EP2640359A2 - Novel compositions and uses of anti-hypertension agents for cancer therapy - Google Patents

Novel compositions and uses of anti-hypertension agents for cancer therapy

Info

Publication number
EP2640359A2
EP2640359A2 EP11841427.5A EP11841427A EP2640359A2 EP 2640359 A2 EP2640359 A2 EP 2640359A2 EP 11841427 A EP11841427 A EP 11841427A EP 2640359 A2 EP2640359 A2 EP 2640359A2
Authority
EP
European Patent Office
Prior art keywords
ahcm
cancer
agent
administered
tumor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP11841427.5A
Other languages
German (de)
French (fr)
Other versions
EP2640359A4 (en
Inventor
Rakesh Kumar Jain
Yves Boucher
Vikash Pal Singh Chauhan
Benjamin Diop-Frimpong
Stephen Krane
Alan L. Crane
Robert Samuel Langer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Hospital Corp
XTUIT PHARMACEUTICALS Inc
Original Assignee
General Hospital Corp
XTUIT PHARMACEUTICALS Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by General Hospital Corp, XTUIT PHARMACEUTICALS Inc filed Critical General Hospital Corp
Publication of EP2640359A2 publication Critical patent/EP2640359A2/en
Publication of EP2640359A4 publication Critical patent/EP2640359A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1271Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
    • A61K9/1273Polymersomes; Liposomes with polymerisable or polymerised bilayer-forming substances

