EP2654426A2 - Use of isothiazolecarboxamides to create latent host defenses in a plant - Google Patents

Use of isothiazolecarboxamides to create latent host defenses in a plant

Info

Publication number
EP2654426A2
EP2654426A2 EP11805478.2A EP11805478A EP2654426A2 EP 2654426 A2 EP2654426 A2 EP 2654426A2 EP 11805478 A EP11805478 A EP 11805478A EP 2654426 A2 EP2654426 A2 EP 2654426A2
Authority
EP
European Patent Office
Prior art keywords
plant
genes
use according
plants
pathogen
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP11805478.2A
Other languages
German (de)
French (fr)
Inventor
Valerie Toquin
Viviane BROZEK
Catherine Sirven
Karl-Wilhelm Münks
Lino Miguel DIAS
Hiroyuki Hadano
Haruko Sawada
Gilbert Labourdette
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer Intellectual Property GmbH
Original Assignee
Bayer Intellectual Property GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Intellectual Property GmbH filed Critical Bayer Intellectual Property GmbH
Priority to EP11805478.2A priority Critical patent/EP2654426A2/en
Publication of EP2654426A2 publication Critical patent/EP2654426A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N43/00Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
    • A01N43/72Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with nitrogen atoms and oxygen or sulfur atoms as ring hetero atoms
    • A01N43/80Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with nitrogen atoms and oxygen or sulfur atoms as ring hetero atoms five-membered rings with one nitrogen atom and either one oxygen atom or one sulfur atom in positions 1,2
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N43/00Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
    • A01N43/72Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with nitrogen atoms and oxygen or sulfur atoms as ring hetero atoms
    • A01N43/82Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with nitrogen atoms and oxygen or sulfur atoms as ring hetero atoms five-membered rings with three ring hetero atoms

