EP2449125A2

EP2449125A2 - Combined nucleic acid blocking, extraction, and detection in a single reaction vessel

Info

Publication number: EP2449125A2
Application number: EP10794424A
Authority: EP
Inventors: David James Saul
Original assignee: ZyGEM Corp Ltd
Current assignee: ZyGEM Corp Ltd
Priority date: 2009-07-02
Filing date: 2010-07-02
Publication date: 2012-05-09
Also published as: JP2012531907A; EP2449125A4; WO2011002319A2; WO2011002319A3

Abstract

The invention relates to a method that utilizes nucleic acid deactivating reagents for the deactivation of contaminating nucleic acids, and thermophilic proteinases for the extraction of nucleic acids in a closed-system to be used in tandem with methods for the amplification of target nucleic acids present in a sample. The combined method enables simplified, temperature-controlled devices to be used for accurate, streamlined testing at the point of care for a wide variety of applications in the medical, industrial, environmental, quality control, security and research fields.

Description

COMBINED NUCLEIC ACID BLOCKING, EXTRACTION, AND DETECTION IN A SINGLE REACTION VESSEL

FIELD

[0001] This application relates generally to a method that can be practiced within a closed system for the rapid amplification of target nucleic acid in a sample. More specifically, the application relates to a combined method for deactivating contaminating nucleic acids and extracting target nucleic acids that is compatible with temperature-controlled target nucleic acid amplification methods which can be used in a closed-system device for the detection of target nucleic acids present in a sample.

BACKGROUND

[0002] Processes that accurately and robustly amplify nucleic acids in a sample are desirable for a variety of medical, industrial, environmental, security, research and quality control purposes. Preferably, such processes are also rapid, yield accurate results and can be performed in a closed-system, i.e. a system that does not need to be opened during the course of the analysis in order to prevent yield reduction or accidental contamination with unwanted nucleic acids or nucleases. Nucleic acid amplification strategies can be split into three stages: deactivation or removal of contaminating nucleic acids, extraction of target nucleic acid, and amplification of target nucleic acid. A primary difficulty with these stages is that they generally require different processes to perform them.

Deactivation of contaminating nucleic acids

[0003] Amplification of nucleic acids is very susceptible to contamination. The ability of the polymerase chain reaction (PCR) to amplify minute amounts of DNA is one of its greatest strengths. However, this ability also means that any traces of contaminating DNA are also co- amplified. This amplification of contaminating DNA can produce misleading, ambiguous or incorrect results (Wilson et al., 1990). In particular, the concept of targeting the highly conserved and evolutionarily homologous eubacterial ribosomal 16S rRNA genes with universal primers for phylogenetic, evolutionary and diagnostic studies is often compromised by the generation of false positives during PCR (Hilali et al., 1997; Corless et al., 2000; Mohammadi et al., 2003). Indeed contamination of commercially available DNA polymerases, such as Taq DNA polymerase, has been repeatedly reported to be one of the most likely sources of exogenous bacterial DNA contamination (Bottger, 1990; Rand et al., 1990; Schmidt et al., 1991; Hilali et. al., 1997).

[0004] Furthermore, eubacterial DNA is ubiquitous in the environment and can also contaminate a PCR mix at practically any stage of processing by laboratory personnel (Kitchin et al., 1990; Millar et al., 2002). Other sources of DNA contamination include: aerosols (Saksena et al., 1991), consumable PCR reagents, plastic ware (Millar et al., 2002), and commercial PCR primers (Goto et al, 2005).

[0005] Another field where contamination is a problem is mitochondrial DNA (mtDNA) typing. Sequence analysis of human mtDNA is widely used for forensic purposes to characterize specimens when there is insufficient nuclear DNA. Often, mtDNA is the only remaining intact DNA in trace or degraded samples. Handling these types of samples requires rigorous quality assurance because the laboratories in which they are processed are often a more abundant source of DNA than the sample itself. (Caπracedo et al., 2000).

[0006] In a similar way, anthropological or phylogenetic analysis of ancient biological material is hampered by the low copy number of the target DNA compared with the high levels of mtDNA present in the environment and the laboratory. Many reports of this difficulty can be found in the scientific press (for example Lourdes Sampietro et al., 2006).

Solution decontamination

[0007] Current practices known in the art for decontaminating solutions for DNA

amplification rely on a pre-treatment step either with nucleic acid degrading enzymes or with chemical agents that inactivate the nucleic acid contaminants. Example enzymes used in the treatment of reagents are DNAseI or SauSA. Solutions for RNA analysis are often treated with diethyl pyrocarbonate (DEPC) and double-stranded DNA can be removed using ethidium monoazide (New Zealand Patent No. 545,894). However, none of these DNA decontaminating solutions have been combined in a closed-system reagent cocktail for decontamination, extraction and amplification of target nucleic acids.

Nucleic acid extraction

[0008] Isolation of target nucleic acids for diagnostic procedures often requires nucleic acid extraction from natural substances. Applications range from forensic DNA-fingerprinting, to medical, agricultural, anthropology, taxonomy and environmental monitoring. It is important that the nucleic acid sample be free from contamination, particularly where the concentration of nucleic acid in the initial sample is very low or where contamination can lead to incorrect outcomes. This is particularly the case for trace microbial, ancient, and forensic samples where quantities of starting material may be on the order of picograms or less. Standard nucleic acid extraction techniques are problematic as the sample tube may require opening and shutting at stages throughout the extraction procedure. Contamination may occur simply as a result of the sample tube being opened to the atmosphere or being touched by a technician.

Amplification

[0009] A target nucleic acid can be subjected to nucleic acid amplification methods to determine if the target nucleic acid is present in a sample. Many situations arise where it is desirable to detect low levels of specific nucleic acid sequences within the context of a complex mixture, therefore any of the current methods for detecting nucleic acids chosen for this purpose must be highly specific and sensitive. No simple method currently exists that can directly detect a single nucleic acid molecule of a specific sequence, and so all currently employed methods include a step or steps which amplify the signal. The most widespread method used to achieve this goal is PCR. This method provides exponential amplification of target molecules by using thermal cycling and a thermostable DNA polymerase.

[0010] A shortfall of all of existing procedures is that the three steps of decontamination, extraction, and amplification of the target nucleic acid are discrete procedures and at some point the tube must be opened to proceed to the next step, thereby exposing the sample to further environmental DNA contamination. This is particularly significant because laboratory plastic- ware such as pipette tips and tubes are also liable to be contaminated, and so even with the most careful laboratory technique and rigorous laboratory standards, sample contamination is inevitable. Therefore, there is clearly a need for a process that combines deactivation of contaminating nucleic acids, extraction of target nucleic acid, and amplification of target nucleic acid into a single closed system performed in a vessel or device that can accurately and rapidly identify target nucleic acids, particularly those corresponding to microorganisms encountered in a wide range of situations or in mixed populations.

[0011] No admission is made that any reference herein constitutes prior art. The discussion of the references states what their authors assert, and the applicants reserve the right to challenge the accuracy and pertinence of the cited documents. It will be clearly understood that, although a number of references are cited herein, this does not constitute an admission that any of these documents form part of the common general knowledge in the art.

SUMMARY OF PREFERRED EMBODIMENTS

[0012] The methods, processes, and devices disclosed herein overcome the shortcomings and disadvantages mentioned above. Herein, methods for combining deactivation of contaminating nucleic acids, extraction of target nucleic acid, and amplification of target nucleic acid into a single process that can be practiced in a closed-system are described. The methods of deactivation of contaminating nucleic acids disclosed herein can be controlled through application of an external stimulus, and surprisingly are compatible with most strategies of nucleic acid extraction and amplification. In addition, the conditions required for nucleic acid extraction by thermophilic proteinase treatment are compatible with those of most amplification processes.

[0013] One embodiment provides a method of decontaminating, extracting and amplifying target nucleic acid in a closed system comprising a single vessel or tube, the method including: i) adding nucleic acid deactivating reagent that has an active form and an inactive form, is converted to the active form only when an external stimulus is applied, and only the active form deactivates contaminating nucleic acids in the system causing contaminating nucleic acids to become unreactive to nucleic acid amplifying reagent; thermophilic proteinase that is in an active form at about 65- 8O⁰C and in an inactive form at or above about 90⁰C; and nucleic acid amplifying reagent to a sample comprising target nucleic acid to form the system, ii) closing the system;

iii) applying the external stimulus for a period of time sufficient to convert the

nucleic acid deactivating reagent from the inactive form to the active form to cause contaminating nucleic acids in the system to become unreactive to nucleic acid amplifying reagent and subsequently having the nucleic acid deactivating reagent be converted to the inactive from;

iv) incubating the sample for a period of time at about 65-80⁰C to activate the

thermophilic proteinase and extract the target nucleic acid for amplification by effecting one or more of lysis of cells, digestion of proteins, and digestion of cell- wall enzymes; v) incubating the sample at or above about 9O⁰C to cause auto-catalysis of the thermophilic proteinase; and

vi) amplifying the target nucleic acid.

[0014] In another embodiment, the nucleic acid deactivating reagent is converted to the inactive form before or concurrent with incubating the sample at about 65-8O⁰C. In yet another embodiment, the nucleic acid deactivating reagent is converted to the inactive form subsequent to causing contaminating nucleic acids to become unreactive to nucleic acid amplifying reagent by applying the external stimulus for a period of time sufficient to convert the nucleic acid deactivating reagent to the inactive form. In a further embodiment, the nucleic acid deactivating reagent is converted to the inactive form subsequent to causing contaminating nucleic acids to become unreactive to nucleic acid amplifying reagent by removing the external stimulus.

[0015] In another embodiment, the nucleic acid deactivating reagent is provided at a concentration sufficient to deactivate contaminating nucleic acids without inhibiting the thermophilic proteinase, the amplifying reagent, or amplification of the target nucleic acid.