Definitions

  • pegylated liposomal doxorubicin (DOXIL ® ), approved by the FDA, and oncolytic viruses, currently in multiple clinical trials, represent two nanotherapeutics whose size ( ⁇ 100 nm) hinders their intratumoral distribution and therapeutic effectiveness (Nemunaitis J, et al. (2001 ) J Clin Oncol 19:289-298).
  • At least two processes governing drug delivery following systemic administration namely, vascular transport throughout tissues and transvascular transport into tissues, are hindered by physiological barriers in tumors for all classes of therapeutics (Jain, R. K. & Stylianopoulos (2010) Nat Rev Clin Oncol. 139; Chauhan, V. P. et al. (2009) Biophysical journal 97, 330-336).
  • These barriers impact therapy, particularly, for patients with desmoplastic, fibrotic tumors, such as pancreatic (Olive, . P. et al. (2009) Science 324, 1457- 1461), colorectal (Halvorsen, T. B. & Seim, E.
  • Fibrotic tumors typically have a dense collagen network, which causes small interfibrillar spacing in the interstitium to retard the movement of particles larger than 10 nanometers (Netti PA, et al. (2000) Cancer Res 60:2497-2503; Pluen A, et al. (2001) Proc Natl Acad Sci USA 98:4628-4633; Ramanujan S, et al. (2002) Biophys J 83: 1650-1660; and Brown E, et al. (2003) Nat Med 9:796-800) These barriers limit the amount of drug that reaches the target cancer cells and leads to poor drug effectiveness.
  • nanotherapeutics e.g., lipid- or polymeric nanoparticles and viruses
  • protein and nucleic acid drugs e.g., lipid- or polymeric nanoparticles and viruses
  • small molecule e.g., lipid- or polymeric nanoparticles and viruses
  • the invention is based, in part, on the discovery that losartan, an angiotensin II receptor antagonist drug approved for the treatment of high blood pressure
  • losartan normalizes the collagen, interstitial matrix of solid tumors and facilitates the distribution and/or penetration of chemotherapeutics, including large molecular weight chemotherapeutics, e.g.,
  • losartan reduced collagen I levels in (e.g., reduced collagen production by) carcinoma associated fibroblasts (CAFs) isolated from breast cancer biopsies, and caused a dose-dependent reduction in stromal collagen in
  • losartan facilitates decompression of blood vessels and vascular normalization, and improves tumor perfusion and delivery of low molecular weight chemotherapeutics, thus enhancing the therapeutic effect of radiation and chemotherapeutics.
  • compositions for improving the delivery and/or efficacy of therapeutics are disclosed.
  • Methods and compositions for treating or preventing a cancer e.g., a solid tumor such as a desmoplastic tumor
  • an anti-hypertensive and/or collagen modifying agent as a single agent or in combination with a therapeutic agent
  • a therapeutic agent for example, a cancer therapeutic agent ranging in size from a large nanotherapeutic to a low molecular weight chemotherapeutics and/or oxygen radicals
  • the invention features a method of treating or preventing a hyperproliferative disorder (e.g., a cancer) in a subject, or of improving the delivery and/or efficacy of a therapy (e.g., a cancer therapy) to a subject.
  • a hyperproliferative disorder e.g., a cancer
  • a therapy e.g., a cancer therapy
  • AHCM anti-hypertensive and/or a collagen modifying agent
  • administering e.g., the cancer therapy
  • the therapy e.g., the cancer therapy
  • AHCM and anti-cancer agent under conditions, e.g., of dosage of AHCM and anti-cancer agent, sufficient to treat or prevent the disorder (e.g., the cancer or tumor), in the subject, or to improve the delivery and/or efficacy of the therapy (e.g., the cancer therapy) provided to the subject.
  • the disorder e.g., the cancer or tumor
  • the therapy e.g., the cancer therapy
  • the method includes one or more of the following:
  • AHCM AHCM
  • the therapy e.g., the cancer therapy
  • a hydrodynamic diameter of greater than about 1, 5, 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150, 200 nm, but less than 300 nm, e.g., as a nanoparticle;
  • the subject has a history of treatment (or lack of treatment) for hypertension, as described herein, e.g., the subject has not been administered a dose of an AHCM, e.g., an AHCM named herein, or any AHCM (e.g., either of a dose sufficient to substantially lower the subject's blood pressure or a sub-anti-hypertensive dose) , within 5, 10, 30, 60 or 100 days of the diagnosis of cancer or the initiation of the AHCM dosing.
  • the subject is not hypertensive, or has been hypertensive, prior to administration of the AHCM;
  • AHCM administration is initiated prior to the initiation of administration of the cancer therapy, e.g., it is initiated at least one, two, three, or five days, or one, two, three, four, five or more weeks prior to cancer therapy (e.g., the AHCM is administered at a minimum of two weeks prior to cancer therapy);
  • a dosing regimen described herein e.g., providing a first course of treatment with an AHCM at a sub-anti- hypertensive dose followed by a second, higher dose, course of treatment with an AHCM, e.g., at a dose that is at or above a standard anti-hypertensive dose (e.g., wherein the second course is administered in a time course that will counteract a hypertensive affect of an anti-cancer therapy
  • the AHCM and the therapy can be administered (at the same or different dosages) in any order and/or overlap with the therapy.
  • the AHCM is administered before the therapy (e.g., as described in step d)).
  • the AHCM is administered sequentially and concurrently with the therapy (e.g., the AHCM is administered prior to the therapy (e.g., as described in step d) and concurrently with the therapy).
  • the therapy is administered first, and the AHCM is administered after initiation of the therapy.
  • the administration of the AHCM and the therapy can be continued as clinically appropriate, for example, (i) as a combination therapy, (ii) with a period of therapy with either the AHCM or the therapy, or (iii) as a combination of (i) and (ii) in any order.
  • the AHCM is administered in an amount sufficient to alter
  • the AHCM is administered in an amount insufficient to inhibit or prevent tumor growth by itself, but sufficient to alter (e.g., enhance) the distribution or efficacy of the therapy, e.g., the cancer therapy.
  • the AHCM is administered at a dose that causes one or more of: decreases the level or production of collagen, decreases tumor fibrosis, increases interstitial tumor transport, improves tumor perfusion, or enhances penetration or diffusion, of the cancer therapeutic in a tumor or tumor vasculature, in the subject.
  • the AHCM is chosen from one or more of:
  • an angiotensin II receptor blocker (ATi blocker)
  • RAAS antagonist an antagonist of renin angiotensin aldosterone system
  • ACE angiotensin converting enzyme
  • TSP-1 thrombospondin 1
  • TGF- ⁇ transforming growth factor beta 1
  • CTGF connective tissue growth factor
  • AHCM AHCM may refer to one or more agents as described herein.
  • the method can include one, two, three or more AHCMs, alone or in combination with one or more cancer therapies.
  • the AHCM is a RAAS antagonist.
  • the RAAS antagonist is chosen from one or more of: aliskiren (TEKTURNA®,
  • RASILEZ® remikiren
  • Ro 42-5892 remikiren
  • enalkiren A-64662
  • SPP635 SPP635
  • the AHCM is an ATi inhibitor.
  • the ATi blocker is chosen from one or more of: losartan (COZAAR®), candesartan
  • the AHCM is an ACE inhibitor.
  • the ACE inhibitor is chosen from one or more of: benazepril (LOTENSIN®), captopril (CAPOTEN®), enalapril (VASOTEC®), fosinopril (MONOPRIL®), lisinopril
  • PRINIVIL® PRINIVIL®, ZESTRIL®
  • moexipril UNIVASC®
  • perindopril ACEON®
  • quinapril ACCUPRIL®
  • ramipril ALTACE®
  • trandolapril MAVIK®
  • the AHCM is a TSP-1 inhibitor.
  • the TSP- 1 inhibitor is chosen from one or more of: ABT-510, CVX-045, LSKL, or a derivative thereof.
  • the AHCM is a TGF- ⁇ inhibitor, e.g., an anti- TGF- ⁇ antibody, a TGF- ⁇ peptide inhibitor.
  • the TGF- ⁇ inhibitor is chosen from one or more of: CAT- 192, fresolimumab (GC 1008), LY 2157299, Peptide 144 (P144), SB-431542, SD-208, compounds described in U.S. Patent Serial No.
  • the AHCM is a CTGF inhibitor.
  • the CTGF inhibitor is chosen from one or more of: DN-9693, FG-3019, and compounds described in European Patent Application Publication No. 1839655, U.S. Patent Serial No. 7,622,454, or a derivative thereof.
  • exemplary AHCMs are described herein are not limiting, e.g, derivatives of AHCMs described herein can be used in the methods described herein.
  • Methods of the invention use an AHCM to potentiate a therapy (e.g., a cancer therapy).
  • a therapy e.g., a cancer therapy
  • the AHCM is administered at a dose that corresponds to a standard of care dose.
  • Standard of care doses of the AHCM are available in the art.
  • the AHCM is the ATi inhibitor, losartan
  • the standard of care dose for antihypertensive use in a human is about 25- 100 mg day *1 .
  • losartan can be administered orally in a daily schedule (once or twice a day), alone or in combination with a cancer therapy described herein.
  • Losartan can be provided in a dosage form (e.g., an oral tablet) of about 12.5 mg, 25 mg, 50 mg or 100 mg.
  • Exemplary standard of care doses for other AT] inhibitors for anti-hypertensive or anti-heart failure use in humans are as follows: 4 to 32 mg day "1 of candesartan
  • TEVETEN® eprosartan mesylate
  • TEVETEN® eprosartan mesylate
  • 150 to 300 mg day "1 of irbesartan AVAPRO®
  • olmesartan BENICAR®
  • 20 to 80 mg day "1 of telmisartin MICARDIS®
  • the AHCM is administered at a sub-anti-hypertensive dose (e.g., a dose that has no significant effect on mean arterial blood pressure when administered to a hypertensive subject; or a dose that is below a standard of care antihypertensive dose).
  • a sub-anti-hypertensive dose e.g., a dose that has no significant effect on mean arterial blood pressure when administered to a hypertensive subject; or a dose that is below a standard of care antihypertensive dose.
  • the AHCM is administered in an amount that does not substantially lower the mean arterial blood pressure of the subject, e.g., as measured after a pre-selected number of administrations at that dosage, e.g., at the steady state plasma level for a given dosage.
  • the AHCM is administered, at least once, at a dose that reduces mean arterial blood pressure in the subject by less than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%.
  • the AHCM is administered at a dose that reduces blood pressure by less than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, or less of the reduction caused by a standard of care anti-hypertensive dose for that AHCM.
  • the AHCM is administered at a dose that is less than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% of the dose of that AHCM that would bring the subject's blood pressure into the normal range, e.g, about 120 systolic and about 80 diastolic, or a dose that would bring the subjects blood pressure into the range of to 120+/-5 systolic and 80+/-5 diastolic.
  • the AHCM is administered at a dose that is less than the standard of care dose for anti-hypertensive or anti-heart failure use (e.g., a dose that is less than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, that of the standard of care dose for anti-hypertensive or anti-heart failure use).
  • Standard of care doses of the AHCM are available in the art.
  • the suboptimal anti-hypertensive drug can range from 0.25 to 17.5, 0.5 to 15, 1.3 to 12, 1.5 to 12, 2 to 12, 2 to 10, 2 to 5, 2 to 3 mg day "1 , typically, 2 mg day "1 .
  • the AHCM is losartan and is administered at a dose less than 25, 20, 15, 10, 5, 4, 3, 2, 1 mg day "1 .
  • Losartan can be administered orally in a daily schedule (once or twice a day) at a sub- anti-hypertensive dose of 2-3 mg day "1 , alone or in combination with a cancer therapeutic described herein.
  • Exemplary standard of care doses for other ATi inhibitors are as follows: 4 to 32 mg day "1 of candesartan (ATACAND®), 400 to 800 mg day 1 of eprosartan mesylate (TEVETEN®), 150 to 300 mg day 1 of irbesartan (AVAPRO®), 20 to 40 mg day "1 of olmesartan (BENICAR®), 20 to 80 mg day "1 of telmisartin
  • the AHCM is administered at a dose that is less than the standard of care dose of the antihypertensive or anti-heart failure dose (e.g., a dose that is less than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, that of the standard of care dose of the anti-hypertensive or anti-heart failure dose for other ATi inhibitors such as candesartan, eprosartan, irbesartan, olmesartan, telmisartin, and valsartan).
  • the standard of care dose of the antihypertensive or anti-heart failure dose e.g., a dose that is less than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, that of the standard
  • the AHCM is formulated in a dosage form that is less than the standard of care anti-hypertensive or anti-heart failure dosage form (e.g., a dosage form that is less than 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.15, 0.16, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, that of the standard of care dosage form).
  • the dosage form can be of about 0.5 mg-1 1 mg; 1 mg -10 mg; 1 -5 mg, or 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg or 10 mg.
  • losartan can be provided in a dosage form (e.g., an oral tablet) below 12.5 mg, e.g., about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 1 1 mg, or about 12 mg.
  • a dosage form e.g., an oral tablet below 12.5 mg, e.g., about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 1 1 mg, or about 12 mg.
  • the AHCM is formulated as a tablet (e.g., an oral tablet). In other embodiments, the AHCM is formulated for other routes of administration, e.g., subcutaneous or intravenous administration.
  • the sub-anti-hypertensive dose of the AHCM or a dose of the AHCM that is less than the standard of care dose for anti-hypertensive or anti-heart failure use can be a dose that is insufficient to inhibit or prevent tumor growth or progression if it is administed to a subject by itself.
  • the AHCM is administered at a dose that is greater than the standard of care dose for anti-hypertensive or anti-heart failure use (e.g., a dose that is greater than 1.1, 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dose for anti-hypertensive or anti-heart failure use).
  • Standard of care doses of the AHCM are available in the art; some of which are exemplified herein.
  • the AHCM is formulated in a dosage form that is greater than the standard of care anti-hypertensive or anti-heart failure dosage form (e.g., a dosage form that is greater than 1.1 , 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dosage form).
  • Standard of care dosage forms of the AHCM are available in the art; some of which are exemplified herein.
  • a dose of the AHCM that is comparble to, or greater than the standard of care anti-hypertensive or anti-heart failure dose can be a dose that is insufficient to inhibit or prevent tumor growth or progression if it is administed to a subject by itself.
  • the anti-cancer agent is administered at a greater dosage, or in a regimen that results in higher levels of the anti-cancer agent, as compared with a reference, e.g., the dosage on a package insert, the standard of care dosing, or the maximum tolerated dose (MTD).
  • the anti-cancer agent is administered at a lesser dosage, or in a regimen that results in lower levels of the anti-cancer agent, as compared with a reference, e.g., the dosage on a package insert, the standard of care dosing, or the MTD.
  • the anti-cancer agent is administered in an amount such that it is not effective to inhibit or prevent tumor growth or progression when administered by itself, but in an amount sufficient to inhibit or prevent tumor growth or progression when administered in combination with the AHCM.
  • the cancer therapy or cancer therapeutic when administered in combination with an AHCM, is administered to the subject at a dose that is less than the lowest dose that would be used in the absence of the AHCM, to treat or prevent cancer in a subject.
  • the dose of the anti-hypertenisve and/or collagen modifying agent can be a dose that is less than the lowest dose that would be used to treat a hypertensive-associated disorder or heart failure, while the dose of the cancer therapy or cancer therapeutic can be a dose that is less than the lowest dose that would be used in the absence of the AHCM, to treat or prevent cancer in a subject.
  • the dose of the cancer therapy or cancer therapeutic administered to the subject is less than the lowest dose that would be used alone to treat a patient with cancer
  • the dose of the AHCM agent administered to the subject as an adjuvant can be less than the lowest dose that would be used alone to treat cancer.
  • the dose of the AHCM agent administered to the subject as an adjuvant can be sub-anti-hypertensive dose or comparable to, or greater than the standard care dose for treatment of hypertension or heart failure.
  • the dose of the cancer therapy or cancer therapeutic administered to the subject is less than the lowest dose that would be used in the absence of the AHCM, to treat a patient with cancer
  • the dose of the AHCM agent administered to the subject as an adjuvant can be less than the lowest dose that would be used alone to treat cancer, but is sufficient to improve efficacy of a cancer therapy or delivery of a cancer therapeutic to a tumor.
  • the dose of the AHCM agent administered to the subject as an adjuvant can be sub-anti-hypertensive dose or comparable to, or greater than the standard care dose for treatment of hypertension or heart failure.
  • any agent e.g., an anti-cancer agent and/or an AHCM
  • Methods to determine the lowest dose of any agent, e.g., an anti-cancer agent and/or an AHCM, for treatment are well known within one of skill in the art.
  • a skilled artisan can determine the lowest dose of an AHCM and/or an anticancer agent effective for treatment in an animal model corresponding to a specific type of cancer, e.g., by administering the animal with different doses of the AHCM and/or anti-cancer agent and monitoring the tumor growth as compared to a control.
  • a control can be an animal treated with an anti-cancer agent alone (i.e., in the absence of the AHCM).
  • the AHCM and the therapy can be administered in combination, e.g., sequentially and/or concurrently, as described herein.
  • the AHCM and the therapy can be administered (at the same or different dosages) in any order and/or overlap with the therapy.
  • the AHCM is administered before the therapy.
  • the AHCM is administered sequentially and concurrently with the therapy (e.g., the AHCM is administered prior to the therapy and concurrently with the therapy).
  • the cancer therapy is administered first, and the AHCM is administered after initiation of the cancer therapy.
  • the administration of the AHCM and the cancer therapy can be continued as clinically appropriate (i) as a combination therapy, (ii) with a period of therapy with either the AHCM or the cancer therapy, or (iii) a combination of (i) and (ii) in any order.
  • the administration of the AHCM can be substantially continuous.
  • administration of the AHCM can be substantially continuously over a period of at least 1 , 5, 10, 24 hours; 2, 5, 10, 14 days, or longer.
  • the administration of the AHCM can be intermittent, e.g., can have gaps at pre-determined intervals, during the course of therapy.
  • two or more doses of the AHCM are administered, alone or in combination with the therapy (e.g., the cancer therapy).
  • the AHCM is administered at a suboptimal anti-hypertensive dose and an anti-hypertensive dose during the course of therapy.
  • a suboptimal anti-hypertensive dose of the AHCM can be administered prior to, or at the time, of therapy (e.g., cancer therapy) (e.g., treatment with an anti-cancer agent that increases mean arterial blood pressure, e.g, treatment with an anti-angiogenic drug (e.g., Avastin, sunitinib or sorafenib)); then followed by a second hypertensive dose of the AHCM.
  • therapy e.g., cancer therapy
  • an anti-cancer agent that increases mean arterial blood pressure e.g, treatment with an anti-angiogenic drug (e.g., Avastin, sunitinib or sorafenib)
  • an anti-angiogenic drug e.g., Avastin, sunitinib or sorafenib
  • an AHCM is administered as an entity having a hydrodynamic diameter of greater thanabout 1, 5, 10, 100, 500, or 1 ,000 nm.
  • the AHCM can be a protein, e.g., an antibody.
  • the AHCM can also be administered as a nanoparticle, e.g., a polymeric nanoparticle or a liposome, that includes the AHCM as a small molecule therapeutic or a protein, e.g., an antibody.
  • the cancer therapy is a cancer therapeutic (also referred to herein as "an anti-cancer agent") or second therapeutic agent is administered as an entity having a hydrodynamic diameter of greater than about 1 , 5, 10, 20, 50, 75, 100, 150, 200, 500, or 1 ,000 nm.
  • the anti-cancer agent can be a protein, e.g., an antibody.
  • the anti-cancer agent can also be administered as a nanoparticle, e.g., a polymeric
  • nanoparticle or a liposome that includes the anti-cancer agent as a small molecule therapeutic (i.e., a molecule having a hydrodynamic diameter of about 1 nm or less) or a protein, e.g., an antibody.
  • a small molecule therapeutic i.e., a molecule having a hydrodynamic diameter of about 1 nm or less
  • a protein e.g., an antibody.
  • an AHCM is administered as an entity having a hydrodynamic diameter of greater than about 1 nm (e.g., greater than about 1, 5, 10, 20, 50, 75, 100, 150, 200, 500, or 1,000 nm) and an anti-cancer agent is administered as an entity having a hydrodynamic diameter of about lnm or less.
  • the AHCM is present in the entity without a chemotherapeutic agent.
  • the AHCM can be formulated for extended release, e.g., in an extended release formulation for substantially continuous release for hours, days, weeks, months or years.
  • an AHCM is administered as an entity having a hydrodynamic diameter of about 1 nm, or less
  • an anti-cancer agent is administered as an entity having a hydrodynamic diameter of about 1 nm or greater (e.g., greater than about 1, 5, 10, 20, 50, 75, 100, 150, 200, 500, or 1 ,000 nm).
  • an AHCM is administered as an entity having a hydrodynamic diameter of less than, or equal to, about 1 nm and an anti-cancer agent is administered as an entity having a hydrodynamic diameter of less than about 1 nm.
  • an AHCM is administered as an entity having a hydrodynamic diameter of greater than about 1 nm (e.g., greater than about 1 , 5, 10, 20, 50, 75, 100, 150, 200, 500, or 1 ,000 nm), and an anti-cancer agent is administered as an entity having a hydrodynamic diameter of greater than about 1 nm (e.g., greater than about 1 , 5, 10, 20, 50, 75, 100, 150, 200, 500, or 1 ,000 nm).
  • the AHCM and anti-cancer agent can be in separate or the same entity.
  • the AHCM can be provided as a first nanoparticle and the anti-cancer agent provided as a second nanoparticle (e.g., where the second nanoparticle has a structural property (e.g., size or composition) or a functional property (e.g., release kinetics or a pharmacodynamic property) that differs from the first nanoparticle).
  • a structural property e.g., size or composition
  • a functional property e.g., release kinetics or a pharmacodynamic property
  • an AHCM and an anticancer agent can be provided on the same entity, e.g., in the same nanoparticle.
  • the AHCM is selected from a therapeutic entity having a hydrodynamic diameter: equal to or less than 1 or 2 nm; between 2 - 20, 10-25, 20-40, 40, 50-150 nm; between 10, 15, 20, 25, 35, 40, 45, 50- 100 nm; between 10, 15, 20, 25, 35, 40, 45, 50 -200 nm; between 10, 15, 20, 25, 35, 40, 45, 50, 75, 100, 150, 200, 300 - 500 nm; and between 10, 15, 20, 25, 35, 40, 45, 50, 75, 100, 150, 200, 300 -1000 nm; or 10, 15, 20,25, 35, 45, 50, 75, 100, 150 or 200 nm.
  • the AHCM is a small molecule therapeutic; is a protein, e.g., an antibody; or is provided in a nanoparticle.
  • the anti-cancer agent or second therapeutic agent is selected from a therapeutic entity having a hydrodynamic diameter: equal to or less than 1 or 2 nm; between 2 - 20, 10-25, 20-40, 40, 50-150 nm; between 10, 15, 20, 25, 35, 40, 45, 50- 100 nm; between 10, 15, 20, 25, 35, 40, 45, 50 -200 nm; between 10, 15, 20, 25, 35, 40, 45, 50, 75, 100, 150, 200, 300 -500 nm; and between 10, 15, 20, 25, 35, 40, 45, 50, 75, 100, 150, 200, 300 -1000 nm; or 10, 15, 20,25, 35, 45, 50, 75, 100, 150 or 200 nm.
  • the anti-cancer agent is a small molecule therapeutic with a hydrodynamic diameter of 1 nm or less; is a protein, e.g., an antibody; or is provided in a nanoparticle.
  • the AHCM, or anti-cancer agent or the second therapeutic agent each independently, can be provided as an entity having the following size ranges (in nm): a hydrodynamic diameter of less than or equal to 1 , or between 0.1 and 1.0 nm, e.g., that of a typical small molecule; a hydrodynamic diameter of between 5 and 20, or 5 and 15 nm, e.g., that of a protein, e.g., an antibody; or a hydrodynamic diameter of 10- 5,000, 20- 1 , 000, 10-500, 10-200, 10-150, or 10-100, 10-25, 20-40, 40, 50-150 nm; between 10, 15, 20, 25, 35, 40, 45, 50- 100 nm; between 10, 15, 20, 25, 35, 40, 45, 50 - 200 nm; between 10, 15, 20, 25, 35, 40, 45, 50, 75, 100, 150, 200, 300 -500 nm; and between 10, 15, 20, 25, 35, 40, 45, 50, 75, 100, 150, 200, 300 -
  • Methods described herein can be used to treat subjects having characteristics or needs defined herein.
  • a subject, or a treatment for a subject is selected on the basis of a characteristic described herein.
  • the methods described herein allow optimized selection of patients and therapies.
  • subjects can be selected or identified prior to subjecting them to any aspects of the methods described herein.
  • the subject is selected or is identified as being in need of receiving the AHCM on the basis of optimizing a therapy, e.g., the need for improved delivery and/or efficacy of the therapy (e.g., the cancer therapy).
  • a therapy e.g., the need for improved delivery and/or efficacy of the therapy (e.g., the cancer therapy).
  • the subject does not have hypertension, or is not being treated for hypertension, at the time of initiation of the AHCM treatment , or at the time of selection of the patient for AHCM administration.
  • the subject e.g., patient
  • has not been administered a dose of an AHCM e.g., an AHCM named herein, or any AHCM, within 5, 10, 30, 60 or 100 days of, the diagnosis of cancer, or the initiation of the AHCM dosing.
  • the subject e.g., a subject with normal or low blood pressure
  • a subject with normal or low blood pressure is selected or is identified on the basis of being in need of an AHCM, e.g., is selected or is identified as being in need of receiving the AHCM on the basis of optimizing a therapy, e.g., the need for improved delivery and/or efficacy of the therapy (e.g., the cancer therapy).
  • a therapy e.g., the need for improved delivery and/or efficacy of the therapy (e.g., the cancer therapy).
  • subjects who are in need of receiving the AHCM on the basis of the need for improved delivery or efficacy of the cancer therapy, or optimizing the therapy are the subjects who partially respond or do not respond to the cancer therapy alone.
  • an AHCM is selected for treating a subject, on the basis of its ability to optimize cancer treatment, e.g., improving delivery and/or efficacy of the cancer therapy.
  • the subject treated is not a hypertensive patient, e.g., does not have a medical history of high blood pressure, or has not been treated with an antihypertensive agent.
  • the subject treated has normal or low mean arterial blood pressure.
  • the subject treated has not undergone, or is not being treated with anti-hypertensive therapy.
  • the subject is in need of cancer therapy.
  • the subject is in need of, or being considered for, anti-cancer therapy (e.g., treatment with any of the anti-cancer therapeutics described herein).
  • the method includes the step of determining if the subject has a cancer (e.g., a solid or fibrotic cancer), and, responsive to said determination, administering the AHCM and the anti-cancer agent.
  • a cancer e.g., a solid or fibrotic cancer
  • the subject is at risk of developing, or having a recurrence of, a cancer, e.g., a subject with pre-neoplasia or a genetic pre-disposition for cancer (e.g., a subject having a BRCA 1 mutation; or a breast cancer patient treated with in an adjuvant setting (e.g., with tamoxifen)).
  • a cancer e.g., a subject with pre-neoplasia or a genetic pre-disposition for cancer (e.g., a subject having a BRCA 1 mutation; or a breast cancer patient treated with in an adjuvant setting (e.g., with tamoxifen)).
  • the subject has early-cancer, or more progressive (e.g., moderate), or metastatic cancer.
  • the subject has a solid, fibrotic tumor chosen from one or more of pancreatic (e.g., pancreatic adenocarcinoma), breast, colorectal, lung (e.g., small or non-small cell lung cancer), skin, ovarian, prostate, cervix, gastrointestinal (e.g., carcinoid or stromal), stomach, head and neck, kidney, or liver cancer, or a metastatic lesion thereof.
  • the subject has a hyperproliferative cancerous condition (e.g., a benign, pre-malignant or malignant condition).
  • the subject can be one at risk of having the disorder, e.g., a subject having a relative afflicted with the disorder, or a subject having a genetic trait associated with risk for the disorder.
  • the subject can be symptomatic or asymptomatic.
  • the subject harbors an alteration in an oncogenic gene or gene product.
  • the subject is a patient who is undergoing cancer therapy (e.g., the same or other anticancer agents, surgery and/or radiation).
  • the subject is a patient who has undergone cancer therapy (e.g., other anti-cancer agents, surgery and/or radiation).
  • the subject has not been treated with the cancer therapy.
  • the subject is a patient with a metastatic cancer, e.g., a metastastatic form of a cancer disclosed herein (one or more of pancreatic (e.g., pancreatic adenocarcinoma), breast, colorectal, lung (e.g., small or non-small cell lung cancer), skin, ovarian, or liver cancer.
  • a metastatic cancer e.g., a metastastatic form of a cancer disclosed herein (one or more of pancreatic (e.g., pancreatic adenocarcinoma), breast, colorectal, lung (e.g., small or non-small cell lung cancer), skin, ovarian, or liver cancer.
  • the subject is a patient having treatment-resistant cancer or hyperproliferative disorder.
  • the subject being selected for subjecting to the methods or pharmaceutical compositions herein does not have a renal disease or a disease associated with kidneys.
  • the subject treated is a mammal, e.g., a primate, typically a human (e.g., a patient having, or at risk of, a cancer or tumor as described herein).
  • a mammal e.g., a primate
  • a human e.g., a patient having, or at risk of, a cancer or tumor as described herein.
  • the subject treated has a hyperproliferative disorder, e.g., a hyperpoliferative connective tissue disorder (e.g., a hyperproliferative fibrotic disease).
  • a hyperproliferative disorder e.g., a hyperpoliferative connective tissue disorder (e.g., a hyperproliferative fibrotic disease).
  • the hyperproliferative fibrotic disease is multisystemic or organ- specific.
  • Exemplary hyperproliferative fibrotic diseases include, but are not limited to, multisystemic (e.g., systemic sclerosis, multifocal fibrosclerosis, sclerodermatous graft- versus-host disease in bone marrow transplant recipients, nephrogenic systemic fibrosis, scleroderma), and organ-specific disorders (e.g., fibrosis of the lung, liver, heart, kidney, pancreas, skin and other organs).
  • multisystemic e.g., systemic sclerosis, multifocal fibrosclerosis, sclerodermatous graft- versus-host disease in bone marrow transplant recipients, nephrogenic systemic fibrosis, scleroderma
  • organ-specific disorders e.g., fibrosis of the lung, liver, heart, kidney, pancreas, skin and other organs.
  • the subject treated has a hyperproliferative genetic disorder, e.g., a hyperproliferative genetic disorder chosen from Marfan's syndrome or Loeys- Dietz syndrome.
  • the hyperproliferative disorder (e.g., the hyperproliferative fibrotic disorder) is chosen from one or more of chronic obstructive pulmonary disease, asthma, aortic aneurysm, radiation-induced fibrosis, skeletal-muscle myopathy, diabetic nephropathy, and/or arthritis.
  • the AHCM is administered in combination with a therapy, e.g., a cancer therapy (e.g., one or more of anti-cancer agents, surgery and/or radiation).
  • a cancer therapy e.g., one or more of anti-cancer agents, surgery and/or radiation.
  • chemotherapeutic chemotherapeutic agent
  • anti-cancer agent are used interchangeably herein.
  • the administration of the AHCM and the cancer therapy can be sequential (with or without overlap) or simultaneous. Administration of the AHCM can be continuous or intermittent during the course of therapy (e.g., cancer therapy).
  • AHCM administration is initiated prior to the initiation of administration of the cancer therapy, e.g., it is initiated at least one, two, three, or five days, or one, two, three, four, five or more weeks prior to cancer therapy (e.g., the AHCM is administered at a mimimum of two weeks prior to cancer therapy). In an embodiment it is intiated no more than 5, 10, 20, 30, 60 or 120 days prior to initiation of cancer therapy.
  • AHCM administration is initiated prior to cancer therapy and the cancer therapy is not initiated until a criterion is met, e.g., a time-based criterion, e.g., administration of AHCM for a predetermined number of days or for a predetermined number of AHCM administrations.
  • the criterion is meeting a preselected level of AHCM, e.g., a preselected level in serum or plasma.
  • the criterion is meeting a preselected level of a biomarker in plasma or serum, including but not limited to, collagen I, collagen III, collagen IV, transforming growth factor beta 1 (TGF- ⁇ ), connective tissue growth factor (CTGF), or
  • the criterion is meeting a preselected level of alteration in tumor morphology.
  • the administration of the AHCM is sequential and/or concurrent with the therapy, e.g., the cancer therapy, as described herein.
  • the AHCM is administered, or a preselected level of AHCM, e.g., a plasma level, of AHCM is maintained for a preselected portion of the time the subject receives cancer therapy.
  • a preselected level of AHCM e.g., a plasma level
  • the AHCM therapy is maintained for the entire period in which the cancer therapy is administered, or for the entire period in which a preselected level of an anti-cancer agent persists in the subject.
  • therapy with the AHCM continues during the entire cancer therapy schedule.
  • administration of the AHCM is discontinued prior to cessation of the cancer therapy.
  • administration of the AHCM is continued after cessation of the cancer therapy.
  • two or more doses of the AHCM are administered, alone or in combination with the cancer therapy.
  • the AHCM is administered at a sub-anti-hypertensive dose and an anti-hypertensive dose during the course of therapy.
  • a sub-anti-hypertensive dose of the AHCM can be administered prior to, or at the time, of cancer therapy (e.g., treatment with an anti-cancer agent that increases mean arterial blood pressure, e.g, treatment with an anti-angiogenic drug (e.g., Avastin, sunitinib or sorafenib)); then followed by a subsequent hypertensive dose of the AHCM.
  • cancer therapy e.g., treatment with an anti-cancer agent that increases mean arterial blood pressure, e.g, treatment with an anti-angiogenic drug (e.g., Avastin, sunitinib or sorafenib)
  • the AHCM (alone or in combination) is administered substantially continuously over a period of, or at least 15, 30, 45 minutes; a period of, or at least, 1 , 5, 10, 24 hours; a period of, or at least, 2, 5, 10, 14 days; a period of, or at least, 3, 4, 5, 6, 7, 8 weeks; a period of, or at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 months; a period of, or at least, 1 , 2, 3, 4, 5 years, or longer.
  • the AHCM is administered as a sustained release formulation.
  • the AHCM is formulated for continuous delivery, e.g., oral, subcutaneus or intravenous continuous delivery.
  • the AHCM is administered via an implantable device, e.g., a pump (e.g., a subcutaneous pump), an implant or a depot.
  • a pump e.g., a subcutaneous pump
  • the delivery method can be optimized such that an AHCM dose as described herein (e.g., a standard, sub- hypertensive, or higher than standard dose) is administered and/or maintained in the subject for a pre-determined period (e.g., a period of, or at least: 15, 30, 45 minutes; 1, 5, 10, 24 hours 2, 5, 10, 14 days; 3, 4, 5, 6, 7, 8 weeks; 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 months; 1 , 2, 3, 4, 5 years, or longer).
  • a pre-determined period e.g., a period of, or at least: 15, 30, 45 minutes; 1, 5, 10, 24 hours 2, 5, 10, 14 days; 3, 4, 5, 6, 7, 8 weeks; 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 months; 1 , 2, 3, 4, 5 years, or longer.
  • the substantially continuously or extended release delivery or formulation of the AHCM can be used for prevention or treatment of cancer for a period of hours, days, weeks, months or years.
  • the cancer therapy is chosen from one or more of: nanotherapy (e.g., a viral cancer therapeutic agent (e.g., an oncolytic herpes simplex virus (HSV), a lipid nanoparticle (e.g., a liposomal formulation (e.g., pegylated liposomal doxorubicin (DOXIL ® )), or a polymeric nanoparticle); an antibody that binds to a cancer target; an antigene.g., a viral cancer therapeutic agent (e.g., an oncolytic herpes simplex virus (HSV), a lipid nanoparticle (e.g., a liposomal formulation (e.g., pegylated liposomal doxorubicin (DOXIL ® )), or a polymeric nanoparticle); an antibody that bind
  • RNAi or antisense RNA agent e.g., a chemotherapeutic agent (e.g., a cytotoxic or a cytostatic agent); radiation; or surgery; or any combination thereof.
  • chemotherapeutic agent e.g., a cytotoxic or a cytostatic agent
  • radiation or surgery; or any combination thereof.
  • Additional examples of anticancer therapies that can be used in combination with the AHCM are provided below.
  • the AHCM and/or the therapy is administered in combination with an inhibitor of a profibrotic pathway (a "profibrotic pathway inhibitor") (e.g., a pathway dependent- or independent of TGF-beta and/or CTGF activation).
  • a profibrotic pathway inhibitor e.g., a pathway dependent- or independent of TGF-beta and/or CTGF activation.
  • the AHCM and/or the cancer therapy is administered in combination with one or more of: an inhibitor of endothelin-1, PDGF, Wnt/beta-catenin, IGF-1, TNF-alpha, and/or IL-4.
  • the AHCM and/or the cancer therapy is administered in another embodiment.
  • the AHCM and/or the cancer therapy is administered in combination with an inhibitor of one or more of chemokine receptor type 4 (CXCR4) (e.g., AMD3100, MSX- 122); stromal- derived-factor-l(SDF- l ) (e.g., tannic acid); hedgehog (e.g., GDC-0449, cylopamine, or GANT58).
  • CXCR4 chemokine receptor type 4
  • SDF- l e.g., tannic acid
  • hedgehog e.g., GDC-0449, cylopamine, or GANT58.
  • the administration of the AHCM, the cancer therapy, and/or the profibrotic pathway inhibitor can be sequential (with or without overlap) or simultaneous (e.g., a described herein).
  • the cancer treated is an epithelial, mesenchymal or hematologic malignancy.
  • the cancer treated is a solid tumor ⁇ e.g., carcinoid, carcinoma or sarcoma), a soft tissue tumor ⁇ e.g., a heme malignancy), and a metastatic lesion, e.g., a metastatic lesion of any of the cancers disclosed herein.
  • the cancer treated is a fibrotic or desmoplastic solid tumor, e.g., a tumor having one or more of: limited tumor perfusion, compressed blood vessels, or fibrotic tumor interstitium.
  • the solid tumor is chosen from one or more of pancreatic ⁇ e.g., pancreatic adenocarcinoma), breast, colorectal, lung ⁇ e.g., small or non- small cell lung cancer), skin, ovarian, or liver cancer. Additional examples of cancers treated are described herein below.
  • the AHCM is administered in combination with a cancer therapy ⁇ e.g., one or more of anti-cancer agents, surgery and/or radiation).
  • the cancer therapy includes one or more of: a cancer therapeutic, including, for example, a nanotherapy ⁇ e.g., one or more nanotherapeutic agents, including viral cancer therapeutic agents ⁇ e.g., an oncolytic herpes simplex virus (HSV)) a lipid nanoparticle ⁇ e.g., a liposomal formulation ⁇ e.g., pegylated liposomal doxorubicin (DOXIL ® )), or a polymeric nanoparticle); one or more cancer therapeutic antibodies ⁇ e.g., anti-HER2, anti-EGFR, anti-CD20 antibodies); RNAi and antisense RNA agents; one or more chemotherapeutic agents ⁇ e.g., low molecular weight chemotherapeutic agents, including a cytotoxic or a cytostatic agent)); radiation; or
  • any combination of one or more AHCMs and one or more therapeutic modalities ⁇ e.g., first, second, third) nanotherapeutic agent, antibody agent, low molecular weight chemotherapeutic agent, radiation can be used.
  • Exemplary cancer therapeutics include, but are not limited to, nanotherapeutic agents ⁇ e.g., one or more lipid nanoparticles ⁇ e.g., a liposomal formulation ⁇ e.g., pegylated liposomal doxorubicin (DOXIL ® ) or liposomal paclitaxel ⁇ e.g., Abraxane®)), or a polymeric nanoparticle); ; one or more low molecular weight chemotherapeutics ⁇ e.g., gemcitabine, cisplatin, epirubicin, 5-fluorouracil, paclitaxel, oxaliplatin, or leucovorin); one or more antibodies against cancer targets ⁇ e.g., growth factor receptor such as HER
  • the chemotherapeutic agent used in combination with the AHCM is a cytotoxic or a cytostatic agent.
  • cytotoxic agents include antimicrotubule agents, topoisomerase inhibitors (e.g., irinotecan), or taxanes (e.g., docetaxel), antimetabolites, mitotic inhibitors, alkylating agents, intercalating agents, agents capable of interfering with a signal transduction pathway, agents that promote apoptosis and radiation.
  • the methods can be used in combination with immunodulatory agents, e.g., IL-1, 2, 4, 6, or 12, or interferon alpha or gamma, or immune cell growth factors such as GM-CSF.
  • the AHCM alone or in combination with one or more cancer therapies described herein, are administered for cancer prevention (e.g., alone or in combination with cancer-prevention agents), during periods of active disorder, or during a period of remission or less active disorder.
  • the AHCM, alone or in combination with one or more cancer therapies described herein, can be administered for cancer prevention, before treatment or prevention, concurrently with treatment or prevention, post-treatment or prevention, or during remission of the disorder.
  • the cancer therapy is administered simultaneously, sequentially, or a combination of both,with the AHCM.
  • the AHCM is administered alone or in combination with cancer-prevention agents, e.g., to treat or prevent cancer in high risk subjects (e.g., a subject with pre-neoplasia or a genetic pre-disposition for cancer (e.g., a subject having a BRCA1 mutation); or a breast cancer patient treated with tamoxifen).
  • cancer-prevention agents e.g., to treat or prevent cancer in high risk subjects (e.g., a subject with pre-neoplasia or a genetic pre-disposition for cancer (e.g., a subject having a BRCA1 mutation); or a breast cancer patient treated with tamoxifen).
  • the AHCM alone or in combination with the cancer therapy, is a first line treatment for the cancer, e.g., it is used in a subject who has not been previously administered another drug intended to treat the cancer.
  • the AHCM alone or in combination with the cancer therapy, is a second line treatment for the cancer, e.g., it is used in a subject who has been previously administered another drug intended to treat the cancer.
  • the AHCM alone or in combination with the cancer therapy, is a third, fourth, or greater than fourth, line treatment for the cancer, e.g., it is used in a subject who has been previously administered two, three, or more than three, other drugs intended to treat the cancer.
  • the AHCM is administered as adjunct therapy, e.g., a treatment in addition to a primary therapy.
  • the AHCM is administered as adjuvant therapy.
  • the AHCM is administered as neoadjuvant therapy.
  • the AHCM is administered to a subject prior to, or following surgical excision/removal of the cancer.
  • the AHCM is administered to a subject before, during, and/or after radiation treatment of the cancer.
  • the AHCM is administered to a subject, e.g., a cancer patient who will undergo, is undergoing or has undergone cancer therapy (e.g., treatment with a chemotherapeutic agent, radiation therapy and/or surgery).
  • a subject e.g., a cancer patient who will undergo, is undergoing or has undergone cancer therapy (e.g., treatment with a chemotherapeutic agent, radiation therapy and/or surgery).
  • the AHCM is administered prior to the cancer therapy. In other embodiments, the AHCM is administered concurrently with the cancer therapy. In yet other embodiments, the AHCM is administered prior to the cancer therapy and concurrently with the cancer therapy. In instances of concurrent administration, the AHCM can continue to be administered after the cancer therapy has ceased.
  • the AHCM is administered sequentially with the cancer therapy.
  • the AHCM can be administered before initiating treatment with, or after ceasing treatment with, the cancer therapy.
  • the administration of the AHCM overlaps with the cancer therapy, and continues after the cancer therapy has ceased.
  • the AHCM is administered concurrently, sequentially, or as a combination of concurrent administration followed by monotherapy with either the cancer therapy, or the AHCM.
  • the method includes administering the AHCM as a first therapeutic agent, followed by administration of a cancer therapy (e.g., treatment with a second therapeutic agent, radiation therapy and/or surgery).
  • a cancer therapy e.g., treatment with a second therapeutic agent, radiation therapy and/or surgery
  • the method includes administering a cancer therapy first (e.g., treatment with a first therapeutic agent, radiation therapy and/or surgery), followed by administering the AHCM as a second therapeutic agent.
  • the method includes administering the AHCM in combination with a second, third or more additional therapeutic agents (e.g., anti-cancer agents as described herein).
  • the AHCM and/or the anticancer agent described herein can be administered to the subject systemically (e.g., orally, parenterally, subcutaneously, intravenously, rectally, intramuscularly, intraperitoneal ly, intranasally, transdermally, or by inhalation or intracavitary installation).
  • the AHCMs are administered orally.
  • the AHCM and/or the anticancer agent are administered intratumorally (e.g., via an oncolytic virus).
  • the AHCM is administered as a pharmaceutical composition comprising one or more AHCMs, and a pharmaceutically acceptable excipient.
  • the AHCM is administered, or is present in the composition, e.g., the pharmaceutical composition (e.g., the same nanoparticle composition).
  • the AHCM and the cancer therapy are administered as separate compositions, e.g., pharmaceutical compositions (e.g., nanoparticles).
  • compositions are provided.
  • the AHCM and the cancer therapy are
  • the AHCM and the cancer therapy are administered separately, but via the same route (e.g., both orally or both intravenously).
  • the AHCM and the cancer therapy are administered by different routes (e.g., AHCM is administered orally and a cancer therapeutic is administered intravenously).
  • the AHCM and the cancer therapy are administered by different routes (e.g., AHCM is administered orally and a cancer therapeutic is administered intravenously).
  • composition e.g., pharmaceutical composition.
  • the methods of the invention can further include the step of monitoring the subject, e.g., for a change (e.g., an increase or decrease) in one or more of: tumor size; the level or signaling of one or more of transforming growth factor beta 1 (TGFpi), connective tissue growth factor (CTGF), or thrombospondin- 1 (TSP-1); tumor collagen I levels; fibrotic content, interstitial pressure; a plasma or serum biomarker, e.g., collagen I, collagen III, collagen IV, TGFpi, CTGF, TSP-1 ; levels of one or more cancer markers; the rate of appearance of new lesions, metabolism, hypoxia evolution; the appearance of new disease-related symptoms; the size of tissue mass, e.g., a decreased or stabilization; quality of life, e.g., amount of disease associated pain; histological analysis, lobular pattern, and/or the presence or absence of mitotic cells; tumor aggressivity,
  • TGFpi transforming growth factor beta 1
  • CTGF
  • vascularization of primary tumor, metastatic spread; tumor size and location can be visualized using multimodal imaging techniques; or any other parameter related to clinical outcome.
  • the subject can be monitored in one or more of the following periods: prior to beginning of treatment; during the treatment; or after one or more elements of the treatment have been administered. Monitoring can be used to evaluate the need for further treatment with the same AHCM, alone or in combination with, the same anticancer agent, or for additional treatment with additional agents. Generally, a decrease in one or more of the parameters described above is indicative of the improved condition of the subject.
  • the methods of the invention can further include the step of analyzing a nucleic acid or protein from the subject, e.g., analyzing the genotype of the subject.
  • the analysis can be used, e.g., to evaluate the suitability of, or to choose between alternative treatments, e.g., a particular dosage, mode of delivery, time of delivery, inclusion of adjunctive therapy, e.g., administration in combination with a second agent, or generally to determine the subject's probable drug response phenotype or genotype.
  • the nucleic acid or protein can be analyzed at any stage of treatment, but preferably, prior to administration of the AHCM and/or anti-cancer agent, to thereby determine appropriate dosage(s) and treatment regimen(s) of the AHCM (e.g., amount per treatment or frequency of treatments) for prophylactic or therapeutic treatment of the subject.
  • the invention features a pharmaceutically acceptable composition
  • a pharmaceutically acceptable composition comprising, in a single dosage form, an AHCM and an anti-cancer agent, e.g., a small molecule or a protein, e.g., an antibody.
  • an AHCM and an anti-cancer agent e.g., a small molecule or a protein, e.g., an antibody.
  • one or both of the AHCM and the anti-cancer agent are provided in a nanoparticle.
  • the AHCM and anti-cancer agent can be in separate or the same entity.
  • the AHCM can be provided as a first nanoparticle and the anti-cancer agent provided as a second nanoparticle (e.g., where the second nanoparticle has a structural property (e.g., size or composition) or a functional property (e.g., release kinetics or a pharmacodynamic property) that differs from the first nanoparticle).
  • a structural property e.g., size or composition
  • a functional property e.g., release kinetics or a pharmacodynamic property
  • an AHCM and an anti-cancer agent can be provided on the same entity, e.g., in the same nanoparticle.
  • the invention features a pharmaceutically acceptable composition (e.g., nanoparticle) comprising an AHCM, e.g., an AHCM described herein.
  • the AHCM is in a dosage described herein, e.g., a standard of care dosage form, a sub-anti-hypertensive dosage form, or a greater than a standard of care dosage form.
  • the AHCM is formulated in a dosage form that is according to the standard of care anti-hypertensive or anti-heart failure dosage form, e.g., a standard of care dosage form as described herein.
  • the AHCM is formulated in a dosage form that is less than the standard of care anti-hypertensive or anti-heart failure dosage form (e.g., a dosage form that is less than 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.15, 0.16, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7-fold, that of the standard of care dosage form, e.g., a standard of care dosage from as described herein).
  • the standard of care anti-hypertensive or anti-heart failure dosage form e.g., a dosage form that is less than 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.15, 0.16, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7-fold, that of the standard of care dosage form, e.g., a standard of care dosage from as described herein).
  • the AHCM is formulated in a dosage form that is greater than the standard of care anti-hypertensive or anti-heart failure dosage form (e.g., a dosage form that is greater than 1.1 , 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dosage form, e.g., a standard of care dosage from as described herein).
  • the standard of care anti-hypertensive or anti-heart failure dosage form e.g., a dosage form that is greater than 1.1 , 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dosage form, e.g., a standard of care dosage from as described herein.
  • the invention features a pharmaceutically acceptable composition
  • a pharmaceutically acceptable composition comprising an anti-cancer agent, e.g., an anti-cancer agent described herein, as a nanoparticle, e.g., a nanoparticle configured for a method described herein.
  • the invention features a therapeutic kit that includes the AHCM, alone or in combination with a therapy, e.g., an anti-cancer agent, described herein, and optionally, instructions for use, e.g., for the treatment of cancer.
  • a therapy e.g., an anti-cancer agent, described herein
  • instructions for use e.g., for the treatment of cancer.
  • the kit comprises one or more dosage for or pharmaceutical preparation or nanoparticle described herein
  • the invention features a method optimizing access to a target tissue, e.g., a cancer, or optimizing delivery to a target tissue, e.g., a cancer, of an agent, e.g., a systemically administered agent, e.g., a diagnostic or imaging agent.
  • the method comprises:
  • AHCM collagen modifying agent
  • an agent e.g., a diagnostic or imaging agent to said subject.
  • the method includes one or more of the following:
  • the AHCM is an anti-hypertensive agent and is administered at a standard of care dose, a sub-anti-hypertensive dose, or a greater than a standard of care -anti- dose;
  • the agent e.g., diagnostic or imaging agent
  • the agent has a hydrodynamic diameter of greater than 1 , 5, or 20 nm, e.g., is nanoparticle
  • the agent is an imaging agent, e.g., radiologic agent, an NMRA agent, a contrast agent; or
  • the subject is treated with a dosing regimen described herein, e.g., AHCM administration is initiated prior to administration of the agent, e.g., for at least one, two, three, or five days, or one, two, three, four, five or more weeks prior to administration of the agent.
  • a dosing regimen described herein e.g., AHCM administration is initiated prior to administration of the agent, e.g., for at least one, two, three, or five days, or one, two, three, four, five or more weeks prior to administration of the agent.
  • the AHCM is administered in an amount sufficient to alter (e.g., enhance) the distribution or efficacy of the agent. In one embodiment, the AHCM is administered in an amount sufficient to alter (e.g., enhance) the distribution or efficacy of the agent, but in an amount insufficient to inhibit or prevent tumor growth or progression by itself.
  • the AHCM is administered at a dose that causes one or more of the following: a decrease in the level or production of collagen, a decrease in tumor fibrosis, an increase in interstitial tumor transport, improvement of tumor perfusion, or enhanced penetration or diffusion, of the cancer therapeutic in a tumor or tumor vasculature, in the subject.
  • the subject is further treated with a cancer therapy, e.g., as therapy as described herein.
  • the subject is a human, or a non-human animal, e.g., a mouse, a rat, a non-human primate, horse, or cow.
  • a non-human animal e.g., a mouse, a rat, a non-human primate, horse, or cow.
  • the invention features a diagnostic kit that includes the AHCM, alone or in combination with the agent, e.g., a diagnostic or imaging agent, described herein, and optionally, instructions for use, e.g., for the diagnosis of cancer.
  • the agent e.g., a diagnostic or imaging agent, described herein, and optionally, instructions for use, e.g., for the diagnosis of cancer.
  • the invention features a method, or assay for, identifying an AHCM.
  • the method, or assay includes providing a cancer or a cancer-associated cell (e.g., a culture of a carcinoma associated fibroblast cell); contacting said cancer or a cancer-associated cell with a candidate agent; detecting a change in the cancer cell in the presence, or absence, of the candidate agent.
  • the detected change includes one or more of an increase or decrease of TGFp i level, connective tissue growth factor (CTGF) level, or collagen (e.g., collagen 1 ) level.
  • CTGF connective tissue growth factor
  • the candidate agent is chosen from one or more of: an antagonist of renin angiotensin aldosterone system (“RAAS antagonist”), an angiotensin converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (AT
  • RAAS antagonist an antagonist of renin angiotensin aldosterone system
  • ACE angiotensin converting enzyme
  • blocker an angiotensin II receptor blocker
  • TSP-1 thrombospondin 1
  • TGF- ⁇ transforming growth factor beta 1
  • CTGF connective tissue growth factor
  • TGFpi level e.g., total and/or activated TGF l
  • CTGF connective tissue growth factor
  • the method, or assay can further include the step of comparing the treated methods or assays to a reference value, e.g., a value obtained in the absence of the candidate agent, or by addition of a control agent, e.g., a positive agent (e.g., losartan), or a negative agent (e.g., saline control), and comparing the difference between the treated and control methods.
  • a control agent e.g., a positive agent (e.g., losartan), or a negative agent (e.g., saline control
  • the method, or assay can be performed in vitro, in vivo, or a combination of both.
  • the method, or assay includes: evaluating the candidate agent in vitro, e.g., using a culture of carcinoma associated cells.
  • the candidate agent is added to the culture medium; and the condition medium is analyzed for an increase or decrease of TGFpi level, connective tissue growth factor (CTGF) level, or collagen level.
  • CTGF connective tissue growth factor
  • the candidate agent is administered to a subject, e.g., an animal model, e.g., an animal tumor model.
  • the candidate agent is administered to the subject under suitable conditions; and the subject is analyzed for an increase or decrease of TGFpi level, connective tissue growth factor (CTGF) level, or collagen level.
  • CTGF connective tissue growth factor
