderen Ausführungsform der Erfindung erfolgt die Kopplung von anderen Bestandteilen des Nuk-Makromoleküls (z.B. Nuk-Komponente) im inneren Bereich des Oligonukleotids. Depending on the nature of the oligonucleotide portion (ie z, B, DNA, PTO, RNA, PNA or LNA), the specificity of binding to the particular nucleic acid chain may vary. For example, one skilled in the art will appreciate that PNA-based oligonucleotides have a greater affinity for complementary regions than the DNA-based oligonucleotides of the same composition and length. The coupling of the oligonucleotides in the nuc-macromolecule takes place in one embodiment at one of the two ends of the oligonucleotide (FIG. 11), for example at the 5 ' end or at the 3 ' end. Examples of coupling of an oligonucleotide at one of its ends are known to a person skilled in the art. In another embodiment of the invention, the coupling of other components of the nuc-macromolecule (eg nuc-component) takes place in the inner region of the oligonucleotide.
Beispielweise kann der jeweilige Linker zwischen einer Nuk-Komponente und einem Oligonukleotid an einer der Basen des Oligonukleotids oder an einem Monomer des Rückgrandes (z.B. am Zucker oder Phosphat bei einem DNA-Rückgrad oder an einer Aminosäure bei einem PNA-Rückgrad, oder am Schwefel-Atom eines PTO-Rückgrades) gekoppelt werden. Einem Fachmann sind verschiedene Möglichkeit der Kopplung von Substanzen an ein Oligonukleotid an verschiedenen Positionen bekannt. For example, the respective linker between a nuc-component and an oligonucleotide on one of the bases of the oligonucleotide or on a monomer of the Rückgrandes (eg on the sugar or phosphate at a DNA backbone or at an amino acid at a PNA backbone, or at the sulfur atom of a PTO backbone) are coupled. A person skilled in the art knows various possibilities of coupling substances to an oligonucleotide at different positions.
Der Abschnitt des Oligonnukleotids, der unspezifisch an Nukleinsäureketten binden kann, kann am 5 ' -Ende oder am 3 ' -Ende von weiteren Sequenzabschnitten flankiert sein. Diese flankierenden Bereiche können aus gleichen Monomenren bestehen (z.B. DNA, PTO, PNA, LNA, RNA) oder sich in der Zusammensetzung von dem bindenden Abschnitt unterscheiden. Diese flankierenden Sequenzabshcnitte können in der Länge von 1 bis 5, 5 bis 10, 10 bis 15, 15 bsi 20, 20 bis 30, 30 bis 100 oder länger als 100 Nukleobasen betragen. Sie können als Abstandhalter dienen oder beispielsweise Funktionen der Marker-Komponente ausführen siehe Cherkasov et al WO 2005044836, Cherkasov et al WO2006097320, Cherkasov et al WO 2008043426. The portion of the oligonucleotide which can bind nonspecifically to nucleic acid chains may be flanked at the 5 'end or at the 3 ' end by further sequence segments. These flanking regions may consist of the same monomials (eg DNA, PTO, PNA, LNA, RNA) or differ in composition from the binding portion. These flanking sequence subtypes may be in the length of 1 to 5, 5 to 10, 10 to 15, 15 to 20, 20 to 30, 30 to 100 or more than 100 nucleobases. They can serve as spacers or, for example, perform functions of the marker component, see Cherkasov et al. WO 2005044836, Cherkasov et al. WO2006097320, Cherkasov et al., WO 2008043426.
Ein Linker, der eine Nuk-Komponente mit dem Oligonukleotid verbindet, kann beispielsweise an einen solchen flankierenden Bereich gekoppelt sein. For example, a linker connecting a nuc-component to the oligonucleotide may be coupled to such a flanking region.
Das Oligonukleotid kann teilweise selbst-komplementäre Abschnitte einschließen, z.B. als Haarnadelstrukturen (engl. Hairpins) oder Schleifen (Engl. Loops) (Fig.8). In einer bevorzugten Ausführungsform der Erfindung ist das Oligonukleotid an der Bildung einer Struktur vom Typ des so genannten „Molecular Beacon" beteilgt (zu Eigenschaften von Molecular Beacons: Bonnet et al. PNAS 1999, v96. 6171-). Die selbstkomplementären Bereiche eines solchen Molecular-Beacons sind in der Regel zwischen 4 bis 6, 6 bis 8, 8 bis 10, 10 bis 15, 15 bis 30 Nukleotiden lang. Es können mehrere selbstkomplementäre Abschnitte innerhalb eines Oligonukleotids vorkommen, z.B. 1 bis 10. Die Sequenz-Zusammensetzung dieser selbstkomplementären Abschnitte ist beispielsweise unterschiedlich. Einem Fachmann sind Oligonukleotid-Modifikationen bekannt, welche die Bindung an die Nnukleinsäureketten beeinflüssen können. Zu solchen Modifikationen gehören z.B. „Minor-Groove-Binder". The oligonucleotide may include, in part, self-complementary portions, e.g. as hairpin structures (English hairpins) or loops (Fig. 8). In a preferred embodiment of the invention, the oligonucleotide is involved in the formation of a so-called "molecular beacon" type structure (for properties of molecular beacons: Bonnet et al., PNAS 1999, v96, 6171-.) The self-complementary regions of such a molecule Beacons are typically between 4 to 6, 6 to 8, 8 to 10, 10 to 15, 15 to 30 nucleotides long, and there may be multiple self-complementary regions within an oligonucleotide, eg, 1 to 10. The sequence composition of these self-complementary Sections are different, for example, and one skilled in the art will recognize oligonucleotide modifications that may affect binding to the nucleic acid chains, such as minor groove binders.
In einer Ausführungsform ist das 3 ' -OH-Ende des Oligonukleotids (oder des flankierenden Oligonukleotids) durch eine chemische Gruppe geblockt. Einem Fachmann sind viele Beispiele von Modifikationen von 3 ' -OH-Gruppe bei Oligonukleotiden bekannt. Sie schließen beispielsweise folgende Substanzen ein : eine 2 ' .3 ' -Dideoxy-Ribose, eine Phosphat-Gruppe, einen Biotin-Rest, einen Amino-Linker, einen Fluoreszenzfarbstoff, eine Peptid -Kette, einen Quencher. Anstelle von 3 ' -OH Gruppe können verschiedene Modifikationen in ein Oligonukleotid inkorporiert sein, z.B. eine Amino-Gruppe, eine Halogen-Atom, eine Azid-Gruppe usw. In dieser Ausführungsform kann ein solches Oligonukleotid nicht weiter durch eine Polymerase extendiert werden, es hat also keine Primer-Funktion. In one embodiment, the 3 ' OH end of the oligonucleotide (or flanking oligonucleotide) is blocked by a chemical group. An expert many examples of modifications of the 3 'OH group with oligonucleotides are well known. They include, for example, the following substances: a 2 ', 3 ' -didoxy-ribose, a phosphate group, a biotin residue, an amino linker, a fluorescent dye, a peptide chain, a quencher. In place of 3 '-OH group, various modifications may be incorporated into an oligonucleotide, such as an amino group, a halogen atom, an azide group, etc. In this embodiment, such an oligonucleotide can not be further extendiert by a polymerase, it has So no primer function.
In einer anderen Ausführungsform ist das 3 ' -OH-Ende des Oligonukleotids nicht blockiert und kann von einer Polymerase verlängert werden. Vorzugsweise schließen ein Oligonukleotid von Nuk-Makromolekülen Nukleinsäureketten mit einer Gesamt-Länge in folgenden Bereichen ein : von 3 bis 6, 6 bis 9, 9 bis 12, 12 bis 14, 14 bis 16, 16 bis 18, 18 bis 20, 20 bis 25, 25 bis 30, 30 bis 40, 40 bis 50, 50 bis 60, 60 bis 70, 70 bis 100, 100 bis 200 Nukleobasen. In einer bevorzugten Ausführungsform der Anmeldung werden Sequenzen der Oligonukleotide dermassen ausgewählt, dass sie nicht in der Lage sind, unter verwendeten Reaktionsbedinungen an andere Arten von Nuk-Makromolekülen zu binden. Jede Art von Nuk-Makromolekülen hat somit eine eigene, nicht zu anderen Oligonukleotiden komplementäre Oligonukleotid-Sequenz. In another embodiment, the 3 ' OH end of the oligonucleotide is not blocked and may be extended by a polymerase. Preferably, an oligonucleotide of nuc-macromolecules include nucleic acid chains having a total length in the following ranges: from 3 to 6, 6 to 9, 9 to 12, 12 to 14, 14 to 16, 16 to 18, 18 to 20, 20 to 25, 25-30, 30-40, 40-50, 50-60, 60-70, 70-100, 100-200 nucleobases. In a preferred embodiment of the application, sequences of the oligonucleotides are selected such that they are unable to bind to other types of nuc-macromolecules under used reaction conditions. Each type of nuc-macromolecule thus has its own, not to other oligonucleotides complementary oligonucleotide sequence.
Das Oligonukleotid kann zusätzliche Modifikationen tragen, wie beispielsweise signalgebende oder signalvermittelnde Moleküle, z. B. Farbstoffe, Fluoresenzfarbstoffe oder Biotin, oder makromolekulare Substanzen, wie Enzyme oder Nanokristalle. Bezüglich der chemischen Synthese von Oligonukleotiden und deren Modifikation kann ein Fachmann an folgende Quellen verwiesen werden : The oligonucleotide may carry additional modifications, such as signaling or signaling molecules, e.g. As dyes, fluorescent dyes or biotin, or macromolecular substances such as enzymes or nanocrystals. With regard to the chemical synthesis of oligonucleotides and their modification, one skilled in the art can be referred to the following sources:
Singh et al Chem Soc Rev, 2010, v.39, 2054-, "Oligonucleotide synthesis, methods and applications" Piet Herdewijn, 2004, ISBN 1-58829-233-9, "Protocols for oligonucleotide conjugates, synthesis and analytical techniques" Sudhir Agrawal, 1993, ISBN 0-89603-252-3, "Protocols for oligonucleotide conjugates, synthesis and properties" Sudhir Agrawal, 1993, ISBN 0-89603-247-7, "The aptamer handbook" Sven Klussmann, 2006, ISBN 10: 3-527-31059-2, "Pharmaceutical aspects of oligonucleotides" Patrick Couvreur, 2000, ISBN 0-748-40841-X,  Singh et al. Chem. Soc. Rev., 2010, v. 39, 2054, "Oligonucleotide synthesis, methods and applications" Piet Herdewijn, 2004, ISBN 1-58829-233-9, "Protocols to oligonucleotide conjugates, synthesis and analytical techniques" Sudhir Agrawal, 1993, ISBN 0-89603-252-3, "Protocols for oligonucleotide conjugates, synthesis and properties" Sudhir Agrawal, 1993, ISBN 0-89603-247-7, "The aptamer handbook" Sven Klussmann, 2006, ISBN 10: 3-527-31059-2, "Pharmaceutical Aspects of Oligonucleotides" Patrick Couvreur, 2000, ISBN 0-748-40841-X,
"Triple Helix forming Oligonucleotides"Claude Malvy, 1999, ISBN 0-7923-8418-0, "Artificial DNA, methods and applications" Yury E. Khudyakov, ISBN 0-8493-1426-7 Komplementäre Sonden (z.B. Oligonukleotide) zu Oligonukleotidsequenz des Nuk-Makromoleküls (Fig.9). "Triple helix forming oligonucleotides" Claude Malvy, 1999, ISBN 0-7923-8418-0, "Artificial DNA, methods and applications" Yury E. Khudyakov, ISBN 0-8493-1426-7 Complementary probes (eg oligonucleotides) to oligonucleotide sequence of the nuc macromolecule (FIG. 9).
In einer Ausführungsform der Erfindung schließen Nukleotid-Konjugate weitere Nukleinsäurekette ein, die zum Oligonukleotidanteil sequenzspezifische komplementäre Abschnitte aufweisen . (Fig . 8- 10). Solche Nukleinsäureketten können als komplementäre Oligonukleotide bezeichnet werden . In one embodiment of the invention, nucleotide conjugates include another nucleic acid chain which has sequence-specific complementary portions to the oligonucleotide portion. (Figures 8-10). Such nucleic acid chains may be referred to as complementary oligonucleotides.
Struktur von komplementäre Oligonukleotiden Structure of complementary oligonucleotides
In einer Ausführungsform besteht das komplementäre Oligonukleotid aus Nukleobasen . Die Nukleobasen wie Adenin, Cytosin, Guanin, Thymin, Uracil (abgekürzt als A, C, G, T, U) oder deren Analoga gekoppelt an einen Zucker-Phosphatrückgrad in Form von DNA oder RNA oder deren Analoga, z. B. PTO, PNA, LNA, können sequenzspezifisch an die Nukleinsäurestränge binden. In one embodiment, the complementary oligonucleotide consists of nucleobases. The nucleobases such as adenine, cytosine, guanine, thymine, uracil (abbreviated as A, C, G, T, U) or their analogues coupled to a sugar-phosphate backbone in the form of DNA or RNA or their analogs, e.g. As PTO, PNA, LNA, can bind sequence-specific to the nucleic acid strands.
Falls mehrere komplementäre Oligonukleotide innerhalb einer Art von Nuk- Makromolekülen vorkommen, können einzelne Sequenzabschnitte unterschiedliche Arten von Bausteinen vorweisen, z. B. ein Antagonisten-Oligonukleotid besteht aus DNA, ein anderes aus PNA, usw. If several complementary oligonucleotides occur within a type of nuc-macromolecules, individual sequence sections may have different types of building blocks, e.g. As an antagonist oligonucleotide consists of DNA, another from PNA, etc.
Zur Vereinfachung der Darstellung werden komplementäre Oligonukleotide in Form der DNA in Details besprochen. Andere Arten der Nukleinsäureketten können entsprechend den einem Fachmann bekannten Regeln nach dem Muster der DNA- Oligonukleotide konstruiert und eingesetzt werden. To simplify the presentation, complementary oligonucleotides in the form of DNA are discussed in detail. Other types of nucleic acid chains can be constructed and used according to the rules known to those skilled in the art, following the pattern of DNA oligonucleotides.
Die Länge des komplementären Oligonukleotids schließt vorzugsweise folgende Bereiche ein : 15 und 25, 25 bis 50, 50 bis 100, länger als 100 Basenpaaren. The length of the complementary oligonucleotide preferably includes the following ranges: 15 and 25, 25 to 50, 50 to 100, more than 100 base pairs.
Das komplementäre Oligonukleotid kann am 5 ' -Ende oder am 3 ' -Ende von weiteren Sequenzabschnitten flankiert sein, die nicht an das Oligonukleotid des Nukleotid- Konjugates binden. Diese flankierenden Sequenzabshcnitte können in der Länge von 1 bis 5, 5 bis 10, 10 bis 15, 15 bsi 20, 20 bis 30 oder länger als 30 Nukleobasen betragen. Sie können als Abstandhalter oder Maerker dienen . Einem Fachmann sind weitere Oligonukleotid-Modifikationen bekannt, welche die Bindung komplementärer Nukleinsäureketten unetreinander beeinflüssen können. Zu solchen Modifikationen gehören z. B.„Minor-Groove-Binder". In einer Ausführungsform ist das 3 ' -OH-Ende des komplementären Oligonukleotids (oder des flankierenden Oligonukleotids) durch eine chemische Gruppe geblockt. Einem Fachmann sind viele Beispiele von Modifikationen von 3 ' -OH-Gruppe bei Oligonukleotiden bekannt. Sie schließen beispielsweise folgende Substanzen ein : eine 2 ' .3 ' -Dideoxy- ibose, eine Phosphat-Gruppe, einen Biotin-Rest, einen Amino-Linker, einen Fluoreszenzfarbstoff, eine Peptid-Kette, einen Quencher. Anstelle von 3 ' -OH Gruppe können verschiedene Modifikationen in ein Oligonukleotid inkorporiert sein, z.B. eine Amino-Gruppe, eine Halogen-Atom, eine Azid-Gruppe usw. In dieser Ausführungsform kann ein solches Oligonukleotid nicht weiter durch eine Polymerase extendiert werden, es hat also keine Primer-Funktion. The complementary oligonucleotide may be flanked at the 5 ' end or at the 3 ' end by further sequence segments which do not bind to the oligonucleotide of the nucleotide conjugate. These flanking sequence subtypes may be in the length of 1 to 5, 5 to 10, 10 to 15, 15 to 20, 20 to 30, or more than 30 nucleobases in length. They can serve as spacers or Maerker. A person skilled in the art is familiar with further oligonucleotide modifications which can influence the binding of complementary nucleic acid chains one after the other. Such modifications include, for. B. "Minor Groove Binder". In one embodiment, the 3 ' OH end of the complementary oligonucleotide (or flanking oligonucleotide) is blocked by a chemical group. An expert many examples of modifications of the 3 'OH group with oligonucleotides are well known. For example, include the following substances: a 2 '.3' -Dideoxy- ibose, a phosphate group, a biotin residue, an amino linker, a fluorescent dye, a peptide chain, a quencher. In place of 3 '-OH group, various modifications may be incorporated into an oligonucleotide, such as an amino group, a halogen atom, an azide group, etc. In this embodiment, such an oligonucleotide can not be further extendiert by a polymerase, it has So no primer function.
Die komplementären Oligonukleotide können teilweise selbst-komplementäre Abschnitte einschließen, z.B. als Haarnadelstrukturen (engl. Hairpins) oder Schleifen (Engl. Loops). In einer Ausführungsform der Erfindung ist das Antagonisten- Oligonukleotid an der Bildung einer Struktur vom Typ des so genannten „Molecular Beacon" beteilgt (zu Eigenschaften von Molecular Beacons: Bonnet et al. PNAS 1999, v96. 6171-). The complementary oligonucleotides may include, in part, self-complementary portions, e.g. as hairpin structures (English hairpins) or loops. In one embodiment of the invention, the antagonist oligonucleotide is involved in the formation of a so-called "molecular beacon" type structure (for properties of molecular beacons: Bonnet et al., PNAS 1999, v96, 6171-).
In einer Ausführungsform erfolgt die Bindung von komplementären Oligonukleotiden an Nukleotid-Konjugate vor einer Einbaureaktion. In einer weiteren Ausführungsform erfolgt die Bindung von komplementären Oligonukleotiden an Nukleotid-Konjugate erst nach einer Einbaureaktion. In one embodiment, the binding of complementary oligonucleotides to nucleotide conjugates occurs prior to an incorporation reaction. In a further embodiment, the binding of complementary oligonucleotides to nucleotide conjugates takes place only after an incorporation reaction.
1.3.3.3.3 Signal-Domäne (Funktionen und Zusammensetzung) Funktion einer Signal-Domäne 1.3.3.3.3 Signal domain (functions and composition) Function of a signal domain
Die Signal-Domäne kann in einer Ausführungsform eine signalgebende Funktion haben. In einer anderen Ausführungsform hat sie eine signalvermittelnde Funktion. In einer weiteren Ausführungsform hat sie eine katalytische Funktion. In einer weiteren Ausführungsform hat die Signal-Domäne mehr als nur eine Funktion, sondern z.B. vereinigt sowohl signalgebende als auch eine signalvermitteldne Funktion. Weitere Kombinationen sind nahe liegend.  The signal domain may have a signaling function in one embodiment. In another embodiment, it has a signal-switching function. In another embodiment, it has a catalytic function. In a further embodiment, the signal domain has more than one function, but e.g. combines both signaling and a signal-switched function. Other combinations are obvious.
Bei der signalgebenden Funktion enthält die Signal-Domäne Bestandteile, die bereits während der chemischen Synthese an Nuk-Makromoleküle gebunden werden, s. Beispiele in Anmeldungen Cherkasov et al WO 2005044836, Cherkasov et al WO2006097320, Cherkasov et al WO 2008043426, Cherkasov et al DE 10356837, Cherkasov et al DE 102004009704. In einer Ausführungsform hat das Oligonukleotid des Nukleotid-Konjugates eine Signal-Funktion: es kann beispielsweise einen oder mehrere Fluorescenzfarbstoffe einschließen. In the signaling function, the signal domain contains components which are already bound to nuc macromolecules during the chemical synthesis, s. Examples in applications Cherkasov et al. WO 2005044836, Cherkasov et al WO2006097320, Cherkasov et al. WO 2008043426, Cherkasov et al DE 10356837, Cherkasov et al DE 102004009704. In one embodiment, the oligonucleotide of the nucleotide conjugate has a signaling function: it may include, for example, one or more fluorescent dyes.
In einer weitren Ausführungsform hat das Oligonukleotid des Nukleotid-Konjugates eine signalvermittelnde Funktion : es schließt beispielsweise mindestens einen Biotin- Rest ein oder hat einen Sequenzabschnitt, an den noch weitere markierte Oligonukleotide binden können. 1.3.3.3.4 Die Kern-Komponente des Markers In a further embodiment, the oligonucleotide of the nucleotide conjugate has a signal-transmitting function: it includes, for example, at least one biotin residue or has a sequence segment to which even more labeled oligonucleotides can bind. 1.3.3.3.4 The core component of the marker
Die Kernkomponente hat die Funktion, mehrere strukturelle Elemente der Nuk- Makromoleküle zu binden. Beispielsweise bindet die Kern-Komponente mehrere Marker-Einheiten zusammen oder einzelne Domänen können mittels Kern- Komponente verbunden sein. In einer weiteren Ausführungsform können Linker- Komponenten an die Kern-Komponente gebunden werden. Der Begriff der Kern- Komponente ist funktionell und dient zur Erläuterung von möglichen Strukturen von Nuk-Makromolekülen. Unterschiedliche chemische Strukturen, die Linker und Marker- Einheiten zusammenhalten, können als Kern-Komponente bezeichnet werden.  The core component has the function of binding several structural elements of the nuc macromolecules. For example, the core component binds together multiple marker units or individual domains may be linked by means of the core component. In another embodiment, linker components can be attached to the core component. The term core component is functional and is used to illustrate possible structures of nuc macromolecules. Different chemical structures that hold linker and marker units together can be called the core component.
Im Folgenden sind Beispiele für Bestandteile der Kernkomponente angegeben. The following are examples of components of the core component.
Beispiele für Kernkomponente sind in Anmeldungen Cherkasov et al WO 2005044836, Cherkasov et al WO2006097320, Cherkasov et al WO 2008043426 angegeben, Examples of core component are given in applications Cherkasov et al. WO 2005044836, Cherkasov et al., WO2006097320, Cherkasov et al., WO 2008043426,
1.3.3.3.6 Kopplung zwischen Linker und Marker 1.3.3.3.6 Coupling between linker and marker
Die Verbindung zwischen der Linker-Komponente und dem Marker hängt von der jeweiligen Struktur der Marker-Einheiten bzw. der Struktur der Kern-Komponente ab. In einer Ausführungsform ist die Linker-Komponente direkt an die signalgebende oder signalvermittelnde Marker-Einheit gebunden. Dabei kann der Marker aus nur einer oder mehreren Marker-Einheiten bestehen. The connection between the linker component and the marker depends on the particular structure of the marker units or the structure of the core component. In one embodiment, the linker moiety is bound directly to the signaling or signal-mediating marker moiety. The marker may consist of only one or more marker units.
In einer weiteren Ausführungsform sind ein oder mehrere Linker-Komponenten an die Kern- Komponente des Markers gebunden. In another embodiment, one or more linker components are attached to the core component of the label.
Die Bindung zwischen der Linker-Komponente und dem Marker kann sowohl kovalent als auch affine erfolgen. Viele Beispiele sind dem Fachmann bekannt, s. z.B. "Bioconjugation : protein coupling techniques for the biomedical sciences", M. Aslam, 1996, ISBN 0-333-58375-2.„Chemistry of protein conjugation and crosslinking" Shan S. Wong 1993 CRC Press Inc.).  Binding between the linker moiety and the label can be both covalent and affine. Many examples are known in the art, s. e.g. "Bioconjugation: protein coupling techniques for the biomedical sciences", M. Aslam, 1996, ISBN 0-333-58375-2. "Chemistry of protein conjugation and crosslinking" Shan S. Wong 1993 CRC Press Inc.).
Kovalente Kopplung: Die Verbindung zwischen der Linker-Komponente und dem Marker kann in einer Ausführungsform widerstandsfähig sein, z.B. bei Temperaturen bis zu 130°C, für pH-Bereiche zwischen 1 und 14, und/oder resistent gegen hydrolytische Enzyme (z.B. Proteasen, Esterasen)sein . In einer anderen Ausführungsform der Erfindung ist die Verbindung zwischen der Nuk-Komponente und dem Linker unter milden Bedingungen spaltbar. Covalent coupling: The connection between the linker component and the Marker may be resistant in one embodiment, eg, at temperatures up to 130 ° C, for pH ranges between 1 and 14, and / or resistant to hydrolytic enzymes (eg, proteases, esterases). In another embodiment of the invention, the connection between the nuc-component and the linker is cleavable under mild conditions.
Die für die Markierung von Nukeotiden erfindugnsgemäß eingesetzten Makromolekulare Verbidungen schließen in einigen Ausführungsformen wasserlösliche Polymere ein (s.o.). Die Linker der Nukmakromoleküle schließen ebenfalls wasserlösliche Polymere ein (s.o. ). Es ist für den Fachmann erkennbar, dass die Zuordung einzelner Polymere zum Linker oder zum Marker einen beschreibenden Charakter hat. The macromolecular compounds used in accordance with the invention to label nucleotides include, in some embodiments, water-soluble polymers (supra). The linkers of nucmacromolecules also include water-soluble polymers (see above). It will be apparent to those skilled in the art that the assignment of individual polymers to the linker or to the label has a descriptive character.
1.3.3.3.7 Das Verhältnis der Nuk- Komponenten in einem Nuk-Makromolekül Ein Nuk-Makromolekül kann durchschnittlich 1 bis 2, 2 bis 5, 5 bis 10, 10 bis 30, 30 bis 100 Nuk-Komponenten einschließen. 1.3.3.3.7 The Ratio of Nuc Components in a Nuc Macromolecule A nuc macromolecule may include on average 1 to 2, 2 to 5, 5 to 10, 10 to 30, 30 to 100 nuc moieties.