[0016] In yet another embodiment, the nucleic acid deactivating reagent is a mesophilic nucleic acid modifying enzyme. In a further embodiment, the mesophilic nucleic acid modifying enzyme is a double-stranded specific endonuclease, a double-stranded specific exonuclease, a single-stranded specific nuclease, a restriction endonuclease, an RNAses, RNAseH, or an RNA modifying enzyme. In still a further embodiment, the mesophilic nucleic acid modifying enzyme is activated by incubating at about 25-40 ⁰C for a period of time sufficient to convert the mesophilic nucleic acid modifying enzyme to the active form. In another embodiment, the mesophilic nucleic acid modifying enzyme is inactivated by incubating at about 65-8O⁰C for a period of time sufficient to convert the mesophilic nucleic acid modifying enzyme to the inactive form.

[0017] In one embodiment, the nucleic acid deactivating reagent is a nucleic acid intercalating agent. In another embodiment, applying the external stimulus converts the nucleic acid intercalating agent to the active form by effecting photolysis of the nucleic acid intercalating agent. In yet another embodiment, the active form of the nucleic acid intercalating agent covalently binds to double-stranded nucleic acids. In a further embodiment, the nucleic acid intercalating agent is ethidium monoazide. In still a further embodiment, the ethidium monoazide is provided at a concentration between about 1 μg/ml and about 5μg/ml. In another embodiment, the ethidium monoazide is provided at a concentration of about 3 μg/ml. [0018] In one embodiment, the external stimulus is a specific narrow spectrum wavelength light, broad spectrum white light, or UV light. In another embodiment, the external stimulus is specific narrow spectrum wavelength light, broad spectrum white light, or UV light sufficient to activate the nucleic acid intercalating agent by effecting photolysis of the nucleic acid intercalating agent. In yet another embodiment, the external stimulus is thermal energy sufficient to activate the nucleic acid deactivating agent without substantially activating the thermophilic proteinase. In a further embodiment, the external stimulus is thermal energy sufficient to raise the system to a temperature of about 25-4O⁰C for a period of time sufficient to convert the mesophilic nucleic acid modifying enzyme to the active form.

[0019] In one embodiment, the thermophilic proteinase is EAl.

[0020] In another embodiment, the method further includes:

i) treating the sample with a mesophilic enzyme, and

ii) incubating the sample at a temperature below about 40⁰C for a period of time that is sufficient to effect removal of cell walls from cells.

[0021] In yet another embodiment, the mesophilic enzyme is a cellulase or lysozyme.

[0022] In one embodiment, amplifying is detected by fluorescence. In another embodiment, amplifying comprises performing a PCR detection method. In yet another embodiment, the PCR detection method is qPCR, multiplex PCR, or reverse-transcription PCR.

[0023] In a further embodiment, the amplifying comprises performing an isothermal detection method. In still another embodiment, the isothermal detection method is strand displacement amplification, rolling circle amplification, loop-mediated isothermal amplification, isothermal chimeric primer-initiated amplification of nucleic acids, Q-beta amplification systems, or OneCutEventAmplificatioN. In another embodiment, the isothermal detection method utilizes a technique such as Nuclease Chain Reaction (NCR), RNAse-mediated

Nucleases Chain Reaction (RNCR), Polymerase Nuclease Chain Reaction (PNCR), RNAse- Mediated Detection (RMD), Tandem Repeat Restriction Enzyme Facilitated (TR-REF) Chain Reaction, or Inverted reverse Complement Restriction Enzyme Facilitated (IRC-REF) Chain Reaction.

[0024] In one embodiment, amplifying comprises performing a SNP detecting assay.

[0025] In another embodiment, amplifying the target nucleic acid is automated. [0026] In one embodiment, the amplifying reagent is added by microfluidics or a solid dispenser.

[0027] In another embodiment, the amplifying reagent is added by microcapsules comprising the amplifying reagent. In yet another embodiment, the microcapsules are predisposed in the vessel or tube. In a further embodiment, the microcapsules are heat-labile capsules. In still another embodiment, the heat-labile capsules are agarose or wax beads. In yet a further embodiment, the heat-labile capsules release detecting reagents when exposed at a sufficient temperature to melt or dissolve the capsules.

[0028] In one embodiment, the amplifying reagent is resistant to proteolytic cleavage by the thermophilic proteinase.

[0029] In another embodiment, the sample is blood, urine, saliva, semen, stool, tissue, swabs, tears, bone, teeth, hair, or mucus. In yet another embodiment, the sample is bacteria, fungi, archaea, eukarya, protozoa, or virus. In a further embodiment, the sample is a mixture of salt water, freshwater, ice, soil, waste material, or food.

[0030] In one embodiment, the vessel or tube is a device. In another embodiment, the device is a hand-held device. In yet another embodiment, the device or components of the device are disposable. In a further embodiment, the device comprises an inlet port, an outlet port, a chamber, a detector for emitted fluorescence and an excitation light source. In still a further embodiment, the device further comprises microfluidics, microchips, nanopore technologies and miniature devices.

[0031] In one embodiment, the device comprises a sealed unit, a light-tight chamber, a nucleic acid deactivating reagent-activating light source, a detector for emitted fluorescence and an excitation light source. In another embodiment, the nucleic acid deactivating reagent- activating light source is an incandescent lamp, a fluorescent lamp, or an array of light emitting diodes.

[0032] Another embodiment provides a method of amplifying target nucleic acid in a closed system comprising a single vessel or tube, the method including:

i) adding mesophilic nucleic acid modifying enzyme that has an active form and an inactive form where only the active form deactivates contaminating nucleic acids in the system causing the contaminating nucleic acids to become unreactive to PCR amplifying reagent and is in an active from at about 25- 4O⁰C and in an inactive form at about 65-8O⁰C; EAl proteinase that is in an active from at about 65-8O⁰C and is in an inactive form at or above about 90°C; and PCR amplifying reagent to a sample comprising target nucleic acid to form the system,

ii) closing the system;

iii) incubating the sample for a period of time at about 25-4O⁰C to activate the mesophilic nucleic acid modifying enzyme and cause contaminating nucleic acids in the system to become unreactive to PCR amplifying reagent;

iv) incubating the sample for a period of time at 65-8O⁰C to inactivate the mesophilic nucleic acid modifying enzyme, activate the EAl proteinase, and extract the target nucleic acid for amplification by effecting one or more of lysis of cells, digestion of proteins, and digestion of cell-wall enzymes;

v) incubating the sample at or above about 90⁰C ^"to cause auto-catalysis of the EAl proteinase; and

vi) amplifying the target nucleic acid.

[0033] Yet another embodiment provides a method of amplifying target nucleic acid in a closed system comprising a single vessel or tube, the method including:

i) adding ethidium monoazide that has an active form and an inactive form and only the active form deactivates contaminating nucleic acids in the system causing the contaminating nucleic acids to become unreactive to PCR amplifying reagent, and is converted to the active form only when specific narrow spectrum wavelength light, broad spectrum white light, or UV light is applied to effect photolysis of the ethidium monoazide; EAl proteinase that is in an active form at about 65-8O⁰C and is in an inactive from at or above about 90°C; and PCR amplifying reagent to a sample comprising target nucleic acid to form the system,

ii) closing the system;

iii) applying the specific narrow spectrum wavelength light, broad spectrum white light, or UV light for a first period of time sufficient to convert the ethidium monoazide from the inactive form to the active form, to cause contaminating nucleic acids in the system to become unreactive to the PCR amplifying reagent and to cause the ethidium monoazide to become inactive to

subsequent nucleic acids;

iv) incubating the sample for a second period of time at about 65-8O⁰C to activate the EAl proteinase and extract the target nucleic acid for amplification by effecting one or more of lysis of cells, digestion of proteins, and digestion of cell-wall enzymes;

v) incubating the sample at or above 9O⁰C to cause the auto-catalysis of the EAl proteinase; and

vi) amplifying the target nucleic acid.

BRIEF DESCRIPTION OF THE FIGURES [0034] Figure 1. Overview of combined nucleic acid detection process.

[0035] Figure 2. Single chamber device with an array of light emitting diodes for deactivation of contaminating nucleic acids, extraction of target nucleic acid, and amplification of target nucleic acid using encapsulated reagents.

[0036] Figure 3. A graph showing the C_T values obtained in a qPCR reaction for different Escherichia coli cell counts when DNA extraction and qPCR are performed in a single vessel. In this reaction, no ethidium monoazide treatment was used. The dashed line indicates the C_T value obtained from water alone (zero cells). Error bars are one standard deviation from the mean.

[0037] Figure 4. A graph showing the C_T values obtained in a qPCR reaction for different Escherichia coli cell counts when DNA extraction and qPCR are performed in a single vessel. In this reaction, an ethidium monoazide treatment is included as part of a closed-tube sequential reaction. The dashed line indicates the C_T value obtained from water alone (zero cells). Error bars are one standard deviation from the mean.

DETAILED DESCRIPTION Definitions

[0038] As used herein the term "nucleic acid deactivating reagent" refers to any chemical, molecule, enzyme, or other type of biological molecule capable of making nucleic acids unreactive to nucleic acid amplification. [0039] As used herein the term "deactivation" refers to the process of removing, degrading, or making contaminating nucleic acids unreactive to nucleic acid amplification.

[0040] As used herein the term "unreactive" refers to a nucleic acid being unable to be amplified by any nucleic acid amplification step or method. A non-limiting example is ethidium monoazide, which can bind the contaminating nucleic acid, which remains in the solution but is not detectable by the signal detection methods used subsequent to target nucleic acid

amplification.

Overview

[0041] Target nucleic acid amplification strategies can be split into three stages: deactivation of contaminating nucleic acids, extraction of target nucleic acid, and amplification of target nucleic acid. Any system for performing these stages requires different instrumentation for each stage, and a method of transferring the material from one internal instrument to the next. The art teaches discrete steps for nucleic acid pre-treatment, extraction and amplification and although each of these may be in closed systems, those systems must be opened and exposed to potential contamination between each step.