  • the levels of these parameters are analyzed as described in the appended Examples.
  • candidate agents evaluated using the in vitro assays are tested in vivo.
  • the invention features a composition for use, or the use, of a AHCM agent, alone or in combination with an anti-cancer agent described herein for the treatment of a cancer or tumor described herein.
  • Fig. 1 is a panel a bar graphs depicting the effects of losartan (10 ⁇ /L) in total and active TGF levels, and collagen I synthesis by carcinoma associated fibroblasts
  • Figs. 2A-2B shows the effects of Losartan on collagen production in tumors.
  • Fig. 2A shows a panel of photographs showing a dose-dependent reduction in collagen levels assessed by SHG imaging in losartan-treated HSTS26T tumors, as
  • Fig. 2B shows a dose response curve of the effect of losartan doses of 10, 20 and
  • Fig. 3 is a bar graph showing a dose response of losartan vs. collagen content in HSTS26T tumors. Losartan treatment at 20 and 60 mg/kg/day led to 42% and 63%
  • Fig. 4 is a bar graph showing the effect of losartan in decreasing the mean arterial blood pressure (MABP) in mice in a dose-dependent manner.
  • MABP mean arterial blood pressure
  • Figs. 5A-5D shows the effects of Losartan in collagen levels in tumors.
  • Fig. 5A shows the results of Collagen-I and nuclei immunostaining in tumor sections in L3.6pl and MMTV control and losartan (20mg/kg/day) treated tumors.
  • Scale bar 100 ⁇ .
  • Losartan treatement e.g., at 20 mg/kg/day significantly reduced the collagen levels in the treated tumors.
  • Fig. 5B is a bar graph summarizing the effects after two weeks losartan treatment at 20mg/kg/day; losartan treatment significantly reduced the collagen I immunostaining in L3.6pl (p ⁇ 0.03) and FVB MMTV PyVT by 50% (p ⁇ 0.05) and 47% (p ⁇ 0.05), respectively.
  • Fig. 5D is a bar graph summarizing the effects of Losartan in significantly reducing the collagen-I immunostaining in HSTS26T and Mu89 by 44% (p ⁇ 0.02) and 20% (p ⁇ 0.05), respectively.
  • Fig. 6 is a panel of bar graphs showing the effects of losartan on TSP-1 , active and total TGF- ⁇ , and collagen I in HSTS26T tumors.
  • Treated animals received losartan (15 mg/kg/day) in drinking water. Tumors were excised after two weeks of treatment, homogenized and analyzed for total and activated TGF- ⁇ ⁇ levels by ELISA. Note a 3.5 fold reduction in TSP-1 , a 4 fold reduction in active TGF- ⁇ and a two fold reduction in collagen 1 after losartan treatment (p ⁇ 0.05).
  • Fig. 7 A shows the effects of losartan in decreasing tumor TSP-1 immunostaining in both MU89 and HSTS26T tumors.
  • the changes in TSP-1 after losartan treatment correspond with changes in collagen I immunostaining; TSP- 1 levels decrease in the tumor center but remain high within a 200 ⁇ from the edge of the tumor.
  • Fig. 7B is a bar graph summarizing the effects of losartan treatment in
  • Figs. 8A-8C shows the effects of: Losartan in increasing the delivery of nanoparticles and nanotherapeutics.
  • Fig. 8A shows two photograhs (control and losartan) and a bar graph summarizing the distribution of intratumorally (i.t.) injected 100 nm diameter nanoparticles in
  • HSTS26T tumors Losartan significantly increased (pO.001) the distribution of i.t.- injected nanoparticles in both tumor types (1.5 fold in HSTS26T and 4 fold in Mu89).
  • An analysis of the distribution pattern shows control tumors with fewer intratumoral nanoparticles and a majority of nanoparticles that backtracked out of the needle track and accumulated at the tumor surface.
  • treated tumors have a significant number of intratumoral nanoparticles.
  • Scale bar 100 ⁇ .
  • Fig. 8B shows two photograhs (control and losartan) and a bar graph summarizing the distribution of viral infection 24 hrs after the intratumoral injection of HSV expressing the green fluorescent protein.
  • HSV infection in control tumors is limited to the cells in close proximity to the injection site whereas losartan treated tumors have a more extensive spread of HSV infection within the tumors.
  • Scale bar 1 mm.
  • Losartan significantly increased (p ⁇ 0.05) the virus spread in HSTS26T and Mu89 tumors.
  • Fig. 8C shows two photograhs (control and losartan) and a bar graph summarizing the distribution of intravenously (i.v.) injected lOOnm diameter nanoparticles in L3.6pl tumors.
  • the nanoparticles are localized around perfused vessels.
  • Scale bar 100 ⁇ .
  • Fig. 9 is a bar graph showing the changes in diffusion coefficient in HSTS26T tumors after losartan treatment.
  • the diffusion coefficient of IgG was measured in HSTS26T tumors implanted in the dorsal window chamber of SCID mice. Treated animals received (40 mg/kg/day) losartan by i.p. injection while control animals received saline. The results show a significant increase (p ⁇ 0.04) in diffusion coefficient as measured by multiphoton fluorescence recovery after photobleaching (FRAP).
  • FRAP multiphoton fluorescence recovery after photobleaching
  • Fig. 10 is a representative distribution profile depicting fractions of injected nanospheres present as a function of the distance from a tumor vessel (penetration depth).
  • the nanosphere penetration depth was analyzed in frozen sections from tumors resected 24 hrs after the intravenous nanosphere injection.
  • the mean characteristic penetration length increased from 18 ⁇ 5 ⁇ (mean ⁇ SE) in control to 37 ⁇ 6 ⁇ in losartan-treated tumors.
  • Ten areas per tumor were analyzed in 6 control and 6 treated tumors.
  • Fig. 11A-11D shows the effects of Losartan in significantly delaying the growth of tumors treated with DOXIL® or HSV.
  • Figs. 11A-11B shows linear graphs of the results from mice bearing HSTS26T (A) and Mu89 (B) tumors treated for 2 weeks with either losartan or saline prior to the i.t. injection of HSV.
  • Losartan alone did not affect the growth of Mu89 or HSTS26T tumors.
  • the growth delay was significantly longer in HSTS26T tumors treated with losartan and HSV compared to tumors treated with HSV alone.
  • the i.t. injection of HSV did not delay the growth of Mu89 tumors, but the combined losartan and HSV treatment significantly retarded the growth of Mu89 tumors.
  • Fig. l lC shows the effect in tumor volume in mice that received losartan treatment prior to i.v. DOXIL® infusion (losartan and DOXIL®) have smaller tumors than those that received DOXIL® alone (DOXIL® alone) in L3.6pl tumors. Note that there is no difference in tumor size between saline and losartan-treated mice.
  • Figs. 12A-12B shows the relationship between the collagen structure and the virus infection and necrosis.
  • HSTS26T the dense mesh-like collagen network confined virus infection to the immediate area surrounding the injection point.
  • losartan treatment there was a reduction in the density of the network that presumably allowed virus particles to infect a larger area and thus more tumor cells.
  • Arrows indicate viable and virus infected cells, respectively.
  • Scale bar 10 ⁇ .
  • Figs. 13A-13B shows a schematic of virus distribution and infection in Mu89 (A) and HSTS26T (B) tumors.
  • the schematics show how the different collagen network structures affect virus propagation and distribution.
  • the collagen fibers (1 ) restrict the movement of virus particles (round spheres, 2) and the infection (3) of non-infected (4) cancer cells.
  • Fig. 13A Mu89 tumors, collagen bundles divide the tumor into isolated regions that cannot be traversed by virus particles. Losartan treatment destabilizes the collagen bundles and allows virus particles to move from one region to another.
  • the collagen structure is a mesh-like sieve. Virus particles can still propagate through the sieve but do not extend very far from the injection site. Losartan treatment significantly destabilizes the mesh structure in the internal regions of the tumor and allows the virus to propagate and infect a larger area.
  • Fig. 14A shows virus infection (HSV immunostaining) and necrosis 21 days after
  • Fig. 14B is a bar graph showing that there is a two-fold increase (p ⁇ 0.05) in necrosis in tumors (both HSTS26T and MU89) that received losartan prior to HSV injection.
  • Fig. 15 shows the in vivo proliferation rates for HSTS26T and MU89 after losartan treatment. Tumors were resected and stained for Ki67 to assess proliferation rates. There was no statistically significant difference in positive Ki67 staining after losartan treatment in HSTS26T and MU89 tumors. There was however a significant difference in proliferation between the two tumor types, the number of Ki67 positive cells was 3 fold higher in HSTS26T tumors.
  • Fig. 16 shows the results of PCR analysis of AGTRl expression in CAF, MU89 and HSTS26T cells.
  • MU89 cells and CAF express AGTRl while HSTS26T cells do not.
  • HUVECs were used as a positive control.
  • GAPDH levels revealed that all three samples had roughly the same amount of cDNA.
  • Figs. 17A-17D shows the effects of angiotensin blockade with AT] blockers or
  • Angiotensin blockade diminishes interstitial matrix density in mammary (MMTV) and pancreatic (L3.6PL) tumors in mice, (B) reducing compressive stress in mammary (E0771) and pancreatic (Pan-02) tumors.
  • A Angiotensin blockade
  • MMTV mammary
  • L3.6PL pancreatic
  • E0771 mammary
  • Pan-02 pancreatic
  • C This increases the fraction of perfused vessels (arrows) in tumors (E0771 shown), resulting in
  • D a normalized vascular network (E0771 shown) that is more efficient and effective at drug and oxygen delivery.
  • Figs. 18A-18D shows the effects of angiotensin blockade with AT] blockers or ACE inhibitors in improving drug transport and distribution in tumors.
  • ARB angiotensin blockade
  • B tumor oxygenation
  • B blood vessels deliver drugs more rapidly.
  • C Reorganization of the interstitial matrix also
  • D improves penetration of nanoparticles in desmoplastic tumors (L3.6PL shown) (D).
  • Figs. 19A-19E shows the effect of angiotensin blockade with AT
  • A improves the effectiveness of the low MW chemotherapeutic doxorubicin in breast cancer models
  • B slowing tumor growth
  • C increasing animal survival
  • D, E improves the effectiveness of the nanoparticle DOXIL® in pancreatic tumors (L3.6PL shown), e.g., by decreasing the tumor weight (D) and/or tumor size or volume (E).
  • the invention is based, at least in part, on the discovery that losartan, an antihypertensive agent, improves the delivery and efficacy of cancer therapeutics.
  • the abnormal matrix of tumors limits the delivery of nano-therapeutics in many types of cancer, e.g., pancreatic, breast, lung, colorectal.
  • the overgrowth of fibrous tissue impedes the movement of nanotherapeutics in tumors two mechanisms - viscoelastic and steric hindrances. Fibrous tissue is highly viscoelastic, meaning it is quite thick and stiff, and therefore slows the movement of these drugs to a small fraction of their typical speed.
  • This tissue is basically an extremely dense mesh, with small pores that are about the same size as nanotherapeutics, thus it does not allow much space for these drugs and often halts their movements by confining them close to blood vessels (in case of intravenous injection) or near the site of injection (in case of intra-tumor injection).
  • This barrier is found in all solid tumors, with possible exception of brain tumors, though it is most prominent in pancreatic, breast, lung, and colorectal cancers.
  • Nanotherapeutics owing to their large size relative to the pores that form the tumor microenvironment, are especially hindered by fibrous tissue.
  • losartan prevents the production of matrix molecules like collagen, which are a component of the dense mesh of fibrous tissue.
  • Losartan is believed to act on fibroblasts and tumor cells by inhibiting the TGF-beta and CTGF pathways, thus limiting their pro-fibrotic activity. It does so by blocking the activity of the angiotensin-II type-1 receptor (ATi), which is highly expressed on both fibroblasts and tumor cells in a variety of cancers.
  • ATi angiotensin-II type-1 receptor
  • losartan blocks activity downstream of ATi in various signaling pathways, including the activation of TGF-beta and CTGF. Since these two pathways promote the production of collagen and other components of fibrotic tissue, blocking them will allow the fibrosis to subside. The result is tissue that is much more like the normal surrounding organ, and is therefore easier to penetrate.
  • losartan Treatment with losartan is shown herein to significantly reduce collagen levels - a marker of fibrosis - in several types of tumors, including pancreatic, breast, skin, and soft tissue tumors. Furthermore, reduction in fibrosis leads to improved mobility of nanotherapeutics in tumors, allowing them to penetrate tumors more easily, and allows these drugs to distribute more widely throughout tumors, making them more effective at fighting tumor growth. Hence, losartan makes nanotherapeutics more effective against cancer.
  • losartan normalizes the collagen, interstitial matrix of several solid tumors, thus facilitating the penetration of
  • chemotherapeutics such as large molecular weight (e.g., nano-) chemotherapeutics.
  • losartan reduced collagen I levels in carcinoma associated fibroblasts (CAFs) isolated from breast cancer biopsies, and caused a dose-dependent reduction in stromal collagen in desmoplastic models of human breast, pancreatic and skin tumors in mice.
  • Losartan also improved the distribution, therapeutic efficacy and/or penetration of nanopartices (e.g., oncolytic herpes simplex viruses (HSV) and pegylated liposomal doxorubicin (DOXIL ® )).
  • HSV oncolytic herpes simplex viruses
  • DOXIL ® pegylated liposomal doxorubicin
  • nanotherapeutics are not as limited by the interstitial matrix barriers, but are similarly affected by other barriers such as abnormal and collapsed blood vessels.
  • losartan facilitates decompression of blood vessels, thus improving tumor perfusion and delivery of low molecular weight chemotherapeutics, thus facilitating radiation and chemotherapeutic delivery through vascular normalization.
  • these agents improve delivery of molecules as small as oxygen - a radiation and chemo sensitizer - through vascular normalization (Figs. 18A-18B), while also enhancing the penetration of larger agents through interstitial matrix normalization (Fig. 18C, 18D).
  • these agents enhance the effectiveness of low molecular weight chemotherapeutics, as well as nanotherapeutics in breast and pancreatic cancer models - leading to reduced tumor growth and longer animal survival (Figs. 19A-19E).
  • angiotensin inhibitors ⁇ e.g., angiotensin receptor blockers
  • ACE inhibitors can enhance the delivery of therapeutics, and thus have broad applicability for combination therapy with all classes of anti-cancer agents, including low molecular weight, small-molecule chemotherapeutics, biologies, nucleic acid agents and nanoparticle therapies.
  • Angiotensin blockers offer numerous advantages over other approaches. Anti- angiogenic therapies normalize the vasculature alone and have been approved for only a limited number of indications. Meanwhile, ARBs and ACE-Is are FDA-approved as antihypertensives with manageable adverse effects. Matrix-degrading enzymes, which can normalize the collagen matrix, are not selective for tumors and can increase invasion and metastasis. ARBs and ACE-Is have no significant complications associated with matrix remodeling in normal tissues, leading to their safety as anti-hypertensives.
  • ARBs and ACE-Is can also be delivered via nanovectors containing chemotherapeutics (e.g., liposomes, nano-particles) to enhance their localization to tumors to further limit toxicity.
  • chemotherapeutics e.g., liposomes, nano-particles
  • Anti-angiogenics the only FDA-approved adjuncts that enhance drug delivery to tumors, cannot improve delivery for larger particles as they can reduce the size of "pores" in vessel walls.
  • Angiotensin blockers can improve delivery for all classes of anti-tumor diagnostics and therapies.
  • Methods and compositions for improving the delivery and/or efficacy of cancer therapeutics are disclosed.
  • Methods and compositions for treating or preventing a cancer ⁇ e.g., a solid tumor such as a desmoplastic tumor) by administering to a subject an anti-hypertensive agent, as a single agent or combination with a cancer therapeutic agent for example, a therapeutic agent ranging in size from a large nanotherapeutic to a low molecular weight chemotherapeutics and/or oxygen
  • a cancer therapeutic agent for example, a therapeutic agent ranging in size from a large nanotherapeutic to a low molecular weight chemotherapeutics and/or oxygen
  • Delivery refers to the placement of the agent(s) in sufficient proximity to one or more (or all) of:
  • the agent(s) can be, e.g., a cancer
  • a cancer therapeutic agent(s) as described herein e.g., a cancer therapeutic agent(s) as described herein
  • the cancer therapeutic agent includes, e.g., one or more of a small molecule, a protein or a nucleic acid drug, an oncolytic virus, a vaccine, an
  • the cancer therapeutic agent can be "free” or packaged or formulated into a delivery vehicle, e.g., a particle, e.g., a nanoparticle (e.g., a lipid nanoparticle, a polymeric nanoparticle, or a viral particle).
  • a delivery vehicle e.g., a particle, e.g., a nanoparticle (e.g., a lipid nanoparticle, a polymeric nanoparticle, or a viral particle).
  • Delivery of a therapeutic agent is characterized by placement of the therapeutic agent in sufficient proximity to the cell to alter an activity of the cell, e.g., to kill the cell and/or reduce its ability to divide.
  • the agent is a diagnostic or an imaging agent (e.g., one or more of a radiologic agent, an NMRA agent, a contrast agent, or the like).
  • the diagnostic or imaging agent can be "free” or packaged or formulated into a delivery vehicle.
  • Delivery of a diagnostic or imaging agent is characterized by placement of the agent in sufficient proximity to a target cell or tissue to allow detection of the target cell or tissue.
  • increased (or improved) delivery (as compared with a delivery which is the same or similar except that it is carried out in the absence of an AHCM) can include one or more of:
  • the tumor e.g., the tumor vasculature interstitial matrix, of the agent
  • tumor cells or tumor-associated cells e.g., fibroblasts
  • the agent in the tumor e.g., the tumor interstitial matrix
  • non-tumor tissue e.g., peripheral blood
  • TGF-beta pathway inhibition of the TGF-beta pathway in the tumor, e.g., in the tumor vasculature interstitial matrix;
  • increased (or improved) delivery can also include increased amount of the agent distributed to at least a portion of the tumor.
  • the increased amount of the agent delivered to the tumor in the presence of the AHCM can be distributed homogenously or heterogeneously throughout the tumor.
  • Effectiveness as used herein in the context of therapy, e.g., cancer therapy, can be characterizes as the extent to which a therapy has a desired effect, including but not limited to, alleviation of a symptom, diminishment of extent of disease, stabilized state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
  • Improved efficacy in the context of efficacy of cancer therapy, can be characterized by one or more of the following: an increase in an anti-tumor effect, of the cancer therapy, and/or a lessening of unwanted side effects (e.g., toxicity), of the cancer therapy, as compared with a treatment which is the same or similar except that it is carried out in the absence of treatment with an AHCM.
  • the increase in the anti-tumor effect of the cancer therapy includes one or more of: inhibiting primary or metastatic tumor growth; reducing primary or metastatic tumor mass or volume;
  • reducing size or number of metastatic lesions inhibiting the development of new metastatic lesions; reducing one or more of non-invasive tumor volume or metabolism; providing prolonged survival; providing prolonged progression-free survival; providing prolonged time to progression; and/or enhanced quality of life.
  • the term "improved efficacy" as used herein, with respect to a cancer therapy in combination with an AHCM can refer to an increase in reduction of primary or metastatic tumor growth by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, up to and including 100%, as compared to the reduction of primary or metastatic tumor growth during a cancer therapy alone (i.e., in the absence of an AHCM).
  • the administration of an AHCM in combination with a cancer therapy can increase the reduction of primary or metastatic tumor growth by at least about 1 -fold, at least about 2- fold, at least about 3-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, or higher, as compared to the reduction of primary or metastatic tumor growth during a cancer therapy alone (i.e., in the absence of an AHCM).
  • Methods for monitoring tumor growth in vivo are well known in the art, e.g., but not limited to, X-ray, CT scan, MRI and other art-recognized medical imaging methods.
  • the term "improved efficacy" as used herein, with respect to a cancer therapy in combination with an AHCM can refer to an increase in perfusion of an anti-cancer agent (e.g., low molecular weight therapeutics or nanotherapeutics such as DOXIL®) into a tumor, e.g., by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, up to and including 100%, as compared to perfusion of an anti-cancer agent alone (i.e., in the absence of an AHCM).
  • an anti-cancer agent e.g., low molecular weight therapeutics or nanotherapeutics such as DOXIL®
  • DOXIL® nanotherapeutics
  • the administration of an AHCM in combination with a cancer therapy can increase perfusion of an anti-cancer agent (e.g., low molecular weight therapeutics or nanotherapeutics such as DOXIL®) into a tumor, by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, or higher, as compared to the perfusion efficiency of an anti-cancer agent alone (i.e., in the absence of an AHCM).
  • an anti-cancer agent e.g., low molecular weight therapeutics or nanotherapeutics such as DOXIL®
  • Methods to measure tumor perfusion in vivo are well established in the art, including, but not limited to, positron emission tomography (PET), and ultrasound or contrast-enhanced ultrasound.
  • the term "improved efficacy" as used herein, with respect to a cancer therapy in combination with an AHCM can refer to an increase in reduction in expression level of at least one cancer biomarker (e.g., in a biological sample such as a blood sample, a serum sample, a plasma sample or a tissue biopsy), e.g., by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, up to and including 100%, as compared to the reduction in expression level of the at least one cancer biomarker when administered with a cancer therapy alone (i.e., in the absence of an AHCM).
  • a cancer biomarker e.g., in a biological sample such as a blood sample, a serum sample, a plasma sample or a tissue biopsy
  • the administration of an AHCM in combination with a cancer therapy can increase the reduction in expression level of at least one cancer biomarker (e.g., in a biological sample such as a blood sample, a serum sample, a plasma sample or a tissue biopsy) by at least about 1 -fold, at least about 2-fold, at least about 3-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, or higher, as compared to the reduction in expression level of the at least one cancer biomarker when administered with a cancer therapy alone (i.e., in the absence of an AHCM).
  • a cancer biomarker e.g., in a biological sample such as a blood sample, a serum sample, a plasma sample or a tissue biopsy
  • serum/plasma cancer biomarker can include, but are not limited to, TGF-beta 1, TGF-beta 2, CTGF, TSP-1, collagen I, collagen II, collagen III, collagen IV.
  • Expression levels of serum/plasma cancer biomarkers can be measured on a transcript level and/or a protein level, using any art-recognized analytical methods, e.g., PCR, western blot, ELISA, and/or immunostaining.
  • “Blood pressure” is usually classified based on the systolic and diastolic blood pressures.
  • “Systolic blood pressure” or Psys refers to the blood pressure in vessels during a heart beat.
  • “Diastolic blood pressure” or Pdias refers to the pressure between heartbeats.
  • a systolic or the diastolic blood pressure measurement higher than the accepted normal values for the age of the individual is classified as prehypertension or hypertension.
  • a systolic or the diastolic blood pressure measurement lower than the accepted normal values for the age of the individual is classified as hypotension.
  • a "normal" systolic pressure for an adult is typically in the range of 90-120 mmHg; a
  • normal diastolic pressure is usually in the range of 60-80 mmHg.
  • the average blood pressure can range from 1 10/65 to 140/90 mmHg for an adult; 95/65 mmHg for a 1 year infant, and 100/65 mmHg for a 6-9 year old.
  • Hypertension has several subclassifications including, prehypertension ( 120/80 to 139/89 mmHg); hypertension stage I (140/90 to 159 to 99 mmHg), hypertension stage II (greater or equal to 160/100 mmHg, and isolated systolic hypertension (greater or equal to 140/90 mmHg).
  • Isolated systolic hypertension refers to elevated systolic pressure with normal diastolic pressure and is common in the elderly. These classifications are made after averaging a patient's resting blood pressure readings taken on two or more office visits.
  • Hypertension is generally diagnosed on the basis of a persistently high blood pressure. Usually this requires three separate sphygmomanometer measurements at least one week apart. Often, this entails three separate visits to the physician's office. Initial assessment of the hypertensive patient should include a complete medical history and physical examination.
  • prehypertensive or a hypertensive stage having a systolic pressure of 120 or greater (typically, 140 or greater) and a diastolic pressure of 80 or greater (all blood pressures herein are expressed as mmHg).
  • MAP mean arterial pressure
  • CO cardiac output
  • SVR systemic vascular resistance
  • CVP central venous pressure
  • MAP (CO x SVR) + CVP.
  • MAP can be approximately determined from measurements of the systolic pressure (Psys) and the diastolic pressure (Pdias), while there is a normal resting heart rate, MAP is approximately Pdias + l/3(Psys -Pdias).
  • Anti-hypertensive agent refers to an agent (e.g., a compound, a protein) that when administered at a selected dose (referred to herein as “an anti- hypertensive dose”) reduces blood pressure, typically in a patient (e.g., a hypertensive patient).
  • an anti- hypertensive dose typically reduces blood pressure, typically in a patient (e.g., a hypertensive patient).
  • Anti-hypertensive agents are routinely used clinically to treat patients with high blood pressure at doses known in the art.
  • Exemplary anti-hypertensive agents include but are not limited to, renin angiotensin aldosterone system antagonists ("RAAS antagonists"), angiotensin converting enzyme (ACE) inhibitors, and angiotensin II receptor blockers (ATi blockers).
  • RAAS antagonists renin angiotensin aldosterone system antagonists
  • ACE angiotensin converting enzyme
  • ATi blockers
  • Sub-anti-hypertensive dose refers to a dose of an anti- hypertension agent that is typically less than the lowest dose that would be used to treat a patient for high blood pressure.
  • a sub-anti-hypertensive dose has one or more of the following properties:
  • blood pressure e.g., the mean arterial blood pressure
  • the subject e.g., a hypertensive subject
  • the ability of a dose to meet one or more of these standards can be made as measured after a preselected number of dosages, e.g., 1 , 2, 5, or 10, or after sufficient dosages that a steady state level, e.g., plasma level, is attained.
  • AHCM can be an agent having one or more of the following properties:
  • RAAS antagonist renin angiotensin aldosterone system
  • ACE angiotensin converting enzyme
  • angiotensin II receptor blocker (ATi blocker)
  • TSP-1 thrombospondin 1
  • TGF- ⁇ transforming growth factor beta 1
  • CTGF connective tissue growth factor
  • Treating typically refers to one or more of the following:
  • AHCM Agents Anti-Hypertensive and/or Collagen Modifying Agents
  • the AHCM agent used in the methods and compositions of the invention can be chosen from one or more of: an antagonist of renin angiotensin aldosterone system ("RAAS antagonist"), an angiotensin converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker ( ⁇ blocker), a thrombospondin 1 (TSP-1) inhibitor, a transforming growth factor beta 1 (TGF- ⁇ ) inhibitor, and a connective tissue growth factor (CTGF) inhibitor.
  • RAAS antagonist an antagonist of renin angiotensin aldosterone system
  • ACE angiotensin converting enzyme
  • ⁇ blocker an angiotensin II receptor blocker
  • TSP-1 thrombospondin 1
  • TGF- ⁇ transforming growth factor beta 1
  • CTGF connective tissue growth factor
  • renin angiotensin aldosterone system examples include, but are not limited to, aliskiren (TE TURNA®, RASILEZ®), remikiren (Ro 42-5892), enalkiren (A-64662), SPP635, and derivatives thereof.
  • angiotensin converting enzyme (ACE) inhibitors include, but are not limited to, benazepril (LOTENSIN®), captopril (CAPOTEN®), enalapril (VASOTEC®), fosinopril (MONOPRIL®), lisinopril (PRINIVIL®, ZESTRIL®), moexipril
  • ALT ACE® trandolapril
  • MAVIK® trandolapril
  • angiotensin II receptor blockers include, but are not limited to, losartan (COZAAR®), candesartan (ATACAND®), eprosartan mesylate (TEVETEN®), EXP 3174, irbesartan (AVAPRO®), LI 58,809, olmesartan
  • BENICAR® saralasin
  • MICARDIS® telmisartin
  • DIOVAN® valsartan
  • the ATi blocker is losartan, or a derivative thereof.
  • Losartan is an anti-hypertensive agent with miminal safety risks (Johnston CI (1995) Lancet 346: 1403-1407).
  • losartan is also an antifibrotic agent that has been shown to reduce the incidence of cardiac and renal fibrosis (Habashi JP, et al. (2006) Science 312: 1 17-121 ; and. Cohn RD, et al. (2007) Nat Med 13:204-210).
  • TGF- ⁇ active transforming growth factor- ⁇ ⁇
  • AGTR1 angiotensin II type I receptor
  • TGF- ⁇ activators like thrombospondin-1 (TSP-1)
  • Habashi JP et al. (2006) Science 312: 1 17-121 ; Cohn RD, et al. (2007) Nat Med 13:204-210; Lavoie P, et al. (2005) JHypertens 23: 1895-1903; Chamberlain JS (2007) Nat Med 13: 125-126; and Dietz HC (2010) J Clin Invest
  • Exemplary thrombospondin 1 (TSP-1 ) inhibitors include, but are not limited to, ABT-510, CVX-045, LS L, and derivatives thereof.
  • Exemplary transforming growth factor beta 1 (TGF- ⁇ ) inhibitors include, but are not limited to, CAT- 192, fresolimumab (GC 1008), LY 2157299, Peptide 144 (PI 44), SB- 431542, SD-208, compounds described in U.S. Patent Serial No. 7,846,908 and U.S. Patent Application Publication No. 201 1/0008364, and derivatives thereof.
  • CTGF connective tissue growth factor
  • beta-blockers include, but are not limited to, atenolol (TENORMIN®), betaxolol (KERLONE®), bisoprolol (ZEBETA®), metoprolol (LOPRESSOR®), metoprolol extended release (TOPROL XI®), nadolol (CORGARD®), propranolol (INDERAL®), propranolo long-acting (INDERAL LA®), timolol (BLOCADREN®), acebutolol (SECTRAL®), penbutolol (LEVATOL®), pindolol, carvedilol (COREG®), labetalol (NORMODYNE®, TRANDATE®), and derivatives thereof.
  • the AHCM agent is a TGF- ⁇ ⁇ inhibitor, e.g., an anti- TGF- ⁇ antibody, a TGF- ⁇ ⁇ peptide inhibitor.
  • the TGF- ⁇ inhibitor is chosen from one or more of: CAT- 192, fresolimumab (GC1008), LY 2157299, Peptide 144 (P144), SB-431 42, SD-208, compounds described in U.S. Patent Serial No.
  • Suitable doses for administration of the AHCM agent can be evaluated based on the standard of care anti-hypertensive doses of the AHCM agents are available in the art.
  • Exemplary standard of care anti-hypertensive and anti-heart failure doses and dosage formulations for ATi inhibitors in humans are as follows: 25-100 mg day "1 of losartan (available in a dosage form for oral administration containing 12.5 mg, 25 mg, 50 mg or 100 mg of losartan); 4 to 32 mg day “1 of candesartan (ATACAND®) (e.g., available in a dosage form for oral administration containing 4 mg, 8 mg, 16 mg, or 32 mg of candesartan); 400 to 800 mg day "1 of eprosartan mesylate (TEVETEN®) (e.g., available in a dosage form for oral administration containing 400 or 600 mg of eprosartan); 150 to 300 mg day " 1 of irbesartan (AVAPRO®) (e.g., available in a dosage form for oral administration containing 150 or 300 mg of irbesartan); 20 to 40 mg day "1 of olmesartan (BENICAR®) (available
  • Exemplary standard of care anti-hypertensive and anti-heart failure doses and dosage formulations for ACE inhibitors in humans are as follows: 10 to 40 mg day “1 of benazepril (LOTENSIN®) (Lotensin (benazepril) is supplied as tablets containing 5 mg, 10 mg, 20 mg, or 40 mg of benazepril hydrochloride for oral administration); 25 to 100 mg day "1 of captopril (CAPOTEN®) (available in a dosage form for oral administration containing 12.5 mg, 25 mg, 50 mg or 100 mg of captopril); 5 to 40 mg day "1 of enalapril (VASOTEC®) (available in a dosage form for oral administration containing 2.5 mg, 5 mg, 10 mg or 20 mg of enalapril; 10 to 40 mg day "1 of fosinopril (MONOPRIL®) (available in a dosage form for oral administration containing 10 mg, 20 mg, or 40 mg of fosinopril); 10 to 40
  • ALT ACE® ramipril
  • MAVIK® trandolapril
  • the AHCM agent is administered at a standard of care antihypertensive and anti-heart failure doses and dosage formulations, e.g., a dose or dosage formulation as described herein.
  • a sub-anti-hypertensive dose or dosage formulation of the AHCM agent is desirable, e.g., a dose of the AHCM agent that is less than the standard of care dose or dosage formulation.
  • the sub-anti-hypertensive dose or dosage formulation has a minimal effect in blood pressure in a hypertensive subject (e.g., decreases the mean arterial blood pressure in a hypertensive subject by less than 20%, 10%, or 5% or less).
  • the AHCM agent is administered at a dose or dosage formulation that is less than 0.01, 0.05, 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, that of the standard of care anti-hypertensive dose (e.g., the lower standard of care dose).
  • the dose or dosage formulation is in the range of, for example, 0.01- 0.9-fold, 0.02-0.8-fold, 0.05-0.7-fold, 0.1-0.5 fold, 0.1 -0.2-fold, that of the standard of care dose or dosage formulation for anti-hypertensive or anti-heart failure use.
  • Standard of care doses or dosage formulation of the AHCM are available in the art, some of which are exemplified herein.
  • the AHCM agent is administered at a dose or dosage formulation that is greater than the standard of care dose or dosage formulation for antihypertensive or anti-heart failure use (e.g., a dose or dosage form that is greater than 1.1 , 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dose for antihypertensive or anti-heart failure use).
  • the dose or dosage formulation is in the range of, for example, 1.1 to 10-fold, 1.5-5-fold, 1.7 to 4-fold, or 2- 3-fold, that of the standard of care dose or dosage formulation for anti-hypertensive or anti-heart failure use.
  • Standard of care doses or dosage formulation of the AHCM are available in the art, some of which are exemplified herein.
  • the standard of care dose and dosage forms are provided herein for a number of AHCMs, e.g., losartan.
  • the dose and/or dosage form is less than (or higher than) the standard of care dose and/or dosage form. In an exemplary embodiment, it is less than 0.01 , 0.02, 0.05, 0.1, 0.2, 0.5, 0.7, 0.8, 0.9-fold, that of the standard of care dose or dosage form.
  • the dose or dosage form contains an amount of AHCM that is within a range of the reduced amounts of the standard of care dose and/or dosage form.
  • an AHCM dosage form that is 0.01-0.9-fold, 0.02-0.8-fold, 0.05-0.7- fold, 0.1-0.5 fold, 0.1-0.2-fold, that of the standard of care dose or dosage form.
  • the range of the dose or the dosage form is 0.5-2.0 times a reduced dose or dosage form recited herein, so long as the dose or dosage form value is less than the standard of care dose or dosage form.
  • a standard of care dosage form for losartan is 12.5 mg.
  • the dosage form is 0.125 mg (.01 x12.5 mg); 0.625 mg (0.05 x 12.5 mg); 1.25 mg (0.1 x 12.5 mg); 2.5 mg (0.2 x 12.5 mg); or 6.25 mg (0.5 x 12.5 mg).
  • This calculation can be applied to any standard of care dose and/or dosage form for any AHCM described herein.
  • the value is less than the standard of care values. In other embodiments, the value is greater than the standard of care
  • the dose of the AHCM agent is calculated based on the
  • the dose of the AHCM agent can be a sub-anti- hypertensive dose, which does not have any anti-tumor effect, e.g., no significant effect on inhibiting or preventing tumor growth or progression when administered alone.
  • the dose of the AHCM agent can be comparable to or greater than the standard of care dose or dosage formulation for anti-hypertensive or anti-heart failure use, and does not have any anti-tumor effect, e.g., no significant effect on inhibiting or
  • the invention relates to a method of treating a hyperproliferative disorder (e.g., a cancer) by administering to a patient an AHCM agent, alone or in
  • a therapeutic agent e.g., an anti-cancer agent as described herein.
  • treatment refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disorder, such as the development or spread of cancer.
  • beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
  • Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment.
  • therapeutic treatment can refer to inhibiting or reducing tumor growth or progression after administration in accordance with the methods or administration with the pharmaceutical compositions described herein.
  • tumor growth or progression is inhibited or reduced by at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, or at least about 50%, after treatment.
  • tumor growth or progression is inhibited or reduced by more than 50%, e.g., at least about 60%, or at least about 70%, after treatment.
  • tumor growth or progression is inhibited or reduced by at least about 80%, at least about 90% or greater, as compared to a control (e.g. in the absence of the pharmaceutical composition described herein).
  • the therapeutic treatment refers to alleviation of at least one symptom associated with cancer.
  • Measurable lessening includes any statistically significant decline in a measurable marker or symptom, such as measuring a cancer biomarker, such as serum/plasma cancer biomarker in a blood sample, after treatment.
  • at least one cancer biomarker or sympton is alleviated by at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, or at least about 50%.
  • at least one cancer biomarker or sympton is alleviated by more than 50%, e.g., at least about 60%, or at least about 70%.
  • at least one cancer biomarker or sympton is alleviated by at least about 80%, at least about 90% or greater, as compared to a control (e.g. in the absence of the pharmaceutical composition described herein).
  • prevention contemplate an action that occurs before a patient begins to suffer from the regrowth of the cancer and/or which inhibits or reduces the severity of the cancer.
  • amount of a compound is an amount sufficient to provide a therapeutic benefit in the treatment of the disorder (e.g., cancer), or to delay or minimize one or more symptoms associated with the disorder (e.g., cancer).
  • a therapeutically effective amount of a compound is an amount sufficient to provide a therapeutic benefit in the treatment of the disorder (e.g., cancer), or to delay or minimize one or more symptoms associated with the disorder (e.g., cancer).
  • compound means an amount of therapeutic agent, alone or in combination with other
  • a “prophylactically effective amount” of a compound is an amount sufficient to prevent a disorder (e.g., regrowth of the cancer, or one or more symptoms associated with the cancer, or prevent its recurrence).
  • a prophylactically effective amount of a compound means an amount of the compound, alone or in combination with other therapeutic agents, which provides a prophylactic benefit in the prevention of the disorder.
  • the term “prophylactically effective amount” can encompass an amount that improves overall prophylaxis or enhances the prophylactic efficacy of another prophylactic agent.
  • the term "patient” or “subject” refers to an animal, typically a human (i.e., a male or female of any age group, e.g., a pediatric patient (e.g, infant, child, adolescent) or adult patient (e.g., young adult, middle-aged adult or senior adult) or other mammal, such as a primate (e.g., cynomolgus monkey, rhesus monkey); commercially relevant mammals such as cattle, pigs, horses, sheep, goats, cats, and/or dogs; and/or birds, including commercially relevant birds such as chickens, ducks, geese, and/or turkeys, that will be or has been the object of treatment, observation, and/or experiment.
  • a human i.e., a male or female of any age group, e.g., a pediatric patient (e.g, infant, child, adolescent) or adult patient (e.g., young adult, middle-aged adult or
  • compositions described herein can also be used to treat domesticated animals or pets such as cats and dogs.
  • cancer and “tumor” are synonymous terms.
  • cancer therapy and “cancer treatment” are synonymous terms.
  • chemotherapy chemotherapeutic
  • chemotherapeutic agent chemotherapeutic agent
  • anti-cancer agent are synonymous terms.
  • the AHCM agent alone or in combination, is a first line treatment for the cancer, i.e., it is used in a subject who has not been previously administered another drug intended to treat the cancer.
  • the AHCM agent alone or in combination, is a second line treatment for the cancer, i.e., it is used in a subject who has been previously administered another drug intended to treat the cancer.
  • the AHCM agent alone or in combination, is a third or fourth line treatment for the cancer, i.e., it is used in a subject who has been previously administered two or three other drugs intended to treat the cancer.
  • the AHCM agent is administered to a subject before, during, and/or after radiation or surgical treatment of the cancer.
  • the AHCM agent is administered, alone or in combination with a cancer therapy or an anti-cancer agent, to a subject who previously did not respond to at least one cancer therapy or anti-cancer agent, including at least two, at least three, or at least four cancer therapies or anti-cancer agents.
  • the AHCM agent can be administered to a subject in combination with the cancer therapy or anticancer agent to which he/she previously did not respond, or in combination with a cancer therapy or anti-cancer agent different from the one(s) he/she has been treated with.
  • the AHCM agent is administered as adjunct therapy, i.e., a treatment in addition to primary therapy.
  • the adjuvant effect of the AHCM administered in combination with a primary therapy can be additive.
  • the cancer is an epithelial, mesenchymal or hematologic malignancy.
  • the cancer treated is a solid tumor (e.g., carcinoid, carcinoma or sarcoma), a soft tissue tumor (e.g., a heme malignancy), and a metastatic lesion, e.g., a metastatic lesion of any of the cancers disclosed herein.
  • a solid tumor e.g., carcinoid, carcinoma or sarcoma
  • a soft tissue tumor e.g., a heme malignancy
  • a metastatic lesion e.g., a metastatic lesion of any of the cancers disclosed herein.
  • the cancer treated is a fibrotic or desmoplastic solid tumor, e.g., a tumor having one or more of: limited tumor perfusion, compressed blood vessels, or fibrotic tumor interstitium.
  • the solid tumor is chosen from one or more of pancreatic (e.g., pancreatic adenocarcinoma), breast, colorectal, lung (e.g., small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC)), skin, ovarian, liver cancer, esophageal cancer, endometrial cancer, gastric cancer, head and neck cancer, kidney, or prostate cancer.
  • hyperproliferative cancerous disease or disorder all neoplastic cell growth and proliferation, whether malignant or benign, including all transformed cells and tissues and all cancerous cells and tissues.
  • Hyperproliferative diseases or disorders include, but are not limited to, precancerous lesions, abnormal cell growths, benign tumors, malignant tumors, and "cancer.”
  • cancer refers to an abnormal mass of tissue that results from excessive cell division, in certain cases tissue comprising cells which express, over-express, or abnormally express a hyperproliferative cell protein.
  • a cancer, tumor or tumor tissue comprises “tumor cells” which are neoplastic cells with abnormal growth properties and no useful bodily function. Cancers, tumors, tumor tissue and tumor cells may be benign or malignant. A cancer, tumor or tumor tissue may also comprise "tumor-associated non-tumor cells", e.g., vascular cells which form blood vessels to supply the tumor or tumor tissue. Non-tumor cells may be induced to replicate and develop by tumor cells, for example, the induction of angiogenesis in a tumor or tumor tissue.
  • cancer examples include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. More particular examples of such cancers are noted below and include: squamous cell cancer (e.g.
  • lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, as well as head and neck cancer.
  • lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer
  • cancer includes primary malignant cells or rumors (e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor) and secondary malignant cells or tumors (e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor).
  • primary malignant cells or rumors e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor
  • secondary malignant cells or tumors e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor.
  • cancers or malignancies include, but are not limited to: Acute Childhood Lymphoblastic Leukemia, Acute Lymphoblastic Leukemia, Acute
  • Lymphocytic Leukemia Acute Myeloid Leukemia, Adrenocortical Carcinoma, Adult (Primary) Hepatocellular Cancer, Adult (Primary) Liver Cancer, Adult Acute
  • Lymphocytic Leukemia Adult Acute Myeloid Leukemia, Adult Hodgkin's Disease, Adult Hodgkin's Lymphoma, Adult Lymphocytic Leukemia, Adult Non-Hodgkin's Lymphoma, Adult Primary Liver Cancer, Adult Soft Tissue Sarcoma, AIDS-Related Lymphoma, AIDS-Related Malignancies, Anal Cancer, Astrocytoma, Bile Duct Cancer, Bladder Cancer, Bone Cancer, Brain Stem Glioma, Brain Tumors, Breast Cancer, Cancer of the Renal Pelvis and Ureter, Central Nervous System (Primary) Lymphoma, Central Nervous System Lymphoma, Cerebellar Astrocytoma, Cerebral Astrocytoma, Cervical Cancer, Childhood (Primary) Hepatocellular Cancer, Childhood (Primary) Liver Cancer,
  • Tumor Gastrointestinal Tumors, Germ Cell Tumors, Gestational Trophoblastic Tumor, Hairy Cell Leukemia, Head and Neck Cancer, Hepatocellular Cancer, Hodgkin's Disease, Hodgkin's Lymphoma, Hypergammaglobulinemia, Hypopharyngeal Cancer, Intestinal Cancers, Intraocular Melanoma, Islet Cell Carcinoma, Islet Cell Pancreatic Cancer, Kaposi's Sarcoma, Kidney Cancer, Laryngeal Cancer, Lip and Oral Cavity Cancer, Liver Cancer, Lung Cancer, Lymphoproliferative Disorders, Macroglobulinemia, Male Breast Cancer, Malignant Mesothelioma, Malignant Thymoma, Medulloblastoma, Melanoma, Mesothelioma, Metastatic Occult Primary Squamous Neck Cancer, Metastatic Primary Squamous Neck Cancer, Metastatic Squamous Neck Cancer, Multiple Myeloma, Multiple Myelo
  • Oropharyngeal Cancer Osteo-/Malignant Fibrous Sarcoma, Osteosarcoma/Malignant Fibrous Histiocytoma, Osteosarcoma/Malignant Fibrous Histiocytoma of Bone, Ovarian Epithelial Cancer, Ovarian Germ Cell Tumor, Ovarian Low Malignant Potential Tumor, Pancreatic Cancer, Paraproteinemias, Purpura, Parathyroid Cancer, Penile Cancer, Pheochromocytoma, Pituitary Tumor, Plasma Cell Neoplasm/Multiple Myeloma, Primary Central Nervous System Lymphoma, Primary Liver Cancer, Prostate Cancer, Rectal Cancer, Renal Cell Cancer, Renal Pelvis and Ureter Cancer, Retinoblastoma, Rhabdomyosarcoma, Salivary Gland Cancer, Sarcoidosis Sarcomas, Sezary Syndrome, Skin Cancer, Small Cell Lung Cancer, Small Intestine Cancer, Soft Tissue Sarcoma, Squamous
  • the AHCM agent as described above and herein, is used to treat a hyperproliferative disorder, e.g., a hyperpoliferative connective tissue disorder (e.g., a hyperproliferative fibrotic disease).
  • a hyperproliferative disorder e.g., a hyperpoliferative connective tissue disorder (e.g., a hyperproliferative fibrotic disease).
  • the hyperproliferative fibrotic disease is multisystemic or organ-specific.
  • Exemplary hyperproliferative fibrotic diseases include, but are not limited to, multisystemic (e.g., systemic sclerosis, multifocal fibrosclerosis, sclerodermatous graft-versus-host disease in bone marrow transplant recipients, nephrogenic systemic fibrosis, scleroderma), and organ-specific disorders (e.g., fibrosis of the lung, liver, heart, kidney, pancreas, skin and other organs).
  • multisystemic e.g., systemic sclerosis, multifocal fibrosclerosis, sclerodermatous graft-versus-host disease in bone marrow transplant recipients, nephrogenic systemic fibrosis, scleroderma
  • organ-specific disorders e.g., fibrosis of the lung, liver, heart, kidney, pancreas, skin and other organs.
  • the subject treated has a hyperproliferative genetic disorder, e.g., a hyperproliferative genetic disorder chosen from Marfan's syndrome or Loeys- Dietz syndrome.
  • a hyperproliferative genetic disorder chosen from Marfan's syndrome or Loeys- Dietz syndrome.
  • Losartan has been shown to treat human Marfan syndrome, a connective tissue disorder caused by mutations in the gene that encodes the extracellular matrix protein, fibrillin- 1 (Dietz, H.C. et al. (2010) New Engl J Med 363(9): 852-863).
  • Fibrillin-1 comprises the microfibrils of elastic tissue and a component of many other connective tissues.
  • Affected patients with Marfan syndrome have blood vessel abnormalities such as aortic aneurysms. The vascular disease can result in blood vessel rupture and death in childhood and later in life.
  • the hyperproliferative disorder (e.g., the hyperproliferative fibrotic disorder) is chosen from one or more of chronic obstructive pulmonary disease, asthma, aortic aneurysm, radiation-induced fibrosis, skeletal-muscle myopathy, diabetic nephropathy, and/or arthritis.
  • AHCM agent as described above and herein, can be administered in combination with one or more additional therapies, e.g., such as radiation therapy, surgery and/or in combination with one or more therapeutic agents, to treat the cancers described herein.
  • additional therapies e.g., such as radiation therapy, surgery and/or in combination with one or more therapeutic agents, to treat the cancers described herein.
  • compositions can be administered concurrently with, prior to, or subsequent to, one or more other additional therapies or therapeutic agents.
  • each agent will be administered at a dose and/or on a time schedule determined for that agent.
  • the additional therapeutic agent utilized in this combination can be administered together in a single composition or administered separately in different compositions.
  • the particular combination to employ in a regimen will take into account compatibility of the inventive pharmaceutical composition with the additional therapeutically active agent and/or the desired therapeutic effect to be achieved.
  • the AHCM and/or the therapy e.g., the cancer or
  • hyperproliferative therapy is administered in combination with an inhibitor of a profibrotic pathway (a "profibrotic pathway inhibitor") (e.g., a pathway dependent- or independent of TGF-beta and/or CTGF activation).
  • a profibrotic pathway inhibitor e.g., a pathway dependent- or independent of TGF-beta and/or CTGF activation.
  • the AHCM and/or the cancer therapy is administered in combination with one or more of: an inhibitor of endothelin-1, PDGF, Wnt/beta-catenin, IGF-1 , TNF-alpha, and/or IL-4.
  • the AHCM and/or the cancer therapy is administered in combination with an inhibitor of endothelin- 1 and/or PDGF.
  • the AHCM and/or the cancer therapy is administered in combination with an inhibitor of one or more of chemokine receptor type 4 (CXCR4) (e.g., AMD3100, MSX-122); stromal- derived-factor-l (SDF-l ) (e.g., tannic acid); hedgehog (e.g., GDC -0449, cylopamine, or GANT58).
  • CXCR4 chemokine receptor type 4
  • SDF-l stromal- derived-factor-l
  • hedgehog e.g., GDC -0449, cylopamine, or GANT58.
  • the AHCM is administered in combination with a low or small molecular weight chemotherapeutic agent.
  • exemplary low or small molecular weight chemotherapeutic agents include, but not limited to, 13-cis-retinoic acid
  • LEUSTATINTM 5-azacitidine (azacitidine, VIDAZA®), 5-fluorouracil (5-FU, fluorouracil, ADRUCIL®), 6-mercaptopurine (6-MP, mercaptopurine,
  • the AHCM agent is administered in conjunction with a biologic.
  • a biologic useful in the treatment of cancers are known in the art and a binding molecule of the invention may be administered, for example, in conjunction with such known biologies.
  • HERCEPTIN® trastuzumab, Genentech Inc., South San Francisco, Calif; a humanized monoclonal antibody that has anti-tumor activity in HER2 -positive breast cancer
  • FASLODEX® fullvestrant, AstraZeneca Pharmaceuticals, LP, Wilmington, Del.; an estrogen-receptor antagonist used to treat breast cancer
  • Other biologies with which the binding molecules of the invention may be combined include:
  • AVASTIN® (bevacizumab, Genentech Inc.; the first FDA-approved therapy designed to inhibit angiogenesis); and ZEVALIN® (ibritumomab tiuxetan, Biogen personal, Cambridge, Mass.; a radiolabeled monoclonal antibody currently approved for the treatment of B-cell lymphomas).
  • AVASTIN® avian avian
  • ERBITUX® cetuximab, ImClone Systems Inc., New York, N.Y., and Bristol-Myers Squibb, New York, N.Y.
  • EGFR epidermal growth factor receptor
  • GLEEVEC® imatinib mesylate; a protein kinase inhibitor
  • ERGAMISOL® levamisole hydrochloride, Janssen Pharmaceutica Products, LP, Titusville, N J.; an immunomodulator approved by the FDA in 1990 as an adjuvant treatment in combination with 5-fluorouracil after surgical resection in patients with Dukes' Stage C colon cancer.
  • exemplary biologies include TARCEVA® (erlotinib HCL, OSI Pharmaceuticals Inc., Melville, N.Y.; a small molecule designed to target the human epidermal growth factor receptor 1 (HER1) pathway).
  • TARCEVA® erlotinib HCL, OSI Pharmaceuticals Inc., Melville, N.Y.
  • HER1 human epidermal growth factor receptor 1
  • exemplary biologies include VELCADE® Velcade (bortezomib, Millennium Pharmaceuticals, Cambridge Mass.; a proteasome inhibitor). Additional biologies include THALIDOMID® (thalidomide, Clegene
  • Additional exemplary cancer therapeutic antibodies include, but are not limited to, 3F8, abagovomab, adecatumumab, afutuzumab, alacizumab pegol, alemtuzumab
  • VECTIBIX® pemtumomab (THERAGYN®), pertuzumab (OMNITARG®), pintumomab, pritumumab, ramucirumab, ranibizumab (LUCENTIS®), rilotumumab, rituximab (MABTHERA®, RITUXAN®), robatumumab, satumomab pendetide, sibrotuzumab, siltuximab, thankuzumab, tacatuzumab tetraxetan (AFP-CIDE®), taplitumomab paptox, tenatumomab, TGN1412, ticilimumab (tremelimumab), tigatuzumab, TNX-650, tositumomab (BEXXAR®), trastuzumab (HERCEPTI ®), tremelimumab, HER
  • the the AHCM is administered in combination with a viral cancer therapeutic agent.
  • viral cancer therapeutic agents include, but not limited to, vaccinia virus (vvDD-CDSR), carcinoembryonic antigen-expressing measles virus, recombinant vaccinia virus (TK-deletion plus GM-CSF), Seneca Valley virus-001 , Newcastle virus, coxsackie virus A21, GL-ONC 1, EBNA1 C-terminal/LMP2 chimeric protein-expressing recombinant modified vaccinia Ankara vaccine, carcinoembryonic antigen-expressing measles virus, G207 oncolytic virus, modified vaccinia virus Ankara vaccine expressing p53, OncoVEX GM-CSF modified herpes-simplex 1 virus, fowlpox virus vaccine vector, recombinant vaccinia prostate-specific antigen vaccine, human papillomavirus 16/18 LI virus-like particle/AS04 vaccine, MVA-
  • ALVAC(2) melanoma multi-antigen therapeutic vaccine ALVAC- hB7.1, canarypox-hIL-12 melanoma vaccine, Ad-REIC/Dkk-3, rAd-IFN SCH 721015, TIL-Ad-INFg, Ad-ISF35, and coxsackievirus A21 (CVA21, CAVATAK®).
  • the the AHCM is administered in combination with a nanopharmaceutical.
  • exemplary cancer nanopharmaceuticals include, but not limited to, ABRAXANE® (paclitaxel bound albumin nanoparticles), CRLX101 (CPT conjugated to a linear cyclodextrin-based polymer), CRLX288 (conjugating docetaxel to the biodegradable polymer poly (lactic-co-glycolic acid)), cytarabine liposomal (liposomal Ara-C, DEPOCYTTM), daunorubicin liposomal (DAU OXOME®), doxorubicin liposomal (DOXIL®, CAELYX®), encapsulated-daunorubicin citrate liposome
  • the AHCM agent is administered in combination with paclitaxel or a paclitaxel formulation, e.g., TAXOL®, protein-bound paclitaxel (e.g., ABRAXANE®).
  • paclitaxel formulations include, but are not limited to, nanoparticle albumin-bound paclitaxel (ABRAXANE®, marketed by Abraxis
  • DHA-paclitaxel docosahexaenoic acid bound-paclitaxel
  • Taxoprexin marketed by Protarga
  • polyglutamate bound-paclitaxel PG-paclitaxel, paclitaxel poliglumex, CT-2103, XYOTAX, marketed by Cell Therapeutic
  • TAP tumor-activated prodrug
  • ANG105 Angiopep-2 bound to three molecules of paclitaxel, marketed by ImmunoGen
  • paclitaxel-EC-1 paclitaxel bound to the erbB2-recognizing peptide EC- 1 ; see Li et al, Biopolymers (2007) 87:225-230
  • glucose-conjugated paclitaxel e.g., 2'-paclitaxel methyl 2-glucopyranosyl succinate, see Liu et al., Bioorganic & Medicinal Chemistry Letters (2007) 17:617-620).
  • RNAi and antisense RNA agents for treating cancer include, but not limited to, CALAA-01 , siG 12D LODER (Local Drug EluteR), and ALN-VSP02.
  • cancer therapeutic agents include, but not limited to, cytokines (e.g., aldesleukin (IL-2, Inter leukin-2, PROLEUKIN®), alpha Interferon (IFN-alpha, Interferon alfa, INTRON® A (Interferon alfa-2b), ROFERON-A® (Interferon alfa-2a)), Epoetin alfa (PROCRIT®), filgrastim (G-CSF, Granulocyte - Colony Stimulating Factor, NEUPOGEN®), GM-CSF (Granulocyte Macrophage Colony Stimulating Factor, sargramostim, LEUKINETM), IL-1 1 (Interleukin-1 1, oprelvekin, NEUMEGA®), Interferon alfa-2b (PEG conjugate) (PEG interferon, PEG-INTRONTM), and pegfilgrastim (NEULASTATM)), hormone therapy agents (e.g., aminoglutethimide
  • EISTA® romiplostim
  • NPLATE® romiplostim
  • tamoxifen tamoxifen
  • FRESTON® toremifene
  • phospholipase A2 inhibitors e.g., anagrelide (AGRYLIN®)
  • biologic response modifiers e.g., BCG (THERACYS®, TICE®
  • target therapy agents e.g., bortezomib (VELCADE®), dasatinib (SPRYCELTM), denileukin diftitox (ONTAK®), erlotinib (TARCEVA®), everolimus (AFINITOR®), gefitinib (IRESSA®), imatinib mesylate (STI-571, GLEEVECTM), lapatinib (TYKERB®), sorafenib (NEXAVAR®), and SU1 1248 (sunitinib, SUTENT®)), immunomodulatory and antiangiogenic agents (e.g., CC-5013 (lenalidomide,