In einer Ausführungsform haben alle Nuk-Makromoleküle eine gleiche Anzahl an Nuk- Komponenten pro ein Nuk-Makromolekül. Beispielsweise können pro ein Strepavidin- Molekül maximal 4 Biotin-Moleküle gebunden werden, bei sättigender Konzentration von Nuk-Linker- Komponenten, eine einheitliche Population an Nuk-Makromolekülen entsteht. In one embodiment, all nuc-macromolecules have an equal number of nuc-components per one nuc-macromolecule. For example, a maximum of 4 biotin molecules can be bound per one strepavidin molecule, with a saturating concentration of nuc-linker components resulting in a uniform population of nuc macromolecules.
In einer anderen Ausführungsform haben die Nuk-Makromoleküle einer Population eine definierte durchschnittliche Anzahl von Nuk- Komponenten pro Nuk- Makromolekül, in der Population selbst findet allerdings eine Verteilung der tatsächlichen Besetzung der Nuk-Makromoleküle mit Nuk- Komponenten statt. Die Verteilungsangaben von Nuk- Komponenten pro Nuk-Makromolekül stellen in diesem Fall einen Mittelwert dar. In another embodiment, the nuc macromolecules of a population have a defined average number of nuc-components per nuc-macromolecule, but in the population itself there is a distribution of the actual population of nuc-macromolecules with nuc-components. The distribution data of nuc-components per nuc-macromolecule in this case represent an average value.
1.3.3.3.8 Das Verhältnis von Marker-Einheiten in einem Nuk-Makromolekül1.3.3.3.8 The ratio of marker units in a nuc macromolecule
Die Zahl der Marker-Einheiten in einem Nuk-Makromolekül schließt folgende Bereiche ein : 1 und 2, 2 und 5, 5 und 20, 20 und 50, 50 und 100, 100 und 500, 500 und 1000. 1000 und 10000, 10000 und 100000, mehr als 100000. The number of marker units in a nuc macromolecule includes the following ranges: 1 and 2, 2 and 5, 5 and 20, 20 and 50, 50 and 100, 100 and 500, 500 and 1000. 1000 and 10,000, 10,000 and 100,000, more than 100,000.
In einer Ausführungsform der Erfindung haben Nuk-Makromoleküle eine feste Anzahl von signalgebenden Einheiten pro Marker. In one embodiment of the invention, nuc macromolecules have a fixed number of signaling units per marker.
In einer anderen Ausführungsform kann die Verteilung von Marker-Einheiten in einer Nuk-Makromolekül-Population schwanken und muß nicht notwendigerweise einen konstanten Wert für jedes einzelne Nuk-Makromolekül darstellen. In another embodiment, the distribution of label moieties in a nuc-macromolecule population may vary and does not necessarily have to represent constant value for each individual nuc macromolecule.
Weitere Beispiele sind in Anmeldungen Cherkasov et al WO2011050938, Cherkasov et al WO2005044836, Cherkasov et al WO2006097320, Cherkasov et al WO2008043426, angegeben.  Further examples are given in applications Cherkasov et al. WO2011050938, Cherkasov et al. WO2005044836, Cherkasov et al. WO2006097320, Cherkasov et al., WO2008043426.
1.3.6 Polymerasen 1.3.6 Polymerases
In einer Ausführungsform können die Nuk-Makromoleküle als Substrate für Enzyme eingesetzt werden. Polymerasen stellen in Anwendungen oft eingesetzte Enzyme, die Nukleotide als Substrate verwerden. Sie werden im weiteren beispielhaft und stellvertretend für andere Nukleotid-umsetzende Enzyme betrachtet. Eine der zentralen Fähigkeit der Polymerasen besteht in kovalenten Kopplung von Nukleotid-Monomeren zu einem Polymer. Dabei kann die Synthese sowohl matrizen-abhängig (wie z.B. DNA-oder RNA-Synthese mit DNA- oder RNA-abhängigen Polymerasen) als auch matrizen- unabhängig, z.B. durch Terminale Transferasen ("J Sambrook "Molecular Cloning" 3. Ed. CSHL Press 2001). In one embodiment, the nuc macromolecules can be used as substrates for enzymes. Polymerases are often used in applications enzymes that use nucleotides as substrates. They are further exemplified and representative of other nucleotide-converting enzymes. One of the central capabilities of polymerases is the covalent coupling of nucleotide monomers to a polymer. The synthesis may be template-dependent (such as DNA or RNA synthesis with DNA- or RNA-dependent polymerases) as well as template-independent, e.g. by terminal transferases ("J Sambrook" Molecular Cloning 3rd Ed. CSHL Press 2001).
Falls RNA als Substrat (z.B. mRNA) in die Sequenzierungsreaktion eingesetzt wird, können handelsübliche RNA-abhängige DNA-Polymerasen eingesetzt werden, z.B. AMV- Reverse Transcriptase (Sigma), M-MLV Reverse Transcriptase (Sigma), HIV- Reverse Transcriptase ohne RNAse-Aktivität. Auch für Klenow Fragment DNA Polymerase ist die Tätigkeit als Reverse Transcriptase beschrieben. Für bestimmte Anwendungen, können Reverse Transcriptasen von RNAse-Aktivität weitgehend frei sein ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory), z.B. bei mRNA-Makrierung für Hybridisierungsexperimente. If RNA is used as a substrate (e.g., mRNA) in the sequencing reaction, commercially available RNA-dependent DNA polymerases can be used, e.g. AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNAse activity. Also for Klenow fragment DNA polymerase activity is described as reverse transcriptase. For certain applications, reverse transcriptases may be largely free of RNAse activity ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory), e.g. mRNA mRNA for hybridization experiments.
Falls DNA als Substrat (z.B. cDNA) verwendet wird, eignen sich als Polymerasen prinzipiell alle DNA-abhängigen DNA-Polymerasen mit oder ohne 3'-5' Exonuklease- Aktivität (DNA-Replication" 1992 Ed. A.Kornberg, Freeman and Company NY), z.B. modifizierte T7-Polymerase z.B. vom Typ "Sequenase Version 2" (Amersham Pharmacia Biotech), Klenow Fragment der DNA-Polymerase I mit oder ohne 3'-5' Exonukleaseaktivität (New England Biolabs), T4 DNA Polymerase, phi29 DNA Polymerase, Polymerase Beta verschiedenen Ursprungs (Animal Cell DNA Polymerases" 1983, Fry M., CRC Press Inc., kommerziell erhältlich bei Chimerx) thermostabile Polymerasen wie beispielsweise Taq-Polymerase (New England Biolabs), Vent Polymerase, Vent exo minus Polymerase, Deep Vent Polymerase, Deep Vent exo minus Polymerase, Pfu Polymerase, Tli Polymerase, Tfl Polymerase, Tth Polymerase, Thermosequenase, Pwo-Polymerase, Terminator, Terminator I, Terminator II, Terminator III, Bst DNA Polymerase, Bst DNA Polymerase, Large Fragment, Phusion® High-Fidelity DNA Polymerase, Phusion® High-Fidelity Hot Start DNA Polymerase, Phire® Hot Start DNA Polymerase, Phire® Hot Start II DNA Polymerase, Phusion® Flash High-Fidelity DNA Polymerase, Crimson Taq DNA Polymerase, DyNAzyme™ EXT DNA Polymerase, DyNAzyme™ II Hot Start DNA Polymerase, 9°Nm DNA Polymerase usw. (von z.B. New England Biolabs oder von Promega oder von Roche oder von Qiagen). If DNA is used as substrate (eg cDNA), all DNA-dependent DNA polymerases with or without 3'-5 'exonuclease activity (DNA replication "1992 Ed A.Kornberg, Freeman and Company NY ), eg modified T7 polymerase eg of the "Sequenase Version 2" type (Amersham Pharmacia Biotech), Klenow fragment of DNA polymerase I with or without 3'-5 'exonuclease activity (New England Biolabs), T4 DNA polymerase, phi29 DNA polymerase , Polymerase Beta of various origins (Animal Cell DNA Polymerases 1983, Fry M., CRC Press Inc., commercially available from Chimerx) thermostable polymerases such as Taq polymerase (New England Biolabs), Vent Polymerase, Vent exo minus polymerase, Deep Vent Polymerase, Deep Vent exo minus Polymerase, Pfu Polymerase, Tli Polymerase, Tfl Polymerase, Tth Polymerase, Thermosequenase, Pwo Polymerase, Terminator, Terminator I, Terminator II, Terminator III, Bst DNA Polymerase, Bst DNA Polymerase, Large Fragment, Phusion® High-Fidelity DNA Polymerase, Phusion® High-Fidelity Hot Start DNA Polymerase, Phire® Hot Start DNA Polymerase, Phire® Hot Start II DNA Polymerase, Phusion® Flash High -Fidelity DNA Polymerase, Crimson Taq DNA Polymerase, DyNAzyme ™ EXT DNA Polymerase, DyNAzyme ™ II Hot Start DNA Polymerase, 9 ° N m DNA Polymerase, etc. (from eg New England Biolabs or from Promega or from Roche or from Qiagen).
Durch moderne gentechnische Methoden ist es möglich, Polymerasen zu konstruieren, die sich in ihren Fähigkeiten von in der Natur vorkommenden Enzymen unterscheiden, z.B. durch Fehlen bestimmter Aktititäten oder durch verbesserte enzymatische Parameter, wie z.B. Präzision, Prozessivität usw. Eine zunehmende Anzahl von Firmen stellt solche thermolabile und thermostabile Polymerase her, die als optimierte Enzyme für PCR oder andere Amplifikationsverfahren bzw. Markierungsverfahren vermarktet werden. Die Grundfunktionen der Polymerasen bleiben allerdings beibehalten : sie sind in der Lage, Nukleotide einzubauen und dadurch komplementäre Stränge synthetisieren. Solche Polymerasen können ebenfalls für die beschriebenen Methoden eingesetzt werden. Eine entsprechende Optimierung der Reaktionsbedingungen ist einem Fachmann bekannt. In einer Ausführungsform der Anmeldung werden Polymerasen ohne eine 5 ' -3 ' - exonuklease-Aktivität bevorzugt, z.B. Klenow Fragment exo minus, Vent exo minus,, Bst-Polymerase großes Fragment. By modern genetic engineering methods it is possible to construct polymerases which differ in their abilities of naturally occurring enzymes, eg by lack of certain activities or by improved enzymatic parameters, such as precision, processivity, etc. An increasing number of companies provide such thermolabile and thermostable polymerase, which are marketed as optimized enzymes for PCR or other amplification methods or labeling methods. The basic functions of the polymerases remain, however: they are able to incorporate nucleotides and thereby synthesize complementary strands. Such polymerases can also be used for the methods described. A corresponding optimization of the reaction conditions is known to a person skilled in the art. In one embodiment of the application polymerases without 5 '-3' are - preferably exonuclease activity, for example Klenow fragment exo minus, Vent exo minus ,, Bst polymerase large fragment.
In einer Ausführungsform der Anmeldung werden Polymerasen ohne eine 3 -5 ' - exonuklease-Aktivität bevorzugt, z.B. Klenow-Fragment exo minus. In one embodiment of the application, polymerases without a 3 -5 ' exonuclease activity are preferred, eg Klenow fragment exo minus.
1.3.7. Spaltbare Verbindung 1.3.7. Cleavable connection
Eine unter milden Bedingungen spaltbare Verbindung. Diese Verbindung kann einen Abschnitt im Linker darstellen und kann an einer oder an mehreren Stellen spaltbar sein. Es kann sich um eine chemisch spaltbare Verbindung, wie z.B. eine Disulfid-, eine Ester-, eine Acetal-, oxidativ spaltbare Verbindungen (z.B. Linker, die eine Tartrat-Verbindung einschließen) oder eine Thioesterverbindung (Short WO 9949082, Tcherkassov WO 02088382) handeln. Es kann auch eine photochemisch spaltbare Verbindung, wie in (Rothschild WO 9531429) dargestellt sein. Es kann auch eine enzymatisch spaltbare Verbindung (beispielsweise eine Peptid- oder Polypeptide- Bindung, Odedra WO 0192284), spaltbar durch Peptidasen, eine Poly- oder Oligosaccharid-Bindung, spaltbar durch Disaccharidasen) sein, wobei die Spaltung durch ein spezifisches Enzym zwischen bestimmten Monomeren der spaltbaren Stellen stattfinden kann. A compound which can be split under mild conditions. This connection may be a section in the linker and may be cleavable at one or more locations. It may be a chemically cleavable compound such as a disulfide, an ester, an acetal, oxidatively cleavable compounds (eg, linkers that include a tartrate compound) or a thioester compound (Short WO 9949082, Tcherkassov WO 02088382) , It may also be a photochemically cleavable compound as shown in (Rothschild WO 9531429). It may also be an enzymatically cleavable compound (for example, a peptide or polypeptide bond, Odedra WO 0192284), cleavable by peptidases, a poly- or oligosaccharide bond, cleavable by disaccharidases), the cleavage by a specific enzyme between certain monomers the fissile places can take place.
Mehrere Beispiele für spaltbare Verbindungen sind bekannt. Die Kopplung einer solchen Verbindung ist beispielsweise beschrieben in (Tcherkassov 02088382, Metzker et al. Nucleic Acid Research 1994, V.22, S. 4259, Canard et al. Gene, 1994, V. 148, 1, , Kwiatkowski US Pat. 6255475, Kwiatkowski WO 01/25247, Parce WO 0050642.). Eine Spaltbare Verbindung kann ein Teil des Linkers sein oder die Kopplungsstelle des Linkers an das Nukleotid bilden, oder die Verbindung zwischen der Linker-Komponente und der Makrer-Komponente, oder die Verbindung zwischen den Marker-Einheiten und der Kern-Komponente.  Several examples of scissile compounds are known. The coupling of such a compound is described, for example, in (Tcherkassov 02088382, Metzker et al Nucleic Acid Research 1994, V.22, page 4259, Canard et al., Gene, 1994, V. 148, 1,, Kwiatkowski US Patent 6255475 , Kwiatkowski WO 01/25247, Parce WO 0050642.). A cleavable compound may be part of the linker or may form the coupling site of the linker to the nucleotide, or the linkage between the linker moiety and the macroser moiety, or the linkage between the label moieties and the core moiety.
1.3.8 DNA - Deoxyribonukleinsäure verschiedenen Ursprungs und unterschiedlicher Länge (z.B. Oligonukleotide, Polynukleotide, Plasmide, genomische DNA, cDNA, ssDNA, dsDNA) 1.3.9 RNA - Ribonukleinsäure 1.3.8 DNA deoxyribonucleic acid of various origin and length (e.g., oligonucleotides, polynucleotides, plasmids, genomic DNA, cDNA, ssDNA, dsDNA) 1.3.9 RNA ribonucleic acid
1.3.10 PNA - Peptide Nucleic Acid 1.3.10 PNA Peptides Nucleic Acid
1.3.11 LNA - locked nucleic acids 1.3.11 LNA - locked nucleic acids
1.3.12 Nukleotide: 1.3.12 Nucleotides:
Nukleotide dienen als Substrate für Polymerasen in einer matrizenabhängigen Synthese- Reaktion. Sie können in einen komplementären Strang eingebaut werden. · dNTP - 2'-deoxi-Nucleosid-Triphosphate oder deren Analoga, Substrate für Nucleotides serve as substrates for polymerases in a template-dependent synthesis reaction. They can be incorporated into a complementary strand. DNTP 2'-deoxynucleoside triphosphates or their analogues, substrates for
DNA-Polymerasen und Reverse-Transkriptasen, z.B. dATP, dGTP, dUTP, dTTP, dCTP, dITP oder deren Analoga wie 7-Deaza-dATP oder 7-Deaza- dGTP. Auch weitere Analoga von natürlichen 2'-deoxi-Nucleosid- Triphosphaten können von DNA-Polymerasen als Substrate verwendet werden. DNA polymerases and reverse transcriptases, e.g. dATP, dGTP, dUTP, dTTP, dCTP, dITP or their analogues such as 7-deaza-dATP or 7-deaza-dGTP. Other analogues of natural 2'-deoxynucleoside triphosphates can also be used as substrates by DNA polymerases.
• NTP - Ribonukleosid-Triphosphate oder deren Analoga, Substrate für RNA- Polymerasen, UTP, CTP, ATP, GTP. • NTP - ribonucleoside triphosphates or their analogues, substrates for RNA polymerases, UTP, CTP, ATP, GTP.
• Abkürzung "NT" wird auch bei der Längenangabe einer Nukleinsäuresequenz verwendet, z.B. 1.000 NT. In diesem Fall steht "NT" für Nukleosid-Monophosphate. Im Text wird bei Abkürzungen die Mehrzahl durch Verwendung des Suffixes "s" gebildet, "NT" steht zum Beispiel für "Nukleotid", "NTs" steht für mehrere Nukleotide. 1.3.13 NSK - Nukleinsäurekette. DNA oder RNA, PNA, LNA • Abbreviation "NT" is also used for the length specification of a nucleic acid sequence, eg 1,000 NT. In this case, "NT" stands for nucleoside monophosphates. In the text, the majority of abbreviations are formed by using the suffix "s", "NT" stands for "nucleotide", for example, "NTs" stands for several nucleotides. 1.3.13 NSK - Nucleic Acid Chain. DNA or RNA, PNA, LNA
1.3.14 Gesamtsequenz - Summe aller Sequenzen zu analysierenden Nukleinsäureketten im Ansatz, sie kann ursprünglich aus einer oder mehreren NSKs bestehen. Dabei kann die Gesamtsequenz Teile oder Äquivalente einer anderen Sequenz oder von Sequenz-Populationen darstellen (z.B. mRNA, cDNA, Plasmid-DNA mit Insert, BAC, YAC) und aus einer oder unterschiedlichen Spezies stammen. Gesamtsequenz kann eine oder mehrere Zielsequenzen einschließen. 1.3.14 Total Sequence - Sum of all sequences of nucleic acid chains to be analyzed in the batch; it may originally consist of one or more NSKs. The overall sequence may be parts or equivalents of another sequence or sequence populations (e.g., mRNA, cDNA, plasmid DNA with insert, BAC, YAC) and derived from one or different species. Total sequence may include one or more target sequences.
1.3.15 NSKF - Nukleinsäurekettenfragment (DNA oder RNA), das einem Teil der Gesamtsequenz entspricht, NSKFs - Nukleinsäurekettenfragmente. Die Summe der1.3.15 NSKF nucleic acid chain fragment (DNA or RNA) corresponding to part of the total sequence, NSKFs - nucleic acid chain fragments. The sum of
NSKFs bildet ein Äquivalent zur Gesamtsequenz. Die NSKFs können beispielsweise Fragmente von DNA- oder RNA-Gesamtsequenz sein, die nach einem Fragmentierungsschritt entstehen. NSKFs is equivalent to the total sequence. For example, the NSKFs may be fragments of total DNA or RNA sequence resulting from a fragmentation step.
1.3.16 Primerbindungstelle (PBS) - Teil der Zielsequenz, an den ein Primer binden kann  1.3.16 Primer binding site (PBS) - Part of the target sequence to which a primer can bind
1.3.17 Referenzsequenz - eine bereits bekannte Sequenz, zu der die Abweichungen in der zu untersuchenden Sequenz bzw. in den zu untersuchenden Sequenzen (z.B. Gesamtsequenz) ermittelt werden. Als Referenzsequenzen können in Datenbanken zugängliche Sequenzen verwendet werden, wie z.B. aus der NCBI- Datenbank.  1.3.17 Reference sequence - an already known sequence for which the deviations in the sequence to be investigated or in the sequences to be examined (for example total sequence) are determined. As reference sequences, sequences accessible in databases may be used, e.g. from the NCBI database.
1.3.18 Tm - Schmelztemperatur 1.3.18 Tm - melting temperature
1.4. Nachfolgend sind wichtige Aspekte der Erfindung aufgeführt. 1.4. The following are important aspects of the invention.
Aspekt 1 : Nukleotid-Konjugate, die folgende Komponenten einschließen: zumindest eine Nukleotid-Komponente (Nuk-Komponente), zumindest ein Oligonukleotid und mindesten einen Linker zwischen der Nukleotid-Komponente und dem Oligonukleotid Aspect 1: Nucleotide conjugates including the following components: at least one nucleotide component (nuc-component), at least one oligonucleotide and at least one linker between the nucleotide component and the oligonucleotide
In einer Ausführungsform ist die Nukleotid-Komponente über einen Linker an das Oligonukleotid an einem seiner Enden gekoppelt. In einer weiteren Ausführungsform ist die Nukleotid-Komponente über einen Linker an einer internen Position an das Oligonukleotid gekoppelt. In einer Ausführungsform ist der Linker beispielsweise an die Base der Nukleotid-Komponente gekoppelt. In einer weiteren Ausführungform ist der Linker an den Zucker-Anteil der Nukleotid-Komponente gekoppelt. In one embodiment, the nucleotide component is coupled via a linker to the oligonucleotide at one of its ends. In another embodiment, the nucleotide component is coupled to the oligonucleotide via a linker at an internal position. For example, in one embodiment, the linker is coupled to the base of the nucleotide component. In another embodiment, the linker is coupled to the sugar portion of the nucleotide component.
Aspekt 2: Nukleotid-Konjugate nach Aspekt 1, wobei der jeweilige Linker spaltbar ist. Beispielsweise schließt der Linker eine Disulfid-Bindung oder eine photolabile Bindung ein. Aspect 2: Nucleotide conjugates according to aspect 1, wherein the respective linker is cleavable. For example, the linker includes a disulfide bond or a photolabile bond.
Aspekt 3 : Nukleotid-Konjugate nach Aspekt 1, wobei das Oligonukleotid selbstkomplementäre Sequenzabschnitte einschließt. Diese Sequenzabschnitte können von 4 bis 10, 10 bis 20, 20 bis 40, oder länger als 40 Basen sein. Vorzugsweise sind sie zwischen 4 und 15 Basen lang. Aspect 3: Nucleotide conjugates according to aspect 1, wherein the oligonucleotide includes self-complementary sequence segments. These sequence sections may be from 4 to 10, 10 to 20, 20 to 40, or longer than 40 bases. Preferably, they are between 4 and 15 bases long.
Aspekt 4: Nukleotid-Konjugate nach Aspekt 1, wobei mindestens ein weiteres komplementäres Oligonukleotid an das Oligonukleotid gekopplet ist. In einer Ausführungsform erfolgt die Kopplung zwischen beiden Oligonukleotiden durch Hybridisierung von komplementären Bereichen der Oligonukleotide. Aspect 4: Nucleotide conjugates according to aspect 1, wherein at least one further complementary oligonucleotide is coupled to the oligonucleotide. In one embodiment, the coupling between the two oligonucleotides occurs by hybridization of complementary regions of the oligonucleotides.
Aspekt 5: Nukleotid-Konjugate nach Aspekt 1 bis 4, wobei mindestens eines der Oligonukleotide spezifisch markiert ist. Der Marker kann beispielsweise ein Fluoreszenzfarbstoff sein. Aspect 5: Nucleotide conjugates according to Aspects 1 to 4, wherein at least one of the oligonucleotides is specifically labeled. The marker may be, for example, a fluorescent dye.
In einer Ausführungsform der Erfindung ist das 3 ' -Ende der genannten Oligonukleotide durch eine chemische Gruppe, z.B. eine Phosphat-Gruppe oder einen Farbstoff blokiert. Aspekt 6: Ein Reaktionsgemisch bzw. eine Komposition für enzymatische Synthese von Nukleinsäureketten, das mindestens eines der Nukleotid-Konjugate nach oben genannten Aspekten einschließt Aspekt 6: Ein Reaktionsgemisch bzw. eine Komposition für enzymatische Synthese von Nukleinsäureketten, das mindestens vier Arten von Nukleotid-Konjugaten nach oben genannten Aspekten einschließt, wobei Nuk-Komponenten der Nukleotid-Konjugate in einer Komposition folgende Basen oder deren Analoga einschließen: Adenin, Guanin, Cytidin, Uridin, und jede Art dieser Nukleotid-Konjugaten einen für sie charakteristischen Marker einschließt. In one embodiment of the invention, the 3 ' end of said oligonucleotides is blocked by a chemical group, eg a phosphate group or a dye. Aspect 6: A nucleic acid chain enzymatic synthesis composition which includes at least one of the nucleotide conjugates in the above aspects Aspect 6: A nucleic acid chain enzymatic synthesis composition including at least four types of nucleotide conjugates in the above aspects, wherein nuc-components of the nucleotide conjugates in a composition include bases or their analogues: adenine, guanine , Cytidine, uridine, and any type of these nucleotide conjugates include a marker characteristic of them.
Aspekt 7: Ein Reaktionsgemisch bzw. eine Komposition für enzymatische Synthese von Nukleinsäureketten, das mindestens vier Populationen von Nukleotid-Konjugaten nach oben genannten Aspekten einschließt, wobei eine Population von Nukleotid-Konjugaten durch eine einheitliche Nukleobase der Nukleotid-Komponente oder deren Analoga (z.B. Adenin, Guanin, Cytidin, Uridin) charakterisiert ist. Aspect 7: A nucleic acid chain enzymatic synthesis composition comprising at least four populations of nucleotide conjugates according to the above aspects, wherein a population of nucleotide conjugates are constituted by a uniform nucleobase of the nucleotide component or its analogs (eg adenine , Guanine, cytidine, uridine).
In einer Ausführungsform der Erfindung schließt eine Population von Nukleotid- Konjugaten mit einer einheitlichen Nukleobase der Nuk-komponente mehrere Oligonukleotide ein. Die Anzahl der Oligonukleotide in einer Population von Nukleotid- Konjugaten schließt folngende Bereiche ein: 4 bis 50, 50 bis 500, 500 bis 5000, 5000 bis 10000, 10000 bis 1000000, mehr als 1000000. Vorzugsweise schließt sie Bereiche von 4 bis 5000 ein. In one embodiment of the invention, a population of nucleotide conjugates having a unique nucleobase of the nuc-component includes a plurality of oligonucleotides. The number of oligonucleotides in a population of nucleotide conjugates includes 4 to 50, 50 to 500, 500 to 5000, 5000 to 10,000, 10,000 to 1,000,000, more than 1,000,000. Preferably, it includes ranges of 4 to 5,000.
Die zu einer Population gehörenden Nukleotid-Konjugate haben vorzugsweise mindestens einen für diese Population charakteristischen Marker. Dieser Marker schließt in einer Ausführungsform einen Fluoreszenzfarbstoff ein. In einer weiteren Ausführungsform schließt dieser Marker einen einheitlichen Sequenzabschnitt der Oligonukleotide ein. The nucleotide conjugates belonging to a population preferably have at least one marker characteristic of this population. This marker in one embodiment includes a fluorescent dye. In another embodiment, this marker includes a uniform sequence portion of the oligonucleotides.
