EP2658574A1 - Polymalic acid-based nanobiopolymer compositions and methods for treating cancer - Google Patents

Polymalic acid-based nanobiopolymer compositions and methods for treating cancer

Info

Publication number
EP2658574A1
EP2658574A1 EP10861515.4A EP10861515A EP2658574A1 EP 2658574 A1 EP2658574 A1 EP 2658574A1 EP 10861515 A EP10861515 A EP 10861515A EP 2658574 A1 EP2658574 A1 EP 2658574A1
Authority
EP
European Patent Office
Prior art keywords
cancer
protein
composition according
her2
antibody
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP10861515.4A
Other languages
German (de)
French (fr)
Other versions
EP2658574A4 (en
Inventor
Satoshi Inoue
Hui DING
Eggehard Holler
Keith Black
Julia LJUBIMOVA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cedars Sinai Medical Center
Original Assignee
Cedars Sinai Medical Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cedars Sinai Medical Center filed Critical Cedars Sinai Medical Center
Publication of EP2658574A1 publication Critical patent/EP2658574A1/en
Publication of EP2658574A4 publication Critical patent/EP2658574A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/593Polyesters, e.g. PLGA or polylactide-co-glycolide
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • A61K47/6855Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell the tumour determinant being from breast cancer cell
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6883Polymer-drug antibody conjugates, e.g. mitomycin-dextran-Ab; DNA-polylysine-antibody complex or conjugate used for therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3233Morpholino-type ring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific

Definitions

  • the present invention generally relates to compositions and methods for treating patients having cell proliferative disorders with polymalic acid-based nanobiopolymeric compositions that inhibit synthesis and activity of an oncogenic protein.
  • the invention was made in part with support from grants R01CA123495 and R01CACA1136841 from the National Institutes of Health. The government has certain rights in the invention.
  • Breast cancer is a disease affecting a significant population of women around the world. About 1 in 8 women in the United States (between 12 and 13%) will develop invasive breast cancer over the course of her lifetime. Prognosis and survival rate varies greatly depending on cancer type and staging. Breast cancers expressing genetic
  • HER2 human epidermal growth factor receptor-2
  • This 185-kDa growth factor receptor is encoded by the her-2 proto-oncogene, also referred to as neu and c- erbB-2 (Slamon et al. 1987 Science 235: 177).
  • the her-2 gene is closely related to the gene encoding epidermal growth factor receptor (EGFR). Amplification of the her-2 gene has been linked to neoplastic transformation in human breast cancer cells (Slamon et al. 1987 Science 235:177).
  • Overexpression of the HER2 protein has been identified in 20-30% of breast cancer patients, and has been correlated with regionally advanced disease, increased probability of tumor recurrence, and reduced patient survival. As many as 30-40% of patients having gastric, endometrial, salivary gland, non-small cell lung, pancreatic, ovarian, peritoneal, prostate, or colorectal cancers may also exhibit overexpression of this protein.
  • HER2 -negative breast cancer A more difficult-to-treat form of HER2 -negative breast cancer known as "triple- negative,” affects some patients. This form tests negative for three primary receptors:
  • trastuzumab Humanized mti- ER2/neu monoclonal antibody trastuzumab (Herceptin ® ,
  • An embodiment of the invention provided herein is a drug delivery composition for treating a cancer in a subject, the drug including a plurality of biologically active molecular modules having at least one module that targets a tumorigenic cell or a cancer cell, at least one module that inhibits synthesis or activity of a human epidermal growth factor receptor (HER) protein in the cell, and at least one module for cytoplasmic delivery, and a polymalic acid-based molecular scaffold, such that the molecular modules are covalently linked to the scaffold.
  • the HER protein is at least one protein selected from the group of: HER1, HER2, HER3 and HER4.
  • the at least one module that inhibits synthesis or activity of the protein is selected from the group of: an antisense oligonucleotide (AON), an siRNA oligonucleotide, an antibody, a polypeptide, an oligopeptide and a low molecular weight drug.
  • AON antisense oligonucleotide
  • siRNA oligonucleotide an antibody
  • a polypeptide an oligopeptide and a low molecular weight drug
  • the scaffold in a related embodiment includes a poly-P-L-malic acid (PMLA) also denoted poly(-P-L-malic acid).
  • the AON in related embodiments is a Morpholino AON having a sequence complementary to a sequence contained in an mRNA transcript of HER2/neu protein.
  • the AON is selected from: 5'-AGGGAGCCGCAGCTTCATGTCTGTG-3' (SEQ ID NO: 1), and 5'-CATGGTGCTCACTGCGGCTCCGGC-3 ' (SEQ ID NO:2).
  • the at least one module that targets the cell includes an antibody that binds specifically to a vasculature protein in the cell.
  • the vasculature protein includes a transferrin receptor protein.
  • the antibody is selected from at least one of: anti-human, rat anti-mouse, rat anti-human, rabbit anti-human and goat anti-human.
  • the at least one module that inhibits activity of the protein includes an antibody binding specifically to a HER2/neu protein.
  • the antibody is Herceptin ® .
  • composition in alternative embodiments includes a Morpholino AON having a sequence complementary to a sequence contained in an mRNA transcript of an epidermal growth factor receptor (EGFR) protein.
  • EGFR epidermal growth factor receptor
  • composition in related embodiments includes a Morpholino AON having a sequence complementary to a sequence contained in an mRNA transcript of at least one subunit of laminin-411.
  • the subunit is selected from an a4 subunit and a ⁇ subunit.
  • the sequence complimentary to the transcript of the a4 subunit includes
  • 5'-AGCTCAAAGCCATTTCTCCGCTGAC-3 ' (SEQ ID NO:4).
  • the sequence complimentary to the transcript of the ⁇ 1 subunit includes 5 '- CTAGC AACTGGAGAAGCCCCATGCC-3 ' (SEQ ID NO:5).
  • the composition includes the siRNA oligonucleotide having a sequence complementary to a gene encoding an EGFR protein.
  • the sequence includes a sense sequence 5'-CCUAUAAUGCUACGAAUAUtt-3' (SEQ ID NO:6) and an antisense sequence 5 '-AUAUUCGUAGCAUUUAUGGag-3 ' (SEQ ID NO:7).
  • the siRNA oligonucleotide in a related embodiment includes a sequence complementary to a gene encoding a HER2 protein.
  • the sequence includes a sense sequence 5'-GUUGGAUGAUUGACUCUGAtt-3' (SEQ ID NO: 8) and an antisense sequence 5'-UCAGAGUCAAUCAUCCAACat-3' (SEQ ID NO:9).
  • the at least one module for cytoplasmic delivery includes an endosome escape unit.
  • the endosome escape unit is selected from a group of: leucine residues, valine residues and a leucine ethylester. i.e., a plurality of leucine or valine residues, or a single or a plurality of leucine residues, or mixture of any of these.
  • a concentration of the leucine ethylester in a related embodiment is about 40% of the drug delivery composition.
  • the plurality of modules in related embodiments further includes a polyethylene glycol (PEG).
  • PEG polyethylene glycol
  • the PEG has a molecular weight of about 1,000 Da, about 5,000 Da, about 10,000 Da, about 15,000 Da, about 20,000 Da, about 25,000 Da and about 30,000 Da.
  • An embodiment provides the composition in a unit dose effective for treatment of the cancer in the patient.
  • the unit dose is at least one selected from: 1 ⁇ g/kg, 50 ⁇ g kg, 100 ⁇ g kg, 500 ⁇ g/kg, 1 mg/kg, 5 mg/kg, 10 mg kg, 50 mg kg, and 100 mg/kg.
  • the unit dose is at least 1 mg/kg.
  • the unit dose is less than about 10 mg/kg.
  • the cancer is at least one selected from the list of: gastric, endometrial, salivary gland, lung, non-small cell lung, pancreatic, ovarian, peritoneal, prostate, colorectal, breast, cervical, uterine, ovarian, brain, head and neck, testicular and teratoma cancers.
  • the breast cancer is a triple-negative breast cancer.
  • the cancer includes either a primary cancer or a metastatic cancer, or both.
  • the cancer in another embodiment includes cells overexpressing a HER2/neu receptor protein.
  • An embodiment of the invention herein is a drag delivery composition for treating a cancer in a subject including: a polymerized carboxylic acid molecular scaffold such as a poly-p-L-malic acid (PMLA), and a plurality of biologically active molecular modules including an antisense molecule that substantially inhibits synthesis of a HER2/neu receptor protein, a molecular module to facilitate delivery of the antisense molecule to cytoplasm, at least one antibody specific for the receptor protein that inhibits activity of the receptor protein, at least one antibody targeting a tumor vasculature protein, and a molecular module that prolongs circulation of the composition, such that the molecular modules are covalently linked to the scaffold.
  • a polymerized carboxylic acid molecular scaffold such as a poly-p-L-malic acid (PMLA)
  • a plurality of biologically active molecular modules including an antisense molecule that substantially inhibits synthesis of a HER2/neu receptor protein, a molecular module to facilitate delivery of
  • the invention in an embodiment provides a drag delivery composition for treating a cancer in a subject including: a polymerized carboxylic acid molecular scaffold such as a poly- -L-malic acid (PMLA), and a plurality of biologically active molecular modules including an antisense molecule that substantially inhibits synthesis of an epidermal growth factor receptor (EGFR) protein, an antisense molecule that substantially inhibits at least one subunit of laminin-411, a molecular module to facilitate delivery of the antisense molecule to cytoplasm, at least one antibody targeting a tumor vasculature protein, and a molecular module that prolongs circulation of the composition, such that the molecular modules are covalently linked to the scaffold.
  • a polymerized carboxylic acid molecular scaffold such as a poly- -L-malic acid (PMLA)
  • a plurality of biologically active molecular modules including an antisense molecule that substantially inhibits synthesis of an epidermal growth factor receptor (EGFR) protein,
  • the invention in another embodiment provides a kit for treating a patient having a cancer that includes a drag deliveiy composition including a nanobiopolymeric conjugate of a scaffold such as a poly-P-L-malie acid (PMLA) and molecular modules including an antisense molecule that substantially inhibits synthesis or activity of a human epidermal growth factor receptor (HER) protein, a molecular module to facilitate delivery of the antisense molecule to cytoplasm, at least one targeting antibody specific for the HER protein, at least one antibody specific for a tumor vasculature protein, and a molecular module that prolongs circulation of the composition, such that the PMLA is covalently linked to the molecular modules, in a container.
  • the kit in related embodiments further includes a pharmaceutically acceptable buffer and instructions for use.
  • An embodiment of the invention herein is a method for treating a cancer in a subject, the method including: contacting the subject with a drug delivery composition that includes a poly-P-L-malic acid (PMLA) covalently linked to a plurality of molecular modules including at least one module that targets a tumorigenic cell or a cancer cell, at least one module that inhibits synthesis or activity of a human epidermal growth factor receptor (HER) protein in the cell, and at least one module for cytoplasmic delivery, and analyzing at least one of: inhibition of tumor growth, tumor regression and elimination of cancer in the subject, thereby treating the cancer in the subject.
  • the HER protein is selected from a group comprising: HER1, HER2, HER3, and HER4.
  • the module that inhibits synthesis or activity of the HER protein is at least one selected from the group of: an antisense oligonucleotide (AON), an siRNA oligonucleotide, an antibody, a polypeptide, an oligopeptide and a low molecular weight drug.
  • AON has a sequence complementary to an mRNA transcript of at least one protein selected from the group of: HER2, an epidermal growth factor receptor (EGFR) protein, and a subunit of laminin-411.
  • sequence complementary to the HER2 transcript includes 5 'AGGGAGCCGCAGCTTCATGTCTGTG-3 ' (SEQ ID NO: 1), and 5 '-CATGGTGCTCACTGCGGCTCCGGC-3 ' (SEQ ID NO:2).
  • sequence complementary to the EGFR transcript includes
  • the subunit of laminin- 411 in related embodiments is selected from a4 and ⁇ subunits.
  • the a4 transcript sequence includes 5 '-AGCTCAAAGCCATTTCTCCGCTGAC-3 ' (SEQ ID NO:4).
  • the ⁇ transcript sequence includes
  • the siR A oligonucleotide includes a sequence complementary to a gene encoding at least one of an epidermal growth factor receptor (EGFR) protein and HER2.
  • EGFR epidermal growth factor receptor
  • the EGFR sequence is selected from: 5'-CCUAUAAUGCUACGAAUAUtt-3' (SEQ ID NO:6), and
  • the HER2 sequence is selected from: 5'-GUUGGAUGAUUGACUCUGAtt-3' (SEQ ID NO:8), and 5'-UCAGAGUCAAUCAUCCAACat-3' (SEQ ID NO:9).
  • the antibody binds specifically to HER2/neu protein.
  • the antibody is Trastuzumab Herceptin ® .
  • the at least one module that targets the cell includes an antibody that binds specifically to a transferrin receptor protein.
  • the antibody is selected from at least one of: anti-human, rat anti-mouse, rat anti-human, rabbit anti-human and goat anti-human.
  • the at least one module for cytoplasmic delivery includes an endosome escape unit.
  • the endosome escape unit is a leucine ethylester.
  • the plurality of modules further includes a polyethylene glycol (PEG).
  • PEG polyethylene glycol
  • the PEG has a molecular weight of about 1,000 Da.
  • the PEG has a molecular weight of about 5,000 Da.
  • An embodiment of the method involves analyzing inhibition of tumor growth by observing more than about 60%, 70%, 80% or about 90% inhibition of tumor growth in the subject.
  • the method in a related embodiment further involves observing with inhibition of tumor growth the inhibition of HER2/neu receptor signaling with suppression of Akt phosphorylation.
  • the subject is a mammal such as a human, a simian, an equine, a bovine, or a high value agricultural or zoo animal
  • the mammal is a rodent.
  • the rodent is an experimental human-breast tumor-bearing nude mouse.
  • the mammal in an alternative embodiment is a human.
  • the method in a related embodiment further includes administering an additional therapeutic agent.
  • the additional therapeutic agent is selected from the group consisting of: an antibody, an enzyme inhibitor, an antibacterial agent, an antiviral agent, a steroid, a non-steroid-inflammatory agent, an antimetabolite, a cytokine, a cytokine blocking agent, an adhesion molecule blocking agent, and a soluble cytokine receptor.
  • contacting the subject with the composition further includes providing the composition in a unit dose effective for treatment the cancer in the subject.
  • the effective dose is at least one selected from: 1 ⁇ g/kg, 50 ⁇ g/kg, 100 ⁇ g/kg, 200 ⁇ g/kg, 300 ⁇ g/kg, 400 ⁇ g/kg, 500 ⁇ g/kg, 600 ⁇ g/kg, 700 ⁇ g/kg, 800 ⁇ g/kg, 900 ⁇ g/kg, 1 mg/kg, 50 mg/kg, 100 mg/kg, 200 mg/kg, 300 mg/kg, 400 mg/kg, 500 mg/kg, 600 mg/kg, 700 mg/kg, 800 mg/kg, 900 mg/kg, and 1 g/kg.
  • the cancer is selected from the list of: gastric, endometrial, salivary gland, lung, non-small cell lung, pancreatic, ovarian, peritoneal, prostate, colorectal, breast, cervical, uterine, ovarian, brain, head and neck, testicular and teratoma cancers.
  • the cancer includes either a primary cancer, or a metastatic cancer, or both.
  • Figure 1 is a chemical structure and schematic drawings showing a
  • nanobiopolymeric conjugate designed to inhibit HERl/neu expression by antisense oligonucleotides (AON) and to attenuate HER2/new-mediated cell signaling by Herceptin ® .
  • the modules are HERl/neu morpholino AON (indicated 1 in Figure) conjugated to the PMLA scaffold by disulfide bonds (S-S) that are cleaved by cytoplasmic glutathione to release the free drugs; targeting and/or effector antibodies that include antinbody specific to a transferrin receptor protein (TfR) either alone or in combination with monoclonal antibodies (mAbs) to mouse TfR (indicated 2a in Figure), human TfR (indicated 2b) and Herceptin ® (indicated 2c) for tumor endothelial and cancer cell targeting, receptor-mediated endocytosis, and anti-tumor effect, polyethylene glycol (PEG) for drag protection (indicated 3), stretches of conjugated L-leu
  • the nanopolymer also contained free unsubstituted pendant carboxyl groups for enhancing solubility and nonfunctional disulfides originating from chemical masking of excess sulfhydryls with 3-(2-pyridyldithio)-propionates.
  • Figure 2 is a set of bar graphs showing data obtained from an in vitro cell viability assay.
  • HER2/ «eu overexpressing breast cancer cells (BT-474 and SKBR-3; also shown in Figure 3 panel A) were treated with various drugs as indicated (top row). After 72 hours, cell viability was determined using a Trypan Blue exclusion assay. Percentage of cell growth was calculated as average cell counts for each group and expressed relative to parallel samples treated with PBS (control) set to 100%.
  • Figure 3 is a set of photographs of immunoblots showing changes observed in HER2/neu expression, Akt phosphorylation, and apoptosis resulting from various treatments of breast cancer cells in vitro.
  • Figure 3 panel A shows a comparison of HERl/neu and TfR expression in various cell lines. Breast cancer cell lines used in Examples herein were observed to express high levels of TfR.
  • Figure 3 panel B shows expression analysis of various markers in cell line SKBR-3.
  • FIG. 3 shows expression of the markers in cell line BT-474.
  • HER2/neu overexpressing breast cancer cells shown in panel A were treated with various compounds.
  • P/mPEG/LOEt/AON/Herceptin ® /TfR(M) further reduced both HER2/neu and p-Akt.
  • Assay of generation of cleaved poly(ADP-ribose) polymerase (PARP) as a measure of apoptosis was observed at highest levels in P/mPEG/LOEt/AON/Herceptin ® /TfR(M)-treated cells.
  • Glyceraldehyde 3 -phosphate dehydrogenase( GAPDH) was used as an internal loading control.
  • Figure 4 is set of photographs showing distribution of various compounds herein labeled with Alexa Fluor 680 in live mice with BT-474 breast tumors and in tumors in isolated organs.
  • Major organ analysis compared breast tumors and organs before injection (left panel) with those twenty-four hours after intravenous injection (right panels).
  • Live mice herein were injected with each of the lead drug P/mPEG/LOEt/AON/Herceptin ® /Tf (M) (bottom row), positive control P/mPEG/LOEt with Herceptin ® (middle row) and control conjugate P/mPEG/LOEt/IgG (top row).
  • Control mice had little BT-474 tumor accumulation, and most of the control polymer accumulated in drug clearing organs, liver and kidneys.
  • Polymer P/mPEG/LOEt with Herceptin ® alone had a moderate tumor accumulation (middle row). The highest accumulation in breast tumor cells was observed in mice treated with the lead compound P/mPEG/LOEt/AON/Herceptin ® /TfR(M). Arrows mark tumor implantation site.
  • Figure 5 is a set of photographs showing distribution of various compounds in BT- 474 breast tumor cells.
  • Animals were administered compounds intravenously as shown in Figure 4, were sacrificed 24 hours after drug injection, tumors were excised, and sections were analyzed by confocal microscopy. Nuclei were counterstained with DAPI (grey area). Animals injected with control conjugate P/mPEG/LOEt/IgG with attached Alexa Fluor 680 tracking dye (grey) showed little if any tumor cell accumulation (top row). Animals injected with P/mPEG/LOEt/Herceptin ® displayed considerable accumulation in tumor cells, and the highest accumulation was observed in animals injected with the lead drug
  • Figure 6 is a set of photographs and a line graph showing mouse tumor inhibition, pathology, signaling and apoptosis marker expression.
  • Figure 6 panel A is a set of photographs showing data obtained and histopathological analysis of respective tumors from two representative animals for each group administered with different drugs. Variable amounts of dead tissue were observed to be present in all treated groups. Tumor size reduction data and pronounced disappearance of tumor cells were observed following treatment with the lead drug
  • Figure 6 panel B is a line graph showing extent of tumor growth inhibition in mice.
  • Animals treated with each of unconjugated Herceptin ® squares
  • P/mPEG/LOEt/Herceptin ® triangles
  • P/mPEG LOEt/AON/TfR(H/M) circles
  • P/mPEG LOEt/AON/TfR(H/M) circles
  • PBS control diamonds
  • P/mPEG/LOEt/AON/Herceptin ® /TfR(M) treatment (large squares) was observed to produce the greatest inhibition of tumor growth compared to other treatment groups, resulting in 80 to 95% tumor regression observed during the follow-up period (P ⁇ 0.02 vs. Herceptin ® and other drugs; PO.001 vs. PBS). Error bars denote standard error of the mean (SEM).
  • Figure 6 panel C is a photograph of an immunoblot showing expression of select markers after treatment of HER2/ «ew positive tumors in vivo.
  • Western blot analysis data showed a decrease in HER2/neu and p-Akt (but not total Akt) expression in each of Herceptin ® -, P/mPEG/LOEt/Herceptin ® -, or P/mPEG/LOEt/AON/TfR(H/M)-treated mice and not in control PB S-treated ones.
  • P/mPEG/LOEt/AON/Herceptin ® /TfR(M) further inhibited HER2/ «e « expression, with near disappearance of a p-Akt band.
  • PARP cleavage as a measure of apoptosis was observed also to be substantially greater in
  • Figure 7 is a line graph showing extent of tumor growth inhibition by compositions herein in subjects bearing triple-negative breast tumors.
  • Animals treated with each of P/mPEG/LOEt/AON-EGFR/ TfR(H/M; squares), or with P/mPEG/LOEt/AON- EGFR/a4pl/TfR(H/M; triangles) showed significant inhibition compared with PBS negative control (diamonds).
  • compositions and methods of the present invention provide a nanobiopolymeric drugs based on poly- -L-malic acid (PMLA) platform specifically designed for delivery into HER2/ «e «-positive tumors.
  • PMLA poly- -L-malic acid
  • Targeted nanobiopolymeric conjugates based on poly-p-L- malic acid (PMLA) are biodegradable, non-toxic, and non-immunogenic.
  • the PMLA nanoplatform was synthesized for repetitive systemic treatments of HER2/?3 ⁇ 4ew-positive human breast tumors in a xenogeneic mouse model.
  • Various moieties were covalently attached to PMLA, including a combination of morpholino antisense oligonucleotides (AON) directed against HER2/ne « mRNA, to block HER2/neu synthesis; anti-HER2//te « antibody trastuzumab (Herceptin ® ), to target breast cancer cells and inhibit receptor activity simultaneously; and transferrin receptor antibody, to target the tumor vasculature and mediate delivery of the nanobiopolymer through the host endothelial system.
  • AON morpholino antisense oligonucleotides
  • Herceptin ® antibody trastuzumab
  • transferrin receptor antibody to target the tumor vasculature and mediate delivery of the nanobiopolymer through the host endothelial system.
  • the Examples herein include tests of the lead compound, and data show that this compound significantly inhibited growth of HER2/new-positive breast cancer cells in vitro and in vivo, and enhanced apoptosis and inhibition of HER2/neu receptor signaling with suppression of Akt phosphorylation was observed in treated cells and animals.
  • In vivo imaging analysis and confocal microscopy demonstrated selective accumulation of the nanodrug in tumor cells as a result of an active delivery mechanism resulting from design of the lead compound.
  • Systemic treatment of human breast tumor-bearing nude mice resulted in more than 90% inhibition of tumor growth and tumor regression, compared to partial (50%) tumor growth inhibition in mice treated with control trastuzumab alone or control AON alone, either free or attached to PMLA.
  • Data from Examples herein offer a preclinical demonstration of use of the PMLA nanoplatform for combination cancer therapy.
  • the epidermal growth factor receptor or ErbB family of receptor tyrosine kinases is exemplified by an epidermal growth factor receptor (also called HER1 or ErbBl), HER2 (ErbB 2 or neu), HER3 (ErbB3), and HER4 (ErbB4).
  • an epidermal growth factor receptor also called HER1 or ErbBl
  • HER2 ErbB 2 or neu
  • HER3 ErbB3
  • HER4 HER4
  • phosphotyrosylated sites in Src-homology 2 (SH2) domains in these proteins serve as docking sites for adaptor proteins such as She, Grb2, and Sos resulting in the activation of the of Ras/Raf/mitogen-activated protein kinase (MAPK) kinase (MEK)/ MAP and PBK/protein kinase B ( P B) pathways and promotion of proliferation and mitogenesis (Yarden et al. 2001 Nat Rev Mol Cel Biol 2:127).
  • MAPK Ras/Raf/mitogen-activated protein kinase
  • MEK MAP and PBK/protein kinase B
  • the HERl/neu proto-oncogene also known as erbB-2, encodes a 185-kDa type I transmembrane receptor tyrosine kinase that is member of the epidermal growth factor receptor family (Hynes NE et al., 2005 Nat Rev Cancer 5:341; Bargmann CI et al. 1986. Nature 319:226; Coussens L et al. 1985 Science 230:1132).
  • Early studies have identified HER2/new protein overexpression in several human carcinomas, including subsets of ovarian and breast cancers (Hynes NE et al. 1994. Biochim Biophys Acta 1198: 165;
  • HER2/neu overexpression has been linked to a short relapse time and poor survival of breast cancer patients (Slamon DJ et al. 1987 Science 235:177), as this protein plays a role in the molecular mechanisms of human cancers.
  • the ErbB2 gene is amplified and overexpressed in up to 30% of primary breast cancers and this is associated with poor patient prognosis (Slamon DJ et al, 1989 Science 244:707). ErbBl is also overexpressed in up to 30% of primary invasive breast cancers and this is coiTelated with reduced overall survival, proliferation, and higher metastatic potential (Tsutsui S et al. 2002 Breast Cancer Res Treat 71 :67). Inhibition of ErbBl signaling reduces both ErbBl and ErbB2 activity and delays tumorigenesis in MMTV Neu mice (Lenferink AEG et al. 2000 Proc Natl Acad Sci 97: 9609). The cooperative activation of proliferative pathways by these two receptors has stimulated the development of a number of small molecule inhibitors of members of the ErbB family for use as anticancer agents.
  • Newly diagnosed estrogen positive breast cancers are commonly treated with the an ti estrogen agent tamoxifen.
  • overexpression of both Erbl and Erb 2 is associated with resistance to tamoxifen therapy. It was shown that administration of such anticancer agents as lapatinib (GW572016) and tamoxifen together was advantageous and restored tamoxifen-mediated cell cycle arrest and inhivited tamoxifen-resistant breast tumor growth (Chu I et al. 2005 Cancer Res 65:18).
  • Trastuzumab also known as Herceptin; Genentech, Inc., San Francisco, CA
  • a Food and Drug Administration- approved humanized monoclonal anti-HER2/ «ew Koreanized monoclonal anti-HER2/ «ew
  • Breast cancer clinical trials for patients with advanced disease expressing high levels of HER2/ «e « showed that use of Trastuzumab as a single immuno therapeutic agent resulted in an objective response rate of 12% to 26% (Cobleigh MA et al. 1999 J Clin Oncol 17:2639; Baselga J et al. 1996 J Clin Oncol 14:737; Vogel CL et al. 2002 J Clin Oncol 20:719).
  • HER2/ «e «-overexpressing tumors demonstrate primary resistance to Herceptin ® (Baselga J et al. 1999 Semin Oncol 26:78; Nahta R et al. 2004 Cancer Res. 64:398). This resistance may be due to epitope masking by overexpressed mucins, loss of receptor ability to influence pro-survival signaling through PI3K-Akt axis, or loss of protein phosphatase PTEN leading to the activation of PI3K-Akt signaling (Tseng PH et al 2006 Mol Pharmacol.70:1534-41; Nagy P et al 1998 Cytometry32:120; Tanner M et al. 2004 Cancer Ther. 3:1585-92).
  • agents including monoclonal antibodies, recombinant proteins, and drugs, are known to have activity in treating breast cancer, and are here contemplated to be useful agents in combination with compositions described herein.
  • Herceptin ® Combination of Herceptin ® with other agents, such as paclitaxel (taxol, Bristol-
  • Tyrosine kinases are associated with breast cancer tumorigenesis and are of substantial interest as potential drag targets (Ocana A et al. 2008 Clin Cancer Res 14:961).
  • IGF-1R insulinlike growth factor 1 receptor
  • RTK receptor tyrosine kinase
  • Cotargeting or simultaneous targeting of IGF-I R and HER2 offers an advantage compared to targeting of the individual RTKs in breast cancer cells (Esparis-Ogando A et al. 2008 Ann Oncol 19:1860).
  • the v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (c- KIT) RT is overexpressed in triple-negative breast cancers (those that do not express estrogen receptor, progesterone receptor, and HER2) (Nielsen TO et al. 2004 Clin Res 10:5367).
  • c-abl oncogene 1 ABL1
  • c-SRC tyrosine kinase CSK