  • glucocorticosteroids e.g., cortisone (hydrocortisone, hydrocortisone sodium phosphate, hydrocortisone sodium succinate, ALA-CORT®, HYDROCORT ACETATE®, hydrocortone phosphate LANACORT®, SOLU-CORTEF®), decadron (dexamethasone, dexamethasone acetate, dexamethasone sodium phosphate, DEXASONE®, DIODEX®, HEXADROL®, MAXIDEX®), methylprednisolone (6-methylprednisolone, methylprednisolone acetate,
  • methylprednisolone sodium succinate DURALONE®, MEDRALONE®, MEDROL®, M-PREDNISOL®, SOLU-MEDROL®
  • prednisolone DELTA -CORTEF®
  • ORAPRED®, PEDIAPRED®, PRELONE®), and prednisone DELTASONE®, LIQUID PRED®, METICORTEN®, ORASONE®
  • bisphosphonates e.g., pamidronate (AREDIA®), and zoledronic acid (ZOMETA®)
  • the AHCM agent is used in combination with a tyrosine kinase inhibitor (e.g., a receptor tyrosine kinase (RTK) inhibitor).
  • a tyrosine kinase inhibitor include, but are not limited to, an epidermal growth factor (EGF) pathway inhibitor (e.g., an epidermal growth factor receptor (EGFR) inhibitor), a vascular endothelial growth factor (VEGF) pathway inhibitor (e.g., a vascular endothelial growth factor receptor (VEGFR) inhibitor ⁇ e.g., a VEGFR-1 inhibitor, a VEGFR-2 inhibitor, a VEGFR-3 inhibitor)), a platelet derived growth factor (PDGF) pathway inhibitor (e.g., a platelet derived growth factor receptor (PDGFR) inhibitor ⁇ e.g., a PDGFR-B inhibitor)), a RAF-1 inhibitor, a KIT inhibitor and a RET inhibitor.
  • EGF epidermal growth
  • the anti- cancer agent used in combination with the AHCM agent is selected from the group consisting of: axitinib (AGO 13736), bosutinib (SKI-606), cediranib (RECENTINTM, AZD2171), dasatinib (SPRYCEL®, BMS-354825), erlotinib (TARCEVA®), gefitinib (IRESSA®), imatinib (Gleevec®, CGP57148B, STI-571), lapatinib (TYKERB®, TYVERB®), lestaurtinib (CEP-701 ), neratinib (HKI-272), nilotinib (TASIGNA®), semaxanib (semaxinib, SU5416), sunitinib (SUTENT®, SU1 1248), toceranib
  • axitinib AGO 13736
  • bosutinib SKI-606
  • PALLADIA® vandetanib
  • ZACTIMA® vandetanib
  • ZD6474 vatalanib
  • PTK787 PTK/ZK
  • trastuzumab HERCEPTIN®
  • bevacizumab AVASTIN®
  • rituximab RITUXAN®
  • cetuximab ERBITUX®
  • panitumumab VECTIBIX®
  • ranibizumab (Lucentis®
  • TASIGNA® sorafenib
  • NEXAVAR® alemtuzumab
  • CAMPATH® gemtuzumab ozogamicin
  • MYLOTARG® ENMD-2076, PCI-32765, AC220, dovitinib lactate (TKI258, CHIR-258), BIBW 2992 (TOVOKTM), SGX523, PF-04217903, PF- 02341066, PF-299804, BMS-777607, ABT
  • tyrosine kinase inhibitors are chosen from sunitinib, erlotinib, gefitinib, or sorafenib. In one embodiment, the tyrosine kinase inhibitor is sunitinib.
  • the AHCM is administered in combination with one of more of: an anti-angiogenic agent, or a vascular targeting agent or a vascular disrupting agent.
  • anti-angiogenic agents include, but are not limited to, VEGF inhibitors ⁇ e.g., anti-VEGF antibodies ⁇ e.g., bevacizumab); VEGF receptor inhibitors (e.g., itraconazole); inhibitors of cell proliferatin and/or migration of endothelial cells (e.g.,
  • VTA vascular-targeting agent
  • VDA vascular disrupting agent
  • necrosis (reviewed in, e.g., Thorpe, P.E. (2004) Clin. Cancer Res. Vol. 10:415-427).
  • VTAs can be small-molecule.
  • Exemplary small-molecule VTAs include, but are not
  • microtubule destabilizing drugs e.g., combretastatin A-4 disodium phosphate (CA4P), ZD6126, AVE8062, Oxi 4503; and vadimezan (ASA404).
  • radioisotopes include: 90 Y, 125 I, 131 1, l2 I, 1 1 1 In, 105 Rh, l 53 Sm, 67 Cu, 67 Ga, 166 Ho, l 77 Lu, l 86 Re and l 88 Re.
  • the radionuclides act by producing ionizing radiation which causes multiple strand breaks in nuclear DNA, leading to cell death.
  • the isotopes used to produce therapeutic conjugates typically produce high energy a-or ⁇ -particles which have a short path length. Such radionuclides kill cells to which they are in close proximity, for example neoplastic cells to which the conjugate has attached or has entered. They have little or no effect on non-localized cells. Radionuclides are essentially non-immunogenic.
  • binding molecules can be conjugated to different radiolabels for diagnostic and therapeutic purposes.
  • U.S. Pat. Nos. 6,682, 134, 6,399,061 , and 5,843,439 disclose radiolabeled therapeutic conjugates for diagnostic "imaging" of tumors before administration of therapeutic antibody.
  • “In2B8” conjugate comprises a murine monoclonal antibody, 2B8, specific to human CD20 antigen, that is attached to 1 " in via a bifunctional chelator, i.e., MX-DTPA (diethylenetriaminepentaacetic acid), which comprises a 1 : 1 mixture of 1-isothiocyanatobenzyl- 3-methyl-DTPA and l -methyl-3-isothiocyanatobenzyl-DTPA.
  • MX-DTPA diethylenetriaminepentaacetic acid
  • " ' in is particularly preferred as a diagnostic radionuclide because between about 1 to about 10 mCi can be safely administered without detectable toxicity; and the imaging data is generally predictive of subsequent 90 Y- labeled antibody distribution.
  • the AHCM agent and the additional anti-cancer agent are administered concurrently ⁇ e.g., administration of the two agents at the same time or day, or within the same treatment regimen) and/or sequentially (e.g., administration of one agent over a period of time followed by administration of the other agent for a second period of time, or within different treatment regimens).
  • the AHCM is administered prior to the anti-cancer agent. In other embodiments, the AHCM is administered prior to the anti-cancer agent, and followed by concurrent administration of the AHCM and the anti-cancer agent.
  • the AHCM agent and the additional anti-cancer agent are administered concurrently.
  • the AHCM agent and the additional anti-cancer agent are administered at the same time, on the same day, or within the same treatment regimen.
  • the AHCM agent is administered before the additional anti-cancer agent on the same day or within the same treatment regimen.
  • the AHCM agent is concurrently administered with additional anti-cancer agent for a period of time, after which point treatment with the additional anti-cancer agent is stopped and treatment with the AHCM agent continues.
  • the AHCM agent is concurrently with the additional anticancer agent for a period of time, after which point treatment with the AHCM agent is stopped and treatment with the additional anti-cancer agent continues.
  • the AHCM agent and the additional anti-cancer agent are administered sequentially.
  • the AHCM agent is administered after the treatment regimen of the additional anti-cancer agent has ceased.
  • the additional anti-cancer agent is administered after the treatment regimen of the AHCM agent has ceased.
  • the AHCM agent and the anti-cancer agent can be administered in a pulse administration. In other embodiments, they can be administered as a pulse-chase administration, e.g., where an AHCM agent is administered for a brief period of time (pulse), followed by administration of an anti-cancer agent for a longer period of time (e.g., chase), or vice versa.
  • pulse-chase administration e.g., where an AHCM agent is administered for a brief period of time (pulse), followed by administration of an anti-cancer agent for a longer period of time (e.g., chase), or vice versa.
  • AHCM agents can be used to improve diagnosis, treatment, prevention and/or prognosis of cancers in mammals, preferably humans.
  • These diagnostic assays can be performed in vivo or in vitro, such as, for example, on blood samples, biopsy tissue or autopsy tissue.
  • the invention provides a diagnostic method useful during diagnosis of a cancer, which involves measuring the expression level of target protein or transcript in tissue or other cells or body fluid from an individual and comparing the measured expression level with a standard target expression levels in normal tissue or body fluid, whereby an increase in the expression level compared to the standard is indicative of a disorder.
  • One embodiment provides a method of detecting the presence of abnormal hyperproliferative cells, e.g., precancerous or cancerous cells, in a fluid or tissue sample, comprising assaying for the expression of the target in tissue or body fluid samples of an individual and comparing the presence or level of target expression in the sample with the presence or level of target expression in a panel of standard tissue or body fluid samples, where detection of target expression or an increase in target expression over the standards is indicative of aberrant hyperproliferative cell growth.
  • abnormal hyperproliferative cells e.g., precancerous or cancerous cells
  • diagnosis comprises: a) administering (for example, parenterally, subcutaneously, or intraperitoneally) to a subject an effective amount of a labeled antibody or fragment thereof against a cancer antigen, to a subject that has been treated with an AHCM or is being treated with the AHCM; b) waiting for a time interval following the administering for permitting the labeled antibody to preferentially concentrate at sites in the subject where target is expressed (and for unbound labeled molecule to be cleared to background level); c) determining background level; and d) detecting the labeled molecule in the subject, such that detection of labeled molecule above the background level indicates that the subject has a particular disease or disorder associated with aberrant expression of target.
  • Background level can be determined by various methods including comparing the amount of labeled molecule detected to a standard value previously determined for
  • the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images.
  • the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of, e.g., 99 Tc.
  • the labeled binding molecule e.g., antibody or antibody fragment, will then preferentially accumulate at the location of cells which contain the specific protein.
  • In vivo tumor imaging is described in S. W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments.” (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S. W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).
  • the time interval following the administration for permitting the labeled molecule to preferentially concentrate at sites in the subject and for unbound labeled molecule to be cleared to background level is 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time interval following administration is 5 to 20 days or 7 to 10 days.
  • Presence of the labeled molecule can be detected in the patient using methods known in the art for in vivo scanning. These methods depend upon the type of label used. Skilled artisans will be able to determine the appropriate method for detecting a particular label. Methods and devices that may be used in the diagnostic methods of the invention include, but are not limited to, computed tomography (CT), whole body scan such as position emission tomography (PET), magnetic resonance imaging (MRI), and sonography, X-radiography, nuclear magnetic resonance imaging (NMR), CAT-scans or electron spin resonance imaging (ESR).
  • CT computed tomography
  • PET position emission tomography
  • MRI magnetic resonance imaging
  • sonography sonography
  • X-radiography nuclear magnetic resonance imaging
  • NMR nuclear magnetic resonance imaging
  • CAT-scans or electron spin resonance imaging (ESR).
  • compositions described herein can be incorporated into a variety of formulations for administration. More particularly, the compositions can be formulated into pharmaceutical compositions by combination with appropriate, pharmaceutically acceptable carriers or diluents, and can be formulated into preparations in semi-solid, liquid or gaseous forms; such as capsules, powders, granules, gels, slurries, ointments, solutions, suppositories, injections, inhalants and aerosols. As such, administration of the compositions can be achieved in various ways, including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal, intratracheal administration. Moreover, the compositions can be administered in a local rather than systemic manner, in a depot or sustained release formulation.
  • compositions can be formulated with common excipients, diluents or carriers, and compressed into tablets, or formulated as elixirs or solutions for convenient oral administration, or administered by the intramuscular or intravenous routes.
  • the compositions can be administered transdermally, and can be formulated as sustained release dosage forms and the like.
  • Compositions can be administered alone, in combination with each other, or they can be used in combination with other known compounds (discussed herein).
  • Suitable formulations for use in the present invention are found in Remington's Pharmaceutical Sciences ( 1985). Moreover, for a review of methods for drug delivery, see, Langer ( 1990) Science 249: 1527-1533.
  • the pharmaceutical compositions described herein can be manufactured in a manner that is known to those of skill in the art, e.g., by mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • the following methods and excipients are merely exemplary and are in no way limiting.
  • compositions can be formulated by combining with pharmaceutically acceptable carriers that are known in the art.
  • Such carriers enable the compounds to be formulated as pills, capsules, emulsions, lipophilic and hydrophilic suspensions, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated.
  • Pharmaceutical preparations for oral use can be obtained by mixing the compositions with an excipient and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl- cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP).
  • fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol
  • cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl- cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP).
  • PVP polyvinylpyrrolidone
  • compositions for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g.,
  • the dosage unit can be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • compositions can be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection can be presented in unit dosage form, e.g., in ampules or in multidose containers, with an added preservative.
  • the compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulator agents such as suspending, stabilizing and/or dispersing agents.
  • compositions can also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter, carbowaxes, polyethylene glycols or other glycerides, all of which melt at body temperature, yet are solidified at room temperature.
  • rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter, carbowaxes, polyethylene glycols or other glycerides, all of which melt at body temperature, yet are solidified at room temperature.
  • compositions can also be formulated as a depot preparation.
  • long acting formulations can be administered by implantation (for example
  • the compounds can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • Lipid particles e.g., liposomes
  • emulsions are known examples of delivery vehicles or carriers for hydrophobic drugs. Long-circulating, e.g., stealth, liposomes can be employed. Such liposomes are generally described in U.S. Pat. No. 5,013,556.
  • the compounds of the present invention can also be administered by controlled release means and/or delivery devices such as those described in U.S. Pat. Nos. 3,845,770; 3,916,899; 3,536,809; 3,598, 123; and 4,008,719.
  • compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in a therapeutically effective amount.
  • the amount of composition administered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician. Determination of an effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
  • a suitable daily dose of an AHCM agent and/or a cancer therapeutic can be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose can generally depend upon the factors described above.
  • the subject receiving this treatment is any animal in need, including primates, in particular humans, equines, cattle, swine, sheep, poultry, dogs, cats, mice and rats.
  • the compounds can be administered daily, every other day. three times a week, twice a week, weekly, or bi-weekly.
  • the dosing schedule can include a "drug holiday," i.e., the drug can be administered for two weeks on, one week off, or three weeks on, one week off, or four weeks on, one week off, etc., or continuously, without a drug holiday.
  • the compounds can be administered orally, intravenously, intraperitoneally, topically, transdermally, intramuscularly, subcutaneously, intranasally, sublingually, or by any other route.
  • the doses of each agent or therapy can be lower than the corresponding dose for single-agent therapy.
  • the determination of the mode of administration and the correct dosage is well within the knowledge of the skilled clinician.
  • the AHCM is administered via an implantable infusion device, e.g., a pump.
  • Implantable infusion devices typically include a housing containing a liquid reservoir which can be filled transcutaneously by a hypodermic needle penetrating a fill port septum.
  • the medication reservoir is generally coupled via an internal flow path to a device outlet port for delivering the liquid through a catheter to a patient body site.
  • Typical infusion devices also include a controller and a fluid transfer mechanism, such as a pump or a valve, for moving the liquid from the reservoir through the internal flow path to the device's outlet port.
  • the anti-cancer agents ⁇ e.g., low molecular weight, mid-molecular weight anti-cancer agents described herein), or both, can be packaged in nanoparticles.
  • nanoparticles are from 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150 or 200 nm or 200-1 ,000, e.g., 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150, or 200, or 20 or 30 or 50-400 nm in diameter. Smaller particles tend to be cleared more rapidly form the system. Drugs can be intrapped within or coupled, e.g., covalent coupled, or otherwise adhered, to nanoparticles.
  • Lipid- or oil-based nanoparticles such as liposomes and solid lipid nanoparticles and can be used to can be used to deliver agents described herein.
  • DOXIL® is an example of a liposomic nanoparticle.
  • Solid lipid nanoparticles for the delivery on anti-cancer agents are descripbed in Serpe et al. (2004) Eur. J. Pharm. Bioparm. 58:673-680 and Lu et al. (20060 Eur. J. Pharm. Sci. 28: 86-95.
  • Polymer-based nanoparticles, e.g., PLGA- based nanoparticles can be used to deliver agents described herein.
  • PLGA is a widely used in polymeric nanoparticles, see Hu et al. (2009) J. Control. Release 134:55-61 ; Cheng et al. (2007) Biomaterials 28:869-876, and Chan et al. (2009) Biomaterials 30: 1627-1634.
  • PEGylated PLGA-based nanoparticles can also be used to deliver anti-cancer agents, see, e.g., Danhhier et al., (2009) J. Control. Release 133: 1 1-17, Gryparis et al (2007) Eur. J.
  • Metal-based, e.g., gold-based nanoparticles can also be used to dleiver anti-cancer agents.
  • Protien-based, e.g., albumin-based nanoparticles can be used to deliver agents described herein.
  • an agent can be bound to nanoparticles of human albumin.
  • An exemplary anti-cancer agent/protein nanoparticle is Abraxane®, in which paclitaxel is pund to nanparticles of albumin.
  • Nanoparticles can employ active targeting, passive targeting or both. Active targeting can rely on inclusion of a ligand tht binds with a target at or near a preselected site, e.g., a solid tumor. Passive targeting nanoparticles can diffuse and accumalte at sites of interest, e.g., sites characterized by excessivley leaky micorvasculatiure, e.g., as seen in tumors and sites of inflammation.
  • the present invention may be defined in any of the following numbered paragraphs:
  • a method of improving the delivery or efficacy of a cancer therapy, in a subject comprising:
  • AHCM collagen modifying agent
  • AHCM AHCM is administered in a dosage sufficient to improve the delivery or efficacy of the cancer therapy.
  • a method of treating or preventing a cancer, in a subject comprising: identifying the subject as being in need of receiving an anti-hypertensive and/or a collagen modifying agent ("AHCM") on the basis of the need for improved delivery or efficacy of a cancer therapy; and either (a), (b), or both:
  • AHCM anti-hypertensive and/or a collagen modifying agent
  • AHCM AHCM
  • the subject has not been administered a dose of the AHCM within 5, 10, 30, 60 or 100 days of the diagnosis of the cancer or the initiation of the AHCM dosing;
  • the subject is not hypertensive, or has been hypertensive, prior to administration of the AHCM;
  • the AHCM is administered at least one, two, three, or five days; or one, two, three, four, five or more weeks, prior to the cancer therapy;
  • the AHCM is administered at least one, two, three, or five days; or one, two, three, four, five or more weeks, prior to the cancer therapy, and concurrently with the cancer therapy, or
  • the AHCM is administered continuously over a period of at least 1, 5, 10, or 24 hours; at least 2, 5, 10, or 14 days; at least 2, 3, 4, 5 or 6 weeks; at least 2, 3, 4, 5 or 6 months; or at least 1 , 2, 3, 4 or 5 years. 4. The method of any of paragraphs 1 -3, wherein the AHCM is chosen from one or more of:
  • an angiotensin II receptor blocker (AT] blocker) (i) an angiotensin II receptor blocker (AT] blocker),
  • RAAS antagonist an antagonist of renin angiotensin aldosterone system
  • an angiotensin converting enzyme (ACE) inhibitor (iii) an angiotensin converting enzyme (ACE) inhibitor
  • TSP-1 thrombospondin 1
  • TGF- ⁇ transforming growth factor beta 1
  • AHCM connective tissue growth factor
  • CTGF connective tissue growth factor
  • the AHCM is an AT] inhibitor chosen from one or more of: losartan (COZAAR®), candesartan (ATACAND®), eprosartan mesylate (TEVETEN®), EXP 3174, irbesartan (AVAPRO®), L I 58,809, olmesartan (BENICAR®), saralasin, telmisartin (MICARDIS®), valsartan (DIOVAN®), or a derivative thereof.
  • AHCM is a RAAS antagonist chosen from one or more of: aliskiren (TEKTURNA®, RASILEZ®), remikiren (Ro 42-5892), enalkiren (A-64662), SPP635, or a derivative thereof.
  • AHCM is an ACE inhibitor chosen from one or more of: benazepril (LOTENSIN®), captopril (CAPOTEN®), enalapril (VASOTEC®), fosinopril (MONOPRIL®), lisinopril (PRINIVIL®,
  • AHCM is a TSP-1 inhibitor chosen from one or more of: ABT-510, CVX-045, LSKL, or a derivative thereof.
  • TGF- ⁇ inhibitor is chosen from one or more of: an anti- TGF- ⁇ antibody, or a TGF- ⁇ 1 peptide inhibitor.
  • CTGF inhibitor is chosen from one or more of: DN-9693, FG-3019, or a derivative thereof.
  • the AHCM is administered as a polymeric nanoparticle or a lipid nanoparticle.
  • the cancer therapy is a cancer therapeutic that is administered as an entity having a hydrodynamic diameter of greater than 1, 5, 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150, 200 nm, but less than 300 nm. 22. The method of paragraph 21, wherein the cancer therapeutic is administered as a polymeric nanoparticle or a lipid nanoparticle.
  • gastrointestinal, stomach, head and neck, kidney, or liver cancer or a metastatic lesion thereof.
  • cancer therapy is chosen from one or more of anti-cancer agents, surgery and/or radiation.
  • a cancer therapeutic chosen from a viral cancer therapeutic agent, a lipid nanoparticle of an anti-cancer therapeutic agent, a polymeric nanoparticle of an anticancer therapeutic agent, an antibody against a cancer target, a dsRNA agent, an antisense RNA agent, or a chemotherapeutic agent;
  • lipid nanoparticle is chosen from pegylated liposomal doxorubicin (DOXIL ® ) or liposomal paclitaxel ⁇ e.g., Abraxane®).
  • DOXIL ® pegylated liposomal doxorubicin
  • paclitaxel ⁇ e.g., Abraxane®
  • chemotherapeutic agent is chosen from gemcitabine, cisplatin, epirubicin, 5-fluorouracil, paclitaxel, oxaliplatin, or leucovorin.
  • cancer therapy is a tyrosine kinase inhibitor chosen from sunitinib, erlotinib, gefitinib, sorafenib, icotinib, lapatinib, neratinib, vandetanib, BIBW 2992 or XL-647, or an anti-EGFR antibody chosen from cetuximab, panitumumab, zalutumumab, nimotuzumab necitumumab or matuzumab.
  • tyrosine kinase inhibitor chosen from sunitinib, erlotinib, gefitinib, sorafenib, icotinib, lapatinib, neratinib, vandetanib, BIBW 2992 or XL-647
  • an anti-EGFR antibody chosen from cetuximab, panitumumab, zalutumumab, nimot
  • chemotherapeutic agent is a cytotoxic or a cytostatic agent.
  • chemotherapeutic agent is chosen from an antimicrotubule agent, a topoisomerase inhibitor, a taxane, an antimetabolite, a mitotic inhibitor, an alkylating agent, or an intercalating agent.
  • the cancer therapy is chosen from one of more of: an anti-angiogenic agent, or a vascular targeting agent or a vascular disrupting agent.
  • TGFpl transforming growth factor beta 1
  • CGF connective tissue growth factor
  • TSP-1 thrombospondin-1
  • a plasma or serum biomarker chosen from collagen I, collagen III, collagen IV, TGF i , CTGF, or TSP-1 ;
  • tumor aggressivity tumor aggressivity, vascularization of primary tumor, or metastatic spread.
  • a pharmaceutical composition comprising a nanoparticle comprising an AHCM.
  • a pharmaceutical composition comprising a nanoparticle comprising an AHCM and a cancer therapeutic agent.
  • the cancer therapeutic is chosen from a viral cancer therapeutic agent, a lipid nanoparticle of an anticancer agent, a polymeric nanoparticle of an anti-cancer agent, an antibody against a cancer target, a dsRNA agent, an antisense RNA agent, or a chemotherapeutic agent.
  • AHCM is formulated in a dosage form that is according to the standard of care dosage form for anti-hypertensive or anti-heart failure use of the AHCM.
  • a dosage form of an AHCM wherein the AHCM is formulated in a dosage form that is less than 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1 , 0.15, 0.16,
  • a dosage form of an AHCM wherein the AHCM is formulated in a dosage form that is greater than 1.1, 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dosage form for anti-hypertensive or anti-heart failure use of the AHCM.
  • a method optimizing access to a cancer, or optimizing delivery to a cancer of an agent comprising: administering an anti-hypertensive and/or a collagen modifying agent ("AHCM") to the subject; and
  • administering comprises one or more of the following:
  • the diagnostic or imaging agent has a hydrodynamic diameter of greater than 1 , 5, or 20-1 50 nm;
  • the agent is a radiologic agent, an NMRA agent, a contrast agent; or c) the subject is treated with a dosing of AHCM administration, whic is initiated prior to administration of the agent for at least two, three, or five days, or one, two, three, four, five or more weeks prior to administration of the agent.
  • the detected change includes one or more of: an increase or decrease of activated TGF beta, TGF beta 1 level, connective tissue growth factor (CTGF) level, or collagen (e.g., collagen 1) level.
  • CGF connective tissue growth factor
  • the candidate agent is chosen from one or more of: an antagonist of renin angiotensin aldosterone system ("RAAS antagonist"), an angiotensin converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (AT] blocker), a thrombospondin 1 (TSP-1 ) inhibitor, a transforming growth factor beta 1 (TGF- ⁇ ⁇ ) inhibitor, or a connective tissue growth factor (CTGF) inhibitor.
  • RAAS antagonist an antagonist of renin angiotensin aldosterone system
  • ACE angiotensin converting enzyme
  • AT] blocker an angiotensin II receptor blocker
  • TSP-1 thrombospondin 1
  • TGF- ⁇ ⁇ transforming growth factor beta 1
  • CTGF connective tissue growth factor
  • AHCM anti-hypertensive and/or a collagen modifying
  • a therapeutic kit comprising an anti-hypertensive and/or a collagen modifying (AHCM), alone or in combination with a cancer therapeutic, and instructions for use for the treatment of cancer.
  • AHCM anti-hypertensive and/or a collagen modifying
  • a diagnostic kit comprising an anti-hypertensive and/or a collagen modifying (AHCM), alone or in combination with an imaging agent, and instructions for use for the diagnosis of cancer.
  • AHCM anti-hypertensive and/or a collagen modifying
  • a method of selecting a subject for receiving an anti-hypertensive and/or a collagen modifying agent comprising:
  • Examples 1-6 below the inventors assessed if an AHCM agent, for example, losartan - a clinically approved angiotensin II receptor antagonist generally for treatment of hypertension - can enhance the penetration and efficacy of nanomedicine, e.g., via an anti-fibrotic effect.
  • an AHCM agent for example, losartan - a clinically approved angiotensin II receptor antagonist generally for treatment of hypertension - can enhance the penetration and efficacy of nanomedicine, e.g., via an anti-fibrotic effect.
  • nanotherapeutics have offered new hope for cancer treatment, their clinical efficacy is modest (Jain RK, et al. (2010) Nat Rev Clin Oncol 7:653-664; Davis ME, et al. (2008) Nat Rev Drug Discov 7:771-782; Peer D, et al. (2007) Nat Nanotechnol 2:751-760; and Torchilin VP (2005) Nat Rev Drug Discov 4: 145-160).
  • the dense collagen network in tumors can generally reduce the penetration and efficacy of nanotherapeutics. This is partly because their penetration is hindered specially in fibrotic tumors where the small interfibrillar spacing in the interstitium retards the movement of particles larger than 10 nanometers (Netti PA, et al. (2000) Cancer Res 60:2497-2503; Pluen A, et al. (2001) Proc Natl Acad Sci USA 98:4628-4633; Ramanujan S, et al. (2002) 5/o/>/ ⁇ J 83: 1650- 1660 and Brown E, et al. (2003) Nat Med 9:796-800).
  • Matrix modifiers like bacterial collagenase, relaxin, and matrix
  • metalloproteinase - 1 and -8 have been used to modify the collagen or proteoglycan network in tumors and have improved the efficacy of intratumorally (i.t.) injected oncolytic viruses (Brown E, et al. (2003) Nat Med 9:796-800; McKee TD, et al. (2006) Cancer Res 66:2509-2513; Mok W, et al. (2007) Cancer Res 67: 10664-10668; Ganesh S, et al. (2007) Cancer Res 67:4399 ⁇ 1407; and Kim J-H, et al. (2006) J Natl Cancer Inst 98: 1482-1493).
  • relaxin can improve transport through the tumor matrix, but may not facilitate the delivery of low molecular weight agents (US 6,719,977). However, these agents may produce normal tissue toxicity (e.g., bacterial collagenase) or increase the risk of tumor progression (e.g., relaxin, matrix metalloproteinases).
  • Losartan Johnston CI (1995) Lancet 346: 1403-1407
  • losartan is also an antifibrotic agent that has been shown to reduce the incidence of cardiac and renal fibrosis (Habashi JP, et al. (2006) Science 312: 1 17-121 ; and.
  • TGF- ⁇ active transforming growth factor- ⁇
  • AGTR1 angiotensin II type I receptor
  • TGF- ⁇ activators like thrombospondin-1 (TSP- 1 )
  • Habashi JP et al. (2006) Science 312: 1 17-121
  • Cohn RD et al. (2007) Nat Med 13:204-210
  • Lavoie P et al. (2005) J Hypertens 23: 1895-1903
  • Chamberlain JS (2007) Nat Med 13: 125-126; and Dietz HC (2010) J Clin Invest 120:403-407.
  • an AHCM agent e.g., losartan inhibited collagen I production by carcinoma associated fibroblasts (CAFs) isolated from breast cancer biopsies. Additionally, an AHCM agent, e.g., losartan, led to a dose-dependent reduction in stromal collagen in desmoplastic models of human breast, pancreatic and skin tumors in mice. Furthermore, an AHCM agent, e.g., losartan improved the distribution and therapeutic efficacy of intratumorally injected oncolytic herpes simplex viruses (HSV).
  • HSV oncolytic herpes simplex viruses
  • an AHCM agent e.g., losartan also enhanced the efficacy of intravenously injected pegylated liposomal doxorubicin (DOXIL ® ). Accordingly, administration of an AHCM agent, e.g., losartan, in combination with a cancer therapeutic (e.g., a cancer nanotherapeutic) can enhance the efficacy of nanotherapeutics in patients with desmoplastic tumors.
  • a cancer therapeutic e.g., a cancer nanotherapeutic
  • an AHCM agent e.g., losartan reduces collagen I levels in four tumor models - a spontaneous mouse mammary carcinoma (FVB MMTV PyVT), an orthotopic pancreatic adenocarcinoma (L3.6pl), and subcutaneously implanted fibrosarcoma (HSTS26T) and melanoma (Mu89).
  • an AHCM agent e.g., Losartan
  • an AHCM agent e.g., losartan
  • an AHCM agent e.g., losartan
  • the inventors assessed how an AHCM agent, e.g., losartan, can affect the distribution and efficacy of oncolytic HSV administered i.t. - a widely used method of administration in patients for gene therapy (Hu JC, et al. (2006) Clin Cancer Res 12:6737-6747; Senzer NN, et al. (2009) J Clin Oncol 27:5763-5771 ; Breitbach CJ, et al. (2010) Cytokine Growth Factor Rev 21 :85-89) - and the efficacy of i.v.- administered DOXIL ® .
  • an AHCM agent e.g., Losartan
  • DOXIL ® i.t.-administered
  • an AHCM agent e.g., losartan
  • an AHCM agent can enhance nanoparticle penetration in the interstitial space by improving interstitial transport.
  • an AHCM agent e.g., losartan
  • an FDA approved antihypertensive drug can be used to improve the efficacy of various nanotherapeutics in multiple tumor types.
  • Example 1 Losartan inhibits collagen I synthesis by carcinoma associated fibroblasts (CAFs)
  • Example 2 Losartan decreases collagen I in tumors in a dose-dependent manner
  • collagen I is the main fibrillar collagen with significantly lower levels of collagen V (Mollenhauer J, et al. (1987) Pancreas 2: 14-24).
  • Losartan doses of 20 and 60 mg/kg/day significantly reduced the intratumoral SHG signal intensity, whereas the lowest dose of 10 mg/kg/day did not have a significant effect on the SHG signal intensity (Figs. 2A and 2B).
  • the injection of losartan at 60 and 20 mg/kg/day also significantly reduced the collagen I immunostaining in HSTS26T tumors by 65% and 42%, respectively (Fig. 3).
  • the 20mg/kg/day dose decreased collagen I immunostaining in four tumor types - FVB MMTV PyVT, L3.6pl, HSTS26T, and Mu89 - by 47% (p ⁇ 0.05), 50% (p ⁇ 0.03), 44% (p ⁇ 0.04), and 20% (p ⁇ 0.02), respectively (Figs. 5A-5D).
  • TSP-1 is a key regulator of TGF- ⁇ activation and losartan has been reported to reduce TSP-1 expression and TGF- ⁇ activation in mouse models of Marian's syndrome and muscular dystrophy (Dietz HC (2010) J Clin Invest 120:403-407). As shown herein, the measurement of protein levels in homogenized HSTS26T tumors showed that losartan did not affect total TGF- ⁇ levels but significantly reduced TSP-1, active TGF- ⁇ , and collagen I levels (Fig. 6). Losartan also decreased the TSP-1 immunostaining in
  • HSTS26T (73% p ⁇ 0.04) and Mu89 (24% p ⁇ 0.03)
  • Figs. 7A-7B the immunostaining patterns for TSP-1 (Figs. 7A-7B) and collagen I (Figs. 5C-5D) were closely matched.
  • the inventors detected high levels of TSP-1 and collagen I in the tumor margin, while losartan induced obvious reductions in TSP-1 and collagen I levels in the tumor center (Figs. 5C, 7A). These data indicate that the reduction in collagen I levels can result in part from the decreased activation of TGF- ⁇ due to the losartan-induced reduction in TSP- 1 expression.
  • Example 4 Losartan improves the intratumor distribution of nanopar icles and nanotherapeutics
  • losartan improved nanoparticle accumulation and penetration in the tumor center (Fig. 8A; HSTS26T p ⁇ 0.001, Mu89 pO.001). Conversely, there was little or no nanoparticle accumulation in the center of control tumors. Most of the injected nanoparticles in control tumors were found in the tumor margin and around the needle insertion point (Fig. 8A). The inventors also determined the effects of losartan on the intratumoral distribution of oncolytic HSV. In both HSTS26T and Mu89, losartan significantly increased the intratumoral spread of HSV injected intratumorally (Fig. 8B).
  • the inventors assessed the effect of losartan on blood vessel perfusion and the intratumoral distribution of i.v. injected nanoparticles in mice with orthotopic pancreatic tumors (L3.6pl).
  • the intratumoral accumulation and penetration of beads away from blood vessels was significantly higher in losartan-treated tumors (Fig. 8C and Fig. 10).
  • mice with orthotopic pancreatic tumors were treated with DOX1L® and losartan.
  • DOX1L® a sub-anti-tumor dose
  • the inventors treated mice with a sub-anti-tumor dose (i.e., a dose that is not effective for treatment of cancer, e.g., a dose that is not effective to inhibit or prevent tumor growth and/or progression) of DOXIL® (4mg/kg, i.v.).
  • a sub-anti-tumor dose i.e., a dose that is not effective for treatment of cancer, e.g., a dose that is not effective to inhibit or prevent tumor growth and/or progression
  • DOXIL® 4mg/kg, i.v.
  • Example 6 The pattern of collagen distribution regulates the effectiveness of losartan
  • Figs. 12A and 12B show striking differences between the collagen structure in Mu89 (Fig. 12A) and HSTS26T (Fig. 12B) tumors, respectively. Without wishing to be bound by theory, these differences in the collagen structure altered the virus propagation in these tumor types. In Mu89 tumors the collagen fiber network was well organized and formed finger-like projections into the tumor (Figs. 12A and 13A). These projections divided the tumor into distinct tumors.
  • renin-angiotensin-aldosterone system has been reported to play a role in the regulation and production of extracellular matrix components (Cook KL, et al. (2010) Cancer Res 70:8319-8328; Rodriguez-Vita J, et al. (2005) Circulation 1 1 1 :2509- 2517; and Wolf G (2006) Kidney Int 70: 1914-1919).
  • Angiotensin II has been reported to stimulate collagen production via both TGF- ⁇ dependent and independent pathways (Yang F, et al. (2009) Hypertension 54:877-884).
  • Losartan and other RAAS inhibitors have reported to reduce the levels of collagen I and III, and basement membrane collagen IV in various experimental models of fibrosis (Toblli JE, et al. (2002) J Urol 168: 1550- 1555 and Boffa JJ, et al. (2003) J Am Soc Nephrol 14: 1 132-1 144), and reverse renal and cardiac fibrosis in hypertensive patients (Lim DS, et al. (2001) Circulation 103:789-791 and halil A, et al. (2000) J Urol 164: 186-191). Using four different tumor types, the inventors have demonstrated herein for the first time that losartan also inhibits collagen I production in tumors.
  • metalloproteinase - 1 and -8 have been reported to modify the collagen or proteoglycan network in tumors and have improved the efficacy of oncolytic virus injected
  • an AHCM agent e.g., losartan
  • the inventors also discovered that the organization of the collagen fibrillar network can affect nanoparticle distribution. This was striking because of significant differences in the structural organization of fibrillar collagen I between Mu89 and HSTS26T. In Mu89 tumors, thick bundles of fibrillar collagen I surround the tumor margins and form finger-like projections, which subdivide the tumor mass into isolated compartments and confine the viral infection to the injection site / isolated compartments (Figs. 12A and 13A).
  • HSTS26T tumors have a meshlike collagen structure, which hinders the virus spread but does not restrict viral particles to the injection site (Figs. 12B and 13B).
  • the slower growth rate of HSTS26T than Mu89 tumors could also explain in part the enhanced efficacy of losartan combined with HSV in HSTS26T tumors.
  • the collagen network organization plays an important role in limiting the penetration of large therapeutics in tumors.
  • doses, administration methods and/or frequency of an AHCM agent e.g., losartan
  • a cancer therapeutic e.g., HSV
  • Pancreatic cancer patients treated with cytotoxic agents have a very high frequency of relapse with a 5 year survival of less than 5% (Li J, et al. (2010) AAPS J 12:223-232).
  • the poor vascular supply and increased fibrotic content of pancreatic tumors most likely play a significant role in limiting the delivery and efficacy of cytotoxics (Olive P, et al. (2009) Science 324: 1457-1461 ).
  • the inventors show - in a mouse orthotopic model of human pancreatic cancer (L3.6pl) - that losartan increases both the intratumoral dispersion and extravascular penetration distance of i.v. injected nanoparticles.
  • losartan are not limited to the interstitial space. Modifications to the
  • RAAS system can also inhibit angiogenesis (Fujita M, et al. (2005) Carcinogenesis 26:271-279) or alter tumor blood flow (Jain R, et al. (1984) IEEE Trans Son Ultrason 31 :504-526 and Zlotecki RA, et al. (1993) Cancer Res 53:2466-2468).
  • Losartan- blockade of AGTR1 can also reduce the production of VEGF by cancer cells and the expression of VEGFR1 in endothelial cells, and inhibit tumor angiogenesis and growth (Otake AH, et al. (2010) Cancer Chemother Pharmacol 66:79-87 and Noguchi R, et al. (2009) Oncol Rep 22:355-360).
  • losartan did not affect tumor growth or the vascular density in HSTS26T tumors. Losartan can also reduce the proliferation of tumor cells expressing AGTR1 (Rhodes DR, et al. (2009) Proc Natl Acad Sci USA
  • a low dose of losartan that is ineffective for treatment of cancer by itself alone, can be used to improve the efficacy of a cancer therapy or an anti-cancer agent (even at a sub-therapuetic level) for treatment of cancer. Further, the low dose of losartan can allow for a more clinically translatable protocol and avoid hypotensive complications.
  • AGTR1 signaling has been reported to increase the proliferation of stromal and tumor cells, and the transcription of inflammatory cytokines and chemokines that promote cancer cell migration and dissemination (Deshayes F, Nahmias C (2005) Endocrinol Metab 16:293-299).
  • losartan in addition to improving the delivery of antitumor agents, losartan can also inhibit tumor progression and metastasis.
  • losartan administered at a low dose e.g., a dose not effective to reduce or prevent metastasis if administered alone
  • an anti-metatstic agent e.g., at a dose less than what is typically administered by itself for treatment and/or prevention of metastasis
  • losartan In order to use losartan as an adjunct in the treatment of cancer patients it is important to consider dosing and treatment schedules along with potential side effects. Results from the dose and time dependent studies presented herein indicate a minimum of two weeks of losartan administration prior to anti-tumor treatment. To obtain maximum effects in patients, it might be prudent to initiate losartan treatment two weeks prior to and continue it during the entire antitumor treatment schedule. Since long-term losartan therapy in hypertensive patients has been shown to have limited and manageable side effects and many antitumor agents (e.g., anti-VEGF drugs) have been shown to increase blood pressure (Ager EI, et al. (2008) Carcinogenesis 29: 1675-1684), extended losartan co-therapy can be beneficial to cancer patients.
  • antitumor agents e.g., anti-VEGF drugs
  • patients can be treated with a dose of 2mg/kg/day losartan, which is generally used for the treatment of patients with Marfan's syndrome (Brooke BS, et al. (2008) N Engl J Med 358:2787- 2795).
  • losartan and ARBs have limited side effects, losartan therapy is not recommended for patients with known renal disease.
  • Losartan can induce renal insufficiency in patients with renal microvascular or macrovascuiar disease, or congestive heart failure (Sica DA, et al. (2005) Clin Pharmacokinet 44:797-814).
  • Hyperkalemia can also occur in patients with poor renal function or patients who are concomitantly receiving potassium supplements or potassium sparing diuretics.
  • angioedema caused by high levels of circulating angiotensin II can occur in patients treated with losartan (Sica DA, et al. (2005) Clin Pharmacokinet 44:797-814).
  • Tumor drug resistance is generally believed to occur at many levels including increased drug efflux, drug inactivation, evasion from apoptosis, and alterations in target pathways (Longley DB, et al. (2005) J Pathol 205:275-292). Since losartan is not an antitumor agent, tumor resistance to losartan therapy after extended treatment can result from other mechanisms. Given that TGF-Bl activation is induced by different agents like MMPs and integrins in addition to TSP-1 , tumor resistance to losartan could result from changes in TGF- ⁇ activation and signaling. However, long-term losartan therapy after myocardial infarction has been reported as not being associated with a reduction in antifibrotic properties (Schieffer B, et al. (1994) Circulation 89:2273-2282).
  • Examples 1-6 the inventors show that losartan reduces the stromal collagen content in tumors and improves the penetration and therapeutic efficacy of nanoparticles (DOXIL ® , HSV) delivered both i.t. and i.v. Losartan also exhibits vasoactive and anti-metastatic properties that could increase its clinical application. Furthermore, since losartan is already approved for clinical use, it represents a safe and effective adjunct for improving the efficacy of nanotherapeutics in cancer patients. Exemplary Experimental Protocols for Examples 1-6
  • CAFs isolated from human breast cancer biopsies were treated with losartan for 24 hrs prior to measurements of collagen and cytokine levels. Protein assays were done with commercial ELISA kits. All animal experiments were done with approval of the Institutional Animal Care and Use Committee. Losartan was administered i.p. at concentrations of 10, 20 or 60 mg/kg/day for up to 2 weeks. Mice were treated with HSV (i.t.) and DOXIL ® (i.v. via tail vein) after 2 weeks of losartan treatment. Excised tumors were either snap frozen for biochemical analyses or fixed in paraformaldehyde, and embedded in paraffin or optimum cutting temperature compound (OCT) for
  • CAFs were isolated from human breast cancer biopsies using an art-recognized protocol, e.g., the protocol described in Orimo A, et al. (2005) Cell 121 :335-348.
  • CAFs were plated in 24 well plates at a concentration of 500K cells/well. Cells were allowed 24 hrs to adhere to the plates before the addition of losartan at 10 ⁇ 1/1 for 24 hrs (Schuttert JB, et al. (2003) Pflugers Arch 446:387-393). Treatment was done in low serum to reduce background collagen levels. Conditioned medium was collected at the end of the 24-hr treatment period and analyzed for collagen levels. Protein assays
  • TGF- ⁇ assays were performed with a human TGF- ⁇ ELISA kit (R&D Systems, Minneapolis, MN). The assay only measures the free-form of mature TGF- ⁇ ⁇ . To measure total levels of TGF- ⁇ the latent form of TGF- ⁇ ⁇ was activated with IN HC1. TSP-1 assays were performed with a human TSP-1 ELISA kit (R&D Systems, Minneapolis, MN). Mice and tumor models
  • Tumor sizes were monitored in spontaneous FVB -Tg(MMTV-PyVT) 634MU1/J mice and tumors selected for treatment when they reached a size of 4 to 6 mm in diameter (Guy CT et al. ( 1992) Mol Cell Biol 12:954-961).
  • Cozaar (losartan potassium) tablets were ground using a mortar and pestle. The powder was then dissolved in water to obtain a concentration of 2.5 mg/ml. The solution was then filtered and stored in a sterile container. Losartan was administered by daily i.p. injections at a concentration of 10, 20 or 60 mg/kg/day for up to 2 weeks (Melo LG, et al. (1999) Am J Physiol 277:R624-R630).
  • Tumors for immunostaining analysis and quantification were harvested from mice, fixed in 4% paraformaldehyde, and embedded in paraffin or optimum cutting temperature compound (OCT) (Sakura Finetek Torrance, CA). OCT embedded tumors were soaked in sucrose solution for 24 hrs prior to embedding and freezing. Collagen I and TSP-1 immunostaining staining in frozen sections
  • Second Harmonic Imaging (SHG) imaging was performed in dorsal chamber tumors with a custom-built multiphoton laser-scanning microscope (Brown E, et al. (2003) Nat Med 9:796-800). Polarized light from a Ti:Sapphire laser (Mai-Tai).
  • Nanoparticles and oncolytic HSV were infused with a syringe pump (Harvard Apparatus Standard Pump 22, Holliston, Massachusetts) at a flow rate of 4 ⁇ / min.
  • the inventors injected 10 ⁇ of HSV (2.5 x 10 5 t.u.) expressing the green fluorescent protein (GFP), or 10 ⁇ of fluorescent nanoparticles (diameter of 100 ⁇ ; concentration of lxl 0 13 nanoparticles / ml).
  • the injected tumors were resected 30 min after the nanosphere injection and 24 hrs after the HSV infusion. Resected tumors were bisected at an angle perpendicular to the needle track, fixed in paraformaldehyde and frozen in OCT.
  • All tumor sections were obtained perpendicular to the angle of the needle track.
  • the entire tumor section was imaged with a confocal microscope (Olympus BX61 WI) at 2x and images were reconstituted as mosaics.
  • the nanosphere distribution and GFP-positive areas corresponds to the fraction of pixels brighter than the background signal.
  • Intravenous injection A total volume of 10 ⁇ at a concentration of 3.6 x 10 nanoparticles / ml was injected via the tail vein. Twenty-four hrs later 50 ⁇ of FITC- lectin was injected to identify functional vessels. Five min after the lectin-injection tumors were resected, fixed in paraformaldehyde and embedded in OCT.
  • Nanosphere penetration was determined by drawing contours around perfused vessels and recording the fraction of pixels positive for nanospheres in each contour. Contours extended out to 30 ⁇ for each perfused vessel. Using a previously described algorithm (Tong RT, et al. (2004) Cancer Res 64:3731-3736), the inventors fit the plot of nanosphere fraction and distance away from the vessel to an exponential and obtained a relative penetration depth of nanospheres from each vessel.
  • mice with HSTS26T tumors implanted in a dorsal skin fold chamber were treated with i.p. injections of losartan (40mg/kg/day) for 1 week.
  • Fluorescence recovery after photobleaching (FRAP) measurements were done with a custom built multiphoton microscope based on a previously described protocol (Chauhan VP, et al. (2009) Biophys J 97:330-336).
  • IgG labeled fluorescein isothiocyanate (0.5 ml; 2mg/ml) was injected i.t. and used as the tracer.
  • Diffusion was measured by multiphoton FRAP (MP-FRAP) and spatial Fourier analysis FRAP (SFA-FRAP) about 10 min after the injection. Matrix pore sizes were calculated using the SFA-FRAP data, using the equation
  • i67 staining was done on paraffin sections 21 days after HSV injection. Slides were microwave processed with Target Retrieval Solution (DAKO, Carpinteria, CA) prior to primary antibody detection. The entire tumor section was imaged at 2x magnification and reconstituted as a mosaic. Twenty regions were randomly selected in each tumor. The fraction of Ki67 positive cells in each region was determined by manual count.
  • DAKO Target Retrieval Solution
  • mice Two weeks after the implantation of orthotopic pancreatic L3.6PL tumors, mice were randomly selected for losartan or saline treatment. A sub-anti-tumor dose of
  • DOXIL ® (4 mg/kg) was infused i.v. via the tail vein after two weeks of losartan treatment (20 mg/kg/day). One week after the DOXIL injection, the tumors were resected and measured. Virus treatment and tumor growth delay
  • Scid mice bearing subcutaneous HSTS26T and MU89 tumors were randomly divided into control and losartan treated groups. Each arm (control and treated) was subsequently divided into HSV treated and non-HSV treated groups. Tumors that had reached 60 mm 3 after two weeks were selected for i.t. HSV injections. Tumors were treated with 10 ⁇ i.t. injections of either PBS or 2.5 x 10 5 transducing units (t.u.) of oncolytic HSV MGH2 (gift from E. Antonio Chiocca, Ohio State University, Columbus, OH). Two i.t. injections of oncolytic HSV separated by 24 hrs were administered.
  • mice in each treatment arm All the animal experiments were conducted with at least 6 mice in each treatment arm.
  • the tumor growth delay studies in HSTS26T and MU89 tumors were done with at least 8 mice in each group.
  • the rational for the number of mice used was based on power calculations in the inventors' previous studies (McKee TD, et al. (2006) CancerRes 66:2509-2513 and Mok W, et al. (2007) Cancer Res 67: 10664-10668), which showed that the inventors needed at least 8 mice in each group to reach statistical significance
  • Example 7 Angiotensin blockade improves drug delivery by normalizing the tumor microenvironment
  • a third determinant of delivery - interstitial transport through tissues - is particularly hindered for nanomedicine in tumors by an abnormally dense and tortuous tumor interstitium (Jain, R. K. & Stylianopoulos (2010) Nat Rev Clin Oncol. 139; Chauhan, V. P. et al. (2009) Biophysical journal 97, 330-336).
  • These barriers impact therapy, particularly, for patients with desmoplastic, fibrotic tumors, including pancreatic (Olive, . P. et al. (2009) Science 324, 1457-1461 ), colorectal (Halvorsen, T. B. & Seim, E.
  • angiotensin blockade “normalizes" interstitial matrix in solid tumors, including breast and pancreatic tumors (Fig. 17A).
  • ARBs angiotensin receptor blockers
  • ACE-ls angiotensin converting enzyme inhibitors
  • the inventors also determined that ARBs and ACE-ls can decompress blood vessels to improve perfusion (Figs. 17B-17D), increase tumor hydraulic conductivity to repair vessel function (Fig.
  • ARBs and ACE-ls can enhance the delivery of therapeutics, and thus have broad applicability for combination therapy with all classes of anti-cancer agents including small-molecule chemotherapeutics, biologies, and nanoparticle therapies.
  • Angiotensin blockers offer numerous advantages over other approaches. Anti- angiogenic therapies normalize the vasculature alone and have been approved for only a limited number of indications. Meanwhile, ARBs and ACE-Is are FDA-approved as antihypertensives with manageable adverse effects. Matrix-degrading enzymes, which can normalize the collagen matrix, are not selective for tumors and can increase invasion and metastasis.
  • ARBs and ACE-Is generally have no complications associated with matrix remodeling in normal tissues, leading to their safety as anti-hypertensives.
  • ARBs and ACE-Is as small-molecule agents, can also be delivered via nanovectors containing chemotherapeutics (e.g., liposomes, nano-particles) to enhance their localization to tumors to further limit toxicity.
  • chemotherapeutics e.g., liposomes, nano-particles
  • Anti-angiogenics the only FDA-approved adjuncts that enhance drug delivery to tumors, generally cannot improve delivery for larger particles as they can reduce the size of "pores" in vessel walls.
  • angiotensin blockers presented herein can improve delivery for all classes of anti-tumor diagnostics and therapies.
  • Example 8 In vitro screen to identify anti-hypertensive agents to lower collagen in solid tumors
  • This Example provides an assay to rank anti-hypertensive (AH) agents based on their ability to lower collagen I level in tumors.
  • TGF- ⁇ active-TGF- ⁇ , thrombospondin 1 (TSP1) and connective tissue growth factor (CTGF)
  • the inventors determined that losartan reduced TGF- ⁇ 1 activation and collagen I production in breast CAFs in vitro.
  • Cells were treated with 10 ⁇ /L of losartan for 24 hrs.
  • Losartan reduced by 90% the active-TGF- ⁇ levels (p ⁇ 0.05), while total TGF- ⁇ levels were unaffected.
  • Anti-hypertensive agents Any FDA-approved angiotensin receptor blockers (ARBs) can be tested. Exemplary names and doses of these agents can be found via, but not limited to, http://www.globa ⁇ h.com/druglist.htm. Although angiotensin converting enzyme inhibitors (ACEIs) also lower collagen, they do not target the receptor on cells and hence the inventors did not measure their effects on collagen I. Calcium channel blockers can also be evaluated for the collagen lowering effects.
  • ARBs angiotensin receptor blockers
  • CAFs Isolate carcinoma-associated fibroblasts
  • human cancer biopsies using a previously described protocol
  • Orimo A, et al. (2005) Cell 121(3):335-348 CAFs should be plated in 24 well plates at a concentration of 500K cells/well and allowed 24 hrs to adhere to the plates before the addition of anti-hypertensive drug.
  • all the losartan studies were performed at 10 ⁇ [/1 for 24 hrs, based on a published protocol (Schuttert JB, et al. (2003) Pflugers Arch 446(3):387-393).
  • Treatment can be done in low serum to reduce background collagen levels.
  • Conditioned medium can be collected at the end of the 24-hr treatment period and analyzed for total and activated TGF- ⁇ , TSP-1 , CTGF and collagen levels.
  • TGF- ⁇ assays were performed with a human TGF- ⁇ ELISA kit (R&D Systems, Minneapolis, MN). The assay only measures the free-form of mature TGF- ⁇ . To measure total levels of TGF- ⁇ the latent form of TGF- ⁇ ⁇ was activated with IN HCI.
  • TSP-1 assays were performed with a human TSP- 1 ELISA kit (R&D Systems, Minneapolis, MN).
  • CTGF ELISA kit can be purchased from Leinco (www.leinco.com).
  • CAFs carcinoma associated fibroblasts
  • Co-culture CAFs and cancer cells in media containing angiotensin I and ACE Co-culture CAFs and cancer cells in media containing angiotensin I and ACE; Treat CAFs for 48 hrs with, for example, 6 doses of an AGTR1 or ACE inhibitor; Collect supernatant and measure TGFpl, connective tissue growth factor (CTGF), thrombospondin 1, and/or collagen I by ELISA. ELISA measurements should be repeated 3 times or more. Additional exemplary testing:
  • angiotensin signaling blockade improves drug delivery, at least partly, through two mechanisms: it relaxes the inherent compressive force in tumors to improve vessel perfusion, and it reduces the viscoelastic and steric hindrance on drug transport directly imparted by the matrix.
  • Angiotensin signaling blockade can safely inhibit activation of the profibrotic TGF-beta and CTGF pathways downstream to produce these changes.
  • endothelin receptor blockers (ERBs) and PDGF inhibitors (PDGF-Is) can be used in combination with angiotensin blockers.
  • ERBs treat pulmonary arterial hypertension and can be used as a class of therapy for cancer (Nelson et al. (2003) Nature Reviews Vol. 3: 1 10-1 16), for example with angiotensin blockers.
  • PDGF-Is haven been reported for their potential anti- vascular effects in tumors (Baluk et al. (2005) Current Opinion in Genetics &
  • ERBs have been reported to be well-tolerated with a potential to improve overall survival in prostate cancer (James et al. (2009) European Urology 55: 1 1 12-1 123) and non-small cell lung cancer (Chiappori et al. (2008) Clin Cancer Res 14: 1464-1469).
  • an angiotensin blockade with endothelin-1 and/or PDGF blockade - with careful dosing - should produce an additive improvement to drug delivery with minimal additional toxicity.
  • endothelin-1 and/or PDGF blockade can be used at a sub-therapuetic dose in combination with an angiotensin blockade, which can be used at a sub-anti-hypertensive dose and/or sub-anti-tumor dose, for improved drug delivery and/or treatment of cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pulmonology (AREA)
  • Epidemiology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Cardiology (AREA)
  • Mycology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Rheumatology (AREA)
  • Oncology (AREA)
  • Dermatology (AREA)
  • Transplantation (AREA)
  • Neurology (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