In einer weiteren Ausführungsform der Erfindung schließen die Oligonukleotide einer Population mindestens einen variablen Sequenzabschnitt ein. Dieser variable Sequenzabschnitt unterscheidet sich von Oligonukleotid zu Oligonukleotid einer Population. Die Vielzahl der Varianten in diesem Abschnitt hängt von der Länge des Abschnittes ab. Je länger der Sequenzabschnitt desto größer kann die Variabilität in diesem Abschnitt sein. In einer Ausführungsform schließt die Vielzahl der variablen Sequenzabschnitte der Oligonukleotide einer Population sämtlich mögliche Abfolgen der Nukleobasen in diesem Abschnitt ein (randomisierte Sequenzen). Die Anzahl der möglichen Sequenzabfolgen hängt von der Länge des variablen Sequenzabschnittes ab und wird berechnet als 4 n, wobei (n) die Länge des variablen Abschnittes in Nukleobasen ist. Beispielsweise schließt eine Population 256 Oligonukleotide bei einer Länge des variablen Abschnittes von vier Nukleobasen oder 4096 Oligonukleotide bei einer Länge des variablen Abschnittes von sechs Nukleobasen. Der variable Sequenzabschnitt der Oligonukleotide ist vorzugsweise einzelsträngig. Durch diesen Abschnitt können Oligonukleotide einer Population von Nukleotid-Konjugaten an einen Strang einer Nukleinsäurekette binden. Eine solche Bindung erfolgt über Hybridisierung eines variablen Abschnittes eines Oligonukleotides einer population von Nukleotid-Konjugaten an eine komplementäre Sequenz einer Nukleinsäurekette. Dank der Vielzahl von variablen Abschnitten innerhalb einer Population von Oligonukleotiden hat eine Population von Nukleotid-Konjugaten das Potenzial, an Nukleinsäuereketten mit beliebiger Zusammensetzung zu binden. In a further embodiment of the invention, the oligonucleotides of a population include at least one variable sequence segment. This variable sequence section differs from oligonucleotide to oligonucleotide of a population. The variety of variants in this section depends on the length of the section. The longer the sequence segment, the greater the variability in this section. In one embodiment, the plurality of variable sequence portions of the oligonucleotides of a population include all possible sequences of the nucleobases in that portion (randomized sequences). The number of possible sequence sequences depends on the length of the variable sequence segment and is calculated as 4 n, where (n) is the length of the variable segment in nucleobases. For example, one population includes 256 oligonucleotides in a variable nucleotide length of four nucleobases or 4096 oligonucleotides in a variable nucleus length of six nucleobases. The variable sequence segment of the oligonucleotides is preferably single-stranded. Through this section, oligonucleotides of a population of nucleotide conjugates can bind to one strand of a nucleic acid chain. Such binding occurs via hybridization of a variable portion of an oligonucleotide of a population of nucleotide conjugates to a complementary sequence of a nucleic acid sequence. Thanks to the large number of variable segments within a population of oligonucleotides, a population of nucleotide conjugates has the potential to bind to nucleic acid chains of any composition.
Aspekt 8: Verfahren zur enzymatischen Synthese von Nukleinsäureketten, bei dem Nukleotid-Konjugate eingesetzt werden. Aspect 8: Methods for Enzymatic Synthesis of Nucleic Acid Chains Using Nucleotide Conjugates.
Aspekt 9: Ein Verfahren zur Synthese von Nukleinsäureketten, das folgende Schritte einschließt: Aspect 9: A Method for the Synthesis of Nucleic Acid Chains, Including the Following Steps:
o Bereitstellung von extensionsfähigen Matrize-Primer-Komplexen o Inkubation dieser Komplexe in einer Reaktionslösung, die eine oder mehrere Polymerase-Arten und zumindest eine Art der Nukleotid- Konjugate enthält, unter Bedingungen, die eine Primer-Verlängerung um ein Nukleotid-Konjugate erlauben, wobei jede Art von Nukleotid-Konjugate charakteristisch markiert ist.  o Provision of template-primer complexes capable of extension o Incubation of these complexes in a reaction solution containing one or more polymerase species and at least one type of nucleotide conjugate, under conditions permitting primer extension by one nucleotide conjugate each type of nucleotide conjugate is characteristically labeled.
Aspekt 10: Kit zur Durchführung einer enzymatischen Synthese von Nukleinsäureketten, das folgende Elemente einschließt: Aspect 10: Kit for carrying out an enzymatic synthesis of nucleic acid chains, which includes the following elements:
o Eine oder mehrere Arten der Polymerasen  One or more types of polymerases
o Zumindes eine Art von Nukleotid-Konjugaten  At least one kind of nucleotide conjugates
Aspekt IIA: Ein Verfahren zur Sequenzierung von Nukleisäureketten durch die Synthese, das folgende Schritte einschließt: a) Bereitstellung von mindestens einer Population an extensionsfähigen Nukleinsäureketten-Primer-Komplexen (NSK-Primer-Komplexe) b) Inkubation von mindestens einer Art der Nukleotid-Konjugate zusammen mit zumindest einer Art der Polymerase mit den im Schritt (a) bereitgestellten NSK-Primer-Komplexen unter Bedingungen, die den Einbau von komplementären Nuk-Komponenten der Nukleotid-Konjugate zulassen, wobei jede Art der Nukleotid-Konjugate eine für sie charakteristische Markierung besitzt. c) Entfernung der nicht eingebauten Nukleotid-Konjugate von den NSK- Primer-Komplexen d) Detektion der Signale von in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate e) Abspaltung der Linker-Komponente sowie der Marker-Komponente und Oligonukleotid-Komponente von den in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate f) Waschen der NSK-Primer-Komplexe gegebenenfalls Wiederholung der Schritte (b) bis (f), Aspect IIA: A Method for the Sequencing of Nucleic Acid Chains by Synthesis, Including the Steps of: a) Providing at Least One Population to Extensible Nucleic Acid Chain Primer Complexes (NSK Primer Complexes) b) incubation of at least one type of nucleotide conjugate together with at least one type of polymerase with the NSK primer complexes provided in step (a) under conditions permitting the incorporation of complementary nuc-components of the nucleotide conjugates, each Type of nucleotide conjugates has a characteristic of their mark. c) Removal of Unincorporated Nucleotide Conjugates from the NSK Primer Complexes d) Detection of Signals from Nucleotide Conjugates Incorporated into the NSK Primer Complexes e) Cleavage of the Linker Component and the Marker Component and Oligonucleotide Component of the nucleotide conjugates incorporated into the NSK primer complexes f) washing of the NSK primer complexes, if necessary repeating steps (b) to (f),
Aspekt IIB: Ein Verfahren zur Sequenzierung von Nukleisäureketten, das folgende Schritte einschließt: a) Bereitstellung von mindestens einer Population an extensionsfähigen Nukleinsäureketten-Primer-Komplexen (NSK-Primer-Komplexe) b) Inkubation von mindestens einer Art der Nukleotid-Konjugate zusammen mit zumindest einer Art der Polymerase mit den im Schritt (a) bereitgestellten NSK-Primer-Komplexen unter Bedingungen, die den Einbau von komplementären Nuk-Komponenten der Nukleotid-Konjugate zulassen, wobei jede Art der Nukleotid-Konjugate eine für sie charakteristische Oligonukleotidsequenz besitzt. c) Entfernung der nicht eingebauten Nukleotid-Konjugate von den NSK- Primer-Komplexen d) Zugabe mindestens eines markierten Oligonukleotids zu verlängerten NSK-Primer-Komplexen und Inkubation unter Bedingungen, die eine spezifische Hybridisierung markierter Oligonukleotide an die Oligonukleotide der Nukleotid-Konjugate zulassen e) Entfernung der nicht hybridisierten, markierten Oligonukleotide von den NSK-Primer-Komplexen f) Detektion der Signale von in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate mit hybridisierten markierten Oligonukleotiden h) Abspaltung der Linker-Komponente sowie der Marker-Komponente und Oligonukleotid-Komponente von den in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate g) Waschen der NSK-Primer-Komplexe gegebenenfalls Wiederholung der Schritte (b) bis (g), Aspekt HC: Ein Verfahren zur Sequenzierung von Nukleisäureketten, das folgende Schritte einschließt: a) Bereitstellung von mindestens einer Population an extensionsfähigen Nukleinsäureketten-Primer-Komplexen (NSK-Primer-Komplexe) b) Inkubation von mindestens einer Art der Nukleotid-Konjugate zusammen mit zumindest einer Art der Polymerase mit den im Schritt (a) bereitgestellten NSK-Primer-Komplexen unter Bedingungen, die den Einbau von komplementären Nuk-Komponenten der Nukleotid-Konjugate zulassen, wobei das Oligonukleotid der Nukleotid-Konjugate nicht zurAspect IIB: A method for sequencing nucleic acid chains, comprising the steps of: a) providing at least one population of extensible nucleic acid chain primer complexes (NSK primer complexes) b) incubating at least one type of nucleotide conjugate together with at least a type of polymerase having the NSK primer complexes provided in step (a) under conditions permitting the incorporation of complementary nuc-components of the nucleotide conjugates, each type of nucleotide conjugate having an oligonucleotide sequence characteristic of it. c) Removal of unincorporated nucleotide conjugates from the NSK primer complexes d) addition of at least one labeled oligonucleotide to extended NSK primer complexes and incubation under conditions allowing specific hybridization of labeled oligonucleotides to the oligonucleotides of the nucleotide conjugates e) removal of unhybridized, labeled oligonucleotides from the NSK primer complexes f ) Detection of the signals of nucleotide conjugates incorporated into the NSK primer complexes with hybridized labeled oligonucleotides h) Cleavage of the linker component and of the marker component and oligonucleotide component from the nucleotide conjugates g incorporated into the NSK primer complexes ) Washing of the NSK primer complexes optionally repeating steps (b) to (g), aspect HC: A method for sequencing nucleic acid chains, which includes the following steps: a) provision of at least one population of extensible nucleic acid chain primer complexes ( NSK primer complexes) b) incubation of at least one kind d he nucleotide conjugates together with at least one type of polymerase with the provided in step (a) NSK primer complexes under conditions that allow the incorporation of complementary nuc-components of the nucleotide conjugates, wherein the oligonucleotide of the nucleotide conjugates not to
Nukleinsäurekette komplementär ist und jede Art der Nukleotid-Konjugate eine für sie charakteristische Markierung besitzt. c) Entfernung der nicht eingebauten Nukleotid-Konjugate von den NSK- Primer-Komplexen d) Detektion der Signale von in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate e) Abspaltung der Linker-Komponente sowie der Marker-Komponente und Oligonukleotid-Komponente von den in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate f) Waschen der NSK-Primer-Komplexe gegebenenfalls Wiederholung der Schritte (b) bis (f), Aspekt HD: Ein Verfahren zur Sequenzierung von Nukleisäureketten, das folgende Schritte einschließt: a) Bereitstellung von mindestens einer Population an extensionsfähigen Nukleinsäureketten-Primer-Komplexen (NSK-Primer-Komplexe) b) Inkubation von mindestens einer Art der Nukleotid-Konjugate zusammen mit zumindest einer Art der Polymerase mit den im Schritt (a) bereitgestellten NSK-Primer-Komplexen unter Bedingungen, die den Einbau von komplementären Nuk-Komponenten der Nukleotid-Konjugate zulassen, wobei mindestens ein Abschnitt des Oligonukleotids der Nukleotid-Nucleic acid chain is complementary and each type of nucleotide conjugates has a characteristic of their mark. c) Removal of unincorporated nucleotide conjugates from NSK primer complexes. d) Detection of signals from nucleotide conjugates incorporated into NSK primer complexes e) cleavage of the linker component and of the marker component and oligonucleotide component from the nucleotide conjugates incorporated into the NSK primer complexes f) washing of the NSK primer complexes optionally repeating steps (b) to (f), Aspect HD: A method for sequencing nucleic acid chains, comprising the steps of: a) providing at least one population of extensible nucleic acid chain primer complexes (NSK primer complexes) b) incubating at least one type of nucleotide conjugate together with at least a type of polymerase having the NSK primer complexes provided in step (a) under conditions permitting the incorporation of complementary nuc-components of the nucleotide conjugates, at least a portion of the oligonucleotide of the nucleotide conjugates being
Konjugate an die zu sequenzierende Nukleinsäurekette binden kann und jede Art der Nukleotid-Konjugate eine für sie charakteristische Markierung besitzt. c) Entfernung der nicht eingebauten Nukleotid-Konjugate von den NSK-Conjugates can bind to the nucleic acid sequence to be sequenced and each type of nucleotide conjugates has a characteristic of their mark. c) removal of unincorporated nucleotide conjugates from the NSK
Primer-Komplexen d) Detektion der Signale von in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate e) Abspaltung der Linker-Komponente sowie der Marker-Komponente und Oligonukleotid-Komponente von den in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate f) Waschen der NSK-Primer-Komplexe gegebenenfalls Wiederholung der Schritte (b) bis (f), Aspekt 11E: Ein Verfahren zur Sequenzierung von Nukleisäureketten, das folgende Schritte einschließt: a) Bereitstellung von mindestens einer Population an extensionsfähigen Nukleinsäureketten-Primer-Komplexen (NSK-Primer-Komplexe) b) Inkubation von mindestens vier Arten der Nukleotid-Konjugate zusammen mit zumindest einer Art der Polymerase mit den im Schritt (a) bereitgestellten NSK-Primer-Komplexen unter Bedingungen, die den Einbau von komplementären Nuk-Komponenten der Nukleotid-Konjugate zulassen, wobei das Oligonukleotid der Nukleotid-Konjugate mindestens einen einzelsträngigen Abschnitt einschließt, der an die zu sequenzierenden Nukleinsäureketten binden kann und jede Art der Nukleotid-Konjugate eine für sie charakteristische Markierung besitzt. c) Entfernung der nicht eingebauten Nukleotid-Konjugate von den NSK- Primer-Komplexen d) Detektion der Signale von in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate e) Abspaltung der Linker-Komponente sowie der Marker-Komponente und Oligonukleotid-Komponente von den in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate f) Waschen der NSK-Primer-Komplexe gegebenenfalls Wiederholung der Schritte (b) bis (f), Aspekt 11F: Ein Verfahren zur Sequenzierung von Nukleisäureketten, das folgende Schritte einschließt: a) Bereitstellung von mindestens einer Population an extensionsfähigen Nukleinsäureketten-Primer-Komplexen (NSK-Primer-Komplexe) b) Inkubation von mindestens vier Arten der Nukleotid-Konjugate zusammen mit zumindest einer Art der Polymerase mit den im Schritt (a) bereitgestellten NSK-Primer-Komplexen unter Bedingungen, die den Einbau von komplementären Nuk-Komponenten der Nukleotid-Konjugate zulassen, wobei jede Art der Nukleind-Konjugate eine Komposition bestehend aus einer Vielzahl von Nukleotid-Konjugaten darstellt, wobei diese Komposition ein einheitliches Nukleosid-Triphosphat (Nuk-Komponeten) und eine Vielzahl von Oligonukleotiden einschließt, welche jeweils mindestens einen einzelsträngigen Abschnitt einschließen, wobei diese Abschnitte eine unterschiedliche Sequenzzusammensetzung haben und in der Lage sind an die zu sequenzierenden Nukleinsäureketten zu binden, und jede Art der Nukleotid-Konjugate eine für sie charakteristische Markierung besitzt. c) Entfernung der nicht eingebauten Nukleotid-Konjugate von den NSK- Primer-Komplexen d) Detektion der Signale von in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate e) Abspaltung der Linker-Komponente sowie der Marker-Komponente und Oligonukleotid-Komponente von den in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate f) Waschen der NSK-Primer-Komplexe gegebenenfalls Wiederholung der Schritte (b) bis (f), Primer complexes d) detection of the signals of nucleotide conjugates incorporated into the NSK primer complexes e) cleavage of the linker component as well as the marker component and oligonucleotide component from the nucleotide conjugates incorporated into the NSK primer complexes f ) Washing the NSK primer complexes, optionally repeating steps (b) to (f), Aspect 11E: A method for sequencing nucleic acid chains, comprising the steps of: a) providing at least one population of extensible nucleic acid chain primer complexes (NSK primer complexes) b) incubating at least four types of nucleotide conjugates together with at least a type of polymerase having the NSK primer complexes provided in step (a) under conditions permitting the incorporation of complementary nuc-components of the nucleotide conjugates, the oligonucleotide of the nucleotide conjugates including at least one single-stranded portion attached to the nucleotide conjugates can bind to nucleic acid chains to be sequenced and each type of nucleotide conjugates has a characteristic of their mark. c) Removal of Unincorporated Nucleotide Conjugates from the NSK Primer Complexes d) Detection of Signals from Nucleotide Conjugates Incorporated into the NSK Primer Complexes e) Cleavage of the Linker Component and the Marker Component and Oligonucleotide Component of the nucleotide conjugates incorporated in the NSK primer complexes f) washing of the NSK primer complexes optionally repeating steps (b) to (f), aspect 11F: a method for sequencing nucleic acid chains, which includes the following steps: a) Provision of at least one population of extensible nucleic acid chain primer complexes (NSK primer complexes) b) incubation of at least four types of nucleotide conjugates together with at least one type of polymerase with the NSK primer complexes provided in step (a) under conditions permitting the incorporation of complementary nuc-components of the nucleotide conjugates, each Type of Nucleic Acid conjugates represents a composition consisting of a plurality of nucleotide conjugates, said composition including a uniform nucleoside triphosphate (nuc-components) and a plurality of oligonucleotides each including at least one single-stranded portion, said portions being a different nucleotide conjugate Having sequence composition and are able to bind to the nucleic acid chains to be sequenced, and each type of nucleotide conjugates has a characteristic of them marker. c) Removal of Unincorporated Nucleotide Conjugates from the NSK Primer Complexes d) Detection of Signals from Nucleotide Conjugates Incorporated into the NSK Primer Complexes e) Cleavage of the Linker Component and the Marker Component and Oligonucleotide Component of the nucleotide conjugates incorporated into the NSK primer complexes f) washing of the NSK primer complexes, if necessary repeating steps (b) to (f),
Aspekt 11G: Ein Verfahren zur Sequenzierung von Nukleisäureketten nach dem vorherigen Aspekt, wobei die jeweilige Komposition der Nukleind-Konjugate Oligonukleotide einschließt, die an die zu sequenzierende Nukleinsäureketten über einzelsträngige Abschnitte von ca. 3 bis 15 Nukleobasen binden. Aspect 11G: A method for sequencing nucleic acid chains according to the previous aspect, wherein the respective composition of the nucleind conjugates includes oligonucleotides which bind to the nucleic acid chains to be sequenced via single-stranded portions of about 3 to 15 nucleobases.
Ein weiterer Aspekt 12 der Erfindung betrifft makromolekulare Nukleotid- Verbindungen nach einem der Aspekte 1 bis 11, wobei die Nuk-Komponente folgende Strukturen einschließt (Fig. 12) : Another aspect 12 of the invention relates to macromolecular nucleotide compounds according to any one of aspects 1 to 11, wherein the nuc-component includes the following structures (Figure 12):
Wobei : In which :
Base - ist unabhängig gewählt aus der Gruppe von Adenin, oder 7-Deazaadenin, oder Guanin, oder 7-Deazaguanin, oder Thymin, oder Cytosin, oder Uracil, oder deren Modifikationen, wobei L die Verbindung zwischen der Nuk-Komponente und der Linker-Komponente darstellt (Kopplungseinheit L) und X die Kopplungsstelle der Kopplungseinheit L an der Base ist i - ist H Base - is independently selected from the group of adenine, or 7-deazaadenine, or guanine, or 7-deazaguanine, or thymine, or cytosine, or uracil, or their modifications, where L is the connection between the nuc-component and the linker component (coupling unit L) and X is the coupling site of the coupling unit L at the base is i - is H
R2 - ist unabhängig gewählt aus der Gruppe H, OH, Halogen, NH2, SH oder geschützte OH-Gruppe R 2 - is independently selected from the group H, OH, halogen, NH 2 , SH or protected OH group
R3 - ist unabhängig gewählt aus der Gruppe H, OH, Halogen, P03, SH, N3, NH2, 0-R3-li P(0)m-R3- 1 (m ist 1 oder 2 ist), NH-R-,.χ, S-R3-x, Si-R3-i wobei R3- 1 eine chemisch, photochemisch oder enzymatisch spaltbare Gruppe ist, oder eine der folgenden Modifikationen einschließt: -CO-Y, -CH2-0-Y, -CH2-S-Y, -CH2-N3, -CO- O-Y, -CO-S-Y, -CO-NH-Y, -CH2-CH=CH2, wobei Y ein Alkyl ist, beispielsweise (CH2)n-CH3 wobei n zwischen 0 und 4 liegt, oder ein substituiertes Alkyl ist, beispielsweise mit Halogen, Hydroxy, Amino, Carboxy-Gruppen). R 3 - is independently selected from the group H, OH, halogen, PO 3 , SH, N 3 , NH 2 , O-R 3 -i P (0) m -R 3-1 (m is 1 or 2 is) , NH-R-,..., SR 3 -x , Si-R 3 -i where R 3-1 is a chemically, photochemically or enzymatically cleavable group, or includes one of the following modifications: -CO-Y, -CH 2 -O-Y, -CH 2 -SY, -CH 2 -N 3 , -CO-OY, -CO-SY, -CO-NH-Y, -CH 2 -CH = CH 2 , where Y is an alkyl, for example, (CH 2 ) n -CH 3 wherein n is between 0 and 4, or is a substituted alkyl, for example with halogen, hydroxy, amino, carboxy groups).
R - ist H oder OH  R - is H or OH
R5 - ist unabhängig gewählt aus der Gruppe OH, oder eine geschützte OH- Gruppe, eine Monophosphat-Gruppe, oder eine Diphosphat-Gruppe, oder eine Triphosphat-Gruppe, oder eine Alpha-Thiotriphosphat-Gruppe ist. R 5 - is independently selected from the group OH, or a protected OH group, a monophosphate group, or a diphosphate group, or a triphosphate group, or an alpha thiotriphosphate group.
Ein weiterer Aspekt 13 der Erfindung betrifft makromolekulare Nukleotid- Verbindungen nach einem der Aspekte 1 bis 11, wobei die Nuk-Komponente folgende Strukturen einschließt (Fig . 12) : Wobei : Another aspect 13 of the invention relates to macromolecular nucleotide compounds according to any one of aspects 1 to 11, wherein the nuc-component includes the following structures (Figure 12): wherein:
Base - ist unabhängig gewählt aus der Gruppe von Adenin, oder 7-Deazaadenin, oder Guanin, oder 7-Deazaguanin, oder Thymin, oder Cytosin, oder Uracil, oder deren zu enzymatischen Reaktionen fähigen Modifikationen Rx - ist H Base - is independently selected from the group of adenine, or 7-deazaadenine, or guanine, or 7-deazaguanine, or thymine, or cytosine, or uracil, or their modifications capable of enzymatic reactions R x - is H
R2 - ist unabhängig gewählt aus der Gruppe H, OH, Hai, NH2, SH oder geschützte OH-Gruppe R 2 - is independently selected from the group H, OH, Hal, NH 2 , SH or protected OH group
R3 - ist unabhängig gewählt aus der Gruppe O- R3-2-L, P(0)m- R3-2-L, wobei m 1 oder 2 ist, NH-R3-2-L, S-R3-2-L, Si-R3-2-L oder, wobei R3.2 die Kopplungsstelle des Linkers an das Nukleotid ist und L - die Kopplungseinheit des Linkers (L) ist. R 3 - is independently selected from the group O-R 3 - 2 -L, P (0) m - R 3-2 -L, where m is 1 or 2, NH-R 3-2 -L, SR 3 2 -L, Si-R 3-2 -L or, wherein R 3 . 2 is the coupling site of the linker to the nucleotide and L - is the coupling unit of the linker (L).
R4 - ist H oder OH R5 - ist unabhängig gewählt aus der Gruppe OH, oder eine geschützte OH- Gruppe, eine Monophosphat-Gruppe, oder eine Diphosphat-Gruppe, oder eine Triphosphat-Gruppe, oder eine Alpha-Thiotriphosphat-Gruppe ist. R4 - is H or OH R 5 - is independently selected from the group OH, or a protected OH group, a monophosphate group, or a diphosphate group, or a triphosphate group, or an alpha thiotriphosphate group.
Ein weiterer Aspekt 14 der Erfindung betrifft makromolekulare Nukleotid- Verbindungen nach einem der Aspekte 1 bis 11, wobei die Nuk-Komponente folgende Strukturen einschließt (Fig. 12) : Another aspect of the invention relates to macromolecular nucleotide compounds according to any one of aspects 1 to 11, wherein the nuc-component includes the following structures (Figure 12):
Wobei : In which :
Base - ist unabhängig gewählt aus der Gruppe von Adenin, oder 7-Deazaadenin, oder Guanin, oder 7-Deazaguanin, oder Thymin, oder Cytosin, oder Uracil, oder deren zu enzymatischen Reaktionen fähigen Modifikationen  Base - is independently selected from the group of adenine, or 7-deazaadenine, or guanine, or 7-deazaguanine, or thymine, or cytosine, or uracil, or their modifications capable of enzymatic reactions
R2 - ist unabhängig gewählt aus der Gruppe H, OH, Hai, NH2, SH oder geschützte OH-Gruppe R 2 - is independently selected from the group H, OH, Hal, NH 2 , SH or protected OH group
