EP2655619A1 - Autophagy inducer and inhibitor combination therapy for the treatment of neoplasms - Google Patents
Autophagy inducer and inhibitor combination therapy for the treatment of neoplasmsInfo
- Publication number
- EP2655619A1 EP2655619A1 EP10861010.6A EP10861010A EP2655619A1 EP 2655619 A1 EP2655619 A1 EP 2655619A1 EP 10861010 A EP10861010 A EP 10861010A EP 2655619 A1 EP2655619 A1 EP 2655619A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- akt
- alkyl
- inhibitor
- autophagy
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
Definitions
- RNAi constructs and combination therapy disclosed herein relate to the treatment of neoplasms.
- PI3K phosphatidylinositol 3-kinase
- Akt phosphatidylinositol 3-kinase
- Aktl governs breast cancer progression in vivo. Proc Natl Acad Sci U S A. 104:7438-43; Maroulakou, I.G., W. Oemler, S.P. Naber, and P.N. Tsichlis, (2007), Aktl ablation inhibits, whereas Akt2 ablation accelerates, the development of mammary adenocarcinomas in mouse mammary tumor virus (MMTV)-ErbB2/neu and MMTV-polyoma middle T transgenic mice. Cancer Res. 67:167- 77; Skeen, J.E., P.T. Bhaskar, C.C. Chen, W.S.
- MMTV mouse mammary tumor virus
- Akt deficiency impairs normal cell proliferation and suppresses oncogenesis in a p53-independent and mTORCl -dependent manner. Cancer Cell. 10:269-80).
- the relative contribution of the three Akt isoforms in maintaining human tumor growth remains elusive.
- Akt isoforms may be differentially regulated depending on the external stimuli and the tissue studied, and may regulate distinct aspects of cellular processes in a cell and tissue-specific manner (Dufour, G., M.J. Demers, D. Gagne, A.B. Dydensborg, I.C. Teller, V. Bouchard, I. Degongre, J.F. Beaulieu, J.Q. Cheng, N. Fujita, T. Tsuruo, K. Vallee, and P.H. Vachon, (2004), Human intestinal epithelial cell survival and anoikis. Differentiation state-distinct regulation and roles of protein kinase B/Akt isoforms. J Biol Chem. 279:44113-22.
- Akt is well known for its anti-apoptotic activity, leading to its depiction as a survival kinase (Amaravadi, R., and C.B. Thompson, (2005), The survival kinases Akt and Pirn as potential pharmacological targets. J Clin Invest. 115:2618-24).
- inhibiting components of the PI3K/Akt pathway often does not induce substantial apoptosis without additional pro-apoptotic insults.
- the subject matter disclosed herein relates to agents and methods of treating neoplasms with an agent that is a kinase inhibitor and is also an inducer of autophagy in combination with an agent that is an inhibitor of autophagy.
- Figure 1 shows inducible (knockdown) KD of Akt isoforms and their effect on xenograft tumor growth.
- A Immunoblot analysis of Akt isoforms and various downstream proteins in stable PC3 clones expressing the inducible shRNA constructs. Each clone was induced to express the respective shRNA(s) with 1 ⁇ g/ml Dox grown under 10% FBS for 7 days. Double arrowheads indicate slight differences in the mobility of the 3 Akt isoforms detected by total and phospho-Akt antibodies, and the mobility shift of IR.S1.
- Figure IB shows the effect of Akt KD on xenograft tumor growth.
- FIG. 2 depicts that Akt KD resulted in cell cycle delay and elevated autophagy without substantial apoptosis.
- A Histological analysis of PC3-shAktl23 tumors treated with Dox or vehicle control for 5, 15, or 21 d as indicated. Tumor tissues were analyzed by IHC using antibodies specific for Ki-67 or by the TUNEL assay. Pathologist's scoring of the signal intensity for each sample is indicated in parentheses. Bars, 100 ⁇ .
- B and C Effect of triple- Akt KD on cell cycle progression under serum starvation (ss) compared with cells grown under 10% FBS.
- Figure 3 depicts autophagy induced in PC3 and U87MG cells by Akt KD.
- A EM images of PC3 (ad) and U87MG (e-g) cells grown in the absence (a and f) or presence (b-e and g) of Dox-induced Akt 123 KD for 5 d.
- Arrows degradative autolysosomes. Double arrows, initial AVs.
- Arrowhead phagophore isolation membrane.
- M mitochondrion in an AV.
- Asterisks glycogen particle clusters. Bars: (a, b, f, and g) 0.5 ⁇ : (c and d) 200 nra; (e) 1 ⁇ .
- the tumor cells contain large nuclei and nucleoli, some lipid droplets (asterisks), and are connected by cell junctions (arrowheads), (b-d) PC3 tumors expressing shAkt 123 after 15 (b and c) or 10 d (d) of Dox treatment, (b) Cells and nuclei in these tumors often appear shrunken. Arrows, AVs. E, eosinophil, (c) Two AVs (arrows) found among dilated RER cisternae in a degenerating tumor cell, (d) Ultrathin cryosection with immunogold labeling of human LAMP1. Label occurs on lysosomes (arrow) and AVs (top inset).
- tumor cells also contain human LAMPl-positive dense bodies with a shape reminiscent of microautophagy (bottom inset; de Waal, E.J., H. Vreeling-Sindelarova, J.P. Schellens, J.M. Houtkooper, and J. James, (1986), Quantitative changes in the lysosomal vacuolar system of rat hepatocytes during short-term starvation. A morphometric analysis with special reference to macro- and microautophagy. Cell Tissue Res. 243:641-8).
- the tumor cells have widened nuclear envelope and ER cisterns (asterisks), which contain small cytoplasmic islands (arrowheads), (e) U87MG tumor after 5 d of vehicle treatment, (f-h) U87MG-shAkt 123 tumor after 5 d of Dox treatment. Arrows, AVs. (h) In some tumor samples, cells with glycogen clusters (asterisks) and glycogen-containing AVs occur. Bars: (a-c) 2 ⁇ : (e and f) 1 ⁇ : (g) 0.5 ⁇ : (d and h) 200 nm.
- Figure 4 depicts lysosomotropic agents accelerated cell death in combination with Akt KD.
- CQ treatment caused accumulation of GFP-LC3 dots in Dox-treated PC3- shAkt 123 cells.
- PC3-shAkt 123 cells stably expressing GFP-LC3 were pretreated with or without 1 ⁇ g/ml Dox for 6 d and treated with or without 10 ⁇ CQ.
- GFP fluorescence was imaged after 1 d of CQ treatment. Arrowheads point to representative GFP dots or clumps. Bar, 10 ⁇ .
- B Effect of shAktl23 and 10 ⁇ CQ on LC3 processing, PARP cleavage, and total Akt in PC3-shAkt 123 cells treated with or without Dox or CQ.
- Figure 6 depicts CQ accelerated cell death in combination with II-4.
- A PC3 cells were treated with DMSO or 4 ⁇ II-4 in the presence or absence of 10 ⁇ CQ under 0.5% FBS. Cell viability was determined by PI exclusion over the course of 10 d. Error bars represent SEM. Representative data from one of three independent experiments are shown.
- B Immunoblot analysis of cell lysates collected at the indicated time points from the experiment shown in A. Arrowheads indicate the positions for LC3-1 and -II, CathD 43, and CathD 28. Quantifications of the indicated markers are shown in C. CathD 43, the 43-50-kD forms of cathepsin D precursors. CathD 28, the 28-kD cathepsin D heavy chain.
- Figure 7 depicts accumulation of AVOs preceded plasma membrane rupture and correlated with the appearance of apoptotic and anucleated cells with Akt inhibitor ("Akti"), in this example compound II-4, and CQ treatment.
- Akti Akt inhibitor
- PC3 cells treated with DMSO, 10 ⁇ II-4, 10 ⁇ CQ, or both under 5% FBS were followed for 3 d using time- lapse microscopy. Representative images of the cells at the indicated time points are shown.
- White arrowheads indicate the fusion between two adjacent cells before plasma membrane rupture in cells treated with both agents. Bar, 10 ⁇ .
- Figure 8 depicts Akt inhibition induces mitochondrial superoxide and cellular
- Figure 9 depicts CQ selectively accelerated cell death in Akti-treated PTEN- null cells in vitro and enhanced the antitumor efficacy of Akt KD in vivo.
- (C) Scatterplot of the tumor volumes in the Dox only and Dox + CQ groups on day 28 (P 0.05). Horizontal bars indicate mean tumor volumes. Numbers of tumors with complete remission (CR, dashed line) are indicated for each group.
- Figure 10 depicts increased AV accumulation and apoptosis in PC3 tumor with combined Aktl23 KD and CQ treatment.
- A (a) EM images of PC3-shAktl23 tumors treated for 5 d with CQ only. Arrows, dense AVs and lysosomes; N, nucleolus,
- B Dox only. Arrows, AVs with a less dense appearance than in a.
- c and d Both Dox and CQ.
- Numerous dense and enlarged AVs (arrows) accumulate in tumor cells.
- An apoptotic cell (Ap) is partially surrounded by a macrophage (M).
- T tumor cell
- Apoptotic nuclei (Ap) among the AV-loaded (arrows) tumor cells.
- Error bars represent SEM; *, P ⁇ 0.0005 compared with the other three groups.
- FIG 11 depicts Akt knockdown by shRNA induces autophagy gene expression.
- PC3 cells were induced to express shRNA to indicated Akt isoforms for 72 hours by Doxycycline, RNA was extracted from both Dox treated (Dox+) or untreated control (Dox-) cells. Microarray analysis was carried out using Affymetrix chips. Ratios of the expression levels of each autophagy gene from Dox+ and Dox- samples are shown. Data are mean values from 3 independent experiments.
- Figure 12 depicts Akt inhibitors that induce autophagy gene expression.
- PC3 cells were treated with DMSO vehicle control or various Akt inhibitors, including l-(l-(4-(5- hydroxy-6-methyl-3 -phenylpyrazin-2-yl)benzyl)piperidin-4-yl)- 1 H-benzo[d] imidazol-2(3H)- one (II- 1 ), 1 -( 1 -(4-(6-hydroxy-5-isobutyl-3-phenylpyrazin-2-yl)benzyl)piperidin-4-yl)- 1 H- benzo[d]imidazol-2(3H)-one ( ⁇ -2), l-(l-(4-(7-phenyl-lH-imidazo[4,5-g]quinoxalin-6- yl)benzyl)piperidin-4-yl)-lH-benzo[d]imidazol-2(3H)-one (II-4), (S)
- Figure 13 depicts various mTOR, PI3K and Akt inhibitors alone induce increased autophagic vacuole accumulation as measured by side scatter (SSC) in a flow cytometer.
- Inhibitors include 3-phenyl-2-(4-((4-(5-(pyridin-2-yl)-lH-l,2,4-triazol-3- yl)piperidin-l-yl)methyl)phenyl)-l,6-naphthyridin-5(6H)-one (H-3), benzyl 2-(4-(3- ethylureido)phenyl)-4-(l,4-oxazepan-4-yl)-5H-pyrrolo[3,4-d]pyrimidine-6(7H)-carboxylate (III-l); l-ethyl-3-(4-(4-morpholino-7-(pyrimidin-2-yl)-5,6,7,8-tetrahydropyrido[3,4
- Figure 14 depicts CQ (10 ⁇ ) increases the number and size of autophagic vacuoles when combined with the various mTOR, PI3K, and Akt inhibitors.
- Figure 15 depicts various mTOR, PI3K and Akt inhibitors alone induce increased autophagic vacuole accumulation as measured by the red to green fluorescent ratio after acridine orange staining.
- Figure 16 depicts CQ increases the accumulation of autophagic vacuoles when combined with the various mTOR, PI3K and Akt inhibitors as measured by the red to green fluorescent ratio after acridine orange staining.
- Figure 17 depicts Akt inhibitor III-4 and PI3K inhibitor III-6 both synergize with CQ to accelerate cell death.
- Figure 18 depicts relative levels of Akt isoforms in cancer cell lines and inducible knockdown of Akt isoforms in U87MG cells and xenograft tumors.
- A Relative expression levels of each Akt isoform in tumor cell lines. Akt proteins in total cell lysates from each cell line were analyzed by Western blot analysis using isoform-specific antibodies and quantified using recombinant proteins of each isoform loaded on the same gel as standards. Data are representative of two independent experiments.
- B Western blot validation of Akt KD in U87MG cells expressing the inducible shRNA constructs.
- Figure 19 depicts the effect of shGFP and Akt isoform KDs on cell cycle progression, apoptosis and autophagy.
- A Steady-state cell cycle profiles of PC3 stable clones containing the indicated shRNAs with or without Dox treatment (1 g/ml for 96 hours). Error bars represent standard deviations of 2 independent experiments.
- B Cell cycle profiles in (A) expressed as the percentage of change in each phase with Dox treatment compared to the same clone without Dox treatment. Data are representative of at least 2 independent experiments with at least 0.5 x 106 cells analyzed for each condition.
- CQ treatment causes accumulation of MDC-labeled vacuoles in Dox-treated PC3 cells expressing shAktl23.
- PC3-shAktl23 cells were incubated in the presence or absence of 1 ⁇ g/ml Dox, with or without 10 ⁇ CQ, for 5 days before labeling with MDC. Scale bar: 10 ⁇ .
- FIG. 20 Effect of LAMP2, Atg7, protease inhibitors, cathepsin D siRNA and pepstatin A on PC3 cell viability in combination with PI- 103 or Akti-1/2.
- A Immunoblot showing KD of LAMP2 by siRNA oligos a-d and their pool compared to a non- targeting control oligo (siCtrl).
- B Effect of LAMP2 siRNA oligos on PC3 cell viability. PC3 cells were transfected with 80 nM of siRNA under 0.5% FBS, PI- 103 (0.5 ⁇ ) or DMSO was added 2 days post-transfection and cell viability (PI exclusion) was analyzed 4 days after PI- 103 addition.
- D Effect of Atg7 siRNA oligos on PC3 cell viability under the different treatments.
- PC3 cells were transfected with 20 nM of siRNA under 0.5% FBS, Akti-112 (5 ⁇ ) or DMSO was added with or without CQ (10 ⁇ ) 2 days post-transfection and cell viability (PI exclusion) was analyzed 2 and 3 days after compound addition. *, P ⁇ 0.05 between the two conditions.
- PC3 cells were treated with DMSO, 5 ⁇ Akti-1/2, 10 ⁇ CQ or both under 0.5% FBS with or without 200 ⁇ pepstatin A.
- Cell viability (PI exclusion) was analyzed 2 days after compound addition. *, P ⁇ 0.05 between the two conditions.
- PC3 cells cultured in 0.5% FBS were pre-treated with 3-MA overnight, then treated with DMSO, 5 ⁇ Akti-1/2, 10 ⁇ CQ, or both for 48 hours and stained with the Image-iT LIVE Green ROS Detection Kit. Total fluorescence intensity from all cells was collected using the Isocyte (Blueshift Biotechnologies), a laser scanning imager.
- Green fluorescence intensity is collected with a 488 nm laser and a 510-540 nm band pass filter, and normalized to cell number determined by Hoechst staining using a 405 nm laser and a 430-480 nm band pass filter. Error bars, standard deviation between two independent experiments.
- D Representative images of the green ROS signals and bright field (BF) taken under a Nikon TE300 inverted microscope. Akti- 1/2 alone first induced a homogeneous increase in ROS level, but by 48 hours the fluorescence became significantly reduced and localized to perinuclear and cytoplasmic vacuoles resembling autolysosomes.
- MitoSOX Red signal induced by the various treatments PC3 cells were either pretreated for 1 day with 5 mM NAC then washed off (NACpr) and treated with the indicated agents, or pretreated for 1 hour with 5 mM NAC and incubated with the indicated agents in the continuous presence of NAC (NAC). MitoSOX signals were determined 24 hours after Akti- 1/2 addition by Flow Cytometry. 5 ⁇ Akti- 1/2 and 10 ⁇ CQ were used. Continuous NAC treatment is required for MitoSOX Red signal reduction at this time point. (B) Viability (PI exclusion) of cells treated as in (A) was determined 4 days after Akti- 1/2 addition by Flow Cytometry.
- NAC pretreatment showed a small, insignificant decrease in cell death in the Akti + CQ group, and significant rescue is seen with continuous NAC treatment.
- C PC3 cells stably expressing GFP-LC3 were treated as in (A) and analyzed by immunoblots at 48 hours after Akti- 1/2 addition, ⁇ -actin and GAPDH were used as loading controls. Quantifications of p62 and cleaved GFP levels normalized to GAPDH, and LC3-II to LC3-I ratios are shown on the right.
- Akti caused a reduction in p62 levels, increased LC3-I turnover (both endogenous and GFP-LC3-I) and concomitant LC3-II and cleaved GFP accumulation.
- CQ increased the level of p62 both with and without Akti, consistent with its blocking of p62 degradation in the autolysosomes.
- CQ also induced LC3-II and cleaved GFP accumulation due to its blocking of their degradation in the autolysosomes.
- NAC treatment counteracted all these effects induced by Akti with or without CQ but did not affect Akti's ability to inhibit pAkt or pS6. NACpr showed some but weaker effects than continuous NAC treatment.
- FIG. 23 depicts the pHUSH vector system used to make shRNAs specifically targeting Akt isoforms.
- the Akt shRNA vectors were constructed by (1) designing and cloning shRNA sequences into pShuttle-Hl (2) transferring the HI -shRNA cassette into pHUSH-GW by a Gateway (Invitrogen) recombination reaction and (3) packaging the completed Hl-pHUSH plasmid as a retrovirus.
- a 19bp siRNA sequence was designed using an appropriate algorithm against the coding sequence of an Akt gene(s).
- the shRNA sequence was converted into an shRNA hairpin sequence, and then the corresponding double-stranded DNA oligo was synthesized and cloned into pShuttle-Hl as shown.
- the effectiveness of each shRNA in pShuttle-Hl vector was verified by transient transfection into cells and the degree of knockdown of each Akt isoform examined by western blots.
- the validated Hl- shRNA cassette was then transferred into the pHUSH-GW vector and packaged as a retrovirus (Table 1 summarizes the validated sequences used).
- Cells stably expressing each shRNA were generated by retroviral infection with single or combination of shRNA- containing viruses.
- single Akt isoform knockdowns cells were infected with one retroviral vector encoding an shRNA construct singly targeting each Akt isoform (constructs 252 & 253 for Aktl, 254 & 255 for Akt2, and 259 & 260 for Akt3) and stable clones were selected using 5 mg/ml puromycin.
- Aktl and Akt2 knockdown a single shRNA targeting both Aktl and 2 simultaneously (construct 256 & 257) was used.
- Dual Akt2 and 3 (constructs 255 and 261), or triple Aktl, 2 and 3 (constructs 257 and 261) knockdowns were achieved by co-infecting the cells with two retroviral vectors containing different antibiotic selection markers (puromycin and hygromycin), each encoding one single shRNA, and stable clones were selected using 5 mg/ml puromycin and 300 mg/ml hygromycin.
- dual Aktl and 3 knockdown either a single shRNA targeting both Aktl and 3 (construct 258), or co- infection with two shRNA vectors (constructs 253 and 261) was employed (Table 2). All shRNAs shown in Table 2 have been validated in cultured cells. The efficiency and tumor inhibitory effect of shRNAs validated in xenograft models are summarized in Table 3.
- Figure 24 depicts a model of the mechanism of cell death induced by the combination of chloroquine with Akt inhibition.