Definitions

  • the present invention relates to the novel use of an isothiazolecarboxamide of the formula (1)
  • the present invention relates to the above mentioned use of the compound of formula (1) or (11), wherein the latent host defenses in a plant are activated in the event of an attack by a phy- topathogenic pathogen or pest.
  • the present invention further relates to the above mentioned use of the compound of formula (1) or (II), wherein the latent host defenses in a plant are activated in the event of abiotic stress.
  • the present application relates to the above mentioned use of the compound of formula (I) or (II), wherein the abiotic stress is induced by high to low zinc deficiency.
  • the invention relates to the above mentioned use of the compound of formula (I) or (11). wherein the inducing of latent host defenses in a plant comprises the priming of the intrinsic disease resistance mechanisms of a plant.
  • intrinsic disease resistance mechanisms of a plant the term “plant immune response” can also be used.
  • defense reactions of plants are induced by various factors e.g. microorganisms, ectoparasites, or abiotic stresses like wind or heat. Numerous species of bacteria, fungi, pathogen-derived molecules, cell-wall components of fungi, peptides or plant extracts are commercialized as biological or natural control agents for crop diseases. Some of them (B. W. M. Verhagen et al..
  • the present invention relates to synthetic chemicals defined as host plant defense inducers by FRAC classification (FRAC website http://www/frac.info/), in particular to the subgroup P3 including Isotianil and Tiadinil.
  • Host plant defense inducers as defined by FRAC classification are practically well established as major countermeasures for specific diseases in particular rice blast in Northeast Asia.
  • SAR is induced by a limited primary infection by a necrotizing pathogen.
  • ISR is induced by non pathogenic organisms that colonize roots. SAR depends on SA, while ISR requires jasmonic acid and ethylene, but not SA. Both, SAR and ISR, confer an enhanced defense capacity. Upon pathogen attack, defense response occurs earlier and is stronger, leading to a broader resistance spectrum (Hammerschmidt, R. Advances in Botanical Research 2009, 5 1. 1 73-222).
  • SAR is most efficient against biotrophic and hemibiotrophic pathogens and leads to the expression of Pa- thogenesis Related (PR) genes (L. C. van Loon, . Rep, C. M. J. Pieterse, in Annu Rev Phytopathol. (2006), vol. 44, pp. 135- 162)
  • PR Pa- thogenesis Related
  • necrotrophic pathogens pathogens that obtain their nutrients from dead cells and tissues of its host organism
  • chemicals can also induce resistance.
  • the compounds used in the present invention are SAR inducers.
  • PR proteins The first proteins associated with SAR that were discovered are PR proteins. They are classified in 1 7 families. Many are extra-cellular and have an antimicrobial activity, supporting the idea of a "direct" role in defense. Induction of PR genes is part of the defense response, activation of additional defenses is necessary to stop pathogen development.
  • a complex array of antimicrobial processes is activated that includes strengthening of plant cell wall by callose and hydroxyproline-rich glycoproteins depositions and, accu- mulation of peroxides (SAR biochemical changes).
  • eSA Methyl Salicylate
  • lipid derived signals including JA and more recently azelaic acid
  • ESA Methyl Salicylate
  • JA lipid derived signals
  • azelaic acid S.-W. Park, E. aimoyo, D. Kumar, S. Mosher, D. F. Klessig, in Science.
  • NPRl is essential for transducing the SA signal and to activate PR gene expression (X. Dong, in Curr. Opin. Plant Biol. (2004), vol. 7, pp. 547-552; M. Grant. C. Lamb, in Curr. Opin. Plant Biol. (2006), vol. 9, pp. 414 ⁇ 120).
  • NPRl migrates from the cytoplasm to the nucleus. There, it interacts with a BZIP transcription factor and acti- vates defense genes (Z. Mou, W. Fan, X. Dong, in Cell. (2003), vol. 1 13, pp. 935-944).
  • SA as well as pathogen infection, also leads to the enhanced expression of NPRl gene (H.
  • NPR1 is essential for priming in Arabidopsis (A. Kohler, S. Schwindling, U. Conrath, in Plant Physiol. (2002), vol. 128, pp. 1046- 1056).
  • Probenazole (figure 2) was the first synthetic chemical host plant defense inducer introduced on the market to control fungal blast disease and bacterial blight in rice.
  • PR genes other genes involved in signal transduction pathways such as kinase and the RPR1 (Rice Probenazole Responsive) gene coding for a disease resistant like protein are also activated and upon infection, enhanced activity in the phenylpropanoid metabolism is also observed (M. Iwata, in Pesticide Outlook. (2001 ), vol. 12, pp. 28-3 1 ).
  • Probenazole induces defense responses through the SA signaling pathway (K. Yo- shioka, H. Nakashita, D. F. lessig, I. Yamaguchi, in Plant . (2001 ), vol. 25, pp. 149-157; . Umemura et ai . - - in Plant J. (2009), vol. 57, pp. 463-472). It was shown that level of total SA (free SA and salicylic acid gluco- side, SAG) is significantly increased by Probenazole treatment. Moreover, Probenazole and its active metabolite, BIT, require SA accumulation to induce SAR in Arabidopsis and tobacco, as well as a functional NPR1 gene (K.
  • ASM Acibenzolar-S-methyl
  • ASM methyl esterase
  • OsBIMK2 coding for a MAP kinase
  • OsBIANKl encoding a plasma membrane anchored protein
  • SERK Somatic Embryogenesis Receptor Kinase
  • ASM induces SAR without accumulation of SA (L. Friedrich et ai , in Plant J. ( 1996), vol. 10, pp. 61 -70). Moreover, its action does not require SA accumulation since ASM induces SAR in transgenic NahG plants. However ASM ne- g . cessitates functional NPR1 gene as SA does ( . A. Lawton et al. , in Plant J. (2006), vol. 10, pp. 71 -82). This is further confirmed by transcriptional profiling, which showed that almost all ASM-responsive genes are NPR 1 dependent (D. Wang, N. Amornsiripanitch, X. Dong, in PLoS Palhog. (2006), vol. 2, pp.
  • ASM is considered as a functional analogue of SA and suggest that it could act at the same site.
  • induced resistance by ASM requires the two transcriptional regulators, NPR1 and the rice-specific OsWRY45 (H. Takatsuji, C.-J. Jiang, S. Sugano, m JARQ. (2010). vol. 44. pp. 217-223).
  • OsWRY45 H. Takatsuji, C.-J. Jiang, S. Sugano, m JARQ. (2010). vol. 44. pp. 217-223
  • Contrary to Arabidopsis it was shown that only a subset of ASM-responsive genes is Os/VYW-dependent in rice (S. Sugano et al., in To be published in Plant Mol Biol).
  • ASM up regulated genes While all of ASM up regulated genes, categorized under defense response, are ATO/-dependent in Arabidopsis, only 5.9% of them are Ck V W -dependent in rice. Expression of PRla and PRlb is controlled by OsNPRl whereas glutathione-S-transferase (GST) and cytochrome P450 genes are regulated by OsWRK45.
  • GST glutathione-S-transferase
  • cytochrome P450 genes are regulated by OsWRK45.
  • Tiadinil was developed to control rice fungal blast and bacterial diseases. Tiadinil treatment in rice induces the expression of PR genes such as PBZ1 and leads to callose deposition upon infection (T. Hirooka, . Umetani, in Agrochem Jpn. (2004), vol. 85, pp. 12- 15).
  • PR genes such as PBZ1
  • SV- 03 The mode of action of Tiadinil and of its active metabolite (SV- 03) has been mostly studied in tobacco and Arabidopsis. There, both compounds induce resistance to a broad spectrum of pathogens as well as expression of SAR marker genes (M. Yasuda, in J. Pestic. Sci. (Tokyo, Jpn.). (2007), vol. 32, pp. 281 -282).
  • Tiadinil and SV-03 are able to induce resistance in NahG plants but require a functional NPR1 (4 M. Yasuda, in J. Pestic. Sci. (Tokyo. Jpn.). (2007), vol. 32, pp. 281 -2827). Using JA-insensitive and ethylene-insensitive mutants, it was also shown that these compounds act independently of the JA and ethylene pathways. Therefore, Tiadinil and SV-03 induce plant defense responses via the SA signaling pathway, at a site between SA and NPR1.
  • Isotianil is a new plant defense inducer that controls for example leaf blast and bacterial leaf blight in rice. Iso- tianil does not exhibit by itself an activity against pathogens but protects plants against infection when applied at an early developmental stage. Therefore it is readily accepted in above countries where prophylactic rice blast control methods e.g. nursery box application, water surface application, seed treatment, etc. are well established by melanin biosynthesis inhibitors and Probenazole. Although its practical use is so far limited in rice, Isotianil demonstrates broader control spectrum as a host defense inducer in various plants. The disease control spectrum is basically similar to Probenazole and Tiadinil, which covers typical biotrophic pathogens like Pyricularia. powdery mildews, Xanthomonas and some leaf spot diseases but generally negative for necrotrophic pathogens.
  • the term "latent host defenses" signifies that the compounds used according to the invention prime the intrinsic disease resistance mechanisms of a plant. Surprisingly, it has now been found that only a few genes are activated when a plant is treated with Isotianil or Tiadinil when no inoculation with a phytopathogenic pathogen or pest or by abiotic stress follows the treatment (data shown in Example A, Table 2).
  • Preferred genes activated by treatment with Isotianil are a NPR1 homolog gene, called NPR3 (or NH3), induced 6-fold over control, OsWRKY62, OsWRKY76 with a fold change of 1 8 and 6.5 respectively, OsSGTl coding for a SA glucosyltransferase, 13.4 fold induction, and OsBMSTl coding for a salicylate methyltransferase, 7. 1 fold induction. Further preferred are genes coding for Jacalin (25.9 fold induction) and Terpene synthase/cyclase family protein (26.8 and 47.1 fold induction) (Table 2).
  • the priming causes a plant to activate its intrinsic disease resistance mechanisms, including the intrinsic defense mechanisms against abiotic stress, in a stronger and faster way upon an attack by a phytopathogenic pathogen or pest or abiotic stress and ensures that the intrinsic disease resistance mechanisms are activated in time for pro- tection.
  • the use of the compounds of formula (I) or (II) according to the invention effectively creates an early warning system so the plant produces naturally occurring disease resistance mechanisms in time to avoid that infections can get a head start.
  • the priming of the intrinsic disease resistance mecha- nisms of a plant by treatment of the plant with a compound of formula (I) or (II) is observed for at least 4 days, preferably at least 5 days, more preferably at least 6 days, also preferably for at least 7, 8, 9, 10, 1 1 , 12, 13, 14, or 15 days after treatment with the compound of formula (I) or (I I).
  • the priming of the intrinsic disease resistance mechanisms of a plant by treatment of the plant with a compound of formula (I) or (II) is observed for at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140 or 150 days after treatment with the compound of formula (I) or (II).
  • the most relevant plant defense genes include (see also Example C, Table 6, expression pattern of defense genes during infection in control plants and in plants pre-treated with Isotianil or Probenazole):
  • the intrinsic disease resistance mechanisms of a plant are primed by treatment of the plant with a compound of formula (I) or (II) for more than one time, such as 2 times, 3 times, 4 times, 5 times or 6 times.
  • the time interval between two treatments can be chosen according to the agronomical needs.
  • the term "priming of the intrinsic disease resistance mechanisms of a plant" within the meaning of the present invention signifies that the compounds of fonnula (I) or (I I) used in the present invention induce only few changes in gene expression in the absence of pathogen pressure (see Example A, Table 2, and above). These genes directly responsive to the compounds of fonnula (I) or (II) are involved in salicylic acid catabolism and pathway.
  • the compounds of formula (I) or (II) prime plants, in particular rice plants, for stronger and faster induction of defense genes as compared to control (simple infection) and also as compared to other plant defense inducers such as Probena- zole (PBZ).
  • PBZ Probena- zole
  • the disease resistance mechanisms arc only activated in the event of an attack by a phytopathogenic pathogen or pest or abiotic stress. This means that the use of the compounds according to the present invention plant does not cause a plant to waste energy in useless defensive processes in a non-attack situation.
  • the invention thus further relates to the above mentioned use of the compound of formula (I) or (II), wherein the inducing of latent host defenses in a plant maintains the strong growth and vitality of the plant.
  • the term "maintaining strong growth and vitality of the plant” within the meaning of the present invention signifies that the treatment of plants with the compounds of formula (I) or (I I), in the absence of an attack by a phy- topathogenic pathogen or pest, does not impair the growth or vitality of the plant, as characterized for example by production yield, or leaf sizes or weight.
  • Further examples related to growth or vitality of a plant are emergence, crop yields, more developed root system, tillering increase, increase in plant height, bigger leaf blade, less dead basal leaves, stronger tillers, greener leaf color, less fertilizers needed, less seeds needed, more productive tillers, earlier flowering, early grain maturity, less plant verse (lodging), increased shoot growth, im- proved plant vigor, and early germination; or any other features familiar to a person skilled in the art. "Maintaining strong growth and vitality of the plant” can further be described with the terms health promoting, plant health care support, or invigorating.
  • the invention relates to the above mentioned use of the compound of formula (I) or (II), wherein the inducing of latent host defenses in a plant results in a stronger and faster induction of the expression of plant defense genes in the event of an attack by a phytopathogenic pathogen or pest or of abiotic stress, as compared to control or other plant defense inducers.
  • the invention relates to the above mentioned use of the compound of formula (I) or (II), wherein the inducing of latent host defenses in a plant results in a stronger and faster induction of the expression of plant defense genes in the event of an attack by a phytopathogenic pathogen or pest, as compared to control or other plant defense inducers.
  • control signifies plants that are inoculated with the same pathogen or the same abiotic stress factor(s) as the plants treated with the compounds of formula (I) or (II) but without prior treatment with a compound of formula (I) or (II). This is also called “mock treatment”.
  • the above mentioned use of the compound of formula (I) or (II) is characterized in that the plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest or of abiotic stress are expressed at least two fold stronger as compared to control.
  • the above mentioned use of the compound of formula (I) or (II) is characterized in that the plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest are expressed at least two fold stronger as compared to control.
  • the at least two fold stronger expression of plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest can be observed 24 or 48 hours, preferably 24 hours, after an attack by a phytopathogenic pathogen or pest.
  • the at least two fold stronger expression of plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest can be observed 48 hours after an attack by a phyto- pathogenic pathogen or pest. . _
  • strong and faster induction of the expression of plant defense genes as compared to control or other plant defense inducers signifies that the degree of induction of the expression of plant defense genes is higher and that the induction occurs at an earlier time point as compared to control or other plant defense inducers.
  • a higher degree of induction of expression is defined as an at least two-fold, preferably an at least 3-fold, 4- fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 12-fold, or 15-fold up regulation of plant defense genes.
  • the induction of the expression of plant defense genes at an earlier time point is defined as an at least 2-fold induction of the expression of plant defense genes that can be observed 24 or 48 hours after an attack by a phyto- pathogenic pathogen or pest, preferably 24 hours after an attack by a phytopathogenic pathogen or pest, also preferably 48 hours after an attack by a phytopathogenic pathogen or pest.
  • the at least two fold stronger expression of plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest can be observed 72 or 96 hours after an attack by a phytopathogenic pathogen or pest.
  • the at least two fold stronger expression of plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest can be observed at least twice as fast as compared to control or other host defense inducers such as pro- benazole.
  • the invention also relates to the above mentioned use of the compound of formula (I) or (II), wherein the plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest or of abiotic stress comprise genes of the SA signalling pathway and of the SAR response.
  • the invention relates to the above mentioned use of the compound of formula (1) or (II), wherein the plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest comprise genes of the SA signalling pathway which are selected from the group consisting of WR Y, NPR 1 , NPR3. and SGT1 and SAR genes which are selected from the group of PR genes and genes involved in the phenylpropanoid pathway.
  • attack by a phytopathogenic pathogen or pest signifies the attack or infestation of a plant with phytopathogenic fungi, bacteria, viruses, viroids, mycoplasma-like organisms, protozoa, insects, acari or nematodes.
  • Blumeria species such as, for example, Blumeria graminis
  • Podosphaera species such as, for example, Podosphaera leucotricha
  • Sphaerotheca species such as, for example, Sphaerotheca fuliginea
  • Uncinula species such as, for example, Uncinula necator
  • Gymnosporangium species such as, for example, Gymnosporangium sabinae
  • Hemileia species such as, for example, Hemileia vastatrix
  • Phakopsora species such as, for example, Phakopsora pachyrhizi and Phakopsora meibomiae
  • Puccinia species such as, for . . example, Puccinia recondita or Puccinia triticina
  • Uromyccs species such as, for example, Uromyces appendicular
  • Uromyccs species such as, for example, Uromyces appendicular
  • Bremia species such as, for example, Bremia lactucae
  • Peronospora species such as. for example, Peronospora pisi or P. brassicae
  • Phy- tophthora species such as, for example Phytophthora infestans
  • Plasmopara species such as, for example, Plasmopara viticola
  • Pseudoperonospora species such as, for example, Pseudoperonospora humuli or Pseu- doperonospora cubensis
  • Pythium species such as, for example, Pythium ultimum
  • Pythium species such as, for example, Pythium ultimum
  • Magnaporthe grisea for example, Magnaporthe grisea; Microdo- chium species, such as, for example. Microdochium nivale; Mycosphaerella species, such as, for example. My- cosphaerella graminicola and . fijiensis; Phaeosphaeria species, such as.
  • Phaeosphaeria no- dorum for example, Phaeosphaeria no- dorum
  • Pyrenophora species such as, for example, Pyrenophora teres
  • Ramularia species such as, for example, Ramularia collo-cygni
  • Rhynchosporium species such as, for example, Rhynchosporium secalis
  • Septoria species such as, for example, Septoria apii
  • Typhula species such as, for example, Typhula incarnata
  • Venturia species such as, for example, Venturia inaequalis
  • Ear and panicle diseases caused, for example, by Alternaria species, such as, for example, Alternaria spp.; Aspergillus species, such as, for example, Aspergillus flavus; Cladosporium species, such as, for example, Cladosporium cladosporioides; Claviceps species, such as, for example, Claviceps purpurea; Fusarium species, such as, for example, Fusarium culmorum; Gibberella species, such as, for example, Gibber- ella zeae; Monographella species, such as, for example, Monographella nivalis; Septoria species, such as for example, Septoria nodorum;
  • smut fungi such as, for example, Sphacelotheca species, such as, for example, Sphace- lotheca reiliana; Tilletia species, such as, for example, Tilletia caries; T. controversa; Urocystis species, such as, for example, Urocystis occulta; Ustilago species, such as, for example, Ustilago nuda; U.
  • nuda tritici Seed- and soil-borne rot and wilt diseases, and also diseases of seedlings, caused, for example, by Fusarium species, such as, for example, Fusarium culmorum; Microdochium species, such as, for example, Microdochi- um nivale; Tilletia species, such as, for example. Tilletia caries; Ustilago species, such as, for example, Ustilago tritici, Utilago nuda; Pyrenophora species, such as, for example, Pyrenophora graminea, Prenophora teres; Phy- tophthora species, such as, for example.
  • Fusarium species such as, for example, Fusarium culmorum
  • Microdochium species such as, for example, Microdochi- um nivale
  • Tilletia species such as, for example. Tilletia caries
  • Ustilago species such as, for example, Ustilago tritici
  • Phytophthora cactorum Pythium species, such as, for example, Pythi- um ultimum; Rhizoctonia species, such as, for example, Rhizoctonia solani; Sclerotium species, such as, for example, Sclerotium rolfsii; Alternaria species, such as, for example, Alternaria brassicae; Phoma species, such as, for example, Phoma lingam.
  • Botrytis species such as, for example, Botrytis cinerea
  • Diseases of plant tubers caused, for example, by Rhizoctonia species, such as, for example, Rhizoctonia solani
  • Helminthosporium species such as, for example, Helminthosporium solani
  • bacteriopathogens such as, for example, Xanthomonas species, such as, for example, Xan- thomonas campestris pv. oryzae; Pseudomonas species, such as, for example, Pseudomonas syringae pv. lach- rymans; Erwinia species, such as, for example, Erwinia amylovora.
  • Xanthomonas species such as, for example, Xan- thomonas campestris pv. oryzae
  • Pseudomonas species such as, for example, Pseudomonas syringae pv. lach- rymans
  • Erwinia species such as, for example, Erwinia amylovora.
  • Seed- and soil-borne rot and wilt diseases, and also diseases of seedlings caused, for example, by Fusarium species, such as, for example, Fusarium culmorum; Microdochium species, such as, for example, Microdochium nivale; Tilletia species, such as, for example, Tilletia caries; Ustilago species, such as, for example, Ustilago tritici, Ustilago nuda; Pyrenophora species, such as, for example, Pyrenophora graminea, Pyrenophora teres; Phytophthora species, such as, for example, Phytophthora cactorum; Pythium species, such as.
  • Fusarium species such as, for example, Fusarium culmorum
  • Microdochium species such as, for example, Microdochium nivale
  • Tilletia species such as, for example, Tilletia caries
  • Ustilago species such as, for example, Ustil
  • Rhizoctonia species such as, for example. Rhizoctonia solani
  • Sclerotium species such as, for example, Sclerotium rolfsii
  • Alternaria species such as, for example, Alternaria brassicae
  • Phoma species such as, for example, Phoma lingam.
  • the term "attack by a phytopathogenic pathogen or pest” signifies the attack or infestation of a plant with phytopathogenic fungi, bacteria, or insects.
  • the pathogens attacking a plant are selected from the group consisting of the rice pathogens Pyricularia grisea causing rice blast and Xanthomonas oryzae causing bacterial leaf blight, the banana pathogen Mycosphaerella fijiensis causing Black Sigatoka, the wheat pathogen Blumeria graminis f.sp tritici causing powdery mildew, the cucumber pathogens Colletolrichum or- biculare causing anthracnose and Pseudomonas syringae pv.
  • the pathogens attacking a plant are selected from the group consisting of the rice pathogens Pyricularia grisea causing rice blast and Xanthomonas oryzae pv. oryzae causing bacterial leaf blight, and the banana pathogen Mycosphaerella fijiensis causing Black Sigatoka, the wheat path- ogen Blumeria graminis f.sp tritici causing powdery mildew, the cucumber pathogens Colletotrichum orbicula- re causing anthracnose and Pseudomonas syringae pv. lachlymans causing bacterial leaf spot and the tea pathogen Pestalozia longiseta.
  • abiotic stress within the meaning of the present invention signifies that the plants are exposed to abiotic stress factors including nutritional deficiencies, micronutrient deficiencies, such as high to low Zn defi- ciency, limited availability of nitrogen nutrients, limited availability of phosphorus nutrients, high radiation exposure, strong light conditions, the avoidance of shade, ozone conditions, low water supply, drought, water logging, cold and heat conditions, osmotic stress, increased soil salinity, or increased exposure to minerals.
  • nutritional deficiencies such as high to low Zn defi- ciency, limited availability of nitrogen nutrients, limited availability of phosphorus nutrients, high radiation exposure, strong light conditions, the avoidance of shade, ozone conditions, low water supply, drought, water logging, cold and heat conditions, osmotic stress, increased soil salinity, or increased exposure to minerals.
  • Zinc is essential for the normal healthy growth and reproduction of plants, animals and humans. When the supply of plant-available zinc is inadequate, crop yields and quality of crop products are impaired. In plants, zinc plays a key role as a structural constituent or regulatory co-factor of a wide range of different enzymes and proteins in many important biochemical pathways. When the supply of zinc to the plant is inadequate, the physiological functions of zinc cannot operate correctly and thus plant growth is adversely affected.
  • zinc-deficient soils can be easily treated with zinc fertilizers to provide an adequate supply of zinc to the crops, where zinc sulphate is by far the most widely used fertilizer (cf. Zinc in Soils and Crop Nutrition by B.J. Alloway, 2 nd Ed. Brussels, Paris, 2008).
  • the invention further relates to the above mentioned use of the compound of fonnuia (I) or (II), wherein the compound of formula (I) or fonnuia (II) is used in combination with at least one further agrochemically active compound.
  • agrochemically active compounds are to be understood as meaning all substances which are or may be customarily used for treating plants. Fungicides, bactericides, insecticides, acaricides, nematicides, mol- luscicides, safeners, plant growth regulators and plant nutrients as well as biological control agents may be mentioned as being preferred.
  • fungicides which may be mentioned are: . .
  • Inhibitors of the nucleic acid synthesis for example benalaxyl, benalaxyl-M, bupirimate, clozylacon, dimethi- rimol, ethirimol, fliralaxyl, hymexazol, metalaxyl, metalaxyl-M, ofurace, oxadixyl and oxolinic acid.
  • Inhibitors of the mitosis and cell division for example benomyl, carbendazim, chlorfenazole, diethofencarb, ethaboxam, fuberidazole, pencycuron, thiabendazole, thiophanate, thiophanate-methyl and zoxamide.
  • Inhibitors of the respiration for example diflumetorim as Cl-respiration inhibitor; bixafen, boscalid, carboxin, fenfuram, flutolanil, fluopyram, furametpyr, furmecyclox, isopyrazam (9R-component), isopyrazam (9S- component), mepronil, oxycarboxin, penthiopyrad, thifluzamide as Cll-respiration inhibitor; amisulbrom, azoxystrobin, cyazofamid, dimoxystrobin, enestroburin, famoxadone, fenamidone, tluoxastrobin, kresoxim-methyl, metominostrobin, orysastrobin, picoxystrobin, pyraclostrobin, pyribencarb, trifloxystrobin as Clll-respiration inhibitor.
  • diflumetorim as Cl-respiration inhibitor
  • Inhibitors of the ATP production for example fentin acetate, fentin chloride, fentin hydroxide, and silthiofam.
  • Inhibitors of the amino acid and/or protein biosynthesis for example andoprim, blasticidin-S, cyprodinil, ka- sugamycin, kasugamycin hydrochloride hydrate, mepanipyrim and pyrimethanil.
  • Inhibitors of the signal transduction for example fenpiclonil, fludioxonil and quinoxyfen.
  • Inhibitors of the lipid and membrane synthesis for example biphenyl, chlozolinate, edifenphos, etridiazole, iodocarb, iprobenfos, iprodione, isoprothiolane, procymidone, propamocarb, propamocarb hydrochloride, pyra- zophos, tolclofos-methyl and vinclozolin.
  • Inhibitors of the ergosterol biosynthesis for example aldimorph, azaconazole, bitertanol, bromuconazole, cyproconazole, diclobutrazole, difenoconazole, diniconazole, diniconazole-M, dodemorph, dodemorph acetate, epoxiconazole, etaconazole, fenarimol, fenbuconazole, fenhexamid, fenpropidin, fenpropimorph, fluquin- conazole, flu ⁇ rimidol, flusilazole, flutriafol, furconazole, furconazole-cis, hexaconazole, imazalil, imazalil sulfate, imibenconazole, ipconazole, metconazole, myclobutanil, naftifme, nuarimol, oxpoconazole, paclo
  • Inhibitors of the cell wall synthesis for example benthiavalicarb, dimethomorph, flumorph. iprovalicarb, mandipropamid, polyoxins, polyoxorim, prothiocarb, validamycin A. and valiphenal.
  • Inhibitors of the melanine biosynthesis for example carpropamid, diclocymet, fenoxanil, phthalide, py- roquilon and tricyclazole.
  • ecomate ferimzone, flumetover, fluopicolidc, fluoroimide, flusulfa- mide, flutianil, fosetyl-aluminium, fosetyl-calcium, fosetyl-sodium, hexachlorobenzene, irumamycin, isotianil.
  • methasulfocarb methyl (2E)-2- ⁇ 2-[( ⁇ cyclopropyl[(4-methoxyphenyl)imino]methyl ⁇ thio)methyl]phenyl ⁇ -3-meth- oxyacrylate, methyl isothiocyanate, metrafenone, (5-bromo-2-methoxy-4-methylpyridin-3-yl)(2,3,4-trimethoxy-6- methylphenyl)methanone, mildiomycin, tolnifanide, N-(4-chlorobenzyl)-3-[3-methoxy-4-(prop-2-yn- l - yloxy)phenyl]propanamide, N-[(4-chlorophenyl)(cyano)methyl]-3-[3-methoxy-4-(prop-2-yn-l -yloxy)phenyl]- propanamide, N-[(5-bromo-3-chloropyridin-2-yl)methyl]-2,4-
  • bactericides which may be mentioned are:
  • bronopol dichlorophen, nitrapyrin, nickel dimethyldithiocarbamate, kasugamycin, octhilinone, furancarboxylic acid, oxytetracycline, probenazole, streptomycin, tecloftalam, copper sulphate and other copper preparations.
  • insecticides examples include acaricides and nematicides.
  • Acetylcholinesterase (AChE) inhibitors for example carbamates, e.g. alanycarb, aldicarb, aidoxycarb, allyxycarb, aminocarb, bendiocarb, benfuracarb, bufencarb, butacarb, butocarboxim, butoxycarboxim, carbaryl, carbofuran, carbosulfan, cloethocarb, dimetilan, ethiofencarb, fenobucarb, fenothiocarb, formetanate, furathiocarb, isoprocarb, metam-sodium, methiocarb, methomyl, metolcarb, oxamyl, pirimicarb, promecarb, propoxur, thiodi- carb, thiofanox, trimethacarb, XMC, and xylylcarb; or organophosphates, e.g.
  • dichlor- vos DDVP dicrotophos, dimethoate, dimethylvinphos, dioxabenzofos, disulfoton, EPN, ethion, ethoprophos, etrimfos, famphur, fena iphos, fenitrothion, fensulfothion, fenthion, flupyrazofos, fonofos, formothion, fosmethi- lan, fosthiazate, heptenophos, iodofenphos, iprobenfos, isazofos, isofenphos, isopropyl, O-salicylate, isoxathion, malathion, mecarbam, methacrifos, methamidophos, methidathion, mevinphos, monocrotophos, naled, omethoate, oxydemeton-methyl, parathion
  • GABA-gated chloride channel antagonists for example organochlorines, e.g. camphechlor, chlordane, en- dosulfan, gamma-HCH, HCH, heptachlor, lindane, and methoxychlor; or fiproles (phenylpyrazoles), e.g. ace- toprole, ethiprole, fipronil, pyrafluprole, pyriprole, and vaniliprole.
  • organochlorines e.g. camphechlor, chlordane, en- dosulfan, gamma-HCH, HCH, heptachlor, lindane, and methoxychlor
  • fiproles phenylpyrazoles
  • Sodium channel modulators/voltage-dependent sodium channel blockers for example pyrethroids, e.g. acrinathrin, allethrin (d-cis-trans, d-trans), beta-cyfluthrin, bifenthrin, bioal!ethrin, bioallethrin S-cyclopentyl isomer, bioethanomethrin, biopermethrin, bioresmethrin, chlovaporthrin, cis-cypermethrin, cis-resmethrin, cis- permethrin, clocythrin, cycloprothrin, cyfluthrin, cyhalothrin, cypermethrin (alpha-, beta-, theta-, zeta-), cyphe- nothrin, deltamethrin, empenthrin ( 1 R isomer), esfen
  • Nicotinergic acetylcholine receptor agonists/antagonists for example chloronicotinyls, e.g. acetamiprid, clo- thianidin, dinotefuran, imidacloprid, imidaclothiz, nitenpyram, nithiazine. thiacloprid. thiamethoxam, AKD- 1022; or nicotine, bensultap, catlap, thiosultap-sodium, and thiocylam.
  • chloronicotinyls e.g. acetamiprid, clo- thianidin, dinotefuran, imidacloprid, imidaclothiz, nitenpyram, nithiazine.
  • thiacloprid thiamethoxam, AKD- 1022; or nicotine, bensultap, catlap, thiosultap-sodium, and thiocyl
  • Allosteric acetylcholine receptor modulators for example spinosyns, e.g. spinosad and spineto- ram.
  • Chloride channel activators for example mectins/macrolides, e.g. abamectin, emamectin, emamectin benzo- ate, ivermectin, lepimectin, and milbemectin; or juvenile hormone analogues, e.g. hydroprene, kinoprene, methoprene, epofenonane, triprene, fenoxycarb, pyriproxifen, and diofenolan.
  • Active ingredients with unknown or non-specific mechanisms of action for example gassing agents, e.g. methyl bromide, chloropicrin and sulfuryl fluoride; selective antifeedants, e.g. cryolite, pymetrozine, pyriflu- quinazon and flonicamid; or mite growth inhibitors, e.g. clofentezine, hexythiazox, etoxazole.
  • gassing agents e.g. methyl bromide, chloropicrin and sulfuryl fluoride
  • selective antifeedants e.g. cryolite, pymetrozine, pyriflu- quinazon and flonicamid
  • mite growth inhibitors e.g. clofentezine, hexythiazox, etoxazole.
  • Oxidative phosphorylation inhibitors, ATP disrupters for example diafenthiuron; organotin compounds, e.g. azocyclotin, cyhexatin and fenbutatin oxide; or propargite, tetradifon.
  • organotin compounds e.g. azocyclotin, cyhexatin and fenbutatin oxide
  • propargite tetradifon.
  • Oxidative phoshorylation decouplers acting by interrupting the H proton gradient for example chlorfenapyr, binapacryl, dinobuton, dinocap and DNOC.
  • Microbial disruptors of the insect gut membrane for example Bacillus thuringiensis strains.
  • Chitin biosynthesis inhibitors for example benzoylureas, e.g. bistrifluron, chlorfluazuron, diflubenzuron, fluazuron, flucycloxuron, flufenoxuron, hexaflumuron, lufenuron, novaluron. noviflumuron, penfluron, teflubenzuron or triflumuron.
  • benzoylureas e.g. bistrifluron, chlorfluazuron, diflubenzuron, fluazuron, flucycloxuron, flufenoxuron, hexaflumuron, lufenuron, novaluron. noviflumuron, penfluron, teflubenzuron or triflumuron.
  • Ecdysone agonists/disruptors for example diacylhydrazines, e.g. chromafenozide, halofenozide, methox- yfenozide, tebufenozide, and Fufenozide (JS 1 18); or azadirachtin.
  • diacylhydrazines e.g. chromafenozide, halofenozide, methox- yfenozide, tebufenozide, and Fufenozide (JS 1 18); or azadirachtin.
  • Site III electron transport inhibitors/site II electron transport inhibitors for example hydramethylnon; acequinocyl; fluacrypyrim; or cyflumetofen and cycnopyrafen.
  • Electron transport inhibitors for example Site I electron transport inhibitors, from the group of the METI acaricides, e.g. fenazaquin, fenpyroximate, pyrimidifen, pyridaben, tebufenpyrad. tolfenpyrad, and rotenone; or voltage-dependent sodium channel blockers, e.g. indoxacarb and metaflumizone.
  • METI acaricides e.g. fenazaquin, fenpyroximate, pyrimidifen, pyridaben, tebufenpyrad. tolfenpyrad, and rotenone
  • voltage-dependent sodium channel blockers e.g. indoxacarb and metaflumizone.
  • Fatty acid biosynthesis inhibitors for example tetronic acid derivatives, e.g. spirodiclofen and spi- romesifen; or tetramic acid derivatives, e.g. spirotetramat.
  • Ryanodine receptor effectors for example diamides, e.g. flubendiamide, (R).(S)-3-chloro-N ' - ⁇ 2-methyl-4- [ l ,2,2,2-tetrafluoro- l -(trinuoromethyl)ethyl]phenyl ⁇ -N 2 -( l -methyl-2-methylsulphonylethyl)phthalamide, chlorantraniliprole (Rynaxypyr), or Cyantraniliprole (Cyazypyr).
  • diamides e.g. flubendiamide
  • chlorantraniliprole Rosinax
  • molluscicides which may be mentioned are metaldehyde and methiocarb.
  • safeners which may be mentioned are:
  • Heterocyclic carboxylic acid derivates for example dichlorophenylpyrazolin-3-carboxylic acid derivatives, e.g. l -(2,4-dichlorophenyl)-5-(ethoxycarbonyl)-5-methyl-4,5-dihydro- l H-pyrazole-3-carboxylic acid, diethyl l -(2,4-dichlorophenyl)-4,5-dihydro-5-methyl- l H-pyrazole-3,5-dicarboxylate ("mefenpyr-diethyl").