R3 - ist unabhängig gewählt aus der Gruppe H, OH, Hai, P03, SH, NH2, O- R3-lf P(0)m- R3-1, NH-R3-1( S-R3-i, Si-R3-i wobei R3-1 eine chemisch, photochemisch oder enzymatisch spaltbare Gruppe ist und m 1 oder 2 ist. R 3 - is independently selected from the group H, OH, Hal, PO 3 , SH, NH 2 , O - R 3 - lf P (O) m - R 3-1 , NH-R 3 - 1 ( SR 3 i, Si-R 3 -i wherein R 3-1 is a chemically, photochemically or enzymatically cleavable group and m is 1 or 2.
R4 - ist H oder OH R4 - is H or OH
Rs - ist unabhängig gewählt aus der Gruppe O- R5- 1-L, oder P-(0)3- R5-1-L (modifizierte Monophosphat-Gruppe), oder P-(0)3-P-(0)3-R5-!-L (modifizierte Diphosphat-Gruppe) R s - is independently selected from the group O-R5-1-L, or P- (0) 3 -R5-1-L (modified monophosphate group), or P- (0) 3 -P- (0) 3 -R 5 - ! -L (modified diphosphate group)
oder P-(0)3-P-(0)3-P-(0)3- R5-1-L (modifizierte Triphosphat-Gruppe), wobei R5-! die Kopplungsstelle der Kopplungseinheit L an das Nukleotid ist und Kopplungseinheit L die Verbindung zwischen der Nuk-Komponente und der Linker-Komponente ist. or P- (0) 3 -P- (0) 3 -P- (0) 3 - R5-1-L (modified triphosphate group), wherein R 5 - ! is the coupling site of the coupling unit L to the nucleotide and coupling unit L is the connection between the nuc-component and the linker component.
Ein weiterer Aspekt 15 der Erfindung betrifft makromolekulare Nukleotid- Verbindungen nach Aspekten 12 bis 14, wobei Kopplungseinheit L folgende strukturelle Elemente einschließt: Another aspect of the invention relates to macromolecular nucleotide compounds according to aspects 12 to 14, wherein coupling unit L includes the following structural elements:
R6-NH-R7, R6"0-R7, R6-S-R7, R6-SS-R7, R6-CO-NH-R7, R6-NH-CO-R7, R6-C0-0-R7, R6-0- CO-R7, R6-CO-S-R7, R6-S-CO-R7, R6-P(0)2-R7, R6-Si-R7, R6-(CH2)n-R7, R 6 -NH-R 7 , R 6 "O-R 7 , R 6 -SR 7 , R 6 -SS-R 7 , R 6 -CO-NH-R 7 , R 6 -NH-CO-R 7 , R 6 -C0 -O-R 7 , R 6 -O-CO-R 7 , R 6 -CO-SR 7 , R 6 -S-CO-R 7 , R 6 -P (O) 2 -R 7 , R 6 -Si-R 7 , R 6 - (CH 2 ) n -R 7 ,
R6-(CH2)n-R7 R6-A-(CH2)n-R7, R6-(CH2)n-B-R7i R6-(CH=CH-)n-R7, R6-(A-CH = CH-)n-R7, R6-(CH=CH-B-)n-R7, R6-(CH=CH-CH2-B-)n R 6 - (CH 2 ) n -R 7 R 6 -A- (CH 2 ) n -R 7 , R 6 - (CH 2 ) n -BR 7i R 6 - (CH = CH-) n -R 7 , R 6 - (A-CH = CH-) n -R 7 , R 6 - (CH = CH-B-) n -R 7 , R 6 - ( CH = CH-CH 2 -B-) n
R6-A-CH=CH-(CH2-)n-R7, R6-(-CH=CH-CH2)n-B-R7, R 6 -A-CH = CH- (CH 2 -) n -R 7 , R 6 - (- CH = CH-CH 2 ) n -BR 7 ,
R6- ( CsC- )n- R7, R6- (A-CeC- )n- R7, R6-(A-OC-CH2)n-R7, R6- (OC- B- )n- R7, R 6 - (CSC) n R 7, R 6 - (A-CEC) n R 7, R 6 - (A-OC-CH 2) n -R 7, R 6 - (OC B-) n - R 7 ,
R6-(OC-CH2-B-)n-R7( R6-A-C--C-(CH2-)n-R7, R6- ( -C*C-CH2)„- B- R7, R 6 - (OC-CH 2 -B-) n -R 7 ( R 6 -AC - C- (CH 2 -) n -R 7 , R 6 - (-C * C-CH 2 ) "-B- R 7 ,
R6-(-C- C-CH2-CH2)n-B-R7 wobei R6 - die Nuk-Komponente ist, R7 - der Linkerrest ist und A und B unabhängig folgende strukturelle Elemente einschließen : -NH-, -0-, -S-, -SS-, -CO-NH-, -NH-CO-, -CO-O-, -O-CO-, -CO-S-, -S-CO-, -P(0)2-, -Si-, -(CH2)n-, eine photolabile Gruppe, wobei n - gleich 1 bis 5 ist R 6 is - (--C-C-CH 2 -CH 2 ) n -BR 7 wherein R 6 - is the nuc-component, R 7 - is the linker radical and A and B independently include the following structural elements: -NH-, - 0-, -S-, -SS-, -CO-NH-, -NH-CO-, -CO-O-, -O-CO-, -CO-S-, -S-CO-, -P ( 0) 2 -, -Si-, - (CH 2 ) n -, a photolabile group, where n - is 1 to 5
Ein weiterer Aspekt 16 der Erfindung betrifft makromolekulare Nukleotid- Verbindungen nach Aspekten 12 bis 15 wobei die Linker-Komponente ein hydrophiles, wasserlösliches Polymer einschließt. Another aspect of the invention pertains to macromolecular nucleotide compounds of aspects 12 to 15 wherein the linker component includes a hydrophilic, water-soluble polymer.
Ein weiterer Aspekt 17: Kit zur Markierung von Nukleinsäureketten nach dem Verfahren nach einem der Aspekte, das folgende Elemente einschließt: Another aspect 17: Kit for labeling nucleic acid chains according to the method of any one of the aspects including:
o Eine oder mehrere Arten der Polymerasen  One or more types of polymerases
o Zumindes eins der Nukleotid-Analoga (Nuk-Makromoleküle), nach Aspekten 1 bis 16  At least one of the nucleotide analogues (nuc macromolecules), according to aspects 1 to 16
o Eine feste Phase zu Bindung von markierten Nukleinsäureketten  o A solid phase for binding of labeled nucleic acid chains
Ein weiterer Aspekt 18: Kit zur Markierung von Nukleinsäureketten nach dem Verfahren von einem der Aspekte, das einer oder mehrere der folgenden Kompositionen - vorliegend als Lösung in konzentrierter oder in verdünter Form oder auch als Gemisch von trockenen Substanzen - aus der folgenden Liste einschließt: Another aspect 18: Kit for labeling nucleic acid chains according to the method of one of the aspects which includes one or more of the following compositions - in the present case as a solution in concentrated or in diluted form or else as a mixture of dry substances - from the following list:
o Eine oder mehrere Arten der Polymerasen  One or more types of polymerases
o Zumindes eins der Nukleotid-Analoga (Nuk-Makromoleküle), nach einem der Aspekte 1 bis 16  At least one of the nucleotide analogues (nuc macromolecules) according to any one of aspects 1 to 16
o Lösungen zur Durchführung von enzymatischen Reaktionen  o Solutions for carrying out enzymatic reactions
o Komposition für Einbaureaktion, einschließlich mindestens einer erforderliche Art von weiteren Nukleosid-Triphosphaten  o Composition for incorporation reaction, including at least one required type of further nucleoside triphosphates
o Komposition für die Bindung von markierten Nukleinsäureketten an die feste Phase  o Composition for the binding of labeled nucleic acid chains to the solid phase
o Komposition für Waschen der festen Phase nach der Einbaureaktion o Komposition für optische Detektion der Signale an der festen Phase Ein weiterer Aspekt 19: Kit zur Amplifikation und Markierung von Nukleinsäureketten nach einem der Aspekte, das eine oder mehrere Elemente aus der folgende Liste einschließt: o Composition for washing the solid phase after the incorporation reaction o Composition for optical detection of the signals on the solid phase Another aspect 19: a kit for amplifying and labeling nucleic acid chains according to any of the aspects including one or more elements from the following list:
o Eine oder mehrere Arten der Polymerasen  One or more types of polymerases
o Eine oder mehrere Primer für die Amplifikation von Nukleinsäureketten o Zumindes eins der Nukleotid-Analoga (Nuk-Makromoleküle), nach einem der Aspekte 1 bis 16  o One or more primers for the amplification of nucleic acid chains o At least one of the nucleotide analogues (nuc macromolecules), according to any one of aspects 1 to 16
o Lösungen zur Durchführung von enzymatischen Reaktionen  o Solutions for carrying out enzymatic reactions
o Komposition aus vier dNTPs oder NTPs  o Composition of four dNTPs or NTPs
o Komposition für die Bindung von markierten Nukleinsäureketten an die feste Phase  o Composition for the binding of labeled nucleic acid chains to the solid phase
o Komposition für Waschen der festen Phase nach der Einbaureaktion o Komposition für optische Detektion der Signale an der festen Phase Ein weiterer Aspekt 20: Kit zur Amplifikation und Markierung von Nukleinsäureketten nach einem der Aspekte, das eine oder mehrere Polymerasen aus der folgenden Liste einschließt:  o Composition for washing the solid phase after the incorporation reaction o Composition for optical detection of the signals on the solid phase Another aspect 20: Kit for amplification and labeling of nucleic acid chains according to one of the aspects, which includes one or more polymerases from the following list:
o Reverse Transcriptasen : M-MLV, RSV, AMV, RAV, MAV, HIV  o reverse transcriptases: M-MLV, RSV, AMV, RAV, MAV, HIV
o DNA Polymerasen : Klenow Fragment DNA Polymerase, Klenow Fragment exo minus DNA Polymerase, T7 DNA Polymerase, Sequenase 2, Vent DNA o DNA polymerases: Klenow fragment DNA polymerase, Klenow fragment exo minus DNA polymerase, T7 DNA polymerase, Sequenase 2, Vent DNA
Polymerase, Vent exo minus DNA Polymerase, Deep Vent DNA Polymerase, Deep Vent exo minus DNA Polymerase, Taq DNA Polymerase, TM DNA Polymerase, Pwo DNA Polymerase, Thermosequenase DNA Polymerase, Pfu DNA Polymerase Polymerase, Vent exo minus DNA Polymerase, Deep Vent DNA Polymerase, Deep Vent exo minus DNA Polymerase, Taq DNA Polymerase, TM DNA Polymerase, Pwo DNA Polymerase, Thermosequenase DNA Polymerase, Pfu DNA Polymerase
Ein weiterer Aspekt 21 : Kit zur Markierung von Nukleinsäureketten nach einem der Aspekte in dem die Bestandteile der Kompositionen breits vorgemischt vorliegen. Another aspect 21: Kit for labeling nucleic acid chains according to one of the aspects in which the constituents of the compositions are already pre-mixed.
1.5 Beispiele für Ausführungsformen 1.5 Examples of embodiments
Beispiele für Kopplungen von einzelnen Komponenten von Nuk-Makromolekülen sind in Anmeldungen Cherkasov et al WO2011050938, Cherkasov et al WO 2005044836, Cherkasov et al WO2006097320, Cherkasov et al WO 2008043426, Cherkasov et al DE 10356837, Cherkasov et al DE 102004009704 angegeben. Nuk-Makromoleküle werden von der Firma Genovoxx GmbH als Auftragssynthese entwickelt und vermarktet. Examples of couplings of individual components of nuc-macromolecules are given in applications Cherkasov et al. WO2011050938, Cherkasov et al., WO2005044836, Cherkasov et al. WO2006097320, Cherkasov et al., WO 2008043426, Cherkasov et al DE 10356837, Cherkasov et al DE 102004009704. Nuc-macromolecules are developed and marketed by Genovoxx GmbH as an order synthesis.
Material: Material:
dUTP-AA (dUTP-Allylamine, Jena-Bioscience oder Trilink Biotechnologies), dCTP-PA (dCTP- Propargyl-Amin, Jena Bioscience), dATP-PA (7-(3-Amino-l-propynyl)-2 , deoxy-7- deazaadenosin-5 '-Triphosphat) (Auftragssynthese von JenaBioscience), dGTP-PA (7-(3- Amino-l-propynyl)-2' deoxy-7-deazaguanosin-5 ' -Triphosphat, (Auftragssynthese von JenaBioscience), PDTP (3-(2-Pyridinyl-dithio)-propionsäure, Fluka), 7-(3-Phthalimido-l- propynyl)-2 '-desoxy-7-deazaguanosin und 7-(3-Phthalimido-l-propynyl)-2 ' -desoxy-7- deazaadenosin (Chembiotech), PDTP-NHS (3-(2-Pyridinyl-dithio)-propionsäure-N- hydroxysuccinimidyl-ester, Sigma), TCEP - (Tris-(2-carboxyethyl)phosphine, Sigma), J-Ac (lodoacetat, Sigma), lodacetamid (Sigma), Gamma-((6-aminohexyl)-imido)-dUTP (Jena Bioscience). dUTP-AA (dUTP-allylamine, Jena-Bioscience or Trilink Biotechnologies), dCTP-PA (dCTP-propargyl-amine, Jena Bioscience), dATP-PA (7- (3-amino-1-propynyl) -2 , deoxy- 7- deazaadenosine-5 'triphosphate) (custom synthesis of JenaBioscience), dGTP-PA (7- (3-amino-l-propynyl) -2' -deoxy-7-deazaguanosine-5 'triphosphate, (custom synthesis of JenaBioscience) PDTP (3- (2-pyridinyl-dithio) propionic acid, Fluka), 7- (3-phthalimido-l-propynyl) -2 '-deoxy-7-deazaguanosine and 7- (3-phthalimido-l-propynyl) - '-deoxy-7-deazaadenosine (Chembiotech) PDTP-NHS ((2-pyridinyl-dithio) -propionic acid N- hydroxysuccinimidyl ester, Sigma 3-), TCEP 2 - (tris (2-carboxyethyl) phosphine, Sigma ), J-Ac (iodoacetate, Sigma), iodoacetamide (Sigma), gamma - ((6-aminohexyl) -imido) -dUTP (Jena Bioscience).
Lieferanten und Firmenverzeichnis: Suppliers and company directory:
Aldrich - s. Sigma  Aldrich - s. Sigma
Fluka - s. Sigma Fluka - s. Sigma
Jena-Bioscience - Jena-Bioscience, Jena, Deutschland  Jena Bioscience - Jena Bioscience, Jena, Germany
Molecular Probes - Molecular Probes Europe, Leiden, Niederlande Molecular Probes - Molecular Probes Europe, Leiden, Netherlands
MWG - MWG-Biotech, Ebersberg bei München, Deutschland, MWG - MWG-Biotech, Ebersberg near Munich, Germany,
Roche - Roche, Mannheim, Deutschland  Roche - Roche, Mannheim, Germany
Sigma - Sigma-Aldrich-Fluka, Taufkirchen, Deutschland, Sigma - Sigma-Aldrich-Fluka, Taufkirchen, Germany,
Trilink - Trilink Biotechnologies Inc. San Diego, CA, USA,  Trilink - Trilink Biotechnologies Inc. of San Diego, CA, USA
Lösungsmittel wurden, wenn nötig, absolutiert verwendet (Fluka) oder nach Standardverfahren getrocknet. Bei Lösungsmittelgemischen beziehen sich die angegebenen Mischungsverhältnisse auf die eingesetzten Volumina (v/v). Solvents were used, if necessary, in the absolute form (Fluka) or dried by standard methods. For solvent mixtures, the mixing ratios given are based on the volumes used (v / v).
1.5.14 Beispiele von Synthesen von Nuk-Makromolekülen Es sind viele Methoden für eine kovalente Kopplung von Substanzen an Nukleinsäureketten bekannt. Die Kopplung kann an verschiedene Positionen in der Nukleinsäurekette (5 ' -Position, 3 ' -Position, innere Abschnitte) erfolgen. Mehrere Markierungen pro eine Nukleinsäurekette sind ebenfalls möglich. Die Modifikation kann durch chemische oder auch enzymatische Reaktionen erfolgen. „Protocols for Oligonuccleotide and Analogs" S.Agrawal, 1993, „Protocols for Oligonucleotide conjugates" S.Agrawal 1994, Y.Singh et al Chem.Soc.Rev.2010, 39, 2054-. Einerseits, kann kann die Kopplung einer Substanz bereits während der chemischen / enzymatischen Synthese von Nukleinsäuren durchgeführt werden (z.B. durch Nutzung von Phosphoroamiditen oder durch Nutzung modifizierter Nukleotide und einer Polymerase oder durch Nutzung von Ligase-Reaktion). Andererseits, kann die Kopplung über einen oder mehrere Zwischenschritte, z.B. durch Einführung einer reaktiven Gruppe, erst nach der Synthese erfolgen. Nachfolgend werden einige Beispiele vorgestellt, die zur Demonstrationszwecken einige dieser Varianten beschreiben. 1.5.14 Examples of Syntheses of Nuc-Macromolecules Many methods for covalent coupling of substances to nucleic acid chains are known. The coupling can take place at various positions in the nucleic acid chain (5 ' position, 3 ' position, internal sections). Several labels per one nucleic acid chain are also possible. The modification can be carried out by chemical or enzymatic reactions. S.Agrawal, 1993, "Protocols for Oligonucleotide conjugates" S.Agrawal 1994, Y. Singh et al Chem. Soc. Rev. 2010, 39, 2054-. On the one hand, the coupling of a substance can already be carried out during the chemical / enzymatic synthesis of nucleic acids (for example by using phosphoramidites or by using modified nucleotides and a polymerase or by using ligase reaction). On the other hand, the coupling can take place via one or more intermediate steps, for example by introducing a reactive group, only after the synthesis. Here are a few examples that describe some of these variants for demonstration purposes.
Synthese von Nuk-Linker-Komponenten mit reaktiven Gruppen. Synthesis of Nuc Linker Components with Reactive Groups.
Die Kopplung von Nuk-Komponenten und Oligonukleotiden, kann durch viele Methoden erreicht werden. Beispielsweise, sind viele Methoden bekannt, wie man zwei Strukturen, die reaktive Amino-Gruppen vorweisen, mittels eines Cross-Linkers koppelt. Mit einer oder mehreren Amino-Gruppen modifizierte Oligonukleotide können kommerziell erworben werden. Die Amino-Gruppe kann wahlweise am 5 ' -Ende, 3 ' - End, oder auch im internen Bereich eines Oligonukleotides vorkommen. In folgenden Beispielen sind amino-reaktive Nuk-Komponenten beschrieben, die als Vorstufen bereitgestellt werden. Solche amino-reaktive Nukleotide können an die Oligonukleotide gekoppelt werden. Ebenfalls können Oligonukleotide synthetisiert werden, welche eine Merkapto-Gruppe an einem der Enden enthalten (z.B. von ThermoFischer Scientific Deutschland). Auch andere Beispiele für Einführung von reaktiven Gruppen in Oligonukleotide sind einem Fachmann bekannt. The coupling of nuc-components and oligonucleotides can be achieved by many methods. For example, many methods are known for coupling two structures that have reactive amino groups by means of a cross-linker. Oligonucleotides modified with one or more amino groups can be purchased commercially. The amino group can be present either at the 5 ' end, 3 ' end, or in the internal region of an oligonucleotide. The following examples describe amino-reactive nuc-components which are provided as precursors. Such amino-reactive nucleotides can be coupled to the oligonucleotides. It is also possible to synthesize oligonucleotides which contain a mercapto group at one of the ends (eg from ThermoFischer Scientific Germany). Other examples of introduction of reactive groups into oligonucleotides are also known to a person skilled in the art.
Beispiel 1 example 1
Synthese von dUTP-AA-PDTP, dGTP-PA-PDTP, dATP-PA-PDTP, dCTP-PA-PDTP  Synthesis of dUTP-AA-PDTP, dGTP-PA-PDTP, dATP-PA-PDTP, dCTP-PA-PDTP
(Synthese erfolgte ähnlich wie in WO 2005 044836 beschrieben) (Synthesis was carried out similarly as described in WO 2005 044836)
20 mg dUTP-AA wurden in 1ml Wasser gelöst und der pH-Wert mit NaOH auf 8.5 eingestellt. Zur dUTP-AA - Lösung wurde PDTP-NHS 60 mg in 0.5 ml Methanol, tropfenweise unter Rühren zugegeben. Reaktion wurde 2 h bei 40°C durchgeführt. Die Trennung von überschüssigem PDTP-NHS und PDTP erfolgte auf präparativen Kieselgel-Platten. Das Produkt, dUTP-AA-PDTP, und dUTP-AA bleiben auf der Startlinie. Die Nukleotide wurden von der Platte mit Wasser eluiert und eingeengt. 20 mg of dUTP-AA were dissolved in 1 ml of water and the pH was adjusted to 8.5 with NaOH. To the dUTP-AA solution, PDTP-NHS 60 mg in 0.5 ml of methanol was added dropwise with stirring. Reaction was carried out at 40 ° C for 2 hours. The separation of excess PDTP-NHS and PDTP was carried out on preparative silica gel plates. The product, dUTP-AA-PDTP, and dUTP-AA remain on the starting line. The nucleotides were eluted from the plate with water and concentrated.
Dieses dUTP-Analog trägt nun eine Disulfid-Bindung, die in einer Thiolaustauschreaktion mit anderen Thiolen reagieren kann und eine unter milden Bedingungen spaltbare Verbindung darstellt. This dUTP analogue now carries a disulfide bond that can react with other thiols in a thiol exchange reaction and is a mildly cleavable compound.
Weitere Nukleotidanaloga, 7-Deaza-Aminopropargyl-2 ' -Desoxy-Guanosin-Triphosphat und 7-Deaza-Aminopropargyl-2 ' -Desoxy-Adenosin-triphosphat, 5-Amino-Propargyl- 2 ' -Desoxy-Cytidin-Triphosphat wurden ebenfalls modifiziert wie oben angeführt. Es resultierten dGTP-PA-PDTP, dATP-PA-PDTP, dCTP-PA-PDTP entsprechend. Other nucleotide analogs 7-deaza-aminopropargyl-2 '-deoxy-guanosine triphosphate, and 7-deaza-aminopropargyl-2' -deoxy-adenosine triphosphate, 5-amino-propargyl 2 '-deoxy-cytidine triphosphate were also modified as stated above. This resulted in dGTP-PA-PDTP, dATP-PA-PDTP, dCTP-PA-PDTP correspondingly.
Beispiel 2 Example 2
Synthese von dUTP-PEG(9)-NHS, dUTP-DTBP-NHS und dUTP-Tartrat-NHS  Synthesis of dUTP-PEG (9) -NHS, dUTP-DTBP-NHS and dUTP-Tartrate-NHS
Beispiel 2A: Kopplung eines kurzen Linkers an die Base eines Nukleotids. Example 2A: Coupling of a Short Linker to the Base of a Nucleotide.
5 mg dUTP-AA (Aminoallyl-dUTP, von Trilink Biotechnologies), pH 7.0 wurden getrocknet und im trockenen DMSO bis zur berechneten Konzentration von 20 mmol/1 suspendiert. PEG(9)-(NHS)2 (BS(PEG)9 erhalten von Thermo Scientific Deutschland) wurde in DMSO bis zur Konzentration von 150 mmol/1 gelöst.  5 mg dUTP-AA (Aminoallyl-dUTP, ex Trilink Biotechnologies), pH 7.0 was dried and suspended in dry DMSO to the calculated concentration of 20 mmol / l. PEG (9) - (NHS) 2 (BS (PEG) 9 obtained from Thermo Scientific Germany) was dissolved in DMSO to the concentration of 150 mmol / l.
Die dUTP-AA Suspension wurde zur PEG(9)-(NHS)2 Lösung zugegeben und 2 h bei 37°C unter kräftigem Rühren inkubiert, bis die Lösung durchsichtig wurde. Die Umsetzung von dUTP-AA wurde mittels DC-Kontrolle kontrolliert. The dUTP-AA suspension was added to the PEG (9) - (NHS) 2 solution and incubated for 2 h at 37 ° C with vigorous stirring until the solution became transparent. The conversion of dUTP-AA was monitored by TLC.
Die Aufreinigung von dUTP-PEG(9)-l\IHS erfolgte mittels Präzipitation durch Diethyläther /DMF-Gemisches (v:v 90: 10). Das Pellet enthält das Produkt. Das Produkt wurde in DMSO gelöst und eingefroren.  The purification of dUTP-PEG (9) -I \ IHS was carried out by precipitation by diethyl ether / DMF mixture (v: v 90: 10). The pellet contains the product. The product was dissolved in DMSO and frozen.
In änlicher Art und Weise können weitere dUTP-R-X Analoga synthetisiert werden, wobei (R) einen beliebigen Linker und (X) eine beliebige reaktive Gruppe darstellen kann. Die reaktive Gruppe kann beispielsweise mit Amino-Gruppen oder Thio-Gruppen oder Carboxy-Gruppen reagieren. Beispiele für weitere käuflich erhältliche kurze Linker (Cross-Linker) sind im Cross-Linker Guide von Thermo Scientific fwww.piercenet.com) präsentiert. In a similar manner, further dUTP-R-X analogues can be synthesized, where (R) can be any linker and (X) can be any reactive group. The reactive group may, for example, react with amino groups or thio groups or carboxy groups. Examples of other commercially available short linkers (cross-linkers) are presented in the Cross-Linker Guide by Thermo Scientific, www.piercenet.com).
Linker können auch eine spaltbare Verbindung einschließen, z.B. eine reduktiv spaltbare Bindung (z.B. Dithiobispropionsäure-(NHS)2) oder eine oxidativ spaltbare Bindung (z.B. Tartrat-(NHS)2). Beide Krosslinker wurden von Thermo Scientific gekauft. dUTP-DTBP-NHS wurde in einer ähnlicher Weise wie dUTP-PEG(9)-NHS synthetisiert. Anstatt von PEG(9)-(NHS)2 wurde Dithiobispropionsäure-(NHS)2 verwendet, DTBP- (NHS)2. Dieses dUTP-Analog hat einen Linker mit einer Disulfid-Bindung, der unter reduktiven Bedingungen, z.B. durch TCEP, gespalten werden kann. dUTP-Tartrat-NHS wurde in einer ähnlicher Weise wie dUTP-PEG9-NHS synthetisiert. Anstatt von PEG(9)-(NHS)2 wurde Tartrat-(NHS)2 verwendet. Dieses Nukleotid hat einen Linker mit einer Diol-Bindung (-CH2(OH)-CH2(OH)-) die unter oxidativen Bedingungen (z.B. mit KCI04) gespalten werden kann. Linkers may also include a cleavable compound, eg, a reductively cleavable bond (eg, dithiobispropionic acid (NHS) 2) or an oxidatively cleavable bond (eg, tartrate (NHS) 2). Both crosslinkers were purchased from Thermo Scientific. dUTP-DTBP-NHS was synthesized in a similar manner to dUTP-PEG (9) -NHS. Instead of PEG (9) - (NHS) 2, dithiobispropionic acid (NHS) 2 was used, DTBP- (NHS) 2. This dUTP analog has a linker with a disulfide bond which can be cleaved under reductive conditions, eg by TCEP. dUTP tartrate NHS was synthesized in a similar fashion to dUTP-PEG9-NHS. Instead of PEG (9) - (NHS) 2, tartrate (NHS) 2 was used. This nucleotide has a linker with a diol bond (-CH2 (OH) -CH2 (OH) -) which can be cleaved under oxidative conditions (eg with KClO4).
NHS-Gruppe am Linker kann nun an Amino-Gruppe eines anderen Moleküls, z.B. eines Oligonukleotids gekoppelt werden. NHS group on the linker can now be attached to amino group of another molecule, e.g. an oligonucleotide are coupled.
Beispiel 2B: Kopplung eines kurzen Linkers an die Gamma-Phosphat-Gruppe eines Nukleotids. Example 2B: Coupling of a short linker to the gamma-phosphate group of a nucleotide.
Kopplung von PEG(9)-(NHS)2 bzw. Dithiobispropionsäure-(NHS)2 an die Amino- Gruppe des Gamma-((6-aminohexyl)-imido)-dUTP erfolgte unter ähnlichen Bedingugnen. Es resultierten Derivate von dUTP, die eine reaktive NHS-Gruppe an Gamma-Phosphat-Rest tragen : NHS-PEG(9)-ppp-dUTP und NHS-DTBP-ppp-dUTP.  Coupling of PEG (9) - (NHS) 2 or dithiobispropionic acid (NHS) 2 to the amino group of gamma - ((6-aminohexyl) -imido) -dUTP was carried out under similar conditions. This resulted in derivatives of dUTP bearing a reactive NHS group on gamma-phosphate residue: NHS-PEG (9) -ppp-dUTP and NHS-DTBP-ppp-dUTP.
Beispiele für Modifikaiton von Oligonukleotiden. Examples of Modification of Oligonucleotides.
Oligonukleotide mit einer Aminogruppe an einem der beiden Ende können beispielsweise mit aktiven Estern (z.B. NHS-Ester modifiziert werden) modifiziert werden.  For example, oligonucleotides having an amino group at either end may be modified with active esters (e.g., NHS esters modified).
Beispiel 3 Example 3
Synthese von PDTP-Oligo 1.  Synthesis of PDTP Oligo 1.
Oligo 1 :  Oligo 1:
5 ' -NH2-taatacgactcactatagg-3 ' Phosphat 5 '-NH2 TAATACGACTCACTATAGG 3' phosphate
Oligo 1 wurde durch Überschuß von PDTP-NHS in einem Phosphat-Puffer/ DMSO (20% DMSO), pH 8, modifiziert, so dass eine Disulfid-Gruppe am 5 ' -Ende von Oligo 1 eingeführt wurde (PDTP-Oligo 1). Das modifizierte Oligonukleotid wurde über DEAE Chromatographie gereinigt. Kopplung von Nuc-Komponenten an das Oligonukleotid. Oligo 1 was modified by excess of PDTP-NHS in a phosphate buffer / DMSO (20% DMSO), pH 8, to introduce a disulfide group at the 5 ' end of oligo 1 (PDTP oligo 1). The modified oligonucleotide was purified by DEAE chromatography. Coupling of Nuc components to the oligonucleotide.
Beispiel 4 Example 4
Synthese von dUTP-AA-SS-Oligo 1, dATP-PA-SS-Oligol, dGTP-PA-SS-Oligol, dCTP-PA-SS-Oligol durch Bildung einer Disulfid-Bindung  Synthesis of dUTP-AA-SS-oligo 1, dATP-PA-SS-oligol, dGTP-PA-SS-oligol, dCTP-PA-SS-oligol by formation of a disulfide bond
Synthese von dUTP-AA-SS-Oligo 1. Synthesis of dUTP-AA-SS-Oligo 1.