  • Dasatinib (Sprycel ® , Bristol-Myers Squibb) a small-molecule tyrosine kinase inhibitor, targets the cytosolic c-SRC and ABL1 kinases, and RTKs c-KIT and platelet- derived growth factor receptors alpha and beta (Finn RS et al. 2007 Breast Cancer Res Treat 105:319; Rix U et al. 2007 Blood 110: 4055; Huang F. et al. 2007 Cancer Res 67: 2226; Huang F. et al. 2007 Cancer Res 67: 2226).
  • the drug combination decreased levels of phosphorylated HER2 and phosphorylated HER3, and a decrease was observed in the total amount of these receptors.
  • the combined treatment affected downstream signaling routes, such as the ER l or AKT pathways that regulate cell proliferation and survival (Garcia-Echeverria C et al. 2008 Oncogene 27:5511; Roberts PJ et al. 2007 Oncogene 26:3291).
  • Dasatinib alone was as inhibitory for phosphorylated levels of ERKl as the combined drug treatment.
  • Treatment with dasatinib also inhibited SRC or FAK phosphorylation to the same degree as the combined drug treatment. These two kinases are known targets of dasatinib (Huang F. et al.
  • the drug combination also induced caspase-independent apoptosis as determined by the lack of an effect of caspase inhibitors on apoptosis induced by the drug combination.
  • One of the possible mediators in caspase- independent apoptosis is NAIF1 a protein that is released from the mitochondrial intermembrane space by certain apoptotic stimuli.
  • NAIF1 a protein that is released from the mitochondrial intermembrane space by certain apoptotic stimuli.
  • the release of NAIF 1 from mitochondria to the cytosol, by treatment with the drug combination indicated that this mechanism could be responsible for caspase-independent apoptosis.
  • the drug combination also affected DNA repair machinery and led to accumulation of double-stranded breaks (DSBs) which indicate control of DNA repair machinery by tyrosine kinases and potential clinical implications.
  • DSBs double-stranded breaks
  • Erlotinib (Tarceva, Roche), an inhibitor of EGFR, blocked homologous
  • Gefitinib (Iressa, Astra Zeneca and Teva) is an EGFR inhibitor that impedes DNA repair in response to ionizing radiations in macrocytic lung cancer cells (Tanaka T et al, 2008 Clin Cancer Res 14: 1266).
  • a transcription factor associated with Williams-Beuren syndrome (WSTF; also known as ⁇ ), a tyrosine kinase component of the WICH complex (WSTF-ISWI ⁇ ⁇ - dependent chromatin-remodeling complex), regulates the DNA damage response through phosphorylation of Tyrl42 of H2AX (Xiao A et al. 2009 Nature 457:57).
  • drugs such as dasatinib in combination with other antineoplastic agents such as gefitinib and erlotinib (Koppikar P et al. 2008 Clin Cancer Res 14:4284), are further combined with compositions described herein.
  • Lapatinib (Tyverb , GSK) is a dual EGFR/HER2 tyrosine kinase inhibitor (Rusnak DW et al. 2001 Mol Cancer Ther 1 :85) which is highly selective to EGFR and HER2 (Karaman MW et al. 2008 Nat Biotechnol 26:127).
  • lapatinib inhibited phosphorylation of HER2 and overall growth in HER2 overexpressing breast cancer cell lines specifically chosen for extent of in vitro resistance to trastuzumab (Konechny GE et al. 2006 Cancer Res 66:1630). Further, treatment with lapatinib combined with trastuzumab resulted in a greater degree of survival and greater apoptosis induction than either agent alone (Xia et al. 2005 Oncogene 24: 6213).
  • HER2-positive metastatic breast cancer patients treated with trastuzumab experience symptomatic central nervous system (CNS) metastasis, which unlike visceral diseases, are not well controlled by trastuzumab.
  • CNS central nervous system
  • Lapatinib and not trasuzumab has been shown to cross the blood-brain barrier, providing rationale for testing lapatinib in patients with CNS metastases (Nielsen DL et al. 2009 Cancer Treat Rev 35: 121).
  • Pertuzumab (2c4, omnitarg, Genentech), another monoclonal antibody specific for the extracellular domain of HER2 protein, attaches to a different epitope of HER2 compared to trastuzumab.
  • Pertuzumab was observed to inhibit heterodimer formation between HER2 and EGFR or HER3 (Agus DB et al. 2002 Cancer Cell 2: 127).
  • the HER2/HER3 heterodimer is important in HER2-driven cell signaling, the heregulin-dependent HER2/ HER3 heterodimer is disrupted by pertuzumab and is not disrupted by trastuzumab (Jitunttila et al. 2009 Cancer Cell 15:429).
  • Trastuzumab-DMl is comprised of trastuzumab and DM1, an agent that is an inhibitor of tubulin polymerization derived from maytansine.
  • a stable MCC linker conjugates the DM1 to the trastuzumab.
  • the compound is designed to deliver DM1 to HER2-overexpressing cancer cells. Preclinical studies have indicated the growth-inhibitory effect of trastuzumab-DMl in HER2-overexpressing and trastuzumabresistant cells (Lewis Phillips GD et al. 2008 Cancer Res 68:9280).
  • PI3K pathway inhibitors are also used for treating HER2 expressing tumors.
  • HER2- overexpressing breast cancer cells are believed to be dependent on the PI3K signaling pathway, and a number of genetic or epigenetic alterations in PI3K signaling molecules have been shown to cause resistance to trastuzumab or small-molecule HER2 kinase inhibitors.
  • HER2-overexpression and PIK3CA mutations frequently occur simultaneously in breast cancer cells (Oda K et al. 2008 Cancer Res 68:8127), and cell lines with either HER2 amplification or PIK3CA mutation are equally Akt-dependent (She QB et al. 2008 PLoS ONE 3:e3065).
  • PI3K pathway inhibitors may therefore be useful in overcoming resistance to anti-HER2 agents. Indeed, PI3K/mTOR dual inhibitor and Akt inhibitor were shown to effectively inhibit cellular growth in trastuzumab-and lapatinib resistant cells. At present, many classes of PI3K pathway inhibitors are in clinical development, and their roles in overcoming trastuzumab resistance will be tested in the future.
  • Inhibitors of alternative signaling molecules are also used to treat trasuzumab resistant cancer cells.
  • Alternative signaling from IGF-1R or MET may be associated with trastuzumab resistance.
  • Small-molecular weight inhibitors of IGF-1R or MET receptor tyrosine kinase, and anti-IGF-1 antibody and anti-HGF antibody are in clinical development at present. Monotherapy or combination therapy with these agents and trastuzumab is therefore an attractive therapeutic strategy.
  • HER2 vaccines and adoptive immunotherapy targeting the HER2 extracellular domain have been tested in clinical trials, with results showing that significant levels of durable T-cell HER2 immunity can be generated with active immunization without significant consequences with regard to autoimmunity against normal tissues (Bernhard H et al 2002 Endoctr Relat Cancer 9:33).
  • Early data from clinical trials testing the potential use of HER2-specific vaccines in adjuvant therapy for high-risk breast cancer patients show promising results (Peoples GE et al. 2008 Clin Cancer Res 14:797).
  • Ertumaxomab (Rexomum, Fresenius Biotech GmbH, phase II study) is an intact bispecific antibody targeting HER2 and CD3 on T cells with preferential binding to activating Fee type I/III receptors and redirecting T cells, macrophages, dendritic cells, and natural killer cells to HER2expressing tumor sites ( Kiewe P et al. 2008 Expert Opin Investig Drugs 17: 1553). In a phase I trial, ertumaxomab treatment was associated with one complete response, two partial responses, and two stable diseases in patients with metastatic breast cancer who had received extensive prior treatment (Kiewe P et al. 2006 Clin Cancer Res 12:3085).
  • Defucosylated trastuzumab is also used to treat trastuzumab resistant cancer cells. Removal of fucose from antibody oligosaccharides attached to the heavy chain of Asn 297 (defucosylation) has been shown to significantly enhance antibody-dependent cellular cytotoxicity (ADCC) compared to the activity of regular antibodies. In addition, defu- cosylation of trastuzumab was also found to enhance ADCC in an in vitro assay as compared to regular trastuzumab (Suzuki E et al. 2007 Clin Cancer Res 13:1875).
  • trastuzumab more than doubled the median progression-free survival compared with conventional trastuzumab in preclinical models of HER2-amplified breast cancer (Juntilla et al. 2010 Cancer Res 70: 4481).
  • any of the above agents including paclitaxel, docetaxel, dasatinib, erlotinib, gefitinib, lapatinib, pertuzumab, trastuzumab, ertumaxomab, trasuzumab-DMl, defucosylated trastuzumab, PI3K pathway inhibitors and HER2 vaccines are here envisioned to be useful in combination with nanobiopolymer conjugate compositions herein to treat breast cancers by methods described herein.
  • Nanobiopolymers as a platform for carrying multiple drugs for treatment of HER2/neu cancers
  • Advantages of drug combinations can be offered in a single molecular entity such as a nanobiopolymeric conjugate.
  • These compounds offer enhanced cancer cell specificity because of the presence of tumor targeting antibodies, bypass drug resistance by delivering polymer-bound drugs into cancer cell cytoplasm, and can carry multiple drugs on a single platform (Wu K et al. 2010 Angew Chem Int Ed Engl. 9:1451).
  • Efficient delivery of nanobiopolymer-attached drugs to tumors is increased by passive targeting through enhanced permeability and retention (EPR) effect typical for tumors (Maeda H et al.
  • EPR enhanced permeability and retention
  • tumor-targeting antibodies have been used as drug carriers or directly as therapeutics (e.g., Herceptin ® ).
  • Dendrimer nanoconjugates with attached Herceptin ® displayed enhanced accumulation in breast cancer cells in animal models (Shukla R et al. 2006 Bioconjug Chem 17: 1109).
  • Methotrexate-loaded dendrimers produced a cytotoxic effect in tumor cells in vitro resulting from Herceptin ® -mediated complex internalization (Shukla R et al. 2008 Nanotech 19: 1).
  • the efficacy of these nanodrugs was limited because of lack of efficient endosome release unit (Shukla R et al. 2008 Nanotech 19:1). Drugs were specifically delivered to cancer cells and tumor growth was inhibited as was angiogenesis in brain glioma-bearing animals (Fujita M et al. 2006
  • Angiogenesis 9 183; Ljubimova JY et al. 2008 Chem Biol Interact. 171 :195).
  • the efficiency of the polymers was associated with properties of tumor targeting, use of AON drugs to more than one tumor marker at the same time, and the presence of endosome disruption moiety ensuring drug release inside the target cell (Gasslmaier B et al. 2000 Eur J Biochem. 267:5101).
  • PMLA is a natural polymer obtained from the slime mold Physarum polycephalum (Lee BS et al. 2006 Bioconjug Chem 17:317; Lee BS et al. 2002 Water-soluble aliphatic polyesters :poly(malic acid)s, in: Doi YSA, eds, Biopolymers, Weinheim: Wiley- VCH, 2002 pp.75- 103).
  • PMLA is non-toxic, non-immunogenic, and biodegradable in vitro and in vivo, stable in the bloodstream, and highly water-soluble (Gasslmaier B et al. 1997 Eur J Biochem 250:308; Gsslmeier B et al.
  • morpholino AONs having nucleotide sequences specific to cc4 and ⁇ chains of a tumor vasculature-specific protein, laminin-411 (formerly, laminin-8), to intracranial glioblastoma was shown to result in marked inhibition of tumor angiogenesis and growth (Ljubimova JY et al. 2008 Nanomedicine 3:247; Ding H et al. 2010 Proc Natl Acad Sci online publication). Further, to target tumor vasculature, a mAb to transferrin receptor (TfR) was attached to the same nanoplatform.
  • TfR transferrin receptor
  • the nanobiopolymer composition carrying each of anti-HER2/neu antibody (Herceptin ® ), anti-TfR antibody, and AON to WSR2/neu is shown herein to enhance the specificity and anti-tumor effect towards HER2/neu positive breast cancer.
  • the lead compound tested herein is a nanoplatform designed to work on several molecular levels, to inhibit the synthesis of new BER2/neu receptors with AON, and to block the activity of existing RERl/neu on the tumor cell membrane with Herceptin ® .
  • AONs Antisense oligonucleotides that bind specifically to mRNA and block protein synthesis are tools specific for silencing gene expression. Efficient delivery of AONs and siRNAs in systemic treatment of tumors however still presents significant problems (Patil SD et al. 2005 AAPS 7:E61; Thierry et al, 2003 Curr Opin Mol Ther 5:133).
  • Nanoparticles are used in drug delivery as carriers for small and large molecules.
  • Nanoparticles are defined as particulate dispersions or solid particles with a size in the range of 10-1000 nm. The drag is dissolved, entrapped, encapsulated or attached to a nanoparticle matrix (Langer R. 2000 Acc Chem Res 33:94). Nanobiopolymers of the present invention differ from nanoparticles in that nanoparticles have no covalent bonds between the particle and drug cargo, generally merely leak the drug, and accordingly cannot directly transport cargo to and release the cargo inside tumor cells.
  • nanobiopolymer compositions comprise a single unitary molecular entity having functional modules including a plurality of the following: tumor cell-targeting antibodies, two or more anti-tumor drugs, an endosomal disruption moiety, and a glutathione-cleavable bond to release the drug inside tumor cell cytoplasm, covalently attached.
  • Such a construct functions to eliminate leakiness, suppresses non-tumor accumulation thereby minimizing side effects, and increase drug half-life dwell time of the composition in plasma.
  • tumor uptake and drug specificity were observed in examples herein to be enhanced, leading to a significant reduction of tumor growth and volume.
  • the combined drug action through inhibiting Akt activation and increase of tumor cell apoptosis was also observed in examples herein.
  • Nanobiopolymers of the present invention offer a great potential in cancer therapy.
  • Table 1. summarizes nanobiopolymer drugs synthesized for use in Examples herein.
  • molecular scaffold refers to a molecule having at least two or more modules that transport a covalently conjugated drug to a targeted tissue; bind to cell surface receptors of the tissue; internalize into endosomes; escape the endosomes into the cytoplasm; and release reactive free drug in the cytoplasm by chemical reaction with glutathione and other sulfhydryl groups of the cytoplasmic content.
  • the specificity of high molecular mass drug vehicles and particles rests primarily on the tumor tissue targeting by tumor-specific conjugated targeting molecules and their enhanced permeability and retention in tumors that originates from high molecular mass such as greater than 20000 (Duncan R. 1999 Research Focus 2:441; Seymour LW et al., 1995 Eur J Cancer Res 31A:766).
  • polymalic acid refers to a polymer, e.g., a homopolymer that contains a main chain ester linkage, is biodegradable and of a high molecular flexibility, soluble in water (when ionized) and organic solvents (in its acid form), non-toxic, and non-immunogenic (Lee Bs et al., Water-soluable aliphatic polyesters:
  • poly(malic acid)s in: Biopolymers, vol.3a (Doi Y, Steinbuchel A eds., pp 75-103, Wiley- VCH, New York 2002).
  • Drug carrying PMLA is synthesized by ring-opening polymerization of derivatized malic acid lactones.
  • Doxorabicin-poly-malic acid has been synthesized from synthetic poly-P-D, L-malic acid (Abdellaoui K et al., 1998 Eur J Pharmaceutical Sciences 6:61).
  • the carrier consists of poly(P -L-malic acid), herein referred to as poly- ⁇ -L-malic acid or PMLA, representing the molecular backbone or scaffold that is chemically conjugated at its carboxylic groups at defined ratios with a variety of modules each of which performs at least one of the following functions: delivery of a pro-drug via a releasable functional module that becomes effective in the cytoplasm; directing the carrier towards a specific tissue by binding to the surfaces of cells, e.g., a monoclonal antibody (mAB); internalization into the targeted cell through endosomes (usually via internalization of a targeted surface receptor); promoting escape from endosomes into the cytoplasm by virtue of hydrophobic functional units that integrate into and finally disrupt endosomal membranes; increasing effectiveness during acidification of endosomes en route to lysosomes; and protection by polyethylene glycol (PEG) against degradative enzyme activities, e.g., peptidases, proteases, etc
  • module refers to a biologically active molecular structure that forms a part of a composition herein, for example, a small drug molecule or a chromophore molecule; a protein molecule such as an antibody or lectin; or a portion thereof that are covalently joined to PMLA in constructing the composition.
  • a biologically active module is exemplified by morpholino antisense oligonucleotides (AON) that are specific to HER2/neu receptor protein.
  • Tissue targeting is exemplified by use of a monoclonal antibody (mAB) module that specifically recognizes and binds a transferrin receptor protein.
  • mAB monoclonal antibody
  • transferrin receptor protein refers to the receptor expressed on endothelium cell surfaces, and at elevated levels on certain tumors (Lee JH et al. 2001 Eur J Biochem 268:2004; Kovar MK et al, 2003 J Drug Targeting 10:23).
  • Transferrin receptors are used as a target for a drug delivery system in compositions herein, to chemically bind to transferring, for example using a monoclonal antibody that binds the transferrin receptor and thereby achieves transcytosis through endothelium associated with blood brain barrier. Antibody binding to transferrin receptor and internalization into endosomes has been demonstrated (Broadwell RD et al, 1996 Exp Neurol 142:47). It will be appreciated that in the case of the transferrin receptor any appropriate antibody monoclonal antibody, for example, a humanized or chimeric antibody, or a lectin or another ligand specific to the transferrin receptor can be used. Other appropriate ligands to any number of cell surface receptors or antigens can be used as targets in the compositions herein and transferrin receptor is merely examplary.
  • endosomal escape unit refers to a carrier module attached to the PMLA scaffold that becomes active by acidification during maturation of the endosomal vesicles towards lysosomes (Bulmus V et al, 2001 Cancer Research 61:5601; Lackey CA et al, 2002 Bioconjugate Chem 13:996).
  • the carrier module includes a plurality of leucine or valine residues, or a leucine ethylester linked to the PMLA scaffold by amide bonds. During acidification of the endosomes en route to lysosomes, these stretches of the carrier molecule become charge-neutralized and hydrophobic, and capable of disrupting membranes. Other molecules that become charge neutralized at lysomal pH's may be used in place of leucine or valine residues, or a leucine ethylester in construction of the
  • compositions containing PMLA and an endosomal escape unit module are provided.
  • PEGylation is generally used in drug design to increase the in vivo half-life of conjugated proteins, to prolong the circulation time, and enhance extravasation into targeted solid tumors (Arpicco S et al. 2002 Bioconjugate Chem 13:757; Maruyama K et al, 1997 FEBS Letters 413:1771).
  • Other molecules known to increase half-life may be used in design of compositions herein.
  • cancer and “cancerous” refer to the physiological condition in mammals in which a population of cells are characterized by unregulated cell growth.
  • cancers include, without limitation, carcinoma, lymphoma, blastoma, sarcoma, and leukemia.
  • cancers include squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancers.
  • proliferative disorder and “proliferative disease” refer to disorders associated with abnormal cell proliferation such as cancer.
  • tumor and “neoplasm” as used herein refer to any mass of tissue that result from excessive cell growth or proliferation, either benign (noncancerous) or malignant (cancerous) including pre-cancerous lesions.
  • primary cancer refers to the original site at which a cancer originates. For example, a cancer originating in the breast is called a primary breast cancer. If it metastasizes, i.e., spreads to the brain, the cancer is referred to as a primary breast cancer metastatic to the brain.
  • metalastasis refers to the process by which a cancer spreads or transfers from the site of origin to other regions of the body with the development of a similar cancerous lesion, i.e., having the same or substantially the same biochemical markers at the new location.
  • a “metastatic” or “metastasizing” cell is one that has a reduced activity for adhesive contacts with neighboring cells and migrates by the bloodstream or within lymph from the primary site of disease to additional distal sites, for example, to invade neighboring body structures or distal structures.
  • cancer cell refers to a cell derived from a tumor or a pre-cancerous lesion including both a non-tumorigenic cell and a tumorigenic cell, i.e., cancer stem cell.
  • tumorigenic refers to the functional features of a solid tumor stem cell including the properties of self-renewal i.e., giving rise to additional tumorigenic cancer cells, and proliferation to generate other tumor cells i.e., giving rise to differentiated and thus non-tumorigenic tumor cells, such that cancer cells form a tumor.
  • target a tumorigenic cell or a cancer cell refers to delivery of a composition to a population of tumor-forming cells within tumors, i.e., tumorigenic cells.
  • the preferential delivery of the composition to the tumorigenic population of cancer cells in comparison to other populations of cells within tumors is referred herein as targeting to eliminate cancer cells, a property that improves specificity and efficacy of the composition.
  • antibody is used herein to mean an immunoglobulin molecule that is a functional module included in compositions herein for ability to recognize and specifically bind to a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combinations of the foregoing through at least one antigen recognition site within the variable region of the immunoglobulin molecule.
  • a target such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combinations of the foregoing through at least one antigen recognition site within the variable region of the immunoglobulin molecule.
  • antibodies included as functional modules of compositions herein include a class described as antagonist antibodies, which specifically bind to a cancer stem cell marker protein and interfere with, for example, ligand binding, receptor dimerization, expression of a cancer stem cell marker protein, and/or downstream signaling of a cancer stem cell marker protein.
  • antibodies as functional modules in compositions herein include agonist antibodies that specifically bind to a cancer stem cell marker protein and promote, for example, ligand binding, receptor dimerization, and/or signaling by a cancer stem cell marker protein.
  • antibodies that do not interfere with or promote the biological activity of a cancer stem cell marker protein instead function to inhibit tumor growth by, for example, antibody internalization and/or recognition by the immune system.
  • an antibody encompasses intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments (such as Fab, Fab', F(ab')2, and Fv fragments), single chain Fv (scFv) mutants, multispecific antibodies such as bispecific antibodies generated from at least two intact antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen determination portion of an antibody, and any other modified immunoglobulin molecule comprising an antigen recognition site so long as the antibodies exhibit the desired biological activity.
  • An antibody includes any the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g.
  • IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) based on the identity of their heavy-chain constant domains referred to as alpha, delta, epsilon, gamma, and mu, respectively.
  • Antibodies can be naked or conjugated to other molecules such as toxins, radioisotopes, etc. In other embodiments an antibody is a fusion antibody.
  • antibody fragment refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody.
  • antibody fragments include, but are not limited to Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, single chain antibodies, and multispecific antibodies formed from antibody fragments.
  • an “Fv antibody” refers to the minimal antibody fragment that contains a complete antigen-recognition and -binding site either as two-chains, in which one heavy and one light chain variable domain form a non-covalent dimer, or as a single-chain (scFv), in which one heavy and one light chain variable domain are covalently linked by a flexible peptide linker so that the two chains associate in a similar dimeric structure.
  • scFv single-chain
  • the complementarity determining regions (CDRs) of each variable domain interact to define the antigen-binding specificity of the Fv dimer.
  • a single variable domain or half of an Fv can be used to recognize and bind antigen, although generally with lower affinity.
  • a “monoclonal antibody” as used herein refers to homogenous antibody population involved in specific recognition and binding of a single antigenic determinant, or epitope.
  • Polyclonal antibodies include a population of antibody species each directed to a different antigenic determinant.
  • the term “monoclonal antibody” encompasses both and full-length monoclonal antibodies and antibody fragments (such as Fab, Fab', F(ab')2, Fv), single chain (scFv) mutants, fusion proteins comprising an antibody portion, and any other modified immunoglobulin molecule comprising an antigen recognition site.
  • “monoclonal antibody” refers to those obtained without limitation by methods including and not limited to hybridoma expression, phage selection, recombinant expression, and by transgenic animals.
  • a pharmaceutical composition in one aspect of the present invention, includes a nanobiopolymeric conjugate of poly(P-L-malic acid) referred to as poly-p-L- malic acid or PMLA herein, covalently linked to an antisense molecule that is a functional module that inhibits expression of an oncogenic protein, and at least one module that is an antibody specific for the protein, and optionally further comprises a module that is an antibody specific for an oncogenic vascular protein, and a pharmaceutically acceptable carrier.
  • the composition optionally further comprises one or more additional modules that are additional therapeutic agents.
  • the additional therapeutic agent or agents is selected from the group consisting of growth factors, anti-inflammatory agents, vasopressor agents, collagenase inhibitors, topical steroids, matrix metalloproteinase inhibitors, ascorbates, angiotensin II, angiotensin III, calreticulin, tetracyclines, fibronectin, collagen, thrombospondin, transforming growth factors (TGF), keratinocyte growth factor (KGF), fibroblast growth factor (FGF), insulinlike growth factors (IGF), epidermal growth factor (EGF), platelet derived growth factor (PDGF), neu differentiation factor (NDF), hepatocyte growth factor (HGF), and hyaluronic acid.
  • TGF transforming growth factors
  • KGF keratinocyte growth factor
  • FGF fibroblast growth factor
  • IGF insulinlike growth factors
  • EGF epidermal growth factor
  • PDGF platelet derived growth factor
  • NDF hepatocyte growth factor
  • HGF hepatocyte growth factor
  • the term "pharmaceutically acceptable carrier” includes any and all solvents, diluents, or other liquid vehicle, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. Remington's
  • compositions and known techniques for the preparation thereof.