  • dichlorophenylpyrazolin-3-carboxylic acid derivatives e.g. l -(2,4-dichlorophenyl)-5-(ethoxycarbonyl)-5-methyl-4,5-dihydro- l H-pyrazole-3-carboxylic acid, diethyl l -(2,4-dichlorophenyl)-4,5-dihydr
  • dichlorophenylpyrazolecarboxylic acid derivatives e.g. ethyl l -(2,4-dichlorophenyl)-5-methyl- l H-pyrazole-3-carboxylate.
  • 8-quinolinol for example derivatives of (quinolin-8-yloxy)acetic acid, e.g. heptan-2-yl [(5-chloroquinolin-8-yl)oxy]acetate ("cloquintocet-mexyr), 4-methylpentan-2-yl [(5-chloroquinolin-8-yl)oxy]- acetate,4-(allyloxy)butyl [(5-chloroquinolin-8-yl)oxy Jacetate, 1 -(allyloxy)propan-2-yl [(5-chloroquinolin-8-yl)- oxy]acetate, ethyl [(5-chloroquinolin-8-yl)oxy]acetate, methyl [(5-chloroquinolin-8-yl)oxy]acetate, allyl [(5- chloroquinolin-8-yl)oxy]acetate, 2- ⁇ [propylideneamino]oxy
  • Dichloroacetamides which are often used as pre-emergence safeners (soil active safeners), e.g. "dichlor- mid" (N,N-diallyl-2,2-dichloroacetamide), "R-29148” (3dichloroacetyl-2,2,5-trimethyl-l ,3-oxazolidine) and "R- 28725" (3-dichloroacetyl-2,2,-dimethyl- l ,3-oxazolidine) both of the company Stauffer, "benoxacor” (4- dichloroacetyl-3,4-dihydro-3-methyl-2H- l ,4-benzoxazine), "PPG- 1292” (N-allyl-N-[( l ,3-dioxolan-2-yl)-methyl]- dichloroacetamide) of PPG Industries, "DKA-24 ( -allyl-N-[(allylaminocarbonyl)methyl]-
  • R' represents (Ci-C6)alkyl, which is unsubstituted or mono- to trisubstituted by substituents selected from the group consisting of halogen, (Ci-Q)alkoxy, (Ci-C&)haloalkoxy and (Ci-Ci)alkylthio;
  • R 2 represents halogen, (C i-C4)alkyl, (Ci-Q)alkoxy, CI 7 ?;
  • n 1 or 2;
  • R 3 , R 4 independently of one another represent hydrogen, (C i -Chalky 1, (C.t-C6)alkenyl, (C3-C f ,)alkynyl, (C3- C6)cycloalkyl,
  • R 5 represents halogen, (Ci-Gt)alkyl, (C i-C4)haloalkyl or (Ci-C4)alkoxy
  • n 1 or 2
  • compounds of formula (I I I) wherein
  • R 3 cyclopropyl
  • R 4 hydrogen
  • R 5 n 2-OMe, (“cyprosulfamide”)
  • R 3 cyclopropyl
  • R 4 hydrogen
  • R 3 ethyl
  • R 4 hydrogen
  • R 3 isopropyl
  • R 4 hydrogen
  • R 5 n 5-Cl-2-O e
  • R 3 isopropyl
  • R 4 hydrogen
  • R 5 n 2-OMe. or for example benzoyls
  • R 6 , R 7 independently of one another represent hydrogen, (Ci-Cs)alkyl, (C3-C6)alkenyl, (C3-C6)alkynyl, R 8 represents halogen, (Ci-C 4 )alkyl, (Ci-C4)alkoxy, CF3
  • r is 1 or 2; in particular
  • Hydroxyaromatic compounds and aromatic-aliphatic carboxylic acid derivatives e.g. ethyl 3,4,5- triacetoxybenzoate, 4-hydroxy-3,5-dimethoxybenzoic acid, 3,5-dihydroxybenzoic acid, 2,4-dihydroxybenzoic acid, 4-fluoro-2-hydroxybenzoic acid, 2-hydroxycinnamic acid, 2,4-dichlorocinnamic acid (cf. WO 2004/084631 , WO 2005/01 5994, WO 2005/016001 ).
  • WO 2004/084631 WO 2005/01 5994, WO 2005/016001
  • WO 2005/016001 WO 2005/016001
  • l ,2-Dihydrochinoxalin-2-ones e.g. l -melhyl-3-(2-thienyl)- l ,2-dihydrochinoxalin-2-one, l -methyl-3-(2- thienyl)- l ,2-dihydrochinoxalin-2-thione, l -(2-aminoethyl)-3-(2-thienyl)- l ,2-dihydrochinoxalin-2-one hydro- chlorid, l -(2-methylsulfonylaminoethy])-3-(2-thienyl)- l ,2-dihydrochinoxalin-2-one (cf. WO 2005/1 1 2630).
  • Diphenylmethoxyacetic acid derivatives e.g. methyl (diphenylmethoxy)acetate (CAS-Reg. No. 41858- 19-9), ethyl (diphenylmethoxy)acetate or (diphenylmethoxy)acetic acid (cf. WO 98/38856).
  • R 9 represents halogen, (Ci-Gi)alkyl, (Ci-Gt)haloalkyl, (Ci-d)alkoxy, (Ci-C4)haloalkoxy,
  • R io represents hydrogen or (Ci-C4)alkyl
  • s 0, 1 or 2.
  • R' 2 represents halogen, (Ci-C4)alkyl, methoxy, nitro, cyano, CF3, OCF3,
  • Y, Z independently represent O or S
  • t is O, 1 , 2, 3 or 4,
  • R 13 represents (Ci-Ci6)alkyl, (C2-C6)alkenyl, aryl, benzyl, halogenobenzyl,
  • R' 4 represents hydrogen or (C
  • Oxyimino compounds known as seed treatment agents, e.g. ' • oxabetrinir [(Z)-l ,3-dioxolan-2- ylmethoxyimino(phenyl)acetonitril], "fluxofenim” [ l -(4-chlorophenyl)-2,2,2-trifluoro-l -ethanone-0-( l ,3- dioxolan-2-ylmethyl)-oxime], and "cyometrinil” or "CGA-43089” [(Z)-cyanomethoxyimino(phenyl)acetonitril], all known as seed treatment safener for sorghum against damage by metolachlor.
  • seed treatment agents e.g. ' • oxabetrinir [(Z)-l ,3-dioxolan-2- ylmethoxyimino(phenyl)acetonitril], "f
  • JP-A 60-087254 which is known as safener for rice against damage by some herbicides, methoxyphenon” or “NK 049” (3,3'-dimethyl-4-methoxy-benzophenone), which is known as safener for rice against damage by some herbicides, "CSB” [ l -bromo-4-(chloromethylsulfonyl)benzene] of umiai (CAS-Reg. No. 54091 -06-4), which is known as safener for rice against damage by some herbicides.
  • plant nutrients which may be mentioned are customary inorganic or organic fertilizers for supplying plants with macro- and/or micronutrients.
  • yeasts and bacteria e.g. Metschnikowia fructicola or bacillus firmus.
  • Preferred fungicidal or insecticidal active compounds are selected from the group consisting of bacillus firmus, beta-cyfluthrin, bixafen, clothianidin, cyproconazole, ethiprole, fenamidone, fenhexamid, fipronil, flubendia- mide, fluopicolide, fluopyram, fluoxastrobin, fluquinconazole, fosetyl-A I, imidacloprid, iprovalicarb, methio- carb, metominostrobin, oryzastrobin, pencycuron, penflufen, prochloraz-manganese chloride, propamocarb, propineb, prothioconazole, pyrimethanil, rynaxypyr, sedaxan
  • Also preferred fungicidal or insecticidal active compounds are selected from the group consisting of ethiprole, fipronil, imidacloprid, prochloraz-manganese chloride, propineb, rynaxypyr, spinosad, thiacloprid, thifluzamide, and trifloxystrobin.
  • the present invention also relates to the use of a compound of formula (I) or formula (II), wherein this compound is used in combination with at least one fertilizer compound.
  • fertilizer compounds include NIPK. fertilizers containing nitrogen (N), phosphorus (P) and potassium (K), or salts or complexed forms of calcium (Ca), sulfur (S), magnesium ( g), boron (B), chlorine (CI), manganese (Mn), iron (Fe), zinc (Zn), copper (Cu), molybdenium (Mo) and selenium (Se).
  • N nitrogen
  • P phosphorus
  • K potassium
  • salts sulphates are especially preferred.
  • the compound of formula (1) is used for inducing latent host defenses in a plant which are activated in the event of an attack by a phytopathogenic pathogen or pest or in the event of abiotic stress.
  • the compound of formula (I) is used for inducing latent host defenses in a plant which are activated in the event of an attack by a phytopathogenic pathogen or pest.
  • the present invention further relates to above mentioned use of the compound of formula (1) or (II), wherein the pathogen is selected from the group consisting of phytopathogenic fungi, bacteria, viruses, viroids, mycoplas- ma-like organisms, protozoa, insects, acari, and nematodes.
  • the pathogen is selected from phytopathogenic fungi, bacteria, and insects.
  • pathogens are given under "attack by a phytopathogenic pathogen or pest" above.
  • Plants are to be understood here as meaning all plants and plant populations, such as wanted and unwanted wild plants or crop plants (including naturally occurring crop plants).
  • Crop plants can be plants which can be obtained by conventional breeding and optimization methods or by biotechnological and genetic engineering methods or combinations of these methods, including the transgenic plants and including plant cultivars which can or cannot be protected by varietal property rights.
  • Parts of plants are to be understood as meaning all above-ground and below-ground parts and organs of the plants, such as shoot, leaf, flower and root, examples which may be mentioned being leaves, needles, stems, trunks, flowers, fruit bodies, fruits and seeds and also roots, tubers and rhizomes.
  • Plant parts also include harvested material and vegetative and generative propagation material, for example seedlings, tubers, rhizomes, cuttings and seeds. Preference is given to the treatment of the plants and the above-ground and below-ground parts and organs of the plants, such as shoot, leaf, flower and root, examples which may be mentioned being leaves, needles, stems, trunks, flowers, fruits.
  • the following plants may be mentioned as plants which can be treated according to the invention: cotton, flax, grapevines, fruit, vegetable, such as Rosaceae sp. (for example pomaceous fruit, such as apples and pears, but also stone fruit, such as apricots, cherries, almonds and peaches and soft fruit such as strawberries), Ribesioidae sp.
  • Juglandaceae sp. Betulaceae sp. , Anacardiaceae sp. , Fagaceae sp. , Morace e sp., Oleaceae sp. , Ac- tinidaceae sp., Lauraceae sp. , Musaceae sp. (for example banana trees and plantations), R biaceae sp. (for example coffee), Theaceae sp. , Sterculiceae sp. , Rutaceae sp. (for example lemons, oranges and grapefruit), Sola- naceae sp. (for example tomatoes), Liliaceae sp.
  • Asieraceae sp. for example lettuce
  • Umbelliferae sp. Cru- ciferae sp., Chenopodiaceae sp.
  • Cucurbit aceae sp. for example cucumbers
  • Alliaceae sp. for example leek, onions
  • Papilionaceae sp. for example peas
  • major crop plants such as Gramineae sp. (for example maize, lawn, cereals such as wheat, rye, rice, barley, oats, millet and triticale), Poaceae sp. (for example sugarcane), Asieraceae sp. (for example sunflowers), Brassicaceae sp.
  • the present invention further relates to the above mentioned use of the compound of formula (I) or (II), wherein the plant is rice, banana, wheat, cucumber, or tea.
  • the present invention further relates to above mentioned use of the compound of formula (I) or (II), wherein the plant is a transgenic plant.
  • Genetically modified organisms are for example plants or seeds. Genetically modified plants are plants whose genome has, stably integrated, a certain heterologous gene coding for a certain protein.
  • ''heterologous gene is meant to be understood as a gene which confers novel agronomical properties on the transformed plant, or a gene which improves the agronomical quality of the modified plant.
  • plants and their parts are treated.
  • wild plant species and plant cultivars or those obtained by conventional biological breeding methods, such as crossing or protoplast fusion, and parts thereof, are treated.
  • transgenic plants and plant cultivars obtained by genetic engineering methods if appropriate in combination with conventional methods (genetically modified organisms), and parts thereof are treated.
  • the terms "parts”, “parts of plants” and “plant parts” have been explained above.
  • plants of the plant cultivars which are in each case commercially available or in use are treated according to the invention.
  • the preferred transgenic plants or plant cultivars which are to be treated ac- cording to the invention include all plants which, by virtue of the genetic modification, received genetic material - - which imparts particularly advantageous, useful traits to these plants. Examples of such traits are better plant growth, increased tolerance to high or low temperatures, increased tolerance to drought or to water or soil salt content, increased flowering performance, easier harvesting, accelerated maturation, higher harvest yields, higher quality and/or a higher nutritional value of the harvested products, better storage stability and/or pro- cessability of the harvested products.
  • transgenic plants which may be mentioned are the important crop plants, such as cereals (wheat, rice), maize, soya beans, potatoes, cotton, oilseed rape, and also fruit plants (with the fruits apples, pears, citrus fruits and grapes), and particular emphasis is given to maize, soya beans, potatoes, cotton, and oilseed rape.
  • Traits that are emphasized are in particular increased defenseof the plants against insects by virtue of toxins formed in the plants, in particular those formed in the plants by the genetic material from Bacillus thuringiensis (for example by the genes CrylA(a), CrylA(b), CrylA(c), CryllA, CrylllA, CryIIIB2, Cry9c Cry2Ab, Cry3 Bb and CrylF and also combinations thereof) (hereinbelow referred to as "Bt plants”).
  • trasits that are also particularly empha- sized are the increased tolerance of the plants to certain herbicidally active compounds, for example imidazoli- nones, sulphonylureas, glyphosate or phosphinotricin (for example the "PAT" gene).
  • herbicidally active compounds for example imidazoli- nones, sulphonylureas, glyphosate or phosphinotricin (for example the "PAT" gene).
  • PAT phosphinotricin
  • Bt plants are maize varieties, cotton varieties, soya bean varieties and potato varieties which are sold under the trade names YIELD GARD® (for example maize, cotton, soya beans), KnockOut ® (for example maize), StarLink ® (for example maize), Bollgard ® (cotton), Nucotn ® (cotton) and NewLeaf® (potatoes).
  • YIELD GARD® for example maize, cotton, soya beans
  • KnockOut ® for example maize
  • StarLink ® for example maize
  • Bollgard ® cotton
  • Nucotn ® cotton
  • NewLeaf® potatoes
  • herbicide-tolerant plants examples include maize varieties, cotton varieties and soya bean varieties which are sold under the trade names Roundup Ready ® (tolerance to glyphosate, for example maize, cotton, soya bean), Liberty Link ® (tolerance to phosphinotricin, for example oilseed rape), I I ® (tolerance to imidazolinones) and STS ® (tolerance to sulphonylureas, for example maize).
  • Herbicide-resistant plants plants bred in a conventional manner for herbicide tolerance
  • Clearfield® for example maize
  • the fungicides used according to the invention are generally applied in form of a composition comprising at least Isotianil or Tiadinil as mentioned above.
  • the fungicidal composition comprises agriculturally acceptable additives, solvents, carriers, surfactants, or extenders.
  • compositions comprising the active compound combinations according to the invention.
  • the compositions are fungicidal compositions comprising agriculturally suitable carriers or extenders.
  • carrier is to be understood as meaning a natural or synthetic, organic or inorganic substance which is mixed or combined with the active compounds for better applicability, in particular for ap- - - plication to plants or plant parts or seeds.
  • the carrier which may be solid or liquid, is generally inert and should be suitable for use in agriculture.
  • Suitable solid carriers are: for example ammonium salts and natural ground minerals, such as kaolins, clays, talc, chalk, quartz, attapulgite, montmorillonite or diatomaceous earth, and ground synthetic minerals, such as finely divided silica, alumina and natural or synthetic silicates, resins, waxes, solid fertilizers, water, alcohols, especially butanol, organic solvents, mineral oils and vegetable oils, and also derivatives thereof. It is also possible to use mixtures of such carriers.
  • natural ground minerals such as kaolins, clays, talc, chalk, quartz, attapulgite, montmorillonite or diatomaceous earth
  • ground synthetic minerals such as finely divided silica, alumina and natural or synthetic silicates, resins, waxes, solid fertilizers, water, alcohols, especially butanol, organic solvents, mineral oils and vegetable oils, and also derivatives thereof. It is also possible to use mixtures of such carriers.
  • Solid carriers suitable for granules are: for example crushed and fractionated natural minerals, such as calcite, marble, pumice, sepiolite, dolomite, and also synthetic granules of inorganic and organic meals and also granules of organic material, such as sawdust, coconut shells, maize cobs and tobacco stalks.
  • Suitable emulsifiers and/or foam-formers are: for example nonionic and anionic emulsifiers, such as polyoxyethylene fatty acid esters, polyoxyethylene fatty alcohol ethers, for example alkylaryl polyglycol ethers, alkylsulphonates, alkyl sulphates, arylsulphonates, and also protein hydrolysates.
  • Suitable dispersants are: for example lignosulphite waste liquors and methylcellulose.
  • Suitable liquefied gaseous extenders or carriers are liquids which are gaseous at ambient temperature and under atmospheric pressure, for example aerosol propellants, such as butane, propane, nitrogen and carbon dioxide.
  • Tackifiers such as carboxymethylcellulose and natural and synthetic polymers in the form of powders, granules and latices, such as gum arabic, polyvinyl alcohol, polyvinyl acetate, or else natural phospholipids, such as cephalins and lecithins and synthetic phospholipids can be used in the formulations.
  • Other possible additives are mineral and vegetable oils.
  • Suitable liquid solvents are essentially: aromatic compounds, such as xylene, toluene or alkylnaphthalenes, chlorinated aromatic compounds or chlorinated aliphatic hydrocarbons, such as chlorobenzenes, chloroethylenes or methylene chloride, aliphatic hydrocarbons, such as cyclohexane or paraffins, for example mineral oil fractions, mineral and vegetable oils, alcohols, such as butanol or glycol, and also ethers and esters thereof, ketones, such as acetone, methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone. strongly polar solvents, such as di- methylformamide and dimethyl sulphoxide, and also water.
  • aromatic compounds such as xylene, toluene or alkylnaphthalenes
  • chlorinated aromatic compounds or chlorinated aliphatic hydrocarbons such as chlorobenzenes, chloroethylenes or
  • compositions according to the invention may comprise additional further components, such as, for example, surfactants.
  • surfactants are emulsifiers, dispersants or wetting agents having ionic or nonionic properties, or mixtures of these surfactants. Examples of these are salts of polyacrylic acid, salts of lignosul- phonic acid, salts of phenolsulphonic acid or naphthalenesulphonic acid, polycondensates of ethylene oxide with fatty alcohols or with fatty acids or with fatty amines, substituted phenols (preferably alkylphenols or ar- ylphenols), salts of sulphosuccinic esters, taurine derivatives (preferably alkyl taurates), phosphoric esters of polyethoxylated alcohols or phenols, fatty esters of polyols, and derivatives of the compounds containing sulphates, sulphonates and phosphates.
  • the presence of a surfactant is required if one of the active compounds and/or one of the inert carriers is insoluble in water and when the application takes place in water.
  • the proportion of surfactants is between 5 and 40 per cent by weight of the composition according to the invention.
  • colorants such as inorganic pigments, for example iron oxide, titanium oxide, Prussian blue, and organic dyes, such as alizarin dyes, azo dyes and metal phthalocyanine dyes, and trace nutrients, such as salts of iron, manganese, boron, copper, cobalt, molybdenum and zinc.
  • inorganic pigments for example iron oxide, titanium oxide, Prussian blue
  • organic dyes such as alizarin dyes, azo dyes and metal phthalocyanine dyes
  • trace nutrients such as salts of iron, manganese, boron, copper, cobalt, molybdenum and zinc.
  • compositions according to the invention comprise between 0.05 and 99 per cent by weight of the active compound combination according to the invention, preferably between 10 and 70 per cent by weight, particularly preferably between 20 and 50 per cent by weight, most preferably 25 per cent by weight.
  • the active compound combinations or compositions according to the invention can be used as such or, depending on their respective physical and/or chemical properties, in the form of their formulations or the use forms prepared therefrom, such as aerosols, capsule suspensions, cold-fogging concentrates, warm-fogging concentrates, encapsulated granules, fine granules, flowable concentrates for the treatment of seed, ready-to-use solutions, dustable powders, emulsifiable concentrates, oil-in-water emulsions, water-in-oil emulsions, macrogranules, microgranules, oil- dispersible powders, oil-miscible flowable concentrates, oil-miscible liquids, foams, pastes, pesticide-coated seed, suspension concentrates, suspoemulsion concentrates, soluble concentrates, suspensions, wettable powders, soluble powders, dusts and granules, water-soluble granules or tablets, water-soluble powders for
  • the formulations mentioned can be prepared in a manner known per se, for example by mixing the active com- pounds or the active compound combinations with at least one additive.
  • Suitable additives are all customary formulation auxiliaries, such as, for example, organic solvents, extenders, solvents or diluents, solid carriers and fillers, surfactants (such as adjuvants, emulsifiers, dispersants, protective colloids, wetting agents and tackifiers), dis- persants and/or binders or fixatives, preservatives, dyes and pigments, defoamers, inorganic and organic thickeners, water repellents, if appropriate siccatives and UV stabilizers, gibberellins and also water and further processing auxiliaries.
  • further processing steps such as, for example, wet grinding, dry grinding or granulation may be required.
  • Organic diluents that may be present are all polar and non-polar organic solvents that are customarily used for such purposes.
  • ketones such as methyl isobutyl ketone and cyclohexanone
  • amides such as dimethylfoimamide and alkanecarboxamides, such as N.N-dimethyldecanamide and N,N-dimethyl- octanamide
  • furthermore cyclic compounds such as N-methylpyrrolidone, N-octylpyrrolidone, N-dodecyl- 2 pyrrolidone, N-octylcaprolactam, N-dodecylcaprolactam and butyrolactone
  • additionally strongly polar solvents such as dimethyl sulphoxide
  • aromatic hydrocarbons such as xylene, SolvessoTM
  • mineral oils such as white spirit, petroleum, alkylbenzenes and spindle oil, moreover esters, such
  • Solid carriers suitable for granules are: for example crushed and fractionated natural minerals, such as calcite, marble, pumice, sepiolite, dolomite, and also synthetic granules of inorganic and organic meals and also granules of organic material, such as sawdust, coconut shells, maize cobs and tobacco stalks.
  • Suitable surfactants are customary ionic and nonionic substances. Examples which may be mentioned are ethoxylated nonylphenols, polyalkylene glycol ethers of straight-chain or branched alcohols, products of reactions of alkylphenols with ethylene oxide and/or propylene oxide, products of reactions of fatty amines with ethylene oxide and/or propylene oxide, furthermore fatty esters, alkylsulphonates.
  • alky I sulphates alky I sulphates, alky I ether sulphates, alkyl ether phosphates, aryl sulphates, ethoxylated arylalkylphenols, such as, for example, tristyrylphenol ethoxylates, further- more ethoxylated and propoxylated arylalkylphenols and also sulphated or phosphated arylalkylphenol ethoxylates or ethoxy- and propoxylates.
  • Mention may furthermore be made of natural and synthetic water-soluble polymers, such as lignosulphonates, gelatine, gum arabic, phospholipids, starch, hydrophobically modified starch and cellulose derivatives, in particular cellulose esters and cellulose ethers, furthermore polyvinyl alcohol, polyvinyl acetate, polyvinylpyrrolidone, polyacrylic acid, polymethacrylic acid and copolymers of (meth)acrylic acid and (meth)acrylic acid esters, and moreover also alkali metal hydroxide-neutralized copoly ⁇ mers of methacrylic acid and methacrylic ester and condensates of optionally substituted naphthalenesulphonic acid salts with formaldehyde.
  • natural and synthetic water-soluble polymers such as lignosulphonates, gelatine, gum arabic, phospholipids, starch, hydrophobically modified starch and cellulose derivatives, in particular cellulose esters and cellulose ethers,
  • Suitable solid fillers and carriers are all substances customarily used for this purpose in crop pretection compositions.
  • Inorganic particles such as carbonates, silicates, sulphates and oxides having a mean particle size of from 0.005 to 20 pm, particularly preferably from 0.02 to 10 pm. may be mentioned as being preferred. Examples which may be mentioned are ammonium sulphate, ammonium phosphate, urea, calcium carbonate, calcium sulphate, magnesium sulphate, magnesium oxide, aluminium oxide, silicon dioxide, finely divided silicic acid, silica gels, natural and synthetic silicates and alumosilicates and vegetable products such as cereal meal, wood powder and cellulose powder.
  • Suitable colorants that may be present in the seed dressing formulations to be used according to the invention include all colorants customary for such purposes. Use may be made both of pigments, of sparing solubility in water, and of dyes, which are soluble in water. Examples that may be mentioned include the colorants known under the designations Rhodamin B, C.I. Pigment Red 1 12 and C.l. Solvent Red 1.
  • the colorants used can be inorganic pigments, for example iron oxide, titanium oxide, Prussian Blue, and organic dyes, such as alizarin, azo and metal phthalocyanine dyes, and trace nutrients, such as salts of iron, manganese, boron, copper, cobalt, molybdenum and zinc.
  • Suitable wetting agents that may be present in the seed dressing formulations to be used according to the invention include all substances which promote wetting and are customary in the formulation of agrochemical ly active compounds. Preference is given to using alkylnaphthalenesulphonates, such as diisopropyl- or diisobu- tylnaphthalenesulphonates.
  • Suitable dispersants and/or emulsifiers that may be present in the seed dressing formulations to be used according to the invention include all nonionic, anionic and cationic dispersants which are customary in the formulation of agrochemically active compounds. Preference is given to using nonionic or anionic dispersants or mixtures of nonionic or anionic dispersants.
  • nonionic dispersants are ethylene oxide/propylene oxide block polymers, alkylphenol polyglycol ethers, and also tristryrylphenol polyglycol ethers and their phos- phated or sulphated derivatives.
  • Particularly suitable anionic dispersants are lignosulphonates, polyacrylic acid salts and arylsulphonate/formaldehyde condensates.
  • Defoamers that may be present in the seed dressing formulations to be used according to the invention include all foam-inhibiting compounds which are customary in the formulation of agrochemically active compounds. Preference is given to using silicone defoamers, magnesium stearate, silicone emulsions, long-chain alcohols, fatty acids and their salts and also organofluorine compounds and mixtures thereof.
  • Preservatives that may be present in the seed dressing formulations to be used according to the invention include all compounds which can be used for such purposes in agrochemical compositions. By way of example, mention may be made of dichlorophen and benzyl alcohol hemiformal.
  • Secondary thickeners that may be present in the seed dressing formulations to be used according to the invention include all compounds which can be used for such purposes in agrochemical compositions. Preference is given to cellulose derivatives, acrylic acid derivatives, polysaccharides, such as xanthan gum or Veegum, modified clays, phyllosilicates, such as attapulgite and bentonite, and also finely divided silicic acids.
  • Suitable adhesives that may be present in the seed dressing formulations to be used according to the invention include all customary binders which can be used in seed dressings.
  • Polyvinylpyrrolidone, polyvinyl acetate, polyvinyl alcohol and tylose may be mentioned as being preferred.
  • the gibberellins are known (cf. R. Wegler "Chemie der convincedstoff- and Schad- lingsbekampfungsstoff" [Chemistry of Crop Protection Agents and Pesticides], Vol. 2, Springer Verlag, 1970. pp. 401 -412).
  • the formulations generally comprise between 0.1 and 95% by weight of active compound, preferably between 0.5 and 90%.
  • the active compound combinations according to the invention can be present in commercial formulations and in the use forms prepared from these formulations as a mixture with other active compounds, such as insecticides, attractants, sterilants. bactericides, acaricides, nematicides. fungicides, growth regulators or herbicides. A mixture with fertilizers is also possible.
  • the treatment according to the invention of the plants and plant parts with the active compound combinations or compositions is carried out directly or by action on their surroundings, habitat or storage space using customary treatment methods, for example by dipping, spraying, atomizing, irrigating, evaporating, dusting, fogging, broadcasting, foaming, painting, spreading-on, watering (drenching), drip irrigating and, in the case of propagation material, in particular in the case of seeds, furthermore as a powder for dry seed treatment, a solution for seed treatment, a water-soluble powder for slurry treatment, by incrusting, by coaling with one or more coats, etc.
  • Preference is given to application by dipping, spraying, atomizing, irrigating, evaporating, dusting, fogging, broadcasting, foaming, painting, spreading-on, watering (drenching) and drip irrigating.
  • Customary applications are, for example, dilution with water and spraying of the resulting spray liquor, application after dilution with oil, direct application without dilution, seed dressing or soil application of carrier granules.
  • the active compound content of the application fonns prepared from the commercial fonriuiations can vary within wide limits.
  • the active compound concentration of the application forms can be from 0.0000001 up to 95% by weight of active compound, preferably between 0.0001 and 2% by weight.
  • the compositions according to the invention do not only comprise ready-to-use compositions which can be applied with suitable apparatus to the plant or the seed, but also commercial concentrates which have to be diluted with water prior to use.
  • Gene expression profiling experiments were performed using an A ffymetrix array of the rice whole genome under two conditions, with and without pathogen challenge. Without pathogen pressure, three weeks-old rice seedlings were drenched in an Isotianil solution (20 mg/L, at a dose range corresponding to agronomical practices) and the gene expression profile was studied at two time points. Mock treated plants were used as control.
  • the first group of interesting genes codes for transcription factors involved in SA pathway. Up regulation of a NPR1 homolog gene, called NPR3 (or /V/73) was observed that is induced by 6 fold. OsWRKY45, another key regulator of induced resistance, is induced by 2.9 fold (PO.0017). Other tran- scription factors implicated in SA pathway are also up regulated: OsWRKY62, OsWRKY76 with a fold change . . of 18 and 6.5 respectively.
  • the second group of interesting genes is involved in SA catabolism such as OsSGTl coding for a SA glucosyltransferase, 13.4 fold induction, and OsBMSTl coding for a salicylate methyltransfer- ase, 7.1 fold induction (Table 2).
  • Isotianil and mock treated three weeks-old rice seedlings were challenged by fungal infection with P. oryzae four days post-treatment. Gene expression was analyzed over two time points: 1 and 2 days post-inoculation (dpi). The same statistical test as described above was used to select differentially regulated genes. Results show that the number of differentially expressed genes in infected mock treated plants, that are susceptible, is very low at these time points.
  • PR genes are implicated in diverse cellular functions and most of them are related to responses to stress and defense responses. Indeed, typical markers of SAR have been identified.
  • a set of 17 PR genes is up regulated, including PR] a, PBZ, PR genes involved in antifungal activities such as chitinase and beta-glucanase (Table 3).
  • PR genes are increased in comparison with non-treated plants. Some display a stronger induction while for other genes induction occurs only upon priming.
  • Defense associated cellular processes were also studied such as the expression level of phenylalanine ammonia-lyase (/ Z,)-encoding genes, a key enzyme in the phenylpropanoid pathways leading to defense related secondary metabolites (e.g. phytoalexins, lignin like polymers); of chalcone synthase and of chalcone isomerase, two genes involved in the phytoalexins biosynthetic pathway.
  • phenylalanine ammonia-lyase (/ Z,)-encoding genes a key enzyme in the phenylpropanoid pathways leading to defense related secondary metabolites (e.g. phytoalexins, lignin like polymers); of chalcone synthase and of chalcone isomerase, two genes involved in the phytoalexins biosynthetic pathway.
  • Isotianil represents a novel type of defense inducer that works by priming plant's intrinsic disease resistance mechanisms. According to these first results, Isotianil mode of action would involve the SA pathway. - -
  • OsWRKY45, OsWRKY62, OsWRKY70 and OsWRKY76 which are activated by SA and by incompatible interaction between P. oryzae and rice (Y. Song, A. C-R., S.-J. Jing, Y. D-Q., in Rice Science. (2010), vol. 17, pp. 60-72 H.-S. Ryu el al. , in Plant Cell Rep. (2006), vol. 25, pp. 836-847), are also strongly induced in Isotianil primed plants.
  • NPR1 homolog gene NPR1 homolog gene (NPR3) is also induced by Isotianil.
  • Isotianil- primed plants also display a potentiated SA R response upon infection, including enhanced activation of PR genes and of genes involved in secondary metabolisms such as phenylpropanoid and flavonoid pathways. Finally, Isotianil induces up regulation of key players involved in signal transduction that were suggested to be part of the priming phenomenon that also occurs in induced resistance.
  • Example B
  • Table 4 Number of differentially expressed genes (down- or up regulated by at least a factor of 2) during time course of fungal infection with Pyriculaha in Isotianil primed 3 weeks-old rice seedlings compared to mock treated and Probenazole treated seedlings. Concentration of Isotianil and Probenazole: 20 mg/L. hpi: hours post- inoculation, p ⁇ 0.001
  • Table 5 Genes down-regulated 24 hpi after pre-treatment with Isotianil or Probenazole (20 mg/L).
  • Example D Confirmation of isotianil-priming of plant defense gene using RT-qPCR.
  • Real-time PCR was then performed using SYBR Green Mix and specific primers listed in Table 7. Gene expression level was normalized to actin (used as internal control). Data are expressed as fold change relative to calibrator samples, which are untreated and non infected control plants at the two time points, 4 dpt and 2 dpi, according to the condition studied.
  • CHTb PR3 /basic chitinase GAGCTCGCCGCTTTCTTTG CAGTTGCCCATCCACCTGTA
  • Os07g03730.1 PR1a TGAGATCGATTAGTCCTTTTCTTTGTT GCCGTGCGTATAGCCATTTC
  • Gene induction fold change compared to control untreated and non infected plants at 4 dpt and at 2 dpi.
  • A genes involved in rice SA signaling pathway
  • B genes involved in rice defense responses.
  • genes involved in the SA signalling pathway were over-expressed by at least a factor of 2, confirming previous data obtained with A ffymetrix microarrays. Upon infection those genes were strongly induced compared to control plants, corresponding to infection alone.
  • Example E Gene expression changes induced by different application doses of isotianil and probenazole upon infection with P. oryzae.
  • Three week old seedlings are treated with Isotianil or probenazole by drenching at doses ranging from 12 mg/L to 50 mg/L for isotianil and from 12 mg/L to 200 mg/L for probenazole (in 1 % acetone, 0. 1 % Tween 20 solution).
  • Four days after treatment rice seedlings are inoculated with P. oryzae as described previously.
  • Two days post-inoculation (2 dpi) samples are harvested.
  • the three biological replicates were subjected to RT-qPCR analysis. The same RT-qPCR procedure as the one described previously was used. Data are presented as fold change in gene expression in treated infected plants relative to untreated infected plants.
  • RT-q PCR anal s is of the isotianil and PBZ responsive genes upon infection accord ing to dose application. Data are expressed as fold change vs untreated infected plants.
  • Isotianil and probenazole biological efficiency against rice blast was evaluated using a dose range from 2.5 mg/L to 40 mg/L. Isotianil already showed an efficiency of up to 85% at the lowest dose tested, 2.5 mg/L, while probenazole showed a significant weaker efficiency (Fig. 5). Isotianil and probenazole showed similar efficiency at 20 mg/L, the dose used for microarray experiments. See Fig. 2.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Dentistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Environmental Sciences (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Cultivation Of Plants (AREA)