Zehn Äquivalente von dUTP-AA-PDTP wurden zu einem Äquivalent von PDTP-Oligo 1 (1 mmol/1) in einer Puffer-Lösung zugegeben. Zur Reduktion von Disulfid-Gruppen wurde TCEP in diese Lösung zugegeben (bis 10 mmol/1 Endkonzentration), so dass dUTP-AA-SH und SH-Oligo 1 gebildet wurden. Anschließend wurde gesättigte J2 haltige Lösung (J2 gelöst in KJ-Lösung) zum Reaktionsansatz solange zugegeben, bis die gelbe Farbe von J2 sichtbar blieb. Durch J2-Zugabe erfolgt eine Oxidation unter Ausbildung von Disulfid-Brücken. Das Produkt wurden mittels DEAE-Säule gereinigt. dATP-PA-SS-Oligol, dGTP-PA-SS-Oligol, dCTP-PA-SS-Oligol wurden in ähnlicher Weise erhalten, wobei dGTP-PA-PDTP, dATP-PA-PDTP, dCTP-PA-PDTP anstatt von dUTP-AA-PDTP verwendet wurden.  Ten equivalents of dUTP-AA-PDTP were added to one equivalent of PDTP oligo 1 (1 mmol / l) in a buffer solution. To reduce disulfide groups, TCEP was added to this solution (to 10 mmol / l final concentration) to form dUTP-AA-SH and SH-oligo 1. Subsequently, saturated solution containing J 2 (J 2 dissolved in K 2 SO 4 solution) was added to the reaction mixture until the yellow color of J 2 remained visible. By adding J2, oxidation occurs to form disulfide bridges. The product was purified by DEAE column. dATP-PA-SS-Oligol, dGTP-PA-SS-Oligol, dCTP-PA-SS-Oligol were similarly obtained using dGTP-PA-PDTP, dATP-PA-PDTP, dCTP-PA-PDTP instead of dUTP -AA-PDTP were used.
Beispiel 5 Example 5
Synthese von dUTP-PEG(9)-Oligo 2-Fluorescein, dUTP-AA-SS-Oligo2-Fluorescein Oligo-2 Fluorescein,  Synthesis of dUTP-PEG (9) -oligo 2-fluorescein, dUTP-AA-SS-oligo2-fluorescein oligo-2 fluorescein,
5 ' NH2-cgt att acc gcg gct gct gg cac AAAAAAAAAA FAM 5 ' NH2-cgt att acc gcg gct gct gg cac AAAAAAAAA FAM
Am 5 ' -Ende ist eine NH2-Gruppe über C6-Linker gekoppelt und am 3 ' -Ende ist ein Farbstoff (Fluorescein) gekoppelt (siehe Liste der Sequenzen) : At the 5 ' end, an NH2 group is coupled via C6 linker and at the 3 ' end a dye (fluorescein) is coupled (see list of sequences):
Das Oligonukleotid wurde in einem Phosphat-Puffer, pH 8.0, gelöst (lmmol/l). Zu dieser Lösung wurde 5x Überschuß von dUTP-PEG(9)-NHS gelöst in DMSO zugegeben. Die Reaktion verlief bei RT. Die anschließende Reinigung des Produktes erfolgte über DEAE-Säule und RP-C18 Säule. Das Produkt, dUTP-PEG(9)-Oligo2-Fluorescein, wurde getrocknet und anschließend in Wasser in 50 pmol/l Konzentrationen gelöst und eingefroren. The oligonucleotide was dissolved in a phosphate buffer, pH 8.0 (1 mmol / l). To this solution was added 5x excess of dUTP-PEG (9) -NHS dissolved in DMSO. The reaction proceeded at RT. The subsequent purification of the product was carried out via DEAE column and RP-C18 column. The product, dUTP-PEG (9) oligo2 fluorescein, was dried and then dissolved in water at 50 pmol / L concentrations and frozen.
In ähnlicher Weise wurde auch dUTP-AA-SS-Oligo2-Fluorescein synthetisiert, wobei dUTP-DTBP-NHS anstelle von dUTP-PEG(9)-NHS verwendet wurde. In ähnlicher Weise wurde auch dUTP-ppp-SS-Oligo2-Fluorescein synthetisiert, wobei NHS-DTBP-ppp-dUTP anstelle von dUTP-PEG(9)-NHS verwendet wurde. Ebenfalls wurde in ähnlicher Weise auch dUTP-ppp-PEG(9)-Oligo2-Fluorescein synthetisiert, wobei NHS-PEG(9)-ppp-dUTP anstelle von dUTP-PEG(9)-NHS verwendet wurde. Bei diesen Nukleotid-Konjugaten sind Oligonukleotide via Linker an die endständige Phosphat-Gruppe der Nuk-Komponente gekoppelt. Similarly, dUTP-AA-SS-oligo2-fluorescein was also synthesized using dUTP-DTBP-NHS instead of dUTP-PEG (9) -NHS. Similarly, dUTP-ppp-SS-oligo2-fluorescein was also synthesized using NHS-DTBP-ppp-dUTP instead of dUTP-PEG (9) -NHS. Similarly, dUTP-ppp-PEG (9) oligo2-fluorescein was similarly synthesized using NHS-PEG (9) -ppp-dUTP instead of dUTP-PEG (9) -NHS. In these nucleotide conjugates, oligonucleotides are coupled via linker to the terminal phosphate group of the nuc-component.
Beispiel 6 Example 6
Synthese von dUTP-AA-SS-Oligo4-Fluorescein  Synthesis of dUTP-AA-SS-oligo4-fluorescein
(Oligonukleotid mit selbstkomplementären Sequenzen vom Typ „Molecular Beacon") (Oligonucleotide with self-complementary sequences of the type "Molecular Beacon")
Es wurde ein modifiziertes Oligonukleotid gekauft (Auftragssynthese Eurofins MWG), das selbstkomplementäre Sequenzabschnitte einschließt (Oligo 4) Eine solches Oligonukleotid kann in Lösung vollständig oder teilweise als doppelsträngiges Oligonukleotid vorliegen, genannt auch„Molecular Beacon".  A modified oligonucleotide was purchased (order synthesis Eurofins MWG), which includes self-complementary sequence segments (oligo 4) Such an oligonucleotide may be present in solution in whole or in part as a double-stranded oligonucleotide, also called "Molecular Beacon".
Oligo-4, Fluorescein, Oligo-4, fluorescein,
5 ' NH2-cat att acc gcg gct gct GTAATAC AAAAA AAAAA FAM 5 ' NH2-cat att acc gcg gct gct GTAATAC AAAAA AAAAA FAM
(Stem-Bereiche sind unterstrichen) Als Nuk-Komponente mit einem Linker wurde dUTP-DTBP-NHS verwendet (Synthese sieht oben). Das Oligonukleotid wurde in einer Phosphat-Puffer-Lösung, pH 8, aufgelöst ( 1 mmol/1) und zu 5x Äquivalenten von dUTP-DTBP-NHS (gelöst in DMSO) zugegeben. Die Reaktion läuft an NH2-Gruppe am 5 ' -Ende in guten Ausbeuten ab. Die Reinigung des Produktes erfolgte über DEAE-Säule und RP-18-Säule. (Stem areas are underlined) As a Nuk component with a linker, dUTP-DTBP-NHS was used (see synthesis above). The oligonucleotide was dissolved in a phosphate buffer solution, pH 8, (1 mmol / l) and added to 5x equivalents of dUTP-DTBP-NHS (dissolved in DMSO). The reaction proceeds on NH2 group at the 5 ' end in good yields. The product was purified by DEAE column and RP-18 column.
Beispiel 7 Example 7
Synthese von dUTP-AA-SS-Oligo 2-Fluorescein / Oligo 3. Zunächst wurde dUTP-AA-SS-Oligo2-Fluorescein synthetisiert (siehe oben) und in einer Puffer-Lösung aufgelöst. Zu dieser Lösung wurde ein Äquivalent eines komplementären Oligonukleotids mit der folgenden Struktur gegeben:  Synthesis of dUTP-AA-SS-oligo-2-fluorescein / oligo 3. First, dUTP-AA-SS-oligo2-fluorescein was synthesized (see above) and dissolved in a buffer solution. To this solution was added one equivalent of a complementary oligonucleotide having the structure:
Oligo-3, Oligo 3,
5 ' gtg cc agc agc cgc ggt aat acg 3 ' Phosphat 5 ' gtg cc agc agc cgc ggt aat acg 3 ' phosphate
Das Oligo 3 kann an die Sequenz von Oligo 2 komplementär binden und blockiert somit einen Teil des Oligo2 am 5 ' -Ende (hier unterstrichen) 5 ' NH2-cqt att acc QCQ act qct qq cac AAAAAAAAAA Fluorescein 3 ' Phosphat ' gca taa tgg cgc cga cga cc gtg Die Lösung mit dUTP-AA-SS-Oligo2-Fluorescein und Oligo 3 (50 mmol/1 Tris-HCI, pH8,0) wurde auf 90°C für 1 min erhitzt und dann auf RT abgekühlt. Durch die Abkühlung binden die beiden komplementären Sequenzabschnitte aneinander unter Ausbildung eines Doppelstrangs. Beispiel 8 The Oligo 3 can bind to the sequence of Oligo 2 complementary and thus blocks a part of Oligo2 at the 5 ' end (underlined here) 5 ' NH2-cqt acc QCQ act qct qq cac AAAAAAAAA fluorescein 3 ' phosphate ' gca ta tgg cgc cga cga ct gtg The solution with dUTP-AA-SS-oligo2-fluorescein and oligo 3 (50 mmol / l Tris-HCl, pH8.0) was heated to 90 ° C for 1 min and then cooled to RT. By cooling, the two complementary sequence sections bind to each other to form a double strand. Example 8
Spaltung einer spaltbaren Gruppe des Linkers und gegebenenfalls Blockade der freien SH-Gruppe  Cleavage of a cleavable group of the linker and optionally blockade of the free SH group
Für eine reduktive Spaltung einer Disulfid-Bindung können beispielsweise folgende Bedingungen verwendet werden : TCEP 10 bis 50 mmol/1 pH 6.0 bis 8.0 bei RT für ca. 5 bis 30 min. Eine solche Spaltung kann beispielsweise bei spaltbaren Nukleotid- Konjugaten mit einem Linker mit Dithiobispropion-Säure verwendet werden.  For a reductive cleavage of a disulfide bond, for example, the following conditions can be used: TCEP 10 to 50 mmol / l pH 6.0 to 8.0 at RT for about 5 to 30 min. Such cleavage can be used, for example, in cleavable nucleotide conjugates with a dithiobispropionic acid-based linker.
Für eine oxidative Spaltung von Diol-haltiven Linkern (z.B.Tartrat-Linker) können beispielsweise folgende Bedingungen verwendet werden : KCI04 5 bis 50 mmol/1 pH 6.0 bis 8.0 bei RT für ca. 5 bis 20 min For example, for oxidative cleavage of diol-containing linkers (e.g., tartrate linkers), the following conditions can be used: KClO 4 5 to 50 mmol / l pH 6.0 to 8.0 at RT for ca. 5 to 20 min
Blockade einer freien SH-Gruppe nach der Spaltung einer Disulfid-Bindung kann beispielsweise mit Jodacetamid erfolgen : 0,1 bis 0,5 mol/l Jodacetamid in Puffer pH 7,0 bis 8.0 für ca. 5 - 15 min bei RT. Blockage of a free SH group after the cleavage of a disulfide bond can be carried out, for example, with iodoacetamide: 0.1 to 0.5 mol / l of iodoacetamide in buffer pH 7.0 to 8.0 for about 5 to 15 min at RT.
Enzymatischer Einbau von Nukleotid-Konjugaten: Beispiel 9 Enzymatic Incorporation of Nucleotide Conjugates: Example 9
Die enzymatischen Einbaureaktionen werden bei üblichen Bedingungen für die Einbaureaktionen von modifizierten Nuk-Makromolekülen durchgeführt. Beispielsweise können folgende Bedingnugen eingesetzt werden:  The enzymatic incorporation reactions are carried out under customary conditions for the incorporation reactions of modified nuc-macromolecules. For example, the following conditions can be used:
Puffer-Lösungen : Buffer solutions:
Tris-HCI (20 mM - 100 mM), pH 7-8,5  Tris-HCl (20 mM - 100 mM), pH 7-8.5
MgCI2 z.B. 1,5 bis 10 mM (oder auch Mn 0,2 - 1 mM) MgCl 2 eg 1.5 to 10 mM (or also Mn 0.2-1 mM)
NaCI 10 bis 100 mM  NaCl 10 to 100 mM
Glycerin ca. 10 - 30 %  Glycerine about 10 - 30%
DMSO ca. 5 bis 30% • Primer (Oligonukleotide) mit einer Länge von 17 bis 50 Nukleotide, die eine ausreichende spezifische Hybridisierung an die Matrize aufweisen. DMSO about 5 to 30% 17-50 nucleotides in length of primers (oligonucleotides) that have sufficient specific hybridization to the template.
Konzentration ca. von 0,02 bis 2 μΜ  Concentration approx. 0.02 to 2 μΜ
• Matrizen (z.B. Oligonukleotide)  Matrices (e.g., oligonucleotides)
· DNA-Polymerasen (Klenow-Fragment exo minus, Vent exo minus Polymerase). · DNA polymerases (Klenow fragment exo minus, Vent exo minus polymerase).
• Nukleotid-Konjugate werden vorzugsweise in Konzentrationen zwischen 0,1 μΜ bis 10 μΜ verwendet. • Nucleotide conjugates are preferably used in concentrations between 0.1 μΜ to 10 μΜ.
Enzymatische Reaktionen wurden für ca. 2 bis 60 min bei Temperaturen zwischen RT bis 60°C durchgeführt. Enzymatic reactions were carried out for about 2 to 60 minutes at temperatures between RT and 60 ° C.
Beispiel 9 Example 9
Materialien: Materials:
Reaktionsuffer 1 : 50 mmol/1 Tris HCl, pH 8,5; 50 mmol/1 NaCI, 5 mmol/1 MgCI2, Glycerin 10 % v/v Reaction buffer 1: 50 mmol / l Tris HCl, pH 8.5; 50 mmol / 1 NaCl, 5 mmol / 1 MgCl 2 , glycerol 10% v / v
Reaktionsuffer 2: 10 mmol/1 Tris HCl, pH 8,5; 10 mmol/1 NaCI, 1 mmol/1 MgCI2, Glycerin 2 %, DMSO 20% v/v Reaction buffer 2: 10 mmol / l Tris HCl, pH 8.5; 10 mmol / l NaCl, 1 mmol / l MgCl 2 , glycerol 2%, DMSO 20% v / v
Beispiel 10 Example 10
Herstellung eines modifizierten Klenow-Fragments Exo minus der DNA-Polymerase I der E. coli (im Weiteren bezeichnet als modifiziertes Klenow Exo minus). In einer Ausführungsform der Modifikation wurden zu 70 μΙ einer Puffer-Lösung mit Klenow- Fragment Exo-minus der DNA-Polymerase (New England Biolabs) 100 μΙ einer Puffer- Lösung (200 mmol/1 Tris-HCI-Puffer, pH 9.0, 60% Glycerin) zugegeben, der pH-Wert der Lösung mit Polymerase betrugt nun 8,5-9.0. Anschließend wurden 20 μΙ einer 1 mol/l wässrigen Iod-Acetamid-Lösung zugegeben. Die Reaktion wurde 5 min bei RT durchgeführt. Auf diese Weise erfolgte eine selektive Modifizierung der Polymerase an der SH-Gruppe des Cysteins und das DTT im Hersteller-Puffer wurde inaktiviert. Die modifizierte Polymerase wurde bei -20°C aufbewahrt. Preparation of a modified Klenow fragment Exo minus the DNA polymerase I of E. coli (hereinafter referred to as modified Klenow exo minus). In one embodiment of the modification, 100 μl of a buffer solution (200 mmol / l Tris-HCl buffer, pH 9.0, 60 .mu.) was added to 70 .mu.l of a buffer solution containing Klenow fragment exo-minus DNA polymerase (New England Biolabs) % Glycerol) was added, the pH of the solution with polymerase was now 8.5-9.0. Subsequently, 20 μΙ were added to a 1 mol / l aqueous iodine-acetamide solution. The reaction was carried out at RT for 5 min. In this way, a selective modification of the polymerase on the SH group of the cysteine was carried out and the DTT in the producer buffer was inactivated. The modified polymerase was stored at -20 ° C.
Beispiel 11 Example 11
Enzymatischer Einbau und Terminierung der Synthese durch dUTP-AA-SS- Oligol, dATP-PA-SS-Oligol, dGTP-PA-SS-Oligol, dCTP-PA-SS-Oligol.  Enzymatic incorporation and termination of the synthesis by dUTP-AA-SS-Oligol, dATP-PA-SS-Oligol, dGTP-PA-SS-Oligol, dCTP-PA-SS-Oligol.
Reversible Terminierung der Synthese an einem homopolymeren Abschnitt einer Sequenz stellt eine besondere Herausforderung für die Sequenzierung-durch-Synthese Verfahren dar. Die Fähigkeit der Nukleotid-Analoga, enzymatische Reaktion nach ihrem Einbau reversibel zu blockieren, wird am Beispiel mit Matrizen mit homopolymeren Sequenzabschnitten demonstriert. Nukleotid-Konjugate wurden in 2 und 0,2 pmol/l Konzentration eingesetzt (wie in Legende beschrieben). Es wurde modifiziertes Klenow Exo minus Fragment verwendet (1 Unit/ 20 μΙ Ansatz). Als Primer wurde T7-19-Cy verwendet ( 1 μητιοΙ/Ι). Als Matrizen wurden Oligonukleotide verwendet ( 1 μηηοΙ/Ι), welche einen einmaligen oder auch mehrfachen Einbau von entsprechend komplementären Nukleotid-Konjugaten zulassen. Bei einigen Rektionen wurden natürliche Substrate (dNTPs) in die Reaktion zugegeben (200 μητιοΙ/Ι), siehe Legende. Reversible termination of the synthesis at a homopolymeric portion of a sequence presents a particular challenge to the sequencing-by-synthesis methods. The ability of the nucleotide analogs to reversibly block enzymatic reaction after their incorporation is demonstrated using templates with homopolymeric sequence portions. Nucleotide conjugates were used at 2 and 0.2 pmol / L concentration (as described in legend). Modified Klenow Exo minus fragment was used (1 unit / 20 μΙ approach). As a primer T7-19-Cy was used (1 μ η τιοΙ / Ι). As templates oligonucleotides were used (1 μηηοΙ / Ι), which allow a single or multiple incorporation of correspondingly complementary nucleotide conjugates. For some reactions, natural substrates (dNTPs) were added to the reaction (200 μητιοΙ / Ι), see legend.
Die Reaktion verlief im Reaktioinspuffer 1 bei 37°C für 1 hr. Anschließend wurde das Reaktionsgemisch auf ein 10% Polyacrylamid-Gel aufgetragen und Reaktionsprodukte bei 150 V (70°C) getrennt. Die Visualisierung erfolgte mittels einer Gel- Dokumentations-Anlage mit UV-Lichtquelle.  The reaction proceeded in Reactioin Buffer 1 at 37 ° C for 1 hr. Subsequently, the reaction mixture was applied to a 10% polyacrylamide gel and reaction products separated at 150 V (70 ° C). The visualization was carried out by means of a gel documentation system with UV light source.
Legende: Legend:
Lane 1 : dATP-PA-SS-Oligol (2pmol/l) , Matrize 4  Lane 1: dATP-PA-SS-Oligol (2 pmol / L), template 4
Lane 2 : dATP-PA-SS-Oligol (0,2μηιοΙ/Ι) , Matrize 4 Lane 2: dATP-PA-SS-oligol (0.2μηιοΙ / Ι), template 4
Lane 3: dATP-PA-SS-Oligol (2pmol/l) , Matrize 5 Lane 3: dATP-PA-SS-Oligol (2 pmol / L), template 5
Lane 4: dATP-PA-SS-Oligol (0,2μιτιοΙ/Ι) , Matrize 5 Lane 4: dATP-PA-SS-Oligol (0.2μιτιοΙ / Ι), template 5
Lane 5 : dCTP-PA-SS-Oligol (2pmol/l) , Matrize 6 Lane 5: dCTP-PA-SS-Oligol (2 pmol / L), template 6
Lane 6: dCTP-PA-SS-Oligol (0,2pmol/l) , Matrize 6 Lane 6: dCTP-PA-SS-Oligol (0.2pmol / L), template 6
Lane 7 : dCTP-PA-SS-Oligol (2pmol/l) , Matrize 7 Lane 7: dCTP-PA-SS-Oligol (2 pmol / L), template 7
Lane 8: dCTP-PA-SS-Oligol (0,2μηιοΙ/Ι) , Matrize 7 Lane 8: dCTP-PA-SS-Oligol (0.2μηιοΙ / Ι), template 7
Lane 9: dGTP-PA-SS-Oligol (2pmol/l) , Matrize 5, dATP, dCTP Lane 9: dGTP-PA-SS-Oligol (2 pmol / L), template 5, dATP, dCTP
Lane 10 : dGTP-PA-SS-Oligol (0,2μηιοΙ/Ι) , Matrize 5, dATP, dCTP Lane 10: dGTP-PA-SS-Oligol (0.2μηιοΙ / Ι), template 5, dATP, dCTP
Lane 11 : dGTP-PA-SS-Oligol (2μιηοΙ/Ι) , Matrize 8, dATP Lane 11: dGTP-PA-SS-Oligol (2μιηοΙ / Ι), template 8, dATP
Lane 12 : dGTP-PA-SS-Oligol (0,2μηηοΙ/Ι) , Matrize 8, dATP Lane 12: dGTP-PA-SS-Oligol (0.2μηηοΙ / Ι), template 8, dATP
Lane 13 : dUTP-AA-SS-Oligol (2μηηοΙ/Ι) , Matrize 2 Lane 13: dUTP-AA-SS-Oligol (2μηηοΙ / Ι), template 2
Lane 14: dUTP-AA-SS-Oligol (0,2pmol/l) , Matrize 2 Lane 14: dUTP-AA-SS-Oligol (0.2pmol / L), template 2
Lane 15 : dUTP-AA-SS-Oligol (2μηιοΙ/Ι) , Matrize 3 Lane 15: dUTP-AA-SS-Oligol (2μηιοΙ / Ι), template 3
Die hier verwendeten Nukleotid-Analoga haben freie 3 ' -OH-Gruppen. An diese Gruppen können potenziell weitere Nukleotide durch die Polymerase gekoppelt werden. In Fig. 13 sieht man einen Einbau von nur einem Nukleotid-Konjugat an allen verwendeten Matrizen (Pfeil A). Pfeil (B) zeigt die Position vom markierten Primer an. dATP-PA-SS-Oligol wird an Matrize 4 (Homopolymer-Abschnitt) nur einmal eingebaut (Lane 1). Der Einbau eines dATP-PA-SS-Oligol führte zur Blockade des Einbaus eines weiteren dATP-PA-SS-Oligol an der benachbarten, zur Matrize komplementären Position (N + l). Als Kontrolle diente Einbaureaktion an Matrize 5. In dieser Reaktion konnte nur ein dATP-PA-SS-Oligol eingebaut werden (Lane 3), da die Matrize keine weiteren komplementären Basen zum Einbau von dATP-PA-SS-Oligol bietet. Ebenfalls als Kontrolle diente der Einbau von dATP-PA-SS-Oligol an Matrize 4 und 5 bei limitierenden Substrat-Konzentrationen (0,2 mol/l dATP-PA-SS-Oligol vs. 1 pmol/l T7-19-Cy3 und Matrize) (Lane 2 und 4). dCTP-PA-SS-Oligol wird an Matrize 6 (Homopolymer-Abschnitt) nur einmal eingebaut (Lane 5). Der Einbau eines dCTP-PA-SS-Oligol führte zur Blockade des Einbaus eines weiteren dCTP-PA-SS-Oligol an der benachbarten Position. Als Kontrolle diente Einbaureaktion an Matrize 7. In dieser Reaktion konnte nur ein dCTP-PA-SS-Oligol eingebaut werden (Lane 7), da die Matrize keine weiteren komplementären Basen zum Einbau von dCTP-PA-SS-Oligol bietet. Ebenfalls als Kontrolle diente der Einbau von dCTP-PA-SS-Oligol an Matrize 6 und 7 bei limitierenden Substrat-Konzentrationen (0,2 pmol/l dCTP-PA-SS-Oligol vs. 1 μηιοΙ/Ι T7-19-Cy3 und Matrize) (Lane 6 und 8). dGTP-PA-SS-Oligol wird an Matrize 5 und 8 nur einmal eingebaut (Lane 9 und 11). Matrize 5 enthält die Sequenz -CGC- und Matrize 8 enthält die Sequenz -CTC-. Beide Matrizensequenzen enhalten somit nicht benachbarte Positionen für den Einbau von dG-Analoga. Der Einbau eines dGTP-PA-SS-Oligol führte dennoch zur Blockade des Einbaus eines weiteren dGTP-PA-SS-Oligol an Position N+2. Als Kontrolle diente der Einbau von dGTP-PA-SS-Oligol an Matrize 5 und 8 bei limitierenden Substrat- Konzentrationen (0,2 pmol/l dGTP-PA-SS-Oligol vs. 1 pmol/l T7-19-Cy3 und Matrize) (Lane 10 und 12). dUTP-AA-SS-Oligol wird an Matrize 2 (Homopolymer-Abschnitt) nur einmal eingebaut (Lane 13). Der Einbau eines dUTP-AA-SS-Oligol führte zur Blockade des Einbaus eines weiteren dUTP-AA-SS-Oligol an der benachbarten Position. Als Kontrolle diente Einbaureaktion an Matrize 3. In dieser Reaktion konnte nur ein dUTP-AA-SS-Oligol eingebaut werden (Lane 15), da die Matrize keine weiteren komplementären Basen zum Einbau von dUTP-AA-SS-Oligol bietet. Ebenfalls als Kontrolle diente der Einbau von dUTP-AA-SS-Oligol an Matrize 2 bei limitierenden Substrat-Konzentrationen (0,2 mol/l dUTP-AA-SS-Oligol vs. 1 pmol/l T7-19-Cy3 und Matrize) (Lane 14). Man sieht, dass an homopolymeren Abschnitten der Matrize nur ein Nukleotid- Konjugat eingebaut wurde, der Einbau von weiteren gleichen Nukleotid-Konjugaten wurde gehemmt. Diese Hemmung erstreckt sich auf die benachbarte Position (N + l) und sogar auf die weiterliegende Positionen (N+2). Die verwendeten Analoga können somit als Terminatoren der Synthese auftreten. Dank einer Disulfid-Brücke im Linker der Nukleotid-Konjugate können Oligonukleotide von den eingebauten Nuk- Kompontenen abgespalten werden. The nucleotide analogs used herein have free 3 'OH groups. Potentially, additional nucleotides can be coupled to these groups by the polymerase. FIG. 13 shows incorporation of only one nucleotide conjugate on all matrices used (arrow A). Arrow (B) indicates the position of the labeled primer. dATP-PA-SS-Oligol is incorporated only once on template 4 (homopolymer section) (Lane 1). The incorporation of a dATP-PA-SS-oligol led to the blockage of the incorporation of another dATP-PA-SS-oligol at the adjacent, complementary to the template Position (N + 1). The incorporation reaction was carried out on template 5 in this reaction. In this reaction, only one dATP-PA-SS-oligol was incorporated (Lane 3), since the template offers no further complementary bases for the incorporation of dATP-PA-SS-oligol. The incorporation of dATP-PA-SS-oligol into template 4 and 5 was also used as control at limiting substrate concentrations (0.2 mol / l dATP-PA-SS-oligol vs. 1 pmol / l T7-19-Cy3 and Matrix) (Lane 2 and 4). dCTP-PA-SS-Oligol is incorporated only once on template 6 (homopolymer section) (Lane 5). The incorporation of a dCTP-PA-SS-oligol resulted in the blockade of the incorporation of another dCTP-PA-SS-oligol at the adjacent position. In this reaction, only one dCTP-PA-SS-oligol was incorporated (Lane 7), since the template offers no further complementary bases for the incorporation of dCTP-PA-SS-oligol. The incorporation of dCTP-PA-SS-oligol into template 6 and 7 at limiting substrate concentrations (0.2 pmol / l dCTP-PA-SS-oligol vs. 1 μηιοΙ / ΙT7-19-Cy3) was also used as control Matrix) (Lane 6 and 8). dGTP-PA-SS-Oligol is only incorporated once on template 5 and 8 (lanes 9 and 11). Template 5 contains the sequence -CGC- and template 8 contains the sequence -CTC-. Both template sequences thus do not contain adjacent positions for the incorporation of dG analogs. However, incorporation of a dGTP-PA-SS-oligol blocked the incorporation of another dGTP-PA-SS-oligol at position N + 2. The incorporation of dGTP-PA-SS-oligol into template 5 and 8 served as control at limiting substrate concentrations (0.2 pmol / l dGTP-PA-SS-oligol vs. 1 pmol / l T7-19-Cy3 and template ) (Lanes 10 and 12). dUTP-AA-SS-Oligol is incorporated only once on template 2 (homopolymer section) (Lane 13). The incorporation of a dUTP-AA-SS oligol resulted in the blockade of the incorporation of another dUTP-AA-SS oligol at the adjacent position. In this reaction, only one dUTP-AA-SS-oligol was incorporated (Lane 15), since the template offers no further complementary bases for the incorporation of dUTP-AA-SS-oligol. The incorporation of dUTP-AA-SS-oligol into template 2 was also used as control at limiting substrate concentrations (0.2 mol / l dUTP-AA-SS-oligol vs. 1 pmol / l T7-19-Cy3 and template). (Lane 14). It can be seen that only one nucleotide conjugate was incorporated at homopolymeric sections of the template, the incorporation of further identical nucleotide conjugates was inhibited. This inhibition extends to the adjacent position (N + 1) and even to the wider positions (N + 2). The analogs used can thus occur as terminators of the synthesis. Thanks to a disulfide bridge in the linker of the nucleotide conjugates, oligonucleotides can be cleaved off the incorporated Nuk components.
Nach der Abspaltung des Oligonukleotid-Anteils vom bereits eingebauten Nukleotid- Konjugat (n) und Blockade der freien Gruppe mit Jodacetamid kann nun ein weiteres Nukleotid-Konjugat (n + 1) eingebaut werden.  After cleavage of the oligonucleotide portion of the already incorporated nucleotide conjugate (s) and blocking of the free group with iodoacetamide now another nucleotide conjugate (n + 1) can be incorporated.
In einer vorteilhaften Ausführungsform werden alle vier Arten der Nukleotid-Konjugate (z.B. dATP-Konjugate, dCTP-Konjugate, dGTP-Konjugate, dUTP-Konjugate) in einer Reaktion gleichzeitig eingesetzt. Vorzugsweise werden keine natürlichen Nukleotide (z.B. dNTPs) in die Reaktion zugegeben.  In an advantageous embodiment, all four types of nucleotide conjugates (e.g., dATP conjugates, dCTP conjugates, dGTP conjugates, dUTP conjugates) are used simultaneously in one reaction. Preferably, no natural nucleotides (e.g., dNTPs) are added to the reaction.
Die Matrizen können an einer festen Phase fixiert sein. Eine solche Reaktion verläut oft in Zyklen, so dass die Matrize zwischen einzelnen Reaktionsschritten gewaschen werden kann. Anstelle von Dithiobis-propionsäure-Linker können auch andere Linker mit ähnlicher Länge, z.B. Tartrat- Linker, oder auch längere Linker, z.B. PEG(9) verwendet werden. Solche Nukleotid-Konjugate weisen ebenfalls terminierende bzw. reversibel terminierende Eigenschaften auf. Beispiel 12  The matrices can be fixed to a solid phase. Such a reaction often results in cycles, so that the template can be washed between individual reaction steps. Instead of dithiobis-propionic acid linkers, other linkers of similar length, e.g. Tartrate linkers, or longer linkers, e.g. PEG (9) can be used. Such nucleotide conjugates also have terminating or reversibly terminating properties. Example 12