- Akt inhibition alone can activate autophagy through multiple mechanisms, including decreased mTORCl activity downstream of Akt, (Corradetti MN, Guan KL. Upstream of the mammalian target of rapamycin: do all roads pass through mTOR? Oncogene (2006); 25:6347-60), increased activity of FoxO proteins (Zhao J, Brault JJ, Schild A, Goldberg AL. Coordinate activation of autophagy and the proteasome pathway by foxO transcription factor, Autophagy (2008); 4:378-80), and decreased glucose and energy metabolism.
- Impaired autolysosomal degradation caused by CQ can result in aggregation of deleterious ROS generators that further amplify the ROS damage.
- Multiple downstream events can lead to both apoptosis-like and non-apoptotic cell death. It is unclear whether the autophagic response induced by Akt inhibition alone can eventually lead to cell death directly in some cells, or require additional insults.
- Figure 25A-E depict AV accumulation in PC3 cells treated with Akt inhibitor, CQ and their combination.
- Panels A-C PC3 cells grown under 0.5% FBS were treated with (A) DMSO control, (B) 10 ⁇ CQ, and (C) 5 ⁇ Akti-1/2 for 1 day. Both CQ and Akti-1/2 alone induced accumulation of AVs (arrows).
- Panels D-E Combined treatment of Akti-1,2 and CQ resulted in accumulation of larger AVs and the appearance apoptotic nuclei.
- Figures 26A-B depicts measured ED50 for CQ alone, the AKTi III-4 alone, and their combination, in multiple cell lines.
- Figure 26A depicts the compound ratio work table for CQ and the AKTi.
- Figure 26B depicts the CI (combination index) by using bar graphs for data obtained by CellTiter-Glo assay at day 4 of treatment with 10%serum.
- the X-axis shows the cell line and the Y-axis shows the concentration in ⁇ .
- the combination of the AKTi with CQ significantly lowers the ED50 for both the AKTi and CQ.
- Figures 27A-B depicts data for the PC3 (PTEN-, p53- and Al) cell line.
- Figure 27A depicts the CI values at ED50, ED75 and ED90 when the AKTi ⁇ -4 and CQ are combined at varying ratios.
- the data show combination ratios of III-4:CQ in the ranges of 5.T to 1 :800, respetively, with the lowest ED50, ED75 and ED90 values in the ratios of about 1:1.5 to about 1:200, with alternative ratios in the range of about 1:3 to about 1:50, with additionally alternative ratios of about 1 :12 to about 1 :50, with particular ratio of about 1 :25, respectively.
- FIG. 27B depicts growth inhibition curves of the AKTi III-4 alone, CQ alone, and the AKTi and CQ combination dosed in a 1 :25 ratio (about the EC50 ratio).
- the x-axis indicates III-4 concentration in uM and the y-axis indicates the % of control. The data indicate that the combination inhibits growth in the cell line at lower concentrations of III-4 than either III-4 alone or CQ alone.
- Figures 28A-B depicts data for the MDA-361.1 (PI2-K mut (E545K), Her2+, HR+ and Luminal) cell line.
- Figure 28A depicts the CI values at ED50, ED75 and ED90 when the AKTi III-4 and CQ are combined at varying ratios.
- the data show combination ratios of III-4:CQ in the ranges of 5:1 to 1:800, respetively, with the lowest ED50, ED75 and ED90 values in the ratios of about 1:1.5 to about 1:200, with alternative ratios in the range of about 1 :3 to about 1 :25, with particular ratio of about 1 :12.5, respectively.
- Figure 28B depicts growth inhibition curves of the AKTi III-4 alone, CQ alone, and the AKTi and CQ combination dosed in a 1 :12.5 ratio (about the EC50 ratio).
- the x-axis indicates III-4 concentration in ⁇ and the y-axis indicates the % of control. The data indicate that the combination inhibits growth in the cell line at lower concentrations of III-4 than either III-4 alone or CQ alone.
- Figures 29A-B depicts data for the MDA-MB-231 (Kras, Braf, p53 mut, Triple- and Basal) cell line.
- Figure 29A depicts the CI values at ED50, ED75 and ED90 when the AKTi III-4 and CQ are combined at varying ratios.
- the data show combination ratios of III-4:CQ in the ranges of 5:1 to 1:800, respetively, with the lowest ED50, ED75 and ED90 values in the ratios of about 2.5:1 to about 1:1:3, with particular ratio of about 1.25: 1, respectively.
- Figure 29B depicts growth inhibition curves of the AKTi III-4 alone, CQ alone, and the AKTi and CQ combination dosed in a 1.25:1 ratio (about the EC50 ratio).
- the x-axis indicates III-4 concentration in ⁇ and the y-axis indicates the % of control.
- the data indicate that the combination inhibits growth in the cell line at lower concentrations of III-4 than either III-4 alone or CQ alone.
- Figures 30A-B depicts data for the U87MG (PTEN-, PI3K mut (1391M)) cell line.
- Figure 30A depicts the CI values at ED50, ED75 and ED90 when the AKTi III-4 and CQ are combined at varying ratios.
- the data show combination ratios of III-4:CQ in the ranges of 5:1 to 1:800, respetively, with the lowest ED50, ED75 and ED90 values in the ratios of about 2.5:1 to about 1:25, with alternative ratios in the range of about 1.25:1 to about 1:3, with a particular ratio of about 1 :1.5, respectively.
- Figure 3 OB depicts growth inhibition curves of the AKTi III-4 alone, CQ alone, and the AKTi and CQ combination dosed in a 1:1.5 ratio (about the EC50 ratio with minimum CI).
- the x-axis indicates III-4 concentration in uM and the y-axis indicates the % of control.
- the data indicate that the combination inhibits growth in the cell line at lower concentrations of III-4 than either III-4 alone or CQ alone.
- Figures 31A-C depicts data for the Panc-1 (Akt2 amp, Kras mut, p53 mut) cell line.
- Figure 31A depicts the CI values at ED50, ED75 and ED90 when the AKTi III-4 and CQ are combined at varying ratios.
- the data show combination ratios of III-4:CQ in the ranges of 5:1 to 1:800, respetively, with the lowest ED50, ED75 and ED90 values in the ratios of about 2.5:1 to about 1:1.3, with a particular ratio of about 1.25: 1, respectively.
- Figure 3 IB depicts growth inhibition curves of the AKTi III-4 alone, CQ alone, and the AKTi and CQ combination dosed in a 1.28:1 ratio (about the EC50 ratio with minimum CI).
- the x-axis indicates III-4 concentration in uM and the y-axis indicates the % of control. The data indicate that the combination inhibits growth in the cell line at lower concentrations of III-4 than either III-4 alone or CQ alone.
- Figure 31C depicts growth inhibition curves of the AKTi III-4 alone, CQ alone, and the AKTi and CQ combination dosed in a 1:1.56 ratio (about the EC 10 ratio with minimum CI).
- the x-axis indicates III-4 concentration in ⁇ and the y-axis indicates the % of control. The data indicate that the combination inhibits growth in the cell line at lower concentrations of III-4 than either III-4 alone or CQ alone.
- Figures 32A-B and 34A-B depict data showing correlation between
- Figures 33A-G and 35A-G show dose response curve of apoptosis induction in 537MEL melanoma and SKBR3 Breast cancer cells, respectively, treated with the indicated compound alone or with 10 ⁇ CQ, measured by Annezin V (AnnV) and Propidium iodide (PI) staining.
- tumors encompasses "cancer” and "cancerous,” which refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth.
- a “tumor” comprises one or more cancerous cells. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies.
- squamous cell cancer e.g., epithelial squamous cell cancer
- lung cancer including small- cell lung cancer, non-small cell lung cancer ("NSCLC"), adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, as well as head and neck cancer.
- NSCLC non-small cell lung cancer
- adenocarcinoma of the lung and squamous carcinoma of the lung cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer
- the neoplasm is other than a glycolysis dependent cancer.
- the neoplasm is prostate, breast, glioma or pancreatic cancer.
- the neoplasm is prostate, breast or ovarian cancer.
- the neoplasm comprises PTEN or PI3K mutations.
- the neoplasm is resistant to inhibitors of the Akt kinase pathway.
- alkyl refers to a saturated linear or branched-chain monovalent hydrocarbon radical of one to twelve carbon atoms, wherein the alkyl radical may be optionally substituted independently with one or more substituents described below.
- alkyl groups include, but are not limited to, methyl (Me, -CH 3 ), ethyl (Et, - CH 2 CH 3 ), 1-propyl (n-Pr, n-propyl, -CH 2 CH 2 CH 3 ), 2-propyl (i-Pr, i-propyl, -CH(CH 3 ) 2 ), 1- butyl (n-Bu, n-butyl, -CH 2 CH 2 CH 2 CH 3 ), 2-methyl- 1-propyl (i-Bu, i-butyl, -CH 2 CH(CH 3 ) 2 ), 2-butyl (s-Bu, s-butyl, -CH(CH 3 )CH 2 CH 3 ), 2-methyl-2-prop
- alkynyl refers to a linear or branched monovalent hydrocarbon radical of two to twelve carbon atoms with at least one site of unsaturation, i.e., a carbon- carbon, sp triple bond, wherein the alkynyl radical may be optionally substituted independently with one or more substituents described herein. Examples include, but are not limited to, ethynyl (-C ⁇ CH), propynyl (propargyl, -CH C ⁇ CH), and the like.
- carrier refers to a monovalent non-aromatic, saturated or partially unsaturated ring having 3 to 12 carbon atoms as a monocyclic ring or 7 to 12 carbon atoms as a bicyclic ring.
- Bicyclic carbocycles having 7 to 12 atoms can be arranged, for example, as a bicyclo [4,5], [5,5], [5,6] or [6,6] system, and bicyclic carbocycles having 9 or 10 ring atoms can be arranged as a bicyclo [5,6] or [6,6] system, or as bridged systems such as bicyclo[2.2.1]heptane, bicyclo [2.2.2] octane and bicyclo[3.2.2]nonane.
- monocyclic carbocycles include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, 1-cyclopent-l-enyl, 1- cyclopent-2-enyl, l-cyclopent-3-enyl, cyclohexyl, 1-cyclohex-l-enyl, l-cyclohex-2-enyl, 1- cyclohex-3-enyl, cyclohexadienyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, cycloundecyl, cyclododecyl, and the like.
- Aryl or aromatic means a monovalent aromatic hydrocarbon radical of 6-
- Aryl includes bicyclic radicals comprising an aromatic ring fused to a saturated, partially unsaturated ring, or aromatic carbocyclic or heterocyclic ring.
- Typical aryl groups include, but are not limited to, radicals derived from benzene (phenyl), substituted benzenes, naphthalene, anthracene, biphenyl, indenyl, indanyl, 1,2-dihydronapthalene, 1,2,3,4- tetrahydronapthyl, and the like.
- Aryl groups are optionally substituted independently with one or more substituents described herein.
- heterocycle refers to a saturated, a partially unsaturated (i.e., having one or more double and/or triple bonds within the ring) or aromatic carbocyclic radical of 3 to 20 ring atoms in which at least one ring atom is a heteroatom selected from nitrogen, oxygen and sulfur, the remaining ring atoms being C, where one or more ring atoms is optionally substituted independently with one or more substituents described below.
- a heterocycle may be a monocycle having 3 to 7 ring members (2 to 6 carbon atoms and 1 to 4 heteroatoms selected from N, O, P, and S) or a bicycle having 7 to 10 ring members (4 to 9 carbon atoms and 1 to 6 heteroatoms selected from N, O, P, and S), for example: a bicyclo [4,5], [5,5], [5,6], or [6,6] system.
- Heterocycles are described in Paquette, Leo A.; "Principles of Modern Heterocyclic Chemistry" (W.A.
- heterocycle includes heterocycloalkoxy.
- Heterocyclyl also includes radicals where heterocycle radicals are fused with a saturated, partially unsaturated ring, or aromatic carbocyclic or heterocyclic ring.
- heterocyclic rings include, but are not limited to, pyrrolidinyl, tetrahydrofiiranyl, dihydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiopyranyl, piperidino, morpholino, thiomorpholino, thioxanyl, piperazinyl, homopiperazinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxepanyl, thiepanyl, oxazepinyl, diazepinyl, thiazepinyl, 2-pyrrolinyl, 3-pyrrolinyl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxanyl, 1,3- dioxolanyl, pyrazolinyl, dithianyl, dithiola
- Spiro moieties are also included within the scope of this definition.
- the heterocycle groups herein are optionally substituted independently with one or more substituents described herein.
- heteroaryl or “heteroaromatic” refers to a monovalent aromatic radical of 5-, 6-, or 7-membered rings, and includes fused ring systems (at least one of which is aromatic) of 5-20 atoms, containing one or more heteroatoms independently selected from nitrogen, oxygen, and sulfur.
- heteroaryl groups are pyridinyl (including, for example, 2-hydroxypyridinyl), imidazolyl, imidazopyridinyl, pyrimidinyl (including, for example, 4-hydroxypyrimidinyl), pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, quinolinyl, isoquinolinyl, indolyl, benzimidazolyl, benzofuranyl, cinnolinyl, indazolyl, indolizinyl, phthalazinyl, pyridazinyl, triazinyl, isoindolyl, pteridinyl, purinyl, oxadiazolyl, triazolyl, thiadiazolyl, thiadiazolyl,
- heterocycle or heteroaryl groups may be carbon (carbon-linked), nitrogen
- carbon bonded heterocycles or heteroaryls are bonded at position 2, 3, 4, 5, or 6 of a pyridine, position 3, 4, 5, or 6 of a pyridazine, position 2, 4, 5, or 6 of a pyrimidine, position 2, 3, 5, or 6 of a pyrazine, position 2, 3, 4, or 5 of a furan, tetrahydrofuran, thiofuran, thiophene, pyrrole or tetrahydropyrrole, position 2, 4, or 5 of an oxazole, imidazole or thiazole, position 3, 4, or 5 of an isoxazole, pyrazole, or isothiazole, position 2 or 3 of an aziridine, position 2, 3, or 4 of an azetidine, position 2, 3, 4, 5, 6, 7, or 8 of a quinoline or position 1, 3, 4, 5, 6, 7, or 8 of an isoquinoline.
- beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
- Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the condition or disorder as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented.
- glycolysis dependent cancer is meant to refer to cancer that is characterized by cancer cells that rely on glucose metabolism for essentially all of their energy needs excluding energy that may be obtained by autophagy. Cancer cells of glycolysis dependent cancer may be capable of some level of non-glycolytic metabolism but such level does not prevent the cancer cells from undergoing cell death by apoptosis or autophagy in the absence of a glucose energy source. There are numerous methods of determining whether or not a cancer is dependent upon glycolysis. Samples of tumors can be excised and examined in vitro by any one of several well known assays to determine if the cells are dependent on glycolysis. Such methods can determine whether or not the cells utilize aerobic or anaerobic glycolysis.
- FDG-PETscan technology uses high levels of glucose uptake as a marker for detection.
- the cancer cells that take up the detectable glucose derivative 18-fluoro-2-deoxyglucose can be located on a computer image of the patient's anatomy. Those cancers which can be detected by FDG-PETscan technology have a high likelihood of being dependent on glycolysis.
- terapéuticaally effective amount means an amount of a compound of the present invention that (i) treats the particular disease, condition, or disorder, (ii) attenuates, ameliorates, or eliminates one or more symptoms of the particular disease, condition, or disorder, or (iii) prevents or delays the onset of one or more symptoms of the particular disease, condition, or disorder described herein.
- the therapeutically effective amount of the drug may reduce the number of cancer cells; reduce the tumor size; inhibit (i.e., slow to some extent and/or stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent and/or stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or relieve to some extent one or more of the symptoms associated with the cancer.
- the drug may prevent growth and/or kill existing cancer cells, it may be cytostatic and/or cytotoxic.
- efficacy can be measured, for example, by assessing the time to disease progression (TTP) and/or determining the response rate (RR).
- TTP time to disease progression
- RR response rate
- the term "mammal” includes, but is not limited to, humans, mice, rats, guinea pigs, monkeys, dogs, cats, horses, cows, pigs, and sheep, and poultry.
- phrases "pharmaceutically acceptable salt” as used herein, refers to pharmaceutically acceptable organic or inorganic salts of a compound of the invention.
- Exemplary salts include, but are not limited, to sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate "mesylate", ethanesulfonate, benzenesulfonate, p- toluenesulfonate, and pamoate (i.e., ⁇ , ⁇ -methylene-bis
- a pharmaceutically acceptable salt may involve the inclusion of another molecule such as an acetate ion, a succinate ion or other counter ion.
- the counter ion may be any organic or inorganic moiety that stabilizes the charge on the parent compound.
- a pharmaceutically acceptable salt may have more than one charged atom in its structure. Instances where multiple charged atoms are part of the pharmaceutically acceptable salt can have multiple counter ions. Hence, a pharmaceutically acceptable salt can have one or more charged atoms and/or one or more counter ion.
- the desired pharmaceutically acceptable salt may be prepared by any suitable method available in the art, for example, treatment of the free base with an inorganic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, methanesulfonic acid, phosphoric acid and the like, or with an organic acid, such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, oxalic acid, glycolic acid, salicylic acid, a pyranosidyl acid, such as glucuronic acid or galacturonic acid, an alpha hydroxy acid, such as citric acid or tartaric acid, an amino acid, such as aspartic acid or glutamic acid, an aromatic acid, such as benzoic acid or cinnamic acid, a sulfonic acid, such as p-toluenesulfonic acid or ethanesulfonic acid
- an inorganic acid such as hydro
- Acids which are generally considered suitable for the formation of pharmaceutically useful or acceptable salts from basic pharmaceutical compounds are discussed, for example, by P. Stahl et al, Camille G. (eds.) Handbook of Pharmaceutical Salts. Properties, Selection and Use. (2002) Zurich: Wiley- VCH; S. Berge et al, Journal of Pharmaceutical Sciences (1977) 66(1) 1 19; P. Gould, International J. of Pharmaceutics (1986) 33 201 217; Anderson et al, The Practice of Medicinal Chemistry (1996), Academic Press, New York; Remington's Pharmaceutical Sciences, 18th ed., (1995) Mack Publishing Co., Easton PA; and in The Orange Book (Food & Drug 2010/062096
- the desired pharmaceutically acceptable salt may be prepared by any suitable method, for example, treatment of the free acid with an inorganic or organic base, such as an amine (primary, secondary or tertiary), an alkali metal hydroxide or alkaline earth metal hydroxide, or the like.
- suitable salts include, but are not limited to, organic salts derived from amino acids, such as glycine and arginine, ammonia, primary, secondary, and tertiary amines, and cyclic amines, such as piperidine, morpholine and piperazine, and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum and lithium.
- phrases "pharmaceutically acceptable” indicates that the substance or composition is compatible chemically and/or toxicologically, with the other ingredients comprising a formulation, and/or the mammal being treated therewith.
- a sequence has inconsequential variations from the known or target sequence.
- a sequence has about 80% homology with a known or target sequence.
- a sequence has 85% homology.
- a sequence has 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or above % homology. Methods are known in the art for determining % homology.
- a “solvate” refers to a physical association or complex of one or more solvent molecules and a compound of the invention.
- the compounds of the invention may exist in unsolvated as well as solvated forms.
- solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid, and ethanolamine.
- hydrate refers to the complex where the solvent molecule is water. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain instances the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid.
- solvates Preparation of solvates is generally known, for example, M. Caira et al, J. Pharmaceutical Sci., 93(3), 601 61 1 (2004). Similar preparations of solvates, hemisolvate, hydrates and the like are described by E. C. van Tonder et al, AAPS PharmSciTech., 5(1), article 12 (2004); and A. L. Bingham et al, Chem. Commun., 603 604 (2001).