Abstract

The present invention relates to the novel use of Isotianil or Tiadinil for inducing latent host defenses in a plant. In particular, the present invention relates the use of Isotianil or Tiadinil for inducing latent host defenses that are activated in the event of an attack by a phytopathogenic pathogen or pestor or of abiotic stress. The invention further relates to the induction of latent host defenses in a plant which comprises the priming of the intrinsic disease resistance mechanisms of a plant.

Description

Use of Isothiazolecarboxamides to create latent host defenses in a plant
The present invention relates to the novel use of an isothiazolecarboxamide of the formula (1)
(common name: Isotianil) a thiadiazolecarboxamide of the formula (II)
(common name: Tiadinil) for inducing latent host defenses in a plant.
According to a further embodiment the present invention relates to the above mentioned use of the compound of formula (1) or (11), wherein the latent host defenses in a plant are activated in the event of an attack by a phy- topathogenic pathogen or pest.
The present invention further relates to the above mentioned use of the compound of formula (1) or (II), wherein the latent host defenses in a plant are activated in the event of abiotic stress.
According to a further embodiment, the present application relates to the above mentioned use of the compound of formula (I) or (II), wherein the abiotic stress is induced by high to low zinc deficiency.
Moreover, the invention relates to the above mentioned use of the compound of formula (I) or (11). wherein the inducing of latent host defenses in a plant comprises the priming of the intrinsic disease resistance mechanisms of a plant. As synonym for "intrinsic disease resistance mechanisms of a plant", the term "plant immune response" can also be used. In the natural environment, defense reactions of plants are induced by various factors e.g. microorganisms, ectoparasites, or abiotic stresses like wind or heat. Numerous species of bacteria, fungi, pathogen-derived molecules, cell-wall components of fungi, peptides or plant extracts are commercialized as biological or natural control agents for crop diseases. Some of them (B. W. M. Verhagen et al.. in ol Plant Microbe Interact. (2004), vol. 17, pp. 895-908; H. Takahashi et al., in Phytopathology. (2006), vol. 96, pp. 908-916) were proved to in- - - duce systemic acquired resistance (SA R) in plants, similar to the synthetic chemical inducers. The present invention relates to synthetic chemicals defined as host plant defense inducers by FRAC classification (FRAC website http://www/frac.info/), in particular to the subgroup P3 including Isotianil and Tiadinil. Host plant defense inducers as defined by FRAC classification are practically well established as major countermeasures for specific diseases in particular rice blast in Northeast Asia.
It is assumed that all plants have the intrinsic capacity to defend themselves against pathogen attacks. Plants can be induced to deploy enhanced defenses and this can be triggered by various stimuli such as biotic and abiotic stress, beneficial micro-organisms and chemicals. Induced resistance is often a systemic response with long lasting effects that confers a broad spectrum of resistance. It is regulated by a network of signaling pathways which involve endogenous phytohormones: salicylic acid (SA), jasmonic acid (J A) (figure 1 ) and ethylene.
Salicylic acid Jasmonic acid
Phytohormones
According to the inducing agent and the subsequent molecular mechanism, two major types of induced resistance are differentiated: SAR and Induced Systemic Resistance (ISR). SAR is induced by a limited primary infection by a necrotizing pathogen. ISR is induced by non pathogenic organisms that colonize roots. SAR depends on SA, while ISR requires jasmonic acid and ethylene, but not SA. Both, SAR and ISR, confer an enhanced defense capacity. Upon pathogen attack, defense response occurs earlier and is stronger, leading to a broader resistance spectrum (Hammerschmidt, R. Advances in Botanical Research 2009, 5 1. 1 73-222). It is admitted that SAR is most efficient against biotrophic and hemibiotrophic pathogens and leads to the expression of Pa- thogenesis Related (PR) genes (L. C. van Loon, . Rep, C. M. J. Pieterse, in Annu Rev Phytopathol. (2006), vol. 44, pp. 135- 162), whereas necrotrophic pathogens (pathogens that obtain their nutrients from dead cells and tissues of its host organism) are usually controlled by ISR. As previously mentioned, chemicals can also induce resistance. The compounds used in the present invention are SAR inducers.
Transcription factors differentially regulate a number of genes involved in defense ultimately leading to the pro- duction of defense proteins. The first proteins associated with SAR that were discovered are PR proteins. They are classified in 1 7 families. Many are extra-cellular and have an antimicrobial activity, supporting the idea of a "direct" role in defense. Induction of PR genes is part of the defense response, activation of additional defenses is necessary to stop pathogen development. A complex array of antimicrobial processes is activated that includes strengthening of plant cell wall by callose and hydroxyproline-rich glycoproteins depositions and, accu- mulation of peroxides (SAR biochemical changes).
Despite the fact that SAR has been extensively studied in various species, the identity of the systemic signal that triggers the defense response is still unknown. In dicots such as Arabidopsis and tobacco, the onset of SAR is associated with accumulation of SA (C. Garcion, J.-P. Metraux, in Annual Plant Reviews. (2006), vol. 24, pp. 229-255). Exogenous application of SA, or functional analogs, induces SA R. Nevertheless studies involving transgenic plants with reduced level of SA suggested that SA is not the mobile signal but is rather required in distant tissues for the establishment of SAR (J. E. Parker, in Science Signaling. (2009), vol. 2, pp. 1 -3). Other putative candidates have been proposed such as Methyl Salicylate ( eSA), lipid derived signals including JA and more recently azelaic acid (S.-W. Park, E. aimoyo, D. Kumar, S. Mosher, D. F. Klessig, in Science.
(2007) , vol. 318, pp. 1 13- 1 16; L. Katsir, H. S. Chung, A. J. K. oo, G. A. Howe, in Curr Opin Plant Biol.
(2008) , vol. 1 1 , pp. 428-435; H. W. Jung, T. J. Tschaplinski, L. Wang, J. Glazebrook, J. T. Greenberg, in Sci- ence. (2009), vol. 324, pp. 89-91 ).
In rice, in contrast to dicots and other monocots, the role of SA in SA R remains unclear. Rice contains already high levels of SA and no further accumulation is observed with disease resistance (P. Silverman el al. , in Plant Physiol. (1995), vol. 108, pp. 633-639). In addition, depletion of endogenous SA in transgenic rice does not measurably effect defense gene expression (Y. Yang, M. Qi, C. Mei, in Plant J. (2004), vol. 40, pp. 909-919). Analysis of an Arabidopsis mutant non-responsive to SA led to the discovery of a key regulator of SAR, called NPRl (Non-Expressor of Pathogenesis Related genes). NPRl is essential for transducing the SA signal and to activate PR gene expression (X. Dong, in Curr. Opin. Plant Biol. (2004), vol. 7, pp. 547-552; M. Grant. C. Lamb, in Curr. Opin. Plant Biol. (2006), vol. 9, pp. 414^120). Upon cellular redox changes induced by SA, NPRl migrates from the cytoplasm to the nucleus. There, it interacts with a BZIP transcription factor and acti- vates defense genes (Z. Mou, W. Fan, X. Dong, in Cell. (2003), vol. 1 13, pp. 935-944). In addition, SA, as well as pathogen infection, also leads to the enhanced expression of NPRl gene (H. Cao, J. Glazebrook, J. D. Clarke, S. Volko, X. Dong, in Cell. ( 1997), vol. 88, pp. 57-63; J. Ryals et al. , in Plant Cell. (1997), vol. 9, pp. 425-439). Recently, a global transcriptional approach was used to identify genes involved in the very early responses to SA (F. Blanco et al. , in Plant Mol Biol. (2009), vol. 70, pp. 79- 102). In rice, the monocot model to investigate the molecular mechanisms of induced resistance, a SA NPR1- dependent signaling pathway has also been characterized (M. S. Chern et al.. in Plant ./. (2001 ), vol. 27, pp. 101 -1 13; M. Chern, H. A. Fitzgerald, P. E. Canlas, D. A . Navarre, P. C. Ronald, in Mol Plant Microbe Interact. (2005), vol. 18, pp. 51 1 -520). This suggests that at least some defense signaling components are conserved between dicots and monocots. Furthermore, over-expression of the Arabidopsis NPRl gene in rice (J. Quilis, G. Penas, J. Messeguer, C. Brugidou, B. S. Segundo, in Mol Plant Microbe Interact. (2008), vol. 21 , pp. 1215- 1231 ) results in enhanced resistance against bacterial and fungal pathogens, as it does in Arabidopsis (H. Cao, X. Li, X. Dong, in Proc Natl Acad Sci U S A. ( 1998). vol. 95, pp. 653 1 -6536), tomato (W. C. Lin et al. , in Transgenic Res. (2004), vol. 13, pp. 567-581 ) and wheat (R. Makandar, J . S. Essig, M. A. Schapaugh, H. N. Trick, J. Shah, in Mol Plant Microbe Interact. (2006), vol. 19, pp. 1 23- 1 29). In rice, the transcription factor OsWRKY45 plays an essential role in induced resistance (M. Shimono et al. , in The Plant Cell. (American Society of Plant Biologists, 2007), vol. 19, pp. pp. 2064-2076; H. Takatsuji, C.-J. Jiang, S. Sugano, in JARQ. (2010), vol. 44, pp. 217-223). This pathway is independent of NPR l but participates actively to blast resistance - - as shown by knockdown experiments. No counterpart o\' OsWRKY45 has yet been found in Arabidopsis, but its over-expression in Arabidopsis increases resistance to bacterial pathogen (Y. Qiu, D. Yu, in Environ. Exp. Bot. (2009), vol. 65, pp. 35-47).
In SA expressing plants, defense is more rapid and/or efficient upon pathogen challenge. This phenomenon, known as priming, exists not only for SAR but also for other forms of induced resistance (U. Conrath et ai , in Mol.Plant Microbe Interact. (2006), vol. 19, pp. 1062-1071 ). Investigation on priming effect in parsley cells shows that chemicals or elicitors at low doses do not induce directly expression of phenylalanine ammonia- lysae (PAL) defense related gene. However in these cells, PAL gene is more robustly expressed after a challenge (U. Conrath, C. M. J. Pieterse, B. Mauch-Mani, in Trends Plant Set. (2002), vol. 7, pp. 210-216). Similar- ly in intact plants, low level of SA primed the plant for a potentiated expression of PR] and PAL genes, which becomes only visible after pathogen attack. In addition, it was shown that NPR1 is essential for priming in Arabidopsis (A. Kohler, S. Schwindling, U. Conrath, in Plant Physiol. (2002), vol. 128, pp. 1046- 1056).
Nevertheless, the exact molecular mechanisms of priming are not clearly understood. Enhancement of signaling pathway, accumulation of post-translational modifications and of crucial transcription factors could be important for the priming effect (K. Goellner, U. Conrath, in Eur. J. Plant Pathol. (2008), vol. 121 , pp. 233-242). Indeed accumulation of two mitogen-activated protein kinases MAPKJ and AP 6, involved in signaling, was recently reported in primed Arabidopsis plants (G. J. . Beckers et ai, in Plant Cell. (2009), vol. 21 , pp. 944-953).
Probenazole (figure 2) was the first synthetic chemical host plant defense inducer introduced on the market to control fungal blast disease and bacterial blight in rice.
Probenazole
In rice, induction of PR genes, for instance PBZ1 and O PRla, as been reported upon Probenazole treatment (T. Iwai, S. Seo, I. itsuhara, Y. Ohashi. in Plant Cell Physiol. (2007). vol. 48, pp. 91 5-924). PBZ1 (for Probenazole inducible), a PR10 related gene, was discovered first by screening genes responding to Probenazole. It represents a useful marker for SA R in rice. Besides PR genes, other genes involved in signal transduction pathways such as kinase and the RPR1 (Rice Probenazole Responsive) gene coding for a disease resistant like protein are also activated and upon infection, enhanced activity in the phenylpropanoid metabolism is also observed (M. Iwata, in Pesticide Outlook. (2001 ), vol. 12, pp. 28-3 1 ).
In dicots it is believed that Probenazole induces defense responses through the SA signaling pathway (K. Yo- shioka, H. Nakashita, D. F. lessig, I. Yamaguchi, in Plant . (2001 ), vol. 25, pp. 149-157; . Umemura et ai . - - in Plant J. (2009), vol. 57, pp. 463-472). It was shown that level of total SA (free SA and salicylic acid gluco- side, SAG) is significantly increased by Probenazole treatment. Moreover, Probenazole and its active metabolite, BIT, require SA accumulation to induce SAR in Arabidopsis and tobacco, as well as a functional NPR1 gene (K. Yoshioka, H. Nakashita, D. F. Klessig, I. Yamaguchi, in Plant ./. (2001 ), vol. 25, pp. 149- 157. H. Nakashita et ai , in Physiol. Mol. Plant Pathol. (2002), vol. 61 , pp. 197-203). Indeed, both compounds are ineffective in NahG transgenic plants that are unable to accumulate SAR. In addition those compounds do not involve JA and ethylene pathways. Thus Probenazole is believed to act upstream SA unlike acibenzolar-S-methyl and Tiadinil (see below).
On the contrary, in rice, SAR is independent of SA accumulation and the exact role of SA remains unclear. Nevertheless, it was reported SA accumulation in adult rice plants upon Probenazole treatment (T. Iwai, S. Seo, I. Mitsuhara, Y. Ohashi, in Plant Cell Physiol. (2007), vol. 48, pp. 915-924). Moreover, other authors recently reported that a salicylic acid glucosyltransferase, OsSGTl, which converts free SA to the glycoside form, could contribute actively to Probenazole induced resistance (K. Umemura et ai , in Plant J. (2009), vol. 57, pp. 463- 472). They found that Probenazole induces a SAG accumulation that is correlated with the activation of OsSGTl gene. Furthermore, OsSGTl knockdown mutant show impaired capacity to develop Probenazole induced resistance against blast disease.
Acibenzolar-S-methyl (ASM) (Figure 3) induces a broad resistance spectrum on an extended diversity of dicots and monocots. In clear contrast to other chemical host defense inducers, ASM is not mainly used in rice but more in dicot crops.
Acibenzolar-S-methyl
It was recently reported that transformation of ASM by methyl esterase (SABP2) is required to induce a full SAR response (D. Tripathi, Y.-L. Jiang, D. Kumar, in FEBS Lett. vol. 584, pp. 3458-3463). At the molecular level, ASM induces the same characteristic set of SAR genes as does biological or SA induction (Friedrich et al. 1996). ASM directly activates PR-1 gene, primes the plants for stronger PAL gene induction and improves cal- lose deposition (A. Kohler, S. Schwindling, U. Conrath. in Plant Physiol. (2002), vol. 1 28, pp. 1046- 1056). Different studies on rice reported that ASM induces divers components of the defense signalling cascade such as OsBIMK2 coding for a MAP kinase (F. Song, R. M. Goodman, in Plant a. (2002), vol. 215, pp. 997- 1005), OsBIANKl encoding a plasma membrane anchored protein (X. Zhang et al, in Mol Biol Rep. (2010), vol. 37. pp. 653-660), OsBlSERKl encoding a protein belonging to Somatic Embryogenesis Receptor Kinase (SERK) (D. Song, G. Li, F. Song, Z. Zheng, in Mol Biol Rep. (2008), vol. 35, pp. 275-283). In dicots, ASM induces SAR without accumulation of SA (L. Friedrich et ai , in Plant J. ( 1996), vol. 10, pp. 61 -70). Moreover, its action does not require SA accumulation since ASM induces SAR in transgenic NahG plants. However ASM ne- g . cessitates functional NPR1 gene as SA does ( . A. Lawton et al. , in Plant J. (2006), vol. 10, pp. 71 -82). This is further confirmed by transcriptional profiling, which showed that almost all ASM-responsive genes are NPR 1 dependent (D. Wang, N. Amornsiripanitch, X. Dong, in PLoS Palhog. (2006), vol. 2, pp. el23). Therefore. ASM is considered as a functional analogue of SA and suggest that it could act at the same site. In rice, induced resistance by ASM requires the two transcriptional regulators, NPR1 and the rice-specific OsWRY45 (H. Takatsuji, C.-J. Jiang, S. Sugano, m JARQ. (2010). vol. 44. pp. 217-223). Contrary to Arabidopsis, it was shown that only a subset of ASM-responsive genes is Os/VYW-dependent in rice (S. Sugano et al., in To be published in Plant Mol Biol). While all of ASM up regulated genes, categorized under defense response, are ATO/-dependent in Arabidopsis, only 5.9% of them are Ck V W -dependent in rice. Expression of PRla and PRlb is controlled by OsNPRl whereas glutathione-S-transferase (GST) and cytochrome P450 genes are regulated by OsWRK45. Thus, ASM induced resistance in rice would depend on two complementary pathways, NPR1 and OsWRKY45, the latest being crucial for blast resistance, induced not only by ASM but also by Tiadinil and Probenazole.
Tiadinil was developed to control rice fungal blast and bacterial diseases. Tiadinil treatment in rice induces the expression of PR genes such as PBZ1 and leads to callose deposition upon infection (T. Hirooka, . Umetani, in Agrochem Jpn. (2004), vol. 85, pp. 12- 15). The mode of action of Tiadinil and of its active metabolite (SV- 03) has been mostly studied in tobacco and Arabidopsis. There, both compounds induce resistance to a broad spectrum of pathogens as well as expression of SAR marker genes (M. Yasuda, in J. Pestic. Sci. (Tokyo, Jpn.). (2007), vol. 32, pp. 281 -282). Like ASM, Tiadinil and SV-03 are able to induce resistance in NahG plants but require a functional NPR1 (4 M. Yasuda, in J. Pestic. Sci. (Tokyo. Jpn.). (2007), vol. 32, pp. 281 -2827). Using JA-insensitive and ethylene-insensitive mutants, it was also shown that these compounds act independently of the JA and ethylene pathways. Therefore, Tiadinil and SV-03 induce plant defense responses via the SA signaling pathway, at a site between SA and NPR1.
Isotianil is a new plant defense inducer that controls for example leaf blast and bacterial leaf blight in rice. Iso- tianil does not exhibit by itself an activity against pathogens but protects plants against infection when applied at an early developmental stage. Therefore it is readily accepted in above countries where prophylactic rice blast control methods e.g. nursery box application, water surface application, seed treatment, etc. are well established by melanin biosynthesis inhibitors and Probenazole. Although its practical use is so far limited in rice, Isotianil demonstrates broader control spectrum as a host defense inducer in various plants. The disease control spectrum is basically similar to Probenazole and Tiadinil, which covers typical biotrophic pathogens like Pyricularia. powdery mildews, Xanthomonas and some leaf spot diseases but generally negative for necrotrophic pathogens.
According to a study by Meiji Seika Kaisha, Ltd, (http://www.meiji.co.jp/agriculture/lecture/ pdf/activator_l 2.pdf), many gene expressions were changed by resistance inducers. 150 hours after treatment, without inoculation: 2.1 % ( 1.7%) by Probenazole, 1.8% (0.9%) by Tiadinil and 1 .8% (0.9%) by Isotianil of genes were activated (deactivat- ed). No data were shown in this study for time points earlier than 150 hours after treatment. As outlined above, both Isotianil and Tiadinil are known as host defense inducers. Surprisingly, it has now been found that Isotianil and Tiadinil induce latent host defenses.
The term "latent host defenses" according to the present invention signifies that the compounds used according to the invention prime the intrinsic disease resistance mechanisms of a plant. Surprisingly, it has now been found that only a few genes are activated when a plant is treated with Isotianil or Tiadinil when no inoculation with a phytopathogenic pathogen or pest or by abiotic stress follows the treatment (data shown in Example A, Table 2). Preferred genes activated by treatment with Isotianil (without inoculation, measured 4 days post treatment, dpt) are a NPR1 homolog gene, called NPR3 (or NH3), induced 6-fold over control, OsWRKY62, OsWRKY76 with a fold change of 1 8 and 6.5 respectively, OsSGTl coding for a SA glucosyltransferase, 13.4 fold induction, and OsBMSTl coding for a salicylate methyltransferase, 7. 1 fold induction. Further preferred are genes coding for Jacalin (25.9 fold induction) and Terpene synthase/cyclase family protein (26.8 and 47.1 fold induction) (Table 2).
Examples for genes specifically induced by Probenazole, (4 days post treatment, without inoculation) that are not induced by Isotianil are shown in Table 1 : Table 1. Genes specifically induced by PBZ, 4 days post-treatment (without inoculation)
The priming causes a plant to activate its intrinsic disease resistance mechanisms, including the intrinsic defense mechanisms against abiotic stress, in a stronger and faster way upon an attack by a phytopathogenic pathogen or pest or abiotic stress and ensures that the intrinsic disease resistance mechanisms are activated in time for pro- tection. The use of the compounds of formula (I) or (II) according to the invention effectively creates an early warning system so the plant produces naturally occurring disease resistance mechanisms in time to avoid that infections can get a head start.
According to a preferred embodiment of the invention, the priming of the intrinsic disease resistance mecha- nisms of a plant by treatment of the plant with a compound of formula (I) or (II) is observed for at least 4 days, preferably at least 5 days, more preferably at least 6 days, also preferably for at least 7, 8, 9, 10, 1 1 , 12, 13, 14, or 15 days after treatment with the compound of formula (I) or (I I). According to a further embodiment of the invention, the priming of the intrinsic disease resistance mechanisms of a plant by treatment of the plant with a compound of formula (I) or (II) is observed for at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140 or 150 days after treatment with the compound of formula (I) or (II). This means that at the indicated times after treatment with the compound of formula (I) or (II), the induction of the expression of plant defense genes is stronger and faster in the event of an attack by a phytopathogenic pathogen or pest or of abiotic stress, as compared to control or other plant defense inducers.
According to the present invention, the most relevant plant defense genes include (see also Example C, Table 6, expression pattern of defense genes during infection in control plants and in plants pre-treated with Isotianil or Probenazole):
LOC_Os03g46440.1 NPR 1 homolog
LOC_Os05g25770.1 OsWR Y45
LOC_Os09g25070.1 OsWRKY62
LOC_Os09g25060.1 OsWRKY76
LOC_Os09g34230.1 SA : OsSGT l
LOC_Os09g34250.1 SA : OsSGT l
According to yet another embodiment of the present invention, the intrinsic disease resistance mechanisms of a plant are primed by treatment of the plant with a compound of formula (I) or (II) for more than one time, such as 2 times, 3 times, 4 times, 5 times or 6 times. The time interval between two treatments can be chosen according to the agronomical needs.
The term "priming of the intrinsic disease resistance mechanisms of a plant" within the meaning of the present invention signifies that the compounds of fonnula (I) or (I I) used in the present invention induce only few changes in gene expression in the absence of pathogen pressure (see Example A, Table 2, and above). These genes directly responsive to the compounds of fonnula (I) or (II) are involved in salicylic acid catabolism and pathway. In the event of an attack by a phytopathogenic pathogen or pest or of abiotic stress, the compounds of formula (I) or (II) prime plants, in particular rice plants, for stronger and faster induction of defense genes as compared to control (simple infection) and also as compared to other plant defense inducers such as Probena- zole (PBZ). The onset of resistance is accompanied by the induction of the expression of genes of the SA signalling pathway leading to a typical SAR response.
The disease resistance mechanisms arc only activated in the event of an attack by a phytopathogenic pathogen or pest or abiotic stress. This means that the use of the compounds according to the present invention plant does not cause a plant to waste energy in useless defensive processes in a non-attack situation. The invention thus further relates to the above mentioned use of the compound of formula (I) or (II), wherein the inducing of latent host defenses in a plant maintains the strong growth and vitality of the plant.
The term "maintaining strong growth and vitality of the plant" within the meaning of the present invention signifies that the treatment of plants with the compounds of formula (I) or (I I), in the absence of an attack by a phy- topathogenic pathogen or pest, does not impair the growth or vitality of the plant, as characterized for example by production yield, or leaf sizes or weight. Further examples related to growth or vitality of a plant are emergence, crop yields, more developed root system, tillering increase, increase in plant height, bigger leaf blade, less dead basal leaves, stronger tillers, greener leaf color, less fertilizers needed, less seeds needed, more productive tillers, earlier flowering, early grain maturity, less plant verse (lodging), increased shoot growth, im- proved plant vigor, and early germination; or any other features familiar to a person skilled in the art. "Maintaining strong growth and vitality of the plant" can further be described with the terms health promoting, plant health care support, or invigorating.
According to yet another embodiment, the invention relates to the above mentioned use of the compound of formula (I) or (II), wherein the inducing of latent host defenses in a plant results in a stronger and faster induction of the expression of plant defense genes in the event of an attack by a phytopathogenic pathogen or pest or of abiotic stress, as compared to control or other plant defense inducers. According to a preferred embodiment, the invention relates to the above mentioned use of the compound of formula (I) or (II), wherein the inducing of latent host defenses in a plant results in a stronger and faster induction of the expression of plant defense genes in the event of an attack by a phytopathogenic pathogen or pest, as compared to control or other plant defense inducers.
Within the meaning of the invention, the term "control" signifies plants that are inoculated with the same pathogen or the same abiotic stress factor(s) as the plants treated with the compounds of formula (I) or (II) but without prior treatment with a compound of formula (I) or (II). This is also called "mock treatment".
In a further embodiment of the present invention the above mentioned use of the compound of formula (I) or (II) is characterized in that the plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest or of abiotic stress are expressed at least two fold stronger as compared to control. In a preferred embodiment of the present invention the above mentioned use of the compound of formula (I) or (II) is characterized in that the plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest are expressed at least two fold stronger as compared to control. According to another embodiment of the present invention, the at least two fold stronger expression of plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest can be observed 24 or 48 hours, preferably 24 hours, after an attack by a phytopathogenic pathogen or pest. According to another embodiment of the present invention, the at least two fold stronger expression of plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest can be observed 48 hours after an attack by a phyto- pathogenic pathogen or pest. . _
The term "stronger and faster induction of the expression of plant defense genes as compared to control or other plant defense inducers" within the meaning of the present invention signifies that the degree of induction of the expression of plant defense genes is higher and that the induction occurs at an earlier time point as compared to control or other plant defense inducers. A higher degree of induction of expression is defined as an at least two-fold, preferably an at least 3-fold, 4- fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 12-fold, or 15-fold up regulation of plant defense genes.