[0042] The methods for deactivating contaminating nucleic acids disclosed herein can be controlled through application of an external stimulus, and surprisingly are compatible and can be successfully included in a single closed system with nucleic acid extraction and amplification methods. In a closed system, sample comprising target nucleic acid, nucleic acid deactivating reagent, nucleic acid extraction reagent, and nucleic acid amplification reagent, are added to an open vessel or tube and the vessel or tube is sealed to prevent further contamination. In an open system, the vessel or tube is opened for a period of time sufficient to introduce additional reagents, such as nucleic acid extraction reagent or nucleic acid amplification reagent. For example, a system is open when the vessel or tube is opened after nucleic acid deactivation, before or after extraction, or before amplification.

[0043] Unexpectedly, combining contaminating nucleic acid deactivation with target nucleic acid extraction and amplification in a closed system results in a many-fold increase in detection sensitivity of nucleic acid amplification compared to amplification without nucleic acid deactivation reagent.

[0044] In preferred embodiments, inclusion of a nucleic acid deactivation reagent improves the amplification detection sensitivity of a method by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5 -fold, at least about 8-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 50-fold, at least about 1000-fold, at least about 250-fold, at least about 500-fold, at least about 750-fold, at least about 1, 000-fold, at least about 2,000-fold, at least about 3,000-fold, at least about 4,000-fold, at least about 5,000-fold, or greater than amplification detection sensitivity of the same method performed without the nucleic acid deactivating reagent.

[0045] In other preferred embodiments of the invention, amplification detection sensitivity of a method practiced in a closed system including nucleic acid deactivation reagent increases by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 8-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 50-fold, at least about 1000-fold, at least about 250-fold, at least about 500-fold, at least about 750-fold, at least about 1, 000-fold , at least about 2,000-fold, at least about 3,000-fold, or greater compared to the same method performed in an open system.

[0046] Nucleic acid extraction via the thermophilic proteinase treatment disclosed herein is temperature controlled, as are all amplification methods, hi addition, the conditions required for the thermophilic treatment are compatible with those of most amplification processes. Because of these factors, combined methods for deactivating contaminating nucleic acids, extracting a target nucleic acid, and amplifying the target nucleic acid can be performed in a single vessel or device. Furthermore, the device can be simplified to a vessel with an external stimulus source to activate a nucleic acid deactivating reagent for deactivation of contaminating nucleic acids, and a heating/cooling mechanism to process raw sample material to take it all the way to amplification of a detectable target nucleic acid. The inclusion of a detector is also facile.

[0047] The currently disclosed methods allow for combined processes for deactivation of contaminating nucleic acids, extraction of target nucleic acid, and amplification of target nucleic acid, and allow for devices with no pumps or need for microfluidics, however these can be used for more complex downstream applications if required. Furthermore, the combined process can be practiced in closed-system devices that utilize external stimuli and heat-controlled reaction chains. Nucleic acid deactivating reagents and thermophilic proteinases are used to inhibit contaminating nucleic acids in the system and to extract nucleic acids in a sample in tandem with nucleic acid amplification techniques including PCR or isothermal amplification. Nucleic acid deactivating reagents, that can be activated by application of an external stimulus and can be subsequently deactivated, as well as heat control using either temperature dependent enzyme mixtures or temperature controlled release of encapsulated reagents simplify the design of current nucleic acid diagnostic methods and devices. The inclusion of a deactivation step as part of the process reduces the rate of false positives and increases the sensitivity of nucleic acid amplification and detection. Reducing complexity can also reduce associated failure rate and cost. These techniques have the added benefit of being amendable to multiplexing for the simultaneous identification of multiple target nucleic acids in a mixed sample.

[0048] One embodiment of the processes detailed in this disclosure is outlined in Figure 1. In a first step nucleic acid deactivating reagent, thermophilic proteinase, nucleic acid amplification and detection reagents, and sample are added to a single reaction vessel. An external stimulus can then be applied to convert a nucleic acid deactivating reagent from an inactive form to an active form. The active form of the nucleic acid deactivating reagent then reacts with all contaminating nucleic acids and renders them unreactive to all subsequent steps in the process. The unused nucleic acid deactivating reagent is converted to an inactive form. A thermophilic proteinase then digests contaminating proteins at a temperature optimal for thermophilic proteinase activity and effects the extraction of target nucleic acid. Subsequent to extraction of target nucleic acid, known nucleic acid sequences can be amplified by PCR or isothermal methods, or simultaneously detected by fluorescence using isothermal amplification or qPCR amplification methods.

Nucleic Acid Deactivating Reagents

[0049] Preferred methods for deactivating contaminating nucleic acids and preventing co- amplification of the contaminating nucleic acids by using a nucleic acid deactivating reagent are described herein. As used herein, the terms "nucleic acid", "nucleic acid sequence",

"polynucleotide(s)," "polynucleotide sequence" and equivalents thereof mean a single or double- stranded deoxyribonucleotide or ribonucleotide polymer of any length, and include as non- limiting examples, coding and non-coding sequences of a gene, sense and antisense sequences, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polynucleotides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers, fragments, genetic constructs, vectors and modified polynucleotides. There is no intended distinction in length between the terms "nucleic acid", "oligonucleotide" and "polynucleotide", and these terms will be used interchangeably.

[0050] In order to prevent further contamination of the sample it is preferable that the nucleic acid deactivating reagent be used in combination with the nucleic acid extraction and amplification reactions requiring the least possible number of opening, adding or removals from the reaction tube. Preferably the reagent is added in one initial step with any nucleic acid extraction and amplification reagents required for amplification and detection of a target nucleic acid.

[0051] In certain embodiments the nucleic acid deactivating reagent can be a chemical, an enzyme, or other type of biological molecule. Any type of nucleic acid deactivating reagent will have the ability to deactivate contaminating nucleic acids. Contaminating nucleic acid is. any nucleic acid that may be found in nucleic acid preparation/extraction reagents; nucleic acid amplification reagents; in vessels, tubes, plates, or devices used for any process involving nucleic acids; or plastic-ware used in any process involving nucleic acids that contaminate the target sample and lead to a reduction in amplification sensitivity and to an increase in the number of false positive results.

[0052] In preferred embodiments, the nucleic acid deactivating reagent has properties which allow it to remain in the sample solution during target nucleic acid extraction and amplification. This is advantageous in that it reduces the possibility for further contamination by opening the container/reaction vessel and allows deactivation to be incorporated into a nucleic acid amplification process.

[0053] Preferably, the nucleic acid deactivating reagent has two different forms under conditions compatible with the methods described herein~an inactive form where it deactivates nucleic acids, and an active form where it deactivates nucleic acids, and the

activation/deactivation is controllable. In certain embodiments the nucleic acid deactivating reagent may alternate between an inactive and an active form (and vice versa), such that a sufficient quantity of the nucleic acid deactivating reagent to deactivate contaminating nucleic acids can be added to the sample and will only deactivate the contaminating nucleic acids when in an active form. Thus, once the nucleic acid deactivating reagent has deactivated the contaminating nucleic acids, any remaining nucleic acid deactivating reagent can be converted to an inactive form that will not deactivate any further nucleic acids. This prevents the nucleic acid deactivating reagent/contaminating nucleic acid combination from interfering in any further reactions in the target nucleic acid amplification process described herein.

[0054] In certain embodiments of the methods disclosed herein where the nucleic acid deactivating reagent has two forms, the nucleic acid deactivating reagent is converted to an active form prior to target nucleic acid extraction and amplification. In a preferred embodiment the nucleic acid deactivating reagent is converted to an inactive form subsequent to causing contaminating nucleic acids to become unreactive to nucleic acid amplification and prior to or concurrent with incubating a sample with nucleic acid extraction reagent such as a thermophilic proteinase. Conversion to or from the active form may occur via any of several mechanisms depending on the properties of the particular nucleic acid deactivating reagent. Exemplary mechanisms are discussed further below.

[0055] In other embodiments, the nucleic acid deactivating reagent is provided in active form at a concentration sufficient to deactivate contaminating nucleic acids without inhibiting subsequent target nucleic acid extraction including treating a sample with thermophilic proteinase, nucleic acid amplification reagent, or target nucleic acid amplification.

[0056] Preferably, the nucleic acid deactivating reagent does not break down or destroy the contaminating nucleic acids, as such nucleic acid fragments or portions may themselves interfere in the amplification reaction.

External Stimulus

[0057] hi certain embodiments the nucleic acid deactivating reagent will only be converted to an active form when an external stimulus is applied. Preferably, the external stimulus is sufficient to activate the nucleic acid deactivating reagent without substantially activating a nucleic acid extraction reagent such as a thermophilic proteinase. As used herein "substantially activating" refers to, for example, a thermophilic proteinase becoming sufficiently active to effect the extraction of an amount of target nucleic acid sufficient to be amplified and detected by the methods described herein during a period of time sufficient to convert the nucleic acid deactivating reagent to an active form.

[0058] In some preferred embodiments the activating external stimulus is specific narrow spectrum wavelength light, broad spectrum white light, or UV light, while in other preferred embodiments the external stimulus is thermal energy. However, this should not be seen as limiting as the external stimulus will depend on the nucleic acid deactivating reagent selected and its specific activating and deactivating properties.