Methods and compositions for improving the delivery and/or efficacy of cancer therapeutics are disclosed. Methods and compositions for treating or preventing a cancer (e.g., a solid tumor such as a desmoplastic tumor) by administering to a subject an antihypertensive agent, as a single agent or combination with a cancer therapeutic agent (for example, a therapeutic agent ranging in size from a large nanotherapeutic to a low molecular weight chemotherapeutics and/or oxygen radical) are disclosed.

Description

NOVEL COMPOSITIONS AND USES OF ANTI-HYPERTENSION AGENTS
FOR CANCER THERAPY
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims benefit under 35 U.S.C. § 1 19(e) of U.S. Provisional
Application Serial No. 61/415,192, filed November 18, 2010; and U.S. Provisional Application Serial No. 61/438,240, filed January 31, 201 1 , the contents of which are each incorporated herein by reference in their entirety. GOVERNMENT SUPPORT
This invention was made with federal funding under Grant No. PO1-CA-80124- 03 awarded by the National Institutes of Health. The U.S. government has certain rights in the invention.
BACKGROUND
Advances in biomedical research have led to the introduction of several novel systemically administered molecular and nanotherapeutic agents in both preclinical and clinical settings (Jones, D. (2007) Nat Rev Drug Discov 6, 174-175; Moghimi, S. M. et al. (2005) Faseb J 19, 31 1-330). While these new agents act on unique targets that afford greater specificity to tumor cells or improved pharmacodynamic properties, their effectiveness suffers from limitations in their delivery owing to the properties of the tumor microenvironment (Jain, R. K. ( 1998) Nat Med A, 655-657; Sanhai, W. R. et al. (2008) Nat Nanotechnol 3, 242-244). For example, pegylated liposomal doxorubicin (DOXIL®), approved by the FDA, and oncolytic viruses, currently in multiple clinical trials, represent two nanotherapeutics whose size (~ 100 nm) hinders their intratumoral distribution and therapeutic effectiveness (Nemunaitis J, et al. (2001 ) J Clin Oncol 19:289-298).
At least two processes governing drug delivery following systemic administration, namely, vascular transport throughout tissues and transvascular transport into tissues, are hindered by physiological barriers in tumors for all classes of therapeutics (Jain, R. K. & Stylianopoulos (2010) Nat Rev Clin Oncol. 139; Chauhan, V. P. et al. (2009) Biophysical journal 97, 330-336). These barriers impact therapy, particularly, for patients with desmoplastic, fibrotic tumors, such as pancreatic (Olive, . P. et al. (2009) Science 324, 1457- 1461), colorectal (Halvorsen, T. B. & Seim, E. (1989) J Clin Pathol 42, 162-166), lung and breast cancer (Ronnov-Jessen, L. et al. (1996) Physiol Rev 76, 69-125). Fibrotic tumors typically have a dense collagen network, which causes small interfibrillar spacing in the interstitium to retard the movement of particles larger than 10 nanometers (Netti PA, et al. (2000) Cancer Res 60:2497-2503; Pluen A, et al. (2001) Proc Natl Acad Sci USA 98:4628-4633; Ramanujan S, et al. (2002) Biophys J 83: 1650-1660; and Brown E, et al. (2003) Nat Med 9:796-800) These barriers limit the amount of drug that reaches the target cancer cells and leads to poor drug effectiveness.
Currently, there are limited approaches to overcome these delivery barriers for nanotherapeutics and for low molecular weight drugs. Thus, the need exists for identifying new cancer therapies, in particular new agents that enhance the delivery and distribution of cancer therapies, including nanotherapeutics (e.g., lipid- or polymeric nanoparticles and viruses), protein and nucleic acid drugs, and small molecule
chemotherapeutic agents.
SUMMARY OF THE INVENTION
The invention is based, in part, on the discovery that losartan, an angiotensin II receptor antagonist drug approved for the treatment of high blood pressure
(hypertension), improves the delivery and efficacy of cancer therapeutics.
The inventors have discovered, inter alia, that losartan normalizes the collagen, interstitial matrix of solid tumors and facilitates the distribution and/or penetration of chemotherapeutics, including large molecular weight chemotherapeutics, e.g.,
nanotherapeutics. For example, losartan reduced collagen I levels in (e.g., reduced collagen production by) carcinoma associated fibroblasts (CAFs) isolated from breast cancer biopsies, and caused a dose-dependent reduction in stromal collagen in
desmoplastic models of human breast, pancreatic and skin tumors in mice. Losartan also improved the distribution, therapeutic efficacy and/or penetration of nanopartices (e.g., oncolytic herpes simplex viruses (HSV) and pegylated liposomal doxorubicin
(DOXIL®)). The inventors have also discovered that losartan facilitates decompression of blood vessels and vascular normalization, and improves tumor perfusion and delivery of low molecular weight chemotherapeutics, thus enhancing the therapeutic effect of radiation and chemotherapeutics.
Thus, methods and compositions for improving the delivery and/or efficacy of therapeutics (e.g., cancer therapeutics) are disclosed. Methods and compositions for treating or preventing a cancer (e.g., a solid tumor such as a desmoplastic tumor) by administering to a subject an anti-hypertensive and/or collagen modifying agent, as a single agent or in combination with a therapeutic agent (for example, a cancer therapeutic agent ranging in size from a large nanotherapeutic to a low molecular weight chemotherapeutics and/or oxygen radicals) are disclosed.
Accordingly, in one aspect, the invention features a method of treating or preventing a hyperproliferative disorder (e.g., a cancer) in a subject, or of improving the delivery and/or efficacy of a therapy (e.g., a cancer therapy) to a subject. The method includes:
administering an anti-hypertensive and/or a collagen modifying agent ( referred to herein as "AHCM" or "AHCM agent") to the subject; and
optionally, administering the therapy (e.g., the cancer therapy),
under conditions, e.g., of dosage of AHCM and anti-cancer agent, sufficient to treat or prevent the disorder (e.g., the cancer or tumor), in the subject, or to improve the delivery and/or efficacy of the therapy (e.g., the cancer therapy) provided to the subject.
In one embodiment, the method includes one or more of the following:
a) selecting or identifying the subject as being in need of receiving the AHCM on the basis of the need for improved delivery and/or efficacy of the therapy (e.g., the cancer therapy);
b) administering the AHCM, the therapy (e.g., the cancer therapy), or both, as an entity having a hydrodynamic diameter of greater than about 1, 5, 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150, 200 nm, but less than 300 nm, e.g., as a nanoparticle;
c) the subject has a history of treatment (or lack of treatment) for hypertension, as described herein, e.g., the subject has not been administered a dose of an AHCM, e.g., an AHCM named herein, or any AHCM (e.g., either of a dose sufficient to substantially lower the subject's blood pressure or a sub-anti-hypertensive dose) , within 5, 10, 30, 60 or 100 days of the diagnosis of cancer or the initiation of the AHCM dosing. In one embodiment, the subject is not hypertensive, or has been hypertensive, prior to administration of the AHCM;
d) treating the subject with a dosing regimen described herein, e.g., AHCM administration is initiated prior to the initiation of administration of the cancer therapy, e.g., it is initiated at least one, two, three, or five days, or one, two, three, four, five or more weeks prior to cancer therapy (e.g., the AHCM is administered at a minimum of two weeks prior to cancer therapy);
e) providing the AHCM and cancer therapy according to a dosing regimen described herein, e.g., providing a first course of treatment with an AHCM at a sub-anti- hypertensive dose followed by a second, higher dose, course of treatment with an AHCM, e.g., at a dose that is at or above a standard anti-hypertensive dose (e.g., wherein the second course is administered in a time course that will counteract a hypertensive affect of an anti-cancer therapy);
f) administering the AHCM substantially continuously over a period of at least 1 ,
5, 10, or 24 hours; at least 2, 5, 10, or 14 days; at least 2, 3, 4, 5 or 6 weeks; at least 2, 3, 4, 5 or 6 months; or at least 1 , 2, 3, 4 or 5 years, or longer;
g) administering the AHCM sequentially and/or concurrently with the therapy, e.g., the cancer therapy. The AHCM and the therapy can be administered (at the same or different dosages) in any order and/or overlap with the therapy. In one embodiment, the AHCM is administered before the therapy (e.g., as described in step d)). In other embodiments, the AHCM is administered sequentially and concurrently with the therapy (e.g., the AHCM is administered prior to the therapy (e.g., as described in step d) and concurrently with the therapy). In yet other embodiments, the therapy is administered first, and the AHCM is administered after initiation of the therapy. In embodiments where administration of the AHCM and therapy is concurrent, the administration of the AHCM and the therapy can be continued as clinically appropriate, for example, (i) as a combination therapy, (ii) with a period of therapy with either the AHCM or the therapy, or (iii) as a combination of (i) and (ii) in any order.
In one embodiment, the AHCM is administered in an amount sufficient to alter
(e.g., enhance) the distribution or efficacy of the therapy, e.g., the cancer therapy. In some embodiments, the AHCM is administered in an amount insufficient to inhibit or prevent tumor growth by itself, but sufficient to alter (e.g., enhance) the distribution or efficacy of the therapy, e.g., the cancer therapy.
In an embodiment, the AHCM is administered at a dose that causes one or more of: decreases the level or production of collagen, decreases tumor fibrosis, increases interstitial tumor transport, improves tumor perfusion, or enhances penetration or diffusion, of the cancer therapeutic in a tumor or tumor vasculature, in the subject.
In one embodiment, the AHCM is chosen from one or more of:
an angiotensin II receptor blocker (ATi blocker),
an antagonist of renin angiotensin aldosterone system ("RAAS antagonist"), an angiotensin converting enzyme (ACE) inhibitor, a thrombospondin 1 (TSP-1) inhibitor,
a transforming growth factor beta 1 (TGF-βΙ) inhibitor,
a connective tissue growth factor (CTGF) inhibitor, or
a combination of two or more of the above.
Unless the context describes otherwise, the term "AHCM" may refer to one or more agents as described herein.
The method can include one, two, three or more AHCMs, alone or in combination with one or more cancer therapies.
In one embodiment, the AHCM is a RAAS antagonist. In an embodiment, the RAAS antagonist is chosen from one or more of: aliskiren (TEKTURNA®,
RASILEZ®), remikiren (Ro 42-5892), enalkiren (A-64662), SPP635, or a derivative thereof.
In another embodiment, the AHCM is an ATi inhibitor. In an embodiment, the ATi blocker is chosen from one or more of: losartan (COZAAR®), candesartan
(ATACAND®), eprosartan mesylate (TEVETEN®), EXP 3174, irbesartan (AVAPRO®), L158,809, olmesartan (BENICAR®), saralasin, telmisartin (MICARDIS®), valsartan (DIOVAN®), or a derivative thereof.
In yet another embodiment, the AHCM is an ACE inhibitor. In an embodiment, the ACE inhibitor is chosen from one or more of: benazepril (LOTENSIN®), captopril (CAPOTEN®), enalapril (VASOTEC®), fosinopril (MONOPRIL®), lisinopril
(PRINIVIL®, ZESTRIL®), moexipril (UNIVASC®), perindopril (ACEON®), quinapril (ACCUPRIL®), ramipril (ALTACE®), trandolapril (MAVIK®), or a derivative thereof.
In yet another embodiment, the AHCM is a TSP-1 inhibitor. In an embodiment, the TSP- 1 inhibitor is chosen from one or more of: ABT-510, CVX-045, LSKL, or a derivative thereof.
In one embodiment, the AHCM is a TGF-βΙ inhibitor, e.g., an anti- TGF-βΙ antibody, a TGF-βΙ peptide inhibitor. In certain embodiment, the TGF-βΙ inhibitor is chosen from one or more of: CAT- 192, fresolimumab (GC 1008), LY 2157299, Peptide 144 (P144), SB-431542, SD-208, compounds described in U.S. Patent Serial No.
7,846,908 and U.S. Patent Application Publication No. 201 1/0008364, or a derivative thereof.
In yet another embodiment, the AHCM is a CTGF inhibitor. In certain embodiment, the CTGF inhibitor is chosen from one or more of: DN-9693, FG-3019, and compounds described in European Patent Application Publication No. 1839655, U.S. Patent Serial No. 7,622,454, or a derivative thereof.
The exemplary AHCMs are described herein are not limiting, e.g, derivatives of AHCMs described herein can be used in the methods described herein.
AHMC Dosage and Dosage Form
Methods of the invention use an AHCM to potentiate a therapy (e.g., a cancer therapy).
In one embodiment, the AHCM is administered at a dose that corresponds to a standard of care dose. Standard of care doses of the AHCM are available in the art. For example, if the AHCM is the ATi inhibitor, losartan, the standard of care dose for antihypertensive use in a human is about 25- 100 mg day*1. In the present methods, losartan can be administered orally in a daily schedule (once or twice a day), alone or in combination with a cancer therapy described herein. Losartan can be provided in a dosage form (e.g., an oral tablet) of about 12.5 mg, 25 mg, 50 mg or 100 mg.
Exemplary standard of care doses for other AT] inhibitors for anti-hypertensive or anti-heart failure use in humans are as follows: 4 to 32 mg day"1 of candesartan
(ATACAND®) (e.g., available in a dosage form for oral administration containing 4 mg, 8 mg, 16 mg, or 32 mg of candesartan); 400 to 800 mg day"1 of eprosartan mesylate (TEVETEN®) (e.g., available in a dosage form for oral administration containing 400 or 600 mg of eprosartan); 150 to 300 mg day"1 of irbesartan (AVAPRO®) (e.g., available in a dosage form for oral administration containing 150 or 300 mg of irbesartan); 20 to 40 mg day"1 of olmesartan (BENICAR®) (available in a dosage form for oral administration containing 5 mg, 20 mg, or 40 mg of olmesartan); 20 to 80 mg day"1 of telmisartin (MICARDIS®) (e.g., available in a dosage form for oral administration containing of 20 mg, 40 mg or 80 mg of telmisartin); and 80 to 320 mg day"1 of valsartan (DIOVAN®) (e.g., available in a dosage form for oral administration containing 40 mg, 80 mg, 160 mg or 320 mg of valsartan).
In an embodiment, the AHCM is administered at a sub-anti-hypertensive dose (e.g., a dose that has no significant effect on mean arterial blood pressure when administered to a hypertensive subject; or a dose that is below a standard of care antihypertensive dose). In an embodiment, the AHCM is administered in an amount that does not substantially lower the mean arterial blood pressure of the subject, e.g., as measured after a pre-selected number of administrations at that dosage, e.g., at the steady state plasma level for a given dosage. In an embodiment, the AHCM is administered, at least once, at a dose that reduces mean arterial blood pressure in the subject by less than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%. In an embodiment, the AHCM is administered at a dose that reduces blood pressure by less than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, or less of the reduction caused by a standard of care anti-hypertensive dose for that AHCM. In an embodiment the AHCM is administered at a dose that is less than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% of the dose of that AHCM that would bring the subject's blood pressure into the normal range, e.g, about 120 systolic and about 80 diastolic, or a dose that would bring the subjects blood pressure into the range of to 120+/-5 systolic and 80+/-5 diastolic.
In an embodiment, the AHCM is administered at a dose that is less than the standard of care dose for anti-hypertensive or anti-heart failure use (e.g., a dose that is less than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, that of the standard of care dose for anti-hypertensive or anti-heart failure use). Standard of care doses of the AHCM are available in the art. For example, if the AHCM is the ATi inhibitor, losartan, and the standard of care dose is about 25-100 mg day"1, the suboptimal anti-hypertensive drug can range from 0.25 to 17.5, 0.5 to 15, 1.3 to 12, 1.5 to 12, 2 to 12, 2 to 10, 2 to 5, 2 to 3 mg day"1, typically, 2 mg day"1. In one embodiment, the AHCM is losartan and is administered at a dose less than 25, 20, 15, 10, 5, 4, 3, 2, 1 mg day"1.
Losartan can be administered orally in a daily schedule (once or twice a day) at a sub- anti-hypertensive dose of 2-3 mg day"1, alone or in combination with a cancer therapeutic described herein. Exemplary standard of care doses for other ATi inhibitors are as follows: 4 to 32 mg day"1 of candesartan (ATACAND®), 400 to 800 mg day 1 of eprosartan mesylate (TEVETEN®), 150 to 300 mg day 1 of irbesartan (AVAPRO®), 20 to 40 mg day"1 of olmesartan (BENICAR®), 20 to 80 mg day"1 of telmisartin
(MICARDIS®), and 80 to 320 mg day"1 of valsartan (DIOVAN®). In an embodiment, the AHCM is administered at a dose that is less than the standard of care dose of the antihypertensive or anti-heart failure dose (e.g., a dose that is less than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, that of the standard of care dose of the anti-hypertensive or anti-heart failure dose for other ATi inhibitors such as candesartan, eprosartan, irbesartan, olmesartan, telmisartin, and valsartan).
In certain embodiments, the AHCM is formulated in a dosage form that is less than the standard of care anti-hypertensive or anti-heart failure dosage form (e.g., a dosage form that is less than 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.15, 0.16, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, that of the standard of care dosage form). For example, if the AHCM is losartan, the dosage form can be of about 0.5 mg-1 1 mg; 1 mg -10 mg; 1 -5 mg, or 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg or 10 mg. In some embodiments, losartan can be provided in a dosage form (e.g., an oral tablet) below 12.5 mg, e.g., about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 1 1 mg, or about 12 mg.
In one embodiment, the AHCM is formulated as a tablet (e.g., an oral tablet). In other embodiments, the AHCM is formulated for other routes of administration, e.g., subcutaneous or intravenous administration.
In some embodiments, the sub-anti-hypertensive dose of the AHCM or a dose of the AHCM that is less than the standard of care dose for anti-hypertensive or anti-heart failure use can be a dose that is insufficient to inhibit or prevent tumor growth or progression if it is administed to a subject by itself.
In yet another embodiment, the AHCM is administered at a dose that is greater than the standard of care dose for anti-hypertensive or anti-heart failure use (e.g., a dose that is greater than 1.1, 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dose for anti-hypertensive or anti-heart failure use). Standard of care doses of the AHCM are available in the art; some of which are exemplified herein.
In other embodiments, the AHCM is formulated in a dosage form that is greater than the standard of care anti-hypertensive or anti-heart failure dosage form (e.g., a dosage form that is greater than 1.1 , 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dosage form). Standard of care dosage forms of the AHCM are available in the art; some of which are exemplified herein.
In some embodiments, a dose of the AHCM that is comparble to, or greater than the standard of care anti-hypertensive or anti-heart failure dose can be a dose that is insufficient to inhibit or prevent tumor growth or progression if it is administed to a subject by itself.
In other embodiments, the anti-cancer agent is administered at a greater dosage, or in a regimen that results in higher levels of the anti-cancer agent, as compared with a reference, e.g., the dosage on a package insert, the standard of care dosing, or the maximum tolerated dose (MTD). In certain embodiments, the anti-cancer agent is administered at a lesser dosage, or in a regimen that results in lower levels of the anti-cancer agent, as compared with a reference, e.g., the dosage on a package insert, the standard of care dosing, or the MTD. In some embodiments, the anti-cancer agent is administered in an amount such that it is not effective to inhibit or prevent tumor growth or progression when administered by itself, but in an amount sufficient to inhibit or prevent tumor growth or progression when administered in combination with the AHCM.
In some embodiments, the cancer therapy or cancer therapeutic, when administered in combination with an AHCM, is administered to the subject at a dose that is less than the lowest dose that would be used in the absence of the AHCM, to treat or prevent cancer in a subject.
In some embodiments, when both the AHCM agent and cancer therapy or cancer therapeutic are administered to the subject, the dose of the anti-hypertenisve and/or collagen modifying agent can be a dose that is less than the lowest dose that would be used to treat a hypertensive-associated disorder or heart failure, while the dose of the cancer therapy or cancer therapeutic can be a dose that is less than the lowest dose that would be used in the absence of the AHCM, to treat or prevent cancer in a subject.
In some embodiments, while the dose of the cancer therapy or cancer therapeutic administered to the subject is less than the lowest dose that would be used alone to treat a patient with cancer, the dose of the AHCM agent administered to the subject as an adjuvant can be less than the lowest dose that would be used alone to treat cancer. In such embodiments, the dose of the AHCM agent administered to the subject as an adjuvant can be sub-anti-hypertensive dose or comparable to, or greater than the standard care dose for treatment of hypertension or heart failure.
In some embodiments, while the dose of the cancer therapy or cancer therapeutic administered to the subject is less than the lowest dose that would be used in the absence of the AHCM, to treat a patient with cancer, the dose of the AHCM agent administered to the subject as an adjuvant can be less than the lowest dose that would be used alone to treat cancer, but is sufficient to improve efficacy of a cancer therapy or delivery of a cancer therapeutic to a tumor. In such embodiments, the dose of the AHCM agent administered to the subject as an adjuvant can be sub-anti-hypertensive dose or comparable to, or greater than the standard care dose for treatment of hypertension or heart failure. Methods to determine the lowest dose of any agent, e.g., an anti-cancer agent and/or an AHCM, for treatment are well known within one of skill in the art. For example, a skilled artisan can determine the lowest dose of an AHCM and/or an anticancer agent effective for treatment in an animal model corresponding to a specific type of cancer, e.g., by administering the animal with different doses of the AHCM and/or anti-cancer agent and monitoring the tumor growth as compared to a control. A control can be an animal treated with an anti-cancer agent alone (i.e., in the absence of the AHCM). The AHCM and the therapy (e.g., cancer therapy) can be administered in combination, e.g., sequentially and/or concurrently, as described herein. The AHCM and the therapy can be administered (at the same or different dosages) in any order and/or overlap with the therapy. In one embodiment, the AHCM is administered before the therapy. In other embodiments, the AHCM is administered sequentially and concurrently with the therapy (e.g., the AHCM is administered prior to the therapy and concurrently with the therapy). In yet other embodiments, the cancer therapy is administered first, and the AHCM is administered after initiation of the cancer therapy. In embodiments where administration of the AHCM and therapy is concurrent, the administration of the AHCM and the cancer therapy can be continued as clinically appropriate (i) as a combination therapy, (ii) with a period of therapy with either the AHCM or the cancer therapy, or (iii) a combination of (i) and (ii) in any order.
The administration of the AHCM can be substantially continuous. For example, administration of the AHCM can be substantially continuously over a period of at least 1 , 5, 10, 24 hours; 2, 5, 10, 14 days, or longer.
In other embodiments, the administration of the AHCM can be intermittent, e.g., can have gaps at pre-determined intervals, during the course of therapy. In certain embodiments, two or more doses of the AHCM are administered, alone or in combination with the therapy (e.g., the cancer therapy). In one embodiment, the AHCM is administered at a suboptimal anti-hypertensive dose and an anti-hypertensive dose during the course of therapy. For example, a suboptimal anti-hypertensive dose of the AHCM can be administered prior to, or at the time, of therapy (e.g., cancer therapy) (e.g., treatment with an anti-cancer agent that increases mean arterial blood pressure, e.g, treatment with an anti-angiogenic drug (e.g., Avastin, sunitinib or sorafenib)); then followed by a second hypertensive dose of the AHCM. Size of therapeutic entities
The methods described herein allow for enhanced flexibility in the range of treatment modalities used or selected, e.g., in the size of the therapeutic entity or entities. Accordingly, in one embodiment, an AHCM is administered as an entity having a hydrodynamic diameter of greater thanabout 1, 5, 10, 100, 500, or 1 ,000 nm. E.g., the AHCM can be a protein, e.g., an antibody. The AHCM can also be administered as a nanoparticle, e.g., a polymeric nanoparticle or a liposome, that includes the AHCM as a small molecule therapeutic or a protein, e.g., an antibody.
In an embodiment, the cancer therapy is a cancer therapeutic (also referred to herein as "an anti-cancer agent") or second therapeutic agent is administered as an entity having a hydrodynamic diameter of greater than about 1 , 5, 10, 20, 50, 75, 100, 150, 200, 500, or 1 ,000 nm. E.g., the anti-cancer agent can be a protein, e.g., an antibody. The anti-cancer agent can also be administered as a nanoparticle, e.g., a polymeric
nanoparticle or a liposome, that includes the anti-cancer agent as a small molecule therapeutic (i.e., a molecule having a hydrodynamic diameter of about 1 nm or less) or a protein, e.g., an antibody.
in an embodiment, an AHCM is administered as an entity having a hydrodynamic diameter of greater than about 1 nm (e.g., greater than about 1, 5, 10, 20, 50, 75, 100, 150, 200, 500, or 1,000 nm) and an anti-cancer agent is administered as an entity having a hydrodynamic diameter of about lnm or less. In one embodiment, the AHCM is present in the entity without a chemotherapeutic agent. The AHCM can be formulated for extended release, e.g., in an extended release formulation for substantially continuous release for hours, days, weeks, months or years.
In an embodiment, an AHCM is administered as an entity having a hydrodynamic diameter of about 1 nm, or less, and an anti-cancer agent is administered as an entity having a hydrodynamic diameter of about 1 nm or greater (e.g., greater than about 1, 5, 10, 20, 50, 75, 100, 150, 200, 500, or 1 ,000 nm).
In an embodiment, an AHCM is administered as an entity having a hydrodynamic diameter of less than, or equal to, about 1 nm and an anti-cancer agent is administered as an entity having a hydrodynamic diameter of less than about 1 nm.
In an embodiment, an AHCM is administered as an entity having a hydrodynamic diameter of greater than about 1 nm (e.g., greater than about 1 , 5, 10, 20, 50, 75, 100, 150, 200, 500, or 1 ,000 nm), and an anti-cancer agent is administered as an entity having a hydrodynamic diameter of greater than about 1 nm (e.g., greater than about 1 , 5, 10, 20, 50, 75, 100, 150, 200, 500, or 1 ,000 nm). The AHCM and anti-cancer agent can be in separate or the same entity. For example, if provided as separate entities the AHCM can be provided as a first nanoparticle and the anti-cancer agent provided as a second nanoparticle (e.g., where the second nanoparticle has a structural property (e.g., size or composition) or a functional property (e.g., release kinetics or a pharmacodynamic property) that differs from the first nanoparticle). Alternatively, an AHCM and an anticancer agent can be provided on the same entity, e.g., in the same nanoparticle.
In an embodiment, the AHCM is selected from a therapeutic entity having a hydrodynamic diameter: equal to or less than 1 or 2 nm; between 2 - 20, 10-25, 20-40, 40, 50-150 nm; between 10, 15, 20, 25, 35, 40, 45, 50- 100 nm; between 10, 15, 20, 25, 35, 40, 45, 50 -200 nm; between 10, 15, 20, 25, 35, 40, 45, 50, 75, 100, 150, 200, 300 - 500 nm; and between 10, 15, 20, 25, 35, 40, 45, 50, 75, 100, 150, 200, 300 -1000 nm; or 10, 15, 20,25, 35, 45, 50, 75, 100, 150 or 200 nm.
In an embodiment, the AHCM: is a small molecule therapeutic; is a protein, e.g., an antibody; or is provided in a nanoparticle.
In an embodiment, the anti-cancer agent or second therapeutic agent is selected from a therapeutic entity having a hydrodynamic diameter: equal to or less than 1 or 2 nm; between 2 - 20, 10-25, 20-40, 40, 50-150 nm; between 10, 15, 20, 25, 35, 40, 45, 50- 100 nm; between 10, 15, 20, 25, 35, 40, 45, 50 -200 nm; between 10, 15, 20, 25, 35, 40, 45, 50, 75, 100, 150, 200, 300 -500 nm; and between 10, 15, 20, 25, 35, 40, 45, 50, 75, 100, 150, 200, 300 -1000 nm; or 10, 15, 20,25, 35, 45, 50, 75, 100, 150 or 200 nm..
In an embodiment, the anti-cancer agent: is a small molecule therapeutic with a hydrodynamic diameter of 1 nm or less; is a protein, e.g., an antibody; or is provided in a nanoparticle.
In an embodiment, the AHCM, or anti-cancer agent or the second therapeutic agent, each independently, can be provided as an entity having the following size ranges (in nm): a hydrodynamic diameter of less than or equal to 1 , or between 0.1 and 1.0 nm, e.g., that of a typical small molecule; a hydrodynamic diameter of between 5 and 20, or 5 and 15 nm, e.g., that of a protein, e.g., an antibody; or a hydrodynamic diameter of 10- 5,000, 20- 1 , 000, 10-500, 10-200, 10-150, or 10-100, 10-25, 20-40, 40, 50-150 nm; between 10, 15, 20, 25, 35, 40, 45, 50- 100 nm; between 10, 15, 20, 25, 35, 40, 45, 50 - 200 nm; between 10, 15, 20, 25, 35, 40, 45, 50, 75, 100, 150, 200, 300 -500 nm; and between 10, 15, 20, 25, 35, 40, 45, 50, 75, 100, 150, 200, 300 -1000 nm; or 10, 15, 20,25, 35, 45, 50, 75, 100, 150 or 200 nm, e.g., a range of typical nanoparticles.
Subjects
Methods described herein can be used to treat subjects having characteristics or needs defined herein. In embodiments a subject, or a treatment for a subject, is selected on the basis of a characteristic described herein. In one embodiment, the methods described herein allow optimized selection of patients and therapies.
In some embodiments, subjects can be selected or identified prior to subjecting them to any aspects of the methods described herein.
In one embodiment, the subject is selected or is identified as being in need of receiving the AHCM on the basis of optimizing a therapy, e.g., the need for improved delivery and/or efficacy of the therapy (e.g., the cancer therapy).
In one embodiment, the subject does not have hypertension, or is not being treated for hypertension, at the time of initiation of the AHCM treatment , or at the time of selection of the patient for AHCM administration.
In an embodiment, the subject, e.g., patient, has not been administered a dose of an AHCM, e.g., an AHCM named herein, or any AHCM, within 5, 10, 30, 60 or 100 days of, the diagnosis of cancer, or the initiation of the AHCM dosing.
In an embodiment, the subject, e.g., a subject with normal or low blood pressure, is selected or is identified on the basis of being in need of an AHCM, e.g., is selected or is identified as being in need of receiving the AHCM on the basis of optimizing a therapy, e.g., the need for improved delivery and/or efficacy of the therapy (e.g., the cancer therapy).
In some embodiments, subjects who are in need of receiving the AHCM on the basis of the need for improved delivery or efficacy of the cancer therapy, or optimizing the therapy, are the subjects who partially respond or do not respond to the cancer therapy alone.
In an embodiment, an AHCM is selected for treating a subject, on the basis of its ability to optimize cancer treatment, e.g., improving delivery and/or efficacy of the cancer therapy.
In an embodiment, the subject treated is not a hypertensive patient, e.g., does not have a medical history of high blood pressure, or has not been treated with an antihypertensive agent. In one embodiment, the subject treated has normal or low mean arterial blood pressure. In other embodiments, the subject treated has not undergone, or is not being treated with anti-hypertensive therapy.
In one embodiment, the subject is in need of cancer therapy. In another embodiment, the subject is in need of, or being considered for, anti-cancer therapy (e.g., treatment with any of the anti-cancer therapeutics described herein). In certain embodiments, the method includes the step of determining if the subject has a cancer (e.g., a solid or fibrotic cancer), and, responsive to said determination, administering the AHCM and the anti-cancer agent.
In other embodiments, the subject is at risk of developing, or having a recurrence of, a cancer, e.g., a subject with pre-neoplasia or a genetic pre-disposition for cancer (e.g., a subject having a BRCA 1 mutation; or a breast cancer patient treated with in an adjuvant setting (e.g., with tamoxifen)).
In other embodiments, the subject has early-cancer, or more progressive (e.g., moderate), or metastatic cancer.
In one embodiment, the subject has a solid, fibrotic tumor chosen from one or more of pancreatic (e.g., pancreatic adenocarcinoma), breast, colorectal, lung (e.g., small or non-small cell lung cancer), skin, ovarian, prostate, cervix, gastrointestinal (e.g., carcinoid or stromal), stomach, head and neck, kidney, or liver cancer, or a metastatic lesion thereof. In other embodiments, the subject has a hyperproliferative cancerous condition (e.g., a benign, pre-malignant or malignant condition). The subject can be one at risk of having the disorder, e.g., a subject having a relative afflicted with the disorder, or a subject having a genetic trait associated with risk for the disorder. In one embodiment, the subject can be symptomatic or asymptomatic. In an embodiment, the subject harbors an alteration in an oncogenic gene or gene product. In an embodiment, the subject is a patient who is undergoing cancer therapy (e.g., the same or other anticancer agents, surgery and/or radiation). In an embodiment, the subject is a patient who has undergone cancer therapy (e.g., other anti-cancer agents, surgery and/or radiation). In one embodiment, the subject has not been treated with the cancer therapy.
In one embodiment, the subject is a patient with a metastatic cancer, e.g., a metastastatic form of a cancer disclosed herein (one or more of pancreatic (e.g., pancreatic adenocarcinoma), breast, colorectal, lung (e.g., small or non-small cell lung cancer), skin, ovarian, or liver cancer.
In one embodiment, the subject is a patient having treatment-resistant cancer or hyperproliferative disorder. In some embodiments, the subject being selected for subjecting to the methods or pharmaceutical compositions herein does not have a renal disease or a disease associated with kidneys.
In one embodiment, the subject treated is a mammal, e.g., a primate, typically a human (e.g., a patient having, or at risk of, a cancer or tumor as described herein).
In one embodiment, the subject treated has a hyperproliferative disorder, e.g., a hyperpoliferative connective tissue disorder (e.g., a hyperproliferative fibrotic disease). In one embodiment, the hyperproliferative fibrotic disease is multisystemic or organ- specific. Exemplary hyperproliferative fibrotic diseases include, but are not limited to, multisystemic (e.g., systemic sclerosis, multifocal fibrosclerosis, sclerodermatous graft- versus-host disease in bone marrow transplant recipients, nephrogenic systemic fibrosis, scleroderma), and organ-specific disorders (e.g., fibrosis of the lung, liver, heart, kidney, pancreas, skin and other organs).
In other embodiment, the subject treated has a hyperproliferative genetic disorder, e.g., a hyperproliferative genetic disorder chosen from Marfan's syndrome or Loeys- Dietz syndrome.
In other embodiments, the hyperproliferative disorder (e.g., the hyperproliferative fibrotic disorder) is chosen from one or more of chronic obstructive pulmonary disease, asthma, aortic aneurysm, radiation-induced fibrosis, skeletal-muscle myopathy, diabetic nephropathy, and/or arthritis.
Combination therapies
In one embodiment, the AHCM is administered in combination with a therapy, e.g., a cancer therapy (e.g., one or more of anti-cancer agents, surgery and/or radiation). The terms "chemotherapeutic," "chemotherapeutic agent," and "anti-cancer agent" are used interchangeably herein. The administration of the AHCM and the cancer therapy can be sequential (with or without overlap) or simultaneous. Administration of the AHCM can be continuous or intermittent during the course of therapy (e.g., cancer therapy).
In an embodiment, AHCM administration is initiated prior to the initiation of administration of the cancer therapy, e.g., it is initiated at least one, two, three, or five days, or one, two, three, four, five or more weeks prior to cancer therapy (e.g., the AHCM is administered at a mimimum of two weeks prior to cancer therapy). In an embodiment it is intiated no more than 5, 10, 20, 30, 60 or 120 days prior to initiation of cancer therapy. In an embodiment, AHCM administration is initiated prior to cancer therapy and the cancer therapy is not initiated until a criterion is met, e.g., a time-based criterion, e.g., administration of AHCM for a predetermined number of days or for a predetermined number of AHCM administrations. In an embodiment, the criterion is meeting a preselected level of AHCM, e.g., a preselected level in serum or plasma. In one embodiment, the criterion is meeting a preselected level of a biomarker in plasma or serum, including but not limited to, collagen I, collagen III, collagen IV, transforming growth factor beta 1 (TGF-βΙ), connective tissue growth factor (CTGF), or
thrombospondin-1 (TSP-1). In another embodiment, the criterion is meeting a preselected level of alteration in tumor morphology.
In one embodiment, the administration of the AHCM is sequential and/or concurrent with the therapy, e.g., the cancer therapy, as described herein.
In an embodiment, the AHCM is administered, or a preselected level of AHCM, e.g., a plasma level, of AHCM is maintained for a preselected portion of the time the subject receives cancer therapy. By way of example, the AHCM therapy is maintained for the entire period in which the cancer therapy is administered, or for the entire period in which a preselected level of an anti-cancer agent persists in the subject.
Typically, therapy with the AHCM continues during the entire cancer therapy schedule. In yet other embodiments, administration of the AHCM is discontinued prior to cessation of the cancer therapy. In other embodiments, administration of the AHCM is continued after cessation of the cancer therapy.
In an embodiment, two or more doses of the AHCM are administered, alone or in combination with the cancer therapy. In one embodiment, the AHCM is administered at a sub-anti-hypertensive dose and an anti-hypertensive dose during the course of therapy. For example, a sub-anti-hypertensive dose of the AHCM can be administered prior to, or at the time, of cancer therapy (e.g., treatment with an anti-cancer agent that increases mean arterial blood pressure, e.g, treatment with an anti-angiogenic drug (e.g., Avastin, sunitinib or sorafenib)); then followed by a subsequent hypertensive dose of the AHCM.
In one embodiment, the AHCM (alone or in combination) is administered substantially continuously over a period of, or at least 15, 30, 45 minutes; a period of, or at least, 1 , 5, 10, 24 hours; a period of, or at least, 2, 5, 10, 14 days; a period of, or at least, 3, 4, 5, 6, 7, 8 weeks; a period of, or at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 months; a period of, or at least, 1 , 2, 3, 4, 5 years, or longer. In one embodiment, the AHCM is administered as a sustained release formulation. In certain embodiments, the AHCM is formulated for continuous delivery, e.g., oral, subcutaneus or intravenous continuous delivery. In one embodiment, the AHCM is administered via an implantable device, e.g., a pump (e.g., a subcutaneous pump), an implant or a depot. The delivery method can be optimized such that an AHCM dose as described herein (e.g., a standard, sub- hypertensive, or higher than standard dose) is administered and/or maintained in the subject for a pre-determined period (e.g., a period of, or at least: 15, 30, 45 minutes; 1, 5, 10, 24 hours 2, 5, 10, 14 days; 3, 4, 5, 6, 7, 8 weeks; 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 months; 1 , 2, 3, 4, 5 years, or longer). The substantially continuously or extended release delivery or formulation of the AHCM (with or without chemotherapy) can be used for prevention or treatment of cancer for a period of hours, days, weeks, months or years. In one embodiment, the cancer therapy is chosen from one or more of: nanotherapy (e.g., a viral cancer therapeutic agent (e.g., an oncolytic herpes simplex virus (HSV), a lipid nanoparticle (e.g., a liposomal formulation (e.g., pegylated liposomal doxorubicin (DOXIL®)), or a polymeric nanoparticle); an antibody that binds to a cancer target; an
RNAi or antisense RNA agent;, a chemotherapeutic agent (e.g., a cytotoxic or a cytostatic agent); radiation; or surgery; or any combination thereof. Additional examples of anticancer therapies that can be used in combination with the AHCM are provided below.
In other embodiments, the AHCM and/or the therapy (e.g., the cancer or hyperproliferative therapy) is administered in combination with an inhibitor of a profibrotic pathway (a "profibrotic pathway inhibitor") (e.g., a pathway dependent- or independent of TGF-beta and/or CTGF activation). In one embodiment, the AHCM and/or the cancer therapy is administered in combination with one or more of: an inhibitor of endothelin-1, PDGF, Wnt/beta-catenin, IGF-1, TNF-alpha, and/or IL-4. In another embodiment, the AHCM and/or the cancer therapy is administered in
combination with an inhibitor of endothelin-1 and/or PDGF. In other embodiments, the AHCM and/or the cancer therapy is administered in combination with an inhibitor of one or more of chemokine receptor type 4 (CXCR4) (e.g., AMD3100, MSX- 122); stromal- derived-factor-l(SDF- l ) (e.g., tannic acid); hedgehog (e.g., GDC-0449, cylopamine, or GANT58).
The administration of the AHCM, the cancer therapy, and/or the profibrotic pathway inhibitor can be sequential (with or without overlap) or simultaneous (e.g., a described herein). Cancer Therapies
In one embodiment, the cancer treated is an epithelial, mesenchymal or hematologic malignancy. In an embodiment, the cancer treated is a solid tumor {e.g., carcinoid, carcinoma or sarcoma), a soft tissue tumor {e.g., a heme malignancy), and a metastatic lesion, e.g., a metastatic lesion of any of the cancers disclosed herein. In one embodiment, the cancer treated is a fibrotic or desmoplastic solid tumor, e.g., a tumor having one or more of: limited tumor perfusion, compressed blood vessels, or fibrotic tumor interstitium. In one embodiment, the solid tumor is chosen from one or more of pancreatic {e.g., pancreatic adenocarcinoma), breast, colorectal, lung {e.g., small or non- small cell lung cancer), skin, ovarian, or liver cancer. Additional examples of cancers treated are described herein below.
In another embodiment, the AHCM is administered in combination with a cancer therapy {e.g., one or more of anti-cancer agents, surgery and/or radiation). In one embodiment, the cancer therapy includes one or more of: a cancer therapeutic, including, for example, a nanotherapy {e.g., one or more nanotherapeutic agents, including viral cancer therapeutic agents {e.g., an oncolytic herpes simplex virus (HSV)) a lipid nanoparticle {e.g., a liposomal formulation {e.g., pegylated liposomal doxorubicin (DOXIL®)), or a polymeric nanoparticle); one or more cancer therapeutic antibodies {e.g., anti-HER2, anti-EGFR, anti-CD20 antibodies); RNAi and antisense RNA agents; one or more chemotherapeutic agents {e.g., low molecular weight chemotherapeutic agents, including a cytotoxic or a cytostatic agent)); radiation; or surgery, or any combination thereof. Any combination of one or more AHCMs and one or more therapeutic modalities {e.g., first, second, third) nanotherapeutic agent, antibody agent, low molecular weight chemotherapeutic agent, radiation can be used. Exemplary cancer therapeutics include, but are not limited to, nanotherapeutic agents {e.g., one or more lipid nanoparticles {e.g., a liposomal formulation {e.g., pegylated liposomal doxorubicin (DOXIL®) or liposomal paclitaxel {e.g., Abraxane®)), or a polymeric nanoparticle); ; one or more low molecular weight chemotherapeutics {e.g., gemcitabine, cisplatin, epirubicin, 5-fluorouracil, paclitaxel, oxaliplatin, or leucovorin); one or more antibodies against cancer targets {e.g., growth factor receptor such as HER-2/neu, HER3, VEGF)); one or more tyrosine kinase inhibitors, e.g., including low molecular weight and antibody agents, such as sunitinib, erlotinib, gefitinib, sorafenib, icotinib, lapatinib, neratinib, vandetanib, BIBW 2992 or XL-647, anti-EGFR antibody {e.g., cetuximab, panitumumab, zalutumumab, nimotuzumab necitumumab or matuzumab)). Additional examples of chemotherapeutic agents used in combination therapies are described hereinbelow.
In one embodiment, the chemotherapeutic agent used in combination with the AHCM is a cytotoxic or a cytostatic agent. Exemplary cytotoxic agents include antimicrotubule agents, topoisomerase inhibitors (e.g., irinotecan), or taxanes (e.g., docetaxel), antimetabolites, mitotic inhibitors, alkylating agents, intercalating agents, agents capable of interfering with a signal transduction pathway, agents that promote apoptosis and radiation. In yet other embodiments, the methods can be used in combination with immunodulatory agents, e.g., IL-1, 2, 4, 6, or 12, or interferon alpha or gamma, or immune cell growth factors such as GM-CSF.
In one embodiment, the AHCM, alone or in combination with one or more cancer therapies described herein, are administered for cancer prevention (e.g., alone or in combination with cancer-prevention agents), during periods of active disorder, or during a period of remission or less active disorder. The AHCM, alone or in combination with one or more cancer therapies described herein, can be administered for cancer prevention, before treatment or prevention, concurrently with treatment or prevention, post-treatment or prevention, or during remission of the disorder. In one embodiment, the cancer therapy is administered simultaneously, sequentially, or a combination of both,with the AHCM.
In one embodiment, the AHCM is administered alone or in combination with cancer-prevention agents, e.g., to treat or prevent cancer in high risk subjects (e.g., a subject with pre-neoplasia or a genetic pre-disposition for cancer (e.g., a subject having a BRCA1 mutation); or a breast cancer patient treated with tamoxifen).
In some embodiments, the AHCM, alone or in combination with the cancer therapy, is a first line treatment for the cancer, e.g., it is used in a subject who has not been previously administered another drug intended to treat the cancer.
In other embodiments, the AHCM, alone or in combination with the cancer therapy, is a second line treatment for the cancer, e.g., it is used in a subject who has been previously administered another drug intended to treat the cancer.
In other embodiments, the AHCM, alone or in combination with the cancer therapy, is a third, fourth, or greater than fourth, line treatment for the cancer, e.g., it is used in a subject who has been previously administered two, three, or more than three, other drugs intended to treat the cancer. In other embodiments, the AHCM is administered as adjunct therapy, e.g., a treatment in addition to a primary therapy.
In one embodiment, the AHCM is administered as adjuvant therapy.
In other embodiments, the AHCM is administered as neoadjuvant therapy.
In some embodiments, the AHCM is administered to a subject prior to, or following surgical excision/removal of the cancer.
In some embodiments, the AHCM is administered to a subject before, during, and/or after radiation treatment of the cancer.
In some embodiments, the AHCM is administered to a subject, e.g., a cancer patient who will undergo, is undergoing or has undergone cancer therapy (e.g., treatment with a chemotherapeutic agent, radiation therapy and/or surgery).
In other embodiments, the AHCM is administered prior to the cancer therapy. In other embodiments, the AHCM is administered concurrently with the cancer therapy. In yet other embodiments, the AHCM is administered prior to the cancer therapy and concurrently with the cancer therapy. In instances of concurrent administration, the AHCM can continue to be administered after the cancer therapy has ceased.
In other embodiments, the AHCM is administered sequentially with the cancer therapy. For example, the AHCM can be administered before initiating treatment with, or after ceasing treatment with, the cancer therapy. In one embodiment, the administration of the AHCM overlaps with the cancer therapy, and continues after the cancer therapy has ceased. In one embodiment, the AHCM is administered concurrently, sequentially, or as a combination of concurrent administration followed by monotherapy with either the cancer therapy, or the AHCM.
In one embodiment, the method includes administering the AHCM as a first therapeutic agent, followed by administration of a cancer therapy (e.g., treatment with a second therapeutic agent, radiation therapy and/or surgery). In another embodiment, the method includes administering a cancer therapy first (e.g., treatment with a first therapeutic agent, radiation therapy and/or surgery), followed by administering the AHCM as a second therapeutic agent. In yet other embodiments, the method includes administering the AHCM in combination with a second, third or more additional therapeutic agents (e.g., anti-cancer agents as described herein).
The AHCM and/or the anticancer agent described herein can be administered to the subject systemically (e.g., orally, parenterally, subcutaneously, intravenously, rectally, intramuscularly, intraperitoneal ly, intranasally, transdermally, or by inhalation or intracavitary installation). Typically, the AHCMs are administered orally. In certain embodiments, the AHCM and/or the anticancer agent are administered intratumorally (e.g., via an oncolytic virus).
In some embodiments, the AHCM is administered as a pharmaceutical composition comprising one or more AHCMs, and a pharmaceutically acceptable excipient.
In an embodiment, the AHCM is administered, or is present in the composition, e.g., the pharmaceutical composition (e.g., the same nanoparticle composition).
In other embodiments, the AHCM and the cancer therapy are administered as separate compositions, e.g., pharmaceutical compositions (e.g., nanoparticle
compositions). In other embodiments, the AHCM and the cancer therapy are
administered separately, but via the same route (e.g., both orally or both intravenously). In some embodiments, the AHCM and the cancer therapy are administered by different routes (e.g., AHCM is administered orally and a cancer therapeutic is administered intravenously). In still other instances, the AHCM and the cancer therapy are
administered in the same composition, e.g., pharmaceutical composition.
Monitoring the Subject
The methods of the invention can further include the step of monitoring the subject, e.g., for a change (e.g., an increase or decrease) in one or more of: tumor size; the level or signaling of one or more of transforming growth factor beta 1 (TGFpi), connective tissue growth factor (CTGF), or thrombospondin- 1 (TSP-1); tumor collagen I levels; fibrotic content, interstitial pressure; a plasma or serum biomarker, e.g., collagen I, collagen III, collagen IV, TGFpi, CTGF, TSP-1 ; levels of one or more cancer markers; the rate of appearance of new lesions, metabolism, hypoxia evolution; the appearance of new disease-related symptoms; the size of tissue mass, e.g., a decreased or stabilization; quality of life, e.g., amount of disease associated pain; histological analysis, lobular pattern, and/or the presence or absence of mitotic cells; tumor aggressivity,
vascularization of primary tumor, metastatic spread; tumor size and location can be visualized using multimodal imaging techniques; or any other parameter related to clinical outcome. The subject can be monitored in one or more of the following periods: prior to beginning of treatment; during the treatment; or after one or more elements of the treatment have been administered. Monitoring can be used to evaluate the need for further treatment with the same AHCM, alone or in combination with, the same anticancer agent, or for additional treatment with additional agents. Generally, a decrease in one or more of the parameters described above is indicative of the improved condition of the subject.
The methods of the invention can further include the step of analyzing a nucleic acid or protein from the subject, e.g., analyzing the genotype of the subject. The analysis can be used, e.g., to evaluate the suitability of, or to choose between alternative treatments, e.g., a particular dosage, mode of delivery, time of delivery, inclusion of adjunctive therapy, e.g., administration in combination with a second agent, or generally to determine the subject's probable drug response phenotype or genotype. The nucleic acid or protein can be analyzed at any stage of treatment, but preferably, prior to administration of the AHCM and/or anti-cancer agent, to thereby determine appropriate dosage(s) and treatment regimen(s) of the AHCM (e.g., amount per treatment or frequency of treatments) for prophylactic or therapeutic treatment of the subject.
Dosage Forms
In another aspect, the invention features a pharmaceutically acceptable composition comprising, in a single dosage form, an AHCM and an anti-cancer agent, e.g., a small molecule or a protein, e.g., an antibody. In another embodiment, one or both of the AHCM and the anti-cancer agent are provided in a nanoparticle. The AHCM and anti-cancer agent can be in separate or the same entity. For example, if provided as separate entities the AHCM can be provided as a first nanoparticle and the anti-cancer agent provided as a second nanoparticle (e.g., where the second nanoparticle has a structural property (e.g., size or composition) or a functional property (e.g., release kinetics or a pharmacodynamic property) that differs from the first nanoparticle).
Alternatively, an AHCM and an anti-cancer agent can be provided on the same entity, e.g., in the same nanoparticle.
In another aspect, the invention features a pharmaceutically acceptable composition (e.g., nanoparticle) comprising an AHCM, e.g., an AHCM described herein. In one embodiment, the AHCM is in a dosage described herein, e.g., a standard of care dosage form, a sub-anti-hypertensive dosage form, or a greater than a standard of care dosage form. In one embodiment, the AHCM is formulated in a dosage form that is according to the standard of care anti-hypertensive or anti-heart failure dosage form, e.g., a standard of care dosage form as described herein.
In certain embodiments, the AHCM is formulated in a dosage form that is less than the standard of care anti-hypertensive or anti-heart failure dosage form (e.g., a dosage form that is less than 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.15, 0.16, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7-fold, that of the standard of care dosage form, e.g., a standard of care dosage from as described herein).
In other embodiments, the AHCM is formulated in a dosage form that is greater than the standard of care anti-hypertensive or anti-heart failure dosage form (e.g., a dosage form that is greater than 1.1 , 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dosage form, e.g., a standard of care dosage from as described herein).
In another aspect, the invention features a pharmaceutically acceptable composition comprising an anti-cancer agent, e.g., an anti-cancer agent described herein, as a nanoparticle, e.g., a nanoparticle configured for a method described herein.
In another aspect, the invention features a therapeutic kit that includes the AHCM, alone or in combination with a therapy, e.g., an anti-cancer agent, described herein, and optionally, instructions for use, e.g., for the treatment of cancer. In an embodiment, the kit comprises one or more dosage for or pharmaceutical preparation or nanoparticle described herein
Delivery Methods
In another aspect, the invention features a method optimizing access to a target tissue, e.g., a cancer, or optimizing delivery to a target tissue, e.g., a cancer, of an agent, e.g., a systemically administered agent, e.g., a diagnostic or imaging agent. The method comprises:
administering an anti-hypertensive and/or a collagen modifying agent ("AHCM") to the subject; and
optionally, administering an agent, e.g., a diagnostic or imaging agent to said subject.
In an embodiment, the method includes one or more of the following:
a) the AHCM is an anti-hypertensive agent and is administered at a standard of care dose, a sub-anti-hypertensive dose, or a greater than a standard of care -anti- dose;
b) the agent, e.g., diagnostic or imaging agent, has a hydrodynamic diameter of greater than 1 , 5, or 20 nm, e.g., is nanoparticle;
c) the agent is an imaging agent, e.g., radiologic agent, an NMRA agent, a contrast agent; or
d) the subject is treated with a dosing regimen described herein, e.g., AHCM administration is initiated prior to administration of the agent, e.g., for at least one, two, three, or five days, or one, two, three, four, five or more weeks prior to administration of the agent.
In an embodiment, the AHCM is administered in an amount sufficient to alter (e.g., enhance) the distribution or efficacy of the agent. In one embodiment, the AHCM is administered in an amount sufficient to alter (e.g., enhance) the distribution or efficacy of the agent, but in an amount insufficient to inhibit or prevent tumor growth or progression by itself.
In an embodiment, the AHCM is administered at a dose that causes one or more of the following: a decrease in the level or production of collagen, a decrease in tumor fibrosis, an increase in interstitial tumor transport, improvement of tumor perfusion, or enhanced penetration or diffusion, of the cancer therapeutic in a tumor or tumor vasculature, in the subject.
In an embodiment, the subject is further treated with a cancer therapy, e.g., as therapy as described herein.
In an embodiment, the subject is a human, or a non-human animal, e.g., a mouse, a rat, a non-human primate, horse, or cow.
In another aspect, the invention features a diagnostic kit that includes the AHCM, alone or in combination with the agent, e.g., a diagnostic or imaging agent, described herein, and optionally, instructions for use, e.g., for the diagnosis of cancer.
Screening Assays
In another aspect, the invention features a method, or assay for, identifying an AHCM. The method, or assay, includes providing a cancer or a cancer-associated cell (e.g., a culture of a carcinoma associated fibroblast cell); contacting said cancer or a cancer-associated cell with a candidate agent; detecting a change in the cancer cell in the presence, or absence, of the candidate agent. In one embodiment, the detected change includes one or more of an increase or decrease of TGFp i level, connective tissue growth factor (CTGF) level, or collagen (e.g., collagen 1 ) level. In one embodiment, the candidate agent is chosen from one or more of: an antagonist of renin angiotensin aldosterone system ("RAAS antagonist"), an angiotensin converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (AT| blocker), a thrombospondin 1 (TSP-1 ) inhibitor, a transforming growth factor beta 1 (TGF-βΙ ) inhibitor, and a connective tissue growth factor (CTGF) inhibitor. A suitable candidate agent reduces one or more of
TGFpi level (e.g., total and/or activated TGF l), connective tissue growth factor (CTGF) level, or collagen level.
The method, or assay, can further include the step of comparing the treated methods or assays to a reference value, e.g., a value obtained in the absence of the candidate agent, or by addition of a control agent, e.g., a positive agent (e.g., losartan), or a negative agent (e.g., saline control), and comparing the difference between the treated and control methods.
The method, or assay, can be performed in vitro, in vivo, or a combination of both.
In one embodiment, the method, or assay, includes: evaluating the candidate agent in vitro, e.g., using a culture of carcinoma associated cells. In such embodiments, the candidate agent is added to the culture medium; and the condition medium is analyzed for an increase or decrease of TGFpi level, connective tissue growth factor (CTGF) level, or collagen level.
In another embodiment, the candidate agent is administered to a subject, e.g., an animal model, e.g., an animal tumor model. In such embodiments, the candidate agent is administered to the subject under suitable conditions; and the subject is analyzed for an increase or decrease of TGFpi level, connective tissue growth factor (CTGF) level, or collagen level. In one embodiment, the levels of these parameters are analyzed as described in the appended Examples.
In yet other embodiments, candidate agents evaluated using the in vitro assays are tested in vivo.
In another aspect, the invention features a composition for use, or the use, of a AHCM agent, alone or in combination with an anti-cancer agent described herein for the treatment of a cancer or tumor described herein.
Headings or numbered or lettered elements, e.g., (a), (b), (i) etc, are presented merely for ease of reading. The use of headings or numbered or lettered elements in this document does not require the steps or elements be performed in alphabetical order or that the steps or elements are necessarily discrete from one another. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.
Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 is a panel a bar graphs depicting the effects of losartan (10 μιηοΙ/L) in total and active TGF levels, and collagen I synthesis by carcinoma associated fibroblasts
(CAFs) in vitro.
Figs. 2A-2B shows the effects of Losartan on collagen production in tumors.
Fig. 2A shows a panel of photographs showing a dose-dependent reduction in collagen levels assessed by SHG imaging in losartan-treated HSTS26T tumors, as
compared to the control, over a period of two weeks, (10, 20 and 60mg/kg/day). Scale bar = 200 μπι.
Fig. 2B shows a dose response curve of the effect of losartan doses of 10, 20 and
60 mg/kg/day in decreasing the SHG levels by 20, 33 and 67%, respectively, at the end of 15 days, indicating a dose-dependent reduction in collagen levels in Losartan-treated tumors. There was a statistically significant difference (*) between the control group and the two higher doses (20 and 60mg/kg/day). There was also a statistically significant difference (†) between the 20 and 60 mg/kg/day groups.
Fig. 3 is a bar graph showing a dose response of losartan vs. collagen content in HSTS26T tumors. Losartan treatment at 20 and 60 mg/kg/day led to 42% and 63%
reduction in collagen I staining respectively. The staining in each treatment group was compared to a control group that received saline.
Fig. 4 is a bar graph showing the effect of losartan in decreasing the mean arterial blood pressure (MABP) in mice in a dose-dependent manner. Although 20mg/kg/day decreased MABP by 10 mm Hg (*p<0.04), the MABP remained within the normal range for SCID mice (70mmHg - 95mmHg)(13). Conversely, when animals were treated with 60mg/kg/day, the 35 mm Hg (**p<0.04) drop in MABP was lower than the normal range MABP in SCID mice.
Figs. 5A-5D shows the effects of Losartan in collagen levels in tumors.
Fig. 5A shows the results of Collagen-I and nuclei immunostaining in tumor sections in L3.6pl and MMTV control and losartan (20mg/kg/day) treated tumors. Scale bar = 100 μπι. Losartan treatement (e.g., at 20 mg/kg/day) significantly reduced the collagen levels in the treated tumors.
Fig. 5B is a bar graph summarizing the effects after two weeks losartan treatment at 20mg/kg/day; losartan treatment significantly reduced the collagen I immunostaining in L3.6pl (p< 0.03) and FVB MMTV PyVT by 50% (p<0.05) and 47% (p<0.05), respectively.
Fig. 5C is a panel of photographs showing collagen-I and nuclei immunostaining in tumor sections in HSTS26T and Mu89 control and losartan (20mg/kg/day) treated tumors. Note that there is no detectable reduction in collagen I immunostaining at 200μηι from the edge of HSTS26T tumors. This phenomenon is less obvious in treated Mu89 tumors where there is some persistent staining both at the edge and in central tumor areas. Scale bar = 100 μιη.
Fig. 5D is a bar graph summarizing the effects of Losartan in significantly reducing the collagen-I immunostaining in HSTS26T and Mu89 by 44% (p<0.02) and 20% (p<0.05), respectively.
Fig. 6 is a panel of bar graphs showing the effects of losartan on TSP-1 , active and total TGF-βΙ , and collagen I in HSTS26T tumors. Treated animals received losartan (15 mg/kg/day) in drinking water. Tumors were excised after two weeks of treatment, homogenized and analyzed for total and activated TGF-β Ι levels by ELISA. Note a 3.5 fold reduction in TSP-1 , a 4 fold reduction in active TGF-βΙ and a two fold reduction in collagen 1 after losartan treatment (p<0.05).
Fig. 7 A shows the effects of losartan in decreasing tumor TSP-1 immunostaining in both MU89 and HSTS26T tumors. In HSTS26T tumors, the changes in TSP-1 after losartan treatment correspond with changes in collagen I immunostaining; TSP- 1 levels decrease in the tumor center but remain high within a 200 μπι from the edge of the tumor. The TSP-1 margin was larger (500 μιη from the edge) in MU89 tumors. Scale bar = 100 μιη.
Fig. 7B is a bar graph summarizing the effects of losartan treatment in
significantly reducing the TSP-1 immununostaining in HSTS26T and MU89 tumors by 73% (p<0.04) and 24% (p<0.03), respectively.
Figs. 8A-8C shows the effects of: Losartan in increasing the delivery of nanoparticles and nanotherapeutics. Fig. 8A shows two photograhs (control and losartan) and a bar graph summarizing the distribution of intratumorally (i.t.) injected 100 nm diameter nanoparticles in
HSTS26T tumors. Losartan significantly increased (pO.001) the distribution of i.t.- injected nanoparticles in both tumor types (1.5 fold in HSTS26T and 4 fold in Mu89). An analysis of the distribution pattern shows control tumors with fewer intratumoral nanoparticles and a majority of nanoparticles that backtracked out of the needle track and accumulated at the tumor surface. In contrast, treated tumors have a significant number of intratumoral nanoparticles. Scale bar = 100 μπι.
Fig. 8B shows two photograhs (control and losartan) and a bar graph summarizing the distribution of viral infection 24 hrs after the intratumoral injection of HSV expressing the green fluorescent protein. HSV infection in control tumors is limited to the cells in close proximity to the injection site whereas losartan treated tumors have a more extensive spread of HSV infection within the tumors. Scale bar = 1 mm. Losartan significantly increased (p<0.05) the virus spread in HSTS26T and Mu89 tumors.
Fig. 8C shows two photograhs (control and losartan) and a bar graph summarizing the distribution of intravenously (i.v.) injected lOOnm diameter nanoparticles in L3.6pl tumors. The nanoparticles are localized around perfused vessels. There is a two-fold increase (p<0.05) in nanoparticle content in losartan-treated tumors compared to control tumors. Scale bar = 100 μιτι.
Fig. 9 is a bar graph showing the changes in diffusion coefficient in HSTS26T tumors after losartan treatment. The diffusion coefficient of IgG was measured in HSTS26T tumors implanted in the dorsal window chamber of SCID mice. Treated animals received (40 mg/kg/day) losartan by i.p. injection while control animals received saline. The results show a significant increase (p<0.04) in diffusion coefficient as measured by multiphoton fluorescence recovery after photobleaching (FRAP).
Fig. 10 is a representative distribution profile depicting fractions of injected nanospheres present as a function of the distance from a tumor vessel (penetration depth). The nanosphere penetration depth was analyzed in frozen sections from tumors resected 24 hrs after the intravenous nanosphere injection. The mean characteristic penetration length increased from 18±5μιη (mean±SE) in control to 37± 6 μιη in losartan-treated tumors. Ten areas per tumor were analyzed in 6 control and 6 treated tumors.
Fig. 11A-11D shows the effects of Losartan in significantly delaying the growth of tumors treated with DOXIL® or HSV. Figs. 11A-11B shows linear graphs of the results from mice bearing HSTS26T (A) and Mu89 (B) tumors treated for 2 weeks with either losartan or saline prior to the i.t. injection of HSV. Losartan alone did not affect the growth of Mu89 or HSTS26T tumors. The growth delay was significantly longer in HSTS26T tumors treated with losartan and HSV compared to tumors treated with HSV alone. The i.t. injection of HSV did not delay the growth of Mu89 tumors, but the combined losartan and HSV treatment significantly retarded the growth of Mu89 tumors.
Fig. l lC shows the effect in tumor volume in mice that received losartan treatment prior to i.v. DOXIL® infusion (losartan and DOXIL®) have smaller tumors than those that received DOXIL® alone (DOXIL® alone) in L3.6pl tumors. Note that there is no difference in tumor size between saline and losartan-treated mice.
Fig. 11D is an image showing a clear difference in size between control tumors (left column) and losartan treated tumors (right column) at 1 week after DOXIL® infusion. Scale bar = 1cm. The losartan treated tumors (right column) were smaller than the control tumors (left column) at 1 week after DOXIL® infusion.
Figs. 12A-12B shows the relationship between the collagen structure and the virus infection and necrosis.
In Fig. 12A, Mu89 tumors collagen bundles are seen around the tumor margin. Occasionally, these bundles project into the tumor (black arrows) and divide the tumor into separate compartments. These compartments seem to confine movement of HSV; evident from the containment of the necrotic region within the region bounded by collagen bundles. When these tumors were treated with losartan the collagen bundles at the margins of the tumor remained intact but the projections became less organized (insert). This presumably allowed virus propagation and necrosis to extend across the boundaries. Scale bar = 100 μιη.
In Fig. 12B, HSTS26T, the dense mesh-like collagen network confined virus infection to the immediate area surrounding the injection point. With losartan treatment, there was a reduction in the density of the network that presumably allowed virus particles to infect a larger area and thus more tumor cells. Arrows indicate viable and virus infected cells, respectively. Scale bar = 10 μιη.
Figs. 13A-13B shows a schematic of virus distribution and infection in Mu89 (A) and HSTS26T (B) tumors. The schematics show how the different collagen network structures affect virus propagation and distribution. The collagen fibers (1 ) restrict the movement of virus particles (round spheres, 2) and the infection (3) of non-infected (4) cancer cells.
In Fig. 13A, Mu89 tumors, collagen bundles divide the tumor into isolated regions that cannot be traversed by virus particles. Losartan treatment destabilizes the collagen bundles and allows virus particles to move from one region to another.
In Fig. 13B, HSTS26T tumors, the collagen structure is a mesh-like sieve. Virus particles can still propagate through the sieve but do not extend very far from the injection site. Losartan treatment significantly destabilizes the mesh structure in the internal regions of the tumor and allows the virus to propagate and infect a larger area.
Fig. 14A shows virus infection (HSV immunostaining) and necrosis 21 days after
HSV injection in HSTS26T and MU89. Hematoxylin staining of intact tumor areas, necrosis, and HSV immunostaining is shown. Necrotic regions are indicated by black arrows. Even though there was no detectable difference in necrotic area between HSTS26T and MU89, necrosis is confined to specific regions in MU89 while there is necrotic tissue (bounded by HSV immunostaining) throughout HSTS26T tumors. Scale bar = 2 mm.
Fig. 14B is a bar graph showing that there is a two-fold increase (p<0.05) in necrosis in tumors (both HSTS26T and MU89) that received losartan prior to HSV injection.
Fig. 15 shows the in vivo proliferation rates for HSTS26T and MU89 after losartan treatment. Tumors were resected and stained for Ki67 to assess proliferation rates. There was no statistically significant difference in positive Ki67 staining after losartan treatment in HSTS26T and MU89 tumors. There was however a significant difference in proliferation between the two tumor types, the number of Ki67 positive cells was 3 fold higher in HSTS26T tumors.
Fig. 16 shows the results of PCR analysis of AGTRl expression in CAF, MU89 and HSTS26T cells. MU89 cells and CAF express AGTRl while HSTS26T cells do not. HUVECs were used as a positive control. GAPDH levels revealed that all three samples had roughly the same amount of cDNA.
Figs. 17A-17D shows the effects of angiotensin blockade with AT] blockers or
ACE inhibitors in normalizing the tumor microenvironment. Studies with an ARB, losartan, are shown. Angiotensin blockade (A) diminishes interstitial matrix density in mammary (MMTV) and pancreatic (L3.6PL) tumors in mice, (B) reducing compressive stress in mammary (E0771) and pancreatic (Pan-02) tumors. (C) This increases the fraction of perfused vessels (arrows) in tumors (E0771 shown), resulting in (D) a normalized vascular network (E0771 shown) that is more efficient and effective at drug and oxygen delivery.
Figs. 18A-18D shows the effects of angiotensin blockade with AT] blockers or ACE inhibitors in improving drug transport and distribution in tumors. Studies with an ARB, losartan, are shown here. Through tumor normalization, angiotensin blockade (A) improves tumor oxygenation (E0771 shown) through enhanced perfusion while (B) making blood vessels deliver drugs more rapidly. Reorganization of the interstitial matrix also (C) improves penetration of nanoparticles in desmoplastic tumors (L3.6PL shown) (D).
Figs. 19A-19E shows the effect of angiotensin blockade with AT| blockers or ACE inhibitors in improving the effectiveness of cancer therapy. Studies with an ARB, losartan, are shown. Angiotensin blockade, given in combination with chemotherapy (A) improves the effectiveness of the low MW chemotherapeutic doxorubicin in breast cancer models, (B) slowing tumor growth and (C) increasing animal survival (E0771 shown). Similarly, angiotensin blockade (D, E) improves the effectiveness of the nanoparticle DOXIL® in pancreatic tumors (L3.6PL shown), e.g., by decreasing the tumor weight (D) and/or tumor size or volume (E).
DETAILED DESCRIPTION OF THE INVENTION
The invention is based, at least in part, on the discovery that losartan, an antihypertensive agent, improves the delivery and efficacy of cancer therapeutics.
The abnormal matrix of tumors limits the delivery of nano-therapeutics in many types of cancer, e.g., pancreatic, breast, lung, colorectal. The overgrowth of fibrous tissue impedes the movement of nanotherapeutics in tumors two mechanisms - viscoelastic and steric hindrances. Fibrous tissue is highly viscoelastic, meaning it is quite thick and stiff, and therefore slows the movement of these drugs to a small fraction of their typical speed. This tissue is basically an extremely dense mesh, with small pores that are about the same size as nanotherapeutics, thus it does not allow much space for these drugs and often halts their movements by confining them close to blood vessels (in case of intravenous injection) or near the site of injection (in case of intra-tumor injection). This barrier is found in all solid tumors, with possible exception of brain tumors, though it is most prominent in pancreatic, breast, lung, and colorectal cancers. Nanotherapeutics, owing to their large size relative to the pores that form the tumor microenvironment, are especially hindered by fibrous tissue.