The induction of the expression of plant defense genes at an earlier time point is defined as an at least 2-fold induction of the expression of plant defense genes that can be observed 24 or 48 hours after an attack by a phyto- pathogenic pathogen or pest, preferably 24 hours after an attack by a phytopathogenic pathogen or pest, also preferably 48 hours after an attack by a phytopathogenic pathogen or pest. According to a further embodiment of the present invention, the at least two fold stronger expression of plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest can be observed 72 or 96 hours after an attack by a phytopathogenic pathogen or pest. According to a further embodiment of the present invention, the at least two fold stronger expression of plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest can be observed at least twice as fast as compared to control or other host defense inducers such as pro- benazole.
The invention also relates to the above mentioned use of the compound of formula (I) or (II), wherein the plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest or of abiotic stress comprise genes of the SA signalling pathway and of the SAR response. According to a preferred embodiment, the invention relates to the above mentioned use of the compound of formula (1) or (II), wherein the plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest comprise genes of the SA signalling pathway which are selected from the group consisting of WR Y, NPR 1 , NPR3. and SGT1 and SAR genes which are selected from the group of PR genes and genes involved in the phenylpropanoid pathway.
The term "attack by a phytopathogenic pathogen or pest" according to the present invention signifies the attack or infestation of a plant with phytopathogenic fungi, bacteria, viruses, viroids, mycoplasma-like organisms, protozoa, insects, acari or nematodes.
Some pathogens of fungal diseases which can be treated according to the invention may be mentioned by way of example, but not by way of limitation:
Diseases caused by powdery mildew pathogens, such as, for example, Blumeria species, such as, for example, Blumeria graminis; Podosphaera species, such as, for example, Podosphaera leucotricha; Sphaerotheca species, such as, for example, Sphaerotheca fuliginea; Uncinula species, such as, for example, Uncinula necator;
Diseases caused by rust disease pathogens, such as, for example, Gymnosporangium species, such as, for example, Gymnosporangium sabinae; Hemileia species, such as, for example, Hemileia vastatrix; Phakopsora species, such as, for example, Phakopsora pachyrhizi and Phakopsora meibomiae; Puccinia species, such as, for . . example, Puccinia recondita or Puccinia triticina; Uromyccs species, such as, for example, Uromyces appendicular;
Diseases caused by pathogens from the group of the Oomycetes, such as, for example, Bremia species, such as, for example, Bremia lactucae; Peronospora species, such as. for example, Peronospora pisi or P. brassicae; Phy- tophthora species, such as, for example Phytophthora infestans; Plasmopara species, such as, for example, Plasmopara viticola; Pseudoperonospora species, such as, for example, Pseudoperonospora humuli or Pseu- doperonospora cubensis; Pythium species, such as, for example, Pythium ultimum;
Leaf blotch diseases and leaf wilt diseases caused, for example, by Altemaria species, such as, for example, Al- ternaria solani; Cercospora species, such as, for example, Cercospora beticola; Cladiosporium species, such as, for example, Cladiosporium cucumerinum; Cochliobolus species, such as, for example, Cochliobolus sativus (conidia form: Drechslera, Syn: Helminthosporium); Colletotrichum species, such as, for example, Colleto- trichum lindemuthanium; Cycloconium species, such as, for example, Cycloconium oleaginum; Diaporthe species, such as, for example, Diaporthe citri; Elsinoe species, such as, for example, Elsinoe fawcettii; Gloeospori- um species, such as, for example, Gloeosporium laeticolor; Glomerella species, such as, for example, Glomerel- la cingulata; Guignardia species, such as, for example, Guignardia bidwelli; Leptosphaeria species, such as, for example, Leptosphaeria maculans; Magnaporthe species, such as. for example, Magnaporthe grisea; Microdo- chium species, such as, for example. Microdochium nivale; Mycosphaerella species, such as, for example. My- cosphaerella graminicola and . fijiensis; Phaeosphaeria species, such as. for example, Phaeosphaeria no- dorum; Pyrenophora species, such as, for example, Pyrenophora teres; Ramularia species, such as, for example, Ramularia collo-cygni; Rhynchosporium species, such as, for example, Rhynchosporium secalis; Septoria species, such as, for example, Septoria apii; Typhula species, such as, for example, Typhula incarnata; Venturia species, such as, for example, Venturia inaequalis;
Root and stem diseases caused, for example, by Corticium species, such as, for example, Corticium graminearum; Fusarium species, such as, for example, Fusarium oxysporum; Gaeumannomyces species, such as, for example, Gaeumannomyces graminis; Rhizoctonia species, such as, for example Rhizoctonia solani; Tapesia species, such as, for example, Tapesia acuformis; Thielaviopsis species, such as, for example, Thielaviopsis basicola;
Ear and panicle diseases (including maize cobs) caused, for example, by Alternaria species, such as, for example, Alternaria spp.; Aspergillus species, such as, for example, Aspergillus flavus; Cladosporium species, such as, for example, Cladosporium cladosporioides; Claviceps species, such as, for example, Claviceps purpurea; Fusarium species, such as, for example, Fusarium culmorum; Gibberella species, such as, for example, Gibber- ella zeae; Monographella species, such as, for example, Monographella nivalis; Septoria species, such as for example, Septoria nodorum;
Diseases caused by smut fungi, such as, for example, Sphacelotheca species, such as, for example, Sphace- lotheca reiliana; Tilletia species, such as, for example, Tilletia caries; T. controversa; Urocystis species, such as, for example, Urocystis occulta; Ustilago species, such as, for example, Ustilago nuda; U. nuda tritici; Seed- and soil-borne rot and wilt diseases, and also diseases of seedlings, caused, for example, by Fusarium species, such as, for example, Fusarium culmorum; Microdochium species, such as, for example, Microdochi- um nivale; Tilletia species, such as, for example. Tilletia caries; Ustilago species, such as, for example, Ustilago tritici, Utilago nuda; Pyrenophora species, such as, for example, Pyrenophora graminea, Prenophora teres; Phy- tophthora species, such as, for example. Phytophthora cactorum; Pythium species, such as, for example, Pythi- um ultimum; Rhizoctonia species, such as, for example, Rhizoctonia solani; Sclerotium species, such as, for example, Sclerotium rolfsii; Alternaria species, such as, for example, Alternaria brassicae; Phoma species, such as, for example, Phoma lingam.
Diseases of flowers and seeds caused, for example, by Botrytis species, such as, for example, Botrytis cinerea; Diseases of plant tubers caused, for example, by Rhizoctonia species, such as, for example, Rhizoctonia solani; Helminthosporium species, such as, for example, Helminthosporium solani;
Diseases caused by bacteriopathogens, such as, for example, Xanthomonas species, such as, for example, Xan- thomonas campestris pv. oryzae; Pseudomonas species, such as, for example, Pseudomonas syringae pv. lach- rymans; Erwinia species, such as, for example, Erwinia amylovora. Preference is given to controlling the following:
Seed- and soil-borne rot and wilt diseases, and also diseases of seedlings, caused, for example, by Fusarium species, such as, for example, Fusarium culmorum; Microdochium species, such as, for example, Microdochium nivale; Tilletia species, such as, for example, Tilletia caries; Ustilago species, such as, for example, Ustilago tritici, Ustilago nuda; Pyrenophora species, such as, for example, Pyrenophora graminea, Pyrenophora teres; Phytophthora species, such as, for example, Phytophthora cactorum; Pythium species, such as. for example, Pythium ultimum; Rhizoctonia species, such as, for example. Rhizoctonia solani; Sclerotium species, such as, for example, Sclerotium rolfsii; Alternaria species, such as, for example, Alternaria brassicae; Phoma species, such as, for example, Phoma lingam.
It is also possible to control resistant strains of the organisms mentioned above. Preferably, the term "attack by a phytopathogenic pathogen or pest" signifies the attack or infestation of a plant with phytopathogenic fungi, bacteria, or insects. More preferably, the pathogens attacking a plant are selected from the group consisting of the rice pathogens Pyricularia grisea causing rice blast and Xanthomonas oryzae causing bacterial leaf blight, the banana pathogen Mycosphaerella fijiensis causing Black Sigatoka, the wheat pathogen Blumeria graminis f.sp tritici causing powdery mildew, the cucumber pathogens Colletolrichum or- biculare causing anthracnose and Pseudomonas syringae pv. lachlymans causing bacterial leaf spot, the pumpkin pathogen Sphaerolheca fuliginea causing powdery mildew, the strawberry pathogens Glomerella cingulaia causing anthracnose, and Sphaerolheca aphanis causing powdery mildew, the eggplant pathogen Sphaerolheca fuliginea causing powdery mildew, the tomato pathogens Oidiopsis sicula causing powdery mildew and Phytophthora infestans causing late blight, the Chinese cabbage pathogen Alternaria brassicae causing leaf spot, - - the peach pathogen Xanthomonas pruni, the tea pathogen Pestalozia longiseta, and the tobacco pathogen TSWV (tomato spotted wilt virus), . Most preferably, the pathogens attacking a plant are selected from the group consisting of the rice pathogens Pyricularia grisea causing rice blast and Xanthomonas oryzae pv. oryzae causing bacterial leaf blight, and the banana pathogen Mycosphaerella fijiensis causing Black Sigatoka, the wheat path- ogen Blumeria graminis f.sp tritici causing powdery mildew, the cucumber pathogens Colletotrichum orbicula- re causing anthracnose and Pseudomonas syringae pv. lachlymans causing bacterial leaf spot and the tea pathogen Pestalozia longiseta.
The term "abiotic stress" within the meaning of the present invention signifies that the plants are exposed to abiotic stress factors including nutritional deficiencies, micronutrient deficiencies, such as high to low Zn defi- ciency, limited availability of nitrogen nutrients, limited availability of phosphorus nutrients, high radiation exposure, strong light conditions, the avoidance of shade, ozone conditions, low water supply, drought, water logging, cold and heat conditions, osmotic stress, increased soil salinity, or increased exposure to minerals.
Zinc is essential for the normal healthy growth and reproduction of plants, animals and humans. When the supply of plant-available zinc is inadequate, crop yields and quality of crop products are impaired. In plants, zinc plays a key role as a structural constituent or regulatory co-factor of a wide range of different enzymes and proteins in many important biochemical pathways. When the supply of zinc to the plant is inadequate, the physiological functions of zinc cannot operate correctly and thus plant growth is adversely affected. This can result within the plant in visible symptoms of stress, which symptoms vary with species and which might include: stunting (reduced height), interveinal chlorosis (yellowing of the leaves between the veins), bronzing of chlo- rotic leaves, small and abnormally shaped leaves and/or stunting and rosetting of leaves (where the leaves form a whorl on shortened stems). So-called hidden deficiencies without obvious visible symptoms might lead to a 20 % loss of plant yield. Zinc-deficient soils causing hidden deficiency may cause a significant financial loss to the fanner. Thus, it is necessary to identify zinc-deficient soils as early as possible by soil testing or crop plant analysis. Once identified, zinc-deficient soils can be easily treated with zinc fertilizers to provide an adequate supply of zinc to the crops, where zinc sulphate is by far the most widely used fertilizer (cf. Zinc in Soils and Crop Nutrition by B.J. Alloway, 2nd Ed. Brussels, Paris, 2008).
The invention further relates to the above mentioned use of the compound of fonnuia (I) or (II), wherein the compound of formula (I) or fonnuia (II) is used in combination with at least one further agrochemically active compound. In the present context, agrochemically active compounds are to be understood as meaning all substances which are or may be customarily used for treating plants. Fungicides, bactericides, insecticides, acaricides, nematicides, mol- luscicides, safeners, plant growth regulators and plant nutrients as well as biological control agents may be mentioned as being preferred.
Examples of fungicides which may be mentioned are: . .
(1 ) Inhibitors of the nucleic acid synthesis, for example benalaxyl, benalaxyl-M, bupirimate, clozylacon, dimethi- rimol, ethirimol, fliralaxyl, hymexazol, metalaxyl, metalaxyl-M, ofurace, oxadixyl and oxolinic acid.
(2) Inhibitors of the mitosis and cell division, for example benomyl, carbendazim, chlorfenazole, diethofencarb, ethaboxam, fuberidazole, pencycuron, thiabendazole, thiophanate, thiophanate-methyl and zoxamide.
(3) Inhibitors of the respiration, for example diflumetorim as Cl-respiration inhibitor; bixafen, boscalid, carboxin, fenfuram, flutolanil, fluopyram, furametpyr, furmecyclox, isopyrazam (9R-component), isopyrazam (9S- component), mepronil, oxycarboxin, penthiopyrad, thifluzamide as Cll-respiration inhibitor; amisulbrom, azoxystrobin, cyazofamid, dimoxystrobin, enestroburin, famoxadone, fenamidone, tluoxastrobin, kresoxim-methyl, metominostrobin, orysastrobin, picoxystrobin, pyraclostrobin, pyribencarb, trifloxystrobin as Clll-respiration inhibitor.
(4) Compounds capable to act as an uncoupler, like for example binapacryl, dinocap, fluazinam and meptyldi- nocap.
(5) Inhibitors of the ATP production, for example fentin acetate, fentin chloride, fentin hydroxide, and silthiofam.
(6) Inhibitors of the amino acid and/or protein biosynthesis, for example andoprim, blasticidin-S, cyprodinil, ka- sugamycin, kasugamycin hydrochloride hydrate, mepanipyrim and pyrimethanil.
(7) Inhibitors of the signal transduction, for example fenpiclonil, fludioxonil and quinoxyfen.
(8) Inhibitors of the lipid and membrane synthesis, for example biphenyl, chlozolinate, edifenphos, etridiazole, iodocarb, iprobenfos, iprodione, isoprothiolane, procymidone, propamocarb, propamocarb hydrochloride, pyra- zophos, tolclofos-methyl and vinclozolin.
(9) Inhibitors of the ergosterol biosynthesis, for example aldimorph, azaconazole, bitertanol, bromuconazole, cyproconazole, diclobutrazole, difenoconazole, diniconazole, diniconazole-M, dodemorph, dodemorph acetate, epoxiconazole, etaconazole, fenarimol, fenbuconazole, fenhexamid, fenpropidin, fenpropimorph, fluquin- conazole, fluφrimidol, flusilazole, flutriafol, furconazole, furconazole-cis, hexaconazole, imazalil, imazalil sulfate, imibenconazole, ipconazole, metconazole, myclobutanil, naftifme, nuarimol, oxpoconazole, paclobutrazol, pefurazoate, penconazole, piperalin, prochloraz. propiconazole, prothioconazole, pyributicarb, pyrifenox, quin- conazole, simeconazole, spiroxamine, tebuconazole. terbinafine, tetraconazole, triadimefon, triadimenol. tridemorph, triflumizole, triforine, triticonazole, uniconazole, viniconazole and voriconazole.
( 10) Inhibitors of the cell wall synthesis, for example benthiavalicarb, dimethomorph, flumorph. iprovalicarb, mandipropamid, polyoxins, polyoxorim, prothiocarb, validamycin A. and valiphenal.
( 1 1 ) Inhibitors of the melanine biosynthesis, for example carpropamid, diclocymet, fenoxanil, phthalide, py- roquilon and tricyclazole.
( 12) Compounds capable to induce a host defense, like for example acibenzolar-S-methyl, Probenazole, and Ti- adinil.
(13) Compounds capable to have a multisite action, like for example bordeaux mixture, captafol, captan, chloro- thalonil, copper naphthenate, copper oxide, copper oxychloride, copper preparations such as copper hydroxide, copper sulphate, dichlofluanid, dithianon, dodine, dodine free base, ferbam, fluorofolpet, folpet, guazatine, guazatine acetate, iminoctadine, iminoctadine albesilate, iminoctadine triacetate, mancopper, mancozeb. maneb, metiram, metiram zinc, oxine-copper, propamidine, sulphur and sulphur preparations including calcium poly- sulphide, thiram, tolylfluanid, zineb and ziram. - -
( 14) Further compounds like for example 2,3-dibutyl-6-chlorothieno[2,3-d]pyrimidin-4(3H)-one, ethyl (2Z)-3-ami- no-2-cyano-3-phenylprop-2-enoate, N-[2-( l ,3-dimethylbutyl)phenyl]-5-fluoro-l ,3-dimethyl- l H-pyrazole-4-carbox- amide, N-{2-[ l , l '-bi(cyclopropyl)-2-yl]phenyl}-3-(ditluoroiTiethyl)- l -methyl-l H-pyrazole-4-carboxamide, 3-(diflu- oromethyl)-l -methyl-N 3 4^5'-trifluorobipheriyl-2-yl)- l H-pyrazole-4-carboxamide, 3-(difluoromethyl)-N-[4-fluo- ro-2-(l , l ,2,3,3,3-hexafluoropropoxy)phenyl]- l -methyl- 1 H-pyrazole-4-carboxamide, (2E)-2-(2-{[6-(3-chloro-2-me- thylphenoxy)-5-fluoropyrimidin-4-yl]oxy}phenyl)-2-(methoxyimino)-N-methylethanamide, (2E)-2-{2-[({[(2E,3E)- 4-(2,6-dichlorophenyl)but-3-en-2-ylidene]amino}oxy)methyl]phenyl}-2-(methoxyimino)-N-methylethanamide, 2- chloro-N-( l , l ,3-trimethyl-2,3-dihydro-l H-inden-4-yl)pyridine-3-carboxamide, N-(3-ethyl-3,5,5-trimethylcyclohex- yl)-3-(formylamino)-2-hydroxybenzamide, 5-methoxy-2-methyl-4-(2-{ [({( l E)- l -[3-(trifluoromethyl)phenyl]ethyli- dene}amino)oxy]methyl}phenyl)-2,4-dihydro-3H- l ,2,4-triazol-3-one, (2E)-2-(methoxyimino)-N-methyl-2-(2- {[({(l E)-l -[3-(trifluoromethyl)phenyl]ethylidene}amino)oxy]methyl}phenyl)ethanamide, (2E)-2-(methoxyimino)- N-methyl-2-{2-[(E)-({ l -[3-(trifluoromethyl)phenyl]ethoxy}imino)methyl]phenyl}ethanamide, (2E)-2-{2-[({ [( ! E)- l -(3-{[(E)- l -fluoro-2-phenylethenyl]oxy}phenyl)ethylidene]amino}oxy)methyl]phenyl}-2-(methoxyimino)-N-rne- thylethanamide, l -(4-chlorophenyl)-2-( l H- l ,2,4-triazol- l -yl)cycloheptanol, methyl l -(2,2-dimethyl-2,3-dihydro- l H-inden-l-yl)- l H-imidazole-5-carboxylate, N-ethyl-N-methyl-N'-{2-methyl-5-(trifluoromethyl)-4-[3-(trimethyl- silyl)propoxy]phenyl } imidoformamide, N'-{5-(difluoromethyl)-2-methyl-4-[3-(trimethylsilyl)propoxy]phenyl }-N- ethyl-N-methylimidoformamide, Sedaxanc, 0-{ l -[(4-methoxyphenoxy)methyl]-2,2-dimethylpropyl} 1 H- imidazole-l -carbothioate, N-[2-(4-{[3-(4-chlorophenyl)prop-2-yn- l -yl]oxy}-3-methoxyphenyl)ethyl]-N2- (methylsulfonyl)valinamide, 5-chloro-7-(4-methylpiperidin- l -yl)-6-(2,4,6-trifluorophenyl)[ l ,2,4]triazolo[l ,5- a]pyrimidine, 5-amino- l ,3,4-thiadiazole-2-thiol, propamocarb-foseryk 1 -[(4-methoxyphenoxy)methyl]-2,2- dimethylpropyl 1 H-imidazole- 1 -carboxylate, 1 -methyl-N-[2-( 1 , 1 ,2,2-tetrafluoroethoxy)phenyl]-3-(trifluoromethyl)- 1 H-pyrazole -carboxamide, 2,3,5,6-tetrachloro-4-(methylsulfonyl)pyridine, 2-butoxy-6-iodo-3-propyl-4H- chromen-4-one, 2-phenylphenol and salts, 3-(difluoromethyl)- l -methyl-N-[2-(l , l ,2,2-tetrafluoroethoxy)phenyl]- 1 H-pyrazole-4-carboxamide, 3,4,5-trichloropyridine-2,6-dicarbonitrile, 3-[5-(4-chlorophenyl)-2,3- dimethylisoxazolidin-3-yl]pyridine, 3-chloro-5-(4-chlorophenyl)-4-(2,6-difluorophenyl)-6-methylpyridazine, 4-(4- chlorophenyl)-5-(2,6-difluorophenyl)-3,6-dimethylpyridazine, quinolin-8-ol, quinolin-8-ol sulfate (2: 1 ) (salt), 5- methyl-6-octyl-3,7-dihydro[ l ,2,4]triazolo[ l ,5-a]pyrimidin-7-amine, 5-ethyl-6-octyl-3,7-dihydro[ l ,2,4]triazolo[ l ,5- a]pyrimidin-7-amine, benthiazole, bethoxazin, capsimycin, carvone, chinomethionat, chloroneb, cufraneb, cyflufenamid, cymoxanil, cyprosulfamide, dazomet, debacarb, dichlorophen, diclomezine, dicloran, difenzoquat, difenzoquat methylsulphate, diphenylamine. ecomate, ferimzone, flumetover, fluopicolidc, fluoroimide, flusulfa- mide, flutianil, fosetyl-aluminium, fosetyl-calcium, fosetyl-sodium, hexachlorobenzene, irumamycin, isotianil. methasulfocarb, methyl (2E)-2-{2-[({cyclopropyl[(4-methoxyphenyl)imino]methyl}thio)methyl]phenyl}-3-meth- oxyacrylate, methyl isothiocyanate, metrafenone, (5-bromo-2-methoxy-4-methylpyridin-3-yl)(2,3,4-trimethoxy-6- methylphenyl)methanone, mildiomycin, tolnifanide, N-(4-chlorobenzyl)-3-[3-methoxy-4-(prop-2-yn- l - yloxy)phenyl]propanamide, N-[(4-chlorophenyl)(cyano)methyl]-3-[3-methoxy-4-(prop-2-yn-l -yloxy)phenyl]- propanamide, N-[(5-bromo-3-chloropyridin-2-yl)methyl]-2,4-dichloropyridine-3-carboxamide, N-[l-(5-bromo-3- chloropyridin-2-yl)ethyl]-2,4-dichloropyridine-3-carboxamide, N-[ l -(5-bromo-3-chloropyridin-2-yl)ethyl]-2-fluoro- 4-iodopyridine-3-carboxamide, N-{(Z)-[(cyclopropylmethoxy)imino][6-(difluoromethoxy)-2,3-difluorophenyl]- methyl}-2-phenylacetamide, N-{(E)-[(cyclopropylmethoxy)iminol[6-(difluoromethoxy)-2,3-difluorophenyl]me- thyl}-2-phenylacetamide, natamycin, nickel dimethyldithiocarbamate, nitrothal-isopropyl, octhilinone, oxamocarb, oxyfenthiin, pentachlorophenol and salts, phenazine- l -carboxylic acid, phenothrin, phosphorous acid and its salts, propamocarb fosetylate, propanosine-sodium, proquinazid, pyrrolnitrine, quintozene, S-prop-2-en-l -yl 5-amino-2- (l -methylethyl)-4-(2-methylphenyl)-3-oxo-2,3-dihydro- l H-pyrazole- 1 -carbothioate, tecloftalam, tecnazene, tri- azoxide, trichlamide, 5-chloro-N'-phenyl-N'-prop-2-yn- l -ylthiophene-2-sulfonohydrazide and zarilamid.
Examples of bactericides which may be mentioned are:
bronopol, dichlorophen, nitrapyrin, nickel dimethyldithiocarbamate, kasugamycin, octhilinone, furancarboxylic acid, oxytetracycline, probenazole, streptomycin, tecloftalam, copper sulphate and other copper preparations.
Examples of insecticides, acaricides and nematicides which may be mentioned are:
(1) Acetylcholinesterase (AChE) inhibitors, for example carbamates, e.g. alanycarb, aldicarb, aidoxycarb, allyxycarb, aminocarb, bendiocarb, benfuracarb, bufencarb, butacarb, butocarboxim, butoxycarboxim, carbaryl, carbofuran, carbosulfan, cloethocarb, dimetilan, ethiofencarb, fenobucarb, fenothiocarb, formetanate, furathiocarb, isoprocarb, metam-sodium, methiocarb, methomyl, metolcarb, oxamyl, pirimicarb, promecarb, propoxur, thiodi- carb, thiofanox, trimethacarb, XMC, and xylylcarb; or organophosphates, e.g. acephate, azamethiphos, azinphos (- methyl, -ethyl), bromophos-ethyl, bromfenvinfos (-methyl), butathiofos, cadusafos, carbophenothion, chlorethox- yfos, chlorfenvinphos, chlonnephos, chlorpyrifos (-methyl/-ethyl)¾ coumaphos, cyanofenphos, cyanophos. chlorfenvinphos, demeton-S-methyl, demeton-S-methylsulphon. dialifos, diazinon, dichlofenthion. dichlor- vos DDVP, dicrotophos, dimethoate, dimethylvinphos, dioxabenzofos, disulfoton, EPN, ethion, ethoprophos, etrimfos, famphur, fena iphos, fenitrothion, fensulfothion, fenthion, flupyrazofos, fonofos, formothion, fosmethi- lan, fosthiazate, heptenophos, iodofenphos, iprobenfos, isazofos, isofenphos, isopropyl, O-salicylate, isoxathion, malathion, mecarbam, methacrifos, methamidophos, methidathion, mevinphos, monocrotophos, naled, omethoate, oxydemeton-methyl, parathion (-methyl/-ethyl), phenthoate, phorate, phosalone, phosmet, phosphamidon, phos- phocarb, phoxim, pirimiphos (-methylAethyl), profenofos, propaphos, propetamphos, prothiofos, prothoate, pyra- clofos, pyridaphenthion, pyridathion, quinalphos, sebufos, sulfotep, sulprofos, tebupirimfos, temephos, terbufos, tetrachlorvinphos, thiometon, triazophos, triclorfon, vamidothion, and imicyafos.
(2) GABA-gated chloride channel antagonists, for example organochlorines, e.g. camphechlor, chlordane, en- dosulfan, gamma-HCH, HCH, heptachlor, lindane, and methoxychlor; or fiproles (phenylpyrazoles), e.g. ace- toprole, ethiprole, fipronil, pyrafluprole, pyriprole, and vaniliprole.
(3) Sodium channel modulators/voltage-dependent sodium channel blockers, for example pyrethroids, e.g. acrinathrin, allethrin (d-cis-trans, d-trans), beta-cyfluthrin, bifenthrin, bioal!ethrin, bioallethrin S-cyclopentyl isomer, bioethanomethrin, biopermethrin, bioresmethrin, chlovaporthrin, cis-cypermethrin, cis-resmethrin, cis- permethrin, clocythrin, cycloprothrin, cyfluthrin, cyhalothrin, cypermethrin (alpha-, beta-, theta-, zeta-), cyphe- nothrin, deltamethrin, empenthrin ( 1 R isomer), esfenvalerate, etofenprox. fenfluthrin, fenpropathrin, fenpy- rithrin, fenvalerate, flubrocythrinate, flucythrinate, flufenprox. flumethrin, fluvalinate, fubfenprox, gamma- cyhalothrin, imiprothrin, kadethrin, lambda-cyhalothrin, metofluthrin, permethrin (cis-, trans-), phenothrin ( 1 R trans isomer), prallethrin, profluthrin, protrifenbute, pyresmethrin, resmethrin, RU 15525, silafluofen, tau- _ χ7 _ fluvalinate, tefluthrin, teral!ethrin, tetramethrin (- 1 - isomer), tralomethrin, trans fluthrin, ZX I 8901 , pyrethrin (pyrethrum), eflusilanat; DDT; or methoxychlor.
(4) Nicotinergic acetylcholine receptor agonists/antagonists, for example chloronicotinyls, e.g. acetamiprid, clo- thianidin, dinotefuran, imidacloprid, imidaclothiz, nitenpyram, nithiazine. thiacloprid. thiamethoxam, AKD- 1022; or nicotine, bensultap, catlap, thiosultap-sodium, and thiocylam.
(5) Allosteric acetylcholine receptor modulators (agonists), for example spinosyns, e.g. spinosad and spineto- ram.
(6) Chloride channel activators, for example mectins/macrolides, e.g. abamectin, emamectin, emamectin benzo- ate, ivermectin, lepimectin, and milbemectin; or juvenile hormone analogues, e.g. hydroprene, kinoprene, methoprene, epofenonane, triprene, fenoxycarb, pyriproxifen, and diofenolan.
(7) Active ingredients with unknown or non-specific mechanisms of action, for example gassing agents, e.g. methyl bromide, chloropicrin and sulfuryl fluoride; selective antifeedants, e.g. cryolite, pymetrozine, pyriflu- quinazon and flonicamid; or mite growth inhibitors, e.g. clofentezine, hexythiazox, etoxazole.
(8) Oxidative phosphorylation inhibitors, ATP disrupters, for example diafenthiuron; organotin compounds, e.g. azocyclotin, cyhexatin and fenbutatin oxide; or propargite, tetradifon.
(9) Oxidative phoshorylation decouplers acting by interrupting the H proton gradient, for example chlorfenapyr, binapacryl, dinobuton, dinocap and DNOC.
( 10) Microbial disruptors of the insect gut membrane, for example Bacillus thuringiensis strains.
( 1 1 ) Chitin biosynthesis inhibitors, for example benzoylureas, e.g. bistrifluron, chlorfluazuron, diflubenzuron, fluazuron, flucycloxuron, flufenoxuron, hexaflumuron, lufenuron, novaluron. noviflumuron, penfluron, teflubenzuron or triflumuron.
( 12) Buprofezin.
( 13) Moulting disruptors, for example cyromazine.
( 14) Ecdysone agonists/disruptors, for example diacylhydrazines, e.g. chromafenozide, halofenozide, methox- yfenozide, tebufenozide, and Fufenozide (JS 1 18); or azadirachtin.
( 15) Octopaminergic agonists, for example amitraz.
( 16) Site III electron transport inhibitors/site II electron transport inhibitors, for example hydramethylnon; acequinocyl; fluacrypyrim; or cyflumetofen and cycnopyrafen.
( 17) Electron transport inhibitors, for example Site I electron transport inhibitors, from the group of the METI acaricides, e.g. fenazaquin, fenpyroximate, pyrimidifen, pyridaben, tebufenpyrad. tolfenpyrad, and rotenone; or voltage-dependent sodium channel blockers, e.g. indoxacarb and metaflumizone.
( 18) Fatty acid biosynthesis inhibitors, for example tetronic acid derivatives, e.g. spirodiclofen and spi- romesifen; or tetramic acid derivatives, e.g. spirotetramat.
( 19) Neuronal inhibitors with unknown mechanism of action, e.g. bifenazate.
(20) Ryanodine receptor effectors, for example diamides, e.g. flubendiamide, (R).(S)-3-chloro-N ' -{2-methyl-4- [ l ,2,2,2-tetrafluoro- l -(trinuoromethyl)ethyl]phenyl }-N2-( l -methyl-2-methylsulphonylethyl)phthalamide, chlorantraniliprole (Rynaxypyr), or Cyantraniliprole (Cyazypyr).