[0059] In preferred embodiments, subsequent to causing contaminating nucleic acids to become unreactive to nucleic acid amplification, the nucleic acid deactivating reagent is converted to its inactive form. In some embodiments removal of the external stimulus converts the active nucleic acid deactivating reagent to an inactive form. In other embodiments, a particular amount of external stimulus may be sufficient to convert the nucleic acid deactivating reagent to an active form, and an increase in the amount of the external stimulus may be required to convert the active nucleic acid deactivating reagent to an inactive form. For example, in a preferred embodiment the nucleic acid deactivating reagent is converted to an inactive form subsequent to causing contaminating nucleic acids to become unreactive to nucleic acid amplification by applying an external stimulus for a period of time sufficient to convert the nucleic acid deactivating reagent to an inactive form. In further embodiments the external stimulus converts the nucleic acid deactivating reagent into an active form by effecting a nonreversible structural change in the nucleic acid deactivating reagent, for example photolysis, that allows for the deactivation of contaminating nucleic acids at the time of activation, but does not allow for the further deactivation of nucleic acids after the structural change has occurred. For example, in a preferred embodiment applying the external stimulus may convert a nucleic acid deactivating reagent to the active form by effecting photolysis of the nucleic acid deactivating reagent.

Intercalating Agents

[0060] In one embodiment the nucleic acid deactivating reagent is an intercalating agent such as ethidium, proflavin, or thalidomide which covalently binds to double-stranded nucleic acids. As used herein, the term "intercalating agent" includes any agent that can be reversibly inserted between two adjacent base pairs of a double-stranded nucleic acid. Non-limiting examples of well studied DNA intercalators include ethidium, proflavin, and thalidomide. In preferred embodiments applying specific narrow spectrum wavelength light, broad spectrum white light, or UV light converts a nucleic acid intercalating agent to an active form by effecting photolysis of the nucleic acid intercalating agent.

[0061] In a preferred embodiment the intercalating agent is ethidium monoazide (EMA). New Zealand Patent No. 545,894, which is hereby incorporated by reference, discloses using EMA to deactivate contaminating nucleic acids. EMA complexes with contaminating nucleic acids. EMA is a photoreactive analogue of ethidium bromide in which the amino group at the 8- position has been replaced with an azido group. In the absence of white light, EMA intercalates with double-stranded nucleic acids in the same manner as ethidium bromide. However, in the presence of light, EMA becomes photo-activated and covalently binds double-stranded nucleic acids (Bolton and Kearns, 1978; Garland et. al., 1980). [0062] When undergoing photoactivation, the azido-group at the 8-position of EMA is photo-chemically lysed using long wavelength light greater than approximately 400 nm (Bolton and Kearns, 1978). EMA that has undergone photolysis can covalently crosslink with nucleic acids at the site of binding via a nitrene radical (Hardwick et al., 1984; Cantrell et al., 1979). Residual unbound nitrene in the solution is converted to hydroxylamine (Graves et al., 1981), which reacts with aldehyde and/or ketone components of the solution— preferentially with cytosine~to form oximes (Freese et al., 1961). After exposure to light and photolysis, EMA loses its ability to covalently bind any further unbound nucleic acids. Therefore subsequent exposure to light (e.g. in a real-time PCR machine) does not affect the outcome of any downstream reaction. Furthermore, covalently cross-linked nucleic acids are unable to participate in any subsequent nucleic acid amplification step, and therefore its interference is removed (Nogva et al., 2003).

[0063] Preferably, EMA is added at a minimal titer, just sufficient to bind all exogenous nucleic acids, while minimizing the formation of free nitrene in solution associated with the formation of hydroxylamine. The amount of contaminating nucleic acids in commercially available amplification reagents may vary, thus every batch of amplification reagents will require optimization of the EMA titer to be undertaken to ensure maximal removal of contaminating nucleic acids while maintaining amplification sensitivity.

[0064] In preferred embodiments the amount of EMA added is sufficient to bind

contaminating nucleic acids. In a preferred embodiment, EMA may be used at a concentration of between lμg/ml and 5μg/ml. More preferably, the EMA concentration is about 3μg/ml.

Mesophilic Nucleic Acid Modifying Enzymes

[0065] In embodiments where sample cells containing a target nucleic acid for amplification are likely to be dead or damaged, other nucleic acid deactivating reagents may be used. The nucleic acid deactivating reagent should be incapable of diffusing into the cellular material. Typically, larger molecules such as a mesophilic nucleic acid modifying enzymes may be used. Preferably, the enzymes used will not hydrolyse or modify the oligonucleotides necessary for PCR, for example, nucleases that modify or hydrolyse short single-stranded nucleic acids cannot be used. However, in some embodiments nucleases that modify or hydrolyse short single- stranded nucleic acids may be used if the oligonucleotides used for the amplification step are modified such that they are resistant to cleavage by the nuclease. For example, a 5¹ modification of a single stranded oligonucleotide may be used to render the oligonucleotide resistant to 5¹- specific exonucleases.

[0066] In a preferred embodiment, the nucleic acid modifying enzyme is combined with a nucleic acid extraction reagent, e.g., thermophilic proteinase, that possesses a different temperature activation profile than the mesophilic nucleic acid modifying enzyme. In this embodiment, activation of the mesophilic nucleic acid modifying enzyme would involve applying thermal energy to raise the temperature of the sample containing the mesophilic nucleic acid modifying enzyme to a level suitable for activation but not high enough to activate the thermophilic proteinase to any significant level. For example, in a preferred embodiment, the mesophilic nucleic acid modifying enzyme may be incubated at about 20 to 45°C for a period of time sufficient to convert the mesophilic nucleic acid modifying enzyme from an inactive from to an active form. In another preferred embodiment the mesophilic nucleic acid modifying enzyme is incubated at about 65 to 80⁰C for a period of time sufficient to convert the mesophilic nucleic acid modifying enzyme from the active form to the inactive form.

[0067] In certain embodiments a mesophilic nucleic acid modifying enzyme such as a nuclease may be used, particularly in combination with PCR, qPCR or RT-PCR amplification methods.

[0068] In other embodiments the mesophilic nucleic acid modifying enzyme may be a double-strand specific endonuclease (e.g. a restriction endonuclease); a double-strand specific exonuclease; a single-strand specific nuclease with low activity on short molecules; or a nucleic acid modifying enzyme that is specific to double-stranded nucleic acids.

[0069] In a particular embodiment the mesophilic nucleic acid modifying enzyme may be T7 exonuclease, T7 endonuclease 1, Exo III, a frequent-cutter restriction endonuclease, or any mixture thereof.

[0070] In another embodiment mesophilic nucleic acid modifying enzymes may be used to deactivate contaminating nucleic acids associated with reverse transcription PCR. The mesophilic nucleic acid modifying enryme may be an RNAse, an RNAseH, or an RNA modifying enzyme.

[0071] After a sample has been treated with a nucleic acid deactivating reagent and the nucleic acid deactivating reagent is either at a suitable level or has become inactivated, target nucleic acid can be extracted from the sample. Methods for the treatment of sample with a thermophilic proteinase to extract target nucleic acids are described below.

Nucleic Acid Extraction

[0072] Preferred methods for extracting target nucleic acid from a biological sample comprising cells are described herein. As used herein, the terms "extracting" and "extraction" refer to the process of increasing the availability of nucleic acid within a sample for processing by other manipulations. Implicit in the concept of nucleic acid extraction is that the target nucleic acid is sufficiently free of interfering substances such as inhibitors, nucleases, other enzymes, and nucleoproteins, and that it is effective in other manipulation methods. It is understood that the nucleic acid is not necessarily purified away from non-interfering compounds as to do so serves no purpose in the present device. The nucleic acid treatment minimizes the negative effects of interfering compounds.

[0073] hi order to minimize sample contamination by contaminating nucleic acids, it is preferable that the nucleic acid extraction be performed in combination with amplification reactions requiring the least possible number of opening, adding, or removals from the reaction tube. Preferably the extraction occurs in the same reaction vessel as target nucleic acid amplification. US Patent No. 7,547,510, which is hereby incorporated by reference, discloses a method of nucleic acid extraction using thermophilic proteinases that are able to be combined with nucleic acid amplification in a single reaction vessel.

[0074] Samples can be obtained from a wide range of substrates including clinical, food and beverage or environmental samples. Typically, microbial samples are obtained from

environmental sources and for food testing by either taking a sample-of a liquid or solid, or by swabbing a solid surface. Conveniently, clinical samples may be taken from tissues, blood, serum, plasma, cerebrospinal fluid, urine, stool, semen, swabs, or saliva. Tissue samples may be obtained using standard techniques such as cell scrapings or biopsy techniques to collect animal tissue. Similarly, blood sampling is routinely performed, for example for pathogen testing, and methods for taking blood samples are well known in the art. Likewise, methods for storing and processing biological samples are well known in the art. For example, tissue samples may be frozen until tested. In addition, one of skill in the art would realize that some test samples would be more readily analyzed following a fractionation or purification procedure, for example, separation of whole blood into serum or plasma components.

[0075] Samples for forensic purposes are typically, blood, saliva, semen, skin, hair, bones or teeth. Typically, the more problematic samples where the target nucleic acid is considered to be trace or "low copy number" are degraded stains or bones, teeth, and hair from historic cases.

[0076] Samples used for species identification, anthropology, phylogenetics, and "bar coding" come from a wide variety of sources but include archaeological digs, bones, feathers and hair, and also preserved museum samples such as those stored in formalin, alcohol, or paraffin wax.

[0077] In preferred embodiments, samples comprising cells from which target nucleic acids are extracted are blood, urine, saliva, semen, stool, tissue, swabs, tears, or mucus samples. In another preferred embodiment the sample is from bacteria, fungi, archaea, eukarya, protozoa, or virus. In another preferred embodiment the sample is a mixture of, salt water, fresh water, ice, soil, waster material, and food. In another preferred embodiment the sample is blood, urine, saliva, semen, stool, tissue, swabs, tears, bone, teeth, hair, or mucus. The sample can also be skin, a feather, or preserved or historic specimens.

Thermophilic Proteinases

[0078] In preferred embodiments, thermophilic proteinases are used to extract nucleic acid from biological samples. Thermophilic proteinases have protein degradation activity at high temperatures. As used herein, the term "thermophilic proteinase" refers to a proteinase having optimal proteolytic activity at elevated temperatures, for example, from about 65-80⁰C, and includes proteinases isolated from thermophilic organisms and proteinases isolated from organisms other than thermophilic organisms that have optimal proteolytic activity as described above, including any variants of such proteases such as those that have subsequently been modified or engineered.