- a typical, non-limiting, process involves dissolving the inventive compound in desired amounts of the desired solvent (organic or water or mixtures thereof) at a higher than ambient temperature, and cooling the solution at a rate sufficient to form crystals which are then isolated by standard methods. Analytical techniques such as, for example I.R. spectroscopy, show the presence of the solvent (or water) in the crystals as a solvate (or hydrate).
- synergistic refers to a therapeutic combination which is more effective than the additive effects of the two or more single agents.
- a determination of a synergistic interaction between a kinase inhibitor that induces autophagy and one or more inhibitor of autophagy may be based on the results obtained from the assays described herein.
- a synergistic effect may be attained when the active ingredients are: (1) co-formulated and administered or delivered simultaneously in a combined, unit dosage formulation; (2) delivered by alternation or in parallel as separate formulations; or (3) by some other regimen.
- a synergistic effect may be attained when the compounds are administered or delivered sequentially, e.g., by different injections in separate syringes.
- an effective dosage of each active ingredient is administered sequentially, i.e., serially, whereas in combination therapy, effective dosages of two or more active ingredients are administered together.
- the combinations provided herein have been evaluated, and the data can be analyzed utilizing a standard program for quantifying synergism, additivism, and antagonism.
- An example of a program used for calculating synergism is that described by Chou and Talalay, in "New Avenues in Developmental Cancer Chemotherapy,” Academic Press, 1987, Chapter 2.
- autophagy inhibitor is meant to refer to composition which decreases the level of autophagy in a cell undergoing autophagy in its presence compared to the level of autophagy in a cell undergoing autophagy in its absence.
- Autophagy is a catabolic process of bulk lysosomal degradation and recycling of cytoplasmic material and organelles, characterized by the appearance of autophagic vacuoles in the cytoplasm, leading to self- digestion of cytoplasmic organelles and other constituents in the lysosomal compartments. While autophagy may be capable of ultimate cell killing when allowed to reach its limit, autophagy can provide a temporary survival mechanism for cells under stress conditions, but can also make cells vulnerable to several forms of cell death under specific circumstances.
- Inhibiting autophagy can either promote or inhibit cell death depending on the conditions and agents used (Amaravadi, R.K., D. Yu, J.J. Lum, T. Bui, M.A. Christophorou, G.I. Evan, A. Thomas-Tikhonenko, and C.B. Thompson, (2007), Autophagy inhibition enhances therapy- induced apoptosis in a Myc-induced model of lymphoma. J Clin Invest. 1 17:326-336; Kroemer, G., and M. Jaattela. 2005. Lysosomes and autophagy in cell death control. Nat Rev Cancer. 5:886-97; Levine, B., and J. Yuan, (2005), Autophagy in cell death: an innocent convict.
- Autophagy is a catabolic process that has distinct phases. These include, induction, sequestration, fusion and degradation phases. Inhibitors of autophagy can inhibit one or more of the phases. In an embodiment, autophagy inhibitors inhibit the later stages of autophagy. In one example, autophagy inhibitors inhibit the sequestration, fusion and degradation phases of autophagy. In one example, autophagy inhibitors inhibit the fusion and degradation phases of autophagy. In one example, autophagy inhibitors inhibit the degradation phase of autophagy.
- Useful inhibitors of autophagy include siRNA; antisense RNA; agents that inhibit the expression or function of LAMP2, LAMP1 or an autophagy (Atg) gene (e.g., Atgl, Atg4, Atg8, Atg5, Atg7 or Atgl2);
- lysosomotropic agents which can also be antiparasitic, such as chloroquine, hydroxychloroquine or suramin, a vacuolar proton -ATPase inhibitor, such as Bafilomycin Al, an agent acting on the circulatory system, such as Amiodarone or Perhexilene, a cytotoxic agent, such as Vinblastine, an agent influencing lipid metabolism, an antibiotic, such as monensin, or a hormone, such as, Glucagon or estradiol, lysosomotropic agents, such as ammonium chloride, cAMP or methylamine, ATPase inhibitors, protease inhibitors, lysosomal protease inhibitors such as cathepsin inhibitors and cathepsin knockdown, as well as LAMP knockdown, e.g.
- modulators of lysosomal activity can be combined with kinase inhibitors that induce autophagy to provide a combination therapy for neoplasms.
- Lysosomes are organelles that contain digestive enzymes (acid hydrolases). Such enzymes include lipase, which digests lipids, carbohydrases, which digest carbohydrates (e.g., sugars), proteases, which digest proteins, nucleases, which digest nucleic acids, and phosphoric acid monoesters.
- the modulator acts to inhibit lysosomal activity.
- the combination provides a synergistic effect.
- kinases There are hundreds of kinases, but not all kinase inhibitors also induce autophagy. For example, inhibitors of the bRaf and MEK kinase do not induce autophagy.
- Akt Akt-1, Akt-2 and Akt-3
- PI3K PI3K
- mTOR PDK1 and p70S6K
- the Akt kinase inhibitor can be a pan-Akt inhibitor, an allosteric Akt inhibitor or a selective inhibitor of Akt-1, Akt-2 or Akt-3.
- the Akt kinase inhibitor is a compound of Formula I:
- R 1 is H, Me, Et and CF 3 ;
- R 2 is H or Me
- R 5 is H or Me
- A is:
- G is phenyl optionally substituted by one to four R 9 groups or a 5-6 membered heteroaryl optionally substituted by a halogen;
- R a and R are H, or R a is H, and R b and R 6 together with the atoms to which they are attached form a 5-6 membered heterocyclic ring having one or two ring nitrogen atoms;
- R c and R d are H or Me, or R° and R d together with the atom to which they are attached from a cyclopropyl ring;
- R 8 is H, Me, F or OH, or R 8 and R 6 together with the atoms to which they are attached form a 5-6 membered heterocyclic ring having one or two ring nitrogen atoms;
- each R 9 is independently halogen, Q-Ce-alkyl, C 3 -C6-cycloalkyl, O-CCpCe-alkyl), CF 3 , OCF 3 , S(C C 6 -alkyl), CN, OCH 2 -phenyl, CH 2 0-phenyl, NH 2 , NH-(Ci-C 6 -alkyl), N-(C,-C 6 - alkyl) 2 , piperidine, pyrrolidine, CH 2 F, CHF 2 , OCH 2 F, OCHF 2 , OH, S0 2 (C C 6 -alkyl), C(0)NH 2 , C(0)NH(CrC 6 -alkyl), and C(0)N(Ci-C 6 -alkyl) 2 ;
- R 10 is H or Me
- n and p are independently 0 or 1.
- Another embodiment includes Akt inhibitors of Formula I, wherein R 1 is methyl; R 2 , R 5 and R 10 are H; G is phenyl optionally substituted with 1-3 R 9 ; R 9 is halogen, C r C 3 alkyl, NC, CF 3 , OCF 3 OCH 3 or OCH 2 Phenyl; R c and Rj are H or methyl; m, n and p are 0 or 1; and R 8 is H or methyl.
- Akt inhibitors of Formula I including the compounds:
- Compounds of Formula I may be prepared singly or as compound libraries comprising at least 2, for example 5 to 1,000 compounds, or 10 to 100 compounds.
- Libraries of compounds of Formula I may be prepared by a combinatorial 'split and mix' approach or by multiple parallel syntheses using either solution phase or solid phase chemistry.
- Schemes 1-4 show a general method for preparing the compounds of Formula I as well as key intermediates. Those skilled in the art will appreciate that other synthetic routes may be used. Although specific starting materials and reagents are depicted in the Schemes and discussed below, other starting materials and reagents can be easily substituted to provide a variety of derivatives and/or reaction conditions. In addition, many of the compounds prepared by the methods described below can be further modified in light of this disclosure using conventional chemistry well known to those skilled in the art.
- Scheme 1 shows a method of preparing compound 10 of Formula I wherein R 1 is H, R 2 is OH and R 5 is H.
- Formation of pyrimidine 2 can be accomplished by the reaction of the keto ester 1 with thiourea in the presence of a base such as KOH in an appropriate solvent, such as ethanol.
- a base such as KOH
- an appropriate solvent such as ethanol.
- the hydroxypynmidine 3 can be chlorinated under standard conditions (e.g., POCI 3 in DIEA/DCE) to provide compound 4.
- Compound 4 is then oxidized under standard conditions (e.g., MCPBA in an appropriate solvent such as CHCI 3 ) to give the pyrimidine-oxide 5.
- Treatment of the pyrimidine-oxide with acetic anhydride gives the rearrangement product 6.
- Compound 7 is obtained by reacting compound 6 with an appropriately substituted piperidine under standard S ⁇ Ar reaction conditions to provide compound 7.
- Compound 7 is hydrolyzed to provide compound 8, which is then deprotected to yield the intermediate 9.
- Scheme 2 shows a method of preparing compounds 22, 25 and 27 of Formula I wherein R 1 , R 2 and R 5 are methyl.
- bromination of (+)-pulegone 1 1 with bromine gives the dibromide 12.
- the treatment of the dibromide 12 with a base such as sodium ethoxide provides the pulegenate 13.
- Ozonolysis of the pulegenate 13 gives the ketoester 14.
- Chlorination of the hydroxypyrimidine 16 under standard conditions provides the 4-chloropyrimidine 17.
- the oxidation of the 4- chloropyrimidine 17 with an oxidizing agent such as MCPB A or hydrogen peroxide provides the N-oxide 18.
- Rearrangement of the N-oxide 18 with acetic anhydride yields the intermediate 19.
- Compound 19 is reacted with the desired piperazine according to the procedure described in Scheme 1 to provide compound 20 where R 5 is H and 23 where R 5 is Me.
- Compounds 20 and 23 are subjected to chiral separation using HPLC with chiral stationary and then hydrolyzed upon treatment with a base such as lithium hydroxide to provide compounds 21 and 24, respectively. After deprotection, compounds 21 and 24 are then reacted with the appropriate amino acid to provide compounds 22 and 25, respectively.
- the 7-hydroxy group of compound 24 may be alkylated with alkylation reagent such as alkyl halide in the presence of a base such as NaH or KOH to provide compound 26 where R 2 is Me. After deprotection, compound 26 is then reacted with the appropriate amino acid to provide compound 27.
- alkylation reagent such as alkyl halide
- a base such as NaH or KOH
- Scheme 3 shows an alternative method of preparing compounds 73 and 74.
- amination of 14 using an ammonia synthon gives 63.
- Pyrimidine formation using, for example, ammonium formate in the presence of formamide at 50°C-250°C and/or at high pressure gives the bicyclic unit 64.
- Activation of 64 using, for example, POCI 3 or SOCI2 gives the activated pyrimidine 65.
- Displacement of this leaving group, using a suitable protected substituted piperidine at 0°C to 150°C gives the piperidine 66.
- Oxidation using, for example, m-chloroperoxybenzoic acid ("MCPBA” or "m-CPBA”) or Oxone® at -20°C to 50°C gives the N-oxide 67.
- MCPBA m-chloroperoxybenzoic acid
- Oxone® at -20°C to 50°C gives the N-oxide 67.
- an acylating agent eg. acetic anhydride
- Hydrolysis using, for example LiOH or NaOH at 0°C to 50°C gives the alcohol 69.
- Oxidation using for example, Swern conditions, Mn0 4 or pyridine-S0 3 complex at appropriate temperatures gives the ketone 70.
- Asymmetric reduction using, for example, a catalytic chiral catalyst in the presence of hydrogen, the CBS catalyst or a borohydride reducing agent in the presence of a chiral ligand gives rise to either the (R) or the (S) stereochemistry at the alcohol 71 or 72.
- a non-chiral reducing agent could be used (eg. H 2 , Pd/C), allowing the methyl group on the cyclopentane unit to provide facial selectivity and ultimately diastereoselectivity. If the reduction gives a lower diastereoselctivity, the diastereomers could be separated by (for example) chromatography, crystallization or derivitization.
- a chiral auxiliary e.g. Evans oxazolidinone, etc.
- Introduction of a chiral auxiliary to compound (1) may be accomplished by standard acylation procedures to give the conjugate (2).
- an activating agent e.g. COCl 2
- mixed anhydride formation e.g. 2,2-dimethylpropanoyl chloride
- an amine base at -20°C to 100°C
- treatment with the appropriate chiral auxiliary (X) gives compound (2).
- the stereochemistry and choice of the chiral auxiliary may determine the stereochemistry of the newly created chiral center and the diastereoselectivity.
- Treatment of compound (2) with a Lewis acid eg. TiCU
- low temperature e.g.
- the kinase inhibitor is an Akt inhibitor of the following formula:
- G is phenyl optionally substituted with one to three R a groups or a 5-6 membered heteroaryl optionally substituted by a halogen;
- R 1 and R la are independently selected from H, Me, CF 3 ,
- R 2 is H, F or -OH
- R 2a is H
- R 3 is H
- R 4 is H, or C1-C4 alkyl optionally substituted with F, -OH or -0(d-C 3 alkyl);
- R 5 and R 5a are independently selected from H and C1-C4 alkyl, or R 5 and R 5a together with the atom to which they are attached form a 5-6 membered cycloalkyl or 5-6 membered heterocycle, wherein the heterocycle has an oxygen heteroatom;
- each R a is independently halogen, Ci-C6-alkyl, C3-C6-cycloalkyl, -0-(Ci-C6-alkyl), CF 3 , -OCF 3 , S(Ci-C 6 -alkyl), CN, -OCH 2 -phenyl, NH 2 , -N0 2 , -NH-(C r C 6 -alkyl), -N-(C 1 -C 6 -alkyl) 2 , piperidine, pyrrolidine, CH 2 F, CHF 2 , -OCH 2 F, -OCHF 2 , -OH, -S0 2 (C,-C 6 -alkyl), C(0)NH 2 , C(0)NH(CrC 6 -alkyl), and C(0)N(C r C 6 -alkyl) 2 ; and
- j 1 or 2.
- Akt inhibitor compounds including:
- R 1 and R 2 are independently hydrogen, C C 5 alkyl, hydroxyl, C 1-5 alkoxy or p is an integer from 1 to 6;
- A is a 5-14 carbon cyclic, bicyclic or tricyclic aromatic or heteroaromatic ring, which can be optionally substituted with halogen, OH, amino, dialkylamino, monoalkylamino, Ci-C6-alkyl or phenyl, which is optionally substituted with halogen, OH, CrC 3 alkyl or cyclopropylmethyl; and in one embodiment A has one of the following structures:
- D and E are independently -CH or N;
- R 3 and R 4 are each independently hydrogen, halogen, OH, amino, dialkylamino, monoalkylamino or Ci-C 6 -alkyl, which is optionally substituted with halogen, OH, C1-C3 alkyl or cyclopropylmethyl;
- R 5 is a 5 or 6 membered aromatic or heteroaromatic ring optionally substituted with halogen, OH, amino, dialkylamino, monoalkylamino or Ci-C6-alkyl, which is optionally substituted with halogen, OH, C1-C 3 alkyl or cyclopropylmethyl; in one embodiment R 5 is phenyl;
- B is an aromatic, heteroaromatic, cyclic or heterocyclic ring having the formula:
- R 6 and R 7 are independently selected from the group consisting of hydrogen, halogen, carbonyl and a 5 or 6 membered aromatic or heteroaromatic ring optionally substituted with halogen, OH, amino, dialkylamino, monoalkylamino or C C 6 -alkyl, which is optionally substituted with halogen, OH, C C 3 alkyl or cyclopropylmethyl; in one embodiment R 6 or R 7 is pyridinyl, or R 6 and R 7 are taken together to form a 5-6 membered aromatic, heteroaromatic, cyclic or
- heterocyclic ring which can be optionally substituted with halogen, OH, amino,
- B has one of the following structures:
- X, Y, Q, R 6 and R 7 are as described above, and X', Q' and T are -CH or N.
- AKT inhibitors include compounds having the formula:
- Q is selected from:— NR 7 R 8 ,
- R 2 is independently selected from C1-C6 alkyl, aryl, heterocyclyl, C0 2 H, halo, CN, OH and S(0) 2 NR 7 R 8 , wherein said alkyl, aryl and heterocyclyl are optionally substituted with one, two or three substituents selected from R z ;
- R 7 and R 8 can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 5-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic or bicyclic heterocycle optionally substituted with one or more substituents selected from R z ;
- R a is (Ci-C 6 )alkyl, (C 3 -C 6 )cycloalkyl, aryl or heterocyclyl;
- R c is selected from: H, Ci-C 6 alkyl, aryl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, heterocyclyl,
- Q is selected from: ⁇ NR 5 R 6 ,
- R 2 is independently selected from Ci-C 6 alkyl, aryl, heterocyclyl, C0 2 H, halo, CN,
- R 7 and R 8 can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 5-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic or bicyclic heterocycle optionally substituted with one or more substituents selected from R z ;
- R c is selected from: H, C r C6 alkyl, aryl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, heterocyclyl, C 3 -C 8 cycloalkyl and Ci-C6 perfluoroaIkyl, wherein said alkyl, cycloalkyl, aryl, heterocylyl, alkenyl, and alkynyl is optionally substituted with one or more substituents selected from R z ; or a pharmaceutically acceptable salt or a stereoisomer thereof.
- AKT inhibitors include:
- Q is selected from: ⁇ NR 5 R 6 ,
- R 2 is independently selected from Ci-Ce alkyl, aryl, heterocyclyl, C0 2 H, halo, CN, OH and S(0) 2 NR 7 R 8 , wherein said alkyl, aryl and heterocyclyl are optionally substituted with one, two or three substituents selected from R z ;
- cycloalkyl, aryl, heterocylyl, alkenyl, and alkynyl is optionally substituted with one or more substituents selected from R z , or
- R 7 and R 8 can be taken together with the nitrogen to which they are attached to form a monocyclic or bicyclic heterocycle with 5-7 members in each ring and optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic or bicyclic heterocycle optionally substituted with one or more substituents selected from R z ;
- R a is (C 1 -C 6 )alkyl, (C 3 -Ce)cycloalkyl, aryl or heterocyclyl;
- R c is selected from: H, Ci-C 6 alkyl, aryl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, heterocyclyl, C 3 -C 8 cycloalkyl and Ci-C 6 perfluoroalkyl, wherein said alkyl, cycloalkyl, aryl, heterocylyl, alkenyl, and alkynyl is optionally substituted with one or more substituents selected from R z ; or a pharmaceutically acceptable salt or a stereoisomer thereof.
- Exemplary A T inhibitors include:
- the kinase inhibitor is an Akt-1 selective inhibitor, and is a compound of Formula IV:
- A, B, D and E are independently S, -CH, O or N, wherein depending on A, B, D and E, the ring shown in formula IV can be aromatic, heteroaromatic, cyclic or heterocyclic; p is an integer from 1 to 6;
- R 15 and R 16 are independently selected from the group consisting of hydrogen, halogen, OH, amino, dialkylamino, monoalkylamino and Q-Ce-alkyl;
- Q is a 5-6 membered aromatic or heteroaromatic ring; in one embodiment Q the following structure:
- R' and R" are taken together with the N to which they are bound to form a 5, 6 or 7 member 2096 heterocyclic ring, which can be optionally substituted with halogen, OH, amino, dialkylamino, monoalkylamino, Q-Ce-alkyl, and, as an example, has the following structure, which depending on G' can be heteroaromatic or heterocyclic, which can further contain the above-listed substituents:
- J is an unsubstituted or substituted amide
- R 17 is a 5-14 membered aromatic or heteroaromatic ring system, which can be optionally substituted; in one embodiment R 17 has one of the following structures:
- X and Y independently, are N, O, S or -CH;
- R , R and R are independently selected from the group consisting of halogen, OH, amino, dialkylamino, monoalkylamino, Ci-Ce-alkyl or phenyl, which is optionally substituted with halogen, OH, Ci-C 3 alkyl or cyclopropylmethyl; or R 18 and R 19 are taken together to form an aromatic, heteroaromatic, cyclic or heterocyclic ring.