(21 ) Further active ingredients with unknown mechanism of action, for example amidoflumet, benclothiaz, ben- zoximate, bromopropylate, buprofezin, chinomethionat, chlordimeform, chlorobenzilate, clothiazoben, cyclo- prene, dicofol, dicyclanil, fenoxacrim, fentrifanil, flubenzimine, flufenerim, flutenzin, gossyplure, japonilure, metoxadiazone, petroleum, potassium oleate, pyridalyl, sulfluramid, tetrasul, triarathene or verbutine; or one of the following known active compounds 4-{ [(6-bromopyrid-3-yl)methyl](2-fluoroethyl)amino}furan-2(5H)-one, 4-{[(6-fluoropyrid-3-yl)methyl](2,2-difluoroethyl)amino} furan-2(5H)-one. 4-{ [(2-chloro- l ,3-thiazol-5-yl)me- thyl](2-fluoroethyl)amino} furan-2(5H)-one. 4-{ [(6-chloropyrid-3-yl)methyl](2-fluoroethyl)amino}furan-2(5H)- one, 4-{[(6-chloropyrid-3-yl)methyl](2,2-difluoroethyl)amino} furan-2(5H)-one (all known from WO 2007/1 15644), 4-{ [(5,6-dichloropyrid-3-yl)methyl](2-fluoroethyl)amino} furan-2(5H)-one (known from WO 2007/1 15646), 4-{[(6-chloro-5-fluoropyrid-3-yl)melhyl](methyl)amino} furan-2(5H)-one, 4-{ [(6-chloro-5-fluo- ropyrid-3-yl)methyl](cyclopropyl)amino} furan-2(5H)-one (both from WO 2007/1 15643), 4-{ [(6-chloropyrid-3- yl)methyl](cyclopropyl)amino}furan-2(5H)-one, 4-{[(6-chloropyrid-3-yl)methyl](methyl)amino}furan-2(5H)- one (both from EP-A-0 539 588), [(6-chloropyridii>3-yl)methyl](methyl)oxido^4-sulfanylidene cyanamide, [ 1 - (6-chloropyridin-3-yl)ethyl](methyl)oxido^4-sulfanylidene cyanamide (both from WO 2007/1491 34) and its diastereomeres (A) and (B)
(also known from WO 2007/1 9134), [(6-tnfluoromelhylpyridin-3-yl)methyl](iTiethyl)oxido- 4-sulfanylidene cyanamide (known from WO 2007/095229), or [ l -(6-trinuoromethylpyridin-3-yl)ethyl](methyl)oxido- 4-sulfa- nylidene cyanamide (known from WO 2007/149134) and its diastereomeres (C) and (D), namely Sul- foxaflor(also known from WO 2007/14 134)
Examples of molluscicides which may be mentioned are metaldehyde and methiocarb. Examples of safeners which may be mentioned are:
(1 ) Heterocyclic carboxylic acid derivates, for example dichlorophenylpyrazolin-3-carboxylic acid derivatives, e.g. l -(2,4-dichlorophenyl)-5-(ethoxycarbonyl)-5-methyl-4,5-dihydro- l H-pyrazole-3-carboxylic acid, diethyl l -(2,4-dichlorophenyl)-4,5-dihydro-5-methyl- l H-pyrazole-3,5-dicarboxylate ("mefenpyr-diethyl"). and similar compounds known from WO 91 /07874: for example dichlorophenylpyrazolecarboxylic acid derivatives, e.g. ethyl l -(2,4-dichlorophenyl)-5-methyl- l H-pyrazole-3-carboxylate. ethyl l -(2.4-dichlorophenyl)-5-isopro- pyl- l H-pyrazole-3-carboxylate, ethyl 5-tert-butyl- 1 -(2.4-dichlorophenyl)- 1 H-pyrazole-3-carboxylate and similar compounds known from EP-A 0 333 1 3 1 and EP-A 0 269 806; for example 1 ,5-diphenylpyrazole-3-carboxy!ic acid derivatives, e.g. ethyl l -(2,4-dichlorophenyl)-5-phenyl- l H-pyrazole-3-carboxylate, methyl l -(2-chloro- phenyl)-5-phenyl- l H-pyrazole-3-carboxylate, and similar compounds known from EP-A 0 268 554; for example triazolecarboxylic acid derivatives, e.g. fenchlorazole, fenchlorazole-ethyl, and similar compounds known from EP-A 0 174 562 and EP-A 0 346 620; for example 2-isoxazoline-3-carboxylic acid derivatives, e.g. ethyl - -
5-(2,4-dichlorobenzyl)-4,5-dihydro- l ,2-oxazole-3-carboxylate, ethyl 5-phenyl-4,5-dihydro- l ,2-oxazole-3-carb- oxylate and similar compounds known from WO 91 /08202, or 5,5-diphenyl-4,5-dihydro- l ,2-oxazole-3-carb- oxylic acid, ethyl 5,5-diphenyl-4,5-dihydro- l ,2-oxazole-3-carboxylate ("isoxadifen-ethyl"), propyl 5,5-diphenyl- 4,5-dihydro-l ,2-oxazole-3-carboxylate, ethyl 5-(4-fluorophenyl)-5-phenyl-4,5-dihydro- l ,2-oxazole-3-carb- oxylate known from WO 95/07897.
(2) Derivatives of 8-quinolinol, for example derivatives of (quinolin-8-yloxy)acetic acid, e.g. heptan-2-yl [(5-chloroquinolin-8-yl)oxy]acetate ("cloquintocet-mexyr), 4-methylpentan-2-yl [(5-chloroquinolin-8-yl)oxy]- acetate,4-(allyloxy)butyl [(5-chloroquinolin-8-yl)oxy Jacetate, 1 -(allyloxy)propan-2-yl [(5-chloroquinolin-8-yl)- oxy]acetate, ethyl [(5-chloroquinolin-8-yl)oxy]acetate, methyl [(5-chloroquinolin-8-yl)oxy]acetate, allyl [(5- chloroquinolin-8-yl)oxy]acetate, 2-{ [propylideneamino]oxy}ethyl [(5-chloroquinolin-8-yl)oxy]acetate, 2-oxo- propyl [(5-chloroquinolin-8-yl)oxy]acetate, and similar compounds known from EP-A 0 086 750, EP-A 0 094 349, EP-A 0 191 736 or EP-A 0 492 366, as well as [(5-chloroquinolin-8-yl)oxy]acetic acid, its hydrates and salts, e.g. the lithium, sodium, potassium, calcium, magnesium, aluminum, iron, ammonium, quartanary ammonium, sulfonium or phosphonium salts as known from WO 02/34048; for example derivatives of [(5- chloroquinolin-8-yl)oxy]malonic acid, e.g diethyl [(5-chloroquinolin-8-yl)oxy]malonate, diallyl [(5-chloro- quinolin-8-yl)oxy]malonate, ethyl methyl [(5-chloroquinolin-8-yl)oxy]malonate, and similar compounds known from EP-A 0 582 198.
(3) Dichloroacetamides, which are often used as pre-emergence safeners (soil active safeners), e.g. "dichlor- mid" (N,N-diallyl-2,2-dichloroacetamide), "R-29148" (3dichloroacetyl-2,2,5-trimethyl-l ,3-oxazolidine) and "R- 28725" (3-dichloroacetyl-2,2,-dimethyl- l ,3-oxazolidine) both of the company Stauffer, "benoxacor" (4- dichloroacetyl-3,4-dihydro-3-methyl-2H- l ,4-benzoxazine), "PPG- 1292" (N-allyl-N-[( l ,3-dioxolan-2-yl)-methyl]- dichloroacetamide) of PPG Industries, "DKA-24 ( -allyl-N-[(allylaminocarbonyl)methyl]-dichloroacetamide) of Sagro-Chem, "AD-67" or "MON 4660" (3-dichloroacetyl-l -oxa-3-aza-spiro[4,5]decane) of Nitrokemia and Monsanto, "Tl-35" (1 -dichloroacetyl-azepane) of TRl-Chemical RT, "diclonon" (dicyclonon) or "BAS 145138" or "LAB 145138" (3-dichloroacetyl-2,5,5-trimethyl- l ,3-diazabicyclo[4.3.0]nonane) of BASF, "Furilazol" or "MON 13900" [(RS)-3-dichloroacetyl-5-(2-furyl)-2,2-dimethyloxazolidine], as well as there (R)-isomer.
(4) Acylsulfonamid
or its salts (known from WO 97/45016), wherein R' represents (Ci-C6)alkyl, which is unsubstituted or mono- to trisubstituted by substituents selected from the group consisting of halogen, (Ci-Q)alkoxy, (Ci-C&)haloalkoxy and (Ci-Ci)alkylthio;
R2 represents halogen, (C i-C4)alkyl, (Ci-Q)alkoxy, CI7?;
m is 1 or 2;
or for example 4-(benzoylsulfamoyl)benzamides of the formula (111) - -
or its salts (known from WO 99/16744), wherein
R3, R4 independently of one another represent hydrogen, (C i -Chalky 1, (C.t-C6)alkenyl, (C3-Cf,)alkynyl, (C3- C6)cycloalkyl,
R5 represents halogen, (Ci-Gt)alkyl, (C i-C4)haloalkyl or (Ci-C4)alkoxy
n is 1 or 2, in particular compounds of formula (I I I), wherein
R3 = cyclopropyl, R4 = hydrogen and R5 n = 2-OMe, ("cyprosulfamide"),
R3 = cyclopropyl, R4 = hydrogen and R5,, = 5-CI-2-OMe,
R3 = ethyl, R4 = hydrogen and R5,, = 2-OMe,
R3 = isopropyl, R4 = hydrogen and R5 n = 5-Cl-2-O e,
R3 = isopropyl, R4 = hydrogen and R5 n = 2-OMe. or for example benzoyls
(known from EP-A 0 365 484), wherein
R6, R7 independently of one another represent hydrogen, (Ci-Cs)alkyl, (C3-C6)alkenyl, (C3-C6)alkynyl, R8 represents halogen, (Ci-C4)alkyl, (Ci-C4)alkoxy, CF3
r is 1 or 2; in particular
l -[4-(N-2-methoxybenzoylsulfamoyl)phenyl]-3-methyl urea,
1 -[4-(N-2-methoxybenzoylsulfamoyl)phenyl]-3,3-dimethyl urea,
1 -[4-(N-4,5-dimethylbenzoylsulfamoyl)phenyl]-3-methyl urea.
(5) Hydroxyaromatic compounds and aromatic-aliphatic carboxylic acid derivatives, e.g. ethyl 3,4,5- triacetoxybenzoate, 4-hydroxy-3,5-dimethoxybenzoic acid, 3,5-dihydroxybenzoic acid, 2,4-dihydroxybenzoic acid, 4-fluoro-2-hydroxybenzoic acid, 2-hydroxycinnamic acid, 2,4-dichlorocinnamic acid (cf. WO 2004/084631 , WO 2005/01 5994, WO 2005/016001 ). - -
(6) l ,2-Dihydrochinoxalin-2-ones, e.g. l -melhyl-3-(2-thienyl)- l ,2-dihydrochinoxalin-2-one, l -methyl-3-(2- thienyl)- l ,2-dihydrochinoxalin-2-thione, l -(2-aminoethyl)-3-(2-thienyl)- l ,2-dihydrochinoxalin-2-one hydro- chlorid, l -(2-methylsulfonylaminoethy])-3-(2-thienyl)- l ,2-dihydrochinoxalin-2-one (cf. WO 2005/1 1 2630).
(7) Diphenylmethoxyacetic acid derivatives, e.g. methyl (diphenylmethoxy)acetate (CAS-Reg. No. 41858- 19-9), ethyl (diphenylmethoxy)acetate or (diphenylmethoxy)acetic acid (cf. WO 98/38856).
(8) Compounds of formula
or its salts (known from WO 98/27049), wherein
R9 represents halogen, (Ci-Gi)alkyl, (Ci-Gt)haloalkyl, (Ci-d)alkoxy, (Ci-C4)haloalkoxy,
R io represents hydrogen or (Ci-C4)alkyl,
represents hydrogen, in each case unsubstituted or mono- to trisubstituted (Ci-Cs)alkyl, (C2-C4)alkenyl, (C2-C4)alkynyl, or aryl, where the substituents are selected from the group consisting of halogen and (Ci- Cg)alkoxy,
s is 0, 1 or 2.
(9) 3-(5-Tetrazolylcarbonyl)-2-chinolones. e.g. l ,2-dihydro-4-hydroxy- l -ethyl-3-(5-tetrazolylcarbonyl)-2- chinolone (CAS-Reg. No. 219479-18-2), l ,2-dihydro-4-hydroxy- l -methyl-3-(5-tetrazolyl-carbonyl)-2- chinolone (CAS-Reg. No. 95855-00-8) (cf. WO 99/00020).
( 10) Compounds of the formulae (Vl-a) and (VI-b)
(known from WO 2007/023719 and WO 2007/023764), wherein
R'2 represents halogen, (Ci-C4)alkyl, methoxy, nitro, cyano, CF3, OCF3,
Y, Z independently represent O or S,
t is O, 1 , 2, 3 or 4,
R13 represents (Ci-Ci6)alkyl, (C2-C6)alkenyl, aryl, benzyl, halogenobenzyl,
R'4 represents hydrogen or (C| -C6)alkyl.
( Π ) Oxyimino compounds, known as seed treatment agents, e.g. 'oxabetrinir [(Z)-l ,3-dioxolan-2- ylmethoxyimino(phenyl)acetonitril], "fluxofenim" [ l -(4-chlorophenyl)-2,2,2-trifluoro-l -ethanone-0-( l ,3- dioxolan-2-ylmethyl)-oxime], and "cyometrinil" or "CGA-43089" [(Z)-cyanomethoxyimino(phenyl)acetonitril], all known as seed treatment safener for sorghum against damage by metolachlor.
( 12) Isothiochromanones, e.g. methyl [(3-oxo- l H-2-benzothiopyran-4(3H)-ylidene)methoxy]acetate (CAS-Reg. No. 205 121 -04-6) and similar compounds known from WO 98/13361 . - -
( 13) Compounds from the group consisting of "naphthalic anhydrid" ( 1 ,8-naphthalinedicarboxylic acid anhydride), which is known as seed treatment safener for corn (maize) against damage by thiocarbamate herbicides, "fenclorim" (4,6-dichloro-2-phenylpyrimidine), which is known as seed treatment safener in sown rice against damage by pretilachlor, "flurazole" (benzyl-2-chloro-4-trifluoromethyl- l ,3-thiazol-5-carbo.\ylate), which is known as seed treatment safener for sorghum against damage by alachlor and metolachlor, "CL 30441 5" (CAS-Reg. No. 31541 -57-8), (4-carboxy-3,4-dihydro-2H- l -benzopyran-4-acetic acid) of American Cyanamid, which is known as safener for corn (maize) against damage by imidazolinones, " G 191 " (CAS-Reg. No. 96420-72-3) (2- dichloromethyl-2-methyI- 1 ,3-dioxolane) of Nitrokemia, known as safener for corn (maize), " G-838" (CAS-Reg. No. 133993-74-5), (2-propenyl l -oxa-4-azaspiro[4.5]decane-4-carbodithioate) of Nitrokemia, "Disul- foton" (0,0-diethyl-S-2-ethylthioethyl phosphorodithioate), "dietholate" (Ο,Ο-diethyl-O-phenylphosphorothioate), "mephenate" (4-chlorophenyl-methylcarbamate).
( 14) Compounds, which besides herbicidal activity als exhibit Safener activity in crops like rice, e.g. "Dimepiperate" or "MY-93" (S- \ -methyl- 1 -phenylethyl-piperidin- l -carbothioate), which is known as safener for rice against damage by molinate, "daimuron" or "S 23" [ 1 -( 1 -methyl- l -phenylethyl)-3-p-tolyl-urea], which is known as safener for rice against damage by imazosulfuron, "cumyluron" = "JC-940" [3-(2-chlorophenylmethyl)- 1 -( 1 -methyl- 1 -phenyl-ethyl)urea] (cf. JP-A 60-087254), which is known as safener for rice against damage by some herbicides, methoxyphenon" or "NK 049" (3,3'-dimethyl-4-methoxy-benzophenone), which is known as safener for rice against damage by some herbicides, "CSB" [ l -bromo-4-(chloromethylsulfonyl)benzene] of umiai (CAS-Reg. No. 54091 -06-4), which is known as safener for rice against damage by some herbicides.
( 15) Compounds, which are mainly used as herbicides, but which exhibit also safener activity on some crops, e.g. (2,4-dichlorophenoxy)acetic acid (2,4-D), (4-chlorophenoxy)acetic acid, (R,S)-2-(4-chlor-o-tolyloxy)propionic acid (mecoprop), 4-(2,4-dichlorophenoxy)butyric acid (2,4-DB), (4-chloro-o-tolyloxy)acetic acid (MCPA), 4-(4- chloro-o-tolyloxy)butyric acid, 4-(4-chlorophenoxy)butyric acid, 3,6-dichloro-2-metho.xybenzoic acid (dicamba), 1 - (ethoxycarbonyl)ethyl-3,6-dichloro-2-methoxybenzoate (lactidichlor-ethyl). Examples of plant growth regulators which may be mentioned are chlorocholine chloride and ethephon.
Examples of plant nutrients which may be mentioned are customary inorganic or organic fertilizers for supplying plants with macro- and/or micronutrients.
Examples of biological control agents which may be mentioned are yeasts and bacteria, e.g. Metschnikowia fructicola or bacillus firmus. Preferred fungicidal or insecticidal active compounds are selected from the group consisting of bacillus firmus, beta-cyfluthrin, bixafen, clothianidin, cyproconazole, ethiprole, fenamidone, fenhexamid, fipronil, flubendia- mide, fluopicolide, fluopyram, fluoxastrobin, fluquinconazole, fosetyl-A I, imidacloprid, iprovalicarb, methio- carb, metominostrobin, oryzastrobin, pencycuron, penflufen, prochloraz-manganese chloride, propamocarb, propineb, prothioconazole, pyrimethanil, rynaxypyr, sedaxane, spinosad, spiroxamine, tebuconazole, tebucona- zole, thiacloprid, thiamethoxam, thifluzamide, thiodicarb, triadimefon, triadimenol trifloxystrobin, and 4-{[(6- chloropyrid-3-yl)methyl](2,2-difluoroethyl)amino}furan-2(5H)-one. Also preferred fungicidal or insecticidal active compounds are selected from the group consisting of ethiprole, fipronil, imidacloprid, prochloraz-manganese chloride, propineb, rynaxypyr, spinosad, thiacloprid, thifluzamide, and trifloxystrobin.
Further preferred is the use of the compound of formula (I) in combination with imidacloprid, with imidacloprid and spinosad, with imidacloprid and spinosad and thifluzamide, with thiacloprid, or with fipronil and prochloraz-manganese chloride.
The present invention also relates to the use of a compound of formula (I) or formula (II), wherein this compound is used in combination with at least one fertilizer compound.
Examples for fertilizer compounds include NIPK. fertilizers containing nitrogen (N), phosphorus (P) and potassium (K), or salts or complexed forms of calcium (Ca), sulfur (S), magnesium ( g), boron (B), chlorine (CI), manganese (Mn), iron (Fe), zinc (Zn), copper (Cu), molybdenium (Mo) and selenium (Se). Among the salts, sulphates are especially preferred.
According to a further embodiment of the invention, the compound of formula (1) is used for inducing latent host defenses in a plant which are activated in the event of an attack by a phytopathogenic pathogen or pest or in the event of abiotic stress. According to a preferred embodiment of the invention, the compound of formula (I) is used for inducing latent host defenses in a plant which are activated in the event of an attack by a phytopathogenic pathogen or pest.
The present invention further relates to above mentioned use of the compound of formula (1) or (II), wherein the pathogen is selected from the group consisting of phytopathogenic fungi, bacteria, viruses, viroids, mycoplas- ma-like organisms, protozoa, insects, acari, and nematodes. According to a more preferred embodiment, the pathogen is selected from phytopathogenic fungi, bacteria, and insects.
Examples for pathogens are given under "attack by a phytopathogenic pathogen or pest" above.
According to the invention, it is possible to treat all plants and parts of plants. Plants are to be understood here as meaning all plants and plant populations, such as wanted and unwanted wild plants or crop plants (including naturally occurring crop plants). Crop plants can be plants which can be obtained by conventional breeding and optimization methods or by biotechnological and genetic engineering methods or combinations of these methods, including the transgenic plants and including plant cultivars which can or cannot be protected by varietal property rights. Parts of plants are to be understood as meaning all above-ground and below-ground parts and organs of the plants, such as shoot, leaf, flower and root, examples which may be mentioned being leaves, needles, stems, trunks, flowers, fruit bodies, fruits and seeds and also roots, tubers and rhizomes. Plant parts also include harvested material and vegetative and generative propagation material, for example seedlings, tubers, rhizomes, cuttings and seeds. Preference is given to the treatment of the plants and the above-ground and below-ground parts and organs of the plants, such as shoot, leaf, flower and root, examples which may be mentioned being leaves, needles, stems, trunks, flowers, fruits. The following plants may be mentioned as plants which can be treated according to the invention: cotton, flax, grapevines, fruit, vegetable, such as Rosaceae sp. (for example pomaceous fruit, such as apples and pears, but also stone fruit, such as apricots, cherries, almonds and peaches and soft fruit such as strawberries), Ribesioidae sp. , Juglandaceae sp. , Betulaceae sp. , Anacardiaceae sp. , Fagaceae sp. , Morace e sp., Oleaceae sp. , Ac- tinidaceae sp., Lauraceae sp. , Musaceae sp. (for example banana trees and plantations), R biaceae sp. (for example coffee), Theaceae sp. , Sterculiceae sp. , Rutaceae sp. (for example lemons, oranges and grapefruit), Sola- naceae sp. (for example tomatoes), Liliaceae sp. , Asieraceae sp. (for example lettuce), Umbelliferae sp. , Cru- ciferae sp., Chenopodiaceae sp. , Cucurbit aceae sp. (for example cucumbers). Alliaceae sp. (for example leek, onions), Papilionaceae sp. (for example peas); major crop plants, such as Gramineae sp. (for example maize, lawn, cereals such as wheat, rye, rice, barley, oats, millet and triticale), Poaceae sp. (for example sugarcane), Asieraceae sp. (for example sunflowers), Brassicaceae sp. (for example white cabbage, red cabbage, broccoli, cauliflowers, brussel sprouts, pak choi, kohlrabi, garden radish, and also oilseed rape, mustard, horseradish and cress), Fabacae sp. (for example beans, peas), Papilionaceae sp. (for example soya beans), Solanaceae sp. (for example potatoes), Chenopodiaceae sp. (for example sugarbeet, fodderbeet, swiss chard, beetroot); crop plants and ornamental plants in garden and forest; and also in each case genetically modified varieties of these plants. Preferably, rice, banana, wheat, cucumber, pumpkin, strawberry, eggplant, tomato, Chinese cabbage, peach, tea, and tobacco are treated according to the invention.
Most preferably rice, banana, wheat, cucumber, and tea are treated according to the invention. Accordingly, the present invention further relates to the above mentioned use of the compound of formula (I) or (II), wherein the plant is rice, banana, wheat, cucumber, or tea.
The present invention further relates to above mentioned use of the compound of formula (I) or (II), wherein the plant is a transgenic plant.
Genetically modified organisms are for example plants or seeds. Genetically modified plants are plants whose genome has, stably integrated, a certain heterologous gene coding for a certain protein. Here, ''heterologous gene" is meant to be understood as a gene which confers novel agronomical properties on the transformed plant, or a gene which improves the agronomical quality of the modified plant.
As already mentioned above, it is possible to treat all plants and their parts according to the invention. In a preferred embodiment, wild plant species and plant cultivars, or those obtained by conventional biological breeding methods, such as crossing or protoplast fusion, and parts thereof, are treated. In a further preferred embodiment, transgenic plants and plant cultivars obtained by genetic engineering methods, if appropriate in combination with conventional methods (genetically modified organisms), and parts thereof are treated. The terms "parts", "parts of plants" and "plant parts" have been explained above. Particularly preferably, plants of the plant cultivars which are in each case commercially available or in use are treated according to the invention.
The preferred transgenic plants or plant cultivars (obtained by genetic engineering) which are to be treated ac- cording to the invention include all plants which, by virtue of the genetic modification, received genetic material - - which imparts particularly advantageous, useful traits to these plants. Examples of such traits are better plant growth, increased tolerance to high or low temperatures, increased tolerance to drought or to water or soil salt content, increased flowering performance, easier harvesting, accelerated maturation, higher harvest yields, higher quality and/or a higher nutritional value of the harvested products, better storage stability and/or pro- cessability of the harvested products. Further and particularly emphasized examples of such traits are a better defense of the plants against animal and microbial pests, such as against insects, mites, phytopathogenic fungi, bacteria and/or viruses, and also increased tolerance of the plants to certain herbicidally active compounds. Examples of transgenic plants which may be mentioned are the important crop plants, such as cereals (wheat, rice), maize, soya beans, potatoes, cotton, oilseed rape, and also fruit plants (with the fruits apples, pears, citrus fruits and grapes), and particular emphasis is given to maize, soya beans, potatoes, cotton, and oilseed rape. "Traits" that are emphasized are in particular increased defenseof the plants against insects by virtue of toxins formed in the plants, in particular those formed in the plants by the genetic material from Bacillus thuringiensis (for example by the genes CrylA(a), CrylA(b), CrylA(c), CryllA, CrylllA, CryIIIB2, Cry9c Cry2Ab, Cry3 Bb and CrylF and also combinations thereof) (hereinbelow referred to as "Bt plants"). Traits that are also particularly empha- sized are the increased tolerance of the plants to certain herbicidally active compounds, for example imidazoli- nones, sulphonylureas, glyphosate or phosphinotricin (for example the "PAT" gene). The genes which impart the desired traits in question can also be present in combination with one another in the transgenic plants. Examples of "Bt plants" which may be mentioned are maize varieties, cotton varieties, soya bean varieties and potato varieties which are sold under the trade names YIELD GARD® (for example maize, cotton, soya beans), KnockOut® (for example maize), StarLink® (for example maize), Bollgard® (cotton), Nucotn® (cotton) and NewLeaf® (potatoes). Examples of herbicide-tolerant plants which may be mentioned are maize varieties, cotton varieties and soya bean varieties which are sold under the trade names Roundup Ready® (tolerance to glyphosate, for example maize, cotton, soya bean), Liberty Link® (tolerance to phosphinotricin, for example oilseed rape), I I® (tolerance to imidazolinones) and STS® (tolerance to sulphonylureas, for example maize). Herbicide-resistant plants (plants bred in a conventional manner for herbicide tolerance) which may be mentioned include the varieties sold under the name Clearfield® (for example maize). Of course, these statements also apply to plant cultivars having these genetic traits or genetic traits still to be developed, which plant culti- vars will be developed and/or marketed in the future.
The fungicides used according to the invention are generally applied in form of a composition comprising at least Isotianil or Tiadinil as mentioned above. Preferably the fungicidal composition comprises agriculturally acceptable additives, solvents, carriers, surfactants, or extenders.
The present invention furthermore relates to compositions comprising the active compound combinations according to the invention. Preferably, the compositions are fungicidal compositions comprising agriculturally suitable carriers or extenders. According to the invention, carrier is to be understood as meaning a natural or synthetic, organic or inorganic substance which is mixed or combined with the active compounds for better applicability, in particular for ap- - - plication to plants or plant parts or seeds. The carrier, which may be solid or liquid, is generally inert and should be suitable for use in agriculture.
Suitable solid carriers are: for example ammonium salts and natural ground minerals, such as kaolins, clays, talc, chalk, quartz, attapulgite, montmorillonite or diatomaceous earth, and ground synthetic minerals, such as finely divided silica, alumina and natural or synthetic silicates, resins, waxes, solid fertilizers, water, alcohols, especially butanol, organic solvents, mineral oils and vegetable oils, and also derivatives thereof. It is also possible to use mixtures of such carriers. Solid carriers suitable for granules are: for example crushed and fractionated natural minerals, such as calcite, marble, pumice, sepiolite, dolomite, and also synthetic granules of inorganic and organic meals and also granules of organic material, such as sawdust, coconut shells, maize cobs and tobacco stalks. Suitable emulsifiers and/or foam-formers are: for example nonionic and anionic emulsifiers, such as polyoxyethylene fatty acid esters, polyoxyethylene fatty alcohol ethers, for example alkylaryl polyglycol ethers, alkylsulphonates, alkyl sulphates, arylsulphonates, and also protein hydrolysates. Suitable dispersants are: for example lignosulphite waste liquors and methylcellulose.
Suitable liquefied gaseous extenders or carriers are liquids which are gaseous at ambient temperature and under atmospheric pressure, for example aerosol propellants, such as butane, propane, nitrogen and carbon dioxide.
Tackifiers, such as carboxymethylcellulose and natural and synthetic polymers in the form of powders, granules and latices, such as gum arabic, polyvinyl alcohol, polyvinyl acetate, or else natural phospholipids, such as cephalins and lecithins and synthetic phospholipids can be used in the formulations. Other possible additives are mineral and vegetable oils.
If the extender used is water, it is also possible for example, to use organic solvents as auxiliary solvents. Suitable liquid solvents are essentially: aromatic compounds, such as xylene, toluene or alkylnaphthalenes, chlorinated aromatic compounds or chlorinated aliphatic hydrocarbons, such as chlorobenzenes, chloroethylenes or methylene chloride, aliphatic hydrocarbons, such as cyclohexane or paraffins, for example mineral oil fractions, mineral and vegetable oils, alcohols, such as butanol or glycol, and also ethers and esters thereof, ketones, such as acetone, methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone. strongly polar solvents, such as di- methylformamide and dimethyl sulphoxide, and also water.
The compositions according to the invention may comprise additional further components, such as, for example, surfactants. Suitable surfactants are emulsifiers, dispersants or wetting agents having ionic or nonionic properties, or mixtures of these surfactants. Examples of these are salts of polyacrylic acid, salts of lignosul- phonic acid, salts of phenolsulphonic acid or naphthalenesulphonic acid, polycondensates of ethylene oxide with fatty alcohols or with fatty acids or with fatty amines, substituted phenols (preferably alkylphenols or ar- ylphenols), salts of sulphosuccinic esters, taurine derivatives (preferably alkyl taurates), phosphoric esters of polyethoxylated alcohols or phenols, fatty esters of polyols, and derivatives of the compounds containing sulphates, sulphonates and phosphates. The presence of a surfactant is required if one of the active compounds and/or one of the inert carriers is insoluble in water and when the application takes place in water. The proportion of surfactants is between 5 and 40 per cent by weight of the composition according to the invention.
It is possible to use colorants such as inorganic pigments, for example iron oxide, titanium oxide, Prussian blue, and organic dyes, such as alizarin dyes, azo dyes and metal phthalocyanine dyes, and trace nutrients, such as salts of iron, manganese, boron, copper, cobalt, molybdenum and zinc.
If appropriate, other additional components may also be present, for example protective colloids, binders, adhe- sives, thickeners, thixotropic substances, penetrants, stabilizers, sequestering agents, complex formers. In general, the active compounds can be combined with any solid or liquid additive customarily used for formulation purposes. In general, the compositions according to the invention comprise between 0.05 and 99 per cent by weight of the active compound combination according to the invention, preferably between 10 and 70 per cent by weight, particularly preferably between 20 and 50 per cent by weight, most preferably 25 per cent by weight.