In certain embodiments, Applicants have shown that losartan prevents the production of matrix molecules like collagen, which are a component of the dense mesh of fibrous tissue. Losartan is believed to act on fibroblasts and tumor cells by inhibiting the TGF-beta and CTGF pathways, thus limiting their pro-fibrotic activity. It does so by blocking the activity of the angiotensin-II type-1 receptor (ATi), which is highly expressed on both fibroblasts and tumor cells in a variety of cancers. Thus losartan blocks activity downstream of ATi in various signaling pathways, including the activation of TGF-beta and CTGF. Since these two pathways promote the production of collagen and other components of fibrotic tissue, blocking them will allow the fibrosis to subside. The result is tissue that is much more like the normal surrounding organ, and is therefore easier to penetrate.
Treatment with losartan is shown herein to significantly reduce collagen levels - a marker of fibrosis - in several types of tumors, including pancreatic, breast, skin, and soft tissue tumors. Furthermore, reduction in fibrosis leads to improved mobility of nanotherapeutics in tumors, allowing them to penetrate tumors more easily, and allows these drugs to distribute more widely throughout tumors, making them more effective at fighting tumor growth. Hence, losartan makes nanotherapeutics more effective against cancer.
More specifically, Applicants discovered that losartan normalizes the collagen, interstitial matrix of several solid tumors, thus facilitating the penetration of
chemotherapeutics, such as large molecular weight (e.g., nano-) chemotherapeutics. For example, losartan reduced collagen I levels in carcinoma associated fibroblasts (CAFs) isolated from breast cancer biopsies, and caused a dose-dependent reduction in stromal collagen in desmoplastic models of human breast, pancreatic and skin tumors in mice. Losartan also improved the distribution, therapeutic efficacy and/or penetration of nanopartices (e.g., oncolytic herpes simplex viruses (HSV) and pegylated liposomal doxorubicin (DOXIL®)).
Low molecular weight therapeutics, which are much smaller than
nanotherapeutics, are not as limited by the interstitial matrix barriers, but are similarly affected by other barriers such as abnormal and collapsed blood vessels.
In other embodiments, Applicants that losartan facilitates decompression of blood vessels, thus improving tumor perfusion and delivery of low molecular weight chemotherapeutics, thus facilitating radiation and chemotherapeutic delivery through vascular normalization.
Thus, these agents improve delivery of molecules as small as oxygen - a radiation and chemo sensitizer - through vascular normalization (Figs. 18A-18B), while also enhancing the penetration of larger agents through interstitial matrix normalization (Fig. 18C, 18D). Through this repair of the entire tumor microenvironment, these agents enhance the effectiveness of low molecular weight chemotherapeutics, as well as nanotherapeutics in breast and pancreatic cancer models - leading to reduced tumor growth and longer animal survival (Figs. 19A-19E). Therefore, angiotensin inhibitors {e.g., angiotensin receptor blockers) and ACE inhibitors can enhance the delivery of therapeutics, and thus have broad applicability for combination therapy with all classes of anti-cancer agents, including low molecular weight, small-molecule chemotherapeutics, biologies, nucleic acid agents and nanoparticle therapies.
Angiotensin blockers offer numerous advantages over other approaches. Anti- angiogenic therapies normalize the vasculature alone and have been approved for only a limited number of indications. Meanwhile, ARBs and ACE-Is are FDA-approved as antihypertensives with manageable adverse effects. Matrix-degrading enzymes, which can normalize the collagen matrix, are not selective for tumors and can increase invasion and metastasis. ARBs and ACE-Is have no significant complications associated with matrix remodeling in normal tissues, leading to their safety as anti-hypertensives. ARBs and ACE-Is, as small-molecule agents, can also be delivered via nanovectors containing chemotherapeutics (e.g., liposomes, nano-particles) to enhance their localization to tumors to further limit toxicity. Anti-angiogenics, the only FDA-approved adjuncts that enhance drug delivery to tumors, cannot improve delivery for larger particles as they can reduce the size of "pores" in vessel walls. Angiotensin blockers can improve delivery for all classes of anti-tumor diagnostics and therapies.
Thus, methods and compositions for improving the delivery and/or efficacy of cancer therapeutics are disclosed. Methods and compositions for treating or preventing a cancer {e.g., a solid tumor such as a desmoplastic tumor) by administering to a subject an anti-hypertensive agent, as a single agent or combination with a cancer therapeutic agent (for example, a therapeutic agent ranging in size from a large nanotherapeutic to a low molecular weight chemotherapeutics and/or oxygen) are disclosed.
Certain terms are first defined. "About" and "approximately" shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20 percent (%), typically, within 10%, and more typically, within 5%, 4%, 3%, 2% or 1% of a given value or range of values.
"Delivery," as used herein in the context of delivery of an agent(s) to a tumor, refers to the placement of the agent(s) in sufficient proximity to one or more (or all) of:
the tumor vasculature, the tumor interstitial matrix, or tumor cells or tumor-associated cells (e.g., fibroblasts), to have a desired effect. The agent(s) can be, e.g., a cancer
therapy (e.g., a cancer therapeutic agent(s) as described herein), or a diagnostic or
imaging agent(s). Unless noted otherwise, the term "agent" or "agent(s)" as used
generically herein can include one, two or more agents.
In one embodiment, the cancer therapeutic agent includes, e.g., one or more of a small molecule, a protein or a nucleic acid drug, an oncolytic virus, a vaccine, an
antibody or a fragment thereof, or a combination thereof. The cancer therapeutic agent can be "free" or packaged or formulated into a delivery vehicle, e.g., a particle, e.g., a nanoparticle (e.g., a lipid nanoparticle, a polymeric nanoparticle, or a viral particle).
Delivery of a therapeutic agent is characterized by placement of the therapeutic agent in sufficient proximity to the cell to alter an activity of the cell, e.g., to kill the cell and/or reduce its ability to divide.
In other embodiments, the agent is a diagnostic or an imaging agent (e.g., one or more of a radiologic agent, an NMRA agent, a contrast agent, or the like). The diagnostic or imaging agent can be "free" or packaged or formulated into a delivery vehicle.
Delivery of a diagnostic or imaging agent is characterized by placement of the agent in sufficient proximity to a target cell or tissue to allow detection of the target cell or tissue.
In embodiments, increased (or improved) delivery (as compared with a delivery which is the same or similar except that it is carried out in the absence of an AHCM) can include one or more of:
increased delivery to, or amount or concentration in, the tumor vasculature, of the agent;
increased delivery to, or amount or concentration in, the tumor, e.g., the tumor vasculature interstitial matrix, of the agent;
increased delivery to, or amount or concentration in, in the tumor cells or tumor- associated cells (e.g., fibroblasts), of the agent;
increased flow rate, e.g., of the agent, in the tumor vasculature; improved (or normalized) vasculature morphology (e.g., less tumor-like);
decompression of tumor vasculature;
increased pore size, or rate of diffusion of the agent, in the tumor, e.g., in the interstitial matrix;
increased perfusion of the agent, in the tumor, e.g., in the interstitial matrix;
broader and/or more homogeneous distribution of the agent throughout the tumor; broader and/or more homogeneous distribution of the agent throughout the tumor interstitial matrix;
increased proportion of the agent in the tumor, e.g., the tumor interstitial matrix, as opposed to non-tumor tissue, e.g., peripheral blood;
inhibition of the TGF-beta pathway in the tumor, e.g., in the tumor vasculature interstitial matrix;
inhibition of the CTGF pathway in the tumor, e.g., in the tumor vasculature interstitial matrix;
inhibition of activity of the angiotension-II type-1 receptor;
decrease in fibrosis, in the tumor, e.g., the tumor vasculature interstitial matrix; or decrease in collagen or collagen deposition, in the tumor, e.g., the tumor vasculature interstitial matrix. In some embodiments, increased (or improved) delivery (as compared with a delivery which is the same or similar except that it is carried out in the absence of an AHCM) can also include increased amount of the agent distributed to at least a portion of the tumor. In some embodiments, the increased amount of the agent delivered to the tumor in the presence of the AHCM can be distributed homogenously or heterogeneously throughout the tumor.
"Efficacy" as used herein in the context of therapy, e.g., cancer therapy, can be characterizes as the extent to which a therapy has a desired effect, including but not limited to, alleviation of a symptom, diminishment of extent of disease, stabilized state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
Improved efficacy, in the context of efficacy of cancer therapy, can be characterized by one or more of the following: an increase in an anti-tumor effect, of the cancer therapy, and/or a lessening of unwanted side effects (e.g., toxicity), of the cancer therapy, as compared with a treatment which is the same or similar except that it is carried out in the absence of treatment with an AHCM. In one embodiment, the increase in the anti-tumor effect of the cancer therapy includes one or more of: inhibiting primary or metastatic tumor growth; reducing primary or metastatic tumor mass or volume;
reducing size or number of metastatic lesions; inhibiting the development of new metastatic lesions; reducing one or more of non-invasive tumor volume or metabolism; providing prolonged survival; providing prolonged progression-free survival; providing prolonged time to progression; and/or enhanced quality of life.
In some embodiments, the term "improved efficacy" as used herein, with respect to a cancer therapy in combination with an AHCM, can refer to an increase in reduction of primary or metastatic tumor growth by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, up to and including 100%, as compared to the reduction of primary or metastatic tumor growth during a cancer therapy alone (i.e., in the absence of an AHCM). In some embodiments, the administration of an AHCM in combination with a cancer therapy can increase the reduction of primary or metastatic tumor growth by at least about 1 -fold, at least about 2- fold, at least about 3-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, or higher, as compared to the reduction of primary or metastatic tumor growth during a cancer therapy alone (i.e., in the absence of an AHCM). Methods for monitoring tumor growth in vivo are well known in the art, e.g., but not limited to, X-ray, CT scan, MRI and other art-recognized medical imaging methods.
In some embodiments, the term "improved efficacy" as used herein, with respect to a cancer therapy in combination with an AHCM, can refer to an increase in perfusion of an anti-cancer agent (e.g., low molecular weight therapeutics or nanotherapeutics such as DOXIL®) into a tumor, e.g., by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, up to and including 100%, as compared to perfusion of an anti-cancer agent alone (i.e., in the absence of an AHCM). In some embodiments, the administration of an AHCM in combination with a cancer therapy can increase perfusion of an anti-cancer agent (e.g., low molecular weight therapeutics or nanotherapeutics such as DOXIL®) into a tumor, by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, or higher, as compared to the perfusion efficiency of an anti-cancer agent alone (i.e., in the absence of an AHCM). Methods to measure tumor perfusion in vivo are well established in the art, including, but not limited to, positron emission tomography (PET), and ultrasound or contrast-enhanced ultrasound.
In some embodiments, the term "improved efficacy" as used herein, with respect to a cancer therapy in combination with an AHCM, can refer to an increase in reduction in expression level of at least one cancer biomarker (e.g., in a biological sample such as a blood sample, a serum sample, a plasma sample or a tissue biopsy), e.g., by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, up to and including 100%, as compared to the reduction in expression level of the at least one cancer biomarker when administered with a cancer therapy alone (i.e., in the absence of an AHCM). In some embodiments, the administration of an AHCM in combination with a cancer therapy can increase the reduction in expression level of at least one cancer biomarker (e.g., in a biological sample such as a blood sample, a serum sample, a plasma sample or a tissue biopsy) by at least about 1 -fold, at least about 2-fold, at least about 3-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, or higher, as compared to the reduction in expression level of the at least one cancer biomarker when administered with a cancer therapy alone (i.e., in the absence of an AHCM). Examples of serum/plasma cancer biomarker can include, but are not limited to, TGF-beta 1, TGF-beta 2, CTGF, TSP-1, collagen I, collagen II, collagen III, collagen IV. Expression levels of serum/plasma cancer biomarkers can be measured on a transcript level and/or a protein level, using any art-recognized analytical methods, e.g., PCR, western blot, ELISA, and/or immunostaining.
"Blood pressure" is usually classified based on the systolic and diastolic blood pressures. "Systolic blood pressure" or Psys refers to the blood pressure in vessels during a heart beat. "Diastolic blood pressure" or Pdias refers to the pressure between heartbeats. A systolic or the diastolic blood pressure measurement higher than the accepted normal values for the age of the individual is classified as prehypertension or hypertension. A systolic or the diastolic blood pressure measurement lower than the accepted normal values for the age of the individual is classified as hypotension. A "normal" systolic pressure for an adult is typically in the range of 90-120 mmHg; a
"normal" diastolic pressure is usually in the range of 60-80 mmHg. In the population, the average blood pressure (Psys/Pdias ratio) can range from 1 10/65 to 140/90 mmHg for an adult; 95/65 mmHg for a 1 year infant, and 100/65 mmHg for a 6-9 year old. Hypertension has several subclassifications including, prehypertension ( 120/80 to 139/89 mmHg); hypertension stage I (140/90 to 159 to 99 mmHg), hypertension stage II (greater or equal to 160/100 mmHg, and isolated systolic hypertension (greater or equal to 140/90 mmHg). Isolated systolic hypertension refers to elevated systolic pressure with normal diastolic pressure and is common in the elderly. These classifications are made after averaging a patient's resting blood pressure readings taken on two or more office visits.
Hypertension is generally diagnosed on the basis of a persistently high blood pressure. Usually this requires three separate sphygmomanometer measurements at least one week apart. Often, this entails three separate visits to the physician's office. Initial assessment of the hypertensive patient should include a complete medical history and physical examination.
As used herein, "hypertension" or "high blood pressure," refers to a
prehypertensive or a hypertensive stage having a systolic pressure of 120 or greater (typically, 140 or greater) and a diastolic pressure of 80 or greater (all blood pressures herein are expressed as mmHg).
As used herein, the term "mean arterial pressure" (MAP) is art recognized and refers to the average over a cardiac cycle and is determined by the cardiac output (CO), systemic vascular resistance (SVR), and central venous pressure (CVP), MAP = (CO x SVR) + CVP. MAP can be approximately determined from measurements of the systolic pressure (Psys) and the diastolic pressure (Pdias), while there is a normal resting heart rate, MAP is approximately Pdias + l/3(Psys -Pdias).
"Anti-hypertensive agent," as used herein refers to an agent (e.g., a compound, a protein) that when administered at a selected dose (referred to herein as "an anti- hypertensive dose") reduces blood pressure, typically in a patient (e.g., a hypertensive patient). Anti-hypertensive agents are routinely used clinically to treat patients with high blood pressure at doses known in the art. Exemplary anti-hypertensive agents, include but are not limited to, renin angiotensin aldosterone system antagonists ("RAAS antagonists"), angiotensin converting enzyme (ACE) inhibitors, and angiotensin II receptor blockers (ATi blockers). Exemplary anti-hypertensive doses of some of these agents are also disclosed herein.
"Sub-anti-hypertensive dose," as used herein, refers to a dose of an anti- hypertension agent that is typically less than the lowest dose that would be used to treat a patient for high blood pressure. In an embodiment, a sub-anti-hypertensive dose has one or more of the following properties:
it does not substantially lower blood pressure, e.g., the mean arterial blood pressure, of the subject, e.g., a hypertensive subject;
it reduces mean arterial blood pressure in the subject by less than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%:
it reduces blood pressure by less than 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, or less of the reduction caused by a standard of care anti-hypertensive dose for that AHCM;
it is less than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% of the dose of that AHCM that would bring the subject's blood pressure into the normal range, e.g, 120 systolic and 80 diastolic, or a dose that would bring the subjects blood pressure into the range of to 120+/-5 systolic and 80+/-5 diastolic; or it is less than a standard of care anti-hypertensive dose.
In certain embodiments, the ability of a dose to meet one or more of these standards can be made as measured after a preselected number of dosages, e.g., 1 , 2, 5, or 10, or after sufficient dosages that a steady state level, e.g., plasma level, is attained.
An "AHCM," as used herein, can be an agent having one or more of the following properties:
it is an antagonist of renin angiotensin aldosterone system ("RAAS antagonist"), it is an angiotensin converting enzyme (ACE) inhibitor,
it is an angiotensin II receptor blocker (ATi blocker),
it is a thrombospondin 1 (TSP-1) inhibitor,
it is a transforming growth factor beta 1 (TGF-βΙ) inhibitor, or
it is a connective tissue growth factor (CTGF) inhibitor.
"Treating" a tumor, as used herein, typically refers to one or more of the following:
inhibiting primary or metastatic tumor growth;
reducing primary or metastatic tumor mass or volume;
reducing size or number of metastatic lesions;
inhibiting the development of new metastatic lesions;
reducing one or more of non-invasive tumor volume or metabolism;
providing prolonged survival; providing prolonged progression-free survival;
providing prolonged time to progression; and/or enhanced quality of life.
Various aspects of the invention are described in further detail below. Additional definitions are set out throughout the specification.
Anti-Hypertensive and/or Collagen Modifying Agents (AHCM Agents)
In certain embodiments, the AHCM agent used in the methods and compositions of the invention can be chosen from one or more of: an antagonist of renin angiotensin aldosterone system ("RAAS antagonist"), an angiotensin converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ΑΤΊ blocker), a thrombospondin 1 (TSP-1) inhibitor, a transforming growth factor beta 1 (TGF-βΙ) inhibitor, and a connective tissue growth factor (CTGF) inhibitor. The method can include one, two, three or more AHCM agents, alone or in combination with one or more cancer therapeutics.
Exemplary antagonists of renin angiotensin aldosterone system (RAAS) include, but are not limited to, aliskiren (TE TURNA®, RASILEZ®), remikiren (Ro 42-5892), enalkiren (A-64662), SPP635, and derivatives thereof.
Exemplary angiotensin converting enzyme (ACE) inhibitors include, but are not limited to, benazepril (LOTENSIN®), captopril (CAPOTEN®), enalapril (VASOTEC®), fosinopril (MONOPRIL®), lisinopril (PRINIVIL®, ZESTRIL®), moexipril
(UNIVASC®), perindopril (ACEON®), quinapril (ACCUPRIL®), ramipril
(ALT ACE®), trandolapril (MAVIK®), and derivatives thereof.
Exemplary angiotensin II receptor blockers (ATi blockers) include, but are not limited to, losartan (COZAAR®), candesartan (ATACAND®), eprosartan mesylate (TEVETEN®), EXP 3174, irbesartan (AVAPRO®), LI 58,809, olmesartan
(BENICAR®), saralasin, telmisartin (MICARDIS®), valsartan (DIOVAN®), and derivatives thereof.
In one embodiment, the ATi blocker is losartan, or a derivative thereof. Losartan is an anti-hypertensive agent with miminal safety risks (Johnston CI (1995) Lancet 346: 1403-1407). Furthermore, in addition to its antihypertensive properties, losartan is also an antifibrotic agent that has been shown to reduce the incidence of cardiac and renal fibrosis (Habashi JP, et al. (2006) Science 312: 1 17-121 ; and. Cohn RD, et al. (2007) Nat Med 13:204-210). The antifibrotic effects of losartan are caused, in part, by the suppression of active transforming growth factor-β ΐ (TGF-βΙ ) levels via an angiotensin II type I receptor (AGTR1) mediated down-regulation of TGF-βΙ activators like thrombospondin-1 (TSP-1) (Habashi JP, et al. (2006) Science 312: 1 17-121 ; Cohn RD, et al. (2007) Nat Med 13:204-210; Lavoie P, et al. (2005) JHypertens 23: 1895-1903; Chamberlain JS (2007) Nat Med 13: 125-126; and Dietz HC (2010) J Clin Invest
120:403-407).
Exemplary thrombospondin 1 (TSP-1 ) inhibitors include, but are not limited to, ABT-510, CVX-045, LS L, and derivatives thereof.
Exemplary transforming growth factor beta 1 (TGF-βΙ) inhibitors include, but are not limited to, CAT- 192, fresolimumab (GC 1008), LY 2157299, Peptide 144 (PI 44), SB- 431542, SD-208, compounds described in U.S. Patent Serial No. 7,846,908 and U.S. Patent Application Publication No. 201 1/0008364, and derivatives thereof.
Exemplary connective tissue growth factor (CTGF) inhibitors include, but are not limited to, DN-9693, FG-3019, and compounds described in European Patent Application Publication No. 1839655, U.S. Patent Serial No. 7,622,454, and derivatives thereof.
Exemplary beta-blockers include, but are not limited to, atenolol (TENORMIN®), betaxolol (KERLONE®), bisoprolol (ZEBETA®), metoprolol (LOPRESSOR®), metoprolol extended release (TOPROL XI®), nadolol (CORGARD®), propranolol (INDERAL®), propranolo long-acting (INDERAL LA®), timolol (BLOCADREN®), acebutolol (SECTRAL®), penbutolol (LEVATOL®), pindolol, carvedilol (COREG®), labetalol (NORMODYNE®, TRANDATE®), and derivatives thereof.
In one embodiment, the AHCM agent is a TGF-β Ι inhibitor, e.g., an anti- TGF-βΙ antibody, a TGF-β Ι peptide inhibitor. In certain embodiment, the TGF-βΙ inhibitor is chosen from one or more of: CAT- 192, fresolimumab (GC1008), LY 2157299, Peptide 144 (P144), SB-431 42, SD-208, compounds described in U.S. Patent Serial No.
7,846,908 and U.S. Patent Application Publication No. 201 1/0008364, or a derivative thereof.
Suitable doses for administration of the AHCM agent can be evaluated based on the standard of care anti-hypertensive doses of the AHCM agents are available in the art.
Exemplary standard of care anti-hypertensive and anti-heart failure doses and dosage formulations for ATi inhibitors in humans are as follows: 25-100 mg day"1 of losartan (available in a dosage form for oral administration containing 12.5 mg, 25 mg, 50 mg or 100 mg of losartan); 4 to 32 mg day"1 of candesartan (ATACAND®) (e.g., available in a dosage form for oral administration containing 4 mg, 8 mg, 16 mg, or 32 mg of candesartan); 400 to 800 mg day"1 of eprosartan mesylate (TEVETEN®) (e.g., available in a dosage form for oral administration containing 400 or 600 mg of eprosartan); 150 to 300 mg day" 1 of irbesartan (AVAPRO®) (e.g., available in a dosage form for oral administration containing 150 or 300 mg of irbesartan); 20 to 40 mg day"1 of olmesartan (BENICAR®) (available in a dosage form for oral administration containing 5 mg, 20 mg, or 40 mg of olmesartan); 20 to 80 mg day"1 of telmisartin (MICARDIS®) (e.g., available in a dosage form for oral administration containing of 20 mg, 40 mg or 80 mg of telmisartin); and 80 to 320 mg day"1 of valsartan (DIOVAN®) (e.g., available in a dosage form for oral administration containing 40 mg, 80 mg, 160 mg or 320 mg of valsartan).
Exemplary standard of care anti-hypertensive and anti-heart failure doses and dosage formulations for ACE inhibitors in humans are as follows: 10 to 40 mg day"1 of benazepril (LOTENSIN®) (Lotensin (benazepril) is supplied as tablets containing 5 mg, 10 mg, 20 mg, or 40 mg of benazepril hydrochloride for oral administration); 25 to 100 mg day"1 of captopril (CAPOTEN®) (available in a dosage form for oral administration containing 12.5 mg, 25 mg, 50 mg or 100 mg of captopril); 5 to 40 mg day"1 of enalapril (VASOTEC®) (available in a dosage form for oral administration containing 2.5 mg, 5 mg, 10 mg or 20 mg of enalapril; 10 to 40 mg day"1 of fosinopril (MONOPRIL®) (available in a dosage form for oral administration containing 10 mg, 20 mg, or 40 mg of fosinopril); 10 to 40 mg day"1 of lisinopril (PRINIVIL®, ZESTRIL®) (available in a dosage form for oral administration containing 2.5 mg, 5mg, 10 mg, 20 mg, 30 mg or 40 mg of lisinopril); 7.5 to 30 mg day"1 of moexipril (U IVASC®) (available in a dosage form for oral administration containing 7.5 mg or 15 mg of Moexipril); 4 to 8 mg day"1 of perindopril (ACEON®) (available in a dosage form for oral administration containing 2 mg, 4 mg or 8 mg of perindopril), 10 to 80 mg day"1 of quinapril (ACCUPRIL®)
(available in a dosage form for oral administration containing 5 mg, 10 mg, 20 mg, or 40 mg of quinapril); 2.5 to 20 mg day"1 of ramipril (ALT ACE®) (available in a dosage form for oral administration containing 1.25 mg, 2.5 mg, 5mg, or 10 mg of ramipril); 1 to 4 mg day" 1 of trandolapril (MAVIK®) (available in a dosage form for oral administration containing 1 mg, 2 mg, or 4 mg of trandolapril).
In one embodiment, the AHCM agent is administered at a standard of care antihypertensive and anti-heart failure doses and dosage formulations, e.g., a dose or dosage formulation as described herein. In certain embodiments, a sub-anti-hypertensive dose or dosage formulation of the AHCM agent is desirable, e.g., a dose of the AHCM agent that is less than the standard of care dose or dosage formulation. In one embodiment, the sub-anti-hypertensive dose or dosage formulation has a minimal effect in blood pressure in a hypertensive subject (e.g., decreases the mean arterial blood pressure in a hypertensive subject by less than 20%, 10%, or 5% or less). In certain embodiments, the AHCM agent is administered at a dose or dosage formulation that is less than 0.01, 0.05, 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, that of the standard of care anti-hypertensive dose (e.g., the lower standard of care dose). In one embodiment, the dose or dosage formulation is in the range of, for example, 0.01- 0.9-fold, 0.02-0.8-fold, 0.05-0.7-fold, 0.1-0.5 fold, 0.1 -0.2-fold, that of the standard of care dose or dosage formulation for anti-hypertensive or anti-heart failure use. Standard of care doses or dosage formulation of the AHCM are available in the art, some of which are exemplified herein.
In yet other embodiments, the AHCM agent is administered at a dose or dosage formulation that is greater than the standard of care dose or dosage formulation for antihypertensive or anti-heart failure use (e.g., a dose or dosage form that is greater than 1.1 , 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dose for antihypertensive or anti-heart failure use). In one embodiment, the dose or dosage formulation is in the range of, for example, 1.1 to 10-fold, 1.5-5-fold, 1.7 to 4-fold, or 2- 3-fold, that of the standard of care dose or dosage formulation for anti-hypertensive or anti-heart failure use. Standard of care doses or dosage formulation of the AHCM are available in the art, some of which are exemplified herein.
The standard of care dose and dosage forms are provided herein for a number of AHCMs, e.g., losartan. In an embodiment, the dose and/or dosage form is less than (or higher than) the standard of care dose and/or dosage form. In an exemplary embodiment, it is less than 0.01 , 0.02, 0.05, 0.1, 0.2, 0.5, 0.7, 0.8, 0.9-fold, that of the standard of care dose or dosage form. In embodiments, the dose or dosage form contains an amount of AHCM that is within a range of the reduced amounts of the standard of care dose and/or dosage form. E.g., an AHCM dosage form that is 0.01-0.9-fold, 0.02-0.8-fold, 0.05-0.7- fold, 0.1-0.5 fold, 0.1-0.2-fold, that of the standard of care dose or dosage form. In certain embodiments, the range of the dose or the dosage form is 0.5-2.0 times a reduced dose or dosage form recited herein, so long as the dose or dosage form value is less than the standard of care dose or dosage form. By way of example, a standard of care dosage form for losartan is 12.5 mg. Thus, in embodiments, the dosage form is 0.125 mg (.01 x12.5 mg); 0.625 mg (0.05 x 12.5 mg); 1.25 mg (0.1 x 12.5 mg); 2.5 mg (0.2 x 12.5 mg); or 6.25 mg (0.5 x 12.5 mg). In an embodiment, the AHCM dosage form is in the range 0.5-2.0 (.125 mg) = 0.0625-0.25 mg; 0.5-2.0(.625 mg) = 0.312-1.25 mg; and so on, so long as the dose or dosage form value is less than the standard of care dose or dosage form. This calculation can be applied to any standard of care dose and/or dosage form for any AHCM described herein. In certain embodiment, the value is less than the standard of care values. In other embodiments, the value is greater than the standard of care
values.
In one embodiment, the dose of the AHCM agent is calculated based on the
severity of the fibrosis in the tumor sample.
In some embodiments, the dose of the AHCM agent can be a sub-anti- hypertensive dose, which does not have any anti-tumor effect, e.g., no significant effect on inhibiting or preventing tumor growth or progression when administered alone. In some embodiments, the dose of the AHCM agent can be comparable to or greater than the standard of care dose or dosage formulation for anti-hypertensive or anti-heart failure use, and does not have any anti-tumor effect, e.g., no significant effect on inhibiting or
prevening tumor growth or progression when administered alone.
Therapeutic Methods
In one aspect, the invention relates to a method of treating a hyperproliferative disorder (e.g., a cancer) by administering to a patient an AHCM agent, alone or in
combination with a therapeutic agent, e.g., an anti-cancer agent as described herein.
As used herein, and unless otherwise specified, the terms "treat," "treating" and
"treatment" refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disorder, such as the development or spread of cancer. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the condition or disorder as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented. For example, in the case of treating cancer, in some embodiments, therapeutic treatment can refer to inhibiting or reducing tumor growth or progression after administration in accordance with the methods or administration with the pharmaceutical compositions described herein. For example, tumor growth or progression is inhibited or reduced by at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, or at least about 50%, after treatment. In another embodiment, tumor growth or progression is inhibited or reduced by more than 50%, e.g., at least about 60%, or at least about 70%, after treatment. In one embodiment, tumor growth or progression is inhibited or reduced by at least about 80%, at least about 90% or greater, as compared to a control (e.g. in the absence of the pharmaceutical composition described herein).
In another embodiment, the therapeutic treatment refers to alleviation of at least one symptom associated with cancer. Measurable lessening includes any statistically significant decline in a measurable marker or symptom, such as measuring a cancer biomarker, such as serum/plasma cancer biomarker in a blood sample, after treatment. In one embodiment, at least one cancer biomarker or sympton is alleviated by at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, or at least about 50%. In another embodiment, at least one cancer biomarker or sympton is alleviated by more than 50%, e.g., at least about 60%, or at least about 70%. In one embodiment, at least one cancer biomarker or sympton is alleviated by at least about 80%, at least about 90% or greater, as compared to a control (e.g. in the absence of the pharmaceutical composition described herein).
As used herein, unless otherwise specified, the terms "prevent," "preventing" and
"prevention" contemplate an action that occurs before a patient begins to suffer from the regrowth of the cancer and/or which inhibits or reduces the severity of the cancer.
As used herein, and unless otherwise specified, a "therapeutically effective
amount" of a compound is an amount sufficient to provide a therapeutic benefit in the treatment of the disorder (e.g., cancer), or to delay or minimize one or more symptoms associated with the disorder (e.g., cancer). A therapeutically effective amount of a
compound means an amount of therapeutic agent, alone or in combination with other
therapeutic agents, which provides a therapeutic benefit in the treatment or management of the disorder. The term "therapeutically effective amount" can encompass an amount that improves overall therapy, reduces or avoids symptoms or causes of the disorder (e.g., cancer), or enhances the therapeutic efficacy of another therapeutic agent. As used herein, and unless otherwise specified, a "prophylactically effective amount" of a compound is an amount sufficient to prevent a disorder (e.g., regrowth of the cancer, or one or more symptoms associated with the cancer, or prevent its recurrence). A prophylactically effective amount of a compound means an amount of the compound, alone or in combination with other therapeutic agents, which provides a prophylactic benefit in the prevention of the disorder. The term "prophylactically effective amount" can encompass an amount that improves overall prophylaxis or enhances the prophylactic efficacy of another prophylactic agent.
As used herein, the term "patient" or "subject" refers to an animal, typically a human (i.e., a male or female of any age group, e.g., a pediatric patient (e.g, infant, child, adolescent) or adult patient (e.g., young adult, middle-aged adult or senior adult) or other mammal, such as a primate (e.g., cynomolgus monkey, rhesus monkey); commercially relevant mammals such as cattle, pigs, horses, sheep, goats, cats, and/or dogs; and/or birds, including commercially relevant birds such as chickens, ducks, geese, and/or turkeys, that will be or has been the object of treatment, observation, and/or experiment. When the term is used in conjunction with administration of a compound or drug, then the patient has been the object of treatment, observation, and/or administration of the compound or drug. The methods and/or pharmaceutical compositions described herein can also be used to treat domesticated animals or pets such as cats and dogs.
As used herein, "cancer" and "tumor" are synonymous terms.
As used herein, "cancer therapy" and "cancer treatment" are synonymous terms. As used herein, "chemotherapy," "chemotherapeutic," "chemotherapeutic agent" and "anti-cancer agent" are synonymous terms.
In some embodiments, the AHCM agent, alone or in combination, is a first line treatment for the cancer, i.e., it is used in a subject who has not been previously administered another drug intended to treat the cancer.
In other embodiments, the AHCM agent, alone or in combination, is a second line treatment for the cancer, i.e., it is used in a subject who has been previously administered another drug intended to treat the cancer.
In other embodiments, the AHCM agent, alone or in combination, is a third or fourth line treatment for the cancer, i.e., it is used in a subject who has been previously administered two or three other drugs intended to treat the cancer.
In some embodiments, the AHCM agent is administered to a subject before, during, and/or after radiation or surgical treatment of the cancer. In some embodiments, the AHCM agent is administered, alone or in combination with a cancer therapy or an anti-cancer agent, to a subject who previously did not respond to at least one cancer therapy or anti-cancer agent, including at least two, at least three, or at least four cancer therapies or anti-cancer agents. In such embodiments, the AHCM agent can be administered to a subject in combination with the cancer therapy or anticancer agent to which he/she previously did not respond, or in combination with a cancer therapy or anti-cancer agent different from the one(s) he/she has been treated with.
In other embodiments, the AHCM agent is administered as adjunct therapy, i.e., a treatment in addition to primary therapy. In embodiments, the adjuvant effect of the AHCM administered in combination with a primary therapy can be additive.
In certain embodiments, the cancer is an epithelial, mesenchymal or hematologic malignancy. In certain embodiments, the cancer treated is a solid tumor (e.g., carcinoid, carcinoma or sarcoma), a soft tissue tumor (e.g., a heme malignancy), and a metastatic lesion, e.g., a metastatic lesion of any of the cancers disclosed herein. In one
embodiment, the cancer treated is a fibrotic or desmoplastic solid tumor, e.g., a tumor having one or more of: limited tumor perfusion, compressed blood vessels, or fibrotic tumor interstitium. In one embodiment, the solid tumor is chosen from one or more of pancreatic (e.g., pancreatic adenocarcinoma), breast, colorectal, lung (e.g., small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC)), skin, ovarian, liver cancer, esophageal cancer, endometrial cancer, gastric cancer, head and neck cancer, kidney, or prostate cancer.
By "hyperproliferative cancerous disease or disorder" is meant all neoplastic cell growth and proliferation, whether malignant or benign, including all transformed cells and tissues and all cancerous cells and tissues. Hyperproliferative diseases or disorders include, but are not limited to, precancerous lesions, abnormal cell growths, benign tumors, malignant tumors, and "cancer."
As used herein, the terms "cancer," "tumor" or "tumor tissue" refer to an abnormal mass of tissue that results from excessive cell division, in certain cases tissue comprising cells which express, over-express, or abnormally express a hyperproliferative cell protein. A cancer, tumor or tumor tissue comprises "tumor cells" which are neoplastic cells with abnormal growth properties and no useful bodily function. Cancers, tumors, tumor tissue and tumor cells may be benign or malignant. A cancer, tumor or tumor tissue may also comprise "tumor-associated non-tumor cells", e.g., vascular cells which form blood vessels to supply the tumor or tumor tissue. Non-tumor cells may be induced to replicate and develop by tumor cells, for example, the induction of angiogenesis in a tumor or tumor tissue.
Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. More particular examples of such cancers are noted below and include: squamous cell cancer (e.g. epithelial squamous cell cancer), lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, as well as head and neck cancer. The term "cancer" includes primary malignant cells or rumors (e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor) and secondary malignant cells or tumors (e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor).
Other examples of cancers or malignancies include, but are not limited to: Acute Childhood Lymphoblastic Leukemia, Acute Lymphoblastic Leukemia, Acute
Lymphocytic Leukemia, Acute Myeloid Leukemia, Adrenocortical Carcinoma, Adult (Primary) Hepatocellular Cancer, Adult (Primary) Liver Cancer, Adult Acute
Lymphocytic Leukemia, Adult Acute Myeloid Leukemia, Adult Hodgkin's Disease, Adult Hodgkin's Lymphoma, Adult Lymphocytic Leukemia, Adult Non-Hodgkin's Lymphoma, Adult Primary Liver Cancer, Adult Soft Tissue Sarcoma, AIDS-Related Lymphoma, AIDS-Related Malignancies, Anal Cancer, Astrocytoma, Bile Duct Cancer, Bladder Cancer, Bone Cancer, Brain Stem Glioma, Brain Tumors, Breast Cancer, Cancer of the Renal Pelvis and Ureter, Central Nervous System (Primary) Lymphoma, Central Nervous System Lymphoma, Cerebellar Astrocytoma, Cerebral Astrocytoma, Cervical Cancer, Childhood (Primary) Hepatocellular Cancer, Childhood (Primary) Liver Cancer,
Childhood Acute Lymphoblastic Leukemia, Childhood Acute Myeloid Leukemia, Childhood Brain Stem Glioma, Childhood Cerebellar Astrocytoma, Childhood Cerebral Astrocytoma, Childhood Extracranial Germ Cell Tumors, Childhood Hodgkin's Disease, Childhood Hodgkin's Lymphoma, Childhood Hypothalamic and Visual Pathway Glioma, Childhood Lymphoblastic Leukemia, Childhood Medulloblastoma, Childhood Non- Hodgkin's Lymphoma, Childhood Pineal and Supratentorial Primitive Neuroectodermal Tumors, Childhood Primary Liver Cancer, Childhood Rhabdomyosarcoma, Childhood Soft Tissue Sarcoma, Childhood Visual Pathway and Hypothalamic Glioma, Chronic Lymphocytic Leukemia, Chronic Myelogenous Leukemia, Colon Cancer, Cutaneous T- Cell Lymphoma, Endocrine Pancreas Islet Cell Carcinoma, Endometrial Cancer, Ependymoma, Epithelial Cancer, Esophageal Cancer, Ewing's Sarcoma and Related Tumors, Exocrine Pancreatic Cancer, Extracranial Germ Cell Tumor, Extragonadal Germ Cell Tumor, Extrahepatic Bile Duct Cancer, Eye Cancer, Female Breast Cancer, Gaucher's Disease, Gallbladder Cancer, Gastric Cancer, Gastrointestinal Carcinoid
Tumor, Gastrointestinal Tumors, Germ Cell Tumors, Gestational Trophoblastic Tumor, Hairy Cell Leukemia, Head and Neck Cancer, Hepatocellular Cancer, Hodgkin's Disease, Hodgkin's Lymphoma, Hypergammaglobulinemia, Hypopharyngeal Cancer, Intestinal Cancers, Intraocular Melanoma, Islet Cell Carcinoma, Islet Cell Pancreatic Cancer, Kaposi's Sarcoma, Kidney Cancer, Laryngeal Cancer, Lip and Oral Cavity Cancer, Liver Cancer, Lung Cancer, Lymphoproliferative Disorders, Macroglobulinemia, Male Breast Cancer, Malignant Mesothelioma, Malignant Thymoma, Medulloblastoma, Melanoma, Mesothelioma, Metastatic Occult Primary Squamous Neck Cancer, Metastatic Primary Squamous Neck Cancer, Metastatic Squamous Neck Cancer, Multiple Myeloma, Multiple Myeloma/Plasma Cell Neoplasm, Myelodysplasia Syndrome, Myelogenous Leukemia, Myeloid Leukemia, Myeloproliferative Disorders, Nasal Cavity and Paranasal Sinus Cancer, Nasopharyngeal Cancer, Neuroblastoma, Non-Hodgkin's Lymphoma During Pregnancy, Nonmelanoma Skin Cancer, Non-Small Cell Lung Cancer, Occult Primary Metastatic Squamous Neck Cancer. Oropharyngeal Cancer, Osteo-/Malignant Fibrous Sarcoma, Osteosarcoma/Malignant Fibrous Histiocytoma, Osteosarcoma/Malignant Fibrous Histiocytoma of Bone, Ovarian Epithelial Cancer, Ovarian Germ Cell Tumor, Ovarian Low Malignant Potential Tumor, Pancreatic Cancer, Paraproteinemias, Purpura, Parathyroid Cancer, Penile Cancer, Pheochromocytoma, Pituitary Tumor, Plasma Cell Neoplasm/Multiple Myeloma, Primary Central Nervous System Lymphoma, Primary Liver Cancer, Prostate Cancer, Rectal Cancer, Renal Cell Cancer, Renal Pelvis and Ureter Cancer, Retinoblastoma, Rhabdomyosarcoma, Salivary Gland Cancer, Sarcoidosis Sarcomas, Sezary Syndrome, Skin Cancer, Small Cell Lung Cancer, Small Intestine Cancer, Soft Tissue Sarcoma, Squamous Neck Cancer, Stomach Cancer, Supratentorial Primitive Neuroectodermal and Pineal Tumors, T-Cell Lymphoma, Testicular Cancer, Thymoma, Thyroid Cancer, Transitional Cell Cancer of the Renal Pelvis and Ureter, Transitional Renal Pelvis and Ureter Cancer, Trophoblastic Tumors, Ureter and Renal Pelvis Cell Cancer, Urethral Cancer, Uterine Cancer, Uterine Sarcoma, Vaginal Cancer, Visual Pathway and Hypothalamic Glioma, Vulvar Cancer, Waldenstrom's
Macroglobulinemia, Wilms' Tumor, and any other hyperproliferative disease, besides neoplasia, located in an organ system listed above.
In other embodiements, the AHCM agent, as described above and herein, is used to treat a hyperproliferative disorder, e.g., a hyperpoliferative connective tissue disorder (e.g., a hyperproliferative fibrotic disease). In one embodiment, the hyperproliferative fibrotic disease is multisystemic or organ-specific. Exemplary hyperproliferative fibrotic diseases include, but are not limited to, multisystemic (e.g., systemic sclerosis, multifocal fibrosclerosis, sclerodermatous graft-versus-host disease in bone marrow transplant recipients, nephrogenic systemic fibrosis, scleroderma), and organ-specific disorders (e.g., fibrosis of the lung, liver, heart, kidney, pancreas, skin and other organs).
In other embodiment, the subject treated has a hyperproliferative genetic disorder, e.g., a hyperproliferative genetic disorder chosen from Marfan's syndrome or Loeys- Dietz syndrome. Losartan has been shown to treat human Marfan syndrome, a connective tissue disorder caused by mutations in the gene that encodes the extracellular matrix protein, fibrillin- 1 (Dietz, H.C. et al. (2010) New Engl J Med 363(9): 852-863). Fibrillin-1 comprises the microfibrils of elastic tissue and a component of many other connective tissues. Affected patients with Marfan syndrome have blood vessel abnormalities such as aortic aneurysms. The vascular disease can result in blood vessel rupture and death in childhood and later in life. Dietz et al. first found in mouse models of Marfan syndrome that excessive activation of latent TGF-β has an important role in the pathophysiology. They used losartan in the affected mice and showed striking effects in improving blood vessel architecture and prevented the development of aortic aneurysms. They have also used losartan to treat children with Marfan syndrome and demonstrated that the drug can strikingly prevent progression of aortic and muscular lesions. Aortic diseases other than Marfan syndrome can also benefit from the use of losartan. Inhibition of activation of latent TGF-β locally and decreasing circulating levels of active TGF-β thus can have effects on components of connective tissues other than collagen in the extracellular matrix of cancer tissues that alter delivery and efficacy of nanotherapeutics.
In other embodiments, the hyperproliferative disorder (e.g., the hyperproliferative fibrotic disorder) is chosen from one or more of chronic obstructive pulmonary disease, asthma, aortic aneurysm, radiation-induced fibrosis, skeletal-muscle myopathy, diabetic nephropathy, and/or arthritis.
Additional exemplary hyperproliferative disorders that can be treated by the methods and compositions of the invention are disclosed in Sounni, N.E. et al. (2010) Diseases Models & Mechanisms 3:317-332.
Combination Therapy
It will be appreciated that the AHCM agent, as described above and herein, can be administered in combination with one or more additional therapies, e.g., such as radiation therapy, surgery and/or in combination with one or more therapeutic agents, to treat the cancers described herein.
By "in combination with," it is not intended to imply that the therapy or the therapeutic agents must be administered at the same time and/or formulated for delivery together, although these methods of delivery are within the scope of the invention. The pharmaceutical compositions can be administered concurrently with, prior to, or subsequent to, one or more other additional therapies or therapeutic agents. In general, each agent will be administered at a dose and/or on a time schedule determined for that agent. In will further be appreciated that the additional therapeutic agent utilized in this combination can be administered together in a single composition or administered separately in different compositions. The particular combination to employ in a regimen will take into account compatibility of the inventive pharmaceutical composition with the additional therapeutically active agent and/or the desired therapeutic effect to be achieved.
In general, it is expected that additional therapeutic agents utilized in combination be utilized at levels that do not exceed the levels at which they are utilized individually. In some embodiments, the levels utilized in combination will be lower than those utilized individually.
In one embodiment, the AHCM and/or the therapy (e.g., the cancer or
hyperproliferative therapy) is administered in combination with an inhibitor of a profibrotic pathway (a "profibrotic pathway inhibitor") (e.g., a pathway dependent- or independent of TGF-beta and/or CTGF activation). In one embodiment, the AHCM and/or the cancer therapy is administered in combination with one or more of: an inhibitor of endothelin-1, PDGF, Wnt/beta-catenin, IGF-1 , TNF-alpha, and/or IL-4. In another embodiment, the AHCM and/or the cancer therapy is administered in combination with an inhibitor of endothelin- 1 and/or PDGF. In other embodiments, the AHCM and/or the cancer therapy is administered in combination with an inhibitor of one or more of chemokine receptor type 4 (CXCR4) (e.g., AMD3100, MSX-122); stromal- derived-factor-l (SDF-l ) (e.g., tannic acid); hedgehog (e.g., GDC -0449, cylopamine, or GANT58).
In other embodiments, the AHCM is administered in combination with a low or small molecular weight chemotherapeutic agent. Exemplary low or small molecular weight chemotherapeutic agents include, but not limited to, 13-cis-retinoic acid
(isotretinoin, ACCUTANE®), 2-CdA (2-chlorodeoxyadenosine, cladribine,
LEUSTATIN™), 5-azacitidine (azacitidine, VIDAZA®), 5-fluorouracil (5-FU, fluorouracil, ADRUCIL®), 6-mercaptopurine (6-MP, mercaptopurine,
PURINETHOL®), 6-TG (6-thioguanine, thioguanine, THIOGUANINE TABLOID®), abraxane (paclitaxel protein-bound), actinomycin-D (dactinomycin, COSMEGEN®), alitretinoin (PANRETIN®), all-transretinoic acid (ATRA, tretinoin, VESANOID®), altretamine (hexamethylmelamine, HMM, HEXALEN®), amethopterin (methotrexate, methotrexate sodium, MTX, TREXALL™, RHEUMATREX®), amifostine
(ETHYOL®), arabinosylcytosine (Ara-C, cytarabine, CYTOSAR-U®), arsenic trioxide (TRISENOX®), asparaginase (Erwinia L-asparaginase, L-asparaginase, ELSPAR®, KIDROLASE®), BCNU (carmustine, BiCNU®), bendamustine (TREANDA®), bexarotene (TARGRETIN®), bleomycin (BLENOXANE®), busulfan (BUSULFEX®, MYLERAN®), calcium leucovorin (Citrovorum Factor, folinic acid, leucovorin), camptothecin-1 1 (CPT-1 1, irinotecan, CAMPTOSAR®), capecitabine (XELODA®), carboplatin (PARAPLATIN®), carmustine wafer (prolifeprospan 20 with carmustine implant, GLIADEL® wafer), CCI-779 (temsirolimus, TORISEL®), CCNU (lomustine, CeeNU), CDDP (cisplatin, PLAT1 OL®, PLATI OL-AQ®), chlorambucil (leukeran), cyclophosphamide (CYTOXAN®, NEOSAR®), dacarbazine (DIC, DTIC, imidazole carboxamide, DTIC-DOME®), daunomycin (daunorubicin, daunorubicin hydrochloride, rubidomycin hydrochloride, CERUBIDINE®), decitabine (DACOGEN®), dexrazoxane (ZINECARD®), DHAD (mitoxantrone, NOVANTRONE®), docetaxel (TAXOTERE®), doxorubicin (ADRIAMYCIN®, RUBEX®), epirubicin (ELLENCE™), estramustine (EMCYT®), etoposide (VP- 16, etoposide phosphate, TOPOSAR®, VEPESID®, ETOPOPHOS®), floxuridine (FUDR®), fludarabine (FLUDARA®), fluorouracil (cream) (CARAC™, EFUDEX®, FLUOROPLEX®), gemcitabine (GEMZAR®), hydroxyurea (HYDREA®, DROXIA™, MYLOCEL™), idarubicin (IDAMYCIN®), ifosfamide (IFEX®), ixabepilone (IXEMPRA™), LCR (leurocristine, vincristine, VCR, ONCOVIN®, VINCASAR PFS®), L-PAM (L-sarcolysin, melphalan, phenylalanine mustard, ALKERAN®), mechlorethamine (mechlorethamine hydrochloride, mustine, nitrogen mustard, MUSTARGEN®), mesna (MESNEX™), mitomycin (mitomycin-C, MTC, MUTAMYCIN®), nelarabine (ARRANON®), oxaliplatin (ELOXATIN™), paclitaxel (TAXOL®, ONXAL™), pegaspargase (PEG-L-asparaginase, ONCOSPAR®), PEMETREXED (ALIMTA®), pentostatin (NIPENT®), procarbazine (MATULANE®), streptozocin (ZANOSAR®), temozolomide (TEMODAR®), teniposide (VM-26, VUMON®), TESPA (thiophosphoamide, thiotepa, TSPA, THIOPLEX®), topotecan (HYCAMTIN®), vinblastine (vinblastine sulfate, vincaleukoblastine, VLB, AL ABAN- AQ®, VELBAN®), vinorelbine (vinorelbine tartrate, NAVELBINE®), and vorinostat (ZOLINZA®).
In another embodiment, the AHCM agent is administered in conjunction with a biologic. Biologies useful in the treatment of cancers are known in the art and a binding molecule of the invention may be administered, for example, in conjunction with such known biologies.
For example, the FDA has approved the following biologies for the treatment of breast cancer: HERCEPTIN® (trastuzumab, Genentech Inc., South San Francisco, Calif; a humanized monoclonal antibody that has anti-tumor activity in HER2 -positive breast cancer); FASLODEX® (fulvestrant, AstraZeneca Pharmaceuticals, LP, Wilmington, Del.; an estrogen-receptor antagonist used to treat breast cancer); ARIMIDEX®
(anastrozole, AstraZeneca Pharmaceuticals, LP; a nonsteroidal aromatase inhibitor which blocks aromatase, an enzyme needed to make estrogen); Aromasin® (exemestane, Pfizer Inc., New York, N.Y.; an irreversible, steroidal aromatase inactivator used in the treatment of breast cancer); FEMARA® (letrozole, Novartis Pharmaceuticals, East Hanover, N.J.; a nonsteroidal aromatase inhibitor approved by the FDA to treat breast cancer); and NOLVADEX® (tamoxifen, AstraZeneca Pharmaceuticals, LP; a nonsteroidal antiestrogen approved by the FDA to treat breast cancer). Other biologies with which the binding molecules of the invention may be combined include:
AVASTIN® (bevacizumab, Genentech Inc.; the first FDA-approved therapy designed to inhibit angiogenesis); and ZEVALIN® (ibritumomab tiuxetan, Biogen Idee, Cambridge, Mass.; a radiolabeled monoclonal antibody currently approved for the treatment of B-cell lymphomas). In addition, the FDA has approved the following biologies for the treatment of colorectal cancer: AVASTIN®; ERBITUX® (cetuximab, ImClone Systems Inc., New York, N.Y., and Bristol-Myers Squibb, New York, N.Y.; is a monoclonal antibody directed against the epidermal growth factor receptor (EGFR)); GLEEVEC® (imatinib mesylate; a protein kinase inhibitor); and ERGAMISOL® (levamisole hydrochloride, Janssen Pharmaceutica Products, LP, Titusville, N J.; an immunomodulator approved by the FDA in 1990 as an adjuvant treatment in combination with 5-fluorouracil after surgical resection in patients with Dukes' Stage C colon cancer).
For the treatment of lung cancer, exemplary biologies include TARCEVA® (erlotinib HCL, OSI Pharmaceuticals Inc., Melville, N.Y.; a small molecule designed to target the human epidermal growth factor receptor 1 (HER1) pathway).
For the treatment of multiple myeloma, exemplary biologies include VELCADE® Velcade (bortezomib, Millennium Pharmaceuticals, Cambridge Mass.; a proteasome inhibitor). Additional biologies include THALIDOMID® (thalidomide, Clegene
Corporation, Warren, N.J.; an immunomodulatory agent and appears to have multiple actions, including the ability to inhibit the growth and survival of myeloma cells and anti- angiogenesis).
Additional exemplary cancer therapeutic antibodies include, but are not limited to, 3F8, abagovomab, adecatumumab, afutuzumab, alacizumab pegol, alemtuzumab
(CAMPATH®, MABCAMPATH®), altumomab pentetate (HYBRI-CEAKER®), anatumomab mafenatox, anrukinzumab (IMA-638), apolizumab, arcitumomab (CEA- SCAN®), bavituximab, bectumomab (LYMPHOSCAN®), belimumab (BENLYSTA®, LYMPHOSTAT-B®), besilesomab (SCINTIMUN®), bevacizumab (AVASTIN®), bivatuzumab mertansine, blinatumomab, brentuximab vedotin, cantuzumab mertansine, capromab pendetide (PROSTASCINT®), catumaxomab (REMOVAB®), CC49, cetuximab (C225, ERBITUX®), citatuzumab bogatox, cixutumumab, clivatuzumab tetraxetan, conatumumab, dacetuzumab, denosumab (PROLIA®), detumomab, ecromeximab, edrecolomab (PANOREX®), elotuzumab, epitumomab cituxetan, epratuzumab, ertumaxomab (REXOMUN®), etaracizumab, farletuzumab, figitumumab, fresolimumab, galiximab, gemtuzumab ozogamicin (MYLOTARG®), girentuximab, glembatumumab vedotin, ibritumomab (ibritumomab tiuxetan, ZEVALIN®), igovomab (I DIMACIS-125®), intetumumab, inotuzumab ozogamicin, ipilimumab, iratumumab, labetuzumab (CEA-CIDE®), lexatumumab, lintuzumab, lucatumumab, lumiliximab, mapatumumab, matuzumab, milatuzumab, minretumomab, mitumomab, nacolomab tafenatox, naptumomab estafenatox, necitumumab, nimotuzumab (THERACIM®, THERALOC®), nofetumomab merpentan (VERLUMA®), ofatumumab (ARZERRA®), olaratumab, oportuzumab monatox, oregovomab (OVAREX®), panitumumab
(VECTIBIX®), pemtumomab (THERAGYN®), pertuzumab (OMNITARG®), pintumomab, pritumumab, ramucirumab, ranibizumab (LUCENTIS®), rilotumumab, rituximab (MABTHERA®, RITUXAN®), robatumumab, satumomab pendetide, sibrotuzumab, siltuximab, sontuzumab, tacatuzumab tetraxetan (AFP-CIDE®), taplitumomab paptox, tenatumomab, TGN1412, ticilimumab (tremelimumab), tigatuzumab, TNX-650, tositumomab (BEXXAR®), trastuzumab (HERCEPTI ®), tremelimumab, tucotuzumab celmoleukin, veltuzumab, volociximab, votumumab (HUMASPECT®), zalutumumab (HUMAX-EGFR®), and zanolimumab (HUMAX- CD4®).
In other embodiments, the the AHCM is administered in combination with a viral cancer therapeutic agent. Exemplary viral cancer therapeutic agents include, but not limited to, vaccinia virus (vvDD-CDSR), carcinoembryonic antigen-expressing measles virus, recombinant vaccinia virus (TK-deletion plus GM-CSF), Seneca Valley virus-001 , Newcastle virus, coxsackie virus A21, GL-ONC 1, EBNA1 C-terminal/LMP2 chimeric protein-expressing recombinant modified vaccinia Ankara vaccine, carcinoembryonic antigen-expressing measles virus, G207 oncolytic virus, modified vaccinia virus Ankara vaccine expressing p53, OncoVEX GM-CSF modified herpes-simplex 1 virus, fowlpox virus vaccine vector, recombinant vaccinia prostate-specific antigen vaccine, human papillomavirus 16/18 LI virus-like particle/AS04 vaccine, MVA-EBNA1/LMP2 Inj. vaccine, quadrivalent HPV vaccine, quadrivalent human papillomavirus (types 6, 1 1, 16, 18) recombinant vaccine (GARDASIL®), recombinant fowlpox-CEA(6D)/TRICOM vaccine; recombinant vaccinia-CEA(6D)-TRICOM vaccine, recombinant modified vaccinia Ankara-5T4 vaccine, recombinant fowlpox-TRICOM vaccine, oncolytic herpes virus NV1020, HPV LI VLP vaccine V504, human papillomavirus bivalent (types 16 and 18) vaccine (CERVARIX®), herpes simplex virus HF 10, Ad5CMV-p53 gene, recombinant vaccinia DF3/MUC1 vaccine, recombinant vaccinia-MUC-1 vaccine, recombinant vaccinia-TRICOM vaccine, ALVAC MART-l vaccine, replication-defective herpes simplex virus type I (HSV-1 ) vector expressing human Preproenkephalin (NP2), wild-type reovirus, reovirus type 3 Dearing (REOLYSIN®), oncolytic virus HSV 1716, recombinant modified vaccinia Ankara (MVA)-based vaccine encoding Epstein-Barr virus target antigens, recombinant fowlpox-prostate specific antigen vaccine, recombinant vaccinia prostate-specific antigen vaccine, recombinant vaccinia-B7.1 vaccine, rAd-p53 gene, Ad5-delta24RGD, HPV vaccine 580299, JX-594 (thymidine kinase-deleted vaccinia virus plus GM-CSF), HPV-16/18 L1/AS04, fowlpox virus vaccine vector, vaccinia-tyrosinase vaccine, MEDI-517 HPV-16/18 VLP AS04 vaccine, adenoviral vector containing the thymidine kinase of herpes simplex virus TK99U , HspE7,
FP253/Fludarabine, ALVAC(2) melanoma multi-antigen therapeutic vaccine, ALVAC- hB7.1, canarypox-hIL-12 melanoma vaccine, Ad-REIC/Dkk-3, rAd-IFN SCH 721015, TIL-Ad-INFg, Ad-ISF35, and coxsackievirus A21 (CVA21, CAVATAK®).
In other embodiments, the the AHCM is administered in combination with a nanopharmaceutical. Exemplary cancer nanopharmaceuticals include, but not limited to, ABRAXANE® (paclitaxel bound albumin nanoparticles), CRLX101 (CPT conjugated to a linear cyclodextrin-based polymer), CRLX288 (conjugating docetaxel to the biodegradable polymer poly (lactic-co-glycolic acid)), cytarabine liposomal (liposomal Ara-C, DEPOCYT™), daunorubicin liposomal (DAU OXOME®), doxorubicin liposomal (DOXIL®, CAELYX®), encapsulated-daunorubicin citrate liposome
(DAUNOXOME®), and PEG anti-VEGF aptamer (MACUGEN®).
In some embodiments, the AHCM agent is administered in combination with paclitaxel or a paclitaxel formulation, e.g., TAXOL®, protein-bound paclitaxel (e.g., ABRAXANE®). Exemplary paclitaxel formulations include, but are not limited to, nanoparticle albumin-bound paclitaxel (ABRAXANE®, marketed by Abraxis
Bioscience), docosahexaenoic acid bound-paclitaxel (DHA-paclitaxel, Taxoprexin, marketed by Protarga), polyglutamate bound-paclitaxel (PG-paclitaxel, paclitaxel poliglumex, CT-2103, XYOTAX, marketed by Cell Therapeutic), the tumor-activated prodrug (TAP), ANG105 (Angiopep-2 bound to three molecules of paclitaxel, marketed by ImmunoGen), paclitaxel-EC-1 (paclitaxel bound to the erbB2-recognizing peptide EC- 1 ; see Li et al, Biopolymers (2007) 87:225-230), and glucose-conjugated paclitaxel (e.g., 2'-paclitaxel methyl 2-glucopyranosyl succinate, see Liu et al., Bioorganic & Medicinal Chemistry Letters (2007) 17:617-620).
Exemplary RNAi and antisense RNA agents for treating cancer include, but not limited to, CALAA-01 , siG 12D LODER (Local Drug EluteR), and ALN-VSP02.
Other cancer therapeutic agents include, but not limited to, cytokines (e.g., aldesleukin (IL-2, Inter leukin-2, PROLEUKIN®), alpha Interferon (IFN-alpha, Interferon alfa, INTRON® A (Interferon alfa-2b), ROFERON-A® (Interferon alfa-2a)), Epoetin alfa (PROCRIT®), filgrastim (G-CSF, Granulocyte - Colony Stimulating Factor, NEUPOGEN®), GM-CSF (Granulocyte Macrophage Colony Stimulating Factor, sargramostim, LEUKINE™), IL-1 1 (Interleukin-1 1, oprelvekin, NEUMEGA®), Interferon alfa-2b (PEG conjugate) (PEG interferon, PEG-INTRON™), and pegfilgrastim (NEULASTA™)), hormone therapy agents (e.g., aminoglutethimide (CYTADREN®), anastrozole (ARIMIDEX®), bicalutamide (CASODEX®), exemestane (AROMAS IN®), fluoxymesterone (HALOTESTIN®), flutamide (EULEXIN®), fulvestrant
(FASLODEX®), goserelin (ZOLADEX®), letrozole (FEMARA®), leuprolide
(ELIGARD™, LUPRON®, LUPRON DEPOT®, VIADUR™), megestrol (megestrol acetate, MEGACE®), nilutamide (ANANDRON®, NILANDRON®), octreotide (octreotide acetate, SANDOSTATIN®, SANDOSTATIN LAR®), raloxifene
(EVISTA®), romiplostim (NPLATE®), tamoxifen (NOVALDEX®), and toremifene (FARESTON®)), phospholipase A2 inhibitors (e.g., anagrelide (AGRYLIN®)), biologic response modifiers (e.g., BCG (THERACYS®, TICE®), and Darbepoetin alfa
(ARANESP®)), target therapy agents (e.g., bortezomib (VELCADE®), dasatinib (SPRYCEL™), denileukin diftitox (ONTAK®), erlotinib (TARCEVA®), everolimus (AFINITOR®), gefitinib (IRESSA®), imatinib mesylate (STI-571, GLEEVEC™), lapatinib (TYKERB®), sorafenib (NEXAVAR®), and SU1 1248 (sunitinib, SUTENT®)), immunomodulatory and antiangiogenic agents (e.g., CC-5013 (lenalidomide,
REVLIMID®), and thalidomide (THALOMID®)), glucocorticosteroids (e.g., cortisone (hydrocortisone, hydrocortisone sodium phosphate, hydrocortisone sodium succinate, ALA-CORT®, HYDROCORT ACETATE®, hydrocortone phosphate LANACORT®, SOLU-CORTEF®), decadron (dexamethasone, dexamethasone acetate, dexamethasone sodium phosphate, DEXASONE®, DIODEX®, HEXADROL®, MAXIDEX®), methylprednisolone (6-methylprednisolone, methylprednisolone acetate,
methylprednisolone sodium succinate, DURALONE®, MEDRALONE®, MEDROL®, M-PREDNISOL®, SOLU-MEDROL®), prednisolone (DELTA -CORTEF®,
ORAPRED®, PEDIAPRED®, PRELONE®), and prednisone (DELTASONE®, LIQUID PRED®, METICORTEN®, ORASONE®)), and bisphosphonates (e.g., pamidronate (AREDIA®), and zoledronic acid (ZOMETA®))
In some embodiments, the AHCM agent is used in combination with a tyrosine kinase inhibitor (e.g., a receptor tyrosine kinase (RTK) inhibitor). Exemplary tyrosine kinase inhibitor include, but are not limited to, an epidermal growth factor (EGF) pathway inhibitor (e.g., an epidermal growth factor receptor (EGFR) inhibitor), a vascular endothelial growth factor (VEGF) pathway inhibitor (e.g., a vascular endothelial growth factor receptor (VEGFR) inhibitor {e.g., a VEGFR-1 inhibitor, a VEGFR-2 inhibitor, a VEGFR-3 inhibitor)), a platelet derived growth factor (PDGF) pathway inhibitor (e.g., a platelet derived growth factor receptor (PDGFR) inhibitor {e.g., a PDGFR-B inhibitor)), a RAF-1 inhibitor, a KIT inhibitor and a RET inhibitor. In some embodiments, the anti- cancer agent used in combination with the AHCM agent is selected from the group consisting of: axitinib (AGO 13736), bosutinib (SKI-606), cediranib (RECENTIN™, AZD2171), dasatinib (SPRYCEL®, BMS-354825), erlotinib (TARCEVA®), gefitinib (IRESSA®), imatinib (Gleevec®, CGP57148B, STI-571), lapatinib (TYKERB®, TYVERB®), lestaurtinib (CEP-701 ), neratinib (HKI-272), nilotinib (TASIGNA®), semaxanib (semaxinib, SU5416), sunitinib (SUTENT®, SU1 1248), toceranib
(PALLADIA®), vandetanib (ZACTIMA®, ZD6474), vatalanib (PTK787, PTK/ZK), trastuzumab (HERCEPTIN®), bevacizumab (AVASTIN®), rituximab (RITUXAN®), cetuximab (ERBITUX®), panitumumab (VECTIBIX®), ranibizumab (Lucentis®), nilotinib (TASIGNA®), sorafenib (NEXAVAR®), alemtuzumab (CAMPATH®), gemtuzumab ozogamicin (MYLOTARG®), ENMD-2076, PCI-32765, AC220, dovitinib lactate (TKI258, CHIR-258), BIBW 2992 (TOVOK™), SGX523, PF-04217903, PF- 02341066, PF-299804, BMS-777607, ABT-869, MP470, BIBF 1 120 (VARGATEF®), AP24534, JNJ-26483327, MGCD265, DCC-2036, BMS-690154, CEP- 1 1981 , tivozanib (AV-951 ), OSI-930, MM-121 , XL-184, XL-647, XL228, AEE788, AG-490, AST-6, BMS-599626, CUDC-101, PD153035, pelitinib (EKB-569), vandetanib (zactima),
WZ3146, WZ4002, WZ8040, ABT-869 (linifanib), AEE788, AP24534 (ponatinib), AV- 951 (tivozanib), axitinib, BAY 73-4506 (regorafenib), brivanib alaninate (BMS-582664), brivanib (BMS-540215), cediranib (AZD2171), CHIR-258 (dovitinib), CP 673451, CYC 1 16, E7080, Ki8751 , masitinib (AB 1010), MGCD-265, motesanib diphosphate (AMG-706), MP-470, OSI-930, Pazopanib Hydrochloride, PD173074,nSorafenib
Tosylate(Bay 43-9006), SU 5402, TSU-68(SU6668), vatalanib, XL880 (GSK 1363089, EXEL-2880). Selected tyrosine kinase inhibitors are chosen from sunitinib, erlotinib, gefitinib, or sorafenib. In one embodiment, the tyrosine kinase inhibitor is sunitinib.
In one embodiment, the AHCM is administered in combination with one of more of: an anti-angiogenic agent, or a vascular targeting agent or a vascular disrupting agent. Exemplary anti-angiogenic agents include, but are not limited to, VEGF inhibitors {e.g., anti-VEGF antibodies {e.g., bevacizumab); VEGF receptor inhibitors (e.g., itraconazole); inhibitors of cell proliferatin and/or migration of endothelial cells (e.g.,
carboxyamidotriazole, TNP-470); inhibitors of angiogenesis stimulators (e.g., suramin), among others. A vascular-targeting agent (VTA) or vascular disrupting agent (VDA) is designed to damage the vasculature (blood vessels) of cancer tumors causing central
necrosis (reviewed in, e.g., Thorpe, P.E. (2004) Clin. Cancer Res. Vol. 10:415-427).
VTAs can be small-molecule. Exemplary small-molecule VTAs include, but are not
limited to, microtubule destabilizing drugs (e.g., combretastatin A-4 disodium phosphate (CA4P), ZD6126, AVE8062, Oxi 4503); and vadimezan (ASA404).
It will be appreciated that anti-tumor antibodies labeled with isotopes have been used successfully to destroy cells in solid tumors, as well as lymphomas/leukemias in animal models, and in some cases in humans. Exemplary radioisotopes include: 90Y, 125I, 1311, l2 I, 1 1 1 In, 105Rh, l 53Sm, 67Cu, 67Ga, 166Ho, l 77Lu, l 86Re and l 88Re. The radionuclides act by producing ionizing radiation which causes multiple strand breaks in nuclear DNA, leading to cell death. The isotopes used to produce therapeutic conjugates typically produce high energy a-or β-particles which have a short path length. Such radionuclides kill cells to which they are in close proximity, for example neoplastic cells to which the conjugate has attached or has entered. They have little or no effect on non-localized cells. Radionuclides are essentially non-immunogenic.
It will also be appreciated that, in accordance with the teachings herein, binding molecules can be conjugated to different radiolabels for diagnostic and therapeutic purposes. To this end the aforementioned U.S. Pat. Nos. 6,682, 134, 6,399,061 , and 5,843,439 disclose radiolabeled therapeutic conjugates for diagnostic "imaging" of tumors before administration of therapeutic antibody. "In2B8" conjugate comprises a murine monoclonal antibody, 2B8, specific to human CD20 antigen, that is attached to 1 " in via a bifunctional chelator, i.e., MX-DTPA (diethylenetriaminepentaacetic acid), which comprises a 1 : 1 mixture of 1-isothiocyanatobenzyl- 3-methyl-DTPA and l -methyl-3-isothiocyanatobenzyl-DTPA. " ' in is particularly preferred as a diagnostic radionuclide because between about 1 to about 10 mCi can be safely administered without detectable toxicity; and the imaging data is generally predictive of subsequent 90Y- labeled antibody distribution. Most imaging studies utilize 5 mCi 1 1 'in-labeled antibody, because this dose is both safe and has increased imaging efficiency compared with lower doses, with optimal imaging occurring at three to six days after antibody administration. See, for example, Murray, J. Nuc. Med. 26: 3328 (1985) and Carraguillo et al., J. Nuc. Med. 26: 67 (1985).
In certain embodiments, the AHCM agent and the additional anti-cancer agent are administered concurrently {e.g., administration of the two agents at the same time or day, or within the same treatment regimen) and/or sequentially (e.g., administration of one agent over a period of time followed by administration of the other agent for a second period of time, or within different treatment regimens).
In one embodiment, the AHCM is administered prior to the anti-cancer agent. In other embodiments, the AHCM is administered prior to the anti-cancer agent, and followed by concurrent administration of the AHCM and the anti-cancer agent.
In certain embodiments, the AHCM agent and the additional anti-cancer agent are administered concurrently. For example, in certain embodiments, the AHCM agent and the additional anti-cancer agent are administered at the same time, on the same day, or within the same treatment regimen. In certain embodiments, the AHCM agent is administered before the additional anti-cancer agent on the same day or within the same treatment regimen.
In certain embodiments, the AHCM agent is concurrently administered with additional anti-cancer agent for a period of time, after which point treatment with the additional anti-cancer agent is stopped and treatment with the AHCM agent continues.
In other embodiments, the AHCM agent is concurrently with the additional anticancer agent for a period of time, after which point treatment with the AHCM agent is stopped and treatment with the additional anti-cancer agent continues.
In certain embodiments, the AHCM agent and the additional anti-cancer agent are administered sequentially. For example, in certain embodiments, the AHCM agent is administered after the treatment regimen of the additional anti-cancer agent has ceased. In certain embodiments, the additional anti-cancer agent is administered after the treatment regimen of the AHCM agent has ceased.
In some embodiments, the AHCM agent and the anti-cancer agent can be administered in a pulse administration. In other embodiments, they can be administered as a pulse-chase administration, e.g., where an AHCM agent is administered for a brief period of time (pulse), followed by administration of an anti-cancer agent for a longer period of time (e.g., chase), or vice versa.
Diagnostic Methods and Assays
AHCM agents can be used to improve diagnosis, treatment, prevention and/or prognosis of cancers in mammals, preferably humans. These diagnostic assays can be performed in vivo or in vitro, such as, for example, on blood samples, biopsy tissue or autopsy tissue. Thus, the invention provides a diagnostic method useful during diagnosis of a cancer, which involves measuring the expression level of target protein or transcript in tissue or other cells or body fluid from an individual and comparing the measured expression level with a standard target expression levels in normal tissue or body fluid, whereby an increase in the expression level compared to the standard is indicative of a disorder.
One embodiment provides a method of detecting the presence of abnormal hyperproliferative cells, e.g., precancerous or cancerous cells, in a fluid or tissue sample, comprising assaying for the expression of the target in tissue or body fluid samples of an individual and comparing the presence or level of target expression in the sample with the presence or level of target expression in a panel of standard tissue or body fluid samples, where detection of target expression or an increase in target expression over the standards is indicative of aberrant hyperproliferative cell growth.
One aspect of the invention is a method for the in vivo detection or diagnosis of a cancer in a subject, preferably a mammal and most preferably a human. In one embodiment, diagnosis comprises: a) administering (for example, parenterally, subcutaneously, or intraperitoneally) to a subject an effective amount of a labeled antibody or fragment thereof against a cancer antigen, to a subject that has been treated with an AHCM or is being treated with the AHCM; b) waiting for a time interval following the administering for permitting the labeled antibody to preferentially concentrate at sites in the subject where target is expressed (and for unbound labeled molecule to be cleared to background level); c) determining background level; and d) detecting the labeled molecule in the subject, such that detection of labeled molecule above the background level indicates that the subject has a particular disease or disorder associated with aberrant expression of target. Background level can be determined by various methods including comparing the amount of labeled molecule detected to a standard value previously determined for a particular system.
It will be understood in the art that the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of, e.g., 99Tc. The labeled binding molecule, e.g., antibody or antibody fragment, will then preferentially accumulate at the location of cells which contain the specific protein. In vivo tumor imaging is described in S. W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S. W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).
Depending on several variables, including the type of label used and the mode of administration, the time interval following the administration for permitting the labeled molecule to preferentially concentrate at sites in the subject and for unbound labeled molecule to be cleared to background level is 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time interval following administration is 5 to 20 days or 7 to 10 days.
Presence of the labeled molecule can be detected in the patient using methods known in the art for in vivo scanning. These methods depend upon the type of label used. Skilled artisans will be able to determine the appropriate method for detecting a particular label. Methods and devices that may be used in the diagnostic methods of the invention include, but are not limited to, computed tomography (CT), whole body scan such as position emission tomography (PET), magnetic resonance imaging (MRI), and sonography, X-radiography, nuclear magnetic resonance imaging (NMR), CAT-scans or electron spin resonance imaging (ESR).
Pharmaceutical Compositions