  • materials which can serve as pharmaceutically acceptable carriers include, but are not limited to, sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppositoiy waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols; such a propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water
  • the invention provides methods for the treatment of a cancer associated with a particular receptor comprising administering a therapeutically effective amount of a pharmaceutical composition comprising active agents that inhibits expression of at least one ligand of the receptor to a subject in need thereof, in such amounts and for such time as is necessary to achieve the desired result. It will be appreciated that this encompasses administering an inventive pharmaceutical as a therapeutic measure to promote regression of a cancer or prevent further development or metastasis, or as a prophylactic measure to minimize complications associated with development of a tumor or cancer.
  • a "therapeutically effective amount" of the pharmaceutical composition is that amount effective for preventing further development of a cancer or transformed growth, and even to effect regression of the cancer.
  • the compositions, according to the method of the present invention may be administered using any amount and any route of administration effective for prevention of development of a cancer.
  • the expression "amount effective for inhibiting expression or activity of the oncogenic protein", as used herein refers to a sufficient amount of composition to prevent or retard development of a cancer, and even cause regression of a cancer or solid tumor.
  • the cancer need not be limited to a solid tumor, and includes various types of lymphomas and leukemias.
  • the exact dosage is chosen by the individual physician with regard to the need of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active agent(s) or to maintain the desired effect. Additional factors which may be taken into account include the severity of the disease state, e.g. , cancer size and location; age, weight and gender of the patient; diet, time and frequency of administration; drug combinations; reaction sensitivities; and tolerance/response to therapy. Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once eveiy two weeks depending on half-life and clearance rate of the particular composition.
  • the active agents of the invention are preferably formulated in dosage unit form for ease of administration and uniformity of dosage.
  • dosage unit form refers to a physically discrete unit of active agent appropriate for the patient to be treated. It will be understood, however, that the total daily usage of the compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs as shown in Examples herein. The animal model is also used to achieve a desirable concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • a therapeutically effective dose refers to that amount of active agent which ameliorates the symptoms or condition.
  • Therapeutic efficacy and toxicity of active agents can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g. , ED50 (the dose is therapeutically effective in 50% of the population) and LD50 (the dose is lethal to 50% of the population).
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50.
  • Pharmaceutical compositions herein exhibit large therapeutic indices. The data obtained from the animal studies herein is used in formulating a range of dosage for human use.
  • Herceptin ® for human treatment accepted by the FDA is 4 mg/kg followed by 2 mg/kg weekly for a total of 52 doses.
  • An efficient dose of the composition herein for treatment of a mouse was 100 ⁇ of observed 40 ⁇ g ml, which is equivalent to about 3.2 mg/kg for human use.
  • compositions of this invention can be administered to humans and other mammals topically (as by powders, ointments, or drops), orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, or intravenously, depending on the severity and location of the cancer or other condition being treated.
  • Intravenous administration includes injection as a bolus, or as a drip.
  • compositions include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches.
  • the active agent is admixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives or buffers as may be required.
  • ocular or cutaneous infections may be treated with aqueous drops, a mist, an emulsion, or a cream.
  • Administration may be therapeutic or it may be prophylactic.
  • Prophylactic formulations may be present or applied to the site of potential tumors, or to sources of tumors.
  • the invention includes devices, surgical devices, audiological devices or products which contain disclosed compositions (e.g. , gauze bandages or strips), and methods of making or using such devices or products. These devices may be coated with, impregnated with, bonded to or otherwise treated with a disclosed composition.
  • the ointments, pastes, creams, and gels may contain, in addition to an active agent of this invention, excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc, zinc oxide, or mixtures thereof.
  • excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc, zinc oxide, or mixtures thereof.
  • Powders and sprays can contain, in addition to the agents of this invention, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates, polyamide powder, or mixtures of these substances.
  • Sprays can additionally contain customary propellants such as chlorofluorohydrocarbons.
  • Transdermal patches have the added advantage of providing controlled delivery of the active ingredients to the body.
  • dosage forms can be made by dissolving or dispensing the compound in the proper medium.
  • Absorption enhancers can also be used to increase the flux of the compound across the skin.
  • the rate can be controlled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel.
  • Injectable preparations for example, sterile injectable aqueous solutions or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents.
  • the sterile injectable preparation may be formulated a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1 ,3-butanediol.
  • acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S. P. and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil can be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid are used in the preparation of injectables.
  • the injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
  • sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
  • Delayed absorption of a parenterally administered active agent may be accomplished by dissolving or suspending the agent in an oil vehicle.
  • Injectable depot forms are made by forming microencapsule matrices of the agent in biodegradable polymers such as polylactide-polyglycolide as described herein, and in Ljubimova et al., US patent number 7,547,511 issued June 16, 2009, Ljubimova et al., US patent application number 12/473,992 published October 22, 2009, Ljubimova et al, US patent application number 10/580,999 published November 8, 2007, and Ding et al, International patent application PCT/US2009/40252 filed April 10, 2009.
  • the rate of active agent release is controlled by the ratio of active agent to polymer and the nature of the particular polymer employed.
  • biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the agent in liposomes or microemulsions which are compatible with body tissues.
  • compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the active agent(s) of this invention with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active agent(s).
  • suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active agent(s).
  • At least one of Inhibition of expression or activity of an oncogenic protein is useful to prevent development or metastasis of a cancer condition.
  • these inhibitors are clinically useful in preventing further growth of a particular cancer type, including but not limited to the breast cancer; skin cancer; ovarian cancer; cervical cancer; the retinoblastoma; colon cancer and other such conditions such as those arising from the lining of the gastrointestinal tract; lung cancer and cancers of the respiratory tract; renal carcinoma and other tumors arising from the inner surface of kidney tubules; leukemias and lymphomas and such disorder of blood; and other types of genital cancer including those associated with various strains of papilloma virus; brain tumors; and cancers of the uterus, of the vagina, of the urethra.
  • a particular cancer type including but not limited to the breast cancer; skin cancer; ovarian cancer; cervical cancer; the retinoblastoma; colon cancer and other such conditions such as those arising from the lining of the gastrointestinal tract; lung cancer and cancers of the respiratory tract; renal carcinoma and other tumors arising from the inner surface of kidney tubules; leukemias
  • the diagnostic, prognostic and therapeutic methods encompassed by the present invention are not limited to treating conditions in humans, but may be used to treat similar conditions in any mammal including but not limited to bovine, canine, feline, caprine, ovine, porcine, murine, and equine species.
  • the antisense oligonucleotides have a nucleotide sequence that is substantially identical in base sequence to that as it occurs naturally in the species.
  • ⁇ 1 ⁇ TM-3'- ⁇ 2 antisense oligonucleotides used in Examples herein were custom made by Gene Tools (Philomath, OR).
  • AONs specific for HER2/neu included two sequences:
  • a4 subunit 5 '-AGCTCAAAGCCATTTCTCCGCTGAC-3 ' (SEQ ID NO:4)
  • ⁇ subunit 5'- CTAGCAACTGGAGAAGCCCCATGCC-3 ' (SEQ ID NO:5).
  • siRNA specific for EGFR included sequences as follows:
  • siRNA specific for HER2 receptor protein included:
  • the nanobiopolymers contain five to six components (Figure 1): PMLA as the backbone; functional modules include: morpholino AON to inhibit HER2/neu protein synthesis; targeting anti-TfR mAb; anti-tumor Herceptin ® ; 40% leucine ethyl ester (LOEt) as endosome escape unit to achieve cytoplasmic AON delivery, and 5% PEG5000 to increase stability in the bloodstream.
  • Anti-mouse TfR mAb on Herceptin ® -containing conjugate was used to target tumor vasculature.
  • the conjugate with AON without Herceptin ® included an anti-human TfR mAb attached to it to promote drug binding to human tumor cells and its internalization.
  • the preconjugate containing 40% LOEt, 5% PEG5000 and 10% of cysteamine (% referring to the total amount of pendant carboxyl groups in polymalic acid) was synthesized by the methods described previously (Lee BS et al. 2006Bioconjug Chem 17:317).
  • the antibodies conjugated with the preconjugate were qualitatively and quantitatively assayed by size exclusion HPLC.
  • ELISA with purified TfR and HER2/neu was used to assess functional reactivity of attached antibodies as described (Fujita M et al. 2007 J Control Release. 122:356).
  • Conjugates for imaging were fluorescently labeled with Alexa Fluor ® 680 C2- maleimide (Invitrogen, Carlsbad, CA) by forming thioether with sulfhydryl groups.
  • Antibody conjugates were then reacted with HER2/neu AON ( Figure 1).
  • a control conjugate contained Herceptin ® ( Figure 1) and not Hisi?2/ «ew-specific AON.
  • Example 3 The nanobiopolymer characterization
  • HPLC nanobiopolymer hydrolysis at 100°C in the presence of 6 M HQ, PEG colorimetric determination and protein quantification, size and potential, HPLC, and ELISA.
  • HPLC was performed on a Hitachi analytical Elite LaChrom HPLC-UV system (Hitachi,
  • Human breast cancer cell lines BT-474, SKBR-3, MDA-MB-231, MDA-MB-435, MDA-MB-468, and MCF-7 were obtained from American Type Culture Collection
  • BT-474, MDA-MB-231, MDA-MB-435, MDA-MB-468, and MCF-7 were cultured in DMEM with 10% fetal bovine serum and antibiotics.
  • SKBR-3 was cultured in McCoy's 5A medium with 10% fetal bovine serum and antibiotics.
  • nanobiopolymer denotes a drug delivery system with PMLA as a nanoplatform and functional module groups covalently attached to the PMLA, including an AON, a rat anti-mouse or a mouse anti-human targeting TfR mAbs (M and H, respectively), and LOEt as the endosomal escape unit module.
  • the nanobiopolymer drags ( Figure 1 and Table 1) described herein to treat HER2/ «eu-positive breast cancer contained either a drug HER2/neu AON or drug Herceptin ® or both HER2/neu AON + Herceptin ® .
  • Example 6 Cell proliferation assay
  • HER2/new-overexpressing breast cancer cells each of BT-474 or SKBR-3 were seeded into six- well plates at 3 ⁇ 10 5 cells/well. The next day, cells were treated with one of Endoporter (4 ⁇ ; control); Herceptin (40 g/ml); P/mPEG/LOEt/Herceptin ® (40 ⁇ ); Endoporter (4 ⁇ ) and AON (4 ⁇ ); P/mPEG/LOEt/AON/TfR(H/M);
  • BT-474 and SKBR-3 breast cancer cells were treated with Herceptin ® (40 ⁇ g ml); P/mPEG/LOEt/Herceptin ® (40 ⁇ g/ml equivalent to Herceptin ® ); Endoporter (4 ⁇ ) and AON (4 ⁇ ); P/ mPEG/LOEt/ AON/TfR(H/M) ; P/mPEG/LOEt/AON/Herceptin ® /TfR(M); PBS control, or 4 ⁇ Endoporter.
  • Cell lysates were collected after 72 hours and were analyzed by western blotting as described previously (Inoue S et al. 2005 Mol Ther. 12:707- 15).
  • Lysates of excised breast tumors after various treatments were analyzed by these methods.
  • the following anti-human primary antibodies were used: HERl/neu, Akt, phosphorylated Akt (p-Akt), glyceraldehyde 3-phosphate dehydrogenase (GAPDH, to normalize gel load) (all from Cell Signaling Technology, Beverly, MA), and poly(ADP ribose) polymerase (PARP; BD Biosciences, San Jose, CA).
  • mice (CrTac: NCr-Foxnlnu Homozygous; Taconic, Hudson, NY) were used.
  • a 0.72-mg, 90-day release, ⁇ - ⁇ ⁇ pellet (Innovative Research of America, Sarasota, FL) was inserted subcutaneously into the back of each mouse seven days prior to injection.
  • mice An amount of 1 x 10 7 BT-474 cells suspended in 150 ⁇ of Matrigel (BD Biosciences, Bedford, MA) were injected into the right flank of each of 35 mice (5 mice per group), and treatment was initiated when tumors achieved an average size of > 120 mm 3 (21 days after injection). Mice were divided into five treatment groups and each group was administered either of: sterile PBS (control); Herceptin ® (40 ⁇ ); P/mPEG/LOEt/Herceptin ® (40 ⁇ g/ml equivalent to Herceptin ® ); P/mPEG/LOEt/AON/Tf (H/M); or
  • Tumor xenografts were measured with calipers twice a week, and tumor volumes were determined using the formula: (lengthx width ) x ( ⁇ /6).
  • mice were euthanized; the tumors were harvested to detect the fluorescent signal, snap-frozen in liquid nitrogen and embedded in OCT compound for confocal microscopy (TCS SP5 X microscope; Leica Microsystems, Mannheim, Germany).
  • Example 10 In vivo imaging
  • BT-474 human breast cancer cells were implanted into the right thigh of mice as described.
  • tumor size attained 120 mm 160 ⁇ of Alexa Fluor 680 labeled nanobiopolymers was injected intravenously (4 ⁇ ).
  • P/mPEG/LOEt/IgG was used as a negative control.
  • Drug distribution and localization was assessed in tumor-bearing mice using Xenogen IVIS 200 imager (Caliper Life Sciences, Hopkinton, MA), at different time points before drug administration, 1 h, 3 h, 6 h, and 24 h after the drug injection). Twenty- four hours after drug administration, mice were euthanized and the circulating drugs eliminated by intraarterial PBS perfusion. The tumor and major organs were harvested to detect the fluorescent signal.
  • Example 11 Statistical analysis
  • Example 13 The lead nanobiopolymer carrying both Herceptin ® and HER2/neu AON (P/mPEG/LOEt/AON/Herceptin ® /TfR(M)) inhibited growth of breast cancer cells in vitro
  • AON and Herceptin ® was first examined. Based on optimization experiments, each of AON at 4 ⁇ with 4 ⁇ Endoporter (in vitro AON delivery agent, GeneTools), and Herceptin ® , at 40 g/ml was analyzed. Results in Figure 2 are shown for HER2/new high-expressing cells BT474 and SKBR-3, as well as for low-expressing cells, MDA-MB-231 and MDA- MB-435. At the concentrations used, it was observed that each of free AON and Herceptin ® resulted in some growth inhibition in HER2/new high-expressing cells. Low-expressing cell lines were observed to be significantly less responsive to these treatments.
  • nanobiopolymeric conjugates (a two-drug compound and single-drug compounds shown in Figure 1) were then tested for tumor cell growth inhibitory effect.
  • the nanobiopolymers, Herceptin ® , and free AON caused significant growth inhibition compared to PBS control in HERl/neu high-expressing cells ( Figure 2 top, P ⁇ 0.01).
  • the lead two- drug compound produced the strongest inhibitory effect that was significantly higher than that of the other nanobiopolymers tested and higher than Herceptin ® (P ⁇ 0.005 compared to all groups).
  • HERl/neu low-expressing cells only the lead compound with AON, Herceptin ® and TfR(M) was able to induce statistically significant inhibition of tumor growth compared to PBS ( Figure 2 bottom, PO.02).
  • Example 14 The lead compound inhibits HER2/neu and p-Akt expression and induces apoptosis of HER2/neu-overexpressing breast cancer cells in vitro
  • PI3K phosphatidylinositol-3 kinase
  • Akt serine/threonine kinase Akt
  • HERl/neu signaling can activate the PI3K/Akt/mTOR cascade, and activated Akt stimulates increases in cell size, metabolism and survival (Plas DR et al. 2005 Oncogene 24:7435).
  • phosphorylation of pertinent signaling markers HERl/neu, Akt, and p-Akt were assessed.
  • HERl/neu high-expressing cell lines BT-474 and SKBR-3 were used ( Figure 3 panel A). To determine whether the nanobiopolymer carrying both HERl/neu AON and
  • Herceptin ® induces apoptosis, PARP cleavage was examined by western blot analysis.
  • HERl/neu expression was inhibited to different extents by each of Herceptin ® , AON, and the single-drug versions of the nanobiopolymer [P/mPEG/LOEt/Herceptin and P/mPEG/LOEt/AON/TfR(H/M)] in comparison with controls.
  • the strongest inhibition of HERl/neu expression was observed upon treatment with the lead nanobiopolymer having AON and Herceptin ® attached to the PMLA carrier molecule.
  • p-Akt a key downstream mediator of HERl/neu signaling (Tseng PH et al, 2006 Mol Pharmacol. 70:1534), was inhibited to different extents in tumor cells treated with Herceptin ® , AON, or single-drug versions of nanobiopolymer compared to control cells treated with PBS or AON transduction reagent Endoporter.
  • the p-Akt signal upon treatment of both breast cancer cell lines with the lead drug carrying both Herceptin ® and HER2/neu AON was observed to be markedly lower in comparison to treatment with any other agent (Figure 3 panel B). The amount of total Akt on western blots remained unchanged by each of the treatment.
  • Apoptosis assessed by PARP cleavage was induced to some extent by each of Herceptin ® , AON, and single-drug nanobiopolymers in HERl/neu high-expressing cells, for example in BT-474 cell line.
  • the lead compound
  • P/mPEG/LOEt/AON/Herceptin ® /TfR(M) triggered apoptosis to a greater extent than the other agents in both cell lines, as shown by increased PARP cleavage compared to the other agents ( Figure 3 panel B).
  • Example 15 The lead compound P/mPEG/LOEt/AON/Herceptin ® /TfR(M) specifically accumulates in HER2/neu-overexpressing breast tumors in vivo
  • P/mPEG/LOEt/AON/Herceptin ® /TfR(M) having anti-mouse TfR and anti-human HER2/neu combined on the same PMLA molecule provided tumor-specific drug delivery through host endothelial system into subcutaneous human breast tumors. Twenty-four hours after injection of drugs, the compounds were observed to accumulate mostly in the tumor and draining organs, kidney and liver ( Figure 4).
  • the nanobiopolymer with only Herceptin ® accumulated to a lesser extent in tumors than the version with Herceptin ® , AON and anti- TfR mAb (the lead drug).
  • Example 16 The lead compound P/mPEG/LOEt/AON/Herceptin ® /TfR(M) significantly inhibits HER2/neu positive breast tumor growth in vivo
  • compositions herein following intravenous administration in subcutaneous mouse models of human breast tumor xenografts was investigated.
  • Cell line BT-474 was selected for in vivo analysis because of its high HER2/ «eu expression and tumorigenicity.
  • Treatment of BT-474 tumor-bearing mice with Herceptin ® , single-drug nanobiopolymers and the lead compound P/mPEG/LOEt/AON/Herceptin ® /TfR(M) was performed and compared to negative control PBS. No decreases in body weight or morbidity, or death was observed, indicating that each treatment was well tolerated.
  • P/mPEG/LOEt/AON/Herceptin ® /TfR(M) was 80% at the start of follow-up to 95% at the end of this period (day 56; Figure 6 panel B). Moreover, tumors in the group treated with this lead compound started to regress within the two weeks after the initial treatment, and tumors in this group remained suppressed for an additional 20 days, at which time the treatment was terminated.
  • Herceptin ® , P/mPEG/LOEt/Herceptin ® , or P/mPEG/LOEt/AON/TfR(H/M) showed some areas of cell death compared with PBS (control) treated tumor. Significantly, treatment with the lead compound led to the appearance of massive morphologically necrotic areas with little unaffected tumor tissue remaining ( Figure 6 panel A).
  • Apoptosis assessed by PARP cleavage was induced to some extent by each of the compouns in HER2/neu high-expressing tumors compared to PBS treatment.
  • lead P/mPEG/LOEt/AON/Herceptin ® /TfR(M) markedly increased PARP cleavage compared to the other treatments indicating that this nanobiopolymer induced apoptosis to a greater extent than the other used drugs (Figure 6 panel C).
  • Example 17 Nanobiopolymer conjugates significantly inhibited triple negative breast cancer growth in vivo
  • TNBC triple-negative breast cancer
  • a set of nanobiopolymeric conjugates specifically tailored for HER2/ «ei -expressing breast cancer treatment was designed and tested in vitro and in vivo.
  • the drug was based on UER2/neu inhibition by simultaneously blocking the synthesis of HER2/neu with specific AON and internalizing the receptor by binding to Herceptin ® .
  • the lead drug was based on UER2/neu inhibition by simultaneously blocking the synthesis of HER2/neu with specific AON and internalizing the receptor by binding to Herceptin ® .
  • P/mPEG/LOEt/AON/Herceptin ® /TfR(M) was thus designed to more efficiently inhibit HER2/ «e « expression and function.
  • the lead drug, P/mPEG/LOEt/AON/Herceptin ® /TfR(M) suppressed proliferation of HER2/ «ew-positive breast cancer cell lines significantly more than Herceptin ® , P/mPEG/LOEt/Herceptin ® or P/mPEG/LOEt/AON/TfR(H/M) ( Figure 2).
  • the lead nanobiopolymer was effective for both ⁇ /neu high- and low-expressing HER2/ «ew breast cancer cell lines.
  • the lead drug was also superior to previously used HER2/neu AON, which did not inhibit their growth in vitro (Roh H et al. 2000 Cancer Res. 60:560). Moreover, the lead drug carrying both Herceptin ® and HER2/neu AON produced the highest inhibition of both RER2/neu expression and Akt
  • Herceptin ® mediates anti-proliferative effects in HER2/ «ew-positive cells by facilitating either HERl/neu degradation or endocytic destruction of the HER2/neu receptor or downregulation of PDK-Akt signaling (Clark AS et al. 2002. Mol Cancer Ther 1 : 707- 17) by inhibiting HER2/ne « receptor dimerization, and also by inducing immune activation (Hudis CA 2007 N Engl J Med 357:39).
  • Examples herein show that the in vitro growth-inhibiting effect of the lead drug carrying both Herceptin ® and HER2/neu AON on tumor cells was enhanced by simultaneous AON-mediated inhibition of HER2/new synthesis and by downregulation of surface HER2/neu through its binding to Herceptin ® .
  • the stronger inhibition of Akt phosphorylation in this case could result from a significant attenuation of HER2/ «ew signaling.
  • the lead drug P/mPEG/LOEt/AON/Herceptin ® /TfR(M) was observed in examples herein to readily accumulate in breast tumors and dramatically inhibit human breast cancer growth in nude mice (Figure 6).
  • the magnitude of anti-tumor effect of this lead drug indicates synergy between HER2/neu AON and Herceptin ® in vivo ( Figure 6).
  • the in vitro effect showed about 50% growth inhibition in high RERl/neu- expressing cells, in contrast to nearly complete in vivo inhibition.
  • the synergistic anti-tumor action in vivo could result from a combination of several effects: enhanced reduction in HER2/??ew-mediated tumor growth by AON together with Herceptin ® , preferential tumor accumulation mediated by combined EPR effect (Maeda H et al. 2009 Eur J Pharm Biopharm 71 :409) and active targeting with antibodies (Ljubimova JY et al. 2008 Chem Biol Interact 171: 195), and maintenance of effective drug concentration due to multiple treatments.
  • the nanobiopolymeric conjugate herein is envisioned as free of side effects because of absence of toxic doxorubicin and of its efficient tumor targeting via Herceptin ® and anti-TfR.
  • P/mPEG/LOEt/AON/Herceptin ® /TfR(M) efficiently blocked ERllneu positive breast tumor growth through dual inhibition of HER2/neu and Akt phosphorylation, and as a result promoted enhanced tumor cell apoptosis.
  • nanobiopolymer resulted in highly specific drug accumulation in the tumor tissue and inside tumor cells.
  • Nanobiopolymer platforms for combinatios of drugs to treat breast cancers Nanobiopolymer compositions herein can be engineered to include any of at least one of functional modules: an antibody, drug, or AON, alone or in combination.
  • the nanobiopolymer conjugates herein are nanodmgs that are tailored to target simultaneously different molecular tumor markers typical of particular tumor cells and therefore are highly efficient against various tumors.
  • nanobiopolymer conjugates of the present invention are covalently linked to one or more antineoplastic agents selected from the following group: a tyrosine kinase inhibitor lapatinib targeting EGFR and HER2 receptor proteins; pertuzumab, a monoclonal antibody (mAb) specific for HER2 receptor;
  • antineoplastic agents selected from the following group: a tyrosine kinase inhibitor lapatinib targeting EGFR and HER2 receptor proteins; pertuzumab, a monoclonal antibody (mAb) specific for HER2 receptor;
  • ertumaxomab a bispecific antibody specific for HER2 and F ⁇ y RI/III; trastuzumab-DMl, mAb-toxin specific for HER2; CP-751,871, mAb specific for IFG-1R; foretinib
  • GSKl 36089 a tyrosine kinase inhibitor targeting MET and VEGFRs
  • BEZ235 targeting proteins of mTOR/PI3K pathway
  • perifistone targeting Akt pathway temsirolimus targeting mTOR
  • everolimus targeting mTOR HER2 peptide-based vaccines
  • defucosylated trastuzumab mAb specific for HER2
  • dasatinib a small-molecule tyrosine kinase inhibitor targeting the cytosolic c-SRC and ABL1 kinases, as well as the RTKs c-KIT and platelet- derived growth factor receptors, alpha and beta
  • gefitinib and erlotinib inhibitors of EGFR. It is envisioned that these nanodrags and nanodrug combinations are effective for treatment of cancer cells in vivo in subjects including human patients.
  • the nanobiopolymer-based therapy used for treatment of BER2/neu expressing cancer cells and/or triple-negative cancer cells should make a significant clinical impact.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Oncology (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Mycology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Nanobiopolymeric conjugates based on biodegradable, non-toxic and non- immunogenic poly (β-L-malic acid) PMLA covalently linked to molecular modules that include morpholino antisense oligonucleotides (AONa), an siRNA or an antibody specific for an oncogenic protein in a cancer cell, and an antibody specific for a transferrin receptor protein, are efficient for treatment a cancer in a subject.