Einbau von Nukleotid-Konjugaten mit einem doppelsträngigen Sequenzabschnitt: dUTP-AA-SS-Oligo 4-Fluorescein (Oligonukleotid enthält selbstkomplementären Sequenzen vom Typ„Molecular Beacon") und dUTP- AA-SS-Oligo 2-Fluorescein/Oligo 3.  Incorporation of nucleotide conjugates with a double-stranded sequence segment: dUTP-AA-SS-oligo 4-fluorescein (oligonucleotide contains self-complementary sequences of the type "molecular beacon") and dUTP-AA-SS-oligo 2-fluorescein / oligo 3.
Nukleotid-Konjugate wurden in jeweils 1 μιηοΙ/Ι Konzentration eingesetzt. Es wurde modifiziertes Klenow Exo minus verwendet ( 1 Unit / 20 μΙ Ansatz). Als Primer wurde T7-19-Cy verwendet (1 oder 0,2 pmol/l). Als Matrizen wurden Oligonukleotide verwendet (1 oder 0,2 pmol/l), welche einen einmaligen (Matrize 3) oder mehrfachen (Matrize 2) Einbau von entsprechend komplementären Nukleotid-Konjugaten zulassen. Die Reaktion verlief im Reaktioinspuffer 1 oder Reaktionspuffer 2 bei 37°C für 1 hr. Anschließend wurde das Reaktionsgemisch mittels Capillar-Elektrophorese analysiert (ABI 310 Kapillar-Sequenzer, POP6 Gel-Matrix). Elektrophorese wurde bei 12 kV (50°C) durchgeführt. Signale von Cy3-Farbstoff als auch von Fluorescein-Farbstoff wurden detekiert. Die CE-Elektrohorogramme sind in Fig. 14 -21 dargestellt. Nucleotide conjugates were used in each case 1 μιηοΙ / Ι concentration. Modified Klenow Exo minus was used (1 unit / 20 μΙ approach). The primer used was T7-19-Cy (1 or 0.2 pmol / l). As templates oligonucleotides were used (1 or 0.2 pmol / l), which allow a single (template 3) or multiple (template 2) incorporation of correspondingly complementary nucleotide conjugates. The reaction proceeded in Reactioin Buffer 1 or Reaction Buffer 2 at 37 ° C for 1 hr. Subsequently, the reaction mixture was analyzed by capillary electrophoresis (ABI 310 capillary sequencer, POP6 gel matrix). Electrophoresis was performed at 12 kV (50 ° C). Signals of Cy3 dye as well as fluorescein dye were detected. The CE electrohormograms are shown in Figs. 14-21.
Fig. 14 nur T7-19-Cy3 Primer (Kontrolle) Fig. 14 only T7-19-Cy3 primer (control)
Fig. 15 nur dUTP-AA-SS-Oligo 2-Fluorescein/Oligo 3 Fig. 16 nur dUTP-AA-SS-Oligo 4-Fluorescein Fig. 15 only dUTP-AA-SS-oligo 2-fluorescein / oligo 3 Fig. 16 only dUTP-AA-SS-oligo-4-fluorescein
Fig. 17 Bl : dUTP-AA-SS-Oligo 4-Fluorescein, modifiziertes Klenow Exo minus, Matrize 2 (1 mol/l), Primer T7-19-Cy3 ( 1 pmol/l), Reaktionspuffer 1  Fig. 17 Bl: dUTP-AA-SS-oligo 4-fluorescein, modified Klenow exo minus, template 2 (1 mol / l), primer T7-19-Cy3 (1 pmol / l), reaction buffer 1
Fig. 17 B3 : dUTP-AA-SS-Oligo 4-Fluorescein, modifiziertes Klenow Exo minus, Matrize 2 (0,2 μηιοΙ/Ι), Primer T7-19-Cy3 (0,2 pmol/l), Reaktionspuffer 1 Fig. 17 B3: dUTP-AA-SS-oligo 4-fluorescein, modified Klenow exo minus, template 2 (0.2 μηιοΙ / Ι), primer T7-19-Cy3 (0.2 pmol / l), reaction buffer 1
Fig. 18 B5: dUTP-AA-SS-Oligo 4-Fluorescein, modifiziertes Klenow Exo minus, Matrize 2 (0,2 μηηοΙ/Ι), Primer T7-19-Cy3 (0,2 μηηοΙ/Ι), Reaktionspuffer 2  Fig. 18 B5: dUTP-AA-SS-oligo 4-fluorescein, modified Klenow Exo minus, template 2 (0.2 μηηοΙ / Ι), primer T7-19-Cy3 (0.2 μηηοΙ / Ι), reaction buffer 2
Fig. 18 B6: dUTP-AA-SS-Oligo 4-Fluorescein, modifiziertes Klenow Exo minus, Matrize 3 (0,2 μηηοΙ/Ι), Primer T7-19-Cy3 (0,2 μηηοΙ/Ι), Reaktionspuffer 2 Fig. 18 B6: dUTP-AA-SS-oligo 4-fluorescein, modified Klenow exo minus, template 3 (0.2 μηηοΙ / Ι), primer T7-19-Cy3 (0.2 μηηοΙ / Ι), reaction buffer 2
Fig. 19 Cl : dUTP-AA-SS-Oligo 2-Fluorescein/Oligo 3, modifiziertes Klenow Exo minus, Matrize 2 (1 μιηοΙ/Ι), Primer T7-19-Cy3 ( 1 μηιοΙ/Ι), Reaktionspuffer 1 19 Cl: dUTP-AA-SS-oligo 2-fluorescein / oligo 3, modified Klenow exo minus, template 2 (1 μιηοΙ / Ι), primer T7-19-Cy3 (1 μηιοΙ / Ι), reaction buffer 1
Fig. 20 C3 : dUTP-AA-SS-Oligo 2-Fluorescein/Oligo 3, modifiziertes Klenow Exo minus, Matrize 2 (0,2 μιηοΙ/Ι), Primer T7-19-Cy3 (0,2 μιηοΙ/Ι), Reaktionspuffer 1 Fig. 21 C5 : dUTP-AA-SS-Oligo 2-Fluorescein/Oligo 3, modifiziertes Klenow Exo minus, Matrize 2 (0,2 μιηοΙ/Ι), Primer T7-19-Cy3 (0,2 pmol/l), Reaktionspuffer 2 20 C3: dUTP-AA-SS-oligo 2-fluorescein / oligo 3, modified Klenow exo minus, template 2 (0.2 μιηοΙ / Ι), primer T7-19-Cy3 (0.2 μιηοΙ / Ι), Reaction buffer 1 Fig. 21 C5: dUTP-AA-SS-oligo 2-fluorescein / oligo 3, modified Klenow exo minus, template 2 (0.2 μιηοΙ / Ι), primer T7-19-Cy3 (0.2 pmol / l ), Reaction buffer 2
Die hier verwendeten Nukleotid-Analoga haben freie 3 ' -OH-Gruppen. An diese Gruppen können potenziell weitere Nukleotide durch die Polymerase gekoppelt werden. Pfeil (A) zeigt die Position vom markierten Primer und nicht eingebauten Nukleotid-Konjugaten an. Man sieht, dass die beiden verwendeten Nukleotid- Konjugate an einer Homopolymer-Strecke (Matrize 2) nur einmal eingebaut werden (Pfeil B). Kontrollen : Primer und Nukleotid-Konjugate alleine, einmaliger Einbau von dUTP-AA-SS-Oligo 4-Fluorescein an Matrize 3, Beispiel 13 The nucleotide analogs used herein have free 3 'OH groups. Potentially, additional nucleotides can be coupled to these groups by the polymerase. Arrow (A) indicates the position of the labeled primer and unincorporated nucleotide conjugates. It can be seen that the two nucleotide conjugates used are incorporated only once on a homopolymer stretch (template 2) (arrow B). Controls: primer and nucleotide conjugates alone, single incorporation of dUTP-AA-SS-oligo 4-fluorescein on template 3, example 13
Zusammensetzung von Kit für Verwendung von Nukleotid-Konjugaten  Composition of kit for use of nucleotide conjugates
Generell, ein oder mehrere Kits schließen Komponenten (z.B. Einzelsubstanzen, Kompositionen, Reaktionsgemische) ein, die für die Durchführung von enzymatischen Einbaureaktionen mit erfindungsgemäßen modifizierten Nuk-Makromolekülen notwendig sind.  Generally, one or more kits include components (e.g., individual substances, compositions, reaction mixtures) necessary for carrying out enzymatic incorporation reactions with modified nuc-macromolecules of the invention.
Die Zusammensetzung der Kits kann nach Anwendung variieren, wobei die Anwendugen können von einfacher Primer-Extensionsreaktion bis zu zyklischen Sequenzierung auf Einzelmolekülebene reichen.  The composition of the kits may vary upon application, with applications ranging from simple primer extension reaction to single-molecule cyclic sequencing.
Beispielsweise Kits, die für zyklische Sequenzierung verwendet werden, können Polymerasen, modifizierte IMuk-Makromoleküle sowie Lösungen für die zyklischen Schritte einschließen.  For example, kits used for cyclic sequencing may include polymerases, modified IMuk macromolecules, as well as solutions to the cyclic steps.
Die Kits können wahlweise positive und / oder negative Kontrollen einschließen, Anleitungen zur Durchführung von Verfahren. Die Kit-Komponenten sind üblicherweise in handelsüblichen Reaktionsgefäßen bereitgestellt, wobei das Volumen der Gefäße zwischen 0,2 ml und 1 I variieren kann. Es können auch Gefäßarrays, z.B. Mikrotiter-Platten mit Komponenten beladen sein, was eine automatische Zufuhr von Reagentien ermöglicht. The kits may optionally include positive and / or negative controls, instructions for performing procedures. The kit components are usually provided in commercially available reaction vessels, wherein the volume of the vessels can vary between 0.2 ml and 1 l. Vessel arrays, eg microtiter plates, can also be loaded with components, which allows automatic supply of reagents.
Ein Kit kann folgende Komponenten einschließen : A kit can include the following components:
o Eine oder mehrere Polymerasen, z.B. modifiziertes Klenow Fragment exo minus  One or more polymerases, e.g. modified Klenow fragment exo minus
• Eine oder mehrere Arten bzw. eine oder mehrere Populationen von Nukleotid- Konjugaten, die als Säure oder als Salze vorliegen können (beisielsweise Natrium, Kalium, Ammonium oder Litium können als Ionen verwendet werden). Die Nukleotid-Konjugate können in trockender Form oder in Form einer Lösung bereitgestellt werden, z.B. im Wasser oder in einem Puffer, z.B. Tris-HCI, HEPES, Borat, Phosphat, Acetat, oder in einer Aufbewahrungslösung, die folgende Komponenten einzeln oder in Kombination einschließen kann: One or more species or one or more populations of nucleotide conjugates which may be present as acid or as salts (for example, sodium, potassium, ammonium or lithium may be used as ions). The nucleotide conjugates may be provided in dry form or in the form of a solution, e.g. in water or in a buffer, e.g. Tris-HCl, HEPES, borate, phosphate, acetate, or in a storage solution which may include the following components, singly or in combination:
o Puffer Tris-HCI, HEPES, Borat, Phosphat, Acetat (in Konzentration die beispielsweise zwischen 10 mM und 200 mM liegt)  o buffer Tris-HCl, HEPES, borate, phosphate, acetate (in concentration, for example, between 10 mM and 200 mM)
o Salze, z.B. NaCI, KCl, NH4CI, MgCI2,  o salts, e.g. NaCl, KCl, NH 4 Cl, MgCl 2,
o PEG oder anderes inertes Polymer, z.B. Mowiol in Konzentration von 1 bis 20% (w/v)  o PEG or other inert polymer, e.g. Mowiol in concentration from 1 to 20% (w / v)
o Glycerin in Konzentration zwischen 1% und 50%  o Glycerol in concentration between 1% and 50%
o Marker oder Marker-Einheiten von modifizierten Nuk-Makromolekülen, insbesondere in den Ausführungsformen, in denen zwischen Linker und Marker oder Marker und Kore-Komponente affine Kopplung besteht.  Markers or marker units of modified nuc macromolecules, in particular in the embodiments in which there is affine coupling between linker and marker or marker and Kore component.
Buffer-Kompositionen für enzymatische Reaktion, Spaltung, Blockade, Detektion, Waschschritte: Buffer compositions for enzymatic reaction, cleavage, blockade, detection, washing steps:
o Spaltungsreagentien, bereitgestellt z.B. als Konzentrierte gepufferte Lösung. Z.B. DTT oder TCEP in Ausführungsformen, in denen Nukleotid- Konjugate einen Linker mit einer spaltbaren Disulfid-Brücke einschließen. o Modifizierende Reagentien bereitgestellt z.B. als Konzentrierte gepufferte Lösung. Z.B. Iodacetamid oder Iodacetat für Ausführungsformen, in denen der Linker eine Mercaptogruppe nach der Spaltung hat. o Detektionsreagentien, z.B. markierte Oligonukleotide, die an Nukleotid- Konjugate hybridisiert werden können. Beispiele von Sequenzen: Cleavage reagents provided, for example, as a concentrated buffered solution. For example, DTT or TCEP in embodiments in which nucleotide conjugates include a linker with a cleavable disulfide bridge. o Modifying reagents provided eg as Concentrated Buffered Solution. For example, iodoacetamide or iodoacetate for embodiments in which the linker has a mercapto group after cleavage. o Detektionsreagentien, eg labeled oligonucleotides that can be hybridized to nucleotide conjugates. Examples of sequences:
Primer primer
Primer T7-19-Cy3 : 5 ' -Cy3- taatacgactcactatagg Primer T7-19-Cy3 5 '-Cy3- TAATACGACTCACTATAGG
Beispiele für Oligonukleotid-Komponente der Nukleotid-Konjugate Oligo 1 Examples of Oligonucleotide Component of the Nucleotide Conjugates Oligo 1
5 ' -NH2-taatacgactcactatagg-3 ' Phosphat 5 '-NH2 TAATACGACTCACTATAGG 3' phosphate
Dieses Oligonukleotid kann beispielsweise in folgenden Kombinationen mit Nuk- Komponenten verwendet werden : This oligonucleotide can be used, for example, in the following combinations with nuc-components:
Kopplung eines PEG-Linkers an der Base:  Coupling of a PEG linker to the base:
dUTP-PEG(9)-taatacgactcactatagg Kopplung eines spaltbaren Linkers an der Base:  dUTP-PEG (9) -taatacgactcactatagg coupling of a cleavable linker to the base:
dUTP-AA-SS-taatacgactcactatagg  dUTP-AA-SS TAATACGACTCACTATAGG
Kopplung eines PEG-Linkers an Gamma-Phosphat-Gruppe: Coupling of a PEG Linker to Gamma Phosphate Group:
dUTP-ppp-PEG(9)-taatacgactcactatagg  dUTP-ppp-PEG (9) -taatacgactcactatagg
Kopplung eines spaltbaren Linkers an Gamma-Phosphat-Gruppe: Coupling of a Cleavable Linker to Gamma-Phosphate Group:
dUTP-ppp-SS-taatacgactcactatagg  dUTP-ppp-SS-TAATACGACTCACTATAGG
Oligonukleotid-Anteil kann als charakteristische Marker-Sequenz für dUTP als Marker- Komponente dienen. Für eine andere Nuk-Komponente kann eine andere charakterischtische Sequenz verwendet werden. Oligonucleotide portion can serve as a characteristic marker sequence for dUTP as marker component. For another nuc-component, another characteristic sequence may be used.
Ein Teil dieses Oligonukleotids kann als Bindungs-Abschnitt (B-Abschnitt) dienen.  A part of this oligonucleotide can serve as the binding section (B section).
Oligo- 2, Fluorescein, Oligo-2, fluorescein,
5 ' NH2-cgt att acc gcg gct gct gg cac AAAAAAAAAA 3 ' - Fluorescein 5 ' NH 2 -cgt att acc gcg gct gct gg cac AAAAAAAAA 3 ' - fluorescein
Der homopolymere Abschnitt von diesem Oligonukleotid (AAAAAAAAAA) stellt ein Beispiel für variablen Abschnitt dar. Er kann an einen Abschnitt einer anderen Nukleinsäurekette binden, der mehrere Thymidin-Reste (z.B. TTTTTT) einschließt. Unter Reaktionsbedinungen, z.B. Reaktionspuffer 1 oder 2 und Raumtemperatur oder 37°C, erfolgt nur eine lose, vorübergehende Bindung, da die Tm von AAAAAAAAAAA unter 25°C liegt. Die Sequenzspezifität ist sehr gering.  The homopolymeric portion of this oligonucleotide (AAAAAAAAAA) is an example of variable portion. It can bind to a portion of another nucleic acid chain that includes multiple thymidine residues (e.g., TTTTTT). Under reaction conditions, e.g. Reaction buffer 1 or 2 and room temperature or 37 ° C, there is only a loose, temporary binding, since the Tm of AAAAAAAAAA is below 25 ° C. The sequence specificity is very low.
Dieses Oligonukleotid kann beispielsweise in folgenden Kombinationen mit Nuk- Komponenten verwendet werden : Kopplung eines PEG-Linkers an der Base: This oligonucleotide can be used, for example, in the following combinations with nuc-components: Coupling of a PEG linker to the base:
dUTP-PEG(9)- cgt att acc gcg gct gct gg cac AAAAAAAAAA  dUTP-PEG (9) - cgt att acc gcg gct gct gg cac AAAAAAAAAA
Kopplung eines spaltbaren Linkers an der Base: Coupling of a cleavable linker to the base:
dUTP-AA-SS- cgt att acc gcg gct gct gg cac AAAAAAAAAA  dUTP-AA-SS-cgt att acc gcg gct gct gg cac AAAAAAAAAA
Kopplung eines PEG-Linkers an Gamma-Phosphat-Gruppe: Coupling of a PEG Linker to Gamma Phosphate Group:
dUTP-ppp-PEG(9)- cgt att acc gcg gct gct gg cac AAAAAAAAAA  dUTP-ppp-PEG (9) - cgt att acc gcg gct gct gg cac AAAAAAAAAA
Kopplung eines spaltbaren Linkers an Gamma-Phosphat-Gruppe: Coupling of a Cleavable Linker to Gamma-Phosphate Group:
dUTP-ppp-SS- cgt att acc gcg gct gct gg cac AAAAAAAAAA  dUTP-ppp-SS-cgt att acc gcg gct gct gg cac AAAAAAAAAA
Oligo-3, Oligo 3,
5 ' gtg cc agc agc cgc ggt aat acg 3 ' Phosphat 5 ' gtg cc agc agc cgc ggt aat acg 3 ' phosphate
Dieses Oligonukleotid kann an ein Sequenzfragment von Oligo 2 sequenzspezifisch binden. Die Tm von diesem Oligonukleotid liegt bei ca. 70°C (gemessen in Reaktionspuffer 1). Nach einer Hybridisierung an Oligo 2 bleibt dieses Oligonukleotid an Oligo 2 auch unter Reaktionbedingungen (RT oder 37°C) gebunden und kann die Interaktion zwischen dem Oligo 2 und einer weiteren, vorwiegend komplementären zu diesem Oligo2-Abschnitt Sequenz blockieren. This oligonucleotide can bind to a sequence fragment of oligo 2 sequence specific. The Tm of this oligonucleotide is about 70 ° C (measured in reaction buffer 1). After hybridization to oligo 2, this oligonucleotide will remain bound to oligo 2 under reaction conditions (RT or 37 ° C) and may block the interaction between oligo 2 and another, predominantly complementary, sequence to this oligo2 region.
Dieses Oligonukleotid kann weitere Modifikationen einschließen, z.B. Fluorescenzfarbstoffe. Bei Verwendung von Farbstoffen mit einem Anregungsspektrum wie z.B. Rhodamin kann es zwischen Fluorescein und Rhodamin zu FRET kommen, This oligonucleotide may include other modifications, e.g. Fluorescent dyes. When using dyes with an excitation spectrum, e.g. Rhodamine may be between FRF and fluorescein to FRET,
Oligo-4, Fluorescein, Oligo-4, fluorescein,
5 ' NH2-cqt att acc gcg gct gct GTAATAC AAAAA AAAAA3 ' - Fluorescein 5 ' NH2-cqt att acc gcg gct gct GTAATAC AAAAA AAAAA3 ' - Fluorescein
(Stem-Bereiche sind unterstrichen)  (Stem areas are underlined)
Dieses Oligonukleotid hat selbstkomplementäre Sequenzen (unterstrichen) und liegt unter Reaktionsbedingungen (Reaktionspuffer 1 oder 2, RT oder 37°C) vorwiegend in Form von Molecular Beacon. Die Interaktion dieses Sequenzabschnitts und einer weiteren, zu diesem Abschnitt komplementären Nukleinsäuresequenz ist dadurch blockiert oder stark reduziert. Der homopolymere Abschnitt von diesem Oligonukleotid (AAAAAAAAAA) kann an einen Abschnitt einer anderen Nukleinsäurekette binden, der mehrere Thymidin-Reste (z.B. TTTTTT oder I I I I I I I I I I ) einschließt. Unter Reaktionsbedinungen, z.B. Reaktionspuffer 1 oder 2 und Raumtemperatur oder 37°C, erfolgt nur eine lose, vorübergehende Bindung, da die Tm von AAAAAAAAAAA unter 25°C liegt. Dieses Oligonukleotid kann beispielsweise in folgenden Kombinationen mit Nuk-This oligonucleotide has self-complementary sequences (underlined) and is under reaction conditions (reaction buffer 1 or 2, RT or 37 ° C) predominantly in the form of molecular beacon. The interaction of this sequence section and a further, complementary to this section nucleic acid sequence is thereby blocked or greatly reduced. The homopolymeric portion of this oligonucleotide (AAAAAAAAAA) can bind to a portion of another nucleic acid chain that includes multiple thymidine residues (eg, TTTTTT or IIIIIIIIII). Under reaction conditions, eg reaction buffer 1 or 2 and room temperature or 37 ° C, only a loose, transient binding takes place since the Tm of AAAAAAAAAA is below 25 ° C. This oligonucleotide can be used, for example, in the following combinations with nucleated
Komponenten verwendet werden : Components are used:
Kopplung eines PEG-Linkers an der Base :  Coupling of a PEG linker to the base:
dUTP-PEG(9)- cqt att acc gcg gct qct GTAATAC AAAAA AAAAA  dUTP-PEG (9) - cqt att acc gcg gct qct GTAATAC AAAAA AAAAA
Kopplung eines spaltbaren Linkers an der Base: Coupling of a cleavable linker to the base:
dUTP-AA-SS- cot att acc gcg gct qct GTAATAC AAAAA AAAAA  dUTP-AA-SS-cot att acc gcg gct qct GTAATAC AAAAA AAAAA
Kopplung eines PEG-Linkers an Gamma-Phosphat-Gruppe: Coupling of a PEG Linker to Gamma Phosphate Group:
dUTP-ppp-PEG(9)- cqt att acc gcg gct oct GTAATAC AAAAA AAAAA  dUTP-ppp-PEG (9) - cqt att acc gcg gct oct GTAATAC AAAAA AAAAA
Kopplung eines spaltbaren Linkers an Gamma-Phosphat-Gruppe : Coupling of a Cleavable Linker to Gamma-Phosphate Group:
dUTP-ppp-SS- cqt att acc gcg gct qct GTAATAC AAAAA AAAAA  dUTP-ppp-SS-cqt att acc gcg gct qct GTAATAC AAAAA AAAAA
Komposition Oligo 5 (4096 Oligonukleotide mit einem einheitlichen Composition Oligo 5 (4096 oligonucleotides with a uniform
Sequenzabschnitt, unterstrichen, und einem variablen, randomisierten Sequence section, underlined, and a variable, randomized
Sequenzabschnitt (X) mit der Länge 6) Sequence section (X) with length 6)
5 ' NH2-(X)n-cqt att acc gcg qct ct gg cacAAAAAAAAAA-Fluorescein 5 ' NH2- (X) n-cqt att acc gcg qct ct gg cacAAAAAAAAA-fluorescein
(X) = A,C,G,T; (n)= 6 (X) = A, C, G, T; (n) = 6
Durch die Hybridisierung von Oligo 3 an die Oligonukleotide dieser Population kann ein Sequenzfragment (unterstrichen) von der Interaktion mit einzelsträngigen Nukleinsäureketten ausgeschlossen werden. Nur variabler Abschnitt (X)n (Hexamer- Abschnitt) und AAAAAAAAAA stehen für die Interaktion mit weiteren Nukleinsäureketten zur Verfügung . Da die Bindung von Hexameren an einzelsträngige Nukleinsäureketten unter angegebenen Reaktionsbedingungen (RT bis 37°C, Reaktionspuffer 1 oder 2) instabil ist, kommt es nur zu einer vorübergehenden Bindung von Nukleotid-Konjugaten an Nukleinsäuresequenzen. Wegen einer ku rzen Länge des variablen Abschnitts besitzen solche Oligonukleotide eine sehr geringe Sequenzspezifität. By hybridizing oligo 3 to the oligonucleotides of this population, a sequence fragment (underlined) can be excluded from interaction with single-stranded nucleic acid chains. Only variable section (X) n (hexamer section) and AAAAAAAAA are available for interaction with other nucleic acid chains. Since the binding of hexamers to single-stranded nucleic acid chains under specified reaction conditions (RT to 37 ° C, reaction buffer 1 or 2) is unstable, there is only a temporary binding of nucleotide conjugates to nucleic acid sequences. Because of a short length of the variable portion, such oligonucleotides have a very low sequence specificity.
Diese Komposition von Oligonukleotiden kann beispielsweise in folgenden Kombinationen mit Nuk-Komponenten verwendet werden : This composition of oligonucleotides can be used, for example, in the following combinations with nuc-components:
Kopplung eines PEG-Linkers an der Base: Coupling of a PEG linker to the base:
dUTP-PEG(9)- (X)n-cqt att acc gcg ct qct oq ca cAAAAAAA AAA Kopplung eines spaltbaren Linkers an der Base: dUTP-PEG (9) - (X) n-cqt att acc gcg ct qct oq ca cAAAAAAA AAA Coupling of a cleavable linker to the base:
dUTP-AA-SS- (X)n-cat att acc qcg qct qct qq cacAAAAAAAAAA  dUTP-AA-SS- (X) n-cat att acc qcg qct qct qq cacAAAAAAAAA
Kopplung eines PEG-Linkers an Gamma-Phosphat-Gruppe: Coupling of a PEG Linker to Gamma Phosphate Group:
dUTP-ppp-PEG(9)- (X)n-cgt att acc qcg qct qct qq cacAAAAAAAAAA  dUTP-ppp-PEG (9) - (X) n-cgt att acc qcg qct qct qq cacAAAAAAAAA
Kopplung eines spaltbaren Linkers an Gamma-Phosphat-Gruppe: Coupling of a Cleavable Linker to Gamma-Phosphate Group:
dUTP-ppp-SS- (X)n-cgt att acc qcg qct gct gg cacAAAAAAAAAA  dUTP-ppp-SS- (X) n-cgt att acc qcg qct gct gg cacAAAAAAAAA
Sequenzabschnitt (cqt att acc qcg gct qct qq cac) kann als eindeutige charakteristische Marker-Sequenz dienen, an die sequenzspezifische markierte Oligonukleotide gebunden werden können. Sequence segment (cqt att accqcg qct qct qq cac g) can serve as a unique characteristic marker sequence to which sequence-specific labeled oligonucleotides can be bound.
Komposition Oligo 6 (4096 Oligonukleotide mit einem einheitlichen Composition Oligo 6 (4096 oligonucleotides with a uniform
Sequenzabschnitt, unterstrichen, und einem Variablen Sequenzabschnitt (X) mit der Länge 6) Sequence section, underlined, and a variable sequence section (X) with length 6)
5 ' NH2- 1 l l l l l l l l l cqt att acc qcg qct qct qq cac-(X)n-Fluorescein 5 ' NH2- 1 lllllllll cqt acc qcg qct qct qq cac- (X) n-fluorescein
(X)= A,C,G,T; (n)= 6  (X) = A, C, G, T; (n) = 6
Komposition von Oligo 6 unterscheidet sich von Komposition Oligo 5 durch Anordnung von einzelnen Sequenzabschnitten. Durch die Änderung der Anordnung kann die Nuk- Komponente unterschiedlich weit von einem bestimmten Abschnitt des Oligonukleotids separiert werden. In diesem Beispiel können Nuk-Komponenten näher an die  The composition of Oligo 6 differs from Composition Oligo 5 in the arrangement of individual sequence sections. By changing the arrangement, the nuc-component can be separated differently from a certain portion of the oligonucleotide. In this example, nuk components can be closer to the
Homopolymer-Strecke (TTTTTTTTTT) gebunden werden. Diese Komposition von Oligonukleotiden kann beispielsweise in folgenden Kombinationen mit Nuk-Komponenten verwendet werden : Homopolymer stretch (TTTTTTTTT) are bound. This composition of oligonucleotides can be used, for example, in the following combinations with nuc-components:
Kopplung eines PEG-Linkers an der Base: Coupling of a PEG linker to the base:
dUTP-PEG(9)- I I I I I I I I I I cot att acc gcq gct gct gq cac-  dUTP-PEG (9) - I I I I I I I I I cot att acc gcq gct gct gq cac-
Kopplung eines spaltbaren Linkers an der Base: Coupling of a cleavable linker to the base:
dUTP-AA-SS- I 1 I I I I I I I I cqt att acc qcg gct qct qq cac-(X)n  dUTP-AA-SS- I 1 I I I I I I I I cqt att acc qcg gct qct qq cac- (X) n
Kopplung eines PEG-Linkers an Gamma-Phosphat-Gruppe: Coupling of a PEG Linker to Gamma Phosphate Group:
dUTP-ppp-PEG(9)- I I I I I I I I I I cot att acc oco qct qct qq cac-f X)n  dUTP-ppp-PEG (9) - I I I I I I I I cot att acc oco qct qct qq cac-f X) n
Kopplung eines spaltbaren Linkers an Gamma-Phosphat-Gruppe: Coupling of a Cleavable Linker to Gamma-Phosphate Group:
dUTP-ppp-SS- I I I I I I I I I l egt att acc qcg ct qct qq cac-(X)n Matrizen: dUTP-ppp-SS-IIIIIIIII gives att acc qcg ct qct qq cac- (X) n matrices:
Matrize 1 (Ml) :  Matrix 1 (ml):
5 ' GTT TTC CCA GTC ACG ACG GGAG gtg cc agc agc cgc ggt aat acg ACCA cctatagtgagtcgtatta 5 ' GTT TTC CCA GTC ACG ACG GGAG gtg cc agc agc cgc ggt aat acg ACCA cctatagtgagtcgtatta