- Com ounds of Formula IV include:
- AKT inhibitors such as oligonucleotides, including antisense oligonucleotides having the sequences: 5' ccagcccccaccagtccact 3', 5' cgccaaggagatcatgcagc 3', 5' gctgcatgatctccttggcg 3', 5' agatagctggtgacagacag 3', 5' cgtggagagatcatctgagg 3', 5' tcgaaaaggtcaagtgctac 3', 5' tggtgcagcggcagcggcag 3' and 5' ggcgcgagcgcgggctagc 3 * .
- the kinase inhibitor is a compound of Formula III.
- compounds of Formula III include PI3-k inhibitors.
- compounds of Formula III include mTOR inhibitors.
- Compounds of Formula III have the formula:
- A, B, D and E are independently -CH or N;
- R 8 and R 9 are taken together to form a 5 or 6 membered aromatic, heteroaromatic, cyclic or heterocyclic ring, which can be optionally substituted.
- R and R can be taken together with the carbons in formula III to which they are attached to form a 9-10 member bicyclic ring system.
- Embodiments of the bicyclic ring systems include the following structures,
- R n and R 12 are independently selected from the group consisting of hydrogen, halogen, OH, amino, dialkylamino, monoalkylamino, Ci-C 6 -alkyl,
- R and R can be taken together with the carbons to which they are attached and the ring in Formula III above to form a 12-14 member tricyclic ring system, and in one embodiment has the following structure:
- R' and R" are taken together with the N to which they are bound to form a 5, 6 or 7 member heterocyclic ring, which can be optionally substituted with halogen, OH, amino, dialkylamino, monoalkylamino, Ci-C6-alkyl, having one of the following structures, which can further contain the above-listed substituents:
- G and G' are independently C, O or N;
- R is an aromatic or heteroaromatic ring g,, hhaavviinngg the structure:
- X, Y, Z and Z' are independently -CH or N;
- R 13 is hydrogen, halogen, OH, amino, dialkylamino, monoalkylamino, Ci-C 6 -alkyl or -N- f R 10 is:
- R is C C 6 -alkyl
- An example compound of Formula III includes the PI3-k inhibitor:
- A is a ring selected from the group consisting of morpholin-4-yl, 3,4-dihydro-2H-pyran- 4-yl, 3,6-dihydro-2H-pyran-4-yl, tetrahydro-2H-pyran-4-yl, 1 ,4-oxazepan-4-yl, piperidin-l-yl, and is optionally substituted with from 1 to 2 substituents selected from the group consisting of -C(0)OR a ,-C(0)NR a R b , -NR a R b , -OR 3 , -SR a , -S(0) 2 R c , -S(0)R c , -R c , halogen, -N0 2 , -CN and -N 3 , wherein R a and R b are each independently selected from hydrogen, alkyl, Ci -6 haloalkyl, C 2 -6 alkenyl and C 3 .
- R° is selected from alkyl, Ci_ 6 haloalkyl, C 2 _6 alkenyl, C 3-6 cycloalkyl;
- R 1 and R 2 are combined with the atoms to which they are attached to form an optionally substituted pyrrolidine, piperidine or homopiperidine ring, wherein the nitrogen atom of said pyrrolidine, piperidine or homopiperidine ring is substituted by the group:
- E is hydrogen, C6-io aryl, C5.10 heteroaryl, C3.10 cycloalkyl, €3.10
- R d and R e are each independently selected from hydrogen, Q-6 alkyl, Q.6 haloalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3 . 7 cycloalkyl, C 3-7 heterocycloalkyl, phenyl and -(CH 2 )i_4-phenyl, or R d and R e , when attached to the same nitrogen atom are combined to form a 3- to 6-membered ring; R f is selected from Ci_6 alkyl, Ci_5 haloalkyl, C 2- 6 alkenyl,
- R 8 and R h are each independently selected from hydrogen, C1-5 alkyl, haloalkyl, Ci_6 heteroalkyl, C 3- 7 cycloalkyl, C 3-7 heterocycloalkyl, phenyl and -(CH 2 )i_4-phenyl, and optionally R 8 and R h , when attached to the same nitrogen atom are combined to form a 3- to 6-membered ring;
- R' is selected from Q-e alkyl, Ci_6 haloalkyl, C 3 . 7 cycloalkyl, C 3-7 heterocycloalkyl, phenyl and -(CH 2 )M-phenyI;
- n and p are each independently an integer from 0 to 1, wherein if m and p are both the integer 0, then E is not .6 alkyl or C1-5 heteroalkyl;
- R j and R k when attached to the same nitrogen atom, are optionally combined to form a 3- to 6- membered ring; and R m is selected from C1.6 alkyl, Ci -6 haloalkyl, C 2- 6 alkenyl, C 2- 6 alkynyl, C 3-5 cycloalkyl and C 3- 5 heterocycloalkyl;
- B is selected from the group consisting of phenylene, pyridylene, pyrimidylene, pyridazinylene and pyrazinyline and is substituted with from 0 to 4 substituents selected from 6 halogen, -CN, -N 3 , -N0 2 , -C(0)OR n , -C(O)NR n R 0 , -NR n C(0)R°, -NR n C(0)NR n R°, -OR", -NR n R° and R p ; wherein R n and R° are independently selected from hydrogen and C alkyl, Q.
- R n and R° are optionally are combined to form a 3- to 6- membered ring;
- R p is C alkyl, Cj.4 haloalkyl, C 3 . 7 cycloalkyl and C 3-7 heterocycloalkyl, wherein any two
- substituents, not including the D group, located on adjacent atoms of B are optionally combined to form a 5- to 6-membered carbocyclic, heterocyclic, aryl or heteroaryl ring;
- D is a member selected from the group consisting of -NR 3 C(0)NR 4 R 5 , -NR 4 R 5 ,
- R q and R r is selected from hydrogen, Ci_6 alkyl, Ci ⁇ haloalkyl, C 2- 6 alkenyl, C 2 ⁇ alkynyl, Ci ⁇ heteroalkyl, C 3 . 7 cycloalkyl, C 3-7 heterocycloalkyl, C 6- io aryl, C5.K) heteroaryl; and R s , at each occurrence, is independently selected from Ci-6 alkyl. Q.
- A is a ring selected from the group consisting of morpholin-4-yl, 3,4-dihydro-2H-pyran- 4-yl, 3,6-dihydro-2H-pyran-4-yl, tetrahydro-2H-pyran-4-yl, 1 ,4-oxazepan-4-yl, piperidin-l-yl, optionally substituted by C1-C6 alkyl;
- B is selected from the group consisting of phenylene and pyrimidylene
- R 3 is hydrogen or Ci -6 alkyl
- R 4 and R 5 are each independently hydrogen, Ci -6 alkyl, Ci_6 haloalkyl or C3-10 cycloalkyl, or R 4 and R 5 are combined to form a 5- or 6- membered heterocyclic ring;
- R 1 and R 2 are combined with the atoms to which they are attached to form an substituted pyrrolidine, piperidine or homopiperidine ring, wherein the nitrogen atom of said ring is substituted by the group:
- E is hydrogen, Ce aryl, C 5 ⁇ heteroaryl, Ci.6 alkyl or C 5 _6 heterocycloalkyl,; and wherein E is optionally substituted with 1 to 5 substituents selected from halogen, Ci -6 alkyl, -NR d R e , -SR d , -OR d , -C(0)OR d , -C(0)NR d R e , -C(0)R d , -NR d C(0)R e , -OC(0)R f ,
- R d and R e are each independently selected from hydrogen, Ci ⁇ alkyl, haloalkyl, C 2- 6 alkenyl, C 2 -6 alkynyl,
- F is Ci ⁇ alkylene
- n and p are independently 0 or 1.
- Another embodiment includes mTOR inhibitor compounds, including:
- A is a 5- to 8-membered heterocyclic ring having from 1 to 3 heteroatoms independently selected from N, O and S as ring vertices, and having from 0 to 2 double bonds; wherein the A ring is T U 2010/062096 further substituted with from 0 to 5 R A substituents selected from the group consisting of C(0)OR a ,-C(0)NR A R B , -NR A R B -OC(0)R C , -OR A , -SR A , -S(0) 2 R C , -S(0)R C , -R C , -(CH 2 ) M - NR A R B -(CH 2 ) 1-4 -NR a C(0)R C , -(CH 2 ) 1-4 -OR A , -(CH 2 ) M -SR A , -(CH 2 ) 1-4 -S(0) 2 R C , -((CH 2 ) M -SR A , -(CH 2 )
- heterocyclic ring comprising 1 to 2 heteroatoms selected from N, O and S;
- R C is selected from Ci- 6 alkyl, C)_ 6 haloalkyl, heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-6 cycloalkyl, phenyl and -(CH 2 )i- 4 (phenyl); and any two substituents attached to the same atom in the 5- to 8- membered heterocyclic ring are optionally combined to form a 3- to 5- membered
- R 1 and R 2 are combined with the atoms to which they are attached to form a 5- to 8- membered monocyclic or bridged bicyclic heterocyclic ring comprising -O- as one of the ring vertices; wherein the 5- to 8- membered monocyclic or bridged-bicyclic heterocyclic ring formed by combining R 1 and R 2 further optionally comprises one additional heteroatom selected from the group consisting of N, O and S, and is substituted with from 0 to 5 R substituents selected from the group consisting of halogen, -NR j R k , -SR j , -OR j , -C(0)OR j , -C(0)NR J R k , -NHC(0)R j , -OC(0)R J , -R m , -CN,
- Ci- 6 alkyl independently selected from hydrogen, Ci- 6 alkyl, Ci- 6 haloalkyl, Ci ⁇ heteroalkyl,
- B is a member selected from the group consisting of phenylene and 5- to 6- membered heteroarylene, and is substituted with from 0 to 4 R B substituents selected from halogen, -CN, -N 3 , -N0 2 , -C(0)OR n , -C(0)NR n R°, -NR n C(0)R°, -NR n C(0)NR n R°, -OR", -NR"R°, -(CH 2 ) M -C(0)OR n , -(CH 2 ) -C(0)NR n R°, -(CH 2 ) -OR n , -(CH 2 ) -NR n R°, -(CH 2 ) 4-SR p and R p ; wherein R" and R° are independently selected from hydrogen and alkyl,
- heterocycloalkyl phenyl and -(CH 2 )i ⁇ -(phenyl) or when attached to the same nitrogen atom, R" and R° are optionally are combined to form a 3- to 6- membered heterocyclic ring
- R p is Ci_6 alkyl, Ci_6 haloalkyl, Ci-6 heteroalkyl, C 2-6 alkenyl, C 2- 6 alkynyl, C 3-7 cycloalkyl, C 2- 6 heterocycloalkyl, phenyl and -(CH 2 )i-4-(phenyl), wherein any two substituents, not including the D group, located on adjacent atoms of B are optionally combined to form a 5- to 6-membered carbocyclic, heterocyclic, aryl or heteroaryl ring; D is a member selected from the group consisting of
- R 3 is selected from the group consisting of hydrogen, C 1-6 alkyl, C 1-6 haloalkyl and C 2- 6 alkenyl; R 4 and R 5 are each independently selected from the group consisting of hydrogen, Q-e alkyl,
- R 4 and R 5 when attached to the same nitrogen atom, are optionally combined to form a 5- to 7- membered heterocyclic or 5- to 6- membered heteroaryl ring comprising 1 to 3 heteroatoms selected from N, O and S; and wherein R 3 , R 4 and R 5 are further substituted with from 0 to 3 R D substituents independently selected from the group consisting of halogen, -N0 2 , -CN, -NR q R r , -OR q , -SR q , -C(0)OR q , -C(0)NR q R r , -NR q C(0)R r , -NR q
- R s at each occurrence, is independently selected from Q-6 alkyl, Ci_6 haloalkyl, C 3-7 cycloalkyl, C 2-
- Another embodiment includes mTOR inhibitor compounds, including:
- R is selected from the group consisting of 6- to 10- membered aryl, 5- to 9- membered heteroaryl, 3- to 12- membered heterocycloalkyl, 3- to 12- membered cycloalkyl, wherein R 1 is substituted with from 0 to 5 R R1 substituents selected from the group consisting of halogen, F, CI, Br, I, -NR A R B , -SR A , -OR A , -C(0)OR A , -C(0)NR A R B , -C(0)R A , -NR a C(0)R B , -OC(0)R C , -NR a C(0)NR A R B , -OC(0)NR A R B , -NR A S(0) 2 NR A R B , -S(0) 2 R A , -S(0) 2 NR A R B , -R C , -N0 2 , -N 3
- R A and R B are each independently selected from hydrogen, C ] -6 alkyl, Ci_6 haloalkyl, Ci-6 heteroalkyl, C 2- 6 alkenyl, C 2-6 alkynyl, C 3-7 cycloalkyl, C 2 .
- R A and R B when attached to the same nitrogen atom are combined to form a 3- to 6-membered heterocyclic ring comprising 1 to 2 heteroatoms selected from N, O and S;
- R C is selected from Ci.e alkyl, Ci_6 haloalkyl, C 2- 6 alkenyl,
- R CL is selected from the group consisting of phenyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2- imidazolyl, 2-indolyl, 1-naphthyl, 2-naphthyl, 2-thienyl, 3-thienyl, 2-pyrrolyl, 2-furanyl and 3-furanyl, and wherein R CL is substituted with from 0 to 3 substituents selected from F, CI, Br,
- R 2 is selected from the group consisting of hydrogen, Ci_6 alkyl, C 2- 6 alkenyl, C 2- 6 alkynyl, C 1-6 heteroalkyl, a 6- to 10 membered aryl, 5- to 10- membered heteroaryl, a 3- to 12- membered heterocycloalkyl, a 3- to 12 membered cycloalkyl, -L-C6-io aryl, -L-Q.g heteroaryl, -L-C 3- i 2 cycloalkyl and -L-C 2- i 2
- heterocycloalkyl wherein L is selected from Ci_6 alkylene, C 2-6 alkenylene, C 2-6 alkynylene and Ci-6 heteroalkylene, and wherein R 2 is substituted with from 0 to 5 R 1 2 substituents selected from the group consisting of halogen, F, CI, Br, I, -NR d R e , -SR d , -OR d , -C(0)OR d , -C(0)NR d R e , -C(0)R d , -NR d C(0)R e , -OC(0)R f , -NR d C(0)NR d R e , -OC(0)NR d R e ,
- R d and R e are each independently selected from hydrogen, Ci -6 alkyl, Ci_ 6 haloalkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2 _6 alkynyl, C 3- 7 cycloalkyl, C 2 .
- R d and R e when attached to the same nitrogen atom are combined to form a 3- to 6-membered heterocyclic ring comprising 1 to 2 heteroatoms selected from N, O and S;
- R f is selected from Ci- 6 alkyl, Ci-e haloalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-7 cycloalkyl, C 2-7 heterocycloalkyl, phenyl and -(CH 2 )i_ 4 -phenyl;
- X 2 is selected from the group consisting of C alkylene, C 2-4 alkenylene and C 2-4 alkynylene;
- R 3 is a 5- to 12- membered monocyclic or bridged heterocycloalkyl ring, wherein the R 3 group is substituted with from 0 to 3 R R3 substituents selected from the group consisting of -C(0)OR
- R A at each occurrence is independently selected from the group consisting of F, CI, Br, I, -N0 2 , -CN, C M alkyl, C 2-4 alkenyl, C 2- alkynyl, or any two R A groups attached to adjacent atoms are optionally combined to form a C 2 ⁇ heterocyclic ring comprising from 1 to 2 heteroatoms selected from N, O and S as ring vertices, C 3-7 cycloalkyl ring, a C ⁇ s heteroaryl ring comprising from 1 to 4 heteroatoms selected from N, O and S as ring vertices, or phenyl ring; and D is a member selected from the group consisting of-NR 4 C(0)NR 5 R 6 , -NR 5 R 6 , -C(0)NR 5
- R j and R k is selected from hydrogen, C ⁇ alkyl, C ⁇ haloalkyl, C 2-6 alkenyl, C 2- 6 alkynyl, Ci_6 heteroalkyl, C 3-7 cycloalkyl, C 3-7 heterocycloalkyl, Ce- ⁇ aryl, Ci -9 heteroaryl; and R m , at each occurrence, is independently selected from C e alkyl, C e haloalkyl, C 3- 7 cycloalkyl, C 3-7 heterocycloalkyl, C 6 -io aryl and C1.9 heteroaryl;
- X 3 is selected from the group consisting of C alkylene, C
- Another embodiment includes mTOR inhibitor compounds, including:
- Y and Y 2 is each independently N or C(R'), but Y 1 and Y 2 are not both N or are not both C(R l ), wherein R 1 is selected from the group consisting of hydrogen, Ci_6 alkyl, C 2- 6 alkenyl, C 2 .
- R 1 is substituted with from 0 to 5 R R1 substituents selected from the group consisting of halogen, F, CI, Br, I, -NR a R b , -SR a , -OR a , -C(0)OR a , -C(0)NR a R b , -C(0)R a , -NR a C(0)R b , -OC(0)R c ,
- R a and R b are each independently selected from hydrogen, Q. 6 alkyl, Ci_ 6 haloalkyl, Ci. 6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-7 cycloalkyl, C 2 .
- R cl is selected from the group consisting of phenyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2- imidazolyl, 2-indolyl, 1-naphthyl, 2-naphthyl, 2-thienyl, 3-thienyl, 2-pyrrolyl, 2-furanyl and 3-furanyl, and wherein R cl is substituted with from 0 to 3 substituents selected from F, CI, Br, I, -NR a R b , -SR a , -OR a , -S(0) 2 R a , -S(0) 2 NR
- R 3 is a 5- to 12- membered monocyclic or bridged heterocycloalkyl ring, wherein the R 3 group is substituted with from 0 to 3 R 3 substituents selected from the group consisting of -C(0)OR g ,-C(0)NR g R h , -NR g R h -OR g , -SR g , -S C z ', -S(0)R -R halogen, F, CI, Br, I, -N0 2 , -CN and -N 3 , wherein R g and R h are each independently selected from hydrogen, Q- 6 alkyl, haloalkyl, heteroalkyl, C 2- 6 alkenyl and C 3-6 cyclo
- R j and R k is selected from hydrogen, Ci_6 alkyl, Ci_6 haloalkyl, C 2-6 alkenyl, C 2- 6 alkynyl, Ci-6 heteroalkyl, C 3 .
- R m at each occurrence, is independently selected from Ci_ alkyl, Ci_6 haloalkyl, C 3- 7 cycloalkyl, C 3- heterocycloalkyl, C6-io aryl and Ci_9 heteroaryl;
- X 3 is selected from the group consisting of C alkylene, C 2-4 alkenylene and C -4 alkynylene; and wherein D and a R A substituent attached to an atom that is adjacent to the atom to which D is attached are optionally combined to form an optionally substituted 5- to 6- membered heterocyclic or heteroaryl ring substituted with from 0 to 4 R D substituents.
- Another embodiment includes mTOR inhibitor compounds, including:
- Another embodiment includes PI3-k inhibitor compounds of the following formula:
- R 1 and R 2 are independently selected from hydrogen, halogen, Ci -6 alkyl, -NR d R e , -SR d , -OR d , -C(0)OR d , -C(0)NR d R e , -C(0)R d , -NR d C(0)R e , -OC(0)R f , -NR d C(0)NR d R e ,
- R f is selected from Ci_s alkyl, haloalkyl, C 3-7 cycloalkyl, C3-7 heterocycloalkyl, phenyl and -(CH 2 )i -4 -phenyl; or
- R 1 and R 2 are taken together with the atoms to which they are attached to form a fused 5- or 6- membered heterocyclyl or heteroaryl ring, optionally substituted by oxo, halogen, Ci- C 3 alkyl or CF 3 .