The active compound combinations or compositions according to the invention can be used as such or, depending on their respective physical and/or chemical properties, in the form of their formulations or the use forms prepared therefrom, such as aerosols, capsule suspensions, cold-fogging concentrates, warm-fogging concentrates, encapsulated granules, fine granules, flowable concentrates for the treatment of seed, ready-to-use solutions, dustable powders, emulsifiable concentrates, oil-in-water emulsions, water-in-oil emulsions, macrogranules, microgranules, oil- dispersible powders, oil-miscible flowable concentrates, oil-miscible liquids, foams, pastes, pesticide-coated seed, suspension concentrates, suspoemulsion concentrates, soluble concentrates, suspensions, wettable powders, soluble powders, dusts and granules, water-soluble granules or tablets, water-soluble powders for the treatment of seed, wettable powders, natural products and synthetic substances impregnated with active compound, and also microencapsulations in polymeric substances and in coating materials for seed, and also ULV cold-fogging and warm- fogging formulations.
The formulations mentioned can be prepared in a manner known per se, for example by mixing the active com- pounds or the active compound combinations with at least one additive. Suitable additives are all customary formulation auxiliaries, such as, for example, organic solvents, extenders, solvents or diluents, solid carriers and fillers, surfactants (such as adjuvants, emulsifiers, dispersants, protective colloids, wetting agents and tackifiers), dis- persants and/or binders or fixatives, preservatives, dyes and pigments, defoamers, inorganic and organic thickeners, water repellents, if appropriate siccatives and UV stabilizers, gibberellins and also water and further processing auxiliaries. Depending on the formulation type to be prepared in each case, further processing steps such as, for example, wet grinding, dry grinding or granulation may be required.
Organic diluents that may be present are all polar and non-polar organic solvents that are customarily used for such purposes. Preferred are ketones, such as methyl isobutyl ketone and cyclohexanone, furthermore amides, such as dimethylfoimamide and alkanecarboxamides, such as N.N-dimethyldecanamide and N,N-dimethyl- octanamide, furthermore cyclic compounds, such as N-methylpyrrolidone, N-octylpyrrolidone, N-dodecyl- 2 pyrrolidone, N-octylcaprolactam, N-dodecylcaprolactam and butyrolactone, additionally strongly polar solvents, such as dimethyl sulphoxide, furthermore aromatic hydrocarbons, such as xylene, Solvesso™, mineral oils, such as white spirit, petroleum, alkylbenzenes and spindle oil, moreover esters, such as propylene glycol mono- methyl ether acetate, dibutyl adipate, hexyl acetate, heptyl acetate, tri-n-butyl citrate and di-n-butyl phthalate, and furthermore alcohols, such as, for example, benzyl alcohol and l -methoxy-2-propanol.
Solid carriers suitable for granules are: for example crushed and fractionated natural minerals, such as calcite, marble, pumice, sepiolite, dolomite, and also synthetic granules of inorganic and organic meals and also granules of organic material, such as sawdust, coconut shells, maize cobs and tobacco stalks.
Suitable surfactants (adjuvants, emulsifiers, dispersants, protective colloids, wetting agents and tackifiers) are customary ionic and nonionic substances. Examples which may be mentioned are ethoxylated nonylphenols, polyalkylene glycol ethers of straight-chain or branched alcohols, products of reactions of alkylphenols with ethylene oxide and/or propylene oxide, products of reactions of fatty amines with ethylene oxide and/or propylene oxide, furthermore fatty esters, alkylsulphonates. alky I sulphates, alky I ether sulphates, alkyl ether phosphates, aryl sulphates, ethoxylated arylalkylphenols, such as, for example, tristyrylphenol ethoxylates, further- more ethoxylated and propoxylated arylalkylphenols and also sulphated or phosphated arylalkylphenol ethoxylates or ethoxy- and propoxylates. Mention may furthermore be made of natural and synthetic water-soluble polymers, such as lignosulphonates, gelatine, gum arabic, phospholipids, starch, hydrophobically modified starch and cellulose derivatives, in particular cellulose esters and cellulose ethers, furthermore polyvinyl alcohol, polyvinyl acetate, polyvinylpyrrolidone, polyacrylic acid, polymethacrylic acid and copolymers of (meth)acrylic acid and (meth)acrylic acid esters, and moreover also alkali metal hydroxide-neutralized copoly¬ mers of methacrylic acid and methacrylic ester and condensates of optionally substituted naphthalenesulphonic acid salts with formaldehyde.
Suitable solid fillers and carriers are all substances customarily used for this purpose in crop pretection compositions. Inorganic particles, such as carbonates, silicates, sulphates and oxides having a mean particle size of from 0.005 to 20 pm, particularly preferably from 0.02 to 10 pm. may be mentioned as being preferred. Examples which may be mentioned are ammonium sulphate, ammonium phosphate, urea, calcium carbonate, calcium sulphate, magnesium sulphate, magnesium oxide, aluminium oxide, silicon dioxide, finely divided silicic acid, silica gels, natural and synthetic silicates and alumosilicates and vegetable products such as cereal meal, wood powder and cellulose powder. Suitable colorants that may be present in the seed dressing formulations to be used according to the invention include all colorants customary for such purposes. Use may be made both of pigments, of sparing solubility in water, and of dyes, which are soluble in water. Examples that may be mentioned include the colorants known under the designations Rhodamin B, C.I. Pigment Red 1 12 and C.l. Solvent Red 1. The colorants used can be inorganic pigments, for example iron oxide, titanium oxide, Prussian Blue, and organic dyes, such as alizarin, azo and metal phthalocyanine dyes, and trace nutrients, such as salts of iron, manganese, boron, copper, cobalt, molybdenum and zinc. _ _
Suitable wetting agents that may be present in the seed dressing formulations to be used according to the invention include all substances which promote wetting and are customary in the formulation of agrochemical ly active compounds. Preference is given to using alkylnaphthalenesulphonates, such as diisopropyl- or diisobu- tylnaphthalenesulphonates. Suitable dispersants and/or emulsifiers that may be present in the seed dressing formulations to be used according to the invention include all nonionic, anionic and cationic dispersants which are customary in the formulation of agrochemically active compounds. Preference is given to using nonionic or anionic dispersants or mixtures of nonionic or anionic dispersants. Particularly suitable nonionic dispersants are ethylene oxide/propylene oxide block polymers, alkylphenol polyglycol ethers, and also tristryrylphenol polyglycol ethers and their phos- phated or sulphated derivatives. Particularly suitable anionic dispersants are lignosulphonates, polyacrylic acid salts and arylsulphonate/formaldehyde condensates.
Defoamers that may be present in the seed dressing formulations to be used according to the invention include all foam-inhibiting compounds which are customary in the formulation of agrochemically active compounds. Preference is given to using silicone defoamers, magnesium stearate, silicone emulsions, long-chain alcohols, fatty acids and their salts and also organofluorine compounds and mixtures thereof.
Preservatives that may be present in the seed dressing formulations to be used according to the invention include all compounds which can be used for such purposes in agrochemical compositions. By way of example, mention may be made of dichlorophen and benzyl alcohol hemiformal.
Secondary thickeners that may be present in the seed dressing formulations to be used according to the invention include all compounds which can be used for such purposes in agrochemical compositions. Preference is given to cellulose derivatives, acrylic acid derivatives, polysaccharides, such as xanthan gum or Veegum, modified clays, phyllosilicates, such as attapulgite and bentonite, and also finely divided silicic acids.
Suitable adhesives that may be present in the seed dressing formulations to be used according to the invention include all customary binders which can be used in seed dressings. Polyvinylpyrrolidone, polyvinyl acetate, polyvinyl alcohol and tylose may be mentioned as being preferred.
Suitable gibberellins that may be present in the seed dressing formulations to be used according to the invention are preferably the gibberellins A l , A3 (= gibberellic acid), A4 and A7; particular preference is given to using gib- berellic acid. The gibberellins are known (cf. R. Wegler "Chemie der Pflanzenschutz- and Schad- lingsbekampfungsmittel" [Chemistry of Crop Protection Agents and Pesticides], Vol. 2, Springer Verlag, 1970. pp. 401 -412).
The formulations generally comprise between 0.1 and 95% by weight of active compound, preferably between 0.5 and 90%. 3Q
The active compound combinations according to the invention can be present in commercial formulations and in the use forms prepared from these formulations as a mixture with other active compounds, such as insecticides, attractants, sterilants. bactericides, acaricides, nematicides. fungicides, growth regulators or herbicides. A mixture with fertilizers is also possible. The treatment according to the invention of the plants and plant parts with the active compound combinations or compositions is carried out directly or by action on their surroundings, habitat or storage space using customary treatment methods, for example by dipping, spraying, atomizing, irrigating, evaporating, dusting, fogging, broadcasting, foaming, painting, spreading-on, watering (drenching), drip irrigating and, in the case of propagation material, in particular in the case of seeds, furthermore as a powder for dry seed treatment, a solution for seed treatment, a water-soluble powder for slurry treatment, by incrusting, by coaling with one or more coats, etc. Preference is given to application by dipping, spraying, atomizing, irrigating, evaporating, dusting, fogging, broadcasting, foaming, painting, spreading-on, watering (drenching) and drip irrigating.
The application of the formulations is carried out in accordance with customary agricultural practice in a manner adapted to the application forms. Customary applications are, for example, dilution with water and spraying of the resulting spray liquor, application after dilution with oil, direct application without dilution, seed dressing or soil application of carrier granules.
The active compound content of the application fonns prepared from the commercial fonriuiations can vary within wide limits. The active compound concentration of the application forms can be from 0.0000001 up to 95% by weight of active compound, preferably between 0.0001 and 2% by weight. The compositions according to the invention do not only comprise ready-to-use compositions which can be applied with suitable apparatus to the plant or the seed, but also commercial concentrates which have to be diluted with water prior to use.
The invention is illustrated by - but not limited to— the examples below.
Example A. Gene Expression Profiling Experiments
Gene expression profiling experiments were performed using an A ffymetrix array of the rice whole genome under two conditions, with and without pathogen challenge. Without pathogen pressure, three weeks-old rice seedlings were drenched in an Isotianil solution (20 mg/L, at a dose range corresponding to agronomical practices) and the gene expression profile was studied at two time points. Mock treated plants were used as control. A t-test analysis using 2 fold threshold increase or decrease in gene expression (PO.001 ), identified 5 lsotianil- responsive genes at one day post-treatment (dpt) and 15 more at four dpt. This first analysis indicates that only very few genes are directly responsive to Isotianil itself. All these genes are up regulated and most of them are involved in defense responses. The first group of interesting genes codes for transcription factors involved in SA pathway. Up regulation of a NPR1 homolog gene, called NPR3 (or /V/73) was observed that is induced by 6 fold. OsWRKY45, another key regulator of induced resistance, is induced by 2.9 fold (PO.0017). Other tran- scription factors implicated in SA pathway are also up regulated: OsWRKY62, OsWRKY76 with a fold change . . of 18 and 6.5 respectively. The second group of interesting genes is involved in SA catabolism such as OsSGTl coding for a SA glucosyltransferase, 13.4 fold induction, and OsBMSTl coding for a salicylate methyltransfer- ase, 7.1 fold induction (Table 2).
Table 2. Induction of expression of genes involved in SA/JA signaling pathways. Up regulated genes 4 days post- treatment (dpt) with Isotianil or Probenazole at concentrations of 20 mg/L. Fold induction compared to control.
In order to investigate whether Isotianil affects gene expression upon infection, Isotianil and mock treated three weeks-old rice seedlings were challenged by fungal infection with P. oryzae four days post-treatment. Gene expression was analyzed over two time points: 1 and 2 days post-inoculation (dpi). The same statistical test as described above was used to select differentially regulated genes. Results show that the number of differentially expressed genes in infected mock treated plants, that are susceptible, is very low at these time points.
In contrast, in infected Isotianil primed plants, that are resistant to fungal blast disease, variation in gene expression is observed as early as 1 dpi and then strongly increases at 2 dpi. Since the highest difference in gene expression between susceptible and resistant rice is observed at 2 dpi, the analysis was first focused on this time point. At 2 dpi, in Isotianil primed plants, with a cut off set above 2, a total of 481 genes are differentially expressed in response to infection, most of them being up regulated. Thirteen percent of these genes are also induced in non infected Isotianil primed plants at the same time point (data not shown). Therefore, 87% of the differentially expressed genes are specifically due to Isotianil treatment upon infection. These differentially expressed genes are implicated in diverse cellular functions and most of them are related to responses to stress and defense responses. Indeed, typical markers of SAR have been identified. A set of 17 PR genes is up regulated, including PR] a, PBZ, PR genes involved in antifungal activities such as chitinase and beta-glucanase (Table 3).
Table 3. Differential expression of genes in Isotianil primed and mock treated plants, inoculated with P. oryzae 4 days after treatment, gene expression measured 2 days after inoculation (2 dpi). The list includes part of genes up regulated by at least a factor 2 (P < 0.001 ). - -
Fold change in Fold change in
Isotianil mock treated
Locus ID Annotation primed plants plants
Defense response : Pathogenesis Related proteins
Os07g03730.1 PRl a like 5.4 2.6
Os01 g51570.1 PR2 / beta glucanase 3.1 1 .4
Os01 g47070.1 PR3 /acidic chitinase 16.9 6.4
Os03g04060.1 PR3 /basic chitinase 4.2 1 .5
Os l 2g36880.1 PBZ / P 10a 19.9 4.0
Secondary metabolism: phenylpropanoids, flavonoids
Os02g41670.1 Phenylalanine ammonia-lyase (PAL I ) 5.44 1 .55
Os l l g32650.1 Chalcone synthase (CHS) 3.68 1 .41
Os l l g02440.2 Chalcone isomerase 5.78 1 .53
Transcription factors
Os03g46440.1 NPR 1 homolog (NPR3) 6.64 1 .04
Os05g25770.1 OsWRKY45 (class III) 9.4 1 .5
Os09g25070.1 OsWR Y62 (class II) 1 8.5 1 .06
Os05g39720.1 OsWRKY70 (classl) 3.7 1.77
SA catabolism
UDP-glucosyl transferase family protein
Os09g34230.1 (OsSGTl ) 65.66 1 .4
UDP-glucosyl transferase family protein
Os09g34250.1 (OsSGTl ) 12.4 0.84
Expression of these PR genes is increased in comparison with non-treated plants. Some display a stronger induction while for other genes induction occurs only upon priming. Defense associated cellular processes were also studied such as the expression level of phenylalanine ammonia-lyase (/ Z,)-encoding genes, a key enzyme in the phenylpropanoid pathways leading to defense related secondary metabolites (e.g. phytoalexins, lignin like polymers); of chalcone synthase and of chalcone isomerase, two genes involved in the phytoalexins biosynthetic pathway. These 3 genes are activated in Isotianil primed plants while no activation is observed in non treated plants (Table 3).
Taken together these results indicate that Isotianil treated plants are potentiated for defense responses. Since transcription factors such as those belonging to WRKY classes and NRP1 are critical for expression of defense related genes, we also studied their expression at 2 dpi. Similarly to Isotianil treatment in the absence of infection, NPR1 homolog gene {NPR3) and OsWRK45 are up regulated as well as OsWRK62 (Table 3). Additional WRKY genes are also up regulated, including OsWRK70. These genes encoding transcription factor are not activated in non-treated plants. Finally OsSGTl (Os09g34230), already induced in absence of pathogen, and its close homolog Os09g34250 are induced by a factor of 65 and 12 respectively.
These first results show that Isotianil, applied at dose range used in agronomical conditions and without pathogen pressure, induces only few changes in gene expression. Nevertheless, upon pathogen challenge, it primes rice plants for an increased defense genes activation compared to simple infection.
Thus Isotianil represents a novel type of defense inducer that works by priming plant's intrinsic disease resistance mechanisms. According to these first results, Isotianil mode of action would involve the SA pathway. - -
Indeed, OsWRKY45, OsWRKY62, OsWRKY70 and OsWRKY76, which are activated by SA and by incompatible interaction between P. oryzae and rice (Y. Song, A. C-R., S.-J. Jing, Y. D-Q., in Rice Science. (2010), vol. 17, pp. 60-72 H.-S. Ryu el al. , in Plant Cell Rep. (2006), vol. 25, pp. 836-847), are also strongly induced in Isotianil primed plants. Another putative key component of the SA pathway in rice, NPR1 homolog gene (NPR3) is also induced by Isotianil. A recent study pointed up the possible direct involvement of NPR3 in defense (W. Bai el al. , in Plant Biotechnol. J. (2010) pp. 1-1 1 ). In addition, Isotianil induced resistance would directly involve SA catabolism by strongly activating OsSGTl. Its activation would probably lead to increased SAG production that is believed to be more than a reservoir for free SA in rice. The observed activation of OsBMSTl would lead to MeSA, that was reported, in tobacco, to be the systemic signal of SAR (J. Shah, in Curr. Opin. Plant Biol. (2009), vol. 1 2, pp. 459-464), would be also important for induced resistance. Isotianil- primed plants also display a potentiated SA R response upon infection, including enhanced activation of PR genes and of genes involved in secondary metabolisms such as phenylpropanoid and flavonoid pathways. Finally, Isotianil induces up regulation of key players involved in signal transduction that were suggested to be part of the priming phenomenon that also occurs in induced resistance. Example B
Table 4. Number of differentially expressed genes (down- or up regulated by at least a factor of 2) during time course of fungal infection with Pyriculaha in Isotianil primed 3 weeks-old rice seedlings compared to mock treated and Probenazole treated seedlings. Concentration of Isotianil and Probenazole: 20 mg/L. hpi: hours post- inoculation, p< 0.001
The genes down-regulated at 24 hpi were identified as (see table 5):
Table 5: Genes down-regulated 24 hpi after pre-treatment with Isotianil or Probenazole (20 mg/L).
Example C
Table 6. Expression pattern of defense genes during infection with P. oryzae in control plants and in plants pre-treated with Isotianil or Probenazole (20 mgL)
Fold change at 24 hpi Fold change at 48 hpi 25 mock treated Isotianil primed PBZ primed mock treat Isotianil PBZ primed
Locus ID Annotation plants plants plants ed plants primed plants plants
Transcription factors
LOC_Os03g46440.1 NPR1 homolog 1,58 16,01 4,77 0,95 10,45 4,96
LOC_Os01g09800.1 NH1 0,94 0,88 1,06 1,48 2,04 1,30
LOC_Os05g25770.1 OsWRKY45 L34 5,53 2,87 L54 9,39 5,61
LOC_Os09g25070.1 OsWRKY62 2,23 19,32 2,91 1,06 18,56 4,34
LOC_Os09g25060.1 OsW KY76 L71 15,89 1,99 1,02 7,58 2,71 SA catabolism
in LOC_Os09g34230.1 SA : OsSGTl 2,03 17,47 4,85 1,40 65,66 9,50
LOC_Os09g34250.1 SA : OsSGTl 1,26 6,69 1,93 0,84 12,42 1,80
—i
Secondary metabolism: phenylpropanoids, flavonoids
73
LOC_Osl2g36880.1 PR10a/PBZ inducible 1,10 0,69 0,74 3,99 19,85 10,58
LOC_Osl2g36850.1 PR 10 /Betv I related prot 1,74 1,44 2,04 16,93 77,35 46,77
LOC_Os01g71340.1 PR2 / beta glucanase 1,45 1,40 1,67 2,85 5,98 4,69
01
LOC_Os06g51060.1 PR3 /basic chitinase 1,48 1,20 1,15 1,13 2,59 1,58
Defense response : Pathoge nesis Related proteins
LOC_Os02g41670.1 PAL 1,17 1,35 1,24 1,55 5,44 2,00
LOC_Os02g41680.1 PAL 1,01 1,74 1,02 2,06 6,64 1,93
LOC_Osllg02440.2 Chalcone isomerase 1,57 2,47 1,55 1,53 5,77 2,55
LOC_Osllg32650.1 CHS Chalcone synthase 1,14 2,96 1,99 1,41 3,68 2,22
- -
Gene expression analysis using real-time quantitative PCR:
Example D: Confirmation of isotianil-priming of plant defense gene using RT-qPCR.
A set of genes, that was shown to be induced by global gene expression analysis of the Affymetrix rice microar- rays, was selected for further analysis. Selected genes included genes involved in SA signaling pathway and in direct defense such as PR genes and genes from the phenylpropanoid pathway. Expression profiling of these genes was studied upon isotianil treatment under 2 conditions, with and without pathogen pressure.
Three week old seedlings were treated with isotianil by drenching (20 mg L in 1 % acetone, 0.1 % Tween 20 solution). As previously described for microarray, to study the effect of isotianil itself, plants were sampled 4 days post-treatment (4 dpt), prior to infection. To study its effect upon infection, plants were inoculated with P. ory- zae as described previously, and harvested 2 days post-inoculation (2 dpi). Untreated non-infected or untreated and infected plants were used as control. For each condition, three biological replicates were performed. All samples were subjected to RT-qPCR analysis. For this, total RNA was reverse transcribed into cDNA using Superscript reverse transcriptase (Invitrogen). Real-time PCR was then performed using SYBR Green Mix and specific primers listed in Table 7. Gene expression level was normalized to actin (used as internal control). Data are expressed as fold change relative to calibrator samples, which are untreated and non infected control plants at the two time points, 4 dpt and 2 dpi, according to the condition studied.
Table 7: Sequences of primers used for RT-qPCR analysis of gene expression. All primers are listed 5'-3'
Accession Gene name Forward Primer Reverse Primer number_
Os05g25770 1 wrky45 trancription factor GGAATTCGGTGGTCGTCAAG GGATCTCCTTCTGCCCGTACT Os09g25070.1 wrky62 trancription factor CGCTGCCGTGCTCCAT TTGGTTC GTCAGGTC G AGTGT
Os01 g47070.1 CHTac: PR3 /acidic chitina- TCCAACTCAACCACTGTGCAA
GCCCCCAAGCCTGAGTAATT
se
Os03g04060.1 CHTb: PR3 /basic chitinase GAGCTCGCCGCTTTCTTTG CAGTTGCCCATCCACCTGTA
Os07g03730.1 PR1a TGAGATCGATTAGTCCTTTTCTTTGTT GCCGTGCGTATAGCCATTTC
Os12g36880.1 PSZ.probenazole inducible AATGAGAGCCGCAGAAATGT TCACCCATTGATGAAGCAAA
PR
Os11g06390.6 i actin GAGAGTATGATGAGTCGGGTCCAGC GACACCAACAATCCCAAACAG
AG 6
Gene induction (fold change compared to control untreated and non infected plants) at 4 dpt and at 2 dpi. A : genes involved in rice SA signaling pathway, B : genes involved in rice defense responses.
Four days after isotianil treatment, genes involved in the SA signalling pathway were over-expressed by at least a factor of 2, confirming previous data obtained with A ffymetrix microarrays. Upon infection those genes were strongly induced compared to control plants, corresponding to infection alone.
Most of the genes involved in direct defense were not induced by isotianil itself at 4 dpt. However upon infection they showed greater and/ or earlier induction in isotianil treated plants compared to control plants (infection alone). This was consistent with Affymetrix microarray data showing that isotianil primes the plants to enhanced defense responses upon pathogen attack. See Fig. 1 .1 to 1 .10.
Example E: Gene expression changes induced by different application doses of isotianil and probenazole upon infection with P. oryzae.
Three week old seedlings are treated with Isotianil or probenazole by drenching at doses ranging from 12 mg/L to 50 mg/L for isotianil and from 12 mg/L to 200 mg/L for probenazole (in 1 % acetone, 0. 1 % Tween 20 solution). Four days after treatment rice seedlings are inoculated with P. oryzae as described previously. Two days post-inoculation (2 dpi) samples are harvested. The three biological replicates were subjected to RT-qPCR analysis. The same RT-qPCR procedure as the one described previously was used. Data are presented as fold change in gene expression in treated infected plants relative to untreated infected plants.
Table 8. RT-q PCR anal s is of the isotianil and PBZ responsive genes upon infection accord ing to dose application. Data are expressed as fold change vs untreated infected plants.
Experiment Λ Experiment B Experiment C
Isotianil Proben/.ole Isotia ni l Pro benzole Isotianil Probeniole
Gene annotation
1 2 mg/L 12 mg/L 20 mg/L 20 mg/L 50 mg/L 200 mg/L
WRK Y45 1 1.6 1 1.3 13.0 6.0 13.0 1 .9
IVRK Y62 137.5 9.5 46.1 7.4 58.3 22.4
WRK Y 76 51.9 5.3 17.1 2.0 12.2 6.9
SA Signa lling pa thway
SGT! 13.4 3.0 2.6 1.6 20.6 29.9
NPR3 14.8 4.9 4.5 1.9 5.6 5.9
NPR1 5.2 2.4 1.5 1.1 2.0 2.6
PALI 10.9 5.8 8.3 2.2 4.0 4.1
4CL 3.7 1 .0 3.4 1.5 4.0 4.2
CAD 2.2 0.7 1.9 1.6 5.0 4.0
COMT 3.4 0.6 1.8 1.0 2.0 5.7
Direct defense
CHTuc 32.4 6.6 1 1.2 3.4 23.0 13.0
CHTb 20.0 7.3 4.1 2.0 16.6 9.0
PR la 18.4 7.6 4.1 1.9 2.2 12.5
PBZ 21.6 5.5 4.2 0.7 2.2 2.1
At lower doses ( 12 mg/L and 20 mg/L) genes involved in signalling as in direct defense are generally stronger or faster induced with isotianil than with probenazole. These results are consistent with the results of microarrays experiments for which a dose of 20 mg/Lfor both isotianil and probenazole was used. At 200 mg/L, probenazole response reached the level of isotianil response obtained at 50 mg/L (limit of solubility for this compound). Nevertheless, the induction of the two transcription factors, wrky62 and wrky76 was stronger with isotianil than with probenazole whatever condition tested. This difference between isotianil and probenazole in the level or in the rapidity of defense gene induction might explain why isotianil can be applied at a very low application dose range compared to probenazole.
Example F
Experimental procedure. Three week old seedlings are treated with Isotianil or probenazole by drenching (20 mg/L in 1 % acetone, 0.1 % Tween20 solution). Samples were harvested for microarray analysis at 1 and 4 days post-treatment (dpt). Mock treated plants were used as control. A fter four days of treatment, rice seedlings were inoculated with Pyricularia grisea (40 000 spores/mL). Samples were harvested at 1 and 2 days post- inoculation (dpi) and subjected to microarray analysis. At the same time points, samples from simple infection as well as controls were also investigated. A ll the experiments were performed in triplicates. In parallel, disease resistance against fungal blast was evaluated 7 dpi, by measuring disease severity (chlorotic regions) in comparison with mock treated plants.
Isotianil and probenazole biological efficiency against rice blast was evaluated using a dose range from 2.5 mg/L to 40 mg/L. Isotianil already showed an efficiency of up to 85% at the lowest dose tested, 2.5 mg/L, while probenazole showed a significant weaker efficiency (Fig. 5). Isotianil and probenazole showed similar efficiency at 20 mg/L, the dose used for microarray experiments. See Fig. 2.