The compositions described herein can be incorporated into a variety of formulations for administration. More particularly, the compositions can be formulated into pharmaceutical compositions by combination with appropriate, pharmaceutically acceptable carriers or diluents, and can be formulated into preparations in semi-solid, liquid or gaseous forms; such as capsules, powders, granules, gels, slurries, ointments, solutions, suppositories, injections, inhalants and aerosols. As such, administration of the compositions can be achieved in various ways, including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal, intratracheal administration. Moreover, the compositions can be administered in a local rather than systemic manner, in a depot or sustained release formulation.
In addition, the compositions can be formulated with common excipients, diluents or carriers, and compressed into tablets, or formulated as elixirs or solutions for convenient oral administration, or administered by the intramuscular or intravenous routes. The compositions can be administered transdermally, and can be formulated as sustained release dosage forms and the like. Compositions can be administered alone, in combination with each other, or they can be used in combination with other known compounds (discussed herein).
Suitable formulations for use in the present invention are found in Remington's Pharmaceutical Sciences ( 1985). Moreover, for a review of methods for drug delivery, see, Langer ( 1990) Science 249: 1527-1533. The pharmaceutical compositions described herein can be manufactured in a manner that is known to those of skill in the art, e.g., by mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. The following methods and excipients are merely exemplary and are in no way limiting.
For oral administration, the compositions can be formulated by combining with pharmaceutically acceptable carriers that are known in the art. Such carriers enable the compounds to be formulated as pills, capsules, emulsions, lipophilic and hydrophilic suspensions, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated. Pharmaceutical preparations for oral use can be obtained by mixing the compositions with an excipient and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl- cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP).
For administration by inhalation, the compositions for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas, or from propellant-free, dry-powder inhalers. In the case of a pressurized aerosol the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The compositions can be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection can be presented in unit dosage form, e.g., in ampules or in multidose containers, with an added preservative. The compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulator agents such as suspending, stabilizing and/or dispersing agents.
The compositions can also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter, carbowaxes, polyethylene glycols or other glycerides, all of which melt at body temperature, yet are solidified at room temperature.
In addition, the compositions can also be formulated as a depot preparation. Such long acting formulations can be administered by implantation (for example
subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
Lipid particles (e.g., liposomes) and emulsions are known examples of delivery vehicles or carriers for hydrophobic drugs. Long-circulating, e.g., stealth, liposomes can be employed. Such liposomes are generally described in U.S. Pat. No. 5,013,556. The compounds of the present invention can also be administered by controlled release means and/or delivery devices such as those described in U.S. Pat. Nos. 3,845,770; 3,916,899; 3,536,809; 3,598, 123; and 4,008,719.
Pharmaceutical compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in a therapeutically effective amount. The amount of composition administered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician. Determination of an effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. In general, a suitable daily dose of an AHCM agent and/or a cancer therapeutic can be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose can generally depend upon the factors described above.
The subject receiving this treatment is any animal in need, including primates, in particular humans, equines, cattle, swine, sheep, poultry, dogs, cats, mice and rats.
The compounds can be administered daily, every other day. three times a week, twice a week, weekly, or bi-weekly. The dosing schedule can include a "drug holiday," i.e., the drug can be administered for two weeks on, one week off, or three weeks on, one week off, or four weeks on, one week off, etc., or continuously, without a drug holiday. The compounds can be administered orally, intravenously, intraperitoneally, topically, transdermally, intramuscularly, subcutaneously, intranasally, sublingually, or by any other route.
Since the AHCM agents are administered in combination with other treatments (such as additional chemotherapeutics, radiation or surgery) the doses of each agent or therapy can be lower than the corresponding dose for single-agent therapy. The determination of the mode of administration and the correct dosage is well within the knowledge of the skilled clinician.
In one embodiment, the AHCM is administered via an implantable infusion device, e.g., a pump. Implantable infusion devices typically include a housing containing a liquid reservoir which can be filled transcutaneously by a hypodermic needle penetrating a fill port septum. The medication reservoir is generally coupled via an internal flow path to a device outlet port for delivering the liquid through a catheter to a patient body site. Typical infusion devices also include a controller and a fluid transfer mechanism, such as a pump or a valve, for moving the liquid from the reservoir through the internal flow path to the device's outlet port.
Nanoparticles
AHCM agents described herein, the anti-cancer agents {e.g., low molecular weight, mid-molecular weight anti-cancer agents described herein), or both, can be packaged in nanoparticles.
Typically nanoparticles are from 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150 or 200 nm or 200-1 ,000, e.g., 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150, or 200, or 20 or 30 or 50-400 nm in diameter. Smaller particles tend to be cleared more rapidly form the system. Drugs can be intrapped within or coupled, e.g., covalent coupled, or otherwise adhered, to nanoparticles.
Lipid- or oil-based nanoparticles, such as liposomes and solid lipid nanoparticles and can be used to can be used to deliver agents described herein. DOXIL® is an example of a liposomic nanoparticle. Solid lipid nanoparticles for the delivery on anti-cancer agents are descripbed in Serpe et al. (2004) Eur. J. Pharm. Bioparm. 58:673-680 and Lu et al. (20060 Eur. J. Pharm. Sci. 28: 86-95. Polymer-based nanoparticles, e.g., PLGA- based nanoparticles can be used to deliver agents described herein. These tend to rely on biodegradable backbone with the theraeutic agent intercalated (with or without covalent linkage to the polymer) in a matrix of polymer. PLGA is a widely used in polymeric nanoparticles, see Hu et al. (2009) J. Control. Release 134:55-61 ; Cheng et al. (2007) Biomaterials 28:869-876, and Chan et al. (2009) Biomaterials 30: 1627-1634. PEGylated PLGA-based nanoparticles can also be used to deliver anti-cancer agents, see, e.g., Danhhier et al., (2009) J. Control. Release 133: 1 1-17, Gryparis et al (2007) Eur. J.
Pharm. Biopharm. 67: 1-8. Metal-based, e.g., gold-based nanoparticles can also be used to dleiver anti-cancer agents. Protien-based, e.g., albumin-based nanoparticles can be used to deliver agents described herein. E.g., an agent can be bound to nanoparticles of human albumin. An exemplary anti-cancer agent/protein nanoparticle is Abraxane®, in which paclitaxel is pund to nanparticles of albumin.
Nanoparticles can employ active targeting, passive targeting or both. Active targeting can rely on inclusion of a ligand tht binds with a target at or near a preselected site, e.g., a solid tumor. Passive targeting nanoparticles can diffuse and accumalte at sites of interest, e.g., sites characterized by excessivley leaky micorvasculatiure, e.g., as seen in tumors and sites of inflammation.
A broad range of nanoparticles are known in the art. Exemplary approaches include those described in WO2010/005726, WO2010/005723 WO2010/005721, WO2010/121949, WO2010/0075072, WO2010/068866, WO2010/005740,
WO2006/014626, 7,820,788, 7,780,984, the contents of which are incorporated herein in reference by their entirety.
The present invention may be defined in any of the following numbered paragraphs:
1. A method of improving the delivery or efficacy of a cancer therapy, in a subject, comprising:
identifying the subject as being in need of receiving an anti-hypertensive and/or a collagen modifying agent ("AHCM") on the basis of the need for improved delivery or efficacy of the cancer therapy; and either (a), (b), or both:
(a) administering the AHCM to the subject; or
(b) administering the cancer therapy,
wherein the AHCM is administered in a dosage sufficient to improve the delivery or efficacy of the cancer therapy.
2. A method of treating or preventing a cancer, in a subject, comprising: identifying the subject as being in need of receiving an anti-hypertensive and/or a collagen modifying agent ("AHCM") on the basis of the need for improved delivery or efficacy of a cancer therapy; and either (a), (b), or both:
(a) administering the AHCM to the subject; or
(b) administering the cancer therapy,
wherein the AHCM is administered in a dosage sufficient to treat or prevent the cancer.
3. The method of paragraph 1 or 2, which comprises one or more of the following: a) administering the AHCM, the cancer therapy, or both, as an entity having a hydrodynamic diameter of greater than 1 , 5, 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150,
200 nm, but less than 300 nm;
b) the subject has not been administered a dose of the AHCM within 5, 10, 30, 60 or 100 days of the diagnosis of the cancer or the initiation of the AHCM dosing;
c) the subject is not hypertensive, or has been hypertensive, prior to administration of the AHCM;
d) the AHCM is administered at least one, two, three, or five days; or one, two, three, four, five or more weeks, prior to the cancer therapy;
e) the AHCM is administered at least one, two, three, or five days; or one, two, three, four, five or more weeks, prior to the cancer therapy, and concurrently with the cancer therapy, or
f) the AHCM is administered continuously over a period of at least 1, 5, 10, or 24 hours; at least 2, 5, 10, or 14 days; at least 2, 3, 4, 5 or 6 weeks; at least 2, 3, 4, 5 or 6 months; or at least 1 , 2, 3, 4 or 5 years. 4. The method of any of paragraphs 1 -3, wherein the AHCM is chosen from one or more of:
(i) an angiotensin II receptor blocker (AT] blocker),
(ii) an antagonist of renin angiotensin aldosterone system ("RAAS antagonist"),
(iii) an angiotensin converting enzyme (ACE) inhibitor,
(iv) a thrombospondin 1 (TSP-1) inhibitor,
(v) a transforming growth factor beta 1 (TGF-βΙ) inhibitor, or
(vi) a connective tissue growth factor (CTGF) inhibitor. 5. The method of any of paragraphs 1 -4, wherein the AHCM is an AT] inhibitor chosen from one or more of: losartan (COZAAR®), candesartan (ATACAND®), eprosartan mesylate (TEVETEN®), EXP 3174, irbesartan (AVAPRO®), L I 58,809, olmesartan (BENICAR®), saralasin, telmisartin (MICARDIS®), valsartan (DIOVAN®), or a derivative thereof.
6. The method of any of paragraphs 1-5, wherein the AHCM is losartan.
7. The method of any of paragraphs 1 -6, wherein the AHCM is a RAAS antagonist chosen from one or more of: aliskiren (TEKTURNA®, RASILEZ®), remikiren (Ro 42-5892), enalkiren (A-64662), SPP635, or a derivative thereof.
8. The method of any of paragraphs 1 -7, wherein the AHCM is an ACE inhibitor chosen from one or more of: benazepril (LOTENSIN®), captopril (CAPOTEN®), enalapril (VASOTEC®), fosinopril (MONOPRIL®), lisinopril (PRINIVIL®,
ZESTRIL®), moexipril (UNIVASC®), perindopril (ACEON®), quinapril
(ACCUPRIL®), ramipril (ALTACE®), trandolapril (MAVIK®), or a derivative thereof.
9. The method of any of paragraphs 1-8, wherein the AHCM is a TSP-1 inhibitor chosen from one or more of: ABT-510, CVX-045, LSKL, or a derivative thereof.
10. The method of paragraph 4, wherein the TGF-βΙ inhibitor is chosen from one or more of: an anti- TGF-βΙ antibody, or a TGF- β 1 peptide inhibitor. 1 1. The method of paragraph 4, wherein the CTGF inhibitor is chosen from one or more of: DN-9693, FG-3019, or a derivative thereof.
12. The method of any of paragraphs 1 -1 1 , wherein the AHCM is administered in an amount sufficient to enhance the distribution or efficacy of the cancer therapy.
13. The method of any of paragraphs 1 -12, wherein the AHCM is administered at a dose that causes one or more of: decreases the level or production of collagen, decreases tumor fibrosis, increases interstitial tumor transport, improves tumor perfusion, or enhances penetration or diffusion, of the cancer therapy in a tumor or tumor vasculature, in the subject.
14. The method of any of paragraphs 1-13, wherein the AHCM is losartan, and is administered at 25- 100 mg day"1.
15. The method of any of paragraphs 1 -14, wherein the AHCM is losartan, and is provided in a dosage form of 12.5 mg, 25 mg, 50 mg or 100 mg. 16. The method of any of paragraphs 1-15, wherein the AHCM is losartan, and is administered at a sub-anti-hypertensive dose ranging from 0.25 to 17.5, 0.5 to 15, 1.3 to 12, 1.5 to 12, 2 to 12, 2 to 10, 2 to 5, 2 to 3 mg day"1, or 2 mg day"1.
17. The method of any of paragraphs 1-16, wherein the AHCM is losartan, and is administered at a dose that is greater than 1.1, 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dose for anti-hypertensive or anti-heart failure use.
18. The method of any of paragraphs 1-17, wherein the AHCM is administered as a first course of treatment with an AHCM at a sub-anti-hypertensive dose followed by a second course of treatment with the AHCM that is at or above a standard hypertensive dose.
19. The method of any of paragraphs 1-18, wherein the AHCM is administered as an entity having a hydrodynamic diameter of greater than 1, 5, 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150, 200 nm, but less than 300 nm.
20. The method of paragraph 19, wherein the AHCM is administered as a polymeric nanoparticle or a lipid nanoparticle. 21. The method of of any of paragraphs 1 -20, wherein the cancer therapy is a cancer therapeutic that is administered as an entity having a hydrodynamic diameter of greater than 1, 5, 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150, 200 nm, but less than 300 nm. 22. The method of paragraph 21, wherein the cancer therapeutic is administered as a polymeric nanoparticle or a lipid nanoparticle.
23. The method of any of paragraphs 1 -22, wherein the AHCM, or the cancer therapeutic, each independently, is provided as an entity having the following size ranges (in nm): a hydrodynamic diameter of less than or equal to 1, or between 0.1 and 1.0 nm; a hydrodynamic diameter of between 5 and 20, or 5 and 15 nm; or a hydrodynamic diameter of 1, 5, 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150, 200 nm, but less than 300 nm.
24. The method of any of paragraphs 1-23, wherein the subject has one or more of:
(i) does not have hypertension,
(ii) is not being treated for hypertension, at the time of initiation of the AHCM treatment; or
(iii) has normal or low blood pressure.
25. The method of any of paragraphs 1 -24, wherein the subject has not been administered the AHCM within 5, 10, 30, 60 or 100 days of the diagnosis of cancer or the initiation of the AHCM dosing.
26. The method of any of paragraphs 1 -25, wherein the subject is in need of, or is being considered for, cancer therapy. 27. The method of any of paragraphs 1-26, which comprises the step of determining if the subject has a cancer, and, responsive to said determination, administering the AHCM and the cancer therapy.
28. The method of any of paragraphs 1-27, wherein the subject is at risk of having, or has a solid, fibrotic tumor.
29. The method of paragraph 28, wherein the subject has a pre-neoplastic condition or a pre-disposition to cancer. 30. The method of any of paragraphs 1 -29, wherein the cancer is chosen from one or more of pancreatic, breast, colorectal, lung, skin, ovarian, prostate, cervix,
gastrointestinal, stomach, head and neck, kidney, or liver cancer, or a metastatic lesion thereof.
31. The method of any of paragraphs 1-30, wherein the AHCM is administered prior to and/or in combination with the cancer therapy.
32. The method of any of paragraphs 1 -31 , wherein the cancer therapy is chosen from one or more of anti-cancer agents, surgery and/or radiation.
33. The method of any of paragraphs 1 -32, wherein the AHCM is administered at least one, two, three, or five days; or one, two, three, four, five or more weeks, prior to the cancer therapy.
34. The method of any of paragraphs 1-33, wherein the AHCM is maintained for a preselected portion of the time the subject receives cancer therapy.
35. The method of any of paragraphs 1 -34, wherein the AHCM is maintained for the entire period in which the cancer therapy is administered.
36. The method of any of paragraphs 1-35, wherein the AHCM is administered continuously over a period of at least 1, 5, 10, or 24 hours; at least 2, 5, 10, or 14 days; at least 2, 3, 4, 5 or 6 weeks; at least 2, 3, 4, 5 or 6 months; or at least 1 , 2, 3, 4 or 5 years.
37. The method of any of paragraphs 1-36, wherein the AHCM is administered as a sustained release formulation.
38. The method of any of paragraphs 1 -37, wherein the AHCM is formulated for oral, subcutaneus or intravenous continuous delivery.
39. The method of any of paragraphs 1 -38, wherein the AHCM is administered via a subcutaneous pump, an implant or a depot. 40. The method of any of paragraphs 1-39, wherein the cancer therapy is chosen from one or more of:
(i) a cancer therapeutic chosen from a viral cancer therapeutic agent, a lipid nanoparticle of an anti-cancer therapeutic agent, a polymeric nanoparticle of an anticancer therapeutic agent, an antibody against a cancer target, a dsRNA agent, an antisense RNA agent, or a chemotherapeutic agent;
(ii) radiation,
(iii) surgery, or
(iv) any combination of (i)-(iii).
41. The method of paragraph 40, wherein the lipid nanoparticle is chosen from pegylated liposomal doxorubicin (DOXIL®) or liposomal paclitaxel {e.g., Abraxane®).
42. The method of paragraph 40, wherein the chemotherapeutic agent is chosen from gemcitabine, cisplatin, epirubicin, 5-fluorouracil, paclitaxel, oxaliplatin, or leucovorin.
43. The method of paragraph 40, wherein the antibody against the cancer target is chosen from an antibody against HER-2/neu, HER3, VEGF, or EGFR.
44. The method of any of paragraphs 1-39, wherein the cancer therapy is a tyrosine kinase inhibitor chosen from sunitinib, erlotinib, gefitinib, sorafenib, icotinib, lapatinib, neratinib, vandetanib, BIBW 2992 or XL-647, or an anti-EGFR antibody chosen from cetuximab, panitumumab, zalutumumab, nimotuzumab necitumumab or matuzumab.
45. The method of paragraph 40, wherein the chemotherapeutic agent is a cytotoxic or a cytostatic agent.
46. The method of paragraph 40 or 45, wherein the chemotherapeutic agent is chosen from an antimicrotubule agent, a topoisomerase inhibitor, a taxane, an antimetabolite, a mitotic inhibitor, an alkylating agent, or an intercalating agent. 47. The method of any of paragraphs 1-46, wherein the cancer therapy is chosen from one of more of: an anti-angiogenic agent, or a vascular targeting agent or a vascular disrupting agent. 48. The method of any of paragraphs 1 -47, wherein the AHCM or the cancer therapy is administered to the subject by a systemic administration chosen from oral, parenteral, subcutaneous, intravenous, rectal, intramuscular, intraperitoneal, intranasal, transdermal, or by inhalation or intracavitary installation. 49. The method of any of paragraphs 1-48, further comprising monitoring the subject, for a change in one or more of:
tumor size;
the level or signaling of one or more of transforming growth factor beta 1 (TGFpl), connective tissue growth factor (CTGF), or thrombospondin-1 (TSP-1);
tumor collagen I levels;
fibrotic content,
interstitial pressure;
a plasma or serum biomarker chosen from collagen I, collagen III, collagen IV, TGF i , CTGF, or TSP-1 ;
levels of one or more cancer markers;
the rate of appearance of new lesions, metabolism, hypoxia evolution;
the appearance of new disease-related symptoms;
the size of tissue mass;
amount of disease associated pain;
histological analysis, lobular pattern, and/or the presence or absence of mitotic cells; or
tumor aggressivity, vascularization of primary tumor, or metastatic spread.
49. A pharmaceutical composition comprising a nanoparticle comprising an AHCM.
50. A pharmaceutical composition comprising a nanoparticle comprising an AHCM and a cancer therapeutic agent. 51. The pharmaceutical composition of paragraph 50, wherein the cancer therapeutic is chosen from a viral cancer therapeutic agent, a lipid nanoparticle of an anticancer agent, a polymeric nanoparticle of an anti-cancer agent, an antibody against a cancer target, a dsRNA agent, an antisense RNA agent, or a chemotherapeutic agent.
52. The pharmaceutical composition of any of paragraphs 49-51, wherein the nanoparticle is a polymeric nanoparticle or a lipid nanoparticle. 53. The pharmaceutical composition of any of paragraphs 49-51 , wherein the
AHCM is formulated in a dosage form that is according to the standard of care dosage form for anti-hypertensive or anti-heart failure use of the AHCM.
54. The pharmaceutical composition of any of paragraphs 49-51 , wherein the AHCM is formulated in a dosage form that is less than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1 , 0.15, 0.16, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7-fold, that of the standard of care dosage form for anti-hypertensive or anti-heart failure use of the AHCM.
55. The pharmaceutical composition of any of paragraphs 49-51, wherein the AHCM is formulated in a dosage form that is greater than 1.1, 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dosage form for anti-hypertensive or anti-heart failure use of the AHCM.
56. A dosage form of an AHCM, wherein the AHCM is formulated in a dosage form that is less than 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1 , 0.15, 0.16,
0.2, 0.3, 0.4, 0.5, 0.6, 0.7-fold, that of the standard of care dosage form for antihypertensive or anti-heart failure use of the AHCM.
57. A dosage form of an AHCM, wherein the AHCM is formulated in a dosage form that is greater than 1.1, 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dosage form for anti-hypertensive or anti-heart failure use of the AHCM.
58. A method optimizing access to a cancer, or optimizing delivery to a cancer of an agent, e.g., a diagnostic or imaging agent, comprising: administering an anti-hypertensive and/or a collagen modifying agent ("AHCM") to the subject; and
optionally, administering the agent to said subject, wherein the method comprises one or more of the following:
a) the diagnostic or imaging agent has a hydrodynamic diameter of greater than 1 , 5, or 20-1 50 nm;
b) the agent is a radiologic agent, an NMRA agent, a contrast agent; or c) the subject is treated with a dosing of AHCM administration, whic is initiated prior to administration of the agent for at least two, three, or five days, or one, two, three, four, five or more weeks prior to administration of the agent.
59. A method, or assay for, identifying an anti-hypertensive and/or a collagen modifying (AHCM), comprising:
contacting a cancer or cancer-associated cell with a candidate agent;
detecting a change in the cancer cell in the presence, or absence, of the candidate agent, wherein the detected change includes one or more of: an increase or decrease of activated TGF beta, TGF beta 1 level, connective tissue growth factor (CTGF) level, or collagen (e.g., collagen 1) level.
60. The method, or assay, of paragraph 59, wherein the candidate agent is chosen from one or more of: an antagonist of renin angiotensin aldosterone system ("RAAS antagonist"), an angiotensin converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (AT] blocker), a thrombospondin 1 (TSP-1 ) inhibitor, a transforming growth factor beta 1 (TGF-β Ι) inhibitor, or a connective tissue growth factor (CTGF) inhibitor.
61. The method, or assay, of paragraph 59 or 60, wherein the candidate agent reduces one or more of: activated TGF beta, TGF i level, connective tissue growth factor (CTGF) level, or collagen level.
62. The method, or assay, of any of paragraphs 59-61, further comprising the step of comparing the treated methods or assays to a reference value, and comparing the difference between the treated and the reference value. 63. The method, or assay, of any of paragraphs 59-62, which is carried out in vitro, in vivo, or a combination of both.
64. The method, or assay, of any of paragraphs 59-63, comprising evaluating the candidate agent in vitro by adding the candidate agent to the culture medium; and the condition medium is analyzed for an increase or decrease of: activated TGF beta, TGF i level, connective tissue growth factor (CTGF) level, or collagen level.
65. The method, or assay, of any of paragraphs 59-64, comprising administering the candidate agent to an animal tumor model; and analyzing the subject for an increase or decrease of: activated TGF beta, TGFpi level, connective tissue growth factor (CTGF) level, or collagen level.
66. A composition for use, or the use, of an anti-hypertensive and/or a collagen modifying (AHCM), alone or in combination with a cancer therapeutic for the treatment of a cancer.
67. A therapeutic kit comprising an anti-hypertensive and/or a collagen modifying (AHCM), alone or in combination with a cancer therapeutic, and instructions for use for the treatment of cancer.
68. A diagnostic kit comprising an anti-hypertensive and/or a collagen modifying (AHCM), alone or in combination with an imaging agent, and instructions for use for the diagnosis of cancer.
69. A method of selecting a subject for receiving an anti-hypertensive and/or a collagen modifying agent ("AHCM"), comprising:
selecting the subject as being in need of receiving the AHCM on the basis of the need for improved delivery or efficacy of the cancer therapy; and either (a), (b), or both:
(a) administering the AHCM to the subject; or
(b) administering the cancer therapy,
wherein the AHCM is administered in a dosage sufficient to improve the delivery or efficacy of the cancer therapy. EXAMPLES
The invention now being generally described, it will be more readily understood by reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention.
In Examples 1-6 below, the inventors assessed if an AHCM agent, for example, losartan - a clinically approved angiotensin II receptor antagonist generally for treatment of hypertension - can enhance the penetration and efficacy of nanomedicine, e.g., via an anti-fibrotic effect. Although nanotherapeutics have offered new hope for cancer treatment, their clinical efficacy is modest (Jain RK, et al. (2010) Nat Rev Clin Oncol 7:653-664; Davis ME, et al. (2008) Nat Rev Drug Discov 7:771-782; Peer D, et al. (2007) Nat Nanotechnol 2:751-760; and Torchilin VP (2005) Nat Rev Drug Discov 4: 145-160). Without wishing to be bound by theory, the dense collagen network in tumors can generally reduce the penetration and efficacy of nanotherapeutics. This is partly because their penetration is hindered specially in fibrotic tumors where the small interfibrillar spacing in the interstitium retards the movement of particles larger than 10 nanometers (Netti PA, et al. (2000) Cancer Res 60:2497-2503; Pluen A, et al. (2001) Proc Natl Acad Sci USA 98:4628-4633; Ramanujan S, et al. (2002) 5/o/>/^ J 83: 1650- 1660 and Brown E, et al. (2003) Nat Med 9:796-800). Pegylated liposomal doxorubicin (DOXIL®), approved by the FDA, and oncolytic viruses, currently in multiple clinical trials, represent two nanotherapeutics whose size (~ 100 nm) hinders their intratumoral distribution and therapeutic effectiveness (Nemunaitis J, et al. (2001 ) J Clin Oncol 19:289-298). Matrix modifiers like bacterial collagenase, relaxin, and matrix
metalloproteinase - 1 and -8 have been used to modify the collagen or proteoglycan network in tumors and have improved the efficacy of intratumorally (i.t.) injected oncolytic viruses (Brown E, et al. (2003) Nat Med 9:796-800; McKee TD, et al. (2006) Cancer Res 66:2509-2513; Mok W, et al. (2007) Cancer Res 67: 10664-10668; Ganesh S, et al. (2007) Cancer Res 67:4399^1407; and Kim J-H, et al. (2006) J Natl Cancer Inst 98: 1482-1493). In addition, relaxin can improve transport through the tumor matrix, but may not facilitate the delivery of low molecular weight agents (US 6,719,977). However, these agents may produce normal tissue toxicity (e.g., bacterial collagenase) or increase the risk of tumor progression (e.g., relaxin, matrix metalloproteinases). Losartan (Johnston CI (1995) Lancet 346: 1403-1407) - approved to control hypertension in patients - does not have many of these safety risks. Furthermore, in addition to its antihypertensive properties, losartan is also an antifibrotic agent that has been shown to reduce the incidence of cardiac and renal fibrosis (Habashi JP, et al. (2006) Science 312: 1 17-121 ; and. Cohn RD, et al. (2007) Nat Med 13:204-210). The antifibrotic effects of losartan are caused, in part, by the suppression of active transforming growth factor-βΐ (TGF-βΙ) levels via an angiotensin II type I receptor (AGTR1) mediated down-regulation of TGF-βΙ activators like thrombospondin-1 (TSP- 1 ) (Habashi JP, et al. (2006) Science 312: 1 17-121 ; Cohn RD, et al. (2007) Nat Med 13:204-210; Lavoie P, et al. (2005) J Hypertens 23: 1895-1903; Chamberlain JS (2007) Nat Med 13: 125-126; and Dietz HC (2010) J Clin Invest 120:403-407).
As demonstrated below, an AHCM agent, e.g., losartan inhibited collagen I production by carcinoma associated fibroblasts (CAFs) isolated from breast cancer biopsies. Additionally, an AHCM agent, e.g., losartan, led to a dose-dependent reduction in stromal collagen in desmoplastic models of human breast, pancreatic and skin tumors in mice. Furthermore, an AHCM agent, e.g., losartan improved the distribution and therapeutic efficacy of intratumorally injected oncolytic herpes simplex viruses (HSV). Further, an AHCM agent, e.g., losartan also enhanced the efficacy of intravenously injected pegylated liposomal doxorubicin (DOXIL®). Accordingly, administration of an AHCM agent, e.g., losartan, in combination with a cancer therapeutic (e.g., a cancer nanotherapeutic) can enhance the efficacy of nanotherapeutics in patients with desmoplastic tumors.
Using a dose that has minimal effects on mean arterial blood pressure (MABP), the inventors have shown below that an AHCM agent, e.g., losartan reduces collagen I levels in four tumor models - a spontaneous mouse mammary carcinoma (FVB MMTV PyVT), an orthotopic pancreatic adenocarcinoma (L3.6pl), and subcutaneously implanted fibrosarcoma (HSTS26T) and melanoma (Mu89). Further, the inventors have shown below that an AHCM agent, e.g., Losartan, can also improve the intratumoral penetration of nanoparticles injected intratumorally (i.t.) or intravenously (i.v.).
Additionally, the inventors assessed how an AHCM agent, e.g., losartan, can affect the distribution and efficacy of oncolytic HSV administered i.t. - a widely used method of administration in patients for gene therapy (Hu JC, et al. (2006) Clin Cancer Res 12:6737-6747; Senzer NN, et al. (2009) J Clin Oncol 27:5763-5771 ; Breitbach CJ, et al. (2010) Cytokine Growth Factor Rev 21 :85-89) - and the efficacy of i.v.- administered DOXIL®. As shown below, an AHCM agent, e.g., Losartan, improved the efficacy of both i.t.-injected oncolytic HSV and i.v.-administered, DOXIL®. The results from the intratumoral (i.t.) experiments indicate that an AHCM agent, e.g., losartan, can enhance nanoparticle penetration in the interstitial space by improving interstitial transport. Additionally, the findings from the intravenous (i.v.) studies indicate that an AHCM agent (e.g., losartan) can improve the efficacy of systemically administered nanotherapeutics to fibrotic solid tumors, even highly fibrotic solid tumors, such as pancreatic adenocarcinomas. Accordingly, an AHCM agent, e.g., losartan, an FDA approved antihypertensive drug, can be used to improve the efficacy of various nanotherapeutics in multiple tumor types.
Example 1: Losartan inhibits collagen I synthesis by carcinoma associated fibroblasts (CAFs)
The effect of losartan on the expression and activation of TGF-βΙ, and collagen I production by mammary CAFs was examined (Fig. 1). Losartan reduces TGF-βΙ activation and collagen I production in carcinoma associated fibroblasts in vitro. Cells were treated with 10 μπιοΙ/L of losartan for 24 hrs. Losartan reduced by 90% the active- TGF-βΙ levels while total TGF-βΙ levels were unaffected. There was a corresponding 27% decrease in collagen I levels. The reduction in active-TGF-βΙ and collagen I was statistically significant (student t-test p<0.05). Since collagen in tumors is mostly produced by CAFs, the effect of losartan in the collagen content in tumors was examined.
Example 2: Losartan decreases collagen I in tumors in a dose-dependent manner
To determine the dose-response of losartan on intratumoral collagen levels, 10, 20, and 60 mg/kg/day of losartan were injected intraperitoneally (i.p.), and performed second harmonic generation (SHG) imaging of fibrillar collagen in HSTS26T tumors in dorsal skin fold chambers (Figs. 2A-2B) and collagen I immunostaining of tumor sections (Figs. 3A-3D). While the SHG signal intensity can include signals contributed from collagen I and other fibril-forming collagens (e.g., collagen III or V), collagen I is generally the predominant collagen type in most soft tissues (Gelse K, et al. (2003) Adv Drug Deliv Rev 55: 1531-1546), and thus contributes as the main source of the SHG signal. Additionally, in human pancreatic tumors collagen I is the main fibrillar collagen with significantly lower levels of collagen V (Mollenhauer J, et al. (1987) Pancreas 2: 14-24). Losartan doses of 20 and 60 mg/kg/day significantly reduced the intratumoral SHG signal intensity, whereas the lowest dose of 10 mg/kg/day did not have a significant effect on the SHG signal intensity (Figs. 2A and 2B). The injection of losartan at 60 and 20 mg/kg/day also significantly reduced the collagen I immunostaining in HSTS26T tumors by 65% and 42%, respectively (Fig. 3). Treatment with the 60mg/kg/day dose led to the highest reduction in collagen I, with a reduction in the mean arterial blood pressure (MABP) by 35 mm Hg (p<0.04; Fig. 4). In the following Examples, 20 mg/kg/day dose was used (but it by no means limits the use of other doses in the methods described herein). After 2 weeks of losartan treatment, the 20 mg/kg/day dose reduced the MABP by 10 mm Hg (Fig. 4), thus maintaining the MABP within the normal range (70 - 95 mmHg) for SCID mice ( ristjansen PE, et al. (1993) Cancer Res 53:4764-4766). It also had no detectable effect on mouse weight (average of 26±lg treated vs. 26±lg control). The 20mg/kg/day dose decreased collagen I immunostaining in four tumor types - FVB MMTV PyVT, L3.6pl, HSTS26T, and Mu89 - by 47% (p<0.05), 50% (p<0.03), 44% (p<0.04), and 20% (p<0.02), respectively (Figs. 5A-5D).
Example 3: Losartan decreases TSP-1 expression in tumors
TSP-1 is a key regulator of TGF-βΙ activation and losartan has been reported to reduce TSP-1 expression and TGF-βΙ activation in mouse models of Marian's syndrome and muscular dystrophy (Dietz HC (2010) J Clin Invest 120:403-407). As shown herein, the measurement of protein levels in homogenized HSTS26T tumors showed that losartan did not affect total TGF-βΙ levels but significantly reduced TSP-1, active TGF-βΙ, and collagen I levels (Fig. 6). Losartan also decreased the TSP-1 immunostaining in
HSTS26T (73% p<0.04) and Mu89 (24% p<0.03) (Figs. 7A-7B). In both Mu89 and HSTS26T tumors the immunostaining patterns for TSP-1 (Figs. 7A-7B) and collagen I (Figs. 5C-5D) were closely matched. The inventors detected high levels of TSP-1 and collagen I in the tumor margin, while losartan induced obvious reductions in TSP-1 and collagen I levels in the tumor center (Figs. 5C, 7A). These data indicate that the reduction in collagen I levels can result in part from the decreased activation of TGF-βΙ due to the losartan-induced reduction in TSP- 1 expression. Example 4: Losartan improves the intratumor distribution of nanopar icles and nanotherapeutics
Based on the previous studies on the tumor interstitial matrix (Pluen A, et al. (2001) Proc Natl Acad Sci USA 98:4628-4633 and Brown E, et al. (2003) Nat Med 9:796-800), the inventors then sought to determine if a decrease in collagen content by Losartan can improve the intratumoral distribution of nanoparticles. The inventors therefore measured the intratumoral distribution of fluorescent polystyrene nanoparticles (100 nm diameter) in three different tumor types - HSTS26T, Mu89, and L3.6pl - after an i.t. or i.v. injection. In mice injected i.t. with nanoparticles, losartan improved nanoparticle accumulation and penetration in the tumor center (Fig. 8A; HSTS26T p<0.001, Mu89 pO.001). Conversely, there was little or no nanoparticle accumulation in the center of control tumors. Most of the injected nanoparticles in control tumors were found in the tumor margin and around the needle insertion point (Fig. 8A). The inventors also determined the effects of losartan on the intratumoral distribution of oncolytic HSV. In both HSTS26T and Mu89, losartan significantly increased the intratumoral spread of HSV injected intratumorally (Fig. 8B). While these findings show that losartan increases the distribution of large nanoparticles, the inventors also determined that in HSTS26T, losartan increased interstitial diffusion of IgG (Fig. 9) and the mean interstitial matrix pore radius - from 9.91±0.43nm to 1 1.78±0.41 nm, calculated based on IgG diffusion data (Nugent LJ, et al. (1984) Cancer Res 44:238-244).
The inventors then assessed the effect of losartan on blood vessel perfusion and the intratumoral distribution of i.v. injected nanoparticles in mice with orthotopic pancreatic tumors (L3.6pl). The intratumoral accumulation and penetration of beads away from blood vessels was significantly higher in losartan-treated tumors (Fig. 8C and Fig. 10). These results indicate that losartan improves the transport and distribution of both i.t. and/or i.v. injected nanoparticles.
Example 5; Losartan improves the efficacy of DOXIL® and oncolytic HSV
The inventors then determined if losartan could improve the efficacy of i.t.
injected oncolytic HSV and i.v. injected DOXIL®. The effect of losartan combined with the i.t. injection of HSV was determined in HSTS26T and Mu89 tumors. The
administration of losartan alone did not affect the tumor growth rate (Figs. 11A and 11B). However, when animals were treated with losartan for two weeks before i.t. injection of HSV, losartan significantly delayed the growth in both Mu89 and HSTS26T tumors (Figs. 11 A and 11B). The volume of HSTS26T tumors remained stable for up to 9 weeks in 50% of mice treated with losartan and HSV. For the Mu89 tumors, mice treated with losartan and HSV had a delay in tumor growth. However, the growth delay in Mu89 tumors was only transient, 4 weeks after the virus injection all the tumors were 3-fold larger than the starting treatment size.
To determine if losartan could increase the efficacy of a nanotherapeutic injected i.v., mice with orthotopic pancreatic tumors (L3.6pl) were treated with DOX1L® and losartan. Four weeks after tumor implantation and two weeks after initiation of losartan treatment (20mg/kg/day), the inventors treated mice with a sub-anti-tumor dose (i.e., a dose that is not effective for treatment of cancer, e.g., a dose that is not effective to inhibit or prevent tumor growth and/or progression) of DOXIL® (4mg/kg, i.v.). After 7 days, losartan or DOXIL alone did not affect the mean tumor weight (Fig. 11C). However, in mice treated with losartan and DOXIL® the tumors were significantly smaller (p<0.001) than in mice that received DOXIL® alone (Figs. 11C and 11D).
Example 6: The pattern of collagen distribution regulates the effectiveness of losartan
To investigate the differences in response between HSTS26T and Mu89 to the losartan-HSV combination therapy, the inventors determined the HSV infection and necrosis patterns 21 days after the i.t. injection of HSV. Figs. 12A and 12B show striking differences between the collagen structure in Mu89 (Fig. 12A) and HSTS26T (Fig. 12B) tumors, respectively. Without wishing to be bound by theory, these differences in the collagen structure altered the virus propagation in these tumor types. In Mu89 tumors the collagen fiber network was well organized and formed finger-like projections into the tumor (Figs. 12A and 13A). These projections divided the tumor into distinct
compartments, which could not be crossed by HSV particles, thus the virus infection and resulting necrosis was restricted to the infected compartments (Fig. 14A). Losartan treatment disrupted the collagen projections to some extent but did not completely eliminate them (Fig. 12A). As a result, there was some crossover of virus particles between compartments in losartan-treated Mu89 tumors. By varying Losartan and/or HSV concentration the amount or extent of collagen projections to be disrupted (e.g., partial or complete disruption) can be modulated, and thus in turn affect the distribution of the HSV particles within the tumor. In contrast, in HSTS26T tumors the dense collagen network was more diffuse, less fibrillar and less compartmentalized (Figs. 12B and 13B). The dense collagen network seemed to slow down virus propagation but did not completely impede it, resulting in increased virus propagation and a more diffuse pattern of necrosis in this tumor (Fig. 14A). Discussion
The renin-angiotensin-aldosterone system (RAAS) has been reported to play a role in the regulation and production of extracellular matrix components (Cook KL, et al. (2010) Cancer Res 70:8319-8328; Rodriguez-Vita J, et al. (2005) Circulation 1 1 1 :2509- 2517; and Wolf G (2006) Kidney Int 70: 1914-1919). Angiotensin II has been reported to stimulate collagen production via both TGF-βΙ dependent and independent pathways (Yang F, et al. (2009) Hypertension 54:877-884). Losartan and other RAAS inhibitors have reported to reduce the levels of collagen I and III, and basement membrane collagen IV in various experimental models of fibrosis (Toblli JE, et al. (2002) J Urol 168: 1550- 1555 and Boffa JJ, et al. (2003) J Am Soc Nephrol 14: 1 132-1 144), and reverse renal and cardiac fibrosis in hypertensive patients (Lim DS, et al. (2001) Circulation 103:789-791 and halil A, et al. (2000) J Urol 164: 186-191). Using four different tumor types, the inventors have demonstrated herein for the first time that losartan also inhibits collagen I production in tumors.
Other matrix modifiers like bacterial collagenase, relaxin, and matrix
metalloproteinase - 1 and -8 have been reported to modify the collagen or proteoglycan network in tumors and have improved the efficacy of oncolytic virus injected
intratumorally (Brown E, et al. (2003) Nat Med 9:796-800; McKee TD, et al. (2006) Cancer Res 66:2509-2513; Mok W, et al. (2007) Cancer Res 67: 10664-10668; Ganesh S, et al. (2007) Cancer Res 67:4399-4407; and Kim J-H, et al. (2006) J Natl Cancer Inst 98: 1482-1493). However, these agents may produce normal tissue toxicity (e.g., bacterial collagenase) or increase the risk of tumor progression (e.g. relaxin, matrix
metalloproteinases). In contrast, losartan (Johnston CI ( 1995) Lancet 346: 1403-1407) has limited side effects. Losartan has been reported to reduce the incidence of metastasis in some tumor types (Arafat HA, et al. (2007) J Am Coll Surg 204:996-1005).
As shown in the Examples above, an AHCM agent, e.g., losartan, can reduce collagen content and in turn improve interstitial transport and the intratumoral distribution of nanoparticles and nanotherapeutics. The inventors also discovered that the organization of the collagen fibrillar network can affect nanoparticle distribution. This was striking because of significant differences in the structural organization of fibrillar collagen I between Mu89 and HSTS26T. In Mu89 tumors, thick bundles of fibrillar collagen I surround the tumor margins and form finger-like projections, which subdivide the tumor mass into isolated compartments and confine the viral infection to the injection site / isolated compartments (Figs. 12A and 13A). In contrast HSTS26T tumors have a meshlike collagen structure, which hinders the virus spread but does not restrict viral particles to the injection site (Figs. 12B and 13B). The slower growth rate of HSTS26T than Mu89 tumors could also explain in part the enhanced efficacy of losartan combined with HSV in HSTS26T tumors. Accordingly, not only the collagen content but also the collagen network organization plays an important role in limiting the penetration of large therapeutics in tumors. Depending on the content and/or organization of the collagen network within certain tumors, doses, administration methods and/or frequency of an AHCM agent (e.g., losartan) and/or a cancer therapeutic (e.g., HSV) can be adjusted accordingly.
Pancreatic cancer patients treated with cytotoxic agents have a very high frequency of relapse with a 5 year survival of less than 5% (Li J, et al. (2010) AAPS J 12:223-232). The poor vascular supply and increased fibrotic content of pancreatic tumors most likely play a significant role in limiting the delivery and efficacy of cytotoxics (Olive P, et al. (2009) Science 324: 1457-1461 ). The inventors show - in a mouse orthotopic model of human pancreatic cancer (L3.6pl) - that losartan increases both the intratumoral dispersion and extravascular penetration distance of i.v. injected nanoparticles. The increased distribution and extravasation of nanoparticles indicate that losartan can not only improve interstitial transport - as shown with the i.t. injections of nanoparticles and virus - but also transvascular transport. When used alone, losartan did not affect the growth of pancreatic tumors or the weight of treated mice. However, losartan combined with DOXIL® reduced the tumor sizes by 50% compared to DOXIL® treatment alone. These findings indicate that losartan increased the tumor penetration and distribution, and enhanced efficacy of DOXIL® injected i.v. in orthotopic pancreatic carcinomas in mice.
The effects of losartan are not limited to the interstitial space. Modifications to the
RAAS system can also inhibit angiogenesis (Fujita M, et al. (2005) Carcinogenesis 26:271-279) or alter tumor blood flow (Jain R, et al. (1984) IEEE Trans Son Ultrason 31 :504-526 and Zlotecki RA, et al. (1993) Cancer Res 53:2466-2468). Losartan- blockade of AGTR1 can also reduce the production of VEGF by cancer cells and the expression of VEGFR1 in endothelial cells, and inhibit tumor angiogenesis and growth (Otake AH, et al. (2010) Cancer Chemother Pharmacol 66:79-87 and Noguchi R, et al. (2009) Oncol Rep 22:355-360). As shown herein, losartan did not affect tumor growth or the vascular density in HSTS26T tumors. Losartan can also reduce the proliferation of tumor cells expressing AGTR1 (Rhodes DR, et al. (2009) Proc Natl Acad Sci USA
106: 10284-10289). The inventors did not find a decrease in cancer cell proliferation (Fig. 15) or tumor size in the human melanoma Mu89, which express AGTR1 (Fig. 16). The difference between their study and other prior studies might be due to differences in dosage. For example, in prior studies the dose of losartan was up to 15 fold higher than what was used in the inventors' study (Otake AH, et al. (2010) Cancer Chemother
Pharmacol 66:79-87). The inventors have shown herein that a low dose of losartan that is ineffective for treatment of cancer by itself alone, can be used to improve the efficacy of a cancer therapy or an anti-cancer agent (even at a sub-therapuetic level) for treatment of cancer. Further, the low dose of losartan can allow for a more clinically translatable protocol and avoid hypotensive complications.
Patients receiving RAAS antagonists have reduced incidence of breast and lung cancer (Lever AF, et al. (1998) Lancet 352: 179-184). Different mechanisms have been reported to discuss the anti-tumor properties of RAAS antagonists when used at high concentrations (Ager EI, et al. (2008) Carcinogenesis 29: 1675-1684; Lindberg H, et al. (2004) Acta Oncol 43: 142-152; Miyajima A, et al. (2002) Cancer Res 62:4176-4179 and Rosenthal T, et al. (2009) J Hum Hypertens 23:623-635). AGTR1 signaling has been reported to increase the proliferation of stromal and tumor cells, and the transcription of inflammatory cytokines and chemokines that promote cancer cell migration and dissemination (Deshayes F, Nahmias C (2005) Endocrinol Metab 16:293-299). The reduction in active TGF-Bl levels by RAAS antagonists administered at high
concentrations have been reported to reduce metastasis (Jakowlew SB (2006) Cancer Metastasis Rev 25:435^157). Accordingly, in addition to improving the delivery of antitumor agents, losartan can also inhibit tumor progression and metastasis. By way of example only, losartan administered at a low dose (e.g., a dose not effective to reduce or prevent metastasis if administered alone) with an anti-metatstic agent (e.g., at a dose less than what is typically administered by itself for treatment and/or prevention of metastasis) can be used to inhibit tumor progression and metastasis.
In order to use losartan as an adjunct in the treatment of cancer patients it is important to consider dosing and treatment schedules along with potential side effects. Results from the dose and time dependent studies presented herein indicate a minimum of two weeks of losartan administration prior to anti-tumor treatment. To obtain maximum effects in patients, it might be prudent to initiate losartan treatment two weeks prior to and continue it during the entire antitumor treatment schedule. Since long-term losartan therapy in hypertensive patients has been shown to have limited and manageable side effects and many antitumor agents (e.g., anti-VEGF drugs) have been shown to increase blood pressure (Ager EI, et al. (2008) Carcinogenesis 29: 1675-1684), extended losartan co-therapy can be beneficial to cancer patients. In some embodiments, patients can be treated with a dose of 2mg/kg/day losartan, which is generally used for the treatment of patients with Marfan's syndrome (Brooke BS, et al. (2008) N Engl J Med 358:2787- 2795).
Although losartan and ARBs have limited side effects, losartan therapy is not recommended for patients with known renal disease. Losartan can induce renal insufficiency in patients with renal microvascular or macrovascuiar disease, or congestive heart failure (Sica DA, et al. (2005) Clin Pharmacokinet 44:797-814). Hyperkalemia can also occur in patients with poor renal function or patients who are concomitantly receiving potassium supplements or potassium sparing diuretics. Finally, angioedema caused by high levels of circulating angiotensin II can occur in patients treated with losartan (Sica DA, et al. (2005) Clin Pharmacokinet 44:797-814).
Tumor drug resistance is generally believed to occur at many levels including increased drug efflux, drug inactivation, evasion from apoptosis, and alterations in target pathways (Longley DB, et al. (2005) J Pathol 205:275-292). Since losartan is not an antitumor agent, tumor resistance to losartan therapy after extended treatment can result from other mechanisms. Given that TGF-Bl activation is induced by different agents like MMPs and integrins in addition to TSP-1 , tumor resistance to losartan could result from changes in TGF-βΙ activation and signaling. However, long-term losartan therapy after myocardial infarction has been reported as not being associated with a reduction in antifibrotic properties (Schieffer B, et al. (1994) Circulation 89:2273-2282).
As shown in Examples 1-6, the inventors show that losartan reduces the stromal collagen content in tumors and improves the penetration and therapeutic efficacy of nanoparticles (DOXIL®, HSV) delivered both i.t. and i.v. Losartan also exhibits vasoactive and anti-metastatic properties that could increase its clinical application. Furthermore, since losartan is already approved for clinical use, it represents a safe and effective adjunct for improving the efficacy of nanotherapeutics in cancer patients. Exemplary Experimental Protocols for Examples 1-6
Exemplary Materials and Methods
A more detailed description of techniques is presented in the Additional Materials and Methods section below.
Briefly, CAFs isolated from human breast cancer biopsies were treated with losartan for 24 hrs prior to measurements of collagen and cytokine levels. Protein assays were done with commercial ELISA kits. All animal experiments were done with approval of the Institutional Animal Care and Use Committee. Losartan was administered i.p. at concentrations of 10, 20 or 60 mg/kg/day for up to 2 weeks. Mice were treated with HSV (i.t.) and DOXIL® (i.v. via tail vein) after 2 weeks of losartan treatment. Excised tumors were either snap frozen for biochemical analyses or fixed in paraformaldehyde, and embedded in paraffin or optimum cutting temperature compound (OCT) for
immunohistochemistry. Additional Materials and Methods:
Cell culture
CAFs were isolated from human breast cancer biopsies using an art-recognized protocol, e.g., the protocol described in Orimo A, et al. (2005) Cell 121 :335-348. CAFs were plated in 24 well plates at a concentration of 500K cells/well. Cells were allowed 24 hrs to adhere to the plates before the addition of losartan at 10 μηιο1/1 for 24 hrs (Schuttert JB, et al. (2003) Pflugers Arch 446:387-393). Treatment was done in low serum to reduce background collagen levels. Conditioned medium was collected at the end of the 24-hr treatment period and analyzed for collagen levels. Protein assays
Collagen I measurements were done with a type I C-terminal collagen propetide Enzyme Linked Immunosorbent Assay (ELISA) kit (Quidel, San Diego, CA) and the Sircol soluble collagen assay (Biocolor Ltd., United Kingdom). TGF-βΙ assays were performed with a human TGF-βΙ ELISA kit (R&D Systems, Minneapolis, MN). The assay only measures the free-form of mature TGF-β Ι . To measure total levels of TGF-βΙ the latent form of TGF-β Ι was activated with IN HC1. TSP-1 assays were performed with a human TSP-1 ELISA kit (R&D Systems, Minneapolis, MN). Mice and tumor models
All experiments were done with approval of the Institutional Animal Care and Use Committee. Human soft tissue sarcoma (HSTS26T) and human melanoma (Mu89) tumors were grown subcutaneously in the legs and dorsal skin fold chamber of severe combined immunodeficient (SCID) mice (Leunig M, et al. (1992) Cancer Res 52:6553— 6560). Human pancreatic adenocarcinoma cells (L3.6PL) were grown orthotopically in the pancreas of SCID mice. L3.6PL tumors were induced with a sub-capsular injection of one million cells in the tail of the pancreas. Tumor sizes were monitored in spontaneous FVB -Tg(MMTV-PyVT) 634MU1/J mice and tumors selected for treatment when they reached a size of 4 to 6 mm in diameter (Guy CT et al. ( 1992) Mol Cell Biol 12:954-961).
Losartan preparation and treatment
Cozaar (losartan potassium) tablets were ground using a mortar and pestle. The powder was then dissolved in water to obtain a concentration of 2.5 mg/ml. The solution was then filtered and stored in a sterile container. Losartan was administered by daily i.p. injections at a concentration of 10, 20 or 60 mg/kg/day for up to 2 weeks (Melo LG, et al. (1999) Am J Physiol 277:R624-R630).
Tissue collection, embedding and staining
Tumors for immunostaining analysis and quantification were harvested from mice, fixed in 4% paraformaldehyde, and embedded in paraffin or optimum cutting temperature compound (OCT) (Sakura Finetek Torrance, CA). OCT embedded tumors were soaked in sucrose solution for 24 hrs prior to embedding and freezing. Collagen I and TSP-1 immunostaining staining in frozen sections
Frozen sections were cut into 10 μηι sections for immunohistochemistry and imaging. Collagen I was detected using the LF-67 antibody ( 1 : 100 dilution) with a previously described protocol (Znati CA, et al. (2003) Clin Cancer Res 9:5508-5513). TSP- 1 was detected with a goat anti-human antibody (1 :50 dilution), which cross-reacts with mice (sc-12312, Santa Cruz Biotechnology Inc., Santa Cruz, CA). For collagen and TSP- 1 analysis, images at 20x magnification were taken randomly from each slide. The collagen and TSP-1 content was determined by measuring the number of pixels above a threshold value that was set based on the average intensity value of pixels from all slides under analysis. The background-signal intensity for both collagen I and thrombospondin- 1 immunostaining was low and uniform. The inventors confirmed that the average signal intensity threshold lead to an accurate representation of the collagen and thrombospondin- 1 immunostaining and did not include the background signal. Second Harmonic Imaging of Collagen Fibers
Second Harmonic Imaging (SHG) imaging was performed in dorsal chamber tumors with a custom-built multiphoton laser-scanning microscope (Brown E, et al. (2003) Nat Med 9:796-800). Polarized light from a Ti:Sapphire laser (Mai-Tai
Broadband: Spectra-Physics, Mountain View, CA) was converted to circularly polarized light using a zero order quarter wave plate (Newport Corporation, Irvine, CA). An excitation wavelength of 810 nm and detected SHG signals at 405 nm was used. SCID mice bearing HSTS26T tumors in dorsal chambers were either treated with losartan (10, 20 or 60 mg/kg/day) or saline for the duration of the dose response experiment (15 days). Vascular markers were used to locate 4 regions of interest in each mouse and periodically returned to the same region of SHG imaging. SHG images were analyzed with a custom- built Matlab (The Math Works, Inc., Natick, MA) code. The fraction of the region of interest (ROI) that was positive for the SHG signal was normalized to the amount of SHG signal obtained on day 1 of the dose response study (before initiation of losartan or saline treatment).
Analysis of HSV infection and nanoparticle distribution
Intratumoral injection: Nanoparticles and oncolytic HSV were infused with a syringe pump (Harvard Apparatus Standard Pump 22, Holliston, Massachusetts) at a flow rate of 4 μΐ / min. The inventors injected 10 μΐ of HSV (2.5 x 105 t.u.) expressing the green fluorescent protein (GFP), or 10 μΐ of fluorescent nanoparticles (diameter of 100 μιη; concentration of lxl 013 nanoparticles / ml). The injected tumors were resected 30 min after the nanosphere injection and 24 hrs after the HSV infusion. Resected tumors were bisected at an angle perpendicular to the needle track, fixed in paraformaldehyde and frozen in OCT. All tumor sections were obtained perpendicular to the angle of the needle track. The entire tumor section was imaged with a confocal microscope (Olympus BX61 WI) at 2x and images were reconstituted as mosaics. The nanosphere distribution and GFP-positive areas (HSV infected cells) corresponds to the fraction of pixels brighter than the background signal. Intravenous injection: A total volume of 10 μΐ at a concentration of 3.6 x 10 nanoparticles / ml was injected via the tail vein. Twenty-four hrs later 50 μΐ of FITC- lectin was injected to identify functional vessels. Five min after the lectin-injection tumors were resected, fixed in paraformaldehyde and embedded in OCT. Tumors were then sectioned before confocal imaging and analysis. The extent of nanosphere distribution was determined by measuring the fraction of pixels brighter than the background signal. Nanosphere penetration was determined by drawing contours around perfused vessels and recording the fraction of pixels positive for nanospheres in each contour. Contours extended out to 30 μπι for each perfused vessel. Using a previously described algorithm (Tong RT, et al. (2004) Cancer Res 64:3731-3736), the inventors fit the plot of nanosphere fraction and distance away from the vessel to an exponential and obtained a relative penetration depth of nanospheres from each vessel.
Diffusion measurements by fluorescence recovery after photobleaching
Mice with HSTS26T tumors implanted in a dorsal skin fold chamber were treated with i.p. injections of losartan (40mg/kg/day) for 1 week. Fluorescence recovery after photobleaching (FRAP) measurements were done with a custom built multiphoton microscope based on a previously described protocol (Chauhan VP, et al. (2009) Biophys J 97:330-336). IgG labeled fluorescein isothiocyanate (0.5 ml; 2mg/ml) was injected i.t. and used as the tracer. Diffusion was measured by multiphoton FRAP (MP-FRAP) and spatial Fourier analysis FRAP (SFA-FRAP) about 10 min after the injection. Matrix pore sizes were calculated using the SFA-FRAP data, using the equation
D _ 1 - 2.105 1 + 2.0865Λ8 - 1.706βΛ8 + 0.72603/ '
£>o 1 - 0.75857Λ5 , where D is the diffusion coefficient for the probe molecule in the tumor, Do is its diffusion coefficient in water, and λ is the ratio of the probe hydrodynamic radius to the pore radius (Nugent LJ, et al. (1984) Microvasc Res 28:270-274).
Analysis of HSV infection, necrosis and collagen structure
To determine the relationship between virus infection, necrosis and collagen structure 21 days after the HSV injection, consecutive paraffin sections were stained with either a polyclonal HSV-1 antibody (DAKO, Glostrup Denmark) or a collagen I antibody (LF-67). For collagen I staining in paraffin sections, slides were treated with 3% hydrogen peroxide prior to antigen retrieval with Target Retrieval Solution, pH 9 (DAKO, Carpinteria, CA). The slides were then treated with 0.05% trypsin before the primary collagen I antibody was applied at a dilution of 1 :500. Sections stained with collagen I or HSV were imaged with a light microscope. PCR Analysis
RNA was extracted using an RNeasy mini kit (Qiagen, Valencia, CA) and converted to cDNA using an RT2 first strand kit (SuperArray Biosciences Corporation, Frederick, MD). The cDNA quality and concentration were measured with an ND-200 Spectrophotometer ( anodrop Technologies, Wilmington, DE). For the PCR reaction, cDNA from all samples were standardized to 1μ§ μ1. The reaction was performed with a HotStarTaq Plus DNA Polymerase (Qiagen, Valencia, CA). For AGTR1 primers, the inventors used: forward primer- GTCCCGCCTTCGACGCACAA (SEQ ID NO: 1), reverse primer- GGGGCGGTAGGAAAGCGTGC (SEQ ID NO: 2). Ki67 staining, imaging and analysis
i67 staining was done on paraffin sections 21 days after HSV injection. Slides were microwave processed with Target Retrieval Solution (DAKO, Carpinteria, CA) prior to primary antibody detection. The entire tumor section was imaged at 2x magnification and reconstituted as a mosaic. Twenty regions were randomly selected in each tumor. The fraction of Ki67 positive cells in each region was determined by manual count.
DOXIL® treatment and tumor growth delay
Two weeks after the implantation of orthotopic pancreatic L3.6PL tumors, mice were randomly selected for losartan or saline treatment. A sub-anti-tumor dose of
DOXIL® (4 mg/kg) was infused i.v. via the tail vein after two weeks of losartan treatment (20 mg/kg/day). One week after the DOXIL injection, the tumors were resected and measured. Virus treatment and tumor growth delay
Scid mice bearing subcutaneous HSTS26T and MU89 tumors were randomly divided into control and losartan treated groups. Each arm (control and treated) was subsequently divided into HSV treated and non-HSV treated groups. Tumors that had reached 60 mm3 after two weeks were selected for i.t. HSV injections. Tumors were treated with 10 μΐ i.t. injections of either PBS or 2.5 x 105 transducing units (t.u.) of oncolytic HSV MGH2 (gift from E. Antonio Chiocca, Ohio State University, Columbus, OH). Two i.t. injections of oncolytic HSV separated by 24 hrs were administered. The injections were done with a Harvard Apparatus Standard Pump 22 infusion/withdraw syringe pump system (Holliston, Massachusetts) at a flow rate of 4 μΐ / min. Tumors were measured every 2 to 3 days. Tumor volume was estimated as: V=AB2/2, where V is the tumor volume; A and B are the maximum and minimum diameters of the tumor as measured with calipers. Statistics
All the animal experiments were conducted with at least 6 mice in each treatment arm. The tumor growth delay studies in HSTS26T and MU89 tumors were done with at least 8 mice in each group. The rational for the number of mice used was based on power calculations in the inventors' previous studies (McKee TD, et al. (2006) CancerRes 66:2509-2513 and Mok W, et al. (2007) Cancer Res 67: 10664-10668), which showed that the inventors needed at least 8 mice in each group to reach statistical significance
(p<0.05). All statistical analyses involving two groups were done using a Student's t-test.
A p-value lower than 0.05 was considered significant. For multiple groups, a one-way
Anova test followed by a Tuskey's post-hoc test was used to determine statistical significance between groups. Statistical significance in figures is identified by an asterix ^»*»^
Example 7: Angiotensin blockade improves drug delivery by normalizing the tumor microenvironment
Advances in biomedical research have led to the introduction of several novel systemically-administered molecular and nanotherapeutics in both preclinical and clinical settings (Jones, D. (2007) Nat Rev Drug Discov 6, 174-175; Moghimi, S. M. et al. (2005) Faseb J 19, 31 1-330). While these new agents act on unique targets that afford greater specificity to tumor cells or improved pharmacodynamic properties, their effectiveness suffers from limitations in their delivery owing to the properties of the tumor
microenvironment (Jain, R. . {\99 ) Nat Med 4, 655-657; Sanhai, W. R. et al. (2008) Nat Nanotechnol 3, 242-244). Growth-induced mechanical forces compress and collapse blood vessels limiting tumor perfusion, while abnormal vasculature leads to
heterogeneous drug extravasation. A third determinant of delivery - interstitial transport through tissues - is particularly hindered for nanomedicine in tumors by an abnormally dense and tortuous tumor interstitium (Jain, R. K. & Stylianopoulos (2010) Nat Rev Clin Oncol. 139; Chauhan, V. P. et al. (2009) Biophysical journal 97, 330-336). These barriers impact therapy, particularly, for patients with desmoplastic, fibrotic tumors, including pancreatic (Olive, . P. et al. (2009) Science 324, 1457-1461 ), colorectal (Halvorsen, T. B. & Seim, E. ( 1989) J Clin Pathol 42, 162- 166), lung and breast cancer (Ronnov-Jessen, L. et al. (1996) Physiol Rev 76, 69-125) - limiting the amount of drug that reaches the target cancer cells leading to poor effectiveness. Currently, there are limited approaches to overcome these delivery barriers for nanotherapeutics and low molecular weight drugs. Previously, the inventors discovered that relaxin can improve transport through the tumor matrix, but may not facilitate the delivery of low MW agents (B. Seed and R. K. Jain. "Methods to Potentiate Cancer Therapies", Patent number US 6,719,977, April 13, 2004.)
Presented herein is a class of FDA-approved agents that can normalize the tumor microenvironment and improve delivery of both low and high molecular weight drugs. Specifically, the inventors showed that angiotensin blockade "normalizes" interstitial matrix in solid tumors, including breast and pancreatic tumors (Fig. 17A). The inventors assessed whether FDA-approved angiotensin receptor blockers (ARBs) and angiotensin converting enzyme inhibitors (ACE-ls), through this mechanism, can alter the tumor microenvironment to enhance drug delivery. The inventors also determined that ARBs and ACE-ls can decompress blood vessels to improve perfusion (Figs. 17B-17D), increase tumor hydraulic conductivity to repair vessel function (Fig. 18B), and decrease interstitial matrix density to enhance penetration of nanotherapeutics (Fig. 18D). These agents improve delivery of molecules as small as oxygen - a radiation and chemo sensitizer - through vascular normalization (Figs. 18A-18B), while also enhancing the penetration of larger agents through interstitial matrix normalization (Figs. 18C-18D). Through this repair of the entire tumor microenvironment, these agents enhance the effectiveness of low molecular weight chemotherapeutics as well as nanotherepeutics in breast and pancreatic cancer models - leading to reduced tumor growth and longer animal survival (Figs. 19A-19E). The inventors showed that ARBs and ACE-ls can enhance the delivery of therapeutics, and thus have broad applicability for combination therapy with all classes of anti-cancer agents including small-molecule chemotherapeutics, biologies, and nanoparticle therapies. Angiotensin blockers offer numerous advantages over other approaches. Anti- angiogenic therapies normalize the vasculature alone and have been approved for only a limited number of indications. Meanwhile, ARBs and ACE-Is are FDA-approved as antihypertensives with manageable adverse effects. Matrix-degrading enzymes, which can normalize the collagen matrix, are not selective for tumors and can increase invasion and metastasis. ARBs and ACE-Is generally have no complications associated with matrix remodeling in normal tissues, leading to their safety as anti-hypertensives. ARBs and ACE-Is, as small-molecule agents, can also be delivered via nanovectors containing chemotherapeutics (e.g., liposomes, nano-particles) to enhance their localization to tumors to further limit toxicity. Anti-angiogenics, the only FDA-approved adjuncts that enhance drug delivery to tumors, generally cannot improve delivery for larger particles as they can reduce the size of "pores" in vessel walls. On the contrary, angiotensin blockers presented herein can improve delivery for all classes of anti-tumor diagnostics and therapies.
Example 8: In vitro screen to identify anti-hypertensive agents to lower collagen in solid tumors
This Example provides an assay to rank anti-hypertensive (AH) agents based on their ability to lower collagen I level in tumors.
Since most collagen I is produced by carcinoma-associated fibroblasts (CAFs), a skilled artisan can measure the level of collagen I - along with its molecular determinants
[active-TGF-βΙ, thrombospondin 1 (TSP1) and connective tissue growth factor (CTGF)]
- in the supernanants of CAFs after AH treatment.
For example, the inventors determined that losartan reduced TGF-β 1 activation and collagen I production in breast CAFs in vitro. Cells were treated with 10 μιηοΙ/L of losartan for 24 hrs. Losartan reduced by 90% the active-TGF-βΙ levels (p<0.05), while total TGF-βΙ levels were unaffected. There was a corresponding 27% decrease in collagen I levels (p<0.05). (See Fig. 1). Exemplary Experimental design:
Anti-hypertensive agents: Any FDA-approved angiotensin receptor blockers (ARBs) can be tested. Exemplary names and doses of these agents can be found via, but not limited to, http://www.globa^h.com/druglist.htm. Although angiotensin converting enzyme inhibitors (ACEIs) also lower collagen, they do not target the receptor on cells and hence the inventors did not measure their effects on collagen I. Calcium channel blockers can also be evaluated for the collagen lowering effects.
Cell culture
Isolate carcinoma-associated fibroblasts (CAFs) from human cancer biopsies using a previously described protocol ( Orimo A, et al. (2005) Cell 121(3):335-348). CAFs should be plated in 24 well plates at a concentration of 500K cells/well and allowed 24 hrs to adhere to the plates before the addition of anti-hypertensive drug. For example, all the losartan studies were performed at 10 μιηο[/1 for 24 hrs, based on a published protocol (Schuttert JB, et al. (2003) Pflugers Arch 446(3):387-393). Treatment can be done in low serum to reduce background collagen levels. Conditioned medium can be collected at the end of the 24-hr treatment period and analyzed for total and activated TGF-βΙ , TSP-1 , CTGF and collagen levels.
Protein assays
In the losartan study (Schuttert JB, et al. (2003) Pflugers Arch 446(3):387-393), Collagen I measurements were done with a type I C-terminal collagen propetide Enzyme Linked Immunosorbent Assay (ELISA) kit (Quidel, San Diego, CA) and the Sircol soluble collagen assay (Biocolor Ltd., United Kingdom). TGF-βΙ assays were performed with a human TGF-βΙ ELISA kit (R&D Systems, Minneapolis, MN). The assay only measures the free-form of mature TGF-βΙ . To measure total levels of TGF-βΙ the latent form of TGF-β Ι was activated with IN HCI. TSP-1 assays were performed with a human TSP- 1 ELISA kit (R&D Systems, Minneapolis, MN). CTGF ELISA kit can be purchased from Leinco (www.leinco.com).
Protocol Summary:
Isolate or purchase carcinoma associated fibroblasts (CAFs) from breast, pancreatic, and colon carcinomas;
Co-culture CAFs and cancer cells in media containing angiotensin I and ACE; Treat CAFs for 48 hrs with, for example, 6 doses of an AGTR1 or ACE inhibitor; Collect supernatant and measure TGFpl, connective tissue growth factor (CTGF), thrombospondin 1, and/or collagen I by ELISA. ELISA measurements should be repeated 3 times or more. Additional exemplary testing:
a) Confirm in vitro findings in vivo in a limited number of tumor models.
b) Identify the features of the AH that make them more effective modifiers of collagen to screen for new AHs. Example 9: Combination of angiotensin blockade with inhibition of alternate profibrotic pathways to improve drug delivery to tumors
The inventors have discovered that normalization of the interstitial matrix through angiotensin signaling blockade improves drug delivery, at least partly, through two mechanisms: it relaxes the inherent compressive force in tumors to improve vessel perfusion, and it reduces the viscoelastic and steric hindrance on drug transport directly imparted by the matrix. Angiotensin signaling blockade can safely inhibit activation of the profibrotic TGF-beta and CTGF pathways downstream to produce these changes. In some embodiments, partnering angiotensin blockers with inhibitors of profibrotic pathways that are independent of TGF-beta and CTGF activation - including endothelin- 1 , PDGF, Wnt/beta-catenin, IGF-1, TNF-alpha, and IL-4 -can enhance these effects, further improving drug delivery and effectiveness. For example, endothelin receptor blockers (ERBs) and PDGF inhibitors (PDGF-Is) can be used in combination with angiotensin blockers. ERBs treat pulmonary arterial hypertension and can be used as a class of therapy for cancer (Nelson et al. (2003) Nature Reviews Vol. 3: 1 10-1 16), for example with angiotensin blockers. PDGF-Is haven been reported for their potential anti- vascular effects in tumors (Baluk et al. (2005) Current Opinion in Genetics &
Development 15: 102-1 1 1, Andrae et al. (2008) Genes & Development 22: 1276-1312). Endothelin blockade has been reported to reduce fibrogenesis in the liver (Binder et al. (2009) Mol. Cancer Ther. 8:2452-2460), lung (Park et al. (1997) Am J. Respir Crit Care Med Vol. 156:600-608), and heart through inhibition of TGF-beta synthesis (Ogata et al. (2002) Clinical Science 103 (Suppl. 48):284S-288S), and has been reported to reduce tumor progression and metastasis in tumor models (Nelson et al. supra; Binder et al. supra). Meanwhile, PDGF inhibition have been reported to prevent fibrogenesis in idiopathic pulmonary fibrosis and scleroderma (Grimminger et al. (2010) Nature Reviews Vol. 9:956-970; Andrae et al. (2008) Genes & Development 22: 1276-1312), and the inventors have determined that it can reduce collagen levels in tumors (data not shown). ERBs have been reported to be well-tolerated with a potential to improve overall survival in prostate cancer (James et al. (2009) European Urology 55: 1 1 12-1 123) and non-small cell lung cancer (Chiappori et al. (2008) Clin Cancer Res 14: 1464-1469). Accordingly, the combination of an angiotensin blockade with endothelin-1 and/or PDGF blockade - with careful dosing - should produce an additive improvement to drug delivery with minimal additional toxicity. In some embodiments, endothelin-1 and/or PDGF blockade can be used at a sub-therapuetic dose in combination with an angiotensin blockade, which can be used at a sub-anti-hypertensive dose and/or sub-anti-tumor dose, for improved drug delivery and/or treatment of cancer.
EQUIVALENTS
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
SEQUENCE LISTING:
GTCCCGCCTTCGACGCACAA (SEQ ID NO: 1) GGGGCGGTAGGAAAGCGTGC (SEQ ID NO: 2)