- -k inhibitors include the following:
- the kinase inhibitor is a PI3K kinase inhibitor of Formulas V and VI:
- R 1 is selected from H, F, CI, Br, I, CN, -(CR 14 R 15 ) m NR 10 R n ,
- Ci-Ci 2 alkyl Ci-Ci 2 alkyl, C 2 -C 8 alkenyl, C 2 -C 8 alkynyl, C 3 -C, 2 carbocyclyl, C 2 -C 20 heterocyclyl, C 6 -C 2 o aryl, and Q-C 2 o heteroaryl;
- R 10 , R 1 1 and R 12 are independently H, Q-Cn alkyl, C 2 -C 8 alkenyl, C 2 -C 8 alkynyl,
- Y is O, S, or NR 12 ;
- n 0, 1, 2, 3, 4, 5 or 6;
- n 1, 2, 3, 4, 5 or 6.
- Example PI3-k inhibitors include the following:
- the Formula V and VI compounds may be synthesized by synthetic routes that include processes analogous to those well-known in the chemical arts, and including WO 2006/046031, which is incorporated herein by reference in its entirety, for all purposes.
- Starting materials are generally available from commercial sources such as Aldrich Chemicals (Milwaukee, WI) or are readily prepared using methods well known to those skilled in the art (e.g., prepared by methods generally described in Louis F. Fieser and Mary Fieser, Reagents for Organic Synthesis, v. 1-19, Wiley, N.Y. (1967-1999 ed.), or Beilsteins Handbuch der organischen Chemie, 4, Aufl. ed. Springer- Verlag, Berlin, including supplements (also available via the Beilstein online database).
- Formulae V and VI compound may be prepared using procedures to prepare other thiophenes, furans, pyrimidines (US 6608053; US 6492383; US 6232320; US 6187777; US 3763156; US 3661908; US 3475429; US 5075305; US 2003/220365; GB 1393161; WO 93/13664); and other heterocycles, which are described in: Comprehensive Heterocyclic Chemistry, Editors Katritzky and Rees, Pergamon Press, 1984.
- Formulae V and VI compounds may be converted into a pharmaceutically acceptable salt, and a salt may be converted into the free compound, by conventional methods.
- pharmaceutically acceptable salts include salts with inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulphuric acid, nitric acid and phosphoric acid; and organic acids such as methanesulfonic acid, benzenesulphonic acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, ethanesulfonic acid, aspartic acid and glutamic acid.
- inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulphuric acid, nitric acid and phosphoric acid
- organic acids such as methanesulfonic acid, benzenes
- the salt may be a mesylate, a hydrochloride, a phosphate, a benzenesulphonate or a sulphate. Salts may be mono-salts or bis-salts.
- the mesylate salt may be the mono-mesylate or the bis-mesylate.
- Formulae V and VI compounds and salts may also exist as hydrates or solvates.
- Suitable amino-protecting groups include acetyl, trifluoroacetyl, t-butoxycarbonyl (BOC), benzyloxycarbonyl (CBz) and 9- fluorenylmethyleneoxycarbonyl (Fmoc).
- BOC t-butoxycarbonyl
- CBz benzyloxycarbonyl
- Fmoc 9- fluorenylmethyleneoxycarbonyl
- Schemes 5-11 show general methods for preparing the compounds of the present invention as well as key intermediates. For a more detailed description of the individual reaction steps, see the Examples section below. Those skilled in the art will appreciate that other synthetic routes may be used to synthesize the inventive compounds. Although specific starting materials and reagents are depicted in the Schemes and discussed below, other starting materials and reagents can be easily substituted to provide a variety of derivatives and/or reaction conditions. In addition, many of the compounds prepared by the methods described below can be further modified in light of this disclosure using conventional chemistry well known to those skilled in the art.
- Scheme 5 shows a general method for preparation of the thienopyrimidine intermediates 55 and 56 from 2-carboxyester, 3-amino thiophene, and 2-amino, 3-carboxy ester thiophene reagents, respectively 51 and 52, wherein Hal is CI, Br, or I; and R 1 , R 2 , and R 10 are as defined for Formulae V and VI compounds, or precursors or prodrugs thereto.
- Scheme 6 shows a general method for selectively displacing a 4-halide from bis-halo thienopyrimidine intermediates 57 and 58 with morpholine under basic conditions in an organic solvent to prepare 2-halo, 4-morpholino thienopyrimidine compounds 59 and 60 respectively, wherein Hal is CI, Br, or I; and R 1 and R 2 are as defined for Formulae V and VI compounds, or precursors or prodrugs thereto.
- Scheme 7 shows a general method for derivatizing the 6-position of 2-halo, 4- morpholino, 6-hydrogen thienopyrimidine compounds 61 and 62 where R 1 is H.
- Treating 61 or 62 with a lithiating reagent to remove the 6 position proton, followed by adding an acylating reagent R 10 C(O)Z where Z is a leaving group, such as halide, NHS ester, carboxylate, or dialkylamino gives 2-halo, 4-morpholino, 6-acyl thienopyrimidine compounds 63 and 64, wherein Hal is CI, Br, or I; and R 2 and R 10 are as defined for Formulae V and VI compounds, or precursors or prodrugs thereto.
- the palladium catalyst may be any that is typically used for Suzuki-type cross-couplings, such as PdCl 2 (PPh 3 ) 2 , Pd(PPh 3 ) 4 , Pd(OAc) 2 , PdCl 2 (dppf)-DCM, Pd 2 (dba) 3 /Pt-Bu) 3 (Owens et al (2003) Bioorganic & Med. Chem. Letters 13:4143-4145; Molander et al (2002) Organic Letters 4(11):1867-1870; US 6448433).
- Scheme 9 shows a general method for the synthesis of alkynes 71, which can be used to prepare alkynylated derivatives of compounds 72 and 73.
- Propargylic amines 71 may be prepared by reaction of propargyl bromide 70 with an amine of the formula R 10 R n NH (wherein R 10 and R 11 are independently selected from H, alkyl, aryl and heteroaryl, or R 10 and R 11 together with the nitrogen to which they are attached form a heterocyclic ring) in the presence of an appropriate base (CS 2 CO 3 or the like).
- Scheme 10 shows a general method for the synthesis of alkynes 77, which can be used to prepare alkynylated derivatives of compounds 72 and 73.
- Gem-dialkyl propargylic amines 77 may be prepared using methods described by Zaragoza et al (2004) J. Med. Chem., 47:2833.
- gem-dialkyl chloride 76 (R 14 and R 15 are independently methyl, ethyl or other alkyl group) can be reacted with an amine of the formula R 10 R U NH (wherein R 10 and R 11 are independently selected from H, alkyl, aryl and heteroaryl, or R 10 and R 11 together with the nitrogen to which they are attached form a heterocyclic ring) in the presence of CuCI and an appropriate base (e.g. TEA or the like) to provide the alkyne 77.
- R 10 R U NH wherein R 10 and R 11 are independently selected from H, alkyl, aryl and heteroaryl, or R 10 and R 11 together with the nitrogen to which they are attached form a heterocyclic ring
- an appropriate base e.g. TEA or the like
- Alkyne 77 can be reacted with intermediates 72 or 73 (via Sonogashira coupling) to provide compounds 78 and 79, respectively, wherein R 2 and R 3 are as defined for Formulae V and VI compounds, or precursors or prodrugs thereto.
- Scheme 11 shows a general scheme for the synthesis of alkynes 81, which can be used to prepare alkynylated derivatives of compounds 72 and 73.
- Alkynes 81 can subsequently be reacted with intermediates 72 or 73 (via Sonogashira coupling), according to the descriptions provided for Schemes 5 and 6 to provide compounds 82 and 83, respectively, wherein R 2 and R 3 are as defined for Formulae V and VI compounds, or precursors or prodrugs thereto.
- Formula I to VI may be prepared using conventional techniques. Typically the process comprises treating the thienopyrimidine of Formula I as defined above with a suitable acid in a suitable solvent.
- the palladium catalyst may be any that is typically used for Suzuki-type cross-couplings, such as PdCl 2 (PPh 3 ) 2
- the reducing agent is typically a borohydride, such as NaBH(OAc) 3 , NaBFLi or NaCNBH 4 .
- An embodiment includes a method of treating a neoplasm in a mammal comprising, administering a combination of (i) an inhibitor of a kinase, wherein said inhibitor induces autophagy, and (ii) an inhibitor of autophagy in an amount effective to treat said neoplasm.
- the inhibitor of a kinase and the inhibitor of autophagy can be administered together or separately, at the same time or at different times.
- the inhibitor of kinase that induces autophagy and said inhibitor of autophagy are present in synergistically effective amounts.
- the method of treating a neoplasm in a mammal comprising, administering a combination of (i) an inhibitor of a kinase, wherein said inhibitor induces autophagy, and (ii) an inhibitor of autophagy in an amount effective to treat said neoplasm, further comprises administering a protease inhibitor.
- protease inhibitors are well known in the art.
- the protease inhibitor inhibits lysosomal cysteine protease activity or aspartic proteases, such as pepstatin A.
- the inhibitor of a kinase, inhibitor of autophagy and the protease inhibitor can be administered singly, or in any combination together or separately, at the same time or at different times.
- Methods of blocking or reducing relapse tumor growth or a relapse cancer cell growth are also provided.
- the subject was, or is concurrently undergoing cancer therapy.
- the administration of the combination therapy described herein blocks or reduces relapse tumor growth or relapse cancer cell growth.
- Another embodiment provides, a method of inducing apoptosis in a cancer cell comprising administering to said cell (i) an inhibitor of a kinase, wherein said inhibitor induces autophagy, and (ii) an inhibitor of autophagy in an amount effective to induce said apoptosis.
- the effective amount of said kinase inhibitor and/or inhibitor of autophagy produces a synergistic apoptosis inducing effect.
- the effective amount of said kinase and/or said inhibitor of autophagy has an ED50, ED75 or ED90 that is lower than the ED50, ED75 or ED90 of the kinase inhibitor or inhibitor of autophagy alone.
- the kinase inhibitor and inhibitor of autophagy are given in ratios in the range of about 2: 1 to about 1 :50, alternatively about 1.25: 1 to about 1 : 12, alternatively about 1:1 to about 1 :5.
- III-4 is dosed in combination with CQ in a ratio of about 1 :25, 1 :12.5, 1 :1.5, or 1.3:1.
- the method of treating a neoplasm described herein can comprise administering an inhibitor of kinase that induces autophagy wherein the inhibitor is an RNA interference (RNAi) construct in combination with an inhibitor of autophagy.
- RNAi RNA interference
- Figure 23 shows that such an RNAi construct can comprise RNA, DNA or DNA that is transcribed to RNA.
- the use of an RNAi construct in the present methods in combination with an autophagy inhibitor results in a synergistic killing or inhibitory effect on a neoplasm.
- RNAi constructs described herein are useful inhibitors of Akt.
- an RNAi construct includes shRNA, siRNA, DNA directed shRNA and siRNA, as well as the DNA itself, DNA oligos and vectors described herein.
- siRNA or shRNA is transcribed from an RNAi construct comprising a nucleic acid sequence substantially corresponding to a target sequence in one or more Akt genes.
- the sequence is selected from SEQ ID Nos: 39-48 and combinations thereof.
- these RNAi constructs are capable of reducing the expression of one or more Akt proteins. Reducing the expression of a protein means that the expression is lower in a cell than it would be if the RNAi construct had not been introduced. Methods for detecting levels of expression are described herein or known in the art.
- the RNAi constructs can reduce the expression of AKT isoforms including Aktl, Akt2, Akt3 and combinations thereof.
- RNAi constructs can comprise one or more DNA sequences substantially corresponding to a sequence selected from the group consisting of SEQ ID Nos: 1-18. DNA sequences can be synthesized and cloned into a shuttle as described herein.
- an RNAi construct capable of reducing the expression of one or more Akt proteins comprises a RNA sequence substantially corresponding to a sequence selected from the group consisting of SEQ ID Nos: 19-38 and combinations thereof.
- the RNAi constructs can comprise a sense RNA strand and a substantially complementary antisense RNA strand, wherein the antisense strand comprises one or more sequence substantially corresponding to a sequence selected from SEQ ID Nos: 20, 22, 24, 26, 28, 30, 32, 34, 36 and 38, wherein the sense and antisense strands are annealed as a RNA duplex.
- the duplex can comprise a sense strand comprising one or more sequences substantially corresponding to a sequence selected from the group consisting of SEQ ID Nos: 19, 21, 23, 25, 27, 29, 31, 33, 35 and 37.
- the sense and antisense strands can be annealed to form the duplex in the pair combinations that include the following: SEQ ID Nos: 19:20, 21 :22, 23:24, 25:26, 27:28, 29:30, 31 :32, 33:34, 35:36 and 37:38 and combinations that include more than one of the pairs.
- the RNAi construct can contain a hairpin that covalently links the sense strand and the antisense strand.
- RNAi constructs that are capable of reducing the expression of one or more Akt proteins are described herein.
- Non-limiting examples of such RNAi constructs include a construct comprising a nucleotide sequence substantially corresponding to SEQ ID No: 32, and additionally comprising a sequence substantially corresponding to a sequence selected from the group consisting of SEQ ID Nos: 22, 26 and 36.
- Another non-limiting example includes a nucleotide sequence substantially corresponding to SEQ ID No: 31, and additionally a sequence substantially corresponding to a sequence selected from the group consisting of SEQ ID Nos: 21, 25 and 35.
- Other combinations which lower expression of target Akt isoforms can be readily obtained from the present disclosure.
- RNAi construct capable of reducing the expression of an Akt gene, wherein the construct is a substrate for a Dicer.
- Yet another embodiment is directed to an isolated nucleotide or nucleic acid sequence as described herein.
- An RNAi construct as described herein can be prepared by any known method. (Mclntyre, GJ, and Fanning GC, BMC Biotechnology (2006), 6: 1).
- compositions or formulations of the present invention include combinations of compounds of Formula I to VI, and other compounds described herein, a inhibitor of autophagy, and one or more pharmaceutically acceptable carrier, glidant, diluent, or excipient.
- the compounds of Formula I to VI, and other compounds described herein, and inhibitors of autophagy of the present invention may exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the invention embrace both solvated and unsolvated forms.
- tautomer or “tautomeric form” refers to structural isomers of different energies which are interconvertible via a low energy barrier.
- proton tautomers also known as prototropic tautomers
- Valence tautomers include interconversions by reorganization of some of the bonding electrons.
- compositions encompass both the bulk composition and individual dosage units comprised of more than one (e.g., two) pharmaceutically active agents including a Formula I to VI compound and a inhibitor of autophagy selected from the lists of the additional agents described herein, along with any pharmaceutically inactive excipients, diluents, carriers, or glidants.
- the bulk composition and each individual dosage unit can contain fixed amounts of the aforesaid pharmaceutically active agents.
- the bulk composition is material that has not yet been formed into individual dosage units.
- An illustrative dosage unit is an oral dosage unit such as tablets, pills, capsules, and the like.
- the herein-described method of treating a patient by administering a pharmaceutical composition of the present invention is also intended to encompass the administration of the bulk composition and individual dosage units.
- compositions also embrace isotopically-labeled compounds of the present invention which are identical to those recited herein, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature.
- Ail isotopes of any particular atom or element as specified are contemplated within the scope of the compounds of the invention, and their uses.
- Exemplary isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, chlorine and iodine, such as 3 ⁇ 4 3 H, n C, ,3 C, 14 C, 13 N, ,5 N, l5 0, 17 0, 18 0, 32 P, 33 P, 35 S, 18 F, 36 C1, 123 I and 125 I.
- Certain isotopically-labeled compounds of the present invention e.g., those labeled with 3 H and 14 C
- Tritiated ( 3 H) and carbon- 14 ( 14 C) isotopes are useful for their ease of preparation and detectability.
- isotopically labeled compounds of the present invention can generally be prepared by following procedures analogous to those disclosed in the Schemes and/or in the Examples herein below, by substituting an isotopically labeled reagent for a non-isotopically labeled reagent.
- the compounds of Formula I to VI, and other compounds described herein, and inhibitors of autophagy are formulated in accordance with standard pharmaceutical practice for use in a therapeutic combination for therapeutic treatment (including prophylactic treatment) of hyperproliferative disorders in mammals including humans.
- the invention provides a pharmaceutical composition comprising a Formula I to VI compound in association with one or more pharmaceutically acceptable carrier, glidant, diluent, or excipient.
- Suitable carriers, diluents and excipients are well known to those skilled in the art and include materials such as carbohydrates, waxes, water soluble and/or swellable polymers, hydrophilic or hydrophobic materials, gelatin, oils, solvents, water and the like.
- the particular carrier, diluent or excipient used will depend upon the means and purpose for which the compound of the present invention is being applied.
- Solvents are generally selected based on solvents recognized by persons skilled in the art as safe (GRAS) to be administered to a mammal.
- safe solvents are non-toxic aqueous solvents such as water and other non-toxic solvents that are soluble or miscible in water.
- Suitable aqueous solvents include water, ethanol, propylene glycol, polyethylene glycols (e.g., PEG 400, PEG 300), etc. and mixtures thereof.
- the formulations may also include one or more buffers, stabilizing agents, surfactants, wetting agents, lubricating agents, emulsifiers, suspending agents, preservatives, antioxidants, opaquing agents, glidants, processing aids, colorants, sweeteners, perfuming agents, flavoring agents and other known additives to provide an elegant presentation of the drug (i.e., a compound of the present invention or pharmaceutical composition thereof) or aid in the manufacturing of the pharmaceutical product (i.e., medicament).
- the formulations may be prepared using conventional dissolution and mixing procedures.
- the bulk drug substance i.e., compound of the present invention or stabilized form of the compound (e.g., complex with a cyclodextrin derivative or other known complexation agent) is dissolved in a suitable solvent in the presence of one or more of the excipients described above.
- the compound of the present invention is typically formulated into pharmaceutical dosage forms to provide an easily controllable dosage of the drug and to enable patient compliance with the prescribed regimen.
- the pharmaceutical composition (or formulation) for application may be packaged in a variety of ways depending upon the method used for administering the drug.
- an article for distribution includes a container having deposited therein the pharmaceutical formulation in an appropriate form.
- Suitable containers are well known to those skilled in the art and include materials such as bottles (plastic and glass), sachets, ampoules, plastic bags, metal cylinders, and the like.
- the container may also include a tamper-proof assemblage to prevent indiscreet access to the contents of the package.
- the container has deposited thereon a label that describes the contents of the container. The label may also include appropriate warnings.
- compositions of the compounds of the present invention may be prepared for various routes and types of administration.
- a compound of Formula I to VI, or another compound described herein, having the desired degree of purity may optionally be mixed with pharmaceutically acceptable diluents, carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences (1995) 18th edition, Mack Publ. Co., Easton, PA), in the form of a lyophilized formulation, milled powder, or an aqueous solution.
- Formulation may be conducted by mixing at ambient temperature at the appropriate pH, and at the desired degree of purity, with physiologically acceptable carriers, i.e., carriers that are non-toxic to recipients at the dosages and concentrations employed.
- physiologically acceptable carriers i.e., carriers that are non-toxic to recipients at the dosages and concentrations employed.
- the pH of the formulation depends mainly on the particular use and the concentration of compound, but may range from about 3 to about 8.
- the pharmaceutical formulation is preferably sterile.
- formulations to be used for in vivo administration must be sterile. Such sterilization is readily accomplished by filtration through sterile filtration membranes.
- the pharmaceutical formulation ordinarily can be stored as a solid composition, a lyophilized formulation or as an aqueous solution.