[0079] Thermophilic proteinases particularly suitable for use in the methods described herein include those that are heat denaturable and/or exhibit auto-catalytic activity at or above about 9O⁰C, and are preferably permanently heat-inactivated at elevated temperatures, for example, at temperatures at or above about 90⁰C. In certain embodiments, the preferred characteristics for a thermophilic proteinase to be used include: 1) being substantially stable and active within the range of about 65-80°C, and

2) being able to be readily inactivated and/or denatured at or above about 90°C, and

3) optionally having a temperature-activity profile such that it has low activity below 4O⁰C such that any accompanying mesophilic enzymes for removing cell-walls, for example, are not degraded.

[0080] A preferred incubation temperature required to activate the thermophilic proteinase and extract the target nucleic acid by effecting one or more of the lysis of cells, digestion of proteins, digestion of cell-wall enzymes may be 75⁰C. The preferred incubation temperature required to cause auto-catalysis of the thermophilic proteinase may be 95°C. However, it should be appreciated that these temperatures are given by way of example only and are not meant to be limiting in any way. It is anticipated that the proteinases will have differing profiles for both enzyme activity and stability over a range of temperatures and that such enzyme dynamics would be known to a skilled artisan. It is also anticipated such enzyme profiles for the proteinases could be determined with minimal experimentation.

[0081] In preferred embodiments the thermophilic proteinase is EAl proteinase, a neutral proteinase isolated from Bacillus species strain EAl, and variants thereof; and AkI proteinase, a serine protease isolated from Bacillus species strain AkI, and variants thereof.

[0082] In a particularly preferred embodiment EAl proteinase may be used. EAl proteinase can be activated and degraded (through auto-lysis) via temperature shifts. For example, EAl proteinase is active when incubated at about 65-80⁰C. At this temperature, cells of a sample are lysed and the EAl proteinase degrades contaminating protein and also rapidly removes DNA- degrading nucleases at temperatures where these nucleases are inactive, thereby minimising degradation of the target nucleic acid.

[0083] In certain embodiments extraction of target nucleic acid from a sample in a closed- system includes the steps of:

1) adding at least one thermophilic proteinase to a sample containing nucleic acid for

testing, and

2) incubating the sample for a preferred period of time at about 65-8O⁰C as required to effect one or more of the lysis of cells, digestion of proteins and digestion of cell-wall enzymes, where the thermophilic proteinase is stable and active at about 65-8O⁰C but is inactivated and/or denatured when the sample is incubated at or above about 9O⁰C without requiring the addition of further denaturing agents.

[0084] While in preferred embodiments a thermophilic proteinase may be used, this should not been seen as a limitation for other enzymes that could also conceivably be used with the methods described herein.

Other Extraction Enzymes

[0085] In certain embodiments, mesophilic enzymes, active at lower temperatures than thermophilic proteinases, may be mixed with a thermophilic proteinase and used to weaken and/or remove cell walls from plant, fungal tissue, bacteria, spores and biofilms before activating the thermophilic proteinase and continuing with the closed-system nucleic acid extraction. The practice of the disclosed method relies on the proteinase and/or a proteinase/cell-wall degrading enzyme having differential activities at different temperatures. By cycling through the variable temperatures, the activities of different enzymes can be brought into play without the need for opening the system to add new reagents.

[0086] In a preferred embodiment, a method using mesophilic enzymes with a thermophilic proteinase further includes the steps of: a. adding at least one mesophilic enzyme and at least one non-specific thermophilic enzyme to a sample comprising a target nucleic acid for testing, and b. incubating the sample for a preferred period of time below about 40⁰C as required to effect removal of any cell walls from cells of a sample.

[0087] A preferred initial incubation temperature required to effect removal of any cell walls via activity of the mesophilic enzyme may be 37°C. Once again, this should not be seen as a limitation in any way.

[0088] In certain embodiments the mesophilic enzyme may be a cellulase or a lysozyme.

[0089] The thermophilic proteinases can also be used in combination with other hydrolases that will burst or weaken cell walls. This allows for the extraction of target nucleic acids from recalcitrant cells, such as plant cells, tough bacterial cells, or fungal spores obtained from the environment (such as soil, rock, water and plant material samples, for example) or from subjects, including tissues or fluids from a subject. [0090] After a sample has been treated with a nucleic acid deactivating reagent, treated with a reagent to extract target nucleic acid, and the extraction reagent has been inactivated, the target nucleic acid in the sample can then be amplified. Known nucleic acid sequences of interest can be amplified by PCR-based methods or isothermal-based methods described below.

Amplification of Target Nucleic Acid

[0091] Preferred nucleic acid amplification methods are described herein. The amplification methods may include PCR-based and isothermal-based methods for amplifying target nucleic acids of interest from a sample after the sample has been treated with a nucleic acid deactivating reagent to inhibit any contaminating nucleic acids and the target nucleic acid has been extracted from the sample by any of the methods detailed above. In certain embodiments the process of target nucleic acid amplification may be automated.

PCR Amplification

[0092] Reagents for PCR typically include a set of primers for each target nucleic acid, a DNA polymerase (preferably a thermostable DNA polymerase), a DNA polymerase cofactor, and one or more deoxyribonucleoside-5' -triphosphates (dNTP's) or similar nucleosides. Other optional reagents and materials used in PCR are described below.

[0093] A DNA polymerase is an enzyme that will add deoxynucleoside monophosphate molecules to (usually the 3 '-hydroxy) end of the primer in a complex of primer and template, but this addition is in a template dependent manner. Generally, synthesis of extension products proceeds in the 5' to 3' direction of the newly synthesized strand until synthesis is terminated. Useful DNA polymerases include, for example, Taq polymerase, E. coli DNA polymerase I, T4 DNA polymerase, Klenow polymerase, reverse transcriptase and others known in the art.

Preferably, the DNA polymerase is thermostable meaning that it is stable to heat and

preferentially active at higher temperatures, especially the high temperatures used for priming and extension of DNA strands. More particularly, thermostable DNA polymerases are not substantially inactive at the high temperatures used in polymerase chain reactions as described herein. Such temperatures will vary depending on a number of reaction conditions, including pH, nucleotide composition, length of primers, salt concentration and other conditions known in the art.

[0094] Particularly useful polymerases are those obtained from various Thermus bacterial species, such as Thermus aquaticus, Thermus thermophilus, Thermus filiformis, and Thermus flavus. Other useful thermostable polymerases are obtained from various microbial sources including Thermococcus literalis, Pyrococcus furiosus, Thermotoga sp. And those described in WO-A-89/06691 (published JuI. 27, 1989). Some useful thermostable polymerases are commercially available, such as, AmpliTaq ", Tth, and UlTma " from Perkin Elmer, Pfu from Stratagene, and Vent and Deep- Vent from New England Biolabs. Other polymerases are complexed with other molecules that render them inactive until a high temperature is applied. Typically, an antibody is used. An example of such a polymerase is Platinum^® Taq from

Invitrogen. A number of techniques are also known for isolating naturally-occurring

polymerases from organisms, and for producing genetically engineered enzymes using recombinant techniques.

[0095] A DNA polymerase cofactor refers to a non-protein compound on which the enzyme depends for activity. Thus, the enzyme is catalytically inactive without the presence of cofactor. A number of materials are known co factors including, but not limited to, manganese and magnesium salts, such as chlorides, sulfates, acetates and fatty acids salts. Magnesium chlorides and sulfates are preferred.

[0096] Also needed for PCR are two or more deoxyribonucleoside-5 '-triphosphates, such as two or more of dATP, dCTP, dGTP and dTTP. Analogues such as dITP, dUTP, and 7-deaza- dGTP are also useful. Preferably, the four common triphosphates (dATP, dCTP, dGTP and dTTP) are used together.

[0097] The PCR reagents described herein are provided and used in PCR in suitable concentrations to provide amplification of the target nucleic acid. The minimal amounts of primers, DNA polymerase, cofactors and deoxyribonucleoside-5 '-triphosphates needed for amplification and suitable ranges of each are well known in the art. The minimal amount of DNA polymerase is generally at least about 0.5 units/1 OOμl of solution, with from about 2 to about 25 units/1 OOμl of solution being preferred, and from about 7 to about 20 units/1 OOμl of solution being more preferred. Other amounts may be useful for given amplification systems. A "unit" is defined herein as the amount of enzyme activity required to incorporate 10 nmoles of total nucleotides (dNTP's) into an extending nucleic acid chain in 30 minutes at 74°C. The minimal amount of primer is at least about 0.075μMol with from about 0.1 to about 2μMol being preferred, but other amounts are well known in the art. The cofactor is generally present in an amount of from about 2 to about 15mMol. The amount of each dNTP is generally from about 0.25 to about 3.5mMol.

[0098] The PCR reagents can be supplied individually, or in various combinations, or all in a buffered solution having a pH in the range of from about 7 to about 9, using any suitable buffer, many of which are known in the art. .

[0099] Other reagents that can be used in PCR include, for example, antibodies specific for the thermostable DNA polymerase. Antibodies can be used to inhibit the polymerase prior to amplification. Preferably, the antibodies are specific for the thermostable DNA polymerase, inhibit the enzymatic activity of the DNA polymerase at temperatures below about 5O⁰C and are deactivated at higher temperatures. Useful antibodies include monoclonal antibodies, polyclonal antibodies and antibody fragments. Preferably, the antibody is monoclonal. Antibodies can be prepared using known methods such as those described in Harlow et al., Antibodies: A

Laboratory Manual, Cold Spring Harbor, N.Y. (1988). [00100] Once the PCR reagents have been supplied, thermal cycling can be achieved using a heating device and controller. PCR reactions can be multiplexed to assay for several target nucleic acids simultaneously.