Claims

Patent claims
1 . Use of an isothiazolecarboxamide of the formula I)
for inducing latent host defenses in a plant.
2. Use according to claim 1 , wherein the latent host defenses are activated in the event of an attack by a phytopathogenic pathogen or pest.
3. Use according to claim 1 or 2, wherein the latent host defenses in a plant are activated in the event of abiotic stress.
4. Use according to any of claims 1 to 3, wherein the inducing of latent host defenses in a plant comprises the priming of the intrinsic disease resistance mechanisms of a plant.
5. Use according to any of claims 1 to 4, wherein the inducing of latent host defenses in a plant maintains the strong growth and vitality of the plant.
6. Use according to any of claims I to 5, wherein the inducing of latent host defenses in a plant results in a stronger and faster induction of the expression of plant defense genes in the event of an attack by a phytopathogenic pathogen or pest or of abiotic stress, as compared to control or other plant defense inducers.
7. Use according to any of claims 1 to 6, wherein the plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest are expressed at least two fold stronger as compared to control.
8. Use according to claim 7, wherein the at least two fold stronger expression of plant defense genes can be observed 24 or 48 hours, preferably 24 hours, after an attack by a phytopathogenic pathogen or pest .
9. Use according to any of claims 1 to 8, wherein the plant defense genes induced in the event of an attack by a phytopathogenic pathogen or pest or of abiotic stress comprise genes of the SA signalling pathway and of the SAR response.
10. Use according to claim 9, wherein the genes of the SA signalling pathway are selected from the group consisting of WRKY, NPR l , NPR3, and SGT l and the SAR genes are selected from the group of PR genes and genes involved in the phenylpropanoid pathway.
1 1 . Use according to any of claims 1 to 10, wherein the compound of formula (I) or formula (II) is used in combination with at least one further agrochemically active compound.
12. Use according to any of claims 1 to 1 1 , wherein the compound of formula (1) or formula (II) is used in combination with at least one fertilizer compound.
13. Use according to any of claims 1 to 1 2, wherein the compound of formula (I) is used.
14. Use according to any of claims 1 to 13, wherein the phytopathogenic pathogen or pest is selected from the group consisting of phytopathogenic fungi, bacteria, viruses, viroids, mycoplasma-like organisms, protozoa, insects, acari, and nematodes.
15. Use according to claim 14, wherein the phytopathogenic pathogen or pest is selected from phytopathogenic fungi, bacteria, and insects.
16. Use according to any of claims 1 to 1 5, wherein the plant is rice, banana, wheat, cucumber, or tea.
17. Use according to any of claims 1 to 16, wherein the plant is a transgenic plant.
EP11805478.2A 2010-12-21 2011-12-19 Use of isothiazolecarboxamides to create latent host defenses in a plant Withdrawn EP2654426A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP11805478.2A EP2654426A2 (en) 2010-12-21 2011-12-19 Use of isothiazolecarboxamides to create latent host defenses in a plant

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP10196197A EP2468097A1 (en) 2010-12-21 2010-12-21 Use of Isothiazolecarboxamides to create latent host defenses in a plant
US201161431162P 2011-01-10 2011-01-10
PCT/EP2011/073288 WO2012084858A2 (en) 2010-12-21 2011-12-19 Use of isothiazolecarboxamides to create latent host defenses in a plant
EP11805478.2A EP2654426A2 (en) 2010-12-21 2011-12-19 Use of isothiazolecarboxamides to create latent host defenses in a plant

Publications (1)

Publication Number Publication Date
EP2654426A2 true EP2654426A2 (en) 2013-10-30

Family

ID=44534871

Family Applications (2)

Application Number Title Priority Date Filing Date
EP10196197A Ceased EP2468097A1 (en) 2010-12-21 2010-12-21 Use of Isothiazolecarboxamides to create latent host defenses in a plant
EP11805478.2A Withdrawn EP2654426A2 (en) 2010-12-21 2011-12-19 Use of isothiazolecarboxamides to create latent host defenses in a plant

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP10196197A Ceased EP2468097A1 (en) 2010-12-21 2010-12-21 Use of Isothiazolecarboxamides to create latent host defenses in a plant

Country Status (5)

Country Link
EP (2) EP2468097A1 (en)
JP (2) JP2014500290A (en)
KR (1) KR20130141606A (en)
CN (1) CN103260411A (en)
WO (1) WO2012084858A2 (en)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6456145B2 (en) * 2012-01-21 2019-01-23 バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングBayer Intellectual Property GmbH Use of host defense inducers to control bacterial harmful microorganisms in useful plants
NZ702523A (en) 2012-06-30 2016-07-29 Dow Agrosciences Llc Production of n-substituted sulfoximine pyridine n-oxides
AU2013281006B2 (en) 2012-06-30 2016-09-29 Corteva Agriscience Llc Pyridine N-oxides and processes for their preparation
BR112015001016A2 (en) * 2012-07-20 2017-08-22 Nippon Soda Co Ltd E Shizuoka Prefecture METHODS FOR PROVIDING A PLANT WITH STRESS RESISTANCE, AND FOR REDUCING PHYTOXICITY OF A PLANT DUE TO AN AGRICULTURAL CHEMICAL, AND COMPOSITION THAT CONFERS STRESS RESISTANCE TO A PLANT
US10136595B2 (en) 2013-03-15 2018-11-27 Boyce Thompson Institute For Plant Research, Inc. Compositions and methods for modulating immunity in plants
WO2014145380A2 (en) * 2013-03-15 2014-09-18 Boyce Thompson Institute For Plant Research, Inc. Compositions and methods for modulating immunity in plants
CN104770375A (en) * 2015-03-25 2015-07-15 安徽省农业科学院植物保护与农产品质量安全研究所 Sterilization composition containing isotianil and validamycin
AU2018335125B2 (en) * 2017-09-19 2023-08-24 Bayer Aktiengesellschaft Use of Isotianil against Panama disease
WO2020214901A1 (en) 2019-04-17 2020-10-22 Boyce Thompson Institute For Plant Research, Inc. Compositions and methods for modulating immunity in plants
WO2023062667A1 (en) 2021-10-11 2023-04-20 国立大学法人東北大学 Method for inducing plant disease resistance, device for inducing plant disease resistance, and agent for inducing plant disease resistance
CN116218873B (en) * 2022-02-18 2025-08-26 山东舜丰生物科技有限公司 A method for conferring resistance to 2,4-D butyrate on plants

Family Cites Families (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MA19709A1 (en) 1982-02-17 1983-10-01 Ciba Geigy Ag APPLICATION OF QUINOLEIN DERIVATIVES TO THE PROTECTION OF CULTIVATED PLANTS.
ATE103902T1 (en) 1982-05-07 1994-04-15 Ciba Geigy Ag USE OF QUINOLINE DERIVATIVES TO PROTECT CROPS.
JPS6087254A (en) 1983-10-19 1985-05-16 Japan Carlit Co Ltd:The Novel urea compound and herbicide containing the same
DE3525205A1 (en) 1984-09-11 1986-03-20 Hoechst Ag, 6230 Frankfurt PLANT PROTECTIVE AGENTS BASED ON 1,2,4-TRIAZOLE DERIVATIVES AND NEW DERIVATIVES OF 1,2,4-TRIAZOLE
DE3680212D1 (en) 1985-02-14 1991-08-22 Ciba Geigy Ag USE OF CHINOLINE DERIVATIVES FOR PROTECTING CROPS.
DE3633840A1 (en) 1986-10-04 1988-04-14 Hoechst Ag PHENYLPYRAZOLIC CARBONIC ACID DERIVATIVES, THEIR PRODUCTION AND USE AS PLANT GROWTH REGULATORS AND SAFENERS
DE3775527D1 (en) 1986-10-22 1992-02-06 Ciba Geigy Ag 1,5-DIPHENYLPYRAZOLE-3-CARBONIC ACID DERIVATIVES FOR THE PROTECTION OF CROPS.
DE3808896A1 (en) 1988-03-17 1989-09-28 Hoechst Ag PLANT PROTECTION AGENTS BASED ON PYRAZOL CARBON SEA DERIVATIVES
DE3817192A1 (en) 1988-05-20 1989-11-30 Hoechst Ag PLANT-PROTECTIVE AGENTS CONTAINING 1,2,4-TRIAZOLE DERIVATIVES AND NEW DERIVATIVES OF 1,2,4-TRIAZOLE
EP0365484B1 (en) 1988-10-20 1993-01-07 Ciba-Geigy Ag Sulfamoyl phenyl ureas
DE3939010A1 (en) 1989-11-25 1991-05-29 Hoechst Ag ISOXAZOLINE, METHOD FOR THE PRODUCTION THEREOF AND THEIR USE AS A PLANT PROTECTIVE AGENT
DE3939503A1 (en) 1989-11-30 1991-06-06 Hoechst Ag NEW PYRAZOLINE FOR THE PROTECTION OF CULTURAL PLANTS AGAINST HERBICIDES
WO1992000964A1 (en) 1990-07-05 1992-01-23 Nippon Soda Co., Ltd. Amine derivative
EP0492366B1 (en) 1990-12-21 1997-03-26 Hoechst Schering AgrEvo GmbH New 5-chloroquinolin-8-oxyalkanecarbonic acid derivatives, process for their preparation and their use as antidotes for herbicides
TW259690B (en) 1992-08-01 1995-10-11 Hoechst Ag
DE4331448A1 (en) 1993-09-16 1995-03-23 Hoechst Schering Agrevo Gmbh Substituted isoxazolines, processes for their preparation, compositions containing them and their use as safeners
DE19621522A1 (en) 1996-05-29 1997-12-04 Hoechst Schering Agrevo Gmbh New N-acylsulfonamides, new mixtures of herbicides and antidots and their use
US6294504B1 (en) 1996-09-26 2001-09-25 Syngenta Crop Protection, Inc. Herbicidal composition
DE19652961A1 (en) 1996-12-19 1998-06-25 Hoechst Schering Agrevo Gmbh New 2-fluoroacrylic acid derivatives, new mixtures of herbicides and antidots and their use
US6071856A (en) 1997-03-04 2000-06-06 Zeneca Limited Herbicidal compositions for acetochlor in rice
DE19727410A1 (en) 1997-06-27 1999-01-07 Hoechst Schering Agrevo Gmbh 3- (5-tetrazolylcarbonyl) -2-quinolones and crop protection agents containing them
DE19742951A1 (en) 1997-09-29 1999-04-15 Hoechst Schering Agrevo Gmbh Acylsulfamoylbenzoic acid amides, crop protection agents containing them and process for their preparation
DE19750012A1 (en) * 1997-11-12 1999-05-20 Bayer Ag Isothiazole carboxamides
RU15525U1 (en) 2000-07-04 2000-10-20 Федеральный научно-производственный центр закрытое акционерное общество "Научно-производственный концерн (объединение) "ЭНЕРГИЯ" DC MOTOR
FR2814471B1 (en) * 2000-09-27 2004-12-17 Centre Nat Rech Scient USE OF XYLOGLUCAN POLYMERS AND OLIGOMERS, AND DERIVED COMPOUNDS, AS PHYTOSANITARY PRODUCTS AND BIOFERTILIZERS
AR031027A1 (en) 2000-10-23 2003-09-03 Syngenta Participations Ag AGROCHEMICAL COMPOSITIONS
CN1764374B (en) 2003-03-26 2010-09-22 拜尔作物科学股份公司 Use of aromatic hydroxy compounds as safeners
DE10335726A1 (en) 2003-08-05 2005-03-03 Bayer Cropscience Gmbh Use of hydroxyaromatics as safener
DE10335725A1 (en) 2003-08-05 2005-03-03 Bayer Cropscience Gmbh Safener based on aromatic-aliphatic carboxylic acid derivatives
DE102004023332A1 (en) 2004-05-12 2006-01-19 Bayer Cropscience Gmbh Quinoxaline-2-one derivatives, crop protection agents containing them, and processes for their preparation and their use
WO2007023719A1 (en) 2005-08-22 2007-03-01 Kumiai Chemical Industry Co., Ltd. Agent for reducing chemical injury and herbicide composition with reduced chemical injury
WO2007023764A1 (en) 2005-08-26 2007-03-01 Kumiai Chemical Industry Co., Ltd. Agent for reduction of harmful effect of herbicide and herbicide composition having reduced harmful effect
JP2009514807A (en) * 2005-10-17 2009-04-09 イサグロ リチェルカ ソシエタ ア レスポンサビリタ リミタータ Compounds for the control of plant pathogens and related uses
JP4926459B2 (en) * 2005-11-21 2012-05-09 バイエルクロップサイエンス株式会社 How to reduce chemical damage
TW201309635A (en) 2006-02-10 2013-03-01 Dow Agrosciences Llc Insecticidal N-substituted (6-haloalkylpyridin-3-yl)alkyl sulfoximines
AU2007224495A1 (en) * 2006-03-14 2007-09-20 Basf Se Method of inducing virus tolerance of plants
DE102006015468A1 (en) 2006-03-31 2007-10-04 Bayer Cropscience Ag New cyclic enamine ketone derivatives useful for controlling pests, especially insects
DE102006015470A1 (en) 2006-03-31 2007-10-04 Bayer Cropscience Ag New cyclic enamine ketone derivatives useful for controlling pests, especially insects
DE102006015467A1 (en) 2006-03-31 2007-10-04 Bayer Cropscience Ag New cyclic enamine ketone derivatives useful for controlling pests, especially insects
TWI381811B (en) 2006-06-23 2013-01-11 Dow Agrosciences Llc A method to control insects resistant to common insecticides
CN101019539A (en) * 2007-02-27 2007-08-22 南开大学 Interacting composition possessing activity of resisting tobacco mosaic virus
CN100488955C (en) * 2007-03-12 2009-05-20 南开大学 New compound with activity of inducing secondary metabolism of Hypericum plant
EP2070414A1 (en) * 2007-12-11 2009-06-17 Bayer CropScience AG Active compound combinations
EP2070415A1 (en) * 2007-12-11 2009-06-17 Bayer CropScience AG Active compound combinations
EP2070413A1 (en) * 2007-12-11 2009-06-17 Bayer CropScience AG Active compound combinations
CN101265240B (en) * 2008-05-12 2010-09-08 南开大学 Method for preventing and controlling plant diseases by improving plant immunity and use thereof
CN101766171A (en) * 2008-05-12 2010-07-07 南开大学 Method for controlling plant virus harm by improving plant immunity and application thereof
CN101265241B (en) * 2008-05-12 2010-06-02 南开大学 Method for preventing and treating plant diseases by improving plant immunity and application thereof
CN102238874B (en) * 2008-10-02 2015-02-18 拜尔农作物科学股份公司 Use of sulfurous, heteroaromatic acid analogs

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2012084858A3 *

Also Published As

Publication number Publication date
CN103260411A (en) 2013-08-21
WO2012084858A2 (en) 2012-06-28
EP2468097A1 (en) 2012-06-27
JP2017061460A (en) 2017-03-30
JP2014500290A (en) 2014-01-09
WO2012084858A3 (en) 2012-08-16
KR20130141606A (en) 2013-12-26

Similar Documents

Publication Publication Date Title
EP2654426A2 (en) Use of isothiazolecarboxamides to create latent host defenses in a plant
AU2016334757B2 (en) Agricultural and horticultural fungicidal composition
EP2958430B1 (en) Use of prothioconazole to induce host defence responses
US20110287108A1 (en) Pesticide composition comprising a tetrazolyloxime derivative and a fungicide or an insecticide active substance
US8586628B2 (en) Use of Propineb as bird repellent
EP2460406A1 (en) Use of fluopyram for controlling nematodes in nematode resistant crops
US20110218107A1 (en) Use of Propineb for Physiological Curative Treatment Under Zinc Deficiency
CA3000622C (en) Fungicide composition for agricultural and horticultural use
JP2008545764A (en) Use of triazolopyrimidines to control legume rust

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20130722

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20151104

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20170419