- the pharmaceutical formulations of the invention will be dosed and administered in a fashion, i.e., amounts, concentrations, schedules, course, vehicles and route of administration, consistent with good medical practice.
- Factors for consideration in this context include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical practitioners.
- the "therapeutically effective amount" of the compound to be administered will be governed by such considerations, and is the minimum amount necessary to prevent, ameliorate, or treat the coagulation factor mediated disorder. Such amount is preferably below the amount that is toxic to the host or renders the host significantly more susceptible to bleeding.
- the initial pharmaceutically effective amount of the compound of Formula I to VI, or another compound described herein, administered orally or parenterally per dose will be in the range of about 0.01-100 mg/kg, namely about 0.1 to 20 mg/kg of patient body weight per day, with the typical initial range of compound used being 0.3 to 15 mg/kg/day.
- Acceptable diluents, carriers, excipients and stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine,
- the active pharmaceutical ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
- colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
- sustained-release preparations of the compounds of Formula I to VI, and other compounds described herein may be prepared.
- suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing a compound of Formula I, which matrices are in the form of shaped articles, e.g., films, or microcapsules.
- sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinyl alcohol)), polylactides (US 3773919), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOTTM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate) and poly-D (-) 3-hydroxybutyric acid.
- polyesters for example, poly(2-hydroxyethyl-methacrylate), or poly(vinyl alcohol)
- polylactides US 3773919
- copolymers of L-glutamic acid and gamma-ethyl-L-glutamate non-degradable ethylene-vinyl acetate
- the pharmaceutical formulations include those suitable for the administration routes detailed herein.
- the formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Techniques and formulations generally are found in Remington's Pharmaceutical Sciences 18 th Ed. (1995) Mack Publishing Co., Easton, PA. Such methods include the step of bringing into association the active ingredient with the carrier which constitutes one or more accessory ingredients.
- the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
- Formulations of compounds of Formula I to VI, and other compounds described herein, and inhibitors of autophagy suitable for oral administration may be prepared as discrete units such as pills, hard or soft e.g., gelatin capsules, cachets, troches, lozenges, aqueous or oil suspensions, dispersible powders or granules, emulsions, syrups or elixirs each containing a predetermined amount of a compound of Formula I to VI, or another compound described herein, and a inhibitor of autophagy.
- Such formulations may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents including sweetening agents, flavoring agents, coloring agents and preserving agents, in order to provide a palatable preparation.
- Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, preservative, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered active ingredient moistened with an inert liquid diluent. The tablets may optionally be coated or scored and optionally are formulated so as to provide slow or controlled release of the active ingredient therefrom.
- Tablet excipients of a pharmaceutical formulation of the invention may include: Filler (or diluent) to increase the bulk volume of the powdered drug making up the tablet; Disintegrants to encourage the tablet to break down into small fragments, ideally individual drug particles, when it is ingested and promote the rapid dissolution and absorption of drug; Binder to ensure that granules and tablets can be formed with the required mechanical strength and hold a tablet together after it has been compressed, preventing it from breaking down into its component powders during packaging, shipping and routine handling; Glidant to improve the flowability of the powder making up the tablet during production; Lubricant to ensure that the tableting powder does not adhere to the equipment used to press the tablet during manufacture.
- Filler or diluent
- Disintegrants to encourage the tablet to break down into small fragments, ideally individual drug particles, when it is ingested and promote the rapid dissolution and absorption of drug
- Binder to ensure that granules and tablets can be formed with the required mechanical strength and hold a tablet together
- Tablets containing the active ingredient in admixture with non-toxic pharmaceutically acceptable excipient which are suitable for manufacture of tablets are acceptable.
- excipients may be, for example, inert diluents, such as calcium or sodium carbonate, lactose, calcium or sodium phosphate; granulating and disintegrating agents, such as maize starch, or alginic acid; binding agents, such as starch, gelatin or acacia; and lubricating agents, such as magnesium stearate, stearic acid or talc. Tablets may be uncoated or may be coated by known techniques including microencapsulation to delay disintegration and adsorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate alone or with a wax may be employed.
- the formulations are preferably applied as a topical ointment or cream containing the active ingredient(s) in an amount of, for example, 0.075 to 20% w/w.
- the active ingredients may be employed with either a paraffinic or a water-miscible ointment base.
- the active ingredients may be formulated in a cream with an oil-in-water cream base.
- the aqueous phase of the cream base may include a polyhydric alcohol, i.e., an alcohol having two or more hydroxyl groups such as propylene glycol, butane 1,3-diol, mannitol, sorbitol, glycerol and polyethylene glycol (including PEG 400) and mixtures thereof.
- the topical formulations may desirably include a compound which enhances absorption or penetration of the active ingredient through the skin or other affected areas. Examples of such dermal penetration enhancers include dimethyl sulfoxide and related analogs.
- the oily phase of the emulsions of this invention may be constituted from known ingredients in a known manner, including a mixture of at least one emulsifier with a fat or an oil, or with both a fat and an oil.
- a hydrophilic emulsifier is included together with a lipophilic emulsifier which acts as a stabilizer.
- the emulsifier(s) with or without stabilizer(s) make up an emulsifying wax, and the wax together with the oil and fat comprise an emulsifying ointment base which forms the oily dispersed phase of cream formulations.
- Emulsifiers and emulsion stabilizers suitable for use in the formulation of the invention include Tween® 60, Span® 80, cetostearyl alcohol, benzyl alcohol, myristyl alcohol, glyceryl mono-stearate and sodium lauryl sulfate.
- Aqueous suspensions of the pharmaceutical formulations of the invention contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions.
- excipients include a suspending agent, such as sodium carboxymethylcellulose, croscarmellose, povidone, methylcellulose, hydroxypropyl methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g., heptadecaethyleneoxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol anhydride (e.g., polyoxyethylene sorbitan
- the aqueous suspension may also contain one or more preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose or saccharin.
- preservatives such as ethyl or n-propyl p-hydroxybenzoate
- coloring agents such as a coloring agent
- flavoring agents such as sucrose or saccharin.
- sweetening agents such as sucrose or saccharin.
- compositions may be in the form of a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension.
- a sterile injectable preparation such as a sterile injectable aqueous or oleaginous suspension.
- This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above.
- the sterile injectable preparation may be a solution or a suspension in a non-toxic parenterally acceptable diluent or solvent, such as a solution in 1 ,3-butanediol or prepared from a lyophilized powder.
- the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
- sterile fixed oils may conventionally be employed as a solvent or suspending medium.
- any bland fixed oil may be employed including synthetic mono- or diglycerides.
- fatty acids such as oleic acid may likewise be used
- a time -release formulation intended for oral administration to humans may contain approximately 1 to 1000 mg of active material compounded with an appropriate and convenient amount of carrier material which may vary from about 5 to about 95% of the total compositions (weight.weight).
- the pharmaceutical composition can be prepared to provide easily measurable amounts for administration.
- an aqueous solution intended for intravenous infusion may contain from about 3 to 500 ⁇ g of the active ingredient per milliliter of solution in order that infusion of a suitable volume at a rate of about 30 mL/hr can occur.
- Formulations suitable for parenteral administration include aqueous and nonaqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
- Formulations suitable for topical administration to the eye also include eye drops wherein the active ingredient is dissolved or suspended in a suitable carrier, especially an aqueous solvent for the active ingredient.
- the active ingredient is preferably present in such formulations in a concentration of about 0.5 to 20% w/w, for example about 0.5 to 10% w/w, for example about 1.5% w/w.
- Formulations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavored basis, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouthwashes comprising the active ingredient in a suitable liquid carrier.
- Formulations for rectal administration may be presented as a suppository with a suitable base comprising for example cocoa butter or a salicylate.
- Formulations suitable for intrapulmonary or nasal administration have a particle size for example in the range of 0.1 to 500 microns (including particle sizes in a range between 0.1 and 500 microns in increments microns such as 0.5, 1, 30 microns, 35 microns, etc.), which is administered by rapid inhalation through the nasal passage or by inhalation through the mouth so as to reach the alveolar sacs.
- Suitable formulations include aqueous or oily solutions of the active ingredient.
- Formulations suitable for aerosol or dry powder administration may be prepared according to conventional methods and may be delivered with other therapeutic agents such as compounds heretofore used in the treatment or prophylaxis disorders as described below.
- Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray formulations containing in addition to the active ingredient such carriers as are known in the art to be appropriate.
- an agent of the invention e.g., DNA, RNAi, shR A, siRNA, kinase inhibitor, chemotherapeutic agent or anti-cancer agent
- Gene therapy refers to therapy performed by the administration of a nucleic acid to a subject.
- genes are introduced into cells in order to achieve in vivo synthesis of a therapeutically effective genetic product, for example for replacement of a defective gene.
- “Gene therapy” includes both conventional gene therapy where a lasting effect is achieved by a single treatment, and the administration of gene therapeutic agents, which involves the one time or repeated administration of a therapeutically effective DNA or mRNA.
- Antisense RNAs and DNAs can be used as therapeutic agents for blocking the expression of certain genes in vivo. It has already been shown that short antisense oligonucleotides can be imported into cells where they act as inhibitors, despite their low intracellular concentrations caused by their restricted uptake by the cell membrane. (Zamecnik et al., Proc. Natl. Acad. Sci. USA 83:4143-4146 (1986)). The oligonucleotides can be modified to enhance their uptake, e.g. by substituting their negatively charged phosphodiester groups by uncharged groups. For general reviews of the methods of gene therapy, see, for example, Goldspiel et al.
- the RNAi constructs or DNA for forming the RNA constructs of the invention are delivered to cell(s) for treatment, and may be delivered in combination with inhibitors of autophagy.
- the DNA/RNA is injected directly into the patient, usually at the site where the DNA/RNA is required.
- the patient's cells are removed, the DNA/RNA is introduced into these isolated cells and the modified cells are administered to the patient either directly or, for example, encapsulated within porous membranes which are implanted into the patient (see, e.g., U.S. Patent Nos.
- oligonucleotide is transferred into cultured cells in vitro, or in vivo in the cells of the intended host.
- Techniques suitable for the transfer of oligonucleotides into mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, etc.
- a commonly used vector for ex vivo delivery of the gene is a retroviral vector.
- Example in vivo nucleic acid transfer techniques include transfection with viral vectors (such as adenovirus, Herpes simplex I virus, or adeno-associated virus) and lipid-based systems (useful lipids for lipid-mediated transfer of the gene are DOTMA, DOPE and DC-Choi, for example).
- viral vectors such as adenovirus, Herpes simplex I virus, or adeno-associated virus
- lipid-based systems useful lipids for lipid-mediated transfer of the gene are DOTMA, DOPE and DC-Choi, for example.
- the nucleic acid source with an agent that targets the target cells, such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cell, etc.
- an agent that targets the target cells such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cell, etc.
- proteins which bind to a cell surface membrane protein associated with endocytosis may be used for targeting and/or to facilitate uptake, e.g. capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half-life.
- the technique of receptor-mediated endocytosis is described, for example, by Wu et al., J. Biol. Chem.
- the formulations may be packaged in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water, for injection immediately prior to use.
- sterile liquid carrier for example water
- Extemporaneous injection solutions and suspensions are prepared from sterile powders, granules and tablets of the kind previously described.
- Preferred unit dosage formulations are those containing a daily dose or unit daily sub-dose, as herein above recited, or an appropriate fraction thereof, of the active ingredient.
- the invention further provides veterinary compositions comprising at least one active ingredient as above defined together with a veterinary carrier therefore.
- Veterinary carriers are materials useful for the purpose of administering the composition and may be solid, liquid or gaseous materials which are otherwise inert or acceptable in the veterinary art and are compatible with the active ingredient. These veterinary compositions may be administered parenterally, orally or by any other desired route.
- the combination therapy may be administered as a simultaneous or sequential regimen.
- the combination may be administered in two or more administrations.
- the combined administration includes coadministration, using separate formulations or a single pharmaceutical formulation, and consecutive administration in either order, wherein preferably there is a time period while both (or all) active agents simultaneously exert their biological activities.
- Suitable dosages for any of the above coadministered agents are those presently used and may be lowered due to the combined action (synergy) of the newly identified agent and other inhibitors of autophagy or treatments.
- a compound of Formula I to VI, or other compounds described herein, or a stereoisomer, geometric isomer, tautomer, solvate, metabolite, or pharmaceutically acceptable salt thereof is combined with an inhibitor of autophagy, and further combined with surgical therapy and radiotherapy.
- the amounts of the compound(s) of Formula I to VI, or other compounds described herein, and the inhibitor(s) of autophagy, and the relative timings of administration will be selected in order to achieve the desired combined therapeutic effect.
- the therapeutic effect is a synergistic effect.
- the compounds of the invention may be administered by any route appropriate to the condition to be treated. Suitable routes include oral, parenteral (including subcutaneous, intramuscular, intravenous, intraarterial, inhalation, intradermal, intrathecal, epidural, and infusion techniques), transdermal, rectal, nasal, topical (including buccal and sublingual), vaginal, intraperitoneal, intrapulmonary and intranasal. Topical administration can also involve the use of transdermal administration such as transdermal patches or iontophoresis devices. Formulation of drugs is discussed in Remington's Pharmaceutical Sciences, 18 th Ed., (1995) Mack Publishing Co., Easton, PA. Other examples of drug formulations can be found in Liberman, H. A.
- the compounds may be administered by intralesional administration, including perfusing or otherwise contacting the graft with the inhibitor before transplantation. It will be appreciated that the preferred route may vary with for example the condition of the recipient. Where the compound is administered orally, it may be formulated as a pill, capsule, tablet, etc. with a pharmaceutically acceptable carrier, glidant, or excipient. Where the compound is administered parenterally, it may be formulated with a pharmaceutically acceptable parenteral vehicle or diluent, and in a unit dosage injectable form, as detailed below.
- a dose to treat human patients may range from about 10 mg to about 1000 mg of Formula I to VI compound.
- a typical dose may be about 100 mg to about 300 mg of the compound.
- a dose may be administered once a day (QID), twice per day (BID), or more frequently, depending on the pharmacokinetic (PK) and pharmacodynamic (PD) properties, including absorption, distribution, metabolism, and excretion of the particular compound.
- PK pharmacokinetic
- PD pharmacodynamic
- toxicity factors may influence the dosage and administration regimen.
- the pill, capsule, or tablet may be ingested daily or less frequently for a specified period of time. The regimen may be repeated for a number of cycles of therapy.
- Kits of combinations of inhibitors of a kinase that induces autophagy and inhibitors of autophagy are also provided.
- a kit includes inhibitors of a kinase that induce autophagy and inhibitors of autophagy, a pharmaceutically acceptable carrier, vehicle, or diluent, and a container. Instructions for use can also be included.
- kits containing compounds of Formulae I to VI useful for the treatment of the diseases and disorders described above.
- the kit comprises a container comprising a compound of Formula I, or a stereoisomer, geometric isomer, tautomer, solvate, metabolite, or pharmaceutically acceptable salt thereof.
- the kit may further comprise a label or package insert, on or associated with the container.
- package insert is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, contraindications and/or warnings concerning the use of such therapeutic products.
- Suitable containers include, for example, bottles, vials, syringes, blister pack, etc.
- the container may be formed from a variety of materials such as glass or plastic.
- the container may hold a compound of Formula I to VI or a formulation thereof which is effective for treating the condition and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
- At least one active agent in the composition is a compound of Formula I to VI, or a compound described herein.
- the label or package insert indicates that the composition is used for treating the condition of choice, such as cancer.
- the label or package inserts indicates that the composition comprising a compound of Formula I to VI, or a compound described herein, can be used to treat a disorder resulting from abnormal cell growth.
- the label or package insert may also indicate that the composition can be used to treat other disorders.
- the article of manufacture may further comprise a second container comprising a pharmaceutically acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
- the kit may further comprise directions for the administration of the compound of Formula I to VI, or a compound described herein, and, if present, the second pharmaceutical formulation.
- the kit may further comprise directions for the simultaneous, sequential or separate administration of the first and second pharmaceutical compositions to a patient in need thereof.
- kits are suitable for the delivery of solid oral forms of a compound of Formula I to VI, or a compound described herein, such as tablets or capsules.
- a kit preferably includes a number of unit dosages.
- Such kits can include a card having the dosages oriented in the order of their intended use.
- An example of such a kit is a "blister pack".
- Blister packs are well known in the packaging industry and are widely used for packaging pharmaceutical unit dosage forms.
- a memory aid can be provided, for example in the form of numbers, letters, or other markings or with a calendar insert, designating the days in the treatment schedule in which the dosages can be administered.
- a kit may comprise (a) a first container with a compound of Formula I to VI, or a compound described herein, contained therein; and optionally (b) a second container with a second pharmaceutical formulation contained therein, wherein the second pharmaceutical formulation comprises a second compound with anti-hyperproliferative activity.
- the kit may further comprise a third container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
- the kit may comprise a container for containing the separate compositions such as a divided bottle or a divided foil packet; however, the separate compositions may also be contained within a single, undivided container.
- the kit comprises directions for the administration of the separate components.
- the kit form is particularly advantageous when the separate components are preferably administered in different dosage forms (e.g., oral and parenteral), are administered at different dosage intervals, or when titration of the individual components of the combination is desired by the prescribing physician.
- Akt inhibition and likewise, inhibition of other certain kinases, does not always induce a clear apoptotic response.
- Autophagy is a readily detectable response to pan-Akt knockdown or inhibition, Akt-isoform selective knockdown or inhibition, or small molecule inhibitors of the Akt, PI3K, mTOR, PDK1 or p70S6K pathways.
- Kinase-inhibition-induced autophagy may sensitize tumor cells to agents targeting this lysosomal degradation pathway. Indeed, agents that block the lysosomal degradation function could precipitate cell death when combined with kinase inhibitors that induce autophagy and promote complete tumor remissions in preclinical models.
- Inhibiting, slowing or blocking the autophagic response may be a promising strategy to increase the therapeutic efficacy of kinase inhibitors that induce autophagy, e.g., Akt, PI3K, mTOR, PDK-1 and p70S6K inhibitors.
- kinase inhibitors that induce autophagy, e.g., Akt, PI3K, mTOR, PDK-1 and p70S6K inhibitors.
- Akt phosphatidylinositol 3 -kinase
- Numerous reports have documented deregulation of the phosphatidylinositol 3 -kinase (PI3K)/Akt pathway in a variety of cancers, leading not only to uncontrolled growth and proliferation, but also to resistance to various cell death stimuli.
- PI3K phosphatidylinositol 3 -kinase
- Manning BD Cantley LC. AKT/PKB signaling: navigating downstream. Cell 2007; 129:1261-74; Samuels Y, Ericson K. Oncogenic PI3K and its role in cancer. Curr Opin Oncol 2006; 18:77-82).
- targeting, for example Akt, the serine/threonine kinase at the central node of this pathway, or other kinases for which inhibition induces autophagy may inhibit both growth and survival of the malignant cells.
- Akt is believed to play a critical role in protecting cells from programmed cell death following various pro-apoptotic insults (Manning BD, et al.; Downward J. Mechanisms and consequences of activation of protein kinase B/Akt. Curr Opin Cell Biol 1998; 10:262-7), it remains to be determined whether apoptosis is a prevailing response to inhibiting Akt activity alone.
- RNA interference techniques that specifically knockdown each of the three Akt isoforms as well as specific inhibitors result in a significant proportion of cancer cell lines examined do not readily undergo apoptosis even when all three Akt isoforms are greatly reduced. (Koseoglu S, Lu Z, Kumar C, Kirschmeier P, Zou J.