Matrize 2 (M2) : Die 2 (M2):
5 ' AAAAAAcctatagtgagtcgtatta3 ' -Phosphat 5 ' AAAAA acctatagtgagtcgtatta3 ' phosphate
Matrize 3 (M3) : Matrix 3 (M3):
5 ' Acctatagtgagtcgtatta-3 ' -Phosphat 5 ' Acctatagtgagtcgtatta-3 ' phosphate
Matrize 4 (M4) : Matrix 4 (M4):
5 M M i cctatagtgagtcgtatta-3 ' -Phosphat Matrize 5 (M5) : 5 mM i cctatagtgagtcgtatta-3 ' -phosphate template 5 (M5):
5 ' CGCTTTGTcctatagtgagtcgtatta 5 ' CGCTTTGTcctatagtgagtcgtatta
Matrize 6 (M6) : Matrix 6 (M6):
5 'AGGGcctatagtgagtcgtatta-3 ' -Phosphat 5 ' AGGGcctatagtgagtcgtatta-3 ' -phosphate
Matrize 7 (M7) : Matrix 7 (M7):
5 'Gcctatagtgagtcgtatta-3 ' -Phosphat 5 ' gctctagtgagtcgtatta-3 ' -phosphate
Matrize 8 (M8) : Matrix 8 (M8):
5 'ACTCTcctatagtgagtcgtatta-3 ' -Phosphat 5 ' ACTCTcctatagtgagtcgtatta-3 ' phosphate
(angegeben sind Primerbindungsstelle für T7-19-Primer sowie die für Einbau von Nukleotid-Konjugaten relevante Positionen der Matrize) Alle Publikationen, Patente und Patentanmeldungen, die hier zitiert wurden, sind eingebaut in diese Anmeldung in vollem Umfang (auch wenn dies bei jeweiliger Publikation nicht expliziert genannt wurde) und unterliegen laut USPTO den Regelungen für„incorporated by reference" für alle Zwecke in den USA. Einzelne Ausführungsformen sollten zur Veranschaulichung der Erfindung dienen und können vom Fachmann weiter miteinander kombiniert werden. Die Kombinationen aus einzelnen Ausführungsformen stellen ebenfalls gegenständ der vorliegenden Erfindung dar. Legenden zu Fig (Specified primer binding site for T7-19 primer as well as the positions of the template relevant for incorporation of nucleotide conjugates) All publications, patents, and patent applications cited herein are incorporated herein in their entirety (although as may be indicated in their respective publications USPTO does not apply to "incorporated by reference" provisions for all purposes in the US Individual embodiments should serve to illustrate the invention and may be further combined with one another by those skilled in the art present invention. Legends to Fig
Fig. 1 Fig. 1
A) Schematische Darstellung von Nukleotid-Konjugaten mit einer einheitlichen Nuk- Komponente (1), einem Linker (2) und einem variablen Abschnitt des Oligonukleotids A) Schematic representation of nucleotide conjugates with a uniform nuc-component (1), a linker (2) and a variable portion of the oligonucleotide
(3) (3)
B) Schematische Darstellung von Nukleotid-Konjugaten mit einer Nuk-Komponente (1), einem Linker (2) und einem einheitlichen Oligonukleotid (4) B) Schematic representation of nucleotide conjugates with a nuc-component (1), a linker (2) and a uniform oligonucleotide (4)
C) Schematische Darstellung von Nukleotid-Konjugaten mit einer einheitlichen Nuk- Komponente (1), einem Linker (2), einem variablen Abschnitt des Oligonukleotids (3) und einem einheitlichen Abschnitt des Oligonukleotids (4) D) Schematische Darstellung von Nukleotid-Konjugaten mit einer einheitlichen Nuk- Komponente (1), einem Linker (2), einem einheitlichen Abschnitt des Oligonukleotids (4) und einem weiteren komplementären Oligonukleotid (5) mit einem variablen Abschnitt (3). Das komplementäre Oligonukleotid ist an das einheitliche Oligonukleotid hybridisiert C) Schematic representation of nucleotide conjugates with a uniform nuc-component (1), a linker (2), a variable portion of the oligonucleotide (3) and a uniform portion of the oligonucleotide (4). D) Schematic representation of nucleotide conjugates with a uniform nuc-component (1), a linker (2), a uniform portion of the oligonucleotide (4) and another complementary oligonucleotide (5) with a variable portion (3). The complementary oligonucleotide is hybridized to the uniform oligonucleotide
Fig. 2 Fig. 2
A) Schematische Darstellung von Nukleotid-Konjugaten mit einer Nuk-Komponente (1), einem Linker (2) und einem einheitlichen Oligonukleotid (3). Das Oligonukleotid ist nicht komplementär zu Nukleinsäurekette, die analysiert werden muss.  A) Schematic representation of nucleotide conjugates with a nuc-component (1), a linker (2) and a uniform oligonucleotide (3). The oligonucleotide is not complementary to the nucleic acid chain that needs to be analyzed.
B) Schematische Darstellung von extensionsfähigen Matrize-Primer-Polymerasen : Primer (4), Polymerase (5), Matrize (6) B) Schematic representation of extensible template primer polymerases: primer (4), polymerase (5), template (6)
C) Schematische Darstellung des Einbauereignisses von Nukleotid-Konjugaten in den Primer durch eine Polymerase C) Schematic representation of the incorporation event of nucleotide conjugates into the primer by a polymerase
D) Schematische Darstellung des eingebauten Nukleotid-Konjugates zusammen mit Primer und Matrize vor der Abspaltung des Linkers und Oligonukleotids E) Schematische Darstellung des eingebauten Nukleotides nach der Spaltung D) Schematic representation of the incorporated nucleotide conjugate together with primer and template before cleavage of the linker and oligonucleotide E) Schematic representation of the incorporated nucleotide after cleavage
F) Schematische Darstellung eines neuen Einbauereignisses von einem zweiten Nukleotid-Konjugat Fig. 3 F) Schematic representation of a new incorporation event of a second nucleotide conjugate Fig. 3
A) Schematische Darstellung von vier Arten von Nukleotid-Konjugaten, die in einer Sequenzierungsreaktion verwendet werden. Jede Art von Nukleotid-Konjugaten ist durch eine einheitliche Nuk-Komponente (entsprechend der vier Base) und ein einheitliches, für die jeweilige Art der Nukleotid-Konjugate spezifisches Oligonukleotid charakterisiert.  A) Schematic representation of four types of nucleotide conjugates used in a sequencing reaction. Each type of nucleotide conjugate is characterized by a uniform nuc-component (corresponding to the four base) and a unique oligonucleotide specific for the particular type of nucleotide conjugate.
B) Schematische Darstellung eines Sequenzierungs-Zyklus: Inkubation von Primer- Plymerase-Matrize-Komplexen mit vier verschiedenen Arten von Nukleotid- Konjugaten, Einbau eines zu jeweiligen Position der Matrize komplementären Nukleotid-Konjugats (Nuk-Komponente ist eingebaut). Anschließende Hybridisierung eines komplementären Oligonukleotids an die eingebauten Nukleotid-Konjugate und Detektion des Einbauereignisses, abschließende Abspaltung des Linkers, des Oligonukleotids mit dem hybridisierten Oligonukleotid mit Markierung. B) Schematic representation of a sequencing cycle: Incubation of primer-plymerase-template complexes with four different types of nucleotide conjugates, incorporation of a nucleotide conjugate complementary to the respective position of the template (Nuc component is incorporated). Subsequent hybridization of a complementary oligonucleotide to the incorporated nucleotide conjugates and detection of the incorporation event, final cleavage of the linker, the oligonucleotide with the annealed hybridized oligonucleotide.
Fig. 4 Fig. 4
A) Schematische Darstellung von Nukleotid-Konjugaten mit einer einheitlichen Nuk- Komponente (1), einem Linker (2), einem variablen Abschnitt des Oligonukleotids (3) und einem einheitlichen Abschnitt des Oligonukleotids (4)  A) Schematic representation of nucleotide conjugates with a uniform nuc-component (1), a linker (2), a variable portion of the oligonucleotide (3) and a uniform portion of the oligonucleotide (4)
B) Schematische Darstellung des Einbauereignisses von Nukleotid-Konjugaten in den Primer durch eine Polymerase. Das Nukleotid-Konjugat ist über sein variablen Abschnitt des Oligonukleotids (3) an die Matrize gebunden. C) Schematische Darstellung des eingebauten Nukleotid-Konjugates zusammen mit Primer und Matrize vor der Abspaltung des Linkers und Oligonukleotids. Da das Nukleotid-Konjugat nur vorübergehend an die Matrize über seinen variablen Abschnitt binden kann, kann ein Gleichgewicht zwischen einer gebundenen und einer freien Form bestehen. B) Schematic representation of the incorporation event of nucleotide conjugates into the primer by a polymerase. The nucleotide conjugate is linked to the template via its variable portion of the oligonucleotide (3). C) Schematic representation of the incorporated nucleotide conjugate together with primer and template prior to cleavage of the linker and oligonucleotide. Since the nucleotide conjugate can only temporarily bind to the template through its variable portion, there may be a balance between a bound and a free form.
E) Schematische Darstellung des eingebauten Nukleotides nach der Spaltung E) Schematic representation of the incorporated nucleotide after cleavage
F) Schematische Darstellung eines neuen Einbauereignisses von einem zweiten Nukleotid-Konjugat Fig. 5 F) Schematic representation of a new incorporation event of a second nucleotide conjugate Fig. 5
A) Schematische Darstellung von vier Populationen von Nukieotid-Konjugaten mit einer jeweils einheitlichen Nuk-Komponente (entsprechend den vier Nukleobasen) und Oligonukleotiden mit einem variablen Abschnitt und einem einheitlichen Abschnitt. Die Länge des variablen Abschnitts ist (N) Basen. Dadurch errechnet sich die Gesamtmenge von unterschiedichen Oligonukleotiden innerhalb einer Population 4Λη. Die einheitlichen Abschnitte von Oligonukleotide können beispielsweise spezifisch für eine jeweilige Population von Nukieotid-Konjugaten sein (z.B. OligoA-Sequenz ist einheitlich für sämtliche Oligonukleotide innerhalb der Population mit der Nuk- Komponente dATP usw.). Vorzugsweise sind die einheitlichen Abschnitte verschiedener Nukleotid-Konjugate einander nicht komplementär. A) Schematic representation of four populations of nucleotide conjugates with a single Nuc component (corresponding to the four nucleobases) and oligonucleotides with a variable segment and a single segment. The length of the variable section is (N) bases. This calculates the total amount of different oligonucleotides within a population 4 Λ η. For example, the unitary portions of oligonucleotides may be specific for a particular population of nucleotide conjugates (eg, oligoA sequence is consistent for all oligonucleotides within the population with the nuk component dATP, etc.). Preferably, the unitary portions of different nucleotide conjugates are not complementary to each other.
B) Schematische Darstellung von vier Populationen von Nukieotid-Konjugaten mit einer jeweils einheitlichen Nuk-Komponente (entsprechend den vier Nukleobasen) und Oligonukleotiden mit einem variablen Abschnitt und einem einheitlichen Abschnitt. Die Länge des variablen Abschnitts ist 3 Basen. Dadurch errechnet sich die Gesamtmenge von unterschiedichen Oligonukleotiden innerhalb einer Population 4Λ3 = 64. Die einheitlichen Abschnitte von Oligonukleotide können beispielsweise spezifisch für eine jeweilige Population von Nukieotid-Konjugaten sein. Vorzugsweise sind die einheitlichen Abschnitte verschiedener Nukleotid-Konjugate einander nicht komplementär. B) Schematic representation of four populations of nucleotide conjugates with a single Nuc component (corresponding to the four nucleobases) and oligonucleotides with a variable section and a single segment. The length of the variable section is 3 bases. As a result, the total amount of different oligonucleotides within a population 4 Λ 3 = 64 is calculated. For example, the unitary portions of oligonucleotides may be specific for a particular population of nucleotide conjugates. Preferably, the unitary portions of different nucleotide conjugates are not complementary to each other.
C) Schematische Darstellung von vier Populationen von Nukieotid-Konjugaten mit einer jeweils einheitlichen Nuk-Komponente (entsprechend den vier Nukleobasen) und Oligonukleotiden mit einem variablen Abschnitt und einem einheitlichen Abschnitt. Die Länge des variablen Abschnitts ist 4 Basen. Dadurch errechnet sich die Gesamtmenge von unterschiedichen Oligonukleotiden innerhalb einer Population 4Λ4=256. C) Schematic representation of four populations of nucleotide conjugates with a single Nuc component (corresponding to the four nucleobases) and oligonucleotides with a variable segment and a single segment. The length of the variable section is 4 bases. This computes the total amount of different oligonucleotides within a population 4 Λ 4 = 256.
Fig. 6 Fig. 6
A) Schematische Darstellung von vier Populationen von Nukieotid-Konjugaten mit einer jeweils einheitlichen Nuk-Komponente (entsprechend den vier Nukleobasen) und Oligonukleotiden mit einem variablen Abschnitt und einem einheitlichen Abschnitt. Die Länge des variablen Abschnitts ist 5 Basen. Dadurch errechnet sich die Gesamtmenge von unterschiedichen Oligonukleotiden innerhalb einer Population 4Λ5 = 1024. A) Schematic representation of four populations of nucleotide conjugates with a single Nuc component (corresponding to the four nucleobases) and oligonucleotides with a variable segment and a single segment. The length of the variable section is 5 bases. As a result, the total amount of different oligonucleotides within a population 4 Λ 5 = 1024 is calculated.
B) Schematische Darstellung von vier Populationen von Nukieotid-Konjugaten mit einer jeweils einheitlichen Nuk-Komponente (entsprechend den vier Nukleobasen) und Oligonukleotiden mit einem variablen Abschnitt und einem einheitlichen Abschnitt. Die Länge des variablen Abschnitts ist 6 Basen. Dadurch errechnet sich die Gesamtmenge von unterschiedichen Oligonukleotiden innerhalb einer Population 4Λ6=4096. B) Schematic representation of four populations of nucleotide conjugates with a single Nuc component (corresponding to the four nucleobases) and oligonucleotides with a variable section and a single segment. The Length of the variable section is 6 bases. As a result, the total amount of different oligonucleotides within a population 4 Λ 6 = 4096 is calculated.
Fig. 7 Fig. 7
A) Schematische Darstellung von vier Populationen von Nukleotid-Konjugaten mit einer jeweils einheitlichen Nuk-Komponente (entsprechend den vier Nukleobasen, dA, dC, dG, dU) und Oligonukleotiden mit einem variablen Abschnitt und einem einheitlichen Abschnitt. Die Länge des variablen Abschnitts ist 4 Basen. Dadurch errechnet sich die Gesamtmenge von unterschiedichen Oligonukleotiden innerhalb einer Population 4Λ4=256. Die einheitlichen Abschnitte von Oligonukleotide können beispielsweise spezifisch für eine jeweilige Population von Nukleotid-Konjugaten sein (z.B. OligoA-Sequenz ist einheitlich für sämtliche Oligonukleotide innerhalb der Population mit der Nuk-Komponente dATP usw.). Vorzugsweise sind die einheitlichen Abschnitte verschiedener Nukleotid-Konjugate einander nicht komplementär. Jede Population von Nukleotid-Konjugaten ist mit einem für diese Population charakteristischen Marker ( 1 bis 4) markiert, z.B. ein Fluorescenzfarbstoff, z.B. Alexa 488, Cy3, Cy5, Cy7. A) Schematic representation of four populations of nucleotide conjugates each with a unique Nuc component (corresponding to the four nucleobases, dA, dC, dG, dU) and oligonucleotides with a variable section and a uniform section. The length of the variable section is 4 bases. This computes the total amount of different oligonucleotides within a population 4 Λ 4 = 256. For example, the unitary portions of oligonucleotides may be specific for a particular population of nucleotide conjugates (eg, oligoA sequence is consistent for all oligonucleotides within the population with the nuk component dATP, etc.). Preferably, the unitary portions of different nucleotide conjugates are not complementary to each other. Each population of nucleotide conjugates is labeled with a marker (1 to 4) characteristic of this population, eg a fluorescent dye, eg Alexa 488, Cy3, Cy5, Cy7.
B) Schematische Darstellung eines Sequenzierungs-Zyklus: Inkubation von Primer- Plymerase-Matrize-Komplexen mit vier verschiedenen Populationen von Nukleotid- Konjugaten (siehe Fig. 7 A), Einbau einer zu jeweiligen Position der Matrize komplementären Nuk-Komponente des Nukleotid-Konjugates (Nuk-Komponente ist eingebaut). Anschließende Detektion des Einbauereignisses anhand des spezifischen Fluoreszenzfarbstoffs, abschließende Abspaltung des Linkers und des Oligonukleotids mit Markierung. B) Schematic representation of a sequencing cycle: Incubation of primer-plymerase-template complexes with four different populations of nucleotide conjugates (see FIG. 7A), incorporation of a nucleotide conjugate complementary to the respective position of the template ( Nuk component is installed). Subsequent detection of the incorporation event on the basis of the specific fluorescent dye, final cleavage of the linker and the oligonucleotide with label.
Fig. 8 Fig. 8
A-C) Schematische Darstellung von Nukleotid-Konjugaten mit einem komplementären Oligonukleotid. Die Hybridisierung kann an verschiedenen Positionen des komplementären Oligonukleotids erfolgen (A: in der Mitte, B oder C: an einem der Enden). Nuk-Komponenten (1).  A-C) Schematic representation of nucleotide conjugates with a complementary oligonucleotide. Hybridization can occur at different positions of the complementary oligonucleotide (A: in the middle, B or C: at one of the ends). Nuk components (1).
D) Schematische Darstellung von Nukleotid-Konjugaten mit mehreren komplementären Oligonukleotiden.  D) Schematic representation of nucleotide conjugates with several complementary oligonucleotides.
E) Schematische Darstellung von Nukleotid-Konjugaten mit einem komplementären Oligonukleotid, der in sich einen geschlossenen Kreis bildet  E) Schematic representation of nucleotide conjugates with a complementary oligonucleotide that forms a closed loop in itself
F) Schematische Darstellung von Nukleotid-Konjugaten mit selbstkomplementären Abschnitten des Oligonukleotids, die unter einander eine Haarnadel-ähnliche Struktur bilden. Fig. 9 F) Schematic representation of nucleotide conjugates with self-complementary sections of the oligonucleotide, which form a hairpin-like structure with each other. Fig. 9
A) Schematische Darstellung von Nukleotid-Konjugaten mit einer Nuk-Komponente ( 1), einem Linker (2) und einem einheitlichen Oligonukleotid (3) B) Schematische Darstellung von Nukleotid-Konjugaten mit einer Nuk-Komponente ( 1), einem Linker (2) und einem einheitlichen Oligonukleotid (3) und einem komplementär gebundenen Oligonukleotid (4)  A) Schematic representation of nucleotide conjugates with a nuc-component (1), a linker (2) and a uniform oligonucleotide (3) B) Schematic representation of nucleotide conjugates with a nuc-component (1), a linker (2 ) and a uniform oligonucleotide (3) and a complementarily bound oligonucleotide (4)
C) Schematische Darstellung von Nukleotid-Konjugaten mit einer Nuk-Komponente (1), einem Linker (2) und einem einheitlichen Oligonukleotid (3) und einem komplementär gebundenen Oligonukleotid (4), das eine Markierung einschließt (z.B. einen Fluorescenzfarbstoff oder ein Biotin-Rest). C) Schematic representation of nucleotide conjugates having a nuc-component (1), a linker (2) and a uniform oligonucleotide (3) and a complementarily bound oligonucleotide (4) which includes a label (eg a fluorescence dye or a biotin). Rest).
D) Schematische Darstellung von Nukleotid-Konjugaten mit einer Nuk-Komponente ( 1), einem Linker (2) und einem einheitlichen Oligonukleotid (6), das eine Markierung einschließt (z.B. einen Fluorescenzfarbstoff oder ein Biotin-Rest). D) Schematic representation of nucleotide conjugates having a nuc-component (1), a linker (2) and a uniform oligonucleotide (6) which includes a label (e.g., a fluorescence dye or a biotin residue).
E) Schematische Darstellung von Nukleotid-Konjugaten mit einer Nuk-Komponente ( 1), einem Linker (2) und einem einheitlichen Oligonukleotid (3), das eine Markierung einschließt (7) (z.B. einen Fluorescenzfarbstoff oder ein Biotin-Rest) und einem komplementär gebundenen Oligonukleotid (8), das ebenfalls eine Markierung einschließt (z.B. einen Fluorescenzfarbstoff oder ein Biotin-Rest). Die beiden Markierungen können gleich oder unterschiedlich sein. Bei Fluoreszenzfarbstoffen können sie ein FRET-Paar bilden. E) Schematic representation of nucleotide conjugates with a nuc-component (1), a linker (2) and a uniform oligonucleotide (3) which includes a label (7) (eg a fluorescence dye or a biotin residue) and a complementary one bound oligonucleotide (8), which also includes a label (eg, a fluorescence dye or a biotin residue). The two marks can be the same or different. For fluorescent dyes, they can form a FRET pair.
F) Schematische Darstellung von Nukleotid-Konjugaten mit einer Nuk-Komponente ( 1), einem Linker (2) und einem langen einheitlichen Oligonukleotid (9) und mehreren (hier zwei) komplementär gebundenen Oligonukleotiden ( 10 und 11), wobei jedes der hybridisierten Oligonukleotiden eine Markierung einschließt (z.B. einen Fluorescenzfarbstoff oder ein Biotin-Rest). Die beiden Markierungen können gleich oder unterschiedlich sein. Bei Fluoreszenzfarbstoffen können sie ein FRET-Paar bilden. F) Schematic representation of nucleotide conjugates having a nuc-component (1), a linker (2) and a long unit oligonucleotide (9) and several (here two) complementarily-bound oligonucleotides (10 and 11), wherein each of the hybridized oligonucleotides includes a label (eg, a fluorescent dye or a biotin residue). The two marks can be the same or different. For fluorescent dyes, they can form a FRET pair.
G) Schematische Darstellung von Nukleotid-Konjugaten mit einer Nuk-Komponente ( 1), einem Linker (2) und einem langen einheitlichen Oligonukleotid (12) und einem komplementär gebundenen Oligonukleotid (13), wobei das hybridisierte Oligonukleotiden zwei Markierungen einschließt (z.B. einen Fluorescenzfarbstoff oder ein Biotin-Rest). Die beiden Markierungen können gleich oder unterschiedlich sein. Bei Fluoreszenzfarbstoffen können sie ein FRET-Paar bilden. Das hybridisierte Oligonukleotid hat einen zum Oligonukleotid 12 komplementären Sequenzabschnitt und weitere flankierende Sequenzbereiche, die nicht zu Oligonukleotid 12 komplementär sind. Diese flankierende Bereiche können unter einander komplementär sein. G) Schematic representation of nucleotide conjugates having a nuc-component (1), a linker (2) and a long unit oligonucleotide (12) and a complementarily-bound oligonucleotide (13), wherein the hybridized oligonucleotide includes two labels (eg, a fluorescence dye or a biotin residue). The two marks can be the same or different. For fluorescent dyes, they can form a FRET pair. That hybridized Oligonucleotide has a sequence portion complementary to oligonucleotide 12 and other flanking sequence regions that are not complementary to oligonucleotide 12. These flanking regions may be complementary to each other.
Fig. 10 Fig. 10
Schematische Darstellung einer Nachweismethode mit Rnase und komplementären RNA-Oligonukleotiden A) Schematische Darstellung eines eingebauten Nukleotid-Konjugates  Schematic representation of a detection method with Rnase and complementary RNA oligonucleotides A) Schematic representation of a built-in nucleotide conjugate
B) Bindung einer hybridisierenden Sonde aus RNA mit zwei Fluoreszenzfarbstoffen (RNA-Sonde)  B) Binding of a Hybridizing Probe from RNA with Two Fluorescent Dyes (RNA Probe)
C) Zugabe einer Rnase und Spaltung eines RNA-DNA-Hybrids  C) Addition of a RNAase and cleavage of an RNA-DNA hybrid
D) Freisetzung von gespaltenen Bruchteilen von RNA-Sonde und Regenirierung der Bindungsfähigkeit des Oligonukleotids  D) Release of cleaved fractions of RNA probe and regeneration of the binding ability of the oligonucleotide
Fig . 11 Fig. 11
Schematische Darstellung von unterschiedlichen Positionen der variablen Abschnitte innerhalb des Oligonukleotids  Schematic representation of different positions of the variable sections within the oligonucleotide
A-C) Schematische Darstellung von Nukleotid-Konjugaten mit einer einheitlichen Nuk- Komponente ( 1), einem Linker (2), einem variablen Abschnitt des Oligonukleotids (3) und einem einheitlichen Abschnitt des Oligonukleotids (4). Der variable Abschnitt kann am 5 ' -Ende von Oligonukleotid (A), in der Mitte (B) oder am 3 ' -Ende (C) von Oligonukleotid positioniert sein. Die Nuk-Komponente ist über den Linker an 5 ' - Position des Oligonukletids gekoppelt. AC) Schematic representation of nucleotide conjugates with a uniform nuc-component (1), a linker (2), a variable portion of the oligonucleotide (3) and a uniform portion of the oligonucleotide (4). The variable portion may be positioned at the 5 ' end of oligonucleotide (A), in the middle (B) or at the 3 ' end (C) of oligonucleotide. The nuk component is coupled via the linker to the 5 ' position of the oligonucleotide.
D) Der variabler Abschnitt ist intern positioniert und die Nuk-Komponente mit dem Linker ist ebenfalls intern positioniert, und zwar am 5 ' -Ende des variablen Abschnitts. D) The variable section is internally positioned and the Nuk component with the linker is also internally positioned at the 5 ' end of the variable section.