[00101] In certain embodiments standard PCR methods may be use. In other particularly preferred embodiments qPCR, reverse-transcription PCR, or multiplex PCR methods may be used.

[00102] As used herein the terms "qPCR," "quantitative PCR," and "real-time PCR" are used interchangeably to refer to a method of polymerase chain reaction (PCR) where a target nucleic acids can be simultaneously amplified and quantified. In qPCR assay a positive reaction is detected by accumulation of a fluorescent signal. The C_T (cycle threshold) is defined as the number of .cycles required for the fluorescent signal to cross the threshold (i.e. exceeds background level). Cj levels are inversely proportional to the amount of target nucleic acid in the sample (Le. the lower the C_T level the greater the amount of target nucleic acid in the sample).

Isothermal Amplification

[00103] Another aspect of the disclosure is directed to isothermal amplification methods to detect target nucleic acid, wherein the method relies on the target nucleic acid-dependent amplification of signal from a detectable label bound to a nucleic acid probe. Methods of isothermal amplification are described in PCT Application No. PCT/NZ2007/000197.

Isothermal amplification can be by strand displacement amplification, rolling circle

amplification, loop-mediated isothermal amplification, isothermal chimeric primer-initiated amplification of nucleic acids, Q-beta amplification systems or OneCutEventAmplificatioN.

[00104] Techniques that may be exploited during isothermal amplification are Nuclease Chain Reaction (NCR), RNAse-mediated Nucleases Chain Reaction (RNCR). Both of these methods replace strand displacement with the selective degradation of one of the strands of DNA. The process can be initiated by using restriction endonucleases or RNAse H when one of the strands contains ribonucelotides. The Polymerase Nuclease Chain Reaction (PNCR) relies on nuclease cleavage in the presence of target DNA followed by an extension process using a DNA polymerase, RNAse-Mediated Detection (RMD) which is a method of strand degradation by RNAse H on DNArRNA hybrids. RMD is an effective linear amplification system that is sometimes used in combination with other methods. Tandem Repeat Restriction Enzyme Facilitated (TR-REF) Chain Reaction or Inverted reverse Complement Restriction Enzyme Facilitated (IRC-REF) Chain Reaction are two variants of a method that relies on the cyclical production of a detector probe that contains tandem repeats. These repeats are copied by a DNA polymerase when a specific oligonucleotide trigger can act as a primer. Next, restriction endonucleases attack the newly formed double-stranded DNA and this releases the original primer and a second primer so that two new cycles can be initiated. Isothermal amplification reactions can be multiplexed to assay for several target nucleic acid sequences of interest simultaneously.

[00105] It will also be appreciated that some nucleic acids exist that possess "strand invasion" properties, whether such strand invasion results in the displacement of the complementary strand of the target nucleic acid and the formation of a target probe duplex, or the formation of a target probe triplex, without the target sequence first being single-stranded. Peptide Nucleic Acids (PNAs) and derivatives thereof may be capable of strand invasion, whereby probes currently disclosed containing target nucleic acid binding regions comprising PNAs can be used to detect target nucleic acid that has not been rendered fully single-stranded. The use of target-binding regions comprising PNAs is particularly contemplated in circular probes, where, prior to the formation of the target probe hybrid, the target-binding region of the probe may be substantially double-stranded.

[00106] As used herein, "target-binding domain" and its equivalent "target binding region" refer to nucleic acid sequence present in a nucleic acid molecule that is sufficiently

complementary to nucleic acid sequence present in the target nucleic acid to allow the hybridisation of the target-binding region and the target nucleic acid, and so to form a target probe hybrid.

SNP Assays

[00107] Two growing fields of use for DNA-based diagnostics are personalised medicine and livestock pedigree analysis using Single Nucleotide Polymorphism (SNP) analysis. A demonstration of the importance of the field is the International HapMap Project, whose goal is to develop a complete haplotype map of the human genome. Single Nucleotide Polymorphisms can provide genetic markers for specific traits and diseases. A number of successful platforms and technologies are available for identifying the allele at a defined SNP locus. Single SNP's can be interrogated by a variety of polymerase-based techniques such as PCR and primer extension. In some cases, the products of a primer extension system are analyzed in multiplex using mass spectroscopy. Other methods such as the Invader technology, uses enzymes that are sensitive to mismatches in DNA sequences (Oliver, 2005). Alternatively, there are li'gase-based and nuclease-based assays or methods that rely on the hybridization kinetics of short

oligonucleotides to polymorphic regions of the genome. Examples of the latter approach are the Affymetrix high density arrays.

Amplification Detection

[00108] In certain embodiments the methods for amplifying target nucleic acids may be reliant on detecting or measuring the signal from a label, preferably the light emission of a probe labelled with a light-emitting label. The term "label", as used herein, refers to any atom, molecule, compound or moiety which.can be attached to a nucleic acid, and which can be used- either to provide a detectable signal or to interact with a second label to modify the detectable signal provided by the second label. Preferred labels are light-emitting compounds which generate a detectable signal by fluorescence, chemiluminescence, or bioluminescence. Still more preferred labels are light-emitting compounds the signal of which is diminished or rendered undetectable when in sufficiently close proximity to a masking group, for example, a quenching chromophore. In particularly preferred embodiments nucleic acid amplification may be detected by fluorescence.

{00109] Light emitting labels may be used in PCR and isothermal detection methods.

Mechanisms by which the light emission of a compound can be quenched by a second compound are described in Morrison, 1992, in Nonisotopic DNA Probe Techniques (Kricka ed., Academic Press, Inc. San Diego, Calif.), Chapter 13. Mechanisms may include fluorescence energy transfer (FRET), non-radiative energy transfer, long-range energy transfer, dipole-coupled energy transfer, and Forster energy transfer. The primary requirement for FRET is that the emission spectrum of one of the compounds, the energy donor, must overlap with the absorption spectrum of the other compound, the energy acceptor. Styer and Haugland, 1967, Proc. Natl. Acad. Sci. U.S.A. 98:719, incorporated herein by reference, show that the energy transfer efficiency of some common emitter-quencher pairs can approach 100% when the separation distances are less than 10 angstroms. The energy transfer rate decreases proportionally to the sixth power of the distance between the energy donor and energy acceptor molecules.

Consequently, small increases in the separation distance greatly diminish the energy transfer rate, resulting in an increased fluorescence of the energy donor and, if the quencher chromophore is also a fluorophore, a decreased fluorescence of the energy acceptor. In the methods, the signal emission of label, preferably a fluorescent label, bound to the probe is detected. [00110] Exposure of a detection sequence means the detection sequence is rendered accessible for detection, for example accessible for binding to a detection probe. Conversely, the terms "hidden" or "masked" and their grammatical equivalents mean that the element(s) in respect of which these terms are used is/are not accessible. For example, a detection sequence may be hidden or masked when bound to nucleic acid molecule other than a detection probe. The term "hybridization" and grammatical equivalents refers the formation of a multimeric structure, usually a duplex structure, by the binding of two or more single-stranded nucleic acids due to complementary base pairing.

[00111] Alternative labelling systems can be also be used that demonstrate the cleavage of a label from moiety that can be bound to a solid matrix. An example would be a biotin label that could be bound to immobilised avidin and thus non-cleavage of the probe would bind a secondary label present on the other end of the probe. Such a method would have applications for dipstick-based detection. Yet more detection system may use labels that can be distinguished by nanopore technology. The methods described herein are applicable to the detection of probes labelled with a single label, although multiple labels may be employed. Detection of the cleaved probe occurs when the label, for example a fluorophore, is sufficiently removed from the masking group, for example a quencher, by the cleavage event, or the probe-denaturing process the cleavage event allows. This diminishes the interaction of the masking group and the label • and so allows emission of the signal. As used herein, the term "masking group" means any atom, molecule, compound or moiety that can interact with the label to decrease the signal emission of the label. The separation of label and masking group resulting from the cleavage event or the probe-denaturing process the cleavage event allows in turn results in a detectable increase in the signal emission of the attached label. Depending on the label, signal emission ^ may include light emission, particle emission, the appearance or disappearance of a colored compound, and the like. _^

[00112] Preferred light-emitting labels and masking groups that can interact to modify the light emission of the label are described below. The term "chromophore" refers to a nonradioactive compound that absorbs energy in the form of light. Some chromophores can be excited to emit light either by a chemical reaction, producing chemiluminescence, or by the absorption of light, producing fluorescence. The term "fluorophore" refers to a compound which is capable of fluorescing, i.e. absorbing light at one frequency and emitting light at another, generally lower, frequency. [00113] The term "bio luminescence" refers to a form of cherniluminescence in which the light-emitting compound is one that is found in living organisms. Examples of bioluminescent compounds include bacterial luciferase and firefly luciferase. The term "quenching" refers to a decrease in fluorescence of a first compound caused by a second compound, regardless of the mechanism. Quenching typically requires that the compounds be in close proximity. As used herein, either the compound or the fluorescence of the compound is said to be quenched, and it is understood that both usages refer to the same phenomenon.

[00114] Many fluorophores and chromophores described in the art are suitable for use in the methods presently disclosed. Suitable fluorophore and quenching chromophore pairs are chosen such that the emission spectrum of the fluorophore overlaps with the absorption spectrum of the chromophore. Preferably, the fluorophore would have a high Stokes shift (a large difference between the wavelength for maximum absorption and the wavelength for maximum emission) to minimize interference by scattered excitation light.

[00115] Suitable labels which are well known in the art include, but are not limited to, fluorescein and derivatives such as FAM, HEX, TET, and JOE; rhodamine and derivatives such as Texas Red, ROX, and TAMRA; Lucifer Yellow, and coumarin derivatives such as 7-Me2N- coumarin-4-acetate, T-OH-Φ-CH.S-coumarin-S-acetate, and 7-NH2-4-CH3-coumarin-3-acetate (AMCA). FAM, HEX, TET, JOE, ROX, and TAMRA are marketed by Perkin Elmer, Applied Biosystems Division (Foster City, Calif.)- Texas Red and many other suitable compounds are marketed by Molecular Probes (Eugene, Oreg.). Examples of chemiluminescent and

bioluminescent compounds that may be suitable for use as the energy donor include luminol

(aminophthalhydrazide) and derivatives, and Luciferases.