- AKT1, AKT2 and AKT3 -dependent cell survival is cell line-specific and knockdown of all three isoforms selectively induces apoptosis in 20 human tumor cell lines. Cancer Biol Ther 2007; 6:755-62). This is consistent with the report that only a small portion of total Akt activity is required for apoptosis inhibition in mouse embryonic fibroblast (MEF) cells.
- MEF mouse embryonic fibroblast
- Akt knockdown or small molecule inhibitors blocking effective autophagy could accelerate cell death in combination with Akt inhibition.
- the lysosomotropic agent chloroquine (CQ) significantly accelerated death rate in cells either expressing shAktl23 or treated with relatively specific small molecule inhibitors of the pathway, PI- 103 (a PI3K/mTOR inhibitor that is l,000x more potent on class I than class III PI3K) (Knight ZA, Gonzalez B, Feldman ME, Zunder ER, Goldenberg DD, Williams O, Loewith R, Stokoe D, Balla A, Toth B, Balla T, Weiss WA, Williams RL, Shokat KM.
- a pharmacological map of the PI3-K family defines a role for pi lOalpha in insulin signaling.
- Cell 2006; 125:733-47 and Akti-1/2 (a selective dual Aktl,2 inhibitor)
- Barnett SF Defeo-Jones D, Fu S, Hancock PJ, Haskell KM, Jones RE, Kahana JA, Krai AM, Leander K, Lee LL, Malinowski J, McAvoy EM, Nahas DD, Robinson RG, Huber HE. Identification and characterization of pleckstrin-homology-domain-dependent and isoenzyme-specific Akt inhibitors. Biochem J 2005; 385:399-408), both of which induced overt autophagy.
- Bafilomycin Al an inhibitor of vacuolar proton pump (V-H + -ATPase) that impairs lysosomal acidification.
- V-H + -ATPase vacuolar proton pump
- Bafilomycin Al prevents maturation of autophagic vacuoles by inhibiting fusion between autophagosomes and lysosomes in rat hepatoma cell line, H-4-II-E cells. Cell Struct Funct 1998; 23:33-42).
- Synergistic growth inhibitory effect of CQ and Akt inhibitors have also been observed in an expanded panel of cancer cell lines.
- cathepsin D knockdown or inhibition of lysosomal protease activity was not able to protect cells from CQ/Akti-l/2-induced cell death, but rather had a similar effect to CQ in promoting cell death when combined with Akti-1/2. This is consistent with the opposite effects of CQ and Akti- 1/2 on cathepsin D maturation, and suggests that preserving (an elevated) lysosomal degradation activity may be critical for cell survival in the presence of elevated autophagic activity induced by Akt inhibition.
- Figure 24 depicts a model of the mechanism of cell death by Akt inhibition in combination with an autophagy inhibitor (chloroquine).
- pan-Akt inhibitor Dosing of a pan-Akt inhibitor will likely be limited by its side effects, most notably metabolic effects due to inhibition of insulin signaling. (Amaravadi et al, 2005). Our data suggest that at least in cancer models like the PTEN-null PC3 xenograft tumors, complete elimination of tumor cells may not be achievable with continuous pan-Akt knockdown alone. However, combined treatment with CQ significantly increased the incidence of complete tumor remission in xenograft models, although CQ alone had no significant effect. This suggests that autophagy induction through Akt inhibition can sensitize tumors to this relatively non-toxic drug, clinically approved for other indications.
- Akt inhibitors The PI3K/Akt pathway is crucial to many aspects of cell growth and survival with multiple components targeted by genomic aberrations more frequently than any other pathway in human cancer, making it an attractive target for cancer therapy.
- Critical questions underlying the clinical outcomes of Akt inhibitors are the degree of selectivity between the three isoforms needed, and the effects on tumor cell growth and survival expected from inhibiting these kinases.
- the recently described allosteric Akt inhibitors with unprecedented selectivity towards Aktl and Akt2 provide valuable tools to begin addressing these questions (Barnett, S.F., M.T. Bilodeau, and C.W. Lindsley, (2005), The Akt/PKB family of protein kinases: a review of small molecule inhibitors and progress towards target validation. Curr Top Med Chem.
- RNA interference is a powerful method for suppressing gene expression.
- Using a Dox- inducible shR A approach we are able to achieve specific KD of each Akt isoform, both individually and in all possible combinations, to evaluate the requirement of each isoform in the maintenance of tumor growth in vivo.
- Data provided herein results suggest that in both Pten- androgen-independent prostate cancer model PC3 and glioblastoma model U87MG, Aktl is the most important isoform in maintaining tumor growth. This is in concert with the recent report that Aktl deficiency can markedly decrease the incidence of tumors in Pten+/- mice, both in tissues where Aktl is the predominantly expressed isoform and in those where Aktl is not (Chen et al., 2006).
- Aktl was ablated prior to the development of tumors in Pten+/- mice, whereas in the present study we allowed the tumors to establish before Aktl KD was induced.
- reducing Aktl activity not only prevents tumors from developing, but also inhibits the growth of established tumors with PTEN deficiency in human cancer models.
- Akt One of the most prominent functions of Akt is to mediate cell survival.
- Akt constitutively active Akt has been reported to protect cells from programmed cell death following various pro-apoptotic insults . Whether apoptosis is a primary response to Akt inhibition is however less clear, especially in cancer cells where apoptosis is often suppressed due to various genetic alterations. Previous experiments using small molecule inhibitors of the PI3K/Akt pathway often generate conflicting results that are obscured by the inevitable non-specific effects of these compounds. Data provided herein indicate that under normal cell culture conditions, specific KD of any or all three isoforms of Akt can result in cell cycle delay without promoting significant apoptosis.
- Akt inhibition-induced autophagy remains to be further elucidated, several possibilities exist.
- inhibiting Akt can lead to inhibition of mTOR, which is a known inhibitor of autophagy.
- mTOR which is a known inhibitor of autophagy.
- a constitutively active form of Akt was shown to suppress the induction of autophagy by rapamycin (Takeuchi, H., Y. Kondo, K. Fujiwara, T. Kanzawa, H. Aoki, G.B. Mills, and S. Kondo, (2005), Synergistic augmentation of rapamycin-induced autophagy in malignant glioma cells by phosphatidylinositol 3-kinase/protein kinase B inhibitors. Cancer Res.
- Akt inhibition stabilizes p27kipl, which was recently shown to mediate autophagy under growth factor withdrawal (Liang, J., S.H. Shao, Z.X. Xu, B. Hennessy, Z. Ding, M. Larrea, S. Kondo, D.J. Dumont, J.U. Gutterman, C.L. Walker, J.M. Slingerland, and G.B.
- autophagy may be a potential mechanism by which Akt inhibition restricts tumor growth, but may also provide temporary relief from the metabolic and oxidative stress imposed by Akt inhibition, which may allow resistance to occur. Indeed, most tumors treated with Akt KD alone became resistant and rebound after initial regression or stasis. Inhibiting autophagy at an early stage may prevent this temporary protective effect, but may also counteract the possible tumor inhibitory effect of autophagy. Blocking autophagy completion at a late stage might avoid this counteracting effect.
- lysosomotropic agents can be exploited using lysosomotropic agents to promote the remission of PTEN-null human tumor xenografts. Since this effect is expected to correlate positively with the degree of autophagy induced by a given treatment, creative combination of lysosomotropic agents with agents that induce extensive autophagy, such as inhibitors of the Akt pathway, may profoundly affect their anticancer efficacy. Degenhardt et al. proposed that autophagy inhibition by Akt overexpression could lead to necrosis in the center of tumors while the surrounding tumor cells might respond with accelerated growth as a result of combined effect of necrosis-induced inflammatory response and Akt-stimulated proliferation .
- PTEN 7 and PTEN + + MEFs were maintained as previously described (Sun, H., R. Lesche, D.M. Li, J. Liliental, H. Zhang, J. Gao, N. Gavrilova, B. Mueller, X. Liu, and H. Wu, (1999), PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc Natl Acad Sci U S A. 96: 199-204).
- the PC3 and U87MG cells were maintained at 37°C and 5% C0 2 in DMEM/Ham's F-12 (1 : 1) containing 10% tetracycline-free fetal bovine serum.
- II-4 was from Calbiochem (Akt inhibitor VIII) (Barnett, S.F., D. Defeo-Jones, S. Fu, P.J. Hancock, K.M. Haskell, R.E. Jones, J.A. Kahana, A.M. Krai, K. Leander, L.L. Lee, J. Malinowski, E.M. McAvoy, D.D. Nahas, R.G. Robinson, and H.E.
- Akt inhibitor VIII Calbiochem
- inducible shRNA constructs and generation of inducible-shRNA clones The pHUSH tetracycline-inducible retrovirus gene transfer vector has been described elsewhere (Gray, D., A.M. Jubb, D. Hogue, P. Dowd, N. Kljavin, S. Yi, W. Bai, G. Frantz, Z. Zhang, H. Koeppen, F.J. de Sauvage, and D.P. Davis, (2005), Maternal embryonic leucine zipper kinase/murine protein serine-threonine kinase 38 is a promising therapeutic target for multiple cancers. Cancer Res. 65:9751-61 ; Hoeflich, K.P., D.C. Gray, M.T.
- Akt isoform knockdowns For single Akt isoform knockdowns, cells were infected with one retroviral vector encoding an shRNA construct singly targeting each Akt isoform (constructs 252 & 253 for Aktl, 254 & 255 for Akt2, and 259 & 260 for Akt3) and stable clones were selected using 5 ⁇ g/ml puromycin.
- shRNA constructs 252 & 253 for Aktl, 254 & 255 for Akt2, and 259 & 260 for Akt3 For dual Aktl and Akt2 KD, a single shRNA targeting both Aktl and 2 simultaneously (construct 256 & 257) was used.
- Dual Akt2 and 3 (constructs 255 and 261), or triple Aktl, 2 and 3 (constructs 257 and 261) knockdowns were achieved by co-infecting the cells with two retroviral vectors containing different antibiotic selection markers (puromycin and hygromycin), each encoding one single shRNA, and stable clones were selected using 5 ⁇ g/ml puromycin and 300 ⁇ g/ml hygromycin.
- antibiotic selection markers puromycin and hygromycin
- stable clones were selected using 5 ⁇ g/ml puromycin and 300 ⁇ g/ml hygromycin.
- dual Aktl and 3 KD either a single shRNA targeting both Aktl and 3 (construct 258), or co- infection with two shRNA vectors (constructs 253 and 261) were employed.
- Western blot analysis Western blot analysis, immunofluorescence, IHC and TUNEL assay: For Western blot analysis, total protein lysates were subjected to SDS-PAGE and transferred to nitrocellulose. Antibodies used were: anti-Aktl, anti-Akt2, anti-Akt3, anti-total-Akt, anti-p- Akt (Ser473), anti-p-Akt (Thr308), anti-p-S6 (Ser235/236), anti-PARP and anti-cleaved caspase-3 (Cell Signaling Technology); anti-p-PRAS40 (Invitrogen); anti-p27 Kipl (Santa Cruz Biotechnology); anti-LC3 (Novus); anti-LAMP2 and anti-Cathepsin D (BD Biosciences); and anti-GAPDH (Advanced Immunochemical Inc.).
- LICOR Odyssey infrared scanner
- mice Six- to 8-week-old female athymic nude nii/nu mice were purchased from Charles River Laboratories and maintained in Genentech's conventional animal facility. Mice were injected in the right flank with 5-7.5 x 10 6 cells resuspended in 200 ⁇ Hank's Balanced Salt Solution (Invitrogen). When tumors reached a mean volume of 100-300 mm the mice with similarly-sized tumors were grouped into treatment cohorts. Mice received 5% sucrose or 5% sucrose plus 1 mg/ml Dox in drinking water for control and KD cohorts, respectively. Amber-colored water bottles were used and were changed 3 times per week.
- CQ is dissolved in 0.9% physiological saline, filter-sterilized and administered at 45 mg/kg through either intraperitoneal or subcutaneous routes. Tumors were measured with calipers and mice weighed twice per week. Mice whose tumors reached 2000 mm 3 or lost more than 20% body weight were euthanized. Between 8-10 mice were used for each treatment group. Statistical significance was analyzed using the JMP software (SAS Institute, Inc.).
- Electron Microscopy Cells were grown to monolayer in plastic flasks and fixed in half-strength Karnovsky fixative (2% paraformaldehyde, 2.5% glutaraldehyde, 0.025% CaCl 2 .2H 2 0 and 0.1 M sodium cacodylate buffer, pH 7.4); tumors were cut into small cubes (-1 mm 3 ) and fixed by immersion in the same fixative or in the fixative used for immunoelectron microscopy. Cells and tissues were postfixed with 1 % Os0 4 and 1 % K 4 Ru(II)(CN)6 or 1.5 % K 3 Fe(CN)6, dehydrated in ethanol and embedded in Epon.
- Karnovsky fixative 2% paraformaldehyde, 2.5% glutaraldehyde, 0.025% CaCl 2 .2H 2 0 and 0.1 M sodium cacodylate buffer, pH 7.4
- tumors were cut into small cubes (-1 mm 3 ) and fixed by immersion in the same fix
- Ultrathin sections were stained with uranyl acetate and lead citrate. Numbers of AV were counted on systematically sampled cytoplasmic areas of 4.5 ⁇ 2 (n>64 per condition). The percent AV area was measured by means of a square mesh grid laid over > 5 sets of systematically sampled micrographs with each set covering a cytoplasmic area > 80 ⁇ 2 . The average percent of apoptotic nuclei in tumor tissues was calculated from the number of apoptotic nuclei in 3 to 4 sets of 100 systematically counted tumor cell nuclei.
- Cell viability and cell cycle analysis were measured using trypan blue exclusion assay using a Vi-Cell Analyzer (Beckman Coulter), or labeled with 1 ⁇ g/ml PI in PBS/1% BSA followed by cytofluorometric analysis with a fluorescence- activated cell sorter (FACS) (Becton Dickinson). FITC-conjugated Annexin V was used for the assessment of phosphatidylserine exposure by FACS analysis. Caspase activation was analyzed using a Caspase-Glo 3/7 Assay kit (Promega).
- Multispectral imaging flow cytometry Cells treated with various agents were stained with Acridine Orange and analyzed by the ImageStream system (Amnis Corporation, Seattle, WA) using the IDEAS image analysis program.
- the DNA AOGreen image and the vacuolar AO Red image were first compensated into separate channels, and then the percentage of apoptotic/anucleate cells (based on AO nuclear morphology and intensity) and vacuolated cells (AO Red+) were quantified.
- AO Green Intensity vs AO Green bright detail area revealed three distinct populations: R2 anucleated cells (low AO Green labeling, higher area due to masking of diffuse cytoplasm); R3 apoptotic cells (intermediate to low AO Green, very low AO Green detail area due to presence of small, bright condensated nuclear fragments); R4 live cells (intact bright nucleus).
- AORed Intensity is plotted on the second histogram with an arbitrary gate (R5) drawn to include events with the brightest AO Red intensity.
- Time-lapse video microscopy Cells cultured in 24-well plates were imaged on an Olympus 1X81 inverted microscope under environmental control (37 °C and 5% C0 2 ) for 3 days. Imaging started 6 hours after the addition of the compounds and was taken at 1-hour intervals.
- Akt2 255 sense 5'-GATCCCCTGACTTCGACTATCTCAAATTCAAGAGA 7 TTTGAGATAGTCGAAGTCATTTTTTGGAAA-3'
- Akt3 259 sense 5'-GATCCCCGAATTGTAGTCCAACTTCATTCAAGAGA 9 TGAAGTTGGACTACAATTCTTTTTTGGAAA-3'
- Akt3 260, 261 sense 5'-GATCCCCGCACTTTTGGGAAAGTTATTTCAAGAGA 11 ATAACTTTCCCAAAAGTGCTTTTTTGGAAA-3'
- Akt l 256 sense 5'- 13 & GATCCCCGCTACTACGCCATGAAGATTTCAAGAGA
- Akt 1 257 sense 5'- 15 & GATCCCCAGGTGCTGGAGGACAATGATTCAAGAGA
- Akt 1 258 sense 5'- 17 & GATCCCCCTACAACCAGGACCATGAGTTCAAGAGA
- anti-sense 257 and 261 core sequences a Antibiotic selection used to establish stable expression of the shRNA. Pur, puromycin; Hyg, Hygromycin.
- siRNA duplexes or shRNA hairpins containing these 19bp core sequences should also be effective against the indicated genes (both sense and sense sequences are in 5 '-3' direction)
- dNumber of tumors regressed by dl4 defined by tumor volume ⁇ 50% of the initial size at the start of treatment.
- % TGI % [Vc(dx-dO)- Vt(dx-dO)]/Vc(dx-dO)* 100, where Vc(dx-dO) is the difference in mean tumor volume of the control cohort (Vc) between the day of analysis (dx) and the day when treatment started (dO), and Vt(dx-dO) is the difference in mean tumor volume of the treated cohort (Vt) between the day of analysis and the day when treatment started. % TGI > 100 indicates tumor regression.
- Akt KDs induced cell cycle delay without significant apoptosis Analysis of PC3 tumors with Akt KDs revealed a mild decrease in the proliferation marker Ki-67 and no significant increase in TUNEL-positive cells compared with control tumors (Fig. 2 A). The lack of apoptosis was also observed in PC3 cells cultured in vitro. Under 10% FBS, a mild increase in GO/G I and a decrease in S phase was observed in cells expressing each shAkt construct. Slightly increased accumulation of cells in the G2/M phase was also observed in cells expressing shRNA for Aktl alone and any combinations of two or three Akt isoforms, suggesting a cell cycle delay in both DNA replication and mitosis in these cells.
- Akt has been shown to inhibit autophagy (Arico, S., A. Petiot, C. Bauvy, P.F. Dubbelhuis, A.J. Meijer, P. Codogno, and E. Ogier-Denis, (2001).
- the tumor suppressor PTEN positively regulates macroautophagy by inhibiting the phosphatidylinositol 3-kinase/protein kinase B pathway. J Biol Chem. 276:35243-6. Epub 2001 Jul 26; Degenhardt et al., 2006), we asked whether specific KD of endogenous Akt could promote autophagy.
- EM analysis revealed a significantly increased accumulation of AV s in both PC3 and U87MG cells induced to express shAktl23 (Fig. 3, A and B; and Fig. 19 C).
- the accumulation of AV and acidic vesicular organelles (AVOs) was further confirmed by localization of the autophagosome marker GFP-LC3, staining with an anti-LC3 antibody, and fluorescent dyes monodansylcadaverine (MDC) and acridine orange (AO; Fig. 4 A, Fig. 19, D-G).
- xenograft tumors expressing shAkt by EM.
- the control GFP- targeting shRNA-expressing PC3 tumors consist of healthy looking cells connected by cell- cell junctions (Fig. 3 C, a).
- cells in the shAktl23-expressing tumors exhibit morphological signs of degeneration and loss of cell-cell contact after 10-15 d of Dox treatment (Fig. 3 C, b).
- Late AV s positive for human lysosome-associated membrane protein (LAMP)l are found in degenerating tumor cells (Fig. 3 C, b-d).
- these cells often contain swollen mitochondria and dilated RER that are drastically disorganized, suggesting a connection between energy metabolism, ER stress, and autophagy.
- Chromatin clumping and fragmentation characteristic of typical apoptosis are rarely observed in the degenerating tumor cells; instead, some AV-containing cells exhibit mild pyknosis typical of cells undergoing autophagic degeneration (Fig. 3 C, b and d).
- Lysosomotropic agents accelerated cell death in PC3 cells with Akt KD
- Akt KD resulted in punctate GFP signals (Fig. 4 A and Fig. 19 E) with a corresponding reduction of the nonlipidated precursor form of the endogenous LC3 (LC3-I) and a slight increase in the lipidated auto phagosome-localized LC3-II, which is rapidly turned over in the autolysosomes (Fig. 4 B; Klionsky et al., 2008).