Claims

Nukleosid-Triphosphat-Konjugate und Methoden zu deren Anwendung Nucleoside-triphosphate conjugates and methods for their use
Ansprüche claims
Anspruch 1 : Nukleotid-Konjugate, die folgende Komponenten einschließen : zumindest eine Nukleotid-Komponente (Nuk-Komponente), zumindest ein Oligonukleotid und mindesten einen Linker zwischen der Nukleotid-Komponente und dem Oligonukleotid  Claim 1: Nucleotide conjugates which include the following components: at least one nucleotide component (nuc-component), at least one oligonucleotide and at least one linker between the nucleotide component and the oligonucleotide
Anspruch 2: Nukleotid-Konjugate nach Anspruch 1, wobei das Oligonukleotid mindestens einen einzelsträngigen Sequenzabschnitt einschließt. Claim 2: Nucleotide conjugates according to claim 1, wherein the oligonucleotide includes at least one single-stranded sequence section.
Anspruch 3: Nukleotid-Konjugate nach Anspruch 1, wobei das Oligonukleotid mindestens einen selbstkomplementären Sequenzabschnitt einschließt Claim 3: Nucleotide conjugates according to claim 1, wherein the oligonucleotide includes at least one self-complementary sequence segment
Anspruch 4: Nukleotid-Konjugate nach Anspruch 1, wobei mindestens ein weiteres vorwiegend komplementäres Oligonukleotid an das genannte Oligonukleotid gekopplet ist. Claim 4: Nucleotide conjugates according to claim 1, wherein at least one further predominantly complementary oligonucleotide is coupled to said oligonucleotide.
Anspruch 5: Ein Reaktionsgemisch bzw. eine Komposition für enzymatische Synthese von Nukleinsäureketten, das mindestens eines der Nukleotid-Konjugate nach einem der oben genannten Ansprüche einschließt Claim 5: A reaction mixture or a composition for enzymatic synthesis of nucleic acid chains, which includes at least one of the nucleotide conjugates according to any one of the above claims
Anspruch 6: Verfahren zur enzymatischen Synthese von komplemetären Strängen von Nukleinsäureketten, bei dem Nukleotid-Konjugate nach einem der Ansprüche 1 bis 5 eingesetzt werden. Claim 6: A process for the enzymatic synthesis of complementary strands of nucleic acid chains, are used in the nucleotide conjugates according to any one of claims 1 to 5.
Anspruch 7: Ein Verfahren zur Markierung von Nukleinsäureketten, das folgende Schritte einschließt: Claim 7: A method for labeling nucleic acid chains, which includes the following steps:
A. Bereitstellung von extensionsfähigen Matrize-Primer-Komplexen  A. Provision of extension-capable template-primer complexes
B. Inkubation dieser Komplexe in einer Reaktionslösung, die eine oder mehrere Polymerase-Arten und zumindest eine Art der Nukleotid-Konjugate nach einem der oben genannten Ansprüche 1 bis 5 einschließt, unter Bedingungen, die eine Primer-Verlängerung um mindestens eine Nuk-Komponente eines Nukleotid- Konjugats erlauben, wobei jede Art von Nukleotid-Konjugate charakteristisch markiert ist und Oligonukleotid der Nukleotid-Konjugate zur unter (A) bereitgestellten Nukleinsäurekette an mindestens 3 Basen und maximum an 10 B. Incubation of these complexes in a reaction solution which includes one or more polymerase species and at least one type of nucleotide conjugate according to any one of claims 1 to 5, under conditions including primer extension by at least one nuc-component of one Allow nucleotide conjugate, each type of nucleotide conjugate is characteristically labeled and oligonucleotide of the nucleotide conjugates to the provided under (A) nucleic acid chain at least 3 bases and a maximum of 10
Basen komplementär ist Anspruch 8: Ein Verfahren zur Sequenzierung von Nukleisäureketten, das folgende Schritte einschließt: a) Bereitstellung von mindestens einer Population an extensionsfähigen Nukleinsäureketten-Primer-Komplexen (NSK-Primer-Komplexe) b) Inkubation von mindestens einer Art der IMukleotid-Konjugate nach einem der oben genannten Ansprüche zusammen mit zumindest einer Art der Polymerase mit den im Schritt (a) bereitgestellten NSK-Primer-Komplexen unter Bedingungen, die den Einbau von komplementären Nuk- Komponenten der Nukleotid-Konjugate zulassen, wobei jede Art derBases is complementary Claim 8: A method for sequencing nucleic acid chains, which includes the following steps: a) providing at least one population of nucleic acid chain-primer complexes (NSK primer complexes) that are capable of extension b) incubation of at least one type of the IM nucleotide conjugates according to one of The above claims together with at least one type of polymerase having the NSK primer complexes provided in step (a) under conditions permitting the incorporation of complementary nuc-components of the nucleotide conjugates, each of which
Nukleotid-Konjugate eine für sie charakteristische Markierung besitzt. Nucleotide conjugates has a characteristic of their mark.
c) Entfernung der nicht eingebauten Nukleotid-Konjugate von den NSK- Primer-Komplexen  c) Removal of unincorporated nucleotide conjugates from the NSK primer complexes
d) Detektion der Signale von in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate  d) Detection of the signals of nucleotide conjugates incorporated into the NSK primer complexes
e) Abspaltung der Linker-Komponente sowie der Marker-Komponente und Oligonukleotid-Komponente von den in die NSK-Primer-Komplexe eingebauten Nukleotid-Konjugate  e) Cleavage of the linker component and of the marker component and oligonucleotide component from the nucleotide conjugates incorporated into the NSK primer complexes
f) Waschen der NSK-Primer-Komplexe gegebenenfalls Wiederholung der Schritte (b) bis (f),  f) washing the NSK primer complexes, optionally repeating steps (b) to (f),
Anspruch 9: Ein Verfahren zur Sequenzierung von Nukleisäureketten, das folgende Schritte einschließt: Claim 9: A method for sequencing nucleic acid chains, which includes the following steps:
a) Bereitstellung von mindestens einer Population an extensionsfähigen a) Provision of at least one population of extensible candidates
Nukleinsäureketten-Primer-Komplexen (NSK-Primer-Komplexe) b) Inkubation von mindestens einer Art der Nukleotid-Konjugate nach einem der oben genannten Ansprüche zusammen mit zumindest einer Art der Polymerase mit den im Schritt (a) bereitgestellten NSK-Primer-Komplexen unter Bedingungen, die den Einbau von komplementären Nuk-Nucleic acid chain primer complexes (NSK primer complexes) b) incubation of at least one kind of the nucleotide conjugates according to one of the above claims together with at least one kind of polymerase with the NSK primer complexes provided in step (a) Conditions requiring the installation of complementary nuclei
Komponenten der Nukleotid-Konjugate zulassen, wobei das Oligonukleotid der Nukleotid-Konjugate nicht zur unter (a) bereitgestellten Nukleinsäurekette komplementär ist und jede Art der Nukleotid-Konjugate eine für sie charakteristische Markierung besitzt. Allow components of the nucleotide conjugates, wherein the oligonucleotide of the nucleotide conjugates is not complementary to the provided under (a) nucleic acid chain and each type of nucleotide conjugates has a characteristic of them marker.
c) Entfernung der nicht eingebauten Nukleotid-Konjugate von den NSK- c) removal of unincorporated nucleotide conjugates from the NSK
Primer-Komplexen d) Detektion der Signale von in die NSK-Primer-Komplexe eingebauten Nukieotid-Konjugate Primer complexes d) detection of the signals of nucleotide conjugates incorporated into the NSK primer complexes
e) Abspaltung der Linker-Komponente sowie der Marker-Komponente und Oligonukleotid-Komponente von den in die NSK-Primer-Komplexe eingebauten Nukieotid-Konjugate  e) Cleavage of the linker component and of the marker component and oligonucleotide component from the nucleotide conjugates incorporated into the NSK primer complexes
f) Waschen der NSK-Primer-Komplexe gegebenenfalls Wiederholung der Schritte (b) bis (f),  f) washing the NSK primer complexes, optionally repeating steps (b) to (f),
Anspruch 10: Ein Verfahren zur Sequenzierung von Nukleisäureketten, das folgende Schritte einschließt: Claim 10: A method for sequencing nucleic acid chains, which includes the following steps:
a) Bereitstellung von mindestens einer Population an extensionsfähigen Nukleinsäureketten-Primer-Komplexen (NSK-Primer-Komplexe) b) Inkubation von mindestens einer Art der Nukieotid-Konjugate nach einem der oben genannten Ansprüche zusammen mit zumindest einer Art der Polymerase mit den im Schritt (a) bereitgestellten NSK-Primer-Komplexen unter Bedingungen, die den Einbau von komplementären Nuk- Komponenten der Nukieotid-Konjugate zulassen, wobei das Oligonukleotid der Nukieotid-Konjugate zur unter (a) bereitgestellten Nukleinsäurekette an mindestens 3 Basen und maximum an 10 Basen komplementär ist und jede Art der Nukieotid-Konjugate eine für sie charakteristische Markierung besitzt.  a) Provision of at least one Population of Extensible Nucleic Acid Chain Primer Complexes (NSK Primer Complexes) b) Incubation of at least one Type of Nukieotide Conjugate According to one of the above claims together with at least one type of polymerase with a) provided NSK primer complexes under conditions that allow the incorporation of complementary nuc-components of Nukieotid conjugates, wherein the oligonucleotide of Nukieotid conjugates to under (a) provided nucleic acid chain is at least 3 bases and a maximum of 10 bases complementary and each type of nucleotide conjugate possesses a characteristic marker.
c) Entfernung der nicht eingebauten Nukieotid-Konjugate von den NSK- Primer-Komplexen  c) Removal of unincorporated nucleotide conjugates from the NSK primer complexes
d) Detektion der Signale von in die NSK-Primer-Komplexe eingebauten Nukieotid-Konjugate  d) detection of the signals of nucleotide conjugates incorporated into the NSK primer complexes
e) Abspaltung der Linker-Komponente sowie der Marker-Komponente und Oligonukleotid-Komponente von den in die NSK-Primer-Komplexe eingebauten Nukieotid-Konjugate  e) Cleavage of the linker component and of the marker component and oligonucleotide component from the nucleotide conjugates incorporated into the NSK primer complexes
f) Waschen der NSK-Primer-Komplexe gegebenenfalls Wiederholung der Schritte (b) bis (f),  f) washing the NSK primer complexes, optionally repeating steps (b) to (f),
EP12730787.4A 2011-05-04 2012-05-04 Nucleoside-triphosphate conjugate and methods for the use thereof Withdrawn EP2705161A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102011100496 2011-05-04
PCT/EP2012/001911 WO2012150035A1 (en) 2011-05-04 2012-05-04 Nucleoside-triphosphate conjugate and methods for the use thereof

Publications (1)

Publication Number Publication Date
EP2705161A1 true EP2705161A1 (en) 2014-03-12

Family

ID=46420042

Family Applications (1)

Application Number Title Priority Date Filing Date
EP12730787.4A Withdrawn EP2705161A1 (en) 2011-05-04 2012-05-04 Nucleoside-triphosphate conjugate and methods for the use thereof

Country Status (4)

Country Link
US (1) US20150086981A1 (en)
EP (1) EP2705161A1 (en)
DE (1) DE102012008759A1 (en)
WO (1) WO2012150035A1 (en)

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3604555A1 (en) * 2011-10-14 2020-02-05 President and Fellows of Harvard College Sequencing by structure assembly
EP4108782B1 (en) 2011-12-22 2023-06-07 President and Fellows of Harvard College Compositions and methods for analyte detection
US11021737B2 (en) 2011-12-22 2021-06-01 President And Fellows Of Harvard College Compositions and methods for analyte detection
US9914967B2 (en) 2012-06-05 2018-03-13 President And Fellows Of Harvard College Spatial sequencing of nucleic acids using DNA origami probes
EP2971184B1 (en) 2013-03-12 2019-04-17 President and Fellows of Harvard College Method of generating a three-dimensional nucleic acid containing matrix
EP3003392B1 (en) 2013-06-04 2019-10-23 President and Fellows of Harvard College Rna-guideded transcriptional regulation
WO2016007839A1 (en) 2014-07-11 2016-01-14 President And Fellows Of Harvard College Methods for high-throughput labelling and detection of biological features in situ using microscopy
AU2016349288A1 (en) 2015-11-03 2018-05-31 President And Fellows Of Harvard College Method and apparatus for volumetric imaging of a three-dimensional nucleic acid containing matrix
CN116200465A (en) 2016-04-25 2023-06-02 哈佛学院董事及会员团体 Hybrid chain reaction method for in situ molecular detection
CN114874337A (en) * 2016-06-24 2022-08-09 加利福尼亚大学董事会 Nucleic acid synthesis and sequencing using tethered nucleoside triphosphates
CN118389650A (en) 2016-08-31 2024-07-26 哈佛学院董事及会员团体 Method for generating a library of nucleic acid sequences for detection by fluorescence in situ sequencing
WO2018045186A1 (en) 2016-08-31 2018-03-08 President And Fellows Of Harvard College Methods of combining the detection of biomolecules into a single assay using fluorescent in situ sequencing
CN110225980B (en) 2016-11-21 2023-01-06 纳米线科技公司 Chemical compositions and methods of use thereof
CN109789167A (en) 2017-04-14 2019-05-21 哈佛学院董事及会员团体 Method for generating cell-derived microfilament network
CN112703255A (en) 2018-05-14 2021-04-23 纳米线科技公司 Chemical compositions and methods of use thereof
SG11202101934SA (en) 2018-07-30 2021-03-30 Readcoor Llc Methods and systems for sample processing or analysis
WO2020076976A1 (en) 2018-10-10 2020-04-16 Readcoor, Inc. Three-dimensional spatial molecular indexing
US10768173B1 (en) 2019-09-06 2020-09-08 Element Biosciences, Inc. Multivalent binding composition for nucleic acid analysis
GB2597398B (en) * 2019-05-24 2024-03-06 Element Biosciences Inc Multivalent binding composition for nucleic acid analysis
EP4237581A1 (en) 2020-10-30 2023-09-06 Element Biosciences, Inc. Reagents for massively parallel nucleic acid sequencing

Family Cites Families (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4711955A (en) 1981-04-17 1987-12-08 Yale University Modified nucleotides and methods of preparing and using same
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
DE3529478A1 (en) 1985-08-16 1987-02-19 Boehringer Mannheim Gmbh 7-DESAZA-2'DESOXYGUANOSINE NUCLEOTIDES, METHOD FOR THE PRODUCTION THEREOF AND THEIR USE FOR NUCLEIC ACID SEQUENCING
US5047519A (en) 1986-07-02 1991-09-10 E. I. Du Pont De Nemours And Company Alkynylamino-nucleotides
US6211158B1 (en) 1987-04-10 2001-04-03 Roche Diagnostics Gmbh Desazapurine-nucleotide derivatives, processes for the preparation thereof, pharmaceutical compositions containing them and the use thereof for nucleic acid sequencing and as antiviral agents
DE3739366A1 (en) 1987-04-10 1988-10-27 Boehringer Mannheim Gmbh DESAZA-PURIN-NUCLEOSIDE DERIVATIVES, METHOD FOR THE PRODUCTION THEREOF AND THEIR USE IN NUCLEIC ACID SEQUENCING AND AS AN ANTIVIRAL AGENT
US5302509A (en) 1989-08-14 1994-04-12 Beckman Instruments, Inc. Method for sequencing polynucleotides
CA2044616A1 (en) 1989-10-26 1991-04-27 Roger Y. Tsien Dna sequencing
FR2703052B1 (en) 1993-03-26 1995-06-02 Pasteur Institut New method of nucleic acid sequencing.
US5986076A (en) 1994-05-11 1999-11-16 Trustees Of Boston University Photocleavable agents and conjugates for the detection and isolation of biomolecules
SE9500342D0 (en) 1995-01-31 1995-01-31 Marek Kwiatkowski Novel chain terminators, the use thereof for nucleic acid sequencing and synthesis and a method of their preparation
CA2325399A1 (en) 1998-03-23 1999-09-30 Invitrogen Corporation Modified nucleotides and methods useful for nucleic acid sequencing
EP2177627B1 (en) 1999-02-23 2012-05-02 Caliper Life Sciences, Inc. Manipulation of microparticles in microfluidic systems
MXPA02002163A (en) * 1999-09-01 2004-04-21 Yeda Res & Dev Template-dependent nucleic acid polymerization using oligonucleotide triphosphates building blocks.
US6309836B1 (en) 1999-10-05 2001-10-30 Marek Kwiatkowski Compounds for protecting hydroxyls and methods for their use
GB0013276D0 (en) 2000-06-01 2000-07-26 Amersham Pharm Biotech Uk Ltd Nucleotide analogues
ATE356222T1 (en) 2000-10-06 2007-03-15 Univ Columbia MASSIVE PARALLEL METHOD FOR DECODING DNA AND RNA
DE10120797B4 (en) 2001-04-27 2005-12-22 Genovoxx Gmbh Method for analyzing nucleic acid chains
US7057026B2 (en) 2001-12-04 2006-06-06 Solexa Limited Labelled nucleotides
DK3363809T3 (en) 2002-08-23 2020-05-04 Illumina Cambridge Ltd MODIFIED NUCLEOTIDES FOR POLYNUCLEOTIDE SEQUENCE
DK3147292T3 (en) 2002-08-23 2018-12-03 Illumina Cambridge Ltd LABELED NUCLEOTIDES
US8637650B2 (en) 2003-11-05 2014-01-28 Genovoxx Gmbh Macromolecular nucleotide compounds and methods for using the same
DE10356837A1 (en) 2003-12-05 2005-06-30 Dmitry Cherkasov New conjugates useful for modifying nucleic acid chains comprise nucleotide or nucleoside molecules coupled to a label through water-soluble polymer linkers
DE102004009704A1 (en) 2004-02-27 2005-09-15 Dmitry Cherkasov New conjugates useful for labeling nucleic acids comprise a label coupled to nucleotide or nucleoside molecules through polymer linkers
WO2006097320A2 (en) 2005-03-17 2006-09-21 Genovoxx Gmbh Macromolecular nucleotide links and methods for their use
WO2008043426A2 (en) 2006-09-20 2008-04-17 Genovoxx Gmbh Components and method for enzymatic synthesis of nucleic acids
WO2009067628A1 (en) * 2007-11-20 2009-05-28 Applied Biosystems Inc. Reversible di-nucleotide terminator sequencing
DE102010049607A1 (en) 2009-10-26 2011-06-30 Becker, Claus, Prof., 76470 Conjugates of nucleotides and methods for their use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2012150035A1 *

Also Published As

Publication number Publication date
WO2012150035A1 (en) 2012-11-08
DE102012008759A1 (en) 2012-11-08
US20150086981A1 (en) 2015-03-26

Similar Documents

Publication Publication Date Title
WO2012150035A1 (en) Nucleoside-triphosphate conjugate and methods for the use thereof
EP1725572B1 (en) Macromolecular nucleotide compounds and methods for using the same
EP1885876A2 (en) Macromolecular nucleotide links and methods for their use
JP6301881B2 (en) Isothermal nucleic acid amplification
US8034923B1 (en) Reagents for reversibly terminating primer extension
DE60032235T2 (en) Ribonukleinsäurederivate
DE60020124T2 (en) EXTENDING A PNA DNA CHIMERATES AT ITS 3 'END BY MEANS OF A POLYMERASE
DE69930379T2 (en) OLIGONUCLEOTIDES WITH PYRAZOLÄ3,4-DÜ PYRIMIDIN FOR HYBRIDIZING AND DISTINGUISHING MALFUNCTIONS
DE69636895T2 (en) The use of the 3 'essential processing efficiency of DNA polymerase
WO2012146377A1 (en) Method and components for detecting nucleic acid chains
CN108366604A (en) Compositions and methods for synthesizing 5' -capped RNA
EP2494073B1 (en) Nucleotide conjugates and methods of uses thereof
WO2008043426A2 (en) Components and method for enzymatic synthesis of nucleic acids
US8053212B1 (en) Non-standard nucleoside analogs with reduced epimerization
CA3196800A1 (en) Reagents for massively parallel nucleic acid sequencing
EP0669395A2 (en) 3'-RNA-labelling with terminal transferase
EP3287528A1 (en) Method for amplification of nucleic acids and kit for same
DE69931928T2 (en) REVERSIBLE INHIBIVING PROBES
KR101922124B1 (en) Method for amplifying DNA from RNA in a sample
JP2016529915A (en) Isothermal amplification using oligocation composite primer sequences
DE102005047617A1 (en) Polymerase chain reaction method using a DNA polymerase with proofreading property
DE60029225T2 (en) COMPOSITIONS AND METHODS FOR HIGHER SENSITIVITY AND SPECIFICITY OF NUCLEIC ACID SYNTHESIS
DE60024464T2 (en) HIGH DENSITY MARKING OF DNA WITH MODIFIED OR CHROMOPHORE-CARRYING NUCLEOTIDES AND USED DNA POLYMERASES
CN101671672A (en) Polyanion for improved nucleic acid amplification
DE602004002485T2 (en) IN THE PRESENCE OF COLLAGEN AND DISACCHARIDES LYOPHILIZED NUCLEIC ACIDS COMPREHENSIVE COMPOSITION

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20131204

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20161201