Description

Polymalic Acid-Based Nanobiopolymer Compositions and Methods for Treating Cancer
Technical field
The present invention generally relates to compositions and methods for treating patients having cell proliferative disorders with polymalic acid-based nanobiopolymeric compositions that inhibit synthesis and activity of an oncogenic protein.
Government support
The invention was made in part with support from grants R01CA123495 and R01CACA1136841 from the National Institutes of Health. The government has certain rights in the invention.
Background
Breast cancer is a disease affecting a significant population of women around the world. About 1 in 8 women in the United States (between 12 and 13%) will develop invasive breast cancer over the course of her lifetime. Prognosis and survival rate varies greatly depending on cancer type and staging. Breast cancers expressing genetic
characteristics such as human epidermal growth factor receptor-2 (HER2) are associated with a poor prognosis.
Research has focused on the use of recombinant humanized monoclonal antibodies for the treatment of cancers with cells that overexpress protein pl85HER2. This 185-kDa growth factor receptor is encoded by the her-2 proto-oncogene, also referred to as neu and c- erbB-2 (Slamon et al. 1987 Science 235: 177). The her-2 gene is closely related to the gene encoding epidermal growth factor receptor (EGFR). Amplification of the her-2 gene has been linked to neoplastic transformation in human breast cancer cells (Slamon et al. 1987 Science 235:177). Overexpression of the HER2 protein has been identified in 20-30% of breast cancer patients, and has been correlated with regionally advanced disease, increased probability of tumor recurrence, and reduced patient survival. As many as 30-40% of patients having gastric, endometrial, salivary gland, non-small cell lung, pancreatic, ovarian, peritoneal, prostate, or colorectal cancers may also exhibit overexpression of this protein.
A more difficult-to-treat form of HER2 -negative breast cancer known as "triple- negative," affects some patients. This form tests negative for three primary receptors:
HER2, estrogen receptor and progesterone receptor.
Humanized mti- ER2/neu monoclonal antibody trastuzumab (Herceptin®,
Genentech Inc., San Francisco, CA) is used alone or combined with chemotherapy for treatment of patients with advanced breast cancer overexpressing HER2/neu (Baselga J. 2006 Science 312: 1175; Baselga J et al. 1999 Semin Oncol 26:78; Slamon DJ et al. 2009 J Natl Cancer Inst 101 :615), with significant anti-tumor effect. However, serious adverse effects on normal organs have been reported (Keef DL. 2002 Cancer 95:1592; Vahid B et al, 2008 Chest 133:528). Moreover, many patients develop resistance to Herceptin® within one year of treatment, which renders this treatment ineffective (Tseng PH et al. 2006 Mol
Pharmacol 70:1534). Therefore, new drugs with minimal side effects for non-tumor tissues are urgently needed to improve HER2/«ew-positive tumor therapy.
Summary of embodiments
An embodiment of the invention provided herein is a drug delivery composition for treating a cancer in a subject, the drug including a plurality of biologically active molecular modules having at least one module that targets a tumorigenic cell or a cancer cell, at least one module that inhibits synthesis or activity of a human epidermal growth factor receptor (HER) protein in the cell, and at least one module for cytoplasmic delivery, and a polymalic acid-based molecular scaffold, such that the molecular modules are covalently linked to the scaffold. For example, the HER protein is at least one protein selected from the group of: HER1, HER2, HER3 and HER4. For example, the at least one module that inhibits synthesis or activity of the protein is selected from the group of: an antisense oligonucleotide (AON), an siRNA oligonucleotide, an antibody, a polypeptide, an oligopeptide and a low molecular weight drug. The scaffold in a related embodiment includes a poly-P-L-malic acid (PMLA) also denoted poly(-P-L-malic acid).
The AON in related embodiments is a Morpholino AON having a sequence complementary to a sequence contained in an mRNA transcript of HER2/neu protein. For example, the AON is selected from: 5'-AGGGAGCCGCAGCTTCATGTCTGTG-3' (SEQ ID NO: 1), and 5'-CATGGTGCTCACTGCGGCTCCGGC-3 ' (SEQ ID NO:2).
In a related embodiment the at least one module that targets the cell includes an antibody that binds specifically to a vasculature protein in the cell. For example, the vasculature protein includes a transferrin receptor protein. In general, the antibody is selected from at least one of: anti-human, rat anti-mouse, rat anti-human, rabbit anti-human and goat anti-human.
In an alternative embodiment the at least one module that inhibits activity of the protein includes an antibody binding specifically to a HER2/neu protein. For example, the antibody is Herceptin®.
The composition in alternative embodiments includes a Morpholino AON having a sequence complementary to a sequence contained in an mRNA transcript of an epidermal growth factor receptor (EGFR) protein. For example, the sequence includes
5'-TCGCTCCGGCTCTCCCGATCAATAC-3' (SEQ ID NO:3).
The composition in related embodiments includes a Morpholino AON having a sequence complementary to a sequence contained in an mRNA transcript of at least one subunit of laminin-411. For example, the subunit is selected from an a4 subunit and a βΐ subunit. The sequence complimentary to the transcript of the a4 subunit includes
5'-AGCTCAAAGCCATTTCTCCGCTGAC-3 ' (SEQ ID NO:4). The sequence complimentary to the transcript of the β 1 subunit includes 5 '- CTAGC AACTGGAGAAGCCCCATGCC-3 ' (SEQ ID NO:5).
In an alternative embodiment the composition includes the siRNA oligonucleotide having a sequence complementary to a gene encoding an EGFR protein. For example, the sequence includes a sense sequence 5'-CCUAUAAUGCUACGAAUAUtt-3' (SEQ ID NO:6) and an antisense sequence 5 '-AUAUUCGUAGCAUUUAUGGag-3 ' (SEQ ID NO:7).
The siRNA oligonucleotide in a related embodiment includes a sequence complementary to a gene encoding a HER2 protein. For example, the sequence includes a sense sequence 5'-GUUGGAUGAUUGACUCUGAtt-3' (SEQ ID NO: 8) and an antisense sequence 5'-UCAGAGUCAAUCAUCCAACat-3' (SEQ ID NO:9).
In a related embodiment the at least one module for cytoplasmic delivery includes an endosome escape unit. In general, the endosome escape unit is selected from a group of: leucine residues, valine residues and a leucine ethylester. i.e., a plurality of leucine or valine residues, or a single or a plurality of leucine residues, or mixture of any of these. For example, a concentration of the leucine ethylester in a related embodiment is about 40% of the drug delivery composition.
The plurality of modules in related embodiments further includes a polyethylene glycol (PEG). For example, the PEG has a molecular weight of about 1,000 Da, about 5,000 Da, about 10,000 Da, about 15,000 Da, about 20,000 Da, about 25,000 Da and about 30,000 Da.
An embodiment provides the composition in a unit dose effective for treatment of the cancer in the patient. For example, the unit dose is at least one selected from: 1 μg/kg, 50 μg kg, 100 μg kg, 500 μg/kg, 1 mg/kg, 5 mg/kg, 10 mg kg, 50 mg kg, and 100 mg/kg. For example, the unit dose is at least 1 mg/kg. For example, the unit dose is less than about 10 mg/kg.
In related embodiments, the cancer is at least one selected from the list of: gastric, endometrial, salivary gland, lung, non-small cell lung, pancreatic, ovarian, peritoneal, prostate, colorectal, breast, cervical, uterine, ovarian, brain, head and neck, testicular and teratoma cancers. For example, the breast cancer is a triple-negative breast cancer. For example, the cancer includes either a primary cancer or a metastatic cancer, or both. The cancer in another embodiment includes cells overexpressing a HER2/neu receptor protein.
An embodiment of the invention herein is a drag delivery composition for treating a cancer in a subject including: a polymerized carboxylic acid molecular scaffold such as a poly-p-L-malic acid (PMLA), and a plurality of biologically active molecular modules including an antisense molecule that substantially inhibits synthesis of a HER2/neu receptor protein, a molecular module to facilitate delivery of the antisense molecule to cytoplasm, at least one antibody specific for the receptor protein that inhibits activity of the receptor protein, at least one antibody targeting a tumor vasculature protein, and a molecular module that prolongs circulation of the composition, such that the molecular modules are covalently linked to the scaffold.
The invention in an embodiment provides a drag delivery composition for treating a cancer in a subject including: a polymerized carboxylic acid molecular scaffold such as a poly- -L-malic acid (PMLA), and a plurality of biologically active molecular modules including an antisense molecule that substantially inhibits synthesis of an epidermal growth factor receptor (EGFR) protein, an antisense molecule that substantially inhibits at least one subunit of laminin-411, a molecular module to facilitate delivery of the antisense molecule to cytoplasm, at least one antibody targeting a tumor vasculature protein, and a molecular module that prolongs circulation of the composition, such that the molecular modules are covalently linked to the scaffold.
The invention in another embodiment provides a kit for treating a patient having a cancer that includes a drag deliveiy composition including a nanobiopolymeric conjugate of a scaffold such as a poly-P-L-malie acid (PMLA) and molecular modules including an antisense molecule that substantially inhibits synthesis or activity of a human epidermal growth factor receptor (HER) protein, a molecular module to facilitate delivery of the antisense molecule to cytoplasm, at least one targeting antibody specific for the HER protein, at least one antibody specific for a tumor vasculature protein, and a molecular module that prolongs circulation of the composition, such that the PMLA is covalently linked to the molecular modules, in a container. The kit in related embodiments further includes a pharmaceutically acceptable buffer and instructions for use.
An embodiment of the invention herein is a method for treating a cancer in a subject, the method including: contacting the subject with a drug delivery composition that includes a poly-P-L-malic acid (PMLA) covalently linked to a plurality of molecular modules including at least one module that targets a tumorigenic cell or a cancer cell, at least one module that inhibits synthesis or activity of a human epidermal growth factor receptor (HER) protein in the cell, and at least one module for cytoplasmic delivery, and analyzing at least one of: inhibition of tumor growth, tumor regression and elimination of cancer in the subject, thereby treating the cancer in the subject. For example, the HER protein is selected from a group comprising: HER1, HER2, HER3, and HER4.
In a related embodiment, the module that inhibits synthesis or activity of the HER protein is at least one selected from the group of: an antisense oligonucleotide (AON), an siRNA oligonucleotide, an antibody, a polypeptide, an oligopeptide and a low molecular weight drug. In general, the AON has a sequence complementary to an mRNA transcript of at least one protein selected from the group of: HER2, an epidermal growth factor receptor (EGFR) protein, and a subunit of laminin-411. For example, the sequence complementary to the HER2 transcript includes 5 'AGGGAGCCGCAGCTTCATGTCTGTG-3 ' (SEQ ID NO: 1), and 5 '-CATGGTGCTCACTGCGGCTCCGGC-3 ' (SEQ ID NO:2). For example, the sequence complementary to the EGFR transcript includes
5'-TCGCTCCGGCTCTCCCGATCAATAC-3' (SEQ ID NO:3). The subunit of laminin- 411 in related embodiments is selected from a4 and βΐ subunits. For example, the a4 transcript sequence includes 5 '-AGCTCAAAGCCATTTCTCCGCTGAC-3 ' (SEQ ID NO:4). For example, the βΐ transcript sequence includes
5'- CTAGCAACTGGAGAAGCCCC ATGCC-3 ' (SEQ ID NO:5). In related embodiments of the method the siR A oligonucleotide includes a sequence complementary to a gene encoding at least one of an epidermal growth factor receptor (EGFR) protein and HER2. For example, the EGFR sequence is selected from: 5'-CCUAUAAUGCUACGAAUAUtt-3' (SEQ ID NO:6), and
5 '-AUAUUCGUAGCAUUUAUGGag-3 ' (SEQ ID NO:7). For example, the HER2 sequence is selected from: 5'-GUUGGAUGAUUGACUCUGAtt-3' (SEQ ID NO:8), and 5'-UCAGAGUCAAUCAUCCAACat-3' (SEQ ID NO:9).
In an alternative embodiment of the method the antibody binds specifically to HER2/neu protein. For example, the antibody is Trastuzumab Herceptin®. In a related embodiment of the method the at least one module that targets the cell includes an antibody that binds specifically to a transferrin receptor protein. In general, the antibody is selected from at least one of: anti-human, rat anti-mouse, rat anti-human, rabbit anti-human and goat anti-human. In a related embodiment of the method the at least one module for cytoplasmic delivery includes an endosome escape unit. For example, the endosome escape unit is a leucine ethylester.
In related embodiments of the method the plurality of modules further includes a polyethylene glycol (PEG). For example, the PEG has a molecular weight of about 1,000 Da.
For example, the PEG has a molecular weight of about 5,000 Da.
An embodiment of the method involves analyzing inhibition of tumor growth by observing more than about 60%, 70%, 80% or about 90% inhibition of tumor growth in the subject. The method in a related embodiment further involves observing with inhibition of tumor growth the inhibition of HER2/neu receptor signaling with suppression of Akt phosphorylation.
In general, the subject is a mammal such as a human, a simian, an equine, a bovine, or a high value agricultural or zoo animal For example, the mammal is a rodent. For example, the rodent is an experimental human-breast tumor-bearing nude mouse. The mammal in an alternative embodiment is a human.
The method in a related embodiment further includes administering an additional therapeutic agent. For example, the additional therapeutic agent is selected from the group consisting of: an antibody, an enzyme inhibitor, an antibacterial agent, an antiviral agent, a steroid, a non-steroid-inflammatory agent, an antimetabolite, a cytokine, a cytokine blocking agent, an adhesion molecule blocking agent, and a soluble cytokine receptor. In an embodiment of the method contacting the subject with the composition further includes providing the composition in a unit dose effective for treatment the cancer in the subject. For example, the effective dose is at least one selected from: 1 μg/kg, 50 μg/kg, 100 μg/kg, 200 μg/kg, 300 μg/kg, 400 μg/kg, 500 μg/kg, 600 μg/kg, 700 μg/kg, 800 μg/kg, 900 μg/kg, 1 mg/kg, 50 mg/kg, 100 mg/kg, 200 mg/kg, 300 mg/kg, 400 mg/kg, 500 mg/kg, 600 mg/kg, 700 mg/kg, 800 mg/kg, 900 mg/kg, and 1 g/kg.
In a related embodiment of the method the cancer is selected from the list of: gastric, endometrial, salivary gland, lung, non-small cell lung, pancreatic, ovarian, peritoneal, prostate, colorectal, breast, cervical, uterine, ovarian, brain, head and neck, testicular and teratoma cancers. For example, the cancer includes either a primary cancer, or a metastatic cancer, or both.
Brief description of the drawings
Figure 1 is a chemical structure and schematic drawings showing a
nanobiopolymeric conjugate designed to inhibit HERl/neu expression by antisense oligonucleotides (AON) and to attenuate HER2/new-mediated cell signaling by Herceptin®. The modules are HERl/neu morpholino AON (indicated 1 in Figure) conjugated to the PMLA scaffold by disulfide bonds (S-S) that are cleaved by cytoplasmic glutathione to release the free drugs; targeting and/or effector antibodies that include antinbody specific to a transferrin receptor protein (TfR) either alone or in combination with monoclonal antibodies (mAbs) to mouse TfR (indicated 2a in Figure), human TfR (indicated 2b) and Herceptin® (indicated 2c) for tumor endothelial and cancer cell targeting, receptor-mediated endocytosis, and anti-tumor effect, polyethylene glycol (PEG) for drag protection (indicated 3), stretches of conjugated L-leucine ethyl ester (LOEt) for endosomal escape of the drug (indicated 4), and optional fluorescent reporter dye (Alexa Fluor 680) for imaging (indicated 5). The nanopolymer also contained free unsubstituted pendant carboxyl groups for enhancing solubility and nonfunctional disulfides originating from chemical masking of excess sulfhydryls with 3-(2-pyridyldithio)-propionates. Figure 2 is a set of bar graphs showing data obtained from an in vitro cell viability assay. HER2/«eu overexpressing breast cancer cells (BT-474 and SKBR-3; also shown in Figure 3 panel A) were treated with various drugs as indicated (top row). After 72 hours, cell viability was determined using a Trypan Blue exclusion assay. Percentage of cell growth was calculated as average cell counts for each group and expressed relative to parallel samples treated with PBS (control) set to 100%. Growth of tumor cells treated with lead compound P/mPEG/LOEt/AON/Herceptin®/TfR(M) was observed to be significantly inhibited compared with other treatments in both cell lines. In cell lines expressing low amounts of HER2/neu (Figure 3 panel A), the data show that was the lead compound had greatest ability to inhibit cell growth (bottom row). One asterisk indicates that P<0.05; two asterisks indicate that P<0.01; three asterisks indicate that P<0.003 compared to PBS control treatment. The lead compound also showed significant differences at P<0.005 when compared to all treatment groups (top row), and at P<0.02 when compared to Herceptin® (bottom row).
Figure 3 is a set of photographs of immunoblots showing changes observed in HER2/neu expression, Akt phosphorylation, and apoptosis resulting from various treatments of breast cancer cells in vitro.
Figure 3 panel A shows a comparison of HERl/neu and TfR expression in various cell lines. Breast cancer cell lines used in Examples herein were observed to express high levels of TfR.
Figure 3 panel B shows expression analysis of various markers in cell line SKBR-3.
Figure 3 panel C shows expression of the markers in cell line BT-474. HER2/neu overexpressing breast cancer cells shown in panel A were treated with various compounds.
Western blot analyses showed decreased BER2/neu and phosphorylated Akt after treatment with each of Herceptin®, P/mPEG/LOEt/Herceptin®, AON or
P/mPEG/LOEt/AON/TfR(H/M)-treated tumor cells, and not with control treatment PBS or Endoporter in both cell lines. Treatment with lead compound
P/mPEG/LOEt/AON/Herceptin®/TfR(M) further reduced both HER2/neu and p-Akt. Assay of generation of cleaved poly(ADP-ribose) polymerase (PARP) as a measure of apoptosis was observed at highest levels in P/mPEG/LOEt/AON/Herceptin®/TfR(M)-treated cells. Glyceraldehyde 3 -phosphate dehydrogenase( GAPDH) was used as an internal loading control.
Figure 4 is set of photographs showing distribution of various compounds herein labeled with Alexa Fluor 680 in live mice with BT-474 breast tumors and in tumors in isolated organs. Major organ analysis compared breast tumors and organs before injection (left panel) with those twenty-four hours after intravenous injection (right panels). Live mice herein were injected with each of the lead drug P/mPEG/LOEt/AON/Herceptin®/Tf (M) (bottom row), positive control P/mPEG/LOEt with Herceptin® (middle row) and control conjugate P/mPEG/LOEt/IgG (top row). Control mice (top row) had little BT-474 tumor accumulation, and most of the control polymer accumulated in drug clearing organs, liver and kidneys. Polymer P/mPEG/LOEt with Herceptin® alone had a moderate tumor accumulation (middle row). The highest accumulation in breast tumor cells was observed in mice treated with the lead compound P/mPEG/LOEt/AON/Herceptin®/TfR(M). Arrows mark tumor implantation site.
Figure 5 is a set of photographs showing distribution of various compounds in BT- 474 breast tumor cells. Animals were administered compounds intravenously as shown in Figure 4, were sacrificed 24 hours after drug injection, tumors were excised, and sections were analyzed by confocal microscopy. Nuclei were counterstained with DAPI (grey area). Animals injected with control conjugate P/mPEG/LOEt/IgG with attached Alexa Fluor 680 tracking dye (grey) showed little if any tumor cell accumulation (top row). Animals injected with P/mPEG/LOEt/Herceptin® displayed considerable accumulation in tumor cells, and the highest accumulation was observed in animals injected with the lead drug
P/mPEG/LOEt/AON/Herceptin®/TfR(M), consistent with live animal imaging data shown in Figure 4. Scale bar = 50 μηι.
Figure 6 is a set of photographs and a line graph showing mouse tumor inhibition, pathology, signaling and apoptosis marker expression.
Figure 6 panel A is a set of photographs showing data obtained and histopathological analysis of respective tumors from two representative animals for each group administered with different drugs. Variable amounts of dead tissue were observed to be present in all treated groups. Tumor size reduction data and pronounced disappearance of tumor cells were observed following treatment with the lead drug
P/mPEG/LOEt/AON/Herceptin®/TfR(M), and mostly necrotic areas were observed to be present.
Figure 6 panel B is a line graph showing extent of tumor growth inhibition in mice. Animals treated with each of unconjugated Herceptin® (squares) and with positive control P/mPEG/LOEt/Herceptin® (triangles), or with P/mPEG LOEt/AON/TfR(H/M) (circles) showed significant inhibition compared with PBS control (diamonds) (P<0.03).
P/mPEG/LOEt/AON/Herceptin®/TfR(M) treatment (large squares) was observed to produce the greatest inhibition of tumor growth compared to other treatment groups, resulting in 80 to 95% tumor regression observed during the follow-up period (P<0.02 vs. Herceptin® and other drugs; PO.001 vs. PBS). Error bars denote standard error of the mean (SEM).
Figure 6 panel C is a photograph of an immunoblot showing expression of select markers after treatment of HER2/«ew positive tumors in vivo. Western blot analysis data showed a decrease in HER2/neu and p-Akt (but not total Akt) expression in each of Herceptin®-, P/mPEG/LOEt/Herceptin®-, or P/mPEG/LOEt/AON/TfR(H/M)-treated mice and not in control PB S-treated ones. P/mPEG/LOEt/AON/Herceptin®/TfR(M) further inhibited HER2/«e« expression, with near disappearance of a p-Akt band. PARP cleavage as a measure of apoptosis was observed also to be substantially greater in
P/mPEG/LOEt/AON/Herceptin®/TfR(M)-treated mice than that in other groups. GAPDH was an internal control to normalize gel loading.
Figure 7 is a line graph showing extent of tumor growth inhibition by compositions herein in subjects bearing triple-negative breast tumors. Animals treated with each of P/mPEG/LOEt/AON-EGFR/ TfR(H/M; squares), or with P/mPEG/LOEt/AON- EGFR/a4pl/TfR(H/M; triangles) showed significant inhibition compared with PBS negative control (diamonds). P=0.002 vs. α4β1 ; P=0.0001 vs. PBS. P/mPEG/LOEt/ AON- a4pi/TfR(H/M) treatment inhibited tumor growth compared to control PBS treatment, and was observed to be less effective compared to data obtained with other nanobiopolymers, shown in the figure. (P=0.01 vs. PBS). Error bars denote SEM.
Detailed description
Compositions and methods of the present invention provide a nanobiopolymeric drugs based on poly- -L-malic acid (PMLA) platform specifically designed for delivery into HER2/«e«-positive tumors. Targeted nanobiopolymeric conjugates based on poly-p-L- malic acid (PMLA) are biodegradable, non-toxic, and non-immunogenic. The PMLA nanoplatform was synthesized for repetitive systemic treatments of HER2/?¾ew-positive human breast tumors in a xenogeneic mouse model. Various moieties were covalently attached to PMLA, including a combination of morpholino antisense oligonucleotides (AON) directed against HER2/ne« mRNA, to block HER2/neu synthesis; anti-HER2//te« antibody trastuzumab (Herceptin®), to target breast cancer cells and inhibit receptor activity simultaneously; and transferrin receptor antibody, to target the tumor vasculature and mediate delivery of the nanobiopolymer through the host endothelial system.
The Examples herein include tests of the lead compound, and data show that this compound significantly inhibited growth of HER2/new-positive breast cancer cells in vitro and in vivo, and enhanced apoptosis and inhibition of HER2/neu receptor signaling with suppression of Akt phosphorylation was observed in treated cells and animals. In vivo imaging analysis and confocal microscopy demonstrated selective accumulation of the nanodrug in tumor cells as a result of an active delivery mechanism resulting from design of the lead compound. Systemic treatment of human breast tumor-bearing nude mice resulted in more than 90% inhibition of tumor growth and tumor regression, compared to partial (50%) tumor growth inhibition in mice treated with control trastuzumab alone or control AON alone, either free or attached to PMLA. Data from Examples herein offer a preclinical demonstration of use of the PMLA nanoplatform for combination cancer therapy.
The epidermal growth factor receptor or ErbB family of receptor tyrosine kinases is exemplified by an epidermal growth factor receptor (also called HER1 or ErbBl), HER2 (ErbB 2 or neu), HER3 (ErbB3), and HER4 (ErbB4). Upon ligand binding, ErbB family members form homodimers and heterodimers followed by the phosphorylation within intracellular kinase domains (Yarden et al. 2001 Nat Rev Mol Cel Biol 2:127). Upon ErbBl and ErbB2 activation, phosphotyrosylated sites in Src-homology 2 (SH2) domains in these proteins serve as docking sites for adaptor proteins such as She, Grb2, and Sos resulting in the activation of the of Ras/Raf/mitogen-activated protein kinase (MAPK) kinase (MEK)/ MAP and PBK/protein kinase B ( P B) pathways and promotion of proliferation and mitogenesis (Yarden et al. 2001 Nat Rev Mol Cel Biol 2:127).
The HERl/neu proto-oncogene, also known as erbB-2, encodes a 185-kDa type I transmembrane receptor tyrosine kinase that is member of the epidermal growth factor receptor family (Hynes NE et al., 2005 Nat Rev Cancer 5:341; Bargmann CI et al. 1986. Nature 319:226; Coussens L et al. 1985 Science 230:1132). Early studies have identified HER2/new protein overexpression in several human carcinomas, including subsets of ovarian and breast cancers (Hynes NE et al. 1994. Biochim Biophys Acta 1198: 165;
D'Emilia J et al. 1989 Oncogene 4:1233; Slamon DJ et al. 1989 Science 244:707).
HER2/neu overexpression has been linked to a short relapse time and poor survival of breast cancer patients (Slamon DJ et al. 1987 Science 235:177), as this protein plays a role in the molecular mechanisms of human cancers.
The ErbB2 gene is amplified and overexpressed in up to 30% of primary breast cancers and this is associated with poor patient prognosis (Slamon DJ et al, 1989 Science 244:707). ErbBl is also overexpressed in up to 30% of primary invasive breast cancers and this is coiTelated with reduced overall survival, proliferation, and higher metastatic potential (Tsutsui S et al. 2002 Breast Cancer Res Treat 71 :67). Inhibition of ErbBl signaling reduces both ErbBl and ErbB2 activity and delays tumorigenesis in MMTV Neu mice (Lenferink AEG et al. 2000 Proc Natl Acad Sci 97: 9609). The cooperative activation of proliferative pathways by these two receptors has stimulated the development of a number of small molecule inhibitors of members of the ErbB family for use as anticancer agents.
Newly diagnosed estrogen positive breast cancers are commonly treated with the an ti estrogen agent tamoxifen. In estrogen-positive breast cancers, overexpression of both Erbl and Erb 2 is associated with resistance to tamoxifen therapy. It was shown that administration of such anticancer agents as lapatinib (GW572016) and tamoxifen together was advantageous and restored tamoxifen-mediated cell cycle arrest and inhivited tamoxifen-resistant breast tumor growth (Chu I et al. 2005 Cancer Res 65:18).
Characteristics such as extracellular accessibility, high expression, and association with poor prognosis make HERl/neu an attractive candidate for antibody therapy.
Metastatic breast cancer patients are currently being treated with Trastuzumab (also known as Herceptin; Genentech, Inc., San Francisco, CA), a Food and Drug Administration- approved humanized monoclonal anti-HER2/«ew (Kaptain S et al. 2001 Diagn Mol Pathol 10: 139). Breast cancer clinical trials for patients with advanced disease expressing high levels of HER2/«e« showed that use of Trastuzumab as a single immuno therapeutic agent resulted in an objective response rate of 12% to 26% (Cobleigh MA et al. 1999 J Clin Oncol 17:2639; Baselga J et al. 1996 J Clin Oncol 14:737; Vogel CL et al. 2002 J Clin Oncol 20:719). Subsequent clinical trials in patients with advanced disease have also shown that targeting metastatic breast cancer with Trastuzumab in combination with chemotherapy resulted in a 50%> objective response, but disease relapse still affected most cases (Slamon DJ et al. 2001 N Engl J Med 344:783). In addition, Trastuzumab lacks considerable activity against tumors expressing HER2/neu that are not of breast origin (Burstein HJ 2005 N Engl J Med 353: 1652). Furthermore, resistance to Trastuzumab is a growing problem in patients with breast tumors. Novel treatments for patients with HER2/«eu-expressing tumors are still needed.
In 66% to 88% of cases, HER2/«e«-overexpressing tumors demonstrate primary resistance to Herceptin® (Baselga J et al. 1999 Semin Oncol 26:78; Nahta R et al. 2004 Cancer Res. 64:398). This resistance may be due to epitope masking by overexpressed mucins, loss of receptor ability to influence pro-survival signaling through PI3K-Akt axis, or loss of protein phosphatase PTEN leading to the activation of PI3K-Akt signaling (Tseng PH et al 2006 Mol Pharmacol.70:1534-41; Nagy P et al 1998 Cytometry32:120; Tanner M et al. 2004 Cancer Ther. 3:1585-92).
Antineoplastic agents for overcoming trastuzumab resistance
A variety of agents including monoclonal antibodies, recombinant proteins, and drugs, are known to have activity in treating breast cancer, and are here contemplated to be useful agents in combination with compositions described herein.
Combination of Herceptin® with other agents, such as paclitaxel (taxol, Bristol-
Myers Squibb) and docetaxel (taxotere, Sanofi-Aventis), yielded increases in response rates, time to disease recurrence, and overall survival (Esteva FJ et al. 2002 J Clin Oncol. 20:1800; Slamon DJ et al. 2001 N Engl J Med.344:783; Wardley AM et al. 2009. J Clin Oncol 49:976).
Combining targeting of HER2 and other tyrosine kinases presents an alternative strategy. Tyrosine kinases are associated with breast cancer tumorigenesis and are of substantial interest as potential drag targets (Ocana A et al. 2008 Clin Cancer Res 14:961). The insulinlike growth factor 1 receptor (IGF-1R), a receptor tyrosine kinase (RTK), has been shown to increase the growth of breast cancer cells and is also implicated in developing resistance to trastuzumab (Nahta R et al. 2006 Nat Clin Pract Oncol 3:269).
Cotargeting or simultaneous targeting of IGF-I R and HER2 offers an advantage compared to targeting of the individual RTKs in breast cancer cells (Esparis-Ogando A et al. 2008 Ann Oncol 19:1860). The v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (c- KIT) RT is overexpressed in triple-negative breast cancers (those that do not express estrogen receptor, progesterone receptor, and HER2) (Nielsen TO et al. 2004 Clin Res 10:5367). The activation of two nonreceptor cytosolic tyrosine kinases, c-abl oncogene 1 (ABL1) and c-SRC tyrosine kinase (CSK), is associated with the aggressiveness of breast cancer (Finn RS. 2008 Ann Oncol 19:1379) and proliferation of triple-negative breast cancers (Finn RS. 2008 Ann Oncol 19: 1379; Finn RS et al. 2007 Breast Cancer Res Treat 105:319), respectively. Moreover, c-SRC has also been associated with antiestrogen resistance in estrogen receptor-positive breast tumors (van Agthoven T et al. 2009 J Clin Oncol 27:542).
Dasatinib, (Sprycel®, Bristol-Myers Squibb) a small-molecule tyrosine kinase inhibitor, targets the cytosolic c-SRC and ABL1 kinases, and RTKs c-KIT and platelet- derived growth factor receptors alpha and beta (Finn RS et al. 2007 Breast Cancer Res Treat 105:319; Rix U et al. 2007 Blood 110: 4055; Huang F. et al. 2007 Cancer Res 67: 2226; Huang F. et al. 2007 Cancer Res 67: 2226). The activity of dasatinib for treatment of triple- negative breast cancer not expressing estrogen receptor, progesterone receptor, or HER2/neu (Finn RS et al. 2007 Breast Cancer Res Treat 105:319; Huang F. et al. 2007 Cancer Res 67: 2226), and favorable antitumoral activity in head and neck cancer in combination with gefitinib (Koppikar P et al. 2008 Clin Cancer Res 14:4284), led to combining trastuzumab and dasatinib for treatment of HER2-positive breast cancers. This combination was found to be highly effective against breast cancer cells overexpressing HER2 receptors. Both drugs individually inhibited cell proliferation in vitro and exhibited antitumoral action, and the combination resulted i a more potent effect on HER2 -overexpressing cells.