- bafilomycin Al A second lysosomotropic agent, bafilomycin Al (Ba), which inhibits the vacuolar proton pump (VH+-ATPase) and prevents the proper acidification of lysosomal compartments (Yamamoto, A., Y. Tagawa, T. Yoshimori, Y. Moriyama, R. Masaki, and Y. Tashiro, (1998), Bafilomycin Al prevents maturation of autophagic vacuoles by inhibiting fusion between autophagosomes and lysosomes in rat hepatoma cell line, H-4-II-E cells. Cell Struct Funct. 23:33-42), also promoted cell death in combination with shAkt 123.
- phosphatidylinositol ether lipid analogue that inhibits Akt activation was reported to induce autophagy with radiosensitizing effect (Fujiwara et al., 2007). Because phosphatidylinositol ether lipid analogues are known to have additional cellular targets (Gills et al., 2006; Memmott et al., 2008), we asked whether other specific inhibitors of PBK-Akt could also induce autophagy and sensitize cells to late stage autophagy inhibition.
- PI- 103 a dual PBK/mTOR inhibitor, compound III-5 (PI- 103), which inhibits the class I PDKs and mTOR at nanomolar concentrations but is > 1,000-fold less potent on the class III PI3K
- Knight, Z.A., B. Gonzalez, M.E. Feldman, E.R. Zunder, D.D. Goldenberg, O. Williams, R. Loewith, D. Stokoe, A. Balla, B. Toth, T. Balla, W.A. Weiss, R.L. Williams, and K.M. Shokat (2006), A pharmacological map of the PI3-K family defines a role for pi lOalpha in insulin signaling. Cell. 125:733-47).
- III-5 is potent at inducing the accumulation of AVs (Fig. 5, B and C). Similar to Akt KD, combination with CQ accelerated the death of cells treated with III-5 (Fig. 5 A). The markedly increased LC3-II to LC3-1 ratio and the appearance of enlarged vacuoles brightly stained by MDC was observed before the detection of overt cell death (Fig. 5, B and C).
- Cathepsin D is synthesized as a 43-kD preprocathepsin D that is cleaved cotranslationally and glycosylated to form a 46-kD procathepsin D, which is targeted to lysosomes yielding an intermediate that is further cleaved into a mature enzyme consisting of a 15-kD light chain and a 28-kD heavy chain.
- a mature enzyme consisting of a 15-kD light chain and a 28-kD heavy chain.
- zVAD.fmk a pancaspase inhibitor, partially rescued cell death at all concentrations tested (Fig. 20 E). Although zVAD.fmk can also inhibit lysosomal cysteine proteases at higher concentrations, the latter have been reported to mediate caspase-independent cell death (Foghsgaard et al., 2001).
- cysteine protease inhibitors Neither of the broad-spectrum cysteine protease inhibitors zFA.fmk and N-Acetyl-Leu-Leu-Nle-CHO nor a more specific cathepsin B inhibitor CA- 074-Me showed significant rescue of cell death induced by II-4 and CQ. Instead, the cysteine protease inhibitors enhanced cell killing in combination with Akti at 10-50 ⁇ concentrations, although they also showed cytotoxicity alone at higher concentrations (Fig. 20, F-H). These results suggest that cell death induced by II-4 and CQ is at least partially caspase dependent, whereas lysosomal protease activity may be required for the survival of cells under Akt inhibition.
- Akti-112 alone caused a decrease in mitochondrial membrane potential, although significant numbers of polarized mitochondria were still present in the majority of cells.
- CQ alone did not have a significant effect, cotreatment of CQ and II-4 caused an almost complete loss of mitochondrial potential, preceding the sharp drop in cell viability (Fig. 21, A and B).
- mitochondrial ROS is involved in autophagy induction (Scherz-Shouval et al., 2007). Because mitochondria are the primary intracellular source of superoxide (0 2 ⁇ ) generation, we analyzed 0 2 " production using MitoSOX red, an 0 2 ⁇ indicator that accumulates in the mitochondria as a function of membrane potential and fluoresces upon oxidation and subsequent binding to DNA. Compound II-4 alone increased MitoSOX fluorescence within 6 h (Fig. 8, A and C; and not depicted). Most of the fluorescence exhibited a mitochondrial localization pattern with a subpopulation of cells showing nuclear fluorescence, consistent with increased mitochondrial permeability in these cells.
- NAC reduced Akti- induced LC3 and GFP-LC3 lipidation, p62 degradation, and GFP-LC3 puncta formation (Fig. SS, C and D), consistent with an essential role of ROS in autophagy induction (Scherz- Shouval et al., 2007).
- PTEN status might affect the sensitivity of cells to Akt inhibition alone or in combination with CQ using isogenic PTEN +/+ and PTEN "7" mouse embryonic fibroblasts (MEFs).
- the PTEN "/* MEFs were previously shown to have elevated Akt pathway activity and are more sensitive to the anti proliferative effect of mTOR inhibition than PTEN+t+ MEFs (Sun et al., 1999).
- the PTEN 7" MEFs were also significantly more sensitive to the cell-killing effect of combined CQ and II-4 than their PTEN*' 4" counterparts. This suggests that PTEN " ' " cells may be more dependent on autophagic degradation for survival upon Akt inhibition, raising the possibility that a reasonable therapeutic index may be achievable by selective targeting of the malignant PTEN-null tumor cells using this strategy.
- Akt isoform both individually and in all possible combinations, to evaluate their requirement in the maintenance of tumor growth.
- Our results suggest that in the PTEN-null PC3 and U87MG cells, Aktl is the most important isoform, whereas Akt2 and Akt3 activities could partially compensate for the reduced Aktl activity in maintaining tumor growth.
- Akt2 inhibition Taking together both the potential metabolic side effects of Akt2 inhibition and the reported increase in invasiveness associated with inhibiting Akt 1 alone that could be counteracted by simultaneous inhibition of Akt2 (Irie et al., 2005), it may be necessary to inhibit two or all three Akt isoforms simultaneously to achieve maximum tumor inhibition, but with different degrees of inactivation to preserve crucial levels of isoform activities to reduce side effects.
- Akt protein survival.
- Constitutively active Akt has been reported to protect cells from programmed cell death after various proapoptotic insults (Downward, 1998).
- apoptosis is a primary response to Akt inhibition is less clear, especially in cancer cells where apoptosis is often suppressed because of various genetic alterations.
- Previous experiments using small molecule inhibitors of the PI3K-Akt pathway often generate conflicting results that are obscured by their nonspecific effects.
- Our data indicate that specific KD of Akt can cause cell cycle delay without promoting significant apoptosis. This is consistent with a recent study that only a small portion of total Akt activity is required for apoptosis inhibition (Liu et al., 2006).
- autophagy is a more sensitive response to reduced Akt activity caused by either specific shRNA KD or selective inhibitors of the pathway.
- Akt inhibition Several mechanisms may contribute to autophagy induction by Akt inhibition.
- inhibiting Akt can lead to mTORCl inhibition.
- mTOR is a known inhibitor of autophagy.
- a constitutively active form of Akt suppressed the induction of autophagy by rapamycin (Takeuchi et al., 2005), raising the possibility that the effect of rapamycin on autophagy may be mediated at least partially through inhibiting Akt via its long-term effect on mTORC2 (Sarbassov et al., 2006).
- other signaling outputs of Akt such as the FoxO proteins (Zhao et al., 2008) or glucose metabolism, can also contribute to autophagy regulation independently of mTOR.
- our data indicate that Akt inhibition induces increased mitochondrial superoxide and cellular ROS signals that can activate autophagy.
- Autophagy activation may lead to eventual cell death when allowed to reach its limit or may sensitize cells to additional death-inducing stimuli either through eventual autophagic cell death or switching to a more rapid death program such as apoptosis.
- Akt inhibition may increase radiosensitivity through augmenting autophagic response (Fujiwara et al., 2007), whereas calpain-mediated cleavage of Atg5 may switch autophagy into apotosis (Yousefi et al., 2006).
- inhibiting Akt alone is ineffective in cell killing in the PTEN-null cancer cells that we examined, but cell death can be accelerated through blocking autolysosomal degradation.
- autophagy may be a potential mechanism by which Akt inhibition restricts tumor growth, it may also provide temporary relief from the metabolic and oxidative stress imposed by Akt inhibition. Inhibiting autophagy at an early stage may prevent this temporary protective effect but may also counteract its tumor inhibitory effect while allowing early escape via alternative survival mechanisms. Blocking lysosomal function after tumor cells have become committed and reliant on autophagic degradation, however, might avoid this counteracting effect while amplifying the oxidative damage and cytotoxic effects through accumulation of deleterious oxidative aggregates (Seehafer and Pearce, 2006).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/US2010/062096 WO2012087336A1 (en) | 2010-12-23 | 2010-12-23 | Autophagy inducer and inhibitor combination therapy for the treatment of neoplasms |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP2655619A1 true EP2655619A1 (en) | 2013-10-30 |
| EP2655619A4 EP2655619A4 (en) | 2014-10-22 |
Family
ID=46314300
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP10861010.6A Withdrawn EP2655619A4 (en) | 2010-12-23 | 2010-12-23 | POLYTHERAPY COMBINING AN INDUCER AND AN AUTOPHAGIA INHIBITOR FOR THE TREATMENT OF NEOPLASMS |
Country Status (9)
| Country | Link |
|---|---|
| EP (1) | EP2655619A4 (en) |
| JP (1) | JP2014507129A (en) |
| KR (1) | KR20130132956A (en) |
| CN (1) | CN103403161A (en) |
| BR (1) | BR112013015891A2 (en) |
| CA (1) | CA2821378A1 (en) |
| MX (1) | MX2013007171A (en) |
| RU (1) | RU2013134359A (en) |
| WO (1) | WO2012087336A1 (en) |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6052540B2 (en) * | 2012-12-21 | 2016-12-27 | 国立大学法人福井大学 | Method for inhibiting autophagy using ATG7 mutant |
| HK1210713A1 (en) | 2012-12-27 | 2016-05-06 | Sanofi | Anti-lamp1 antibodies and antibody drug conjugates, and uses thereof |
| KR101461916B1 (en) | 2013-11-04 | 2014-11-19 | 현대자동차 주식회사 | Coupled torsion beam axle type suspension system |
| MA44075A (en) | 2015-12-17 | 2021-05-19 | Incyte Corp | N-PHENYL-PYRIDINE-2-CARBOXAMIDE DERIVATIVES AND THEIR USE AS MODULATORS OF PROTEIN / PROTEIN PD-1 / PD-L1 INTERACTIONS |
| AU2016379372A1 (en) * | 2015-12-22 | 2018-08-02 | Incyte Corporation | Heterocyclic compounds as immunomodulators |
| US20180179202A1 (en) | 2016-12-22 | 2018-06-28 | Incyte Corporation | Heterocyclic compounds as immunomodulators |
| JP7161760B2 (en) * | 2017-02-03 | 2022-10-27 | 国立大学法人東北大学 | heterocyclic compound |
| WO2018226776A1 (en) * | 2017-06-08 | 2018-12-13 | The Penn State Research Foundation | Assay for monitoring autophagosome completion |
| EP3722419A4 (en) * | 2017-12-07 | 2021-12-08 | Pearl Kogyo Co., Ltd. | PROCESS FOR THE INTRODUCTION OF A SELECTED MOLECULE AND COMPOSITION CONTAINING AN INHIBITOR |
| CN108103194B (en) * | 2017-12-27 | 2021-05-18 | 中国医学科学院药用植物研究所 | A target for inhibiting gastric cancer cell MGC-803 and its application |
| KR102095749B1 (en) * | 2018-12-20 | 2020-04-01 | 충남대학교 산학협력단 | Composition for prevention or treatment of a disease occured by autophagy disorder in mitochondria comprising expression inhibitors of S6K1 gene or activity inhibitors of S6K1 protein |
| CN111593068B (en) * | 2019-01-28 | 2023-10-17 | 广州溯原生物科技股份有限公司 | Preparation method and application of novel gene therapy vector pIRES-Rsirt2/4-Tet-nap |
| CN110592044B (en) * | 2019-07-26 | 2021-06-22 | 中国农业科学院蔬菜花卉研究所 | Gene encoding protein kinase Fused and its application in the control of diamondback moth |
| CN120005876A (en) * | 2023-11-15 | 2025-05-16 | 纳肽得(青岛)生物医药有限公司 | siRNA for inhibiting angiotensinogen expression and its use |
| WO2026085362A1 (en) * | 2024-10-16 | 2026-04-23 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Autophagy modulators and methods of use |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080269259A1 (en) * | 2005-01-19 | 2008-10-30 | The Trustees Of The University Of Pennsylvania | Regulation of Autophagy and Cell Survival |
| US20100004156A1 (en) * | 2005-07-27 | 2010-01-07 | Shalesh Kaushal | Small Compounds That Correct Protein Misfolding and Uses Thereof |
| US8063050B2 (en) * | 2006-07-06 | 2011-11-22 | Array Biopharma Inc. | Hydroxylated and methoxylated pyrimidyl cyclopentanes as AKT protein kinase inhibitors |
| UA95641C2 (en) * | 2006-07-06 | 2011-08-25 | Эррей Биофарма Инк. | HYDROXYLATED PYRIMIDYL CYCLOPENTANE AS AKT PROTEIN KINASE INHIBITORS |
| EP2046330A2 (en) * | 2006-07-14 | 2009-04-15 | Astex Therapeutics Limited | Pharmaceutical combinations |
| US8476431B2 (en) * | 2008-11-03 | 2013-07-02 | Itellikine LLC | Benzoxazole kinase inhibitors and methods of use |
| JP2012528588A (en) * | 2009-06-05 | 2012-11-15 | ソル,ダイ‐ウ | Multi-cistron shRNA expression cassette suppressing single or multi-target genes |
-
2010
- 2010-12-23 MX MX2013007171A patent/MX2013007171A/en not_active Application Discontinuation
- 2010-12-23 CA CA2821378A patent/CA2821378A1/en not_active Abandoned
- 2010-12-23 RU RU2013134359/15A patent/RU2013134359A/en not_active Application Discontinuation
- 2010-12-23 EP EP10861010.6A patent/EP2655619A4/en not_active Withdrawn
- 2010-12-23 WO PCT/US2010/062096 patent/WO2012087336A1/en not_active Ceased
- 2010-12-23 CN CN2010800712519A patent/CN103403161A/en active Pending
- 2010-12-23 JP JP2013546098A patent/JP2014507129A/en active Pending
- 2010-12-23 KR KR1020137019575A patent/KR20130132956A/en not_active Withdrawn
- 2010-12-23 BR BR112013015891A patent/BR112013015891A2/en not_active IP Right Cessation
Non-Patent Citations (5)
| Title |
|---|
| CHEN S ET AL: "Autophagy is a therapeutic target in anticancer drug resistance", BBA - REVIEWS ON CANCER, ELSEVIER SCIENCE BV, AMSTERDAM, NL, vol. 1806, no. 2, 1 December 2010 (2010-12-01), pages 220-229, XP027527118, ISSN: 0304-419X [retrieved on 2010-07-13] * |
| FAN QI-WEN ET AL: "Akt and Autophagy Cooperate to Promote Survival of Drug-Resistant Glioma", SCIENCE SIGNALING, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 3, no. 147, 9 November 2010 (2010-11-09), page 11pp, XP009158787, ISSN: 1945-0877, DOI: 10.1126/SCISIGNAL.2001017 * |
| See also references of WO2012087336A1 * |
| SHI-YONG SUN: "Enhancing perifosine's anticancer efficacy by preventing autophagy", AUTOPHAGY, vol. 6, no. 1, 1 January 2010 (2010-01-01) , pages 184-185, XP055139450, DOI: 10.4161/auto.6.1.10816 * |
| Z. WU ET AL: "Autophagy Blockade Sensitizes Prostate Cancer Cells towards Src Family Kinase Inhibitors", GENES & CANCER, vol. 1, no. 1, 1 January 2010 (2010-01-01) , pages 40-49, XP055139460, ISSN: 1947-6019, DOI: 10.1177/1947601909358324 * |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2014507129A (en) | 2014-03-27 |
| KR20130132956A (en) | 2013-12-05 |
| CN103403161A (en) | 2013-11-20 |
| CA2821378A1 (en) | 2012-06-28 |
| WO2012087336A1 (en) | 2012-06-28 |
| BR112013015891A2 (en) | 2016-10-04 |
| RU2013134359A (en) | 2015-01-27 |
| EP2655619A4 (en) | 2014-10-22 |
| MX2013007171A (en) | 2013-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2012087336A1 (en) | Autophagy inducer and inhibitor combination therapy for the treatment of neoplasms | |
| Wang et al. | Verteporfin inhibits YAP function through up-regulating 14-3-3σ sequestering YAP in the cytoplasm | |
| CA2841203C (en) | Apoptosis-inducing agent | |
| DK2753316T3 (en) | PHARMACEUTICAL COMBINATION INCLUDING A CIP2A SILENCING AGENT TO USE IN THE TREATMENT OF A HYPERPROLIFERATIVE DISORDER, PRIOR TO AN IMPAIRED P53 FUNCTION | |
| CA2895690C (en) | Apoptosis-inducing agent comprising suppressors of gst-.pi. and akt | |
| US20140004209A1 (en) | Autophagy inducer and inhibitor combination therapy for the treatment of neoplasms | |
| KR20100038377A (en) | Preventive/remedy for cancer | |
| KR101774652B1 (en) | Composition for treatment of cancer stem cells | |
| Qin et al. | DC120, a novel AKT inhibitor, preferentially suppresses nasopharyngeal carcinoma cancer stem-like cells by downregulating Sox2 | |
| Li et al. | Inhibition of Mnk enhances apoptotic activity of cytarabine in acute myeloid leukemia cells | |
| KR20240051953A (en) | Compounds that inhibit PI3K isoform alpha and methods for treating cancer | |
| US9476050B2 (en) | Combination therapy | |
| Saxena et al. | Anti-miRNA therapeutics for uterine fibroids | |
| WO2016081503A1 (en) | Tki permeability enhancers | |
| EP3223843B1 (en) | Pigment epithelium derived factor (pedf) for the treatment of uterine fibroids | |
| KR102220965B1 (en) | Pharmaceutical combination comprising a phosphatidylinositol 3-kinase inhibitor and an aromatase inhibitor | |
| HK1187367A (en) | Autophagy inducer and inhibitor combination therapy for the treatment of neoplasms | |
| Liang et al. | Effects of short-hairpin RNA-inhibited β-catenin expression on the growth of human multiple myeloma cells in vitro and in vivo | |
| Tan et al. | DEHP and its metabolite MEHP exposure impairs endometrial decidualization during early pregnancy via up-regulation of Mtmr6 | |
| WO2014048071A1 (en) | Method and pharmaceutical composition for inhibiting pi3k/akt/mtor signal path | |
| WO2022165606A1 (en) | Rationale, design, synthesis and validation of a small molecule anticancer agent | |
| Omori et al. | Molecular radiosensitization of soft tissue sarcoma by oncolytic virus-mediated MCL1 ablation | |
| JP2024504679A (en) | Composition for treating myocardial infarction containing miR145 inhibitor as an active ingredient | |
| WO2018200149A1 (en) | Synergistic combination of nucleic acid oligonucleotides and protein kinase inhibitor chemotherapeutics |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20130722 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20140922 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C07H 21/04 20060101ALI20140916BHEP Ipc: C12N 15/11 20060101AFI20140916BHEP |
|
| 17Q | First examination report despatched |
Effective date: 20160531 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20160701 |