[00116] While in most embodiments it will be preferred that the detectable label be a light- emitting label and the masking group be a quencher, such as a quenching chromophore, other detectable labels and masking groups are possible. For example, the label may be an enzyme and the masking group an inhibitor of said enzyme. When the enzyme and inhibitor are in sufficiently close proximity to interact, the inhibitor is able to inhibit the activity of the enzyme. On cleavage or denaturation of the probe, the enzyme and inhibitor are separated and no longer able to interact, such that the enzyme is rendered active. A wide variety of enzymes capable of catalysing a reaction resulting in the production of a detectable product and inhibitors of the activity of such enzyme are well known to the skilled artisan, such as 13-galactosidase and horseradish peroxidise. Combined Methods for Deactivating Contaminating Nucleic Acids, Extracting and

Amplifying a Target Nucleic Acid

[00117] The methods for deactivating contaminating nucleic acids, extracting target nucleic acid from a sample, and amplifying target nucleic acid described herein are compatible and may be combined in a single closed system. In a preferred embodiment the closed system comprises a single vessel or tube.

[00118] Preferably, the reagents for deactivating contaminating nucleic acids, extracting target nucleic acid from a sample, and amplifying target nucleic acid are provided in a manner allowing the system to remain closed after deactivation of contaminating nucleic acids.

[00119] In certain embodiments, compatible reagents are provided in a single mixture and then the system is closed. In other embodiments where the reagents are not compatible, the reagents can be functionally sequestered and provided sequentially.

[00120] In a particularly preferred embodiment the nucleic acid deactivating reagent is compatible with the nucleic acid extracting reagent (e.g. thermophilic proteinase) and can be added in a single mixture, hi a non-limiting example a mesophilic nucleic acid modifying deactivating reagent is active at about 25-40°C and inactive at about 65-8O⁰C, while the thermophilic proteinase is inactive at about 25-40°C and active at about 65-80⁰C.

In another preferred embodiment the deactivating reagent and nucleic acid extracting reagent are also compatible with nucleic acid amplification reagents and can be provided in a single mixture By way of example, the nucleic acid amplification reagents may be unaffected by the enzymes and the process for deactivating contaminating nucleic acids and extracting the target nucleic acid. For example, the DNA polymerase may be resistant to proteolytic cleavage by

thermophilic proteinase.

[00121] Under such circumstances, the nucleic acid deactivating reagent may be provided in combination with the extraction and amplification reagents. For example, the deactivating reagent may be provided in combination with a PCR master mix, containing all the required components to carry out a PCR reaction (buffer containing deoxyribonucleotides, divalent ions, oligonucleotide primers, and DNA polymerase) except the target DNA to be amplified.

[00122] In other embodiments where the nucleic acid amplification reagents are not fully compatible with the other reagents, the reagents may be functionally sequestered in a closed system and provided sequentially. For example, some DNA polymerases such as Tag DNA polymerase are degraded by the thermophilic proteinase in the extraction reagents, so post- extraction delivery strategies for the polymerase should be considered. Possible strategies may include: (1) delivery of the polymerase and any other sensitive reagents after the deactivation and extraction processes are complete. This may be a delivery via an inlet port by microfluidics or a solid dispenser. (2) The polymerase and other sensitive reagents can be added to the deactivation and extraction reagents in a protected form. This can be in the form of a bead or film with the sensitive reagents microencapsulate within. (3) The polymerase can be modified to protect it from the thermophilic proteinase for example by the attachment of antibodies. (4) Novel polymerases can be used that are resistant to proteolytic cleavage. In certain embodiments the amplifying reagents are added by microfluidics or a solid dispenser. In other embodiments the amplifying reagents are added by microcapsules comprising the amplifying reagents.

[00123] In a preferred embodiment the microcapsules are pre-disposed in the vessel or tube in which the amplification will be carried out. In another preferred embodiment the microcapsules are heat-labile capsules. In still other embodiments the heat-labile capsules are agarose or wax beads. In yet other embodiments the heat-labile capsules release amplification detecting reagents when exposed at a temperature sufficient to melt or dissolve the capsules.

[00124] In certain embodiments where the nucleic acid deactivating reagent is use in combination with quantitative PCR amplification methods, EMA fluorescence should be taken into account for the quencher and/or reporter dyes used with quantitative PCR.

Devices for the Deactivation of Contaminating Nucleic Acids, and Extraction and

Amplification of Target Nucleic Acid

[00125] In a preferred embodiment the closed system comprising a single vessel or tube for deactivating contaminating nucleic acids, extracting target nucleic acid, and amplifying target nucleic acid may be a device. Figure 2 illustrates a non-limiting example of a preferred embodiment of a device. The preferred device may include an external stimulus source for converting the nucleic acid deactivating reagent from an inactive form to an active form. For example in certain embodiments, a source of specific narrow spectrum wavelength light, broad spectrum white light, or UV light activates EMA by causing photolysis to occur. The preferred device would also allow for closed-system reactions, thus requiring little more than simple physical modulation of a reaction between sample insertion and result generation. Preferably, light and temperature are used to initiate and stop sequential chemical reactions allowing multi- step procedures to be performed without complex pumps, valves or microfluidics. Light and heat can be controlled by many simple devices including microelectronics, LEDs, Peltier plates or incandescent light bulbs.

[00126] In certain preferred embodiments the device may be compatible with reaction conditions for all stages of the combined method, deactivating contaminating nucleic acids, to extracting target nucleic acids from a sample, to amplifying the target nucleic acid. This system can be integrated with existing technologies.

[00127] In a preferred embodiment, the device includes a single chamber. In another embodiment the chamber is dark or light-tight. In a further embodiment the chamber holds an externally supplied tube (e.g. a PCR tube) or plate (e.g. a 96- well microtiter plate), which is placed within the device, hi a yet another embodiment, the device may comprise an inlet port, an outlet port, a chamber, a detector for emitted fluorescence, and an excitation light source. In a preferred embodiment the device may further comprise a means for controlling the temperature within the chamber. In some embodiments, the device also comprises a light source for activating a nucleic acid deactivating reagent. In certain embodiments the deactivating reagent- activating light source may be an incandescent lamp, a fluorescent lamp, or an array of light emitting diodes.

[00128] In other embodiments, the device further includes microfluidics, microchips, nanopore technologies and miniature devices. The device or components of the device may be disposable. The device may also be hand-held.

[00129] It should be appreciated that the present described devices and methods may have applications for a range of nucleic acid diagnostic techniques where clean-up of nucleic acids to remove contaminants is particularly beneficial, or for diagnostic techniques where the present devices and methods may be adapted to achieve a similar beneficial outcome.

Computer Related Embodiments

[00130] Device control can be achieved by standard electronic methods using hardware, software and firmware typical of thermal cycling devices. Likewise, any integrated detection system could use similar programmable devices.

[00131] Data produced by the detection device may range from a simple yes/no detection when the device is used for detecting a specific agent to real-time data where the time is measured for the signal to reach a pre-defined threshold thereby giving quantitative data.

Similarly, electrophoretic data could be produced in the form the taken for peaks of fluorescence to reach a detector placed at a point along a capillary electrophoresis device.

[00132] Data analysis can be achieved using a computer program supplied to the device either via and external electronic port, wireless technology, an internal storage device or internal firmware. For simple purposes for example a device with a specific role of determining the presence or absence of a single target nucleic acid, reporting may be in the form of any visible indicator such as a light or and LCD or LED display.

[00133] Where data requires more complex analysis or a greater level of user input, the raw data, processed data or partially processed data can be transferred to an external computer via any form of removable storage device or a communications cable.

[00134] In certain embodiments, the results can utilize wireless technology to obtain data base information or use database information stored on the device that may aid in the identification of target nucleic acid present in the sample. Results can be binary, i.e. present or not present, or they can be quantitative or multivariate.

EXAMPLES

[00135] Aspects of the present disclosure have been described by way of example only and it should be appreciated that modifications and additions may be made thereto without departing . from the scope thereof as defined in the appended claims.

Example 1: Use of ethidium monoazide in a combined nucleic acid amplification process

Background

[00136] The experiment described below demonstrates the unexpectedly significant increase in amplification detection sensitivity of adding ethidium monoazide treatment to deactivate contaminating nucleic acids in a closed system method of extracting and amplifying target nucleic acid from samples.

[00137] The experiment was performed on a dilution series of Escherichia coli cells, and the presence of the cells was detected with universal 16S rRNA oligonucleotide primers. These primers are typical of the type used in microbial analysis. Their advantage is that they can be used for any known bacterial species; their disadvantage is that they also detect any contaminating bacterial DNA. The purposes of the experiment were to demonstrate that reagent purification, DNA extraction and DNA amplification by qPCR could be carried out in a single sealed vessel using only light and heat to control the reaction; and to demonstrate a significant improvement in the lower detection limits achieved by this process.

[00138] Under normal qPCR conditions using more that 25 cycles with, for example, universal 16S rRNA primers carries a high risk of false positives or the misidentification of the organisms present in a sample. This is demonstrated in Figure 2 where the dashed line indicates that the average Cy value of the negative controls (qPCR reactions containing only ultra-pure water). The value is approximately 25 cycles. When EMA is used, the average C_T value of the negative control increases to 37 cycles. This allows at least an extra 10 cycles to be used in the qPCR, thereby increasing sensitivity by a large factor before the background level becomes a problem.

Materials and Methods

[00139] In the following experiment, all work was performed in a PCR hood situated in an air-locked laboratory with positive air pressure generated through a HEPA filter. Only previously unopened reagents were used. Previously unopened tubes, PCR plates and filter-tips were used. All surfaces were swabbed with 1% sodium hypochlorite prior to the experiment.