Claims

CLAIMS What is claimed is:
1. A method of improving the delivery or efficacy of a cancer therapy, in a subject, comprising:
identifying the subject as being in need of receiving an anti-hypertensive and/or a collagen modifying agent ("AHCM") on the basis of the need for improved delivery or efficacy of the cancer therapy; and either (a), (b), or both:
(a) administering the AHCM to the subject; or
(b) administering the cancer therapy,
wherein the AHCM is administered in a dosage sufficient to improve the delivery or efficacy of the cancer therapy.
2. A method of treating or preventing a cancer, in a subject, comprising:
identifying the subject as being in need of receiving an anti-hypertensive and/or a collagen modifying agent ("AHCM") on the basis of the need for improved delivery or efficacy of a cancer therapy; and either (a), (b), or both:
(a) administering the AHCM to the subject; or
(b) administering the cancer therapy,
wherein the AHCM is administered in a dosage sufficient to treat or prevent the cancer.
3. The method of claim 1 or 2, which comprises one or more of the following: a) administering the AHCM, the cancer therapy, or both, as an entity having a hydrodynamic diameter of greater than 1 , 5, 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150, 200 nm, but less than 300 nm;
b) the subject has not been administered a dose of the AHCM within 5, 10, 30, 60 or 100 days of the diagnosis of the cancer or the initiation of the AHCM dosing;
c) the subject is not hypertensive, or has been hypertensive, prior to administration of the AHCM;
d) the AHCM is administered at least one, two, three, or five days; or one, two, three, four, five or more weeks, prior to the cancer therapy;
e) the AHCM is administered at least one, two, three, or five days; or one, two, three, four, five or more weeks, prior to the cancer therapy, and concurrently with the cancer therapy, or f) the AHCM is administered continuously over a period of at least 1 , 5, 10, or 24 hours; at least 2, 5, 10, or 14 days; at least 2, 3, 4, 5 or 6 weeks; at least 2, 3, 4, 5 or 6 months; or at least 1 , 2, 3, 4 or 5 years.
4. The method of claim 3, wherein the AHCM is chosen from one or more of.
(i) an angiotensin II receptor blocker (ATi blocker),
(ii) an antagonist of renin angiotensin aldosterone system ("RAAS antagonist"),
(iii) an angiotensin converting enzyme (ACE) inhibitor,
(iv) a thrombospondin 1 (TSP-1 ) inhibitor,
(v) a transforming growth factor beta 1 (TGF-βΙ) inhibitor, or
(vi) a connective tissue growth factor (CTGF) inhibitor.
5. The method of claim 3, wherein the AHCM is an ATi inhibitor chosen from one or more of: losartan (COZAAR®), candesartan (ATACAND®), eprosartan mesylate (TEVETEN®), EXP 3174, irbesartan (AVAPRO®), LI 58,809, olmesartan
(BENICAR®), saralasin, telmisartin (MICARDIS®), valsartan (DIOVAN®), or a derivative thereof.
6. The method of claim 3, wherein the AHCM is losartan.
7. The method of claim 3, wherein the AHCM is a RAAS antagonist chosen from one or more of: aliskiren (TEKTURNA®, RASILEZ®), remikiren (Ro 42-5892), enalkiren (A-64662), SPP635, or a derivative thereof.
8. The method of claim 3, wherein the AHCM is an ACE inhibitor chosen from one or more of: benazepril (LOTENSIN®), captopril (CAPOTEN®), enalapril
(VASOTEC®), fosinopril (MONOPRIL®), lisinopril (PRINIVIL®, ZESTRIL®), moexipril (UNIVASC®), perindopril (ACEON®), quinapril (ACCUPRIL®), ramipril (ALT ACE®), trandolapril (MAVI ®), or a derivative thereof.
9. The method of claim 3, wherein the AHCM is a TSP- 1 inhibitor chosen from one or more of: ABT-510, CVX-045, LS L, or a derivative thereof.
10. The method of claim 3, wherein the TGF-β Ι inhibitor is chosen from one or more of: an anti- TGF-βΙ antibody, or a TGF- β 1 peptide inhibitor.
1 1. The method of claim 3, wherein the CTGF inhibitor is chosen from one or more of: DN-9693, FG-3019, or a derivative thereof.
12. The method of claim 4, wherein the AHCM is administered in an amount sufficient to enhance the distribution or efficacy of the cancer therapy.
13. The method of claim 4, wherein the AHCM is administered at a dose that causes one or more of: decreases the level or production of collagen, decreases tumor fibrosis, increases interstitial tumor transport, improves tumor perfusion, or enhances penetration or diffusion, of the cancer therapy in a tumor or tumor vasculature, in the subject.
14. The method of claim 3, wherein the AHCM is losartan, and is administered at 25-100 mg day" 1.
15. The method of claim 3, wherein the AHCM is losartan, and is provided in a dosage form of 12.5 mg, 25 mg, 50 mg or 100 mg.
16. The method of claim 3, wherein the AHCM is losartan, and is administered at a sub-anti-hypertensive dose ranging from 0.25 to 17.5, 0.5 to 15, 1.3 to 12, 1.5 to 12, 2 to 12, 2 to 10, 2 to 5, 2 to 3 mg day"1, or 2 mg day"1.
17. The method of claim 3, wherein the AHCM is losartan, and is administered at a dose that is greater than 1.1 , 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dose for anti-hypertensive or anti-heart failure use.
18. The method of claim 4, wherein the AHCM is administered as a first course of treatment with an AHCM at a sub-anti-hypertensive dose followed by a second course of treatment with the AHCM that is at or above a standard hypertensive dose.
19. The method of claim 4, wherein the AHCM is administered as an entity having a hydrodynamic diameter of greater than 1, 5, 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150, 200 nm, but less than 300 nm.
20. The method of claim 19, wherein the AHCM is administered as a polymeric nanoparticle or a lipid nanoparticle.
21. The method of of claim 4, wherein the cancer therapy is a cancer therapeutic that is administered as an entity having a hydrodynamic diameter of greater than 1 , 5, 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150, 200 nm, but less than 300 nm.
22. The method of claim 21, wherein the cancer therapeutic is administered as a polymeric nanoparticle or a lipid nanoparticle.
23. The method of claim 4, wherein the AHCM, or the cancer therapeutic, each independently, is provided as an entity having the following size ranges (in nm): a hydrodynamic diameter of less than or equal to 1 , or between 0.1 and 1.0 nm; a hydrodynamic diameter of between 5 and 20, or 5 and 15 nm; or a hydrodynamic diameter of 1, 5, 10, 15, 20, 25, 30, 35, 45, 50, 75, 100, 150, 200 nm, but less than 300 nm.
24. The method of claim 4, wherein the subject has one or more of:
(i) does not have hypertension,
(ii) is not being treated for hypertension, at the time of initiation of the AHCM treatment; or
(iii) has normal or low blood pressure.
25. The method of claim 4, wherein the subject has not been administered the AHCM within 5, 10, 30, 60 or 100 days of the diagnosis of cancer or the initiation of the AHCM dosing.
26. The method of claim 4, wherein the subject is in need of, or is being considered for, cancer therapy.
27. The method of claim 4, which comprises the step of determining if the subject has a cancer, and, responsive to said determination, administering the AHCM and the cancer therapy.
28. The method of claim 4, wherein the subject is at risk of having, or has a solid, fibrotic tumor.
29. The method of claim 28, wherein the subject has a pre-neoplastic condition or a pre-disposition to cancer.
30. The method of claim 4, wherein the cancer is chosen from one or more of pancreatic, breast, colorectal, lung, skin, ovarian, prostate, cervix, gastrointestinal, stomach, head and neck, kidney, or liver cancer, or a metastatic lesion thereof.
31. The method of claim 4, wherein the AHCM is administered prior to and/or in combination with the cancer therapy.
32. The method of claim 31, wherein the cancer therapy is chosen from one or more of anti-cancer agents, surgery and/or radiation.
33. The method of claim 32, wherein the AHCM is administered at least one, two, three, or five days; or one, two, three, four, five or more weeks, prior to the cancer therapy.
34. The method of claim 32, wherein the AHCM is maintained for a preselected portion of the time the subject receives cancer therapy.
35. The method of claim 34, wherein the AHCM is maintained for the entire period in which the cancer therapy is administered.
36. The method of claim 4, wherein the AHCM is administered continuously over a period of at least 1 , 5, 10, or 24 hours; at least 2, 5, 10, or 14 days; at least 2, 3, 4, 5 or 6 weeks; at least 2, 3, 4, 5 or 6 months; or at least 1, 2, 3, 4 or 5 years.
37. The method of claim 4, wherein the AHCM is administered as a sustained release formulation.
38. The method of claim 4, wherein the AHCM is formulated for oral, subcutaneus or intravenous continuous delivery.
39. The method of claim 4, wherein the AHCM is administered via a
subcutaneous pump, an implant or a depot.
40. The method of claim 4, wherein the cancer therapy is chosen from one or more of:
(i) a cancer therapeutic chosen from a viral cancer therapeutic agent, a lipid nanoparticle of an anti-cancer therapeutic agent, a polymeric nanoparticle of an anticancer therapeutic agent, an antibody against a cancer target, a dsRNA agent, an antisense R A agent, or a chemotherapeutic agent;
(ii) radiation,
(iii) surgery, or
(iv) any combination of (i)-(iii).
41. The method of claim 40, wherein the lipid nanoparticle is chosen from pegylated liposomal doxorubicin (DOXIL®) or liposomal paclitaxel (e.g., Abraxane®).
42. The method of claim 40, wherein the chemotherapeutic agent is chosen from gemcitabine, cisplatin, epirubicin, 5-fluorouracil, paclitaxel, oxaliplatin, or leucovorin.
43. The method of claim 40, wherein the antibody against the cancer target is chosen from an antibody against HER-2/neu, HER3, VEGF, or EGFR.
44. The method of claim 4, wherein the cancer therapy is a tyrosine kinase inhibitor chosen from sunitinib, erlotinib, gefitinib, sorafenib, icotinib, lapatinib, neratinib, vandetanib, BIBW 2992 or XL-647, or an anti-EGFR antibody chosen from cetuximab, panitumumab, zalutumumab, nimotuzumab necitumumab or matuzumab.
45. The method of claim 40, wherein the chemotherapeutic agent is a cytotoxic or a cytostatic agent.
46. The method of claim 40, wherein the chemotherapeutic agent is chosen from an antimicrotubule agent, a topoisomerase inhibitor, a taxane, an antimetabolite, a mitotic inhibitor, an alkylating agent, or an intercalating agent.
47. The method of claim 4, wherein the cancer therapy is chosen from one of more of: an anti-angiogenic agent, or a vascular targeting agent or a vascular disrupting agent.
48. The method of claim 4, wherein the AHCM or the cancer therapy is administered to the subject by a systemic administration chosen from oral, parenteral, subcutaneous, intravenous, rectal, intramuscular, intraperitoneal, intranasal, transdermal, or by inhalation or intracavitary installation.
49. The method of claim 4, further comprising monitoring the subject, for a change in one or more of:
tumor size;
the level or signaling of one or more of transforming growth factor beta 1 (TGF i), connective tissue growth factor (CTGF), or thrombospondin-1 (TSP-1);
tumor collagen I levels;
fibrotic content,
interstitial pressure;
a plasma or serum biomarker chosen from collagen I, collagen III, collagen IV, TGFpi , CTGF, or TSP-1 ;
levels of one or more cancer markers;
the rate of appearance of new lesions, metabolism, hypoxia evolution;
the appearance of new disease-related symptoms;
the size of tissue mass;
amount of disease associated pain;
histological analysis, lobular pattern, and/or the presence or absence of mitotic cells; or tumor aggressivity, vascularization of primary tumor, or metastatic spread.
49. A pharmaceutical composition comprising a nanoparticle comprising an AHCM.
50. A pharmaceutical composition comprising a nanoparticle comprising an AHCM and a cancer therapeutic agent.
51. The pharmaceutical composition of claim 50, wherein the cancer therapeutic is chosen from a viral cancer therapeutic agent, a lipid nanoparticle of an anti-cancer agent, a polymeric nanoparticle of an anti-cancer agent, an antibody against a cancer target, a dsRNA agent, an antisense RNA agent, or a chemotherapeutic agent.
52. The pharmaceutical composition of any of claims 49-51, wherein the nanoparticle is a polymeric nanoparticle or a lipid nanoparticle.
53. The pharmaceutical composition of any of claims 49-51, wherein the AHCM is formulated in a dosage form that is according to the standard of care dosage form for anti-hypertensive or anti-heart failure use of the AHCM.
54. The pharmaceutical composition of any of claims 49-51 , wherein the AHCM is formulated in a dosage form that is less than 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1 , 0.15, 0.16, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7-fold, that of the standard of care dosage form for anti-hypertensive or anti-heart failure use of the AHCM.
55. The pharmaceutical composition of any of claims 49-51 , wherein the AHCM is formulated in a dosage form that is greater than 1.1 , 1.5, 1.7, 2, 3, 4, 5, 10-foId or higher, that of the standard of care dosage form for anti-hypertensive or anti-heart failure use of the AHCM.
56. A dosage form of an AHCM, wherein the AHCM is formulated in a dosage form that is less than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.15, 0.16, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7-fold, that of the standard of care dosage form for antihypertensive or anti-heart failure use of the AHCM.
57. A dosage form of an AHCM, wherein the AHCM is formulated in a dosage form that is greater than 1.1 , 1.5, 1.7, 2, 3, 4, 5, 10-fold or higher, that of the standard of care dosage form for anti-hypertensive or anti-heart failure use of the AHCM.
58. A method optimizing access to a cancer, or optimizing delivery to a cancer of an agent, e.g., a diagnostic or imaging agent, comprising:
administering an anti-hypertensive and/or a collagen modifying agent ("AHCM") to the subject; and
optionally, administering the agent to said subject, wherein the method comprises one or more of the following:
a) the diagnostic or imaging agent has a hydrodynamic diameter of greater than 1, 5, or 20-150 nm;
b) the agent is a radiologic agent, an NMRA agent, a contrast agent; or c) the subject is treated with a dosing of AHCM administration, whic is initiated prior to administration of the agent for at least two, three, or five days, or one, two, three, four, five or more weeks prior to administration of the agent.
59. A method, or assay for, identifying an anti-hypertensive and/or a collagen modifying (AHCM), comprising:
contacting a cancer or cancer-associated cell with a candidate agent;
detecting a change in the cancer cell in the presence, or absence, of the candidate agent, wherein the detected change includes one or more of: an increase or decrease of activated TGF beta, TGF beta 1 level, connective tissue growth factor (CTGF) level, or collagen (e.g., collagen 1) level.
60. The method, or assay, of claim 59, wherein the candidate agent is chosen from one or more of: an antagonist of renin angiotensin aldosterone system ("RAAS antagonist"), an angiotensin converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ATi blocker), a thrombospondin 1 (TSP-1) inhibitor, a transforming growth factor beta 1 (TGF-βΙ) inhibitor, or a connective tissue growth factor (CTGF) inhibitor.
61. The method, or assay, of claim 59 or 60, wherein the candidate agent reduces one or more of: activated TGF beta, TGFpi level, connective tissue growth factor (CTGF) level, or collagen level.
62. The method, or assay, of any of claims 59 or 60, further comprising the step of comparing the treated methods or assays to a reference value, and comparing the difference between the treated and the reference value.
63. The method, or assay, of any of claims 59 or 60, which is carried out in vitro, in vivo, or a combination of both.
64. The method, or assay, of any of claims 59 or 60, comprising evaluating the candidate agent in vitro by adding the candidate agent to the culture medium; and the condition medium is analyzed for an increase or decrease of: activated TGF beta, TGF i level, connective tissue growth factor (CTGF) level, or collagen level.
65. The method, or assay, of any of claims 59 or 60, comprising administering the candidate agent to an animal tumor model; and analyzing the subject for an increase or decrease of: activated TGF beta, TGF i level, connective tissue growth factor (CTGF) level, or collagen level.
66. A composition for use, or the use, of an anti-hypertensive and/or a collagen modifying (AHCM), alone or in combination with a cancer therapeutic for the treatment of a cancer.
67. A therapeutic kit comprising an anti-hypertensive and/or a collagen modifying (AHCM), alone or in combination with a cancer therapeutic, and instructions for use for the treatment of cancer.
68. A diagnostic kit comprising an anti-hypertensive and/or a collagen modifying (AHCM), alone or in combination with an imaging agent, and instructions for use for the diagnosis of cancer.
69. A method of selecting a subject for receiving an anti-hypertensive and/or a collagen modifying agent ("AHCM"), comprising:
selecting the subject as being in need of receiving the AHCM on the basis of the need for improved delivery or efficacy of the cancer therapy; and either (a), (b), or both:
(a) administering the AHCM to the subject; or
(b) administering the cancer therapy,
wherein the AHCM is administered in a dosage sufficient to improve the delivery or efficacy of the cancer therapy.
EP11841427.5A 2010-11-18 2011-11-18 NEW COMPOSITIONS AND USES OF BLOOD PRESSURE RECIPROCATORS FOR CANCER THERAPY Withdrawn EP2640359A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US41519210P 2010-11-18 2010-11-18
US201161438240P 2011-01-31 2011-01-31
PCT/US2011/061510 WO2012068531A2 (en) 2010-11-18 2011-11-18 Novel compositions and uses of anti-hypertension agents for cancer therapy

Publications (2)

Publication Number Publication Date
EP2640359A2 true EP2640359A2 (en) 2013-09-25
EP2640359A4 EP2640359A4 (en) 2015-11-04

Family

ID=46084685

Family Applications (1)

Application Number Title Priority Date Filing Date
EP11841427.5A Withdrawn EP2640359A4 (en) 2010-11-18 2011-11-18 NEW COMPOSITIONS AND USES OF BLOOD PRESSURE RECIPROCATORS FOR CANCER THERAPY

Country Status (7)

Country Link
EP (1) EP2640359A4 (en)
JP (2) JP2014505666A (en)
CN (1) CN103561726A (en)
AU (1) AU2011329638C1 (en)
CA (1) CA2817250A1 (en)
RU (2) RU2018102375A (en)
WO (1) WO2012068531A2 (en)

Families Citing this family (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1747747B (en) 2003-01-06 2012-09-05 安吉奥开米公司 Aprotinin and analogs as carriers across the blood-brain barrier
JP5436856B2 (en) 2005-07-15 2014-03-05 アンジオケム インコーポレーティッド Use of an aprotinin polypeptide as a carrier in a pharmaceutical complex
US9365634B2 (en) 2007-05-29 2016-06-14 Angiochem Inc. Aprotinin-like polypeptides for delivering agents conjugated thereto to tissues
RU2518240C2 (en) 2008-04-18 2014-06-10 Ангиочем Инк. Composition based on hydrophobic agents and method for preparing it (versions)
US8921314B2 (en) 2008-10-15 2014-12-30 Angiochem, Inc. Conjugates of GLP-1 agonists and uses thereof
RU2531591C2 (en) 2008-10-15 2014-10-20 Ангиокем Инк. Etoposide and doxorubicin conjugates for drug delivery
MX2011005963A (en) 2008-12-05 2011-09-01 Angiochem Inc Conjugates of neurotensin or neurotensin analogs and uses thereof.
CN102300987A (en) 2008-12-17 2011-12-28 安吉奥开米公司 Membrane Type-1 Matrix Metalloprotein Inhibitors And Uses Thereof
AU2010239069B2 (en) 2009-04-20 2015-05-14 Angiochem Inc Treatment of ovarian cancer using an anticancer agent conjugated to an Angiopep-2 analog
MX2012000016A (en) 2009-07-02 2012-03-26 Angiochem Inc Multimeric peptide conjugates and uses thereof.
WO2013155487A1 (en) 2012-04-12 2013-10-17 Yale University Vehicles for controlled delivery of different pharmaceutical agents
CA2872652A1 (en) * 2012-05-07 2013-11-14 The General Hospital Corporation Novel compositions and uses of anti-hypertension agents for cancer therapy
WO2014054798A1 (en) * 2012-10-04 2014-04-10 独立行政法人国立循環器病研究センター Drug for inhibiting malignant tumor metastasis
EP2914263A4 (en) * 2012-11-02 2016-04-27 Pharmacyclics Inc ADJUVANT THERAPY BY KINASE INHIBITOR OF THE TEC FAMILY
WO2014129914A1 (en) * 2013-02-22 2014-08-28 Auckland Uniservices Limited Methods of treatment
EP2961483A4 (en) * 2013-03-01 2017-03-08 The Colorado State University Research Foundation Methods and compositions for enhancing an immune response, blocking monocyte migration, amplifying vaccine immunity and inhibiting tumor growth and metastasis
US8975290B2 (en) 2013-03-01 2015-03-10 Colorado State University Research Foundation Methods and compositions for enhancing an immune response, blocking monocyte migration, amplifying vaccine immunity and inhibiting tumor growth and metastasis
JP6702722B2 (en) * 2013-04-10 2020-06-03 公立大学法人奈良県立医科大学 Preventive and/or therapeutic agent for hepatocellular carcinoma
IL299897B2 (en) * 2013-08-19 2024-02-01 Taris Biomedical Llc Multi-unit drug delivery devices and methods
KR102460800B1 (en) * 2013-11-01 2022-10-31 예일 유니버시티 Modular particles for immunotherapy
CA2922575C (en) * 2013-11-01 2022-10-11 Newsouth Innovations Pty Limited Pharmaceutical combinations for the treatment of cancer
CN108135939A (en) * 2015-04-25 2018-06-08 综合医院公司 For the anti-property the driven away reagent and immunotherapeutic agent conjoint therapy and composition for the treatment of cancer
US10980892B2 (en) 2015-06-15 2021-04-20 Angiochem Inc. Methods for the treatment of leptomeningeal carcinomatosis
CN105326812A (en) * 2015-10-28 2016-02-17 南昌大学 Sorafenib solid lipid nanoparticles and preparation method thereof
WO2017106630A1 (en) 2015-12-18 2017-06-22 The General Hospital Corporation Polyacetal polymers, conjugates, particles and uses thereof
WO2018038253A1 (en) * 2016-08-26 2018-03-01 哲治 奥野 Fine nano-sized medicinal agent and use thereof
JP2019529475A (en) * 2016-09-27 2019-10-17 バーテックス ファーマシューティカルズ インコーポレイテッドVertex Pharmaceuticals Incorporated Method for treating cancer using a combination of a DNA damaging agent and a DNA-PK inhibitor
CN108358995B (en) * 2017-01-25 2021-07-06 四川大学 CP-iRGD polypeptides, iDPP nanoparticles, drug-loaded complexes and their preparation methods and applications
RU2724398C1 (en) * 2019-09-03 2020-06-23 Федеральное государственное бюджетное образовательное учреждение высшего образования "Алтайский государственный медицинский университет" Министерства здравоохранения Российской Федерации Method for determining aggressiveness of lung cancer
BR112022009955A2 (en) 2019-12-13 2022-08-09 Massachusetts Inst Technology SYNTHETIC FABRIC BARRIERS AND THEIR USES
EP3842099A1 (en) 2019-12-23 2021-06-30 Albert-Ludwigs-Universität Freiburg Use of losartan for the treatment of fibrotic diseases, in particular epidermolysis bullosa
EP4233863A4 (en) * 2020-10-26 2024-10-02 Korea Institute of Radiological & Medical Sciences Composition for enhancing tumor penetration of anticancer drug, comprising losartan as active ingredient, and use thereof
CN112933235A (en) * 2021-04-07 2021-06-11 北京蛋白质组研究中心 Application of compound targeting SOAT1 protein in preparation of drugs for preventing and/or treating liver cancer
CN115317627B (en) * 2022-08-26 2023-10-24 江西中医药大学 Application of ABT-510 peptide in preparation of tumor imaging agent

Family Cites Families (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3536809A (en) 1969-02-17 1970-10-27 Alza Corp Medication method
US3598123A (en) 1969-04-01 1971-08-10 Alza Corp Bandage for administering drugs
US3845770A (en) 1972-06-05 1974-11-05 Alza Corp Osmatic dispensing device for releasing beneficial agent
US3916899A (en) 1973-04-25 1975-11-04 Alza Corp Osmotic dispensing device with maximum and minimum sizes for the passageway
US4008719A (en) 1976-02-02 1977-02-22 Alza Corporation Osmotic system having laminar arrangement for programming delivery of active agent
US5013556A (en) 1989-10-20 1991-05-07 Liposome Technology, Inc. Liposomes with enhanced circulation time
DE69303494T2 (en) 1992-11-13 1997-01-16 Idec Pharma Corp THERAPEUTIC USE OF CHIMERIC AND LABELED ANTIBODIES AGAINST HUMAN B LYMPHOCYTIC LIMITED DIFFERENTIATION ANTIQUES FOR THE TREATMENT OF B CELL LYMPHOMA
ZA988461B (en) * 1997-09-18 1999-03-30 Idec Pharma Corp Synergistic composition and methods for treating neoplastic or cancerous growths and for restoring or boosting hematopoiesis
US6719977B1 (en) 1998-02-12 2004-04-13 The General Hospital Corporation Methods to potentiate cancer therapies
DE10144980B4 (en) 2001-09-12 2004-06-03 Webasto Vehicle Systems International Gmbh Guide device for a lid of a vehicle roof to be opened
JP2007533745A (en) * 2004-04-20 2007-11-22 アールエヌディー・ファーマシューティカルズ Pharmaceutical compositions and methods of use of lipophilic silicon-substituted cyclooxygenase-2 selective non-steroidal anti-inflammatory drugs and derivatives
JP2008506780A (en) 2004-07-19 2008-03-06 セレーター ファーマスーティカルズ、インク. Particulate constructs for active agent release
TWI386225B (en) 2004-12-23 2013-02-21 Alcon Inc Rnai inhibition of ctgf for treatment of ocular disorders
TW200637539A (en) 2005-01-20 2006-11-01 Shionogi & Co CTGF inhibitors
CN101163502A (en) 2005-02-08 2008-04-16 根茨美公司 Antibodies against TGF-beta
WO2006089290A1 (en) * 2005-02-18 2006-08-24 Abraxis Bioscience Inc.. Combinations and modes of administration of therapeutic agents and combination therapy
WO2007109097A2 (en) 2006-03-16 2007-09-27 Alnylam Pharmaceuticals, Inc. RNAi MODULATION OF TGF-BETA AND THERAPEUTIC USES THEREOF
US20090012052A1 (en) * 2006-11-09 2009-01-08 Ore Pharmaceuticals Inc. Method for treating er+ breast cancer
WO2009105624A2 (en) * 2008-02-21 2009-08-27 Massachusetts Institute Of Technology Simultaneous delivery of receptors and/or co-receptors for growth factor stability and activity
WO2009137543A2 (en) * 2008-05-06 2009-11-12 Ore Pharmaceuticals Inc. Methods for breast cancer screening and treatment
HUE035770T2 (en) 2008-06-16 2018-05-28 Pfizer Methods for the preparation of targeting agent functionalized diblock copolymers for use in fabrication of therapeutic nanoparticles
EA020954B1 (en) 2008-06-16 2015-03-31 Бинд Терапьютикс, Инк. POLYMERIC NANOPARTICLES, PHARMACEUTICAL COMPOSITION AND CANCER TREATMENT
WO2010005726A2 (en) 2008-06-16 2010-01-14 Bind Biosciences Inc. Therapeutic polymeric nanoparticles with mtor inhibitors and methods of making and using same
WO2010068866A2 (en) 2008-12-12 2010-06-17 Bind Biosciences Therapeutic particles suitable for parenteral administration and methods of making and using same
EP2379064B1 (en) 2008-12-15 2020-02-26 Pfizer Inc. Long circulating nanoparticles for sustained release of therapeutic agents
DE202009018883U1 (en) 2009-04-24 2014-03-12 BSH Bosch und Siemens Hausgeräte GmbH Program selector for a domestic appliance, in particular for a washing machine

Also Published As

Publication number Publication date
AU2011329638C1 (en) 2017-04-27
WO2012068531A2 (en) 2012-05-24
CA2817250A1 (en) 2012-05-24
WO2012068531A3 (en) 2013-11-28
RU2018102375A (en) 2019-02-21
EP2640359A4 (en) 2015-11-04
RU2013127625A (en) 2014-12-27
AU2011329638B2 (en) 2016-10-13
CN103561726A (en) 2014-02-05
JP2017101056A (en) 2017-06-08
AU2011329638A1 (en) 2013-05-30
JP2014505666A (en) 2014-03-06

Similar Documents

Publication Publication Date Title
AU2011329638C1 (en) Novel compositions and uses of anti-hypertension agents for cancer therapy
US20130287688A1 (en) Novel compositions and uses of anti-hypertension agents for cancer therapy
AU2018200448A1 (en) Novel compositions and uses of anti-hypertension agents for cancer therapy
US20180064662A1 (en) Novel compositions and uses of metformin agents
US11433136B2 (en) Polyacetal polymers, conjugates, particles and uses thereof
US12134654B2 (en) Multispecific molecules and uses thereof
CA2897018C (en) Polymeric forms of h-nox proteins
JP2024116286A (en) Systems and methods for in vivo nucleic acid expression
US12571799B2 (en) Biomarkers for determining the efficacy of immune checkpoint inhibitors
ES2838925T3 (en) Combination therapy for the treatment of atherosclerosis
WO2024081329A1 (en) Multifunctional molecules binding to tcr and uses thereof
JP2022180464A (en) Treatment of pancreatic cancer
AU2013305888A1 (en) Compositions and methods for treating or preventing anthracycline induced cardiotoxicity
CN101970670A (en) Methods for inhibiting angiogenesis using egfl8 antagonists
US20220218833A1 (en) Platelet-facilitated delivery of therapeutic compounds
JP2011068627A (en) Agent for prevention of atherosclerosis
US20240034788A1 (en) Abscopal therapy for cancer
JP2024504822A (en) How to treat or prevent adverse secondary neurological outcomes after hemorrhagic stroke
US20240052012A1 (en) Platelet alpha-granules for delivery of multiple proteins
WO2025110250A1 (en) Modified mfg-e8 protein
KR20240167580A (en) Pharmaceutical composition for treating colorectal cancer comprising Tumor-Targeted Liposomes with Platycodin D2
US20200147070A1 (en) Inducing phospholipidosis for enhancing therapeutic efficacy
WO2021091896A1 (en) Method for treating cancer

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20130611

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

R17D Deferred search report published (corrected)

Effective date: 20131128

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1189801

Country of ref document: HK

DAX Request for extension of the european patent (deleted)
RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 9/14 20060101ALI20150924BHEP

Ipc: A61K 39/395 20060101ALI20150924BHEP

Ipc: A61K 45/06 20060101AFI20150924BHEP

A4 Supplementary search report drawn up and despatched

Effective date: 20151002

17Q First examination report despatched

Effective date: 20170309

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

INTG Intention to grant announced

Effective date: 20181211

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20190424

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1189801

Country of ref document: HK