The drug combination decreased levels of phosphorylated HER2 and phosphorylated HER3, and a decrease was observed in the total amount of these receptors. The combined treatment affected downstream signaling routes, such as the ER l or AKT pathways that regulate cell proliferation and survival (Garcia-Echeverria C et al. 2008 Oncogene 27:5511; Roberts PJ et al. 2007 Oncogene 26:3291). Dasatinib alone was as inhibitory for phosphorylated levels of ERKl as the combined drug treatment. Treatment with dasatinib also inhibited SRC or FAK phosphorylation to the same degree as the combined drug treatment. These two kinases are known targets of dasatinib (Huang F. et al. 2007 Cancer Res 67: 2226) and participate in several oncogenic processes (Kim LC et al. 2009 Nat Rev Clin Oncol 6:587). Combined treatment and not the individual drugs was observed to decrease the level of phosphorylated AKT. Downstream targets of AKT such as p70S6K and BAD were also affected by the combined drug treatment, and not by the individual drugs, as the resting phosphorylated levels of these proteins were reduced by treatment with trastuzumab and dasatinib.
The drug combination also induced caspase-independent apoptosis as determined by the lack of an effect of caspase inhibitors on apoptosis induced by the drug combination. One of the possible mediators in caspase- independent apoptosis is NAIF1 a protein that is released from the mitochondrial intermembrane space by certain apoptotic stimuli. The release of NAIF 1 from mitochondria to the cytosol, by treatment with the drug combination, indicated that this mechanism could be responsible for caspase-independent apoptosis.
The drug combination also affected DNA repair machinery and led to accumulation of double-stranded breaks (DSBs) which indicate control of DNA repair machinery by tyrosine kinases and potential clinical implications.
Erlotinib (Tarceva, Roche), an inhibitor of EGFR, blocked homologous
recombination repair of the DSBs in breast cancer cells through reduction of RAD51 foci formation (Li L et al 2008 Cancer Res 68:9141). Previous studies have also indicated that RTKs may regulate DNA repair (Tanaka T et al, 2008 Clin Cancer Res 14:1266;
Ganapathipillai SS et al. 2008 Cancer Res 68:5769).
Gefitinib (Iressa, Astra Zeneca and Teva) is an EGFR inhibitor that impedes DNA repair in response to ionizing radiations in macrocytic lung cancer cells (Tanaka T et al, 2008 Clin Cancer Res 14: 1266). Mutated forms of MET protein, an RTK implicated in several oncogenic processes such as invasion and metastasis (Benvenuti S et al. 2007 J Cell Physiol 213:316) or drug resistance (Engelman JA et al. 2007 Science 316:1039), have been reported to bind to and phosphorylate RAD51, facilitating DNA repair in tumor cells (Ganapathipillai SS et al. 2008 Cancer Res 68:5769).
A transcription factor associated with Williams-Beuren syndrome (WSTF; also known as ΒΑΖΓΒ), a tyrosine kinase component of the WICH complex (WSTF-ISWI Λ Ρ- dependent chromatin-remodeling complex), regulates the DNA damage response through phosphorylation of Tyrl42 of H2AX (Xiao A et al. 2009 Nature 457:57).
It is here envisioned that drugs such as dasatinib in combination with other antineoplastic agents such as gefitinib and erlotinib (Koppikar P et al. 2008 Clin Cancer Res 14:4284), are further combined with compositions described herein.
Lapatinib (Tyverb , GSK) is a dual EGFR/HER2 tyrosine kinase inhibitor (Rusnak DW et al. 2001 Mol Cancer Ther 1 :85) which is highly selective to EGFR and HER2 (Karaman MW et al. 2008 Nat Biotechnol 26:127). In preclinical models of trastuzumab resistance, lapatinib inhibited phosphorylation of HER2 and overall growth in HER2 overexpressing breast cancer cell lines specifically chosen for extent of in vitro resistance to trastuzumab (Konechny GE et al. 2006 Cancer Res 66:1630). Further, treatment with lapatinib combined with trastuzumab resulted in a greater degree of survival and greater apoptosis induction than either agent alone (Xia et al. 2005 Oncogene 24: 6213).
A substantial number of HER2-positive metastatic breast cancer patients treated with trastuzumab experience symptomatic central nervous system (CNS) metastasis, which unlike visceral diseases, are not well controlled by trastuzumab. Lapatinib and not trasuzumab has been shown to cross the blood-brain barrier, providing rationale for testing lapatinib in patients with CNS metastases (Nielsen DL et al. 2009 Cancer Treat Rev 35: 121).
Trastuzumab in combination with lapatinib was found to be superior to lapatinib alone in HER2-positive metastatic breast cancer patients (Blackwell KL et al. 2010 J Clin Oncol 28:1124).
Pertuzumab (2c4, omnitarg, Genentech), another monoclonal antibody specific for the extracellular domain of HER2 protein, attaches to a different epitope of HER2 compared to trastuzumab. Pertuzumab was observed to inhibit heterodimer formation between HER2 and EGFR or HER3 (Agus DB et al. 2002 Cancer Cell 2: 127). Although the HER2/HER3 heterodimer is important in HER2-driven cell signaling, the heregulin-dependent HER2/ HER3 heterodimer is disrupted by pertuzumab and is not disrupted by trastuzumab (Jitunttila et al. 2009 Cancer Cell 15:429). In a phase II clinical trial involving combination treatment with pertuzumab and trastuzumab in HER2-positive breast cancer patients, treatment produced a response rate of 24.2%, and disease control rate of 50% (Baselga J et al. 2010 J Clin Oncol 28: 1138).
Trastuzumab-DMl is comprised of trastuzumab and DM1, an agent that is an inhibitor of tubulin polymerization derived from maytansine. A stable MCC linker conjugates the DM1 to the trastuzumab. The compound is designed to deliver DM1 to HER2-overexpressing cancer cells. Preclinical studies have indicated the growth-inhibitory effect of trastuzumab-DMl in HER2-overexpressing and trastuzumabresistant cells (Lewis Phillips GD et al. 2008 Cancer Res 68:9280). In a phase II clinical trial involving HER2- positive metastatic breast cancer patients with disease progression despite trastuzumab- based therapy, trastuzumab-DMl yielded an independently reviewed response rate and progression-free survival of 26.9% and 4.6 months, respectively (Vogel CL et al. 2009 J Clin Oncol 27: 15s (suppl; abstr 1017). Importantly, trastuzumab-DMl had similar antitumor activity and an independently reviewed response rate of 24.2% even in patients previously treated with lapatinib and trastuzumab (n = 66).
PI3K pathway inhibitors are also used for treating HER2 expressing tumors. HER2- overexpressing breast cancer cells are believed to be dependent on the PI3K signaling pathway, and a number of genetic or epigenetic alterations in PI3K signaling molecules have been shown to cause resistance to trastuzumab or small-molecule HER2 kinase inhibitors. HER2-overexpression and PIK3CA mutations frequently occur simultaneously in breast cancer cells (Oda K et al. 2008 Cancer Res 68:8127), and cell lines with either HER2 amplification or PIK3CA mutation are equally Akt-dependent (She QB et al. 2008 PLoS ONE 3:e3065). PI3K pathway inhibitors may therefore be useful in overcoming resistance to anti-HER2 agents. Indeed, PI3K/mTOR dual inhibitor and Akt inhibitor were shown to effectively inhibit cellular growth in trastuzumab-and lapatinib resistant cells. At present, many classes of PI3K pathway inhibitors are in clinical development, and their roles in overcoming trastuzumab resistance will be tested in the future.
Inhibitors of alternative signaling molecules are also used to treat trasuzumab resistant cancer cells. Alternative signaling from IGF-1R or MET may be associated with trastuzumab resistance. Small-molecular weight inhibitors of IGF-1R or MET receptor tyrosine kinase, and anti-IGF-1 antibody and anti-HGF antibody are in clinical development at present. Monotherapy or combination therapy with these agents and trastuzumab is therefore an attractive therapeutic strategy.
HER2 vaccines and adoptive immunotherapy targeting the HER2 extracellular domain have been tested in clinical trials, with results showing that significant levels of durable T-cell HER2 immunity can be generated with active immunization without significant consequences with regard to autoimmunity against normal tissues (Bernhard H et al 2002 Endoctr Relat Cancer 9:33). Early data from clinical trials testing the potential use of HER2-specific vaccines in adjuvant therapy for high-risk breast cancer patients show promising results (Peoples GE et al. 2008 Clin Cancer Res 14:797).
Ertumaxomab (Rexomum, Fresenius Biotech GmbH, phase II study) is an intact bispecific antibody targeting HER2 and CD3 on T cells with preferential binding to activating Fee type I/III receptors and redirecting T cells, macrophages, dendritic cells, and natural killer cells to HER2expressing tumor sites ( Kiewe P et al. 2008 Expert Opin Investig Drugs 17: 1553). In a phase I trial, ertumaxomab treatment was associated with one complete response, two partial responses, and two stable diseases in patients with metastatic breast cancer who had received extensive prior treatment (Kiewe P et al. 2006 Clin Cancer Res 12:3085). The effects of ertumaxomab are being evaluated in phase II studies. Defucosylated trastuzumab is also used to treat trastuzumab resistant cancer cells. Removal of fucose from antibody oligosaccharides attached to the heavy chain of Asn297 (defucosylation) has been shown to significantly enhance antibody-dependent cellular cytotoxicity (ADCC) compared to the activity of regular antibodies. In addition, defu- cosylation of trastuzumab was also found to enhance ADCC in an in vitro assay as compared to regular trastuzumab (Suzuki E et al. 2007 Clin Cancer Res 13:1875).
Defucosylated trastuzumab more than doubled the median progression-free survival compared with conventional trastuzumab in preclinical models of HER2-amplified breast cancer (Juntilla et al. 2010 Cancer Res 70: 4481).
Any of the above agents including paclitaxel, docetaxel, dasatinib, erlotinib, gefitinib, lapatinib, pertuzumab, trastuzumab, ertumaxomab, trasuzumab-DMl, defucosylated trastuzumab, PI3K pathway inhibitors and HER2 vaccines are here envisioned to be useful in combination with nanobiopolymer conjugate compositions herein to treat breast cancers by methods described herein.
Nanobiopolymers as a platform for carrying multiple drugs for treatment of HER2/neu cancers
Advantages of drug combinations can be offered in a single molecular entity such as a nanobiopolymeric conjugate. These compounds offer enhanced cancer cell specificity because of the presence of tumor targeting antibodies, bypass drug resistance by delivering polymer-bound drugs into cancer cell cytoplasm, and can carry multiple drugs on a single platform (Wu K et al. 2010 Angew Chem Int Ed Engl. 9:1451). Efficient delivery of nanobiopolymer-attached drugs to tumors is increased by passive targeting through enhanced permeability and retention (EPR) effect typical for tumors (Maeda H et al. 2009 Eur J Pharm Biopharm 71 :409), and additionally, by active targeting using antibodies, such as anti-TfR (Maeda H et al. 2009 Eur J Pharm Biopharm 71 :409; Liu X, et al. 2008 Cancer Gene Ther. 15:126; Peterson CM et al. 2003Adv Exp Med Biol. 519:101). Table 1 shows the size (smaller than 30 nm) of conjugates used in Examples herein.
The slightly negative ζ potentials promote interaction of the conjugate with the cell membrane and enhance intracellular internalization (Wilhelm C et al. 2003 Biomaterials 24:1001-11).
A general problem with anti-cancer drugs is lack of specific tumor targeting, resulting in an extent of random tissue accumulation and significant side effects for normal tissues (Shukla R et al. 2008 Nanotech 19:1; Shukla R et al. 2006 Bioconjug Chem
17:1109). To circumvent this drawback, tumor-targeting antibodies have been used as drug carriers or directly as therapeutics (e.g., Herceptin®). Dendrimer nanoconjugates with attached Herceptin® displayed enhanced accumulation in breast cancer cells in animal models (Shukla R et al. 2006 Bioconjug Chem 17: 1109). Methotrexate-loaded dendrimers produced a cytotoxic effect in tumor cells in vitro resulting from Herceptin®-mediated complex internalization (Shukla R et al. 2008 Nanotech 19: 1). However, the efficacy of these nanodrugs was limited because of lack of efficient endosome release unit (Shukla R et al. 2008 Nanotech 19:1). Drugs were specifically delivered to cancer cells and tumor growth was inhibited as was angiogenesis in brain glioma-bearing animals (Fujita M et al. 2006
Angiogenesis 9: 183; Ljubimova JY et al. 2008 Chem Biol Interact. 171 :195). The efficiency of the polymers was associated with properties of tumor targeting, use of AON drugs to more than one tumor marker at the same time, and the presence of endosome disruption moiety ensuring drug release inside the target cell (Gasslmaier B et al. 2000 Eur J Biochem. 267:5101).
Table 1. Nanobiopolymer drugs and controls for treatment of cancers overexpressing HER2/neu, molecular sizes, and ζ potentials
PMLA is a natural polymer obtained from the slime mold Physarum polycephalum (Lee BS et al. 2006 Bioconjug Chem 17:317; Lee BS et al. 2002 Water-soluble aliphatic polyesters :poly(malic acid)s, in: Doi YSA, eds, Biopolymers, Weinheim: Wiley- VCH, 2002 pp.75- 103). PMLA is non-toxic, non-immunogenic, and biodegradable in vitro and in vivo, stable in the bloodstream, and highly water-soluble (Gasslmaier B et al. 1997 Eur J Biochem 250:308; Gsslmeier B et al. 2000 Eur J Biochem 267:5101). Systemic delivery of morpholino AONs having nucleotide sequences specific to cc4 and βΐ chains of a tumor vasculature-specific protein, laminin-411 (formerly, laminin-8), to intracranial glioblastoma was shown to result in marked inhibition of tumor angiogenesis and growth (Ljubimova JY et al. 2008 Nanomedicine 3:247; Ding H et al. 2010 Proc Natl Acad Sci online publication). Further, to target tumor vasculature, a mAb to transferrin receptor (TfR) was attached to the same nanoplatform. The nanobiopolymer composition carrying each of anti-HER2/neu antibody (Herceptin®), anti-TfR antibody, and AON to WSR2/neu is shown herein to enhance the specificity and anti-tumor effect towards HER2/neu positive breast cancer. Without being limited by any specific theory or molecular mechanism, the lead compound tested herein is a nanoplatform designed to work on several molecular levels, to inhibit the synthesis of new BER2/neu receptors with AON, and to block the activity of existing RERl/neu on the tumor cell membrane with Herceptin®.
Antisense oligonucleotides (AONs) that bind specifically to mRNA and block protein synthesis are tools specific for silencing gene expression. Efficient delivery of AONs and siRNAs in systemic treatment of tumors however still presents significant problems (Patil SD et al. 2005 AAPS 7:E61; Thierry et al, 2003 Curr Opin Mol Ther 5:133).
Preclinical studies of AON for cancer treatment showed promising results, and stability of AON in plasma renders these molecules feasible for systemic treatment (Busch RK et al. 1994 Cancer Lett 86:151; Sekhon HS et al. 2008 Lung Cancer 60:347; Garbuzenko OB et al. 2010 Proc Natl Acad Sci 107:10737). Further, Morpholino AONs specific for dystrophin have been delivered to dystrophic muscle cells in vivo in a Duchenne muscular dystrophy mouse model and to patients (Wu B et al. 2010 Gene Ther 17:132; Kinali M et al 2009 Lancet Neurol 8:918). An AON specific for HER2/neu was observed to be more potent for inhibiting neoplastic cell proliferation in vitro than mAb inhibition of BERl/neu receptor (Roh H et al. 2000 Cancer Res 60:560). Combination treatment of HER2/new-positive breast cancer cells in vitro with HER2/neu AON and conventional chemotherapeutic agents results in synergistic inhibition of tumor cell growth by activation of apoptosis (Rait AS et al. 2001 Cancer Gene Ther 8:728; Lewis PGD 2008 Cancer Res 68:9280).
Nanoparticles are used in drug delivery as carriers for small and large molecules.
Nanoparticles are defined as particulate dispersions or solid particles with a size in the range of 10-1000 nm. The drag is dissolved, entrapped, encapsulated or attached to a nanoparticle matrix (Langer R. 2000 Acc Chem Res 33:94). Nanobiopolymers of the present invention differ from nanoparticles in that nanoparticles have no covalent bonds between the particle and drug cargo, generally merely leak the drug, and accordingly cannot directly transport cargo to and release the cargo inside tumor cells.
Contrary to nanoparticles, nanobiopolymer compositions provided herein comprise a single unitary molecular entity having functional modules including a plurality of the following: tumor cell-targeting antibodies, two or more anti-tumor drugs, an endosomal disruption moiety, and a glutathione-cleavable bond to release the drug inside tumor cell cytoplasm, covalently attached. Such a construct functions to eliminate leakiness, suppresses non-tumor accumulation thereby minimizing side effects, and increase drug half-life dwell time of the composition in plasma. As a result, tumor uptake and drug specificity were observed in examples herein to be enhanced, leading to a significant reduction of tumor growth and volume. Moreover, the combined drug action through inhibiting Akt activation and increase of tumor cell apoptosis was also observed in examples herein.
Nanobiopolymers of the present invention offer a great potential in cancer therapy. Table 1. summarizes nanobiopolymer drugs synthesized for use in Examples herein.
Definitions
As used herein the term "molecular scaffold" refers to a molecule having at least two or more modules that transport a covalently conjugated drug to a targeted tissue; bind to cell surface receptors of the tissue; internalize into endosomes; escape the endosomes into the cytoplasm; and release reactive free drug in the cytoplasm by chemical reaction with glutathione and other sulfhydryl groups of the cytoplasmic content. The specificity of high molecular mass drug vehicles and particles rests primarily on the tumor tissue targeting by tumor-specific conjugated targeting molecules and their enhanced permeability and retention in tumors that originates from high molecular mass such as greater than 20000 (Duncan R. 1999 Research Focus 2:441; Seymour LW et al., 1995 Eur J Cancer Res 31A:766).
The term "polymalic acid" or PMLA as used herein refers to a polymer, e.g., a homopolymer that contains a main chain ester linkage, is biodegradable and of a high molecular flexibility, soluble in water (when ionized) and organic solvents (in its acid form), non-toxic, and non-immunogenic (Lee Bs et al., Water-soluable aliphatic polyesters:
poly(malic acid)s, in: Biopolymers, vol.3a (Doi Y, Steinbuchel A eds., pp 75-103, Wiley- VCH, New York 2002). Drug carrying PMLA is synthesized by ring-opening polymerization of derivatized malic acid lactones. Doxorabicin-poly-malic acid has been synthesized from synthetic poly-P-D, L-malic acid (Abdellaoui K et al., 1998 Eur J Pharmaceutical Sciences 6:61). The carrier consists of poly(P -L-malic acid), herein referred to as poly-β -L-malic acid or PMLA, representing the molecular backbone or scaffold that is chemically conjugated at its carboxylic groups at defined ratios with a variety of modules each of which performs at least one of the following functions: delivery of a pro-drug via a releasable functional module that becomes effective in the cytoplasm; directing the carrier towards a specific tissue by binding to the surfaces of cells, e.g., a monoclonal antibody (mAB); internalization into the targeted cell through endosomes (usually via internalization of a targeted surface receptor); promoting escape from endosomes into the cytoplasm by virtue of hydrophobic functional units that integrate into and finally disrupt endosomal membranes; increasing effectiveness during acidification of endosomes en route to lysosomes; and protection by polyethylene glycol (PEG) against degradative enzyme activities, e.g., peptidases, proteases, etc.
The term "module" as used herein refers to a biologically active molecular structure that forms a part of a composition herein, for example, a small drug molecule or a chromophore molecule; a protein molecule such as an antibody or lectin; or a portion thereof that are covalently joined to PMLA in constructing the composition. In the examples herein a biologically active module is exemplified by morpholino antisense oligonucleotides (AON) that are specific to HER2/neu receptor protein. Tissue targeting is exemplified by use of a monoclonal antibody (mAB) module that specifically recognizes and binds a transferrin receptor protein.
The term "transferrin receptor protein" as used herein refers to the receptor expressed on endothelium cell surfaces, and at elevated levels on certain tumors (Lee JH et al. 2001 Eur J Biochem 268:2004; Kovar MK et al, 2003 J Drug Targeting 10:23).
Transferrin receptors are used as a target for a drug delivery system in compositions herein, to chemically bind to transferring, for example using a monoclonal antibody that binds the transferrin receptor and thereby achieves transcytosis through endothelium associated with blood brain barrier. Antibody binding to transferrin receptor and internalization into endosomes has been demonstrated (Broadwell RD et al, 1996 Exp Neurol 142:47). It will be appreciated that in the case of the transferrin receptor any appropriate antibody monoclonal antibody, for example, a humanized or chimeric antibody, or a lectin or another ligand specific to the transferrin receptor can be used. Other appropriate ligands to any number of cell surface receptors or antigens can be used as targets in the compositions herein and transferrin receptor is merely examplary.
The phrase "endosomal escape unit" as used herein refers to a carrier module attached to the PMLA scaffold that becomes active by acidification during maturation of the endosomal vesicles towards lysosomes (Bulmus V et al, 2001 Cancer Research 61:5601; Lackey CA et al, 2002 Bioconjugate Chem 13:996). The carrier module includes a plurality of leucine or valine residues, or a leucine ethylester linked to the PMLA scaffold by amide bonds. During acidification of the endosomes en route to lysosomes, these stretches of the carrier molecule become charge-neutralized and hydrophobic, and capable of disrupting membranes. Other molecules that become charge neutralized at lysomal pH's may be used in place of leucine or valine residues, or a leucine ethylester in construction of the
compositions containing PMLA and an endosomal escape unit module.
PEGylation is generally used in drug design to increase the in vivo half-life of conjugated proteins, to prolong the circulation time, and enhance extravasation into targeted solid tumors (Arpicco S et al. 2002 Bioconjugate Chem 13:757; Maruyama K et al, 1997 FEBS Letters 413:1771). Other molecules known to increase half-life may be used in design of compositions herein.
As used herein, the terms "cancer" and "cancerous" refer to the physiological condition in mammals in which a population of cells are characterized by unregulated cell growth. Examples of cancers include, without limitation, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancers.
The terms "proliferative disorder" and "proliferative disease" refer to disorders associated with abnormal cell proliferation such as cancer.
The terms "tumor" and "neoplasm" as used herein refer to any mass of tissue that result from excessive cell growth or proliferation, either benign (noncancerous) or malignant (cancerous) including pre-cancerous lesions. The term "primary cancer" refers to the original site at which a cancer originates. For example, a cancer originating in the breast is called a primary breast cancer. If it metastasizes, i.e., spreads to the brain, the cancer is referred to as a primary breast cancer metastatic to the brain.
The term "metastasis" as used herein refers to the process by which a cancer spreads or transfers from the site of origin to other regions of the body with the development of a similar cancerous lesion, i.e., having the same or substantially the same biochemical markers at the new location. A "metastatic" or "metastasizing" cell is one that has a reduced activity for adhesive contacts with neighboring cells and migrates by the bloodstream or within lymph from the primary site of disease to additional distal sites, for example, to invade neighboring body structures or distal structures.
The terms "cancer cell", "tumor cell" and grammatical equivalents refer to a cell derived from a tumor or a pre-cancerous lesion including both a non-tumorigenic cell and a tumorigenic cell, i.e., cancer stem cell.
As used herein "tumorigenic" refers to the functional features of a solid tumor stem cell including the properties of self-renewal i.e., giving rise to additional tumorigenic cancer cells, and proliferation to generate other tumor cells i.e., giving rise to differentiated and thus non-tumorigenic tumor cells, such that cancer cells form a tumor.
The phrase "target a tumorigenic cell or a cancer cell" as used herein refers to delivery of a composition to a population of tumor-forming cells within tumors, i.e., tumorigenic cells. The preferential delivery of the composition to the tumorigenic population of cancer cells in comparison to other populations of cells within tumors is referred herein as targeting to eliminate cancer cells, a property that improves specificity and efficacy of the composition.
The term "antibody" is used herein to mean an immunoglobulin molecule that is a functional module included in compositions herein for ability to recognize and specifically bind to a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combinations of the foregoing through at least one antigen recognition site within the variable region of the immunoglobulin molecule. In certain embodiments, antibodies included as functional modules of compositions herein include a class described as antagonist antibodies, which specifically bind to a cancer stem cell marker protein and interfere with, for example, ligand binding, receptor dimerization, expression of a cancer stem cell marker protein, and/or downstream signaling of a cancer stem cell marker protein. In alternative embodiments, antibodies as functional modules in compositions herein include agonist antibodies that specifically bind to a cancer stem cell marker protein and promote, for example, ligand binding, receptor dimerization, and/or signaling by a cancer stem cell marker protein. In alternative embodiments, antibodies that do not interfere with or promote the biological activity of a cancer stem cell marker protein instead function to inhibit tumor growth by, for example, antibody internalization and/or recognition by the immune system.
As used herein, the term "antibody" encompasses intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments (such as Fab, Fab', F(ab')2, and Fv fragments), single chain Fv (scFv) mutants, multispecific antibodies such as bispecific antibodies generated from at least two intact antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen determination portion of an antibody, and any other modified immunoglobulin molecule comprising an antigen recognition site so long as the antibodies exhibit the desired biological activity. An antibody includes any the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g. IgGl, IgG2, IgG3, IgG4, IgAl and IgA2), based on the identity of their heavy-chain constant domains referred to as alpha, delta, epsilon, gamma, and mu, respectively. Antibodies can be naked or conjugated to other molecules such as toxins, radioisotopes, etc. In other embodiments an antibody is a fusion antibody.
As used herein, the term "antibody fragment" refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody. Examples of antibody fragments include, but are not limited to Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, single chain antibodies, and multispecific antibodies formed from antibody fragments.
An "Fv antibody" refers to the minimal antibody fragment that contains a complete antigen-recognition and -binding site either as two-chains, in which one heavy and one light chain variable domain form a non-covalent dimer, or as a single-chain (scFv), in which one heavy and one light chain variable domain are covalently linked by a flexible peptide linker so that the two chains associate in a similar dimeric structure. In this configuration the complementarity determining regions (CDRs) of each variable domain interact to define the antigen-binding specificity of the Fv dimer. Alternatively a single variable domain (or half of an Fv) can be used to recognize and bind antigen, although generally with lower affinity.
A "monoclonal antibody" as used herein refers to homogenous antibody population involved in specific recognition and binding of a single antigenic determinant, or epitope. Polyclonal antibodies include a population of antibody species each directed to a different antigenic determinant. The term "monoclonal antibody" encompasses both and full-length monoclonal antibodies and antibody fragments (such as Fab, Fab', F(ab')2, Fv), single chain (scFv) mutants, fusion proteins comprising an antibody portion, and any other modified immunoglobulin molecule comprising an antigen recognition site. Furthermore,
"monoclonal antibody" refers to those obtained without limitation by methods including and not limited to hybridoma expression, phage selection, recombinant expression, and by transgenic animals. Pharmaceutical Compositions
In one aspect of the present invention, a pharmaceutical composition is provided that includes a nanobiopolymeric conjugate of poly(P-L-malic acid) referred to as poly-p-L- malic acid or PMLA herein, covalently linked to an antisense molecule that is a functional module that inhibits expression of an oncogenic protein, and at least one module that is an antibody specific for the protein, and optionally further comprises a module that is an antibody specific for an oncogenic vascular protein, and a pharmaceutically acceptable carrier. In certain embodiments, the composition optionally further comprises one or more additional modules that are additional therapeutic agents. In certain embodiments, the additional therapeutic agent or agents is selected from the group consisting of growth factors, anti-inflammatory agents, vasopressor agents, collagenase inhibitors, topical steroids, matrix metalloproteinase inhibitors, ascorbates, angiotensin II, angiotensin III, calreticulin, tetracyclines, fibronectin, collagen, thrombospondin, transforming growth factors (TGF), keratinocyte growth factor (KGF), fibroblast growth factor (FGF), insulinlike growth factors (IGF), epidermal growth factor (EGF), platelet derived growth factor (PDGF), neu differentiation factor (NDF), hepatocyte growth factor (HGF), and hyaluronic acid.
As used herein, the term "pharmaceutically acceptable carrier" includes any and all solvents, diluents, or other liquid vehicle, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. Remington's
Pharmaceutical Sciences Ed. by Gennaro, Mack Publishing, Easton, PA, 1995 discloses various carriers used in formulating pharmaceutical compositions and known techniques for the preparation thereof. Some examples of materials which can serve as pharmaceutically acceptable carriers include, but are not limited to, sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppositoiy waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols; such a propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol, and phosphate buffer solutions, as well as other non-toxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the composition, according to the judgment of the formulator.
Therapeutically Effective Dose
In yet another aspect, according to the methods of treatment of the present invention, methods for treatment of a specific type of cancer, are described herein. Thus, the invention provides methods for the treatment of a cancer associated with a particular receptor comprising administering a therapeutically effective amount of a pharmaceutical composition comprising active agents that inhibits expression of at least one ligand of the receptor to a subject in need thereof, in such amounts and for such time as is necessary to achieve the desired result. It will be appreciated that this encompasses administering an inventive pharmaceutical as a therapeutic measure to promote regression of a cancer or prevent further development or metastasis, or as a prophylactic measure to minimize complications associated with development of a tumor or cancer. In certain embodiments of the present invention a "therapeutically effective amount" of the pharmaceutical composition is that amount effective for preventing further development of a cancer or transformed growth, and even to effect regression of the cancer. The compositions, according to the method of the present invention, may be administered using any amount and any route of administration effective for prevention of development of a cancer. Thus, the expression "amount effective for inhibiting expression or activity of the oncogenic protein", as used herein, refers to a sufficient amount of composition to prevent or retard development of a cancer, and even cause regression of a cancer or solid tumor. The cancer need not be limited to a solid tumor, and includes various types of lymphomas and leukemias.
The exact dosage is chosen by the individual physician with regard to the need of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active agent(s) or to maintain the desired effect. Additional factors which may be taken into account include the severity of the disease state, e.g. , cancer size and location; age, weight and gender of the patient; diet, time and frequency of administration; drug combinations; reaction sensitivities; and tolerance/response to therapy. Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once eveiy two weeks depending on half-life and clearance rate of the particular composition.