Reagents

[00140] The following reagents were used:

1. EA 1 proteinase (ZyGEM Corporation Ltd) at 1 U/μl

2. GIBCO UltraPure^™ (Invitrogen) Distilled water

3. Quanta Bioscience qPCR reagents

4. Ethidium monoazide at 0.1 mg/ml

5. Optically clear 96-well PCR plates (Axygen)

6. Maximum recovery filter tips (Axygen).

7. qPCR Primers at 1 OμM

[00141] The qPCR primers had the following sequences:

1. Forward Primer: GTCGTCAGCTCGTGTTGTGA (SEQ ID NO: 1 )

2. Reverse Primer: GCCCGGGAACGTATTCAC (SEQ ID NO: 2). [00142] The Quanta Bioscience qPCR reagents include dNTP's, buffer, MgCl₂, and Taq DNA polymerase.

Method

[00143] Escherichia coli MGl 655 cells were grown overnight in LB broth. The cells were then centrifuged at 12,000RCF for 5 minutes and resuspended in water to a cell density of 2x10⁷ cells per ml. This density is the equivalent of 10^D cells per 5 μl. Cells were then diluted in a 1 : 10 serial dilution in ultra-pure water to approximately 10 cells per 5μl. Following the serial dilution, 5μl of each dilution was placed into 8 wells of an optically transparent 96- well microtiter plate.

[00144] The following cocktail was added was added to four replicates of each dilution under reduced light conditions with EMA present in this cocktail:

[00145] To another four replicates of each dilution the following cocktail was added without

EMA:

[00146] In addition to the above replicates of each dilution, four water controls were included for each reagent cocktail. The EAl proteinase and the Taq DNA polymerase were able to be added simultaneously because it has been observed that Taq DNA polymerase is highly resistant to inactivation by EAl proteinase. [00147] The 96-well microtiter plate was sealed with a transparent adhesive lid and held at 4°C for 5 minutes in the dark. The plate was then exposed through the seal to a 600W halogen lamp at a distance of 200mm from the plate for 5 minutes with the microtiter plate maintained at 4°C. The samples were then placed in an Applied Biosystems 7300 Real-time PCR System and cycled as follows:

[00148] The PCR steps were cycled 45 times, and fluorescence was measured at the 72°C, 30 sec step with excitation and emission for SYBR^® Green (494nm and 521nm, respectively).

Results

[00149] Figure 3 shows C_T values obtained for qPCR reactions performed in the absence of EMA. The results demonstrate that extraction and detection can be performed in a single reaction vessel without opening the tube. As can be seen by the dashed line, the highest Cj level that can be obtained is approximately 25 cycles. This is the Cj value of the negative control (ultra-pure water only). This Cj value equates to approximately 1,000 cells (genomes).

[00150] Figure 4 shows improved results when EMA treatment is used. EMA treatment is integrated into the entire reaction. Here, the negative control C_T has been raised to

approximately 37 cycles. Given that each cycle represents a doubling of DNA, this is an estimated 4,000-fold improvement in detection sensitivity. The addition of EMA to the system allowed for the detection of DNA in samples containing less than 10 cells per reaction.

Discussion

[00151] This experiment demonstrates that all steps in a combined process including deactivation of contaminating nucleic acids, extraction of target DNA, and PCR amplification of target DNA can be performed in a single, sealed vessel. AU reagents were simultaneously treated, as was the reaction vessel in which they were contained. This experiment also demonstrates the unexpectedly significant effect of including EMA treatment to deactivate contaminating nucleic acids in a closed system. As shown in Figure 4, adding EMA to a negative control, amplification cycles can be increased to approximately 37 cycles before contaminating DNA is detected. It was unexpected that combination of all three stages in the process of decontamination, extraction and detection into a single, closed-tube procedure, would be possible given that the reagents required for each step are intuitively incompatible. In this experiment, combining the processes into a single cocktail controlled by only external stimuli gave uninhibited extraction and amplification, while simultaneously causing such a large reduction in background. Each step in the process was uninhibited by the presence of reagents required for the other steps. The combined effect is that interfering background contamination is reduced to such an extent that the qPCR amplification can be extended by 12 cycles thereby providing an approximately 4000-fold enhancement in amplification detection sensitivity.

[00152] One advantage of this new method is that the integration of the contaminating nucleic acid deactivation step with the extraction and amplification steps has improved detection level by more than three orders of magnitude. This enhancement has been achieved by reducing the level of background noise, thereby allowing more amplification cycles to be used.

Maintaining a closed tube system for all stages of the reaction (including deactivation) also represents a significant enhancement in securing the sample from contamination.

[00153] Furthermore, integration of the deactivation step into the reaction allows all reagents and the reaction vessel to be simultaneously processed. This simplifies the procedure and enables easy automation. The integration of the deactivation step with the extraction step also allows for the detection of DNA from living cells and excludes DNA from contaminated reagents, sample matrix, dead cells or plastic-ware.

[00154] The potential for false positive results or incorrect results are greatly reduced.

Furthermore, due to the reduced back ground, the potential to identify trace and rare samples has been significantly increased.

Example 2: Comparison of combined EMA treatment, nucleic acid extraction and amplification and EMA pre-treatment

[00155] The combined nucleic acid amplification process incorporating EMA treatment described in Example 1 above is compared to EMA pre-treatment of sample prior to target DNA extraction and amplification.

[00156] The combined method is performed as described in Example 1 above. [00157] The EMA pre-treatment method is performed as follows: 0.1 μg/μl of EMA is added to samples in a 96-well microtiter plate and sealed with a transparent adhesive lid and is held at 4°C for 5 minutes in the dark. The plate is then exposed through the seal to a 600W halogen lamp at a distance of 200 mm from the plate for 5 minutes with the microtiter plate maintained at 4⁰C.

[00158J After the EMA pre-treatment step, the transparent adhesive lid is removed from the 96-well microtiter plate and Quanta PCR mix, Primer 1, Primer 2, and EAl proteinase lU/μl are added to each sample. The 96-well microtiter plate is then re-sealed with a transparent adhesive lid and placed in an Applied Biosystems 7300 Real-time PCR System. The qPCR is performed as described in Example 1 above.

[00159] The results of the combined EMA method and the EMA pre-treatment method are compared, and difference in amplification detection sensitivity is quantitated and the EMA method is found to have increased amplification detection sensitivity as compared to the EMA pre-treatment method.

Example 3: Use of a mesophilic nucleic acid modifying enzyme in a combined nucleic acid amplification process

[00160] A combined nucleic acid amplification process incorporating the use of a mesophilic nuclease for deactivating contaminating nucleic acids, and a thermophilic proteinase that is inactive on the DNA polymerase and can be used in combination with the deactivating nucleases by virtue of different temperature activation profiles.

[00161] Quantitative PCR incorporating a mesophilic nuclease and thermophilic proteinase is performed as follows:

1. prepare a reagent cocktail containing (i) target cellular material; (ii) one or more

mesophilic nuclease for deactivating contaminating nucleic acids; (iii) a thermophilic proteinase for extracting target nucleic acid, providing that the thermophilic proteinase has low activity on the amplification enzyme(s) used in the qPCR; (iv) necessary reagents for the qPCR (e.g. dNTP's, buffer, MgCI2, oligonucleotide primers, and Taq DNA polymerase).

2. incubate the reagent cocktail at about 20 to 45⁰C to activate the mesophilic nuclease for a period of time sufficient to degrade or inactivate any contaminating nucleic acids (the thermophilic proteinase has low activity at this temperature and does not affect the mesophilic nuclease).

3. incubate the reagent cocktail at about 65 to 80°C to activate the thermophilic proteinase (the proteinase simultaneously digests the mesophilic nuclease and mediates the lysis and degradation of the cellular material to release the target nucleic acid).

4. incubate the reagent cocktail at about 90 to 95°C to simultaneously activate the Taq DNA polymerase and inactivate the thermophilic proteinase.

5. perform the qPCR thermal cycling (amplification of the target nucleic acid) and

detection.

[00162] As can be seen in the example above, all of the steps in the process are temperature controlled and are carried out in a thermal cycler in a single closed tube or microtiter plate.

Example 4: A device with a controlled light source

[00163] Figure 2 illustrates one embodiment of the combined contaminating nucleic acid deactivation, nucleic acid extraction, and nucleic acid amplification process performed using a device. The device is a sealed unit with a light source for exposing a 96-well microtiter plate to light at a wavelength of 510nm that can, for example, activate the nucleic acid deactivating reagent ethidium monoazide (EMA) and lead to the covalent linkage of EMA with

contaminating nucleic acids. One purpose of the device is to simplify the application of EMA in a secure chamber that protects the sample from (i) extraneous ambient light, (ii) further contamination with nucleic acids, and (iii) protects the user from an intense light source.

[00164] The device of Figure 2 has dimensions suited for the 96-well microtiter plate, and consists of a light-tight (or partially light-tight) chamber with an array of light emitting diodes (LED's) that exposes the 96-well microtiter plate to light at a wavelength of 510nm, a timer that controls the dark incubation period and the light period, and a temperature-controlled block (Peltier Device, also known as a Termoelectric Cooler or TEC) for maintaining the 96-well microtiter plate at a desired temperature.

[00165] The advantages of using wavelength specific LED's are that less thermal energy is released resulting is less heating of the samples, less unnecessary wavelengths are used which also results in less heating, a lower power source can be used for the device, and will result in less photo-bleaching of fluorescent reagents. Furthermore, using an array of LED's ensures that all wells in the 96-well microtiter plate receive an equivalent amount of light.

[00166] Furthermore, the device of Figure 2 is used, for example, to deactivate contaminating nucleic acids in qPCR reagents. The combined nucleic acid amplification processes utilizing ethidium monoazide or mesophilic nucleases described in the above