The active agents of the invention are preferably formulated in dosage unit form for ease of administration and uniformity of dosage. The expression "dosage unit form" as used herein refers to a physically discrete unit of active agent appropriate for the patient to be treated. It will be understood, however, that the total daily usage of the compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. For any active agent, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs as shown in Examples herein. The animal model is also used to achieve a desirable concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans. A therapeutically effective dose refers to that amount of active agent which ameliorates the symptoms or condition. Therapeutic efficacy and toxicity of active agents can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g. , ED50 (the dose is therapeutically effective in 50% of the population) and LD50 (the dose is lethal to 50% of the population). The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50. Pharmaceutical compositions herein exhibit large therapeutic indices. The data obtained from the animal studies herein is used in formulating a range of dosage for human use.
An initial dose of Herceptin® for human treatment accepted by the FDA is 4 mg/kg followed by 2 mg/kg weekly for a total of 52 doses. An efficient dose of the composition herein for treatment of a mouse was 100 μΐ of observed 40 μg ml, which is equivalent to about 3.2 mg/kg for human use.
Administration of Pharmaceutical Compositions After formulation with an appropriate pharmaceutically acceptable carrier in a desired dosage, the pharmaceutical compositions of this invention can be administered to humans and other mammals topically (as by powders, ointments, or drops), orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, or intravenously, depending on the severity and location of the cancer or other condition being treated. Intravenous administration includes injection as a bolus, or as a drip.
Dosage forms for topical or transdermal administration of an inventive
pharmaceutical composition include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches. The active agent is admixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives or buffers as may be required. For example, ocular or cutaneous infections may be treated with aqueous drops, a mist, an emulsion, or a cream. Administration may be therapeutic or it may be prophylactic. Prophylactic formulations may be present or applied to the site of potential tumors, or to sources of tumors. The invention includes devices, surgical devices, audiological devices or products which contain disclosed compositions (e.g. , gauze bandages or strips), and methods of making or using such devices or products. These devices may be coated with, impregnated with, bonded to or otherwise treated with a disclosed composition.
The ointments, pastes, creams, and gels may contain, in addition to an active agent of this invention, excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc, zinc oxide, or mixtures thereof.
Powders and sprays can contain, in addition to the agents of this invention, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates, polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants such as chlorofluorohydrocarbons.
Transdermal patches have the added advantage of providing controlled delivery of the active ingredients to the body. Such dosage forms can be made by dissolving or dispensing the compound in the proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel.
Injectable preparations, for example, sterile injectable aqueous solutions or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may be formulated a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1 ,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S. P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. To prolong the effect of an active agent, it is often desirable to slow the absorption of the agent from subcutaneous or intramuscular injection. Delayed absorption of a parenterally administered active agent may be accomplished by dissolving or suspending the agent in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the agent in biodegradable polymers such as polylactide-polyglycolide as described herein, and in Ljubimova et al., US patent number 7,547,511 issued June 16, 2009, Ljubimova et al., US patent application number 12/473,992 published October 22, 2009, Ljubimova et al, US patent application number 10/580,999 published November 8, 2007, and Ding et al, International patent application PCT/US2009/40252 filed April 10, 2009. The rate of active agent release is controlled by the ratio of active agent to polymer and the nature of the particular polymer employed. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the agent in liposomes or microemulsions which are compatible with body tissues.
Compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the active agent(s) of this invention with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active agent(s).
Uses of Pharmaceutical Compositions
As discussed above and described in greater detail in the Examples in a manuscript attached in an appendix hereto, accepted for publication in Cancer Research, at least one of Inhibition of expression or activity of an oncogenic protein is useful to prevent development or metastasis of a cancer condition. In general, it is believed that these inhibitors are clinically useful in preventing further growth of a particular cancer type, including but not limited to the breast cancer; skin cancer; ovarian cancer; cervical cancer; the retinoblastoma; colon cancer and other such conditions such as those arising from the lining of the gastrointestinal tract; lung cancer and cancers of the respiratory tract; renal carcinoma and other tumors arising from the inner surface of kidney tubules; leukemias and lymphomas and such disorder of blood; and other types of genital cancer including those associated with various strains of papilloma virus; brain tumors; and cancers of the uterus, of the vagina, of the urethra.
It will be appreciated that the diagnostic, prognostic and therapeutic methods encompassed by the present invention are not limited to treating conditions in humans, but may be used to treat similar conditions in any mammal including but not limited to bovine, canine, feline, caprine, ovine, porcine, murine, and equine species. When treating tumors in a given species, it is preferred, but not required, that the antisense oligonucleotides have a nucleotide sequence that is substantially identical in base sequence to that as it occurs naturally in the species.
The invention having been fully described is it further exemplified in a research paper by Satoshi Inoue et al. entitled "Polymalic acid-based nanobiopolymer provides efficient systemic breast cancer treatment by inhibiting both HER2/neu receptor synthesis and activity", which is accepted for publication in Cancer Research and is incorporated herein by reference hereby in its entirety.
The invention now having been fully described it is exemplified in Examples below and in the claims, which are not to be construed as further limiting. References cited herein are hereby incorporated by reference in their entireties.
Examples
Example 1. Reagents
Μοφηο1ίηο™-3'-ΝΗ2 antisense oligonucleotides (AONs) used in Examples herein were custom made by Gene Tools (Philomath, OR).
AONs specific for HER2/neu included two sequences:
version 1 : 5 '-AGGGAGCCGCAGCTTCATGTCTGTG-3 ' (SEQ ID NO:l), and
version 2: 5 ' -CATGGTGCTC ACTGCGGCTCCGGC-3 ' (SEQ ID NO:2). AONs specific for an epidermal growth factor receptor (EGFR) included:
5'-TCGCTCCGGCTCTCCCGATCAATAC-3' (SEQ ID NO:3).
AONs specific for a4 and βΐ subunits of laminin-411 included:
a4 subunit: 5 '-AGCTCAAAGCCATTTCTCCGCTGAC-3 ' (SEQ ID NO:4), and βΐ subunit: 5'- CTAGCAACTGGAGAAGCCCCATGCC-3 ' (SEQ ID NO:5).
siRNA specific for EGFR included sequences as follows:
sense: 5'-CCUAUAAUGCUACGAAUAUtt-3' (SEQ ID NO:6), and
antisense: 5'-AUAUUCGUAGCAUUUAUGGag-3'(SEQ ID NO:7).
siRNA specific for HER2 receptor protein included:
sense: 5'-GUUGGAUGAUUGACUCUGAtt-3' (SEQ ID NO:8), and
antisense: 5'-UCAGAGUCAAUCAUCCAACat-3' (SEQ ID NO:9).
Small letters "tt", "ag" and "at" at the 3'-terminus of the siRNA sequence denote DNA oligonucleotides that are synthesized to anneal siRNA to a DNA molecule.
Highly purified, endotoxin-free poly^-L-malic acid, Mw (weight-averaged) = 100 kDa, polydispersity = 1.1, was obtained from the culture broth of Physarum polycephalum. Rat anti-mouse TfR mAb R 17217 (mTfR) was purchased from Southern Biotech
(Birmingham, AL). Cysteamine (2-mercaptoethyl-l -amine hydrochloride), N- hydroxysuccinimide, other reagents and solvents were of highest available purity and purchased from Sigma-Aldrich (St. Louis, MO).
Example 2. Synthesis of polvmalic acid nanobiopolvmers
The nanobiopolymers contain five to six components (Figure 1): PMLA as the backbone; functional modules include: morpholino AON to inhibit HER2/neu protein synthesis; targeting anti-TfR mAb; anti-tumor Herceptin®; 40% leucine ethyl ester (LOEt) as endosome escape unit to achieve cytoplasmic AON delivery, and 5% PEG5000 to increase stability in the bloodstream. Anti-mouse TfR mAb on Herceptin®-containing conjugate was used to target tumor vasculature. The conjugate with AON without Herceptin® included an anti-human TfR mAb attached to it to promote drug binding to human tumor cells and its internalization. The preconjugate containing 40% LOEt, 5% PEG5000 and 10% of cysteamine (% referring to the total amount of pendant carboxyl groups in polymalic acid) was synthesized by the methods described previously (Lee BS et al. 2006Bioconjug Chem 17:317). The antibodies conjugated with the preconjugate were qualitatively and quantitatively assayed by size exclusion HPLC. ELISA with purified TfR and HER2/neu was used to assess functional reactivity of attached antibodies as described (Fujita M et al. 2007 J Control Release. 122:356).
Conjugates for imaging were fluorescently labeled with Alexa Fluor® 680 C2- maleimide (Invitrogen, Carlsbad, CA) by forming thioether with sulfhydryl groups.
Antibody conjugates were then reacted with HER2/neu AON (Figure 1). A control conjugate contained Herceptin® (Figure 1) and not Hisi?2/«ew-specific AON.
Example 3. The nanobiopolymer characterization
Chemical and physical characterization of polymeric nanobioconjugate was performed by various methods including L-malate dehydrogenase assay after
nanobiopolymer hydrolysis at 100°C in the presence of 6 M HQ, PEG colorimetric determination and protein quantification, size and potential, HPLC, and ELISA. HPLC was performed on a Hitachi analytical Elite LaChrom HPLC-UV system (Hitachi,
Pleasanton, CA) and size exclusion, on a BioSep-SEC-S 3000 column (Phenomenex, Torrance, CA). The nanobiopolymer variants were characterized by their size
(hydrodynamic diameter) on the basis of noninvasive back-scattering (NIBS), and ζ potential from electrophoretic mobility based on the Helmholtz-Smoluchowski formula, using electrophoresis M3-PALS (Gasslaier B et a. 1997 Eur J Biochem 250:308). Both measurements were performed in a Zetasizer Nano System ZS90 (Malvern Instruments, Malvern, UK). Data on molecular size and ζ potential represent mean ± standard deviation obtained from three independent measurements.
Example 4. Cell lines and culture conditions
Human breast cancer cell lines BT-474, SKBR-3, MDA-MB-231, MDA-MB-435, MDA-MB-468, and MCF-7 were obtained from American Type Culture Collection
(Manassas, VA). BT-474, MDA-MB-231, MDA-MB-435, MDA-MB-468, and MCF-7 were cultured in DMEM with 10% fetal bovine serum and antibiotics. SKBR-3 was cultured in McCoy's 5A medium with 10% fetal bovine serum and antibiotics. Example 5. Nomenclature
The term "nanobiopolymer" denotes a drug delivery system with PMLA as a nanoplatform and functional module groups covalently attached to the PMLA, including an AON, a rat anti-mouse or a mouse anti-human targeting TfR mAbs (M and H, respectively), and LOEt as the endosomal escape unit module. The nanobiopolymer drags (Figure 1 and Table 1) described herein to treat HER2/«eu-positive breast cancer contained either a drug HER2/neu AON or drug Herceptin® or both HER2/neu AON + Herceptin®. Example 6. Cell proliferation assay
HER2/new-overexpressing breast cancer cells each of BT-474 or SKBR-3 were seeded into six- well plates at 3 <105 cells/well. The next day, cells were treated with one of Endoporter (4 μΜ; control); Herceptin (40 g/ml); P/mPEG/LOEt/Herceptin® (40 μ^ηιΐ); Endoporter (4 μΜ) and AON (4 μΜ); P/mPEG/LOEt/AON/TfR(H/M);
P/mPEG/LOEt/AON/Herceptin®/TfR(M); and PBS control. Seventy-two hours after treatment, the cells were stained with Trypan Blue. Cell viability was determined by calculating the mean of cell counts for each treatment group (in triplicate) and was expressed as a percentage of the total number of cells treated normalized to the number of cells treated with PBS.
Example 7. Western blotting
BT-474 and SKBR-3 breast cancer cells were treated with Herceptin® (40 μg ml); P/mPEG/LOEt/Herceptin® (40 μg/ml equivalent to Herceptin®); Endoporter (4 μΜ) and AON (4 μΜ); P/ mPEG/LOEt/ AON/TfR(H/M) ; P/mPEG/LOEt/AON/Herceptin®/TfR(M); PBS control, or 4 μΜ Endoporter. Cell lysates were collected after 72 hours and were analyzed by western blotting as described previously (Inoue S et al. 2005 Mol Ther. 12:707- 15). Lysates of excised breast tumors after various treatments were analyzed by these methods. The following anti-human primary antibodies were used: HERl/neu, Akt, phosphorylated Akt (p-Akt), glyceraldehyde 3-phosphate dehydrogenase (GAPDH, to normalize gel load) (all from Cell Signaling Technology, Beverly, MA), and poly(ADP ribose) polymerase (PARP; BD Biosciences, San Jose, CA).
Example 8. Tumor xenografts in nude mice
Animal experiments were performed in accordance with the protocols approved by the Cedars-Sinai Medical Center Institutional Animal Care and Use Committee. Athymic mice (CrTac: NCr-Foxnlnu Homozygous; Taconic, Hudson, NY) were used. A 0.72-mg, 90-day release, Πβ-ββΰ ίοΙ pellet (Innovative Research of America, Sarasota, FL) was inserted subcutaneously into the back of each mouse seven days prior to injection. An amount of 1 x 107 BT-474 cells suspended in 150 μΐ of Matrigel (BD Biosciences, Bedford, MA) were injected into the right flank of each of 35 mice (5 mice per group), and treatment was initiated when tumors achieved an average size of > 120 mm3 (21 days after injection). Mice were divided into five treatment groups and each group was administered either of: sterile PBS (control); Herceptin® (40 μ^ηιΐ); P/mPEG/LOEt/Herceptin® (40 μg/ml equivalent to Herceptin®); P/mPEG/LOEt/AON/Tf (H/M); or
P/mPEG/LOEt/AON/Herceptin®/TfR(M); into the tail vein twice a week. Treatments were performed six times during a period of three weeks.
Tumor xenografts were measured with calipers twice a week, and tumor volumes were determined using the formula: (lengthx width ) x (π/6).
Eighteen days after the last treatment, the animals were anesthetized with 3% isoflurane-air mixture and were euthanized. Tumor samples were stained with hematoxylin and eosin for morphological observation. The data are the average of two independent examples.
Example 9. Confocal microscopy
Alexa Fluor 680-labeled nanobiopolymers (P/mPEG/LOEt/IgG, control);
P/mPEG/LOEt/Herceptin®, 40 μ^πύ; or P/mPEG/LOEt/AON/Herceptin®/TfR(M)) was each injected into the tail vein of mice. Twenty-four hours after drug administration, mice were euthanized; the tumors were harvested to detect the fluorescent signal, snap-frozen in liquid nitrogen and embedded in OCT compound for confocal microscopy (TCS SP5 X microscope; Leica Microsystems, Mannheim, Germany).
Example 10. In vivo imaging
BT-474 human breast cancer cells were implanted into the right thigh of mice as described. When tumor size attained 120 mm , 160 μΐ of Alexa Fluor 680 labeled nanobiopolymers was injected intravenously (4 μΜ). P/mPEG/LOEt/IgG was used as a negative control. Drug distribution and localization was assessed in tumor-bearing mice using Xenogen IVIS 200 imager (Caliper Life Sciences, Hopkinton, MA), at different time points before drug administration, 1 h, 3 h, 6 h, and 24 h after the drug injection). Twenty- four hours after drug administration, mice were euthanized and the circulating drugs eliminated by intraarterial PBS perfusion. The tumor and major organs were harvested to detect the fluorescent signal. Example 11. Statistical analysis
Student's t-test (for two groups) and analysis of variance (A OVA, for three and more groups) were used to calculate significance of the experimental results. GraphPad Prism4 program (GraphPad Software, statistical San Diego, CA) was utilized for all calculations. Data are presented as mean ± standard error of mean (SEM). The significance level was set at PO.05.
Example 12. Synthesis of polymer conjugates
Of the HER2/neu-specific AON sequences, a version that did not inhibit HER2/neu expression well in comparison with another version was observed; therefore, only the effective version was conjugated to the polymer platform. The absolute molecular weight of the lead version of nanobiopolymer (Figure 1) was 1,300 kDa by light scattering and close to the calculated value based on design. Hydrodynamic diameters (nano sizes) and ζ potentials of the nanobiopolymers in Figure 1 are summarized in Table 1. Parameters for ζ potentials in the range of -4.1 to - 5.7 mV have been reported for other nanoparticles as compatible with cell membrane attachment and nanoparticle internalization (Lorenz MR et al. 2006. Biomaterials 27:2820; Wilhelm C et al. 2003 Biomaterials. 24: 1001). Example 13. The lead nanobiopolymer carrying both Herceptin® and HER2/neu AON (P/mPEG/LOEt/AON/Herceptin®/TfR(M)) inhibited growth of breast cancer cells in vitro
Breast cancer cell growth inhibition following
AON and Herceptin® was first examined. Based on optimization experiments, each of AON at 4 μΜ with 4 μΜ Endoporter (in vitro AON delivery agent, GeneTools), and Herceptin®, at 40 g/ml was analyzed. Results in Figure 2 are shown for HER2/new high-expressing cells BT474 and SKBR-3, as well as for low-expressing cells, MDA-MB-231 and MDA- MB-435. At the concentrations used, it was observed that each of free AON and Herceptin® resulted in some growth inhibition in HER2/new high-expressing cells. Low-expressing cell lines were observed to be significantly less responsive to these treatments.
These nanobiopolymeric conjugates (a two-drug compound and single-drug compounds shown in Figure 1) were then tested for tumor cell growth inhibitory effect. The nanobiopolymers, Herceptin®, and free AON caused significant growth inhibition compared to PBS control in HERl/neu high-expressing cells (Figure 2 top, P<0.01). The lead two- drug compound produced the strongest inhibitory effect that was significantly higher than that of the other nanobiopolymers tested and higher than Herceptin® (P<0.005 compared to all groups). In HERl/neu low-expressing cells, only the lead compound with AON, Herceptin® and TfR(M) was able to induce statistically significant inhibition of tumor growth compared to PBS (Figure 2 bottom, PO.02).
Example 14. The lead compound inhibits HER2/neu and p-Akt expression and induces apoptosis of HER2/neu-overexpressing breast cancer cells in vitro
A phosphatidylinositol-3 kinase (PI3K) and its downstream target, the
serine/threonine kinase Akt, play an important roll in HERl/neu positive breast cancer cell growth and proliferation, as well as in anti-tumor effect of Herceptin® (Tseng PH et al, 2006 Mol Pharmacol. 70:1534; Yakes FM et al. 2002 Cancer Res. 62:4132). HERl/neu signaling can activate the PI3K/Akt/mTOR cascade, and activated Akt stimulates increases in cell size, metabolism and survival (Plas DR et al. 2005 Oncogene 24:7435).
Therefore, to examine the mechanism responsible for the enhanced growth inhibitory effect of the lead nanobiopolymer, drug effects on the expression and
phosphorylation of pertinent signaling markers HERl/neu, Akt, and p-Akt were assessed.
HERl/neu high-expressing cell lines BT-474 and SKBR-3 were used (Figure 3 panel A). To determine whether the nanobiopolymer carrying both HERl/neu AON and
Herceptin® induces apoptosis, PARP cleavage was examined by western blot analysis.
In HERl/neu high-expressing cell lines, HERl/neu expression was inhibited to different extents by each of Herceptin®, AON, and the single-drug versions of the nanobiopolymer [P/mPEG/LOEt/Herceptin and P/mPEG/LOEt/AON/TfR(H/M)] in comparison with controls. The strongest inhibition of HERl/neu expression was observed upon treatment with the lead nanobiopolymer having AON and Herceptin® attached to the PMLA carrier molecule.
Expression of p-Akt, a key downstream mediator of HERl/neu signaling (Tseng PH et al, 2006 Mol Pharmacol. 70:1534), was inhibited to different extents in tumor cells treated with Herceptin®, AON, or single-drug versions of nanobiopolymer compared to control cells treated with PBS or AON transduction reagent Endoporter. The p-Akt signal upon treatment of both breast cancer cell lines with the lead drug carrying both Herceptin® and HER2/neu AON was observed to be markedly lower in comparison to treatment with any other agent (Figure 3 panel B). The amount of total Akt on western blots remained unchanged by each of the treatment.
Apoptosis assessed by PARP cleavage was induced to some extent by each of Herceptin®, AON, and single-drug nanobiopolymers in HERl/neu high-expressing cells, for example in BT-474 cell line. Significantly, the lead compound,
P/mPEG/LOEt/AON/Herceptin®/TfR(M), triggered apoptosis to a greater extent than the other agents in both cell lines, as shown by increased PARP cleavage compared to the other agents (Figure 3 panel B). Example 15. The lead compound P/mPEG/LOEt/AON/Herceptin®/TfR(M) specifically accumulates in HER2/neu-overexpressing breast tumors in vivo
Imaging studies in vivo showed that the lead compound
P/mPEG/LOEt/AON/Herceptin®/TfR(M) having anti-mouse TfR and anti-human HER2/neu combined on the same PMLA molecule provided tumor-specific drug delivery through host endothelial system into subcutaneous human breast tumors. Twenty-four hours after injection of drugs, the compounds were observed to accumulate mostly in the tumor and draining organs, kidney and liver (Figure 4). The nanobiopolymer with only Herceptin® accumulated to a lesser extent in tumors than the version with Herceptin®, AON and anti- TfR mAb (the lead drug). These data show the enhanced targeting of tumor vasculature with anti-TfR mAb compared to Herceptin®. Control nanobiopolymer with IgG showed only a small amount of tumor accumulation (Figure 4).
Confocal microscopy was performed on sections of brain tumors removed 24 hours after intravenous injection of Alexa Fluor 680-labeled drugs. A significantly stronger signal in tumor cells for P/mPEG/LOEt/Herceptin® was observed than for the control conjugate P/mPEG/LOEt/IgG, and the highest tumor accumulation was observed with the lead compound compared to other nanobiopolymers (Figure 5).
Example 16. The lead compound P/mPEG/LOEt/AON/Herceptin®/TfR(M) significantly inhibits HER2/neu positive breast tumor growth in vivo
The therapeutic effect of compositions herein following intravenous administration in subcutaneous mouse models of human breast tumor xenografts was investigated. Cell line BT-474 was selected for in vivo analysis because of its high HER2/«eu expression and tumorigenicity. Treatment of BT-474 tumor-bearing mice with Herceptin®, single-drug nanobiopolymers and the lead compound P/mPEG/LOEt/AON/Herceptin®/TfR(M) was performed and compared to negative control PBS. No decreases in body weight or morbidity, or death was observed, indicating that each treatment was well tolerated.
Each the compounds inhibited tumor growth after six treatments (from days 21-38 post tumor implantation) and during follow-up to 56 days (Figure 6 panel B). Control unconjugated Herceptin® showed a similar tumor growth inhibition as a function of time as PMLA-bound Herceptin®. Both these drugs produced a somewhat stronger effect than HER2/neu AON bound to PMLA (Figure 6 panel B). This effect was significant for all three of these single drug compounds (P<0.03 vs. PBS). The compound having both Herceptin® and HER2/neu AON combined on one nanobiopolymer showed the highest degree of inhibition of tumor growth, with a clear synergistic effect compared to single-drug treatments (Figure 6 panel ; P<0.001 vs. PBS; P<0.03 vs. other treatment groups). The observed tumor regression following treatment with
P/mPEG/LOEt/AON/Herceptin®/TfR(M) was 80% at the start of follow-up to 95% at the end of this period (day 56; Figure 6 panel B). Moreover, tumors in the group treated with this lead compound started to regress within the two weeks after the initial treatment, and tumors in this group remained suppressed for an additional 20 days, at which time the treatment was terminated.
Hematoxylin and eosin staining revealed that the tumors treated with each of
Herceptin®, P/mPEG/LOEt/Herceptin®, or P/mPEG/LOEt/AON/TfR(H/M) showed some areas of cell death compared with PBS (control) treated tumor. Significantly, treatment with the lead compound led to the appearance of massive morphologically necrotic areas with little unaffected tumor tissue remaining (Figure 6 panel A).
The mechanism of this antitumor effect was further investigated by western blot analysis using lysates of subcutaneous BT-474 breast tumors after different treatments. Tumor ERl/neu expression was partially inhibited by each of Herceptin®, AON, and single-drug versions of the PMLA nanobiopolymer [P/mPEG/LOEt/Herceptin® and P/mPEG/LOEt/AON/TfR(H/M)] in comparison with PBS controls (Figure 6 panel C). The lead compound P/mPEG/LOEt/AON/Herceptin®/TfR(M) produced the highest inhibition of HER2/neu tumor expression, consistent with the in vitro western blot analysis.
Phosphorylated Akt was also reduced after drug treatments. Again, lead drug
P/mPEG/LOEt/AON/Herceptin®/TfR(M) resulted in the most pronounced decrease, with little p-Akt signal observed remaining (Figure 6 panel C). Total Akt remained unchanged upon treatments, as in the in vitro experiments.
Apoptosis assessed by PARP cleavage was induced to some extent by each of the compouns in HER2/neu high-expressing tumors compared to PBS treatment. Significantly, lead P/mPEG/LOEt/AON/Herceptin®/TfR(M) markedly increased PARP cleavage compared to the other treatments indicating that this nanobiopolymer induced apoptosis to a greater extent than the other used drugs (Figure 6 panel C).
Example 17. Nanobiopolymer conjugates significantly inhibited triple negative breast cancer growth in vivo
Potential therapeutic effects of each of the compounds in Table 2 following intravenous administration using subcutaneous mouse models of human triple-negative breast cancer (TNBC) xenografts were investigated. Cell line MDA-MB-468 was selected for in vivo analysis because it lacked expression of estrogen and progesterone, and the HER2 protein in these cells is expressed normally. Treatment of TNBC tumor-bearing mice was performed with a single-drug nanobiopolymer containing AONs specific for a4 and βΐ subunits of laminin-411; or with a single-drag nanobiopolymer containing AONs specific for an epidermal growth factor receptor (EGFR) protein; or with a two-drug
nanobiopolymer conjugate combing AONs specific for EGFR protein with AONs specific for <x4 and β 1 subunits of laminin-411 , in comparison with negative control PBS using the treatment protocol schedule shown in Table 2.
Table 2. Nanobiopolymer drugs and controls for treatment of triple-negative breast cancers.
It was observed that single-drug compound carrying AONs specific for EGFR and the two-drag compound carrying both AONs specific for EGFR and AONs specific α4β1- subunits of laminin-411 inhibited tumor growth after six treatments that were administered during days 19-52 after implantation of tumor cells (Figure 7). The two-drug compound was observed to have produced a stronger therapeutic effect than the single-drug compound carrying AONs specific for EGFR alone, and the data were statistically significant for each single drag compound and the two-drag compound (P=0.1 vs. PBS). Further, administration on a schedule of the eight treatments was observed to be more effective than six treatments for greater regression of tumors.
Example 18. Advantages of nanobiopolvmers
A set of nanobiopolymeric conjugates specifically tailored for HER2/«ei -expressing breast cancer treatment was designed and tested in vitro and in vivo. The drug was based on UER2/neu inhibition by simultaneously blocking the synthesis of HER2/neu with specific AON and internalizing the receptor by binding to Herceptin®. The lead drug
P/mPEG/LOEt/AON/Herceptin®/TfR(M) was thus designed to more efficiently inhibit HER2/«e« expression and function. In vitro data showed that indeed, the lead drug, P/mPEG/LOEt/AON/Herceptin®/TfR(M), suppressed proliferation of HER2/«ew-positive breast cancer cell lines significantly more than Herceptin®, P/mPEG/LOEt/Herceptin® or P/mPEG/LOEt/AON/TfR(H/M) (Figure 2). Surprisingly, the lead nanobiopolymer was effective for both ΉΕΚΙ/neu high- and low-expressing HER2/«ew breast cancer cell lines. With regard to HER2/neu low-expressing cells, the lead drug was also superior to previously used HER2/neu AON, which did not inhibit their growth in vitro (Roh H et al. 2000 Cancer Res. 60:560). Moreover, the lead drug carrying both Herceptin® and HER2/neu AON produced the highest inhibition of both RER2/neu expression and Akt
phosphorylation, as well as enhanced tumor cell apoptosis, compared to other treatments. Herceptin® mediates anti-proliferative effects in HER2/«ew-positive cells by facilitating either HERl/neu degradation or endocytic destruction of the HER2/neu receptor or downregulation of PDK-Akt signaling (Clark AS et al. 2002. Mol Cancer Ther 1 : 707- 17) by inhibiting HER2/ne« receptor dimerization, and also by inducing immune activation (Hudis CA 2007 N Engl J Med 357:39).
Examples herein show that the in vitro growth-inhibiting effect of the lead drug carrying both Herceptin® and HER2/neu AON on tumor cells was enhanced by simultaneous AON-mediated inhibition of HER2/new synthesis and by downregulation of surface HER2/neu through its binding to Herceptin®. The stronger inhibition of Akt phosphorylation in this case could result from a significant attenuation of HER2/«ew signaling.
The lead drug P/mPEG/LOEt/AON/Herceptin®/TfR(M) was observed in examples herein to readily accumulate in breast tumors and dramatically inhibit human breast cancer growth in nude mice (Figure 6). Importantly, the magnitude of anti-tumor effect of this lead drug indicates synergy between HER2/neu AON and Herceptin® in vivo (Figure 6). In comparison, the in vitro effect showed about 50% growth inhibition in high RERl/neu- expressing cells, in contrast to nearly complete in vivo inhibition. Without being limited by any particular theory or mechanism of action, the synergistic anti-tumor action in vivo could result from a combination of several effects: enhanced reduction in HER2/??ew-mediated tumor growth by AON together with Herceptin®, preferential tumor accumulation mediated by combined EPR effect (Maeda H et al. 2009 Eur J Pharm Biopharm 71 :409) and active targeting with antibodies (Ljubimova JY et al. 2008 Chem Biol Interact 171: 195), and maintenance of effective drug concentration due to multiple treatments. Compared to the previously used combination of HER2/nen AON with doxorubicin that was similarly effective against xenogeneic BT-474 tumors (Roh H et al. 2000 Cancer Res. 60:560), the nanobiopolymeric conjugate herein is envisioned as free of side effects because of absence of toxic doxorubicin and of its efficient tumor targeting via Herceptin® and anti-TfR.
Examples herein confirmed that the lead nanobiopolymer
P/mPEG/LOEt/AON/Herceptin®/TfR(M) efficiently blocked ERllneu positive breast tumor growth through dual inhibition of HER2/neu and Akt phosphorylation, and as a result promoted enhanced tumor cell apoptosis. The combination of features of the
nanobiopolymer resulted in highly specific drug accumulation in the tumor tissue and inside tumor cells.
Example 19. Nanobiopolymer platforms for combinatios of drugs to treat breast cancers Nanobiopolymer compositions herein can be engineered to include any of at least one of functional modules: an antibody, drug, or AON, alone or in combination. By this characteristic, the nanobiopolymer conjugates herein are nanodmgs that are tailored to target simultaneously different molecular tumor markers typical of particular tumor cells and therefore are highly efficient against various tumors. For more efficient cancer treatment, nanobiopolymer conjugates of the present invention are covalently linked to one or more antineoplastic agents selected from the following group: a tyrosine kinase inhibitor lapatinib targeting EGFR and HER2 receptor proteins; pertuzumab, a monoclonal antibody (mAb) specific for HER2 receptor;
ertumaxomab, a bispecific antibody specific for HER2 and F<y RI/III; trastuzumab-DMl, mAb-toxin specific for HER2; CP-751,871, mAb specific for IFG-1R; foretinib
(GSKl 36089), a tyrosine kinase inhibitor targeting MET and VEGFRs; BEZ235 targeting proteins of mTOR/PI3K pathway; perifistone targeting Akt pathway; temsirolimus targeting mTOR; everolimus targeting mTOR; HER2 peptide-based vaccines; defucosylated trastuzumab, mAb specific for HER2; dasatinib, a small-molecule tyrosine kinase inhibitor targeting the cytosolic c-SRC and ABL1 kinases, as well as the RTKs c-KIT and platelet- derived growth factor receptors, alpha and beta; and gefitinib and erlotinib, inhibitors of EGFR. It is envisioned that these nanodrags and nanodrug combinations are effective for treatment of cancer cells in vivo in subjects including human patients.
The nanobiopolymer-based therapy used for treatment of BER2/neu expressing cancer cells and/or triple-negative cancer cells should make a significant clinical impact.
The following claims are exemplary only and are not to be construed as further limiting. One of ordinary skill in the art would readily determine from the examples and claims numerous equivalents that are within the scope of the invention herein.

Claims

What is claimed is:
1. A drug delivery composition for treating a cancer in a subject comprising:
a plurality of biologically active molecular modules comprising at least one module that targets a tumorigenic cell or a cancer cell, at least one module that inhibits synthesis or activity of a human epidermal growth factor receptor (HER) protein in the cell, and at least one module for cytoplasmic delivery; and
a polymalic acid-based molecular scaffold, wherein the molecular modules are covalently linked to the scaffold.
2. The composition according to claim 1 wherein the HER protein is at least one protein selected from the group comprising: HER1, HER2, HER3 and HER4.
3. The composition according to claim 1 wherein the at least one module that inhibits synthesis or activity of the protein is selected from the group comprising: an antisense oligonucleotide (AON), an siRNA oligonucleotide, an antibody, a polypeptide, an oligopeptide and a low molecular weight drug.
4. The composition according to claim 3 wherein the AON is a Morpholino AON having a sequence complementary to a sequence contained in an mRNA transcript of HER2/neu protein.
5. The composition according to claim 4 wherein the AON is selected from:
5 '-AGGGAGCCGCAGCTTCATGTCTGTG-3 ' (SEQ ID NO: 1), and
5 ' -CATGGTGCTCACTGCGGCTCCGGC-3 ' (SEQ ID NO:2).
6. The composition according to claim 1 wherein the at least one module that targets the cell comprises an antibody that binds specifically to a vasculature protein in the cell.
7. The composition according to claim 6 wherein the vasculature protein comprises a transferrin receptor protein.
8. The composition according to claim 6 wherein the antibody is anti-human.
9. The composition according to claim 6 wherein the antibody is selected from at least one of: rat anti-mouse, rat anti-human, rabbit anti-human and goat anti-human.
10. The composition according to claim 1 wherein the at least one module that inhibits activity of the protein comprises an antibody that binds specifically to a HER2/neu protein.
1 1. The composition according to claim 10 wherein the antibody comprises Herceptin®.
12. The composition according to claim 3 wherein the AON is a Morpholino AON having a sequence complementary to a sequence contained in an mRNA transcript of an epidermal growth factor receptor (EGFR) protein.
13. The composition according to claim 12 wherein the sequence comprises
5'-TCGCTCCGGCTCTCCCGATCAATAC-3' (SEQ ID NO:3).
14. The composition according to claim 3 wherein the AON is a Morpholino AON having a sequence complementary to a sequence contained in an mRNA transcript of at least one subunit of laminin-411.
15. The composition according to claim 14 wherein the at least one subunit is selected from a4 subunit and βΐ subunit.
16. The composition according to claim 15 wherein the sequence complimentary to the transcript of a4 subunit comprises 5 '-AGCTCAAAGCCATTTCTCCGCTGAC-3 ' (SEQ ID NO:4).
17. The composition according to claim 15 wherein the sequence complimentary to the transcript of the βΐ subunit comprises 5'- CTAGCAACTGGAGAAGCCCCATGCC-3' (SEQ ID NO: 5).
18. The composition according to claim 3 wherein the siRNA oligonucleotide compiises a sequence complementary to a gene encoding an EGFR protein.
19. The composition according to claim 18 wherein the sequence is selected from a sense sequence and an antisense sequence.
20. The composition according to claim 19 wherein the sense sequence comprises 5'-CCUAUAAUGCUACGAAUAUtt-3' (SEQ ID NO:6).
21. The composition according to claim 19 wherein the antisense sequence comprises 5'-AUAUUCGUAGCAUUUAUGGag-3' (SEQ ID NO:7).
22. The composition according to claim 3 wherein the siRNA oligonucleotide comprises a sequence complementary to a gene encoding a HER2 protein.
23. The composition according to claim 22 wherein the sequence is selected from a sense sequence and an antisense sequence.
24. The composition according to claim 23 wherein the sense sequence comprises 5'-GUUGGAUGAUUGACUCUGAtt-3' (SEQ ID NO:8).
25. The composition according to claim 23 wherein the antisense sequence comprises 5'-UCAGAGUCAAUCAUCCAACat-3' (SEQ ID NO:9).
26. The composition according to claim 1 wherein the at least one module for cytoplasmic delivery comprises an endosome escape unit.
27. The composition according to claim 26 wherein the endosome escape unit comprises a leucine ethylester.
28. The composition according to claim 27 wherein a concentration of the leucine ethylester comprises about 40% of the drug delivery composition.
29. The composition according to claim 1 wherein the plurality of modules further comprises a polyethylene glycol (PEG).
30. The composition according to claim 29 wherein the PEG has a molecular weight of about 1,000 Da, about 5,000 Da, about 10,000 Da, about 15,000 Da, about 20,000 Da, about 25,000 Da and about 30,000 Da.
31. The composition according to claim 1 wherein the scaffold comprises a poly-p-L- malic acid (PMLA).
32. The composition according to claim 1 present in a unit dose effective for treatment of the cancer in the subject.
33. The composition according to claim 32 wherein the unit dose is at least one selected from: 1 μg/kg, 50 μg/kg, 100 Hg/kg, 500 μg/kg, 1 mg/kg, 5 mg/kg, 10 mg/kg, 50 mg/kg, and 100 mg/kg.
34. The composition according to claim 32 wherein the unit dose is at least 1 mg/kg.
35. The composition according to claim 32 wherein the unit dose is less than about 10 mg/kg.
36. The composition according to claim 1 wherein the cancer is at least one selected from the list of: gastric, endometrial, salivary gland, lung, non-small cell lung, pancreatic, ovarian, peritoneal, prostate, colorectal, breast, cervical, uterine, ovarian, brain, head and neck, testicular and teratoma cancers.
37. The composition according to claim 36 wherein the cancer comprises a primary cancer.
38. The composition according to claim 36 wherein the cancer comprises a metastatic cancer.
39. The composition according to claim 36 wherein the cancer comprises cells overexpressing a HER2/neu receptor protein.
40. The composition according to claim 36 wherein the breast cancer is a triple-negative breast cancer.
41. A drag delivery composition for treating a cancer in a subject comprising:
a polymerized carboxylic acid molecular scaffold wherein the scaffold comprises a poly-P-L-malic acid (PMLA); and
a plurality of biologically active molecular modules comprising:
an antisense molecule that substantially inhibits synthesis of a HER2/neu receptor protein,
a molecular module to facilitate delivery of the antisense molecule to cytoplasm,
at least one antibody specific for the receptor protein that inhibits activity of the receptor protein,
at least one antibody targeting a tumor vasculature protein, and a molecular module that prolongs circulation of the composition, wherein the molecular modules are covalently linked to the scaffold.
42. A drug delivery composition for treating a cancer in a subject comprising:
a polymerized carboxylic acid molecular scaffold wherein the scaffold comprises a poly-P-L-malic acid (PMLA); and
a plurality of biologically active molecular modules comprising:
an antisense molecule that substantially inhibits synthesis of an epidermal growth factor receptor (EGFR) protein,
an antisense molecule that substantially inhibits at least one subunit of laminin-411,
a molecular module to facilitate delivery of the antisense molecule to cytoplasm,
at least one antibody targeting a tumor vasculature protein, and a molecular module that prolongs circulation of the composition, wherein the molecular modules are covalently linked to the scaffold.
43. A kit for treating a patient having a cancer comprising a drug delivery composition comprising a nanobiopolymeric conjugate of a scaffold comprising a poly-P-L-malic acid (PMLA) and molecular modules comprising an antisense molecule that substantially inhibits synthesis or activity of a human epidermal growth factor receptor (HER) protein, a molecular module to facilitate delivery of the antisense molecule to cytoplasm, at least one targeting antibody specific for the HER protein, at least one antibody specific for a tumor vasculature protein, and a molecular module that prolongs circulation of the composition, wherein the PMLA is covalently linked to the molecular modules, in a container.
44. The kit according to claim 43 further comprising a pharmaceutically acceptable buffer.
45. The kit according to claim 43 further comprising instructions for use.
46. A method for treating a cancer in a subject, comprising:
contacting the subject with a drug delivery composition comprising a poly- -L-malic acid (PMLA) covalently linked to a plurality of molecular modules comprising at least one module that targets a tumorigenic cell or a cancer cell, at least one module that inhibits synthesis or activity of a human epidermal growth factor receptor (HER) protein in the cell, and at least one module for cytoplasmic delivery; and
analyzing at least one of: inhibition of tumor growth, tumor regression and elimination of cancer in the subject, thereby treating the cancer in the subject.
47. The method according to claim 46 wherein the HER protein is selected from a group comprising: HER1, HER2, HER3, and HER4.
48. The method according to claim 46 wherein the module that inhibits synthesis or activity of the HER protein is at least one selected from the group of: an antisense oligonucleotide (AON), an siRNA oligonucleotide, an antibody, a polypeptide, an oligopeptide and a low molecular weight drug.
49. The method according to claim 46 wherein the AON has a sequence complementary to an mRNA transcript of at least one protein selected from the group of: HER2, an epidermal growth factor receptor (EGFR) protein, and a subunit of laminin-411.
50. The method according to claim 49 wherein the sequence complementary to the HER2 transcript comprises: 5 'AGGGAGCCGC AGCTTCATGTCTGTG-3 ' (SEQ ID NO: 1), and 5'-CATGGTGCTCACTGCGGCTCCGGC-3' (SEQ ID NO:2).
51. The method according to claim 49 wherein the sequence complementary to the
EGFR transcript comprises 5'-TCGCTCCGGCTCTCCCGATCAATAC-3' (SEQ ID NO:3).
52. The method according to claim 49 wherein the subunit of laminin-411 comprises an (x4 subunit.
53. The method according to claim 52 wherein the sequence comprises
5 '-AGCTCAAAGCCATTTCTCCGCTGAC-3 ' (SEQ ID NO:4).
54. The method according to claim 49 wherein the subunit of laminin-411 comprises a βΐ subunit.
55. The composition according to claim 54 wherein the sequence comprises
5'- CTAGCAACTGGAGAAGCCCC ATGCC-3 ' (SEQ ID NO:5).
56. The method according to claim 46 wherein the siRNA oligonucleotide comprises a sequence complementary to a gene encoding at least one of an epidermal growth factor receptor (EGFR) protein and HER2.
57. The method according to the claim 56 wherein the siRNA sequence complementary to the EGFR gene is selected from: 5'-CCUAUAAUGCUACGAAUAUtt-3' (SEQ ID
NO:6), and 5'-AUAUUCGUAGCAUUUAUGGag-3' (SEQ ID NO:7).
58. The method according to claim 56 wherein the siRNA sequence complementary to the HER2 gene is selected from: 5'-GUUGGAUGAUUGACUCUGAtt-3' (SEQ ID NO:8), and 5'-UCAGAGUCAAUCAUCCAACat-3' (SEQ ID NO:9).
59. The method according to claim 48 wherein the antibody binds specifically to HER2/neu protein.
60. The method according to claim 59 wherein the antibody comprises Trastuzumab Herceptin®.
61. The method according to claim 46 wherein the at least one module that targets the cell comprises an antibody that binds specifically to a transferrin receptor protein.
62. The method according to claim 61 wherein the antibody is anti-human.
63. The method according to claim 61 wherein the antibody is selected from at least one of: rat anti-mouse, rat anti-human, rabbit anti-human and goat anti-human.
64. The method according to claim 46 wherein the at least one module for cytoplasmic delivery comprises an endosome escape unit.
65. The method according to claim 64 wherein the endosome escape unit comprises a leucine ethylester.
66. The method according to claim 46 wherein the plurality of modules further comprises a polyethylene glycol (PEG).
67. The method according to claim 66 wherein the PEG has a molecular weight of about 1,000 Da.
68. The method according to claim 66 wherein the PEG has a molecular weight of about 5,000 Da.
69. The method according to claim 46 wherein analyzing inhibition of tumor growth comprises observing more than about 60%, 70%, 80% or about 90% inhibition of tumor growth in the subject.
70. The method according to claim 46 wherein the subject is a mammal.
71. The method according to claim 70 wherein the mammal is a rodent.
72. The method according to claim 71 wherein the rodent is an experimental human- breast tumor-bearing nude mouse.
73. The method according to claim 70 wherein the subject is a human.
74. The method according to claim 46 further comprising observing with inhibition of tumor growth the inhibition of HER2/neu receptor signaling with suppression of Akt phosphorylation.
75. The method according to claim 46 further comprising administering an additional therapeutic agent.
76. The method according to claim 75 wherein the additional therapeutic agent is selected from the group consisting of: an antibody, an enzyme inhibitor, an antibacterial agent, an antiviral agent, a steroid, a non-steroid-inflammatory agent, an antimetabolite, a cytokine, a cytokine blocking agent, an adhesion molecule blocking agent, and a soluble cytokine receptor.
77. The method according to claim 46 wherein contacting the subject with the composition further includes providing the composition in a unit dose effective for treatment the cancer in the subject.
78. The method according to claim 77 wherein the unit dose is at least one selected from:
1 μg kg, 50 g/kg, 100 μg/kg, 500 μg kg, 1 mg/kg, 5 mg/kg, 10 mg/kg, 50 mg kg, and 100 mg/kg.
79. The method according to claim 77 wherein the unit dose is at least one 1 mg/kg.
80. The method according to claim 77 wherein the unit dose is less than about 10 mg/kg.
81. The method according to claim 46 wherein the cancer is selected from the list of: gastric, endometrial, salivaiy gland, lung, non-small cell lung, pancreatic, ovarian, peritoneal, prostate, colorectal, breast, cervical, uterine, ovarian, brain, head and neck, testicular and teratoma cancers.
82. The method according to claim 81 wherein the cancer comprises a primary cancer.
83. The method according to claim 81 wherein the cancer comprises a metastatic cancer.
EP10861515.4A 2010-12-30 2010-12-30 POLYMALIC ACID NANOBIOPOLYMER COMPOSITIONS AND METHODS OF TREATING CANCER Withdrawn EP2658574A4 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2010/062515 WO2012091718A1 (en) 2010-12-30 2010-12-30 Polymalic acid-based nanobiopolymer compositions and methods for treating cancer

Publications (2)

Publication Number Publication Date
EP2658574A1 true EP2658574A1 (en) 2013-11-06
EP2658574A4 EP2658574A4 (en) 2014-03-12

Family

ID=46383442

Family Applications (1)

Application Number Title Priority Date Filing Date
EP10861515.4A Withdrawn EP2658574A4 (en) 2010-12-30 2010-12-30 POLYMALIC ACID NANOBIOPOLYMER COMPOSITIONS AND METHODS OF TREATING CANCER

Country Status (3)

Country Link
EP (1) EP2658574A4 (en)
JP (1) JP2014504591A (en)
WO (1) WO2012091718A1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103582497A (en) * 2011-04-06 2014-02-12 西奈医疗中心 Polymalic acid based nanoconjugates for imaging
JP7021955B2 (en) 2015-06-24 2022-03-03 エフ・ホフマン-ラ・ロシュ・アクチェンゲゼルシャフト Trispecific antibodies specific for HER2 and blood-brain barrier receptors and how to use them
WO2017152054A1 (en) * 2016-03-04 2017-09-08 Cedars-Sinai Medical Center Polymalic acid based nanoimmunoconjugates and uses thereof
KR20220125802A (en) * 2020-01-10 2022-09-14 다인 세라퓨틱스, 인크. Muscle targeting complexes and their use for treating dystrophinopathy

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7332585B2 (en) * 2002-04-05 2008-02-19 The Regents Of The California University Bispecific single chain Fv antibody molecules and methods of use thereof
WO2005055980A2 (en) * 2003-12-05 2005-06-23 Arrogene, Inc. Polymalic acid-based multifunctional drug delivery system
RU2342159C2 (en) * 2004-07-16 2008-12-27 Пфайзер Продактс Инк. Combined therapy for non-hematologic malignant tumours using anti-igf-1r antibody
US8309614B2 (en) * 2008-04-11 2012-11-13 Cedars-Sinai Medical Center Poly(beta malic acid) with pendant leu-leu-leu tripeptide for effective cytoplasmic drug delivery

Also Published As

Publication number Publication date
EP2658574A4 (en) 2014-03-12
WO2012091718A1 (en) 2012-07-05
JP2014504591A (en) 2014-02-24

Similar Documents

Publication Publication Date Title
US20200155593A1 (en) Polymalic acid-based nanobiopolymer compositions
JP7458981B2 (en) Combination of antibody-drug conjugate and tubulin inhibitor
JP6224268B2 (en) Duocarmycin ADC for use in the treatment of endometrial cancer
JP7769032B2 (en) Treatment of metastatic brain tumors by administration of antibody-drug conjugates
Inoue et al. Polymalic acid–based nanobiopolymer provides efficient systemic breast cancer treatment by inhibiting both HER2/neu receptor synthesis and activity
AU2017228459A1 (en) Polymalic acid based nanoimmunoconjugates and uses thereof
WO2012091718A1 (en) Polymalic acid-based nanobiopolymer compositions and methods for treating cancer
TW202440169A (en) Combination of antibody-drug conjugates and dnmt inhibitors
TW202506190A (en) Method for treating drug-low-sensitive cancer by administration of anti-muc1 antibody-drug conjugate
EA053135B1 (en) Treatment of metastatic brain tumor by administering antibody-drug conjugate
EA046932B1 (en) TREATMENT OF METASTATIC BRAIN TUMOR BY ADMINISTRATION OF ANTIBODY-DRUG CONJUGATE
HK40045208A (en) Treatment of metastatic brain tumor by administration of antibody-drug conjugate
EA053283B1 (en) Treatment of metastatic brain tumor by administering antibody-drug conjugate
EA053204B1 (en) Treatment of metastatic brain tumor by administering antibody-drug conjugate
Alcivar et al. Antibody‐Mediated Drug Delivery Systems for Breast Cancer Therapeutics

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20130628

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 47/48 20060101AFI20140130BHEP

Ipc: A61K 39/395 20060101ALI20140130BHEP

Ipc: A61P 35/00 20060101ALI20140130BHEP

Ipc: A61K 47/30 20060101ALI20140130BHEP

Ipc: A61K 38/16 20060101ALI20140130BHEP

A4 Supplementary search report drawn up and despatched

Effective date: 20140207

17Q First examination report despatched

Effective date: 20140226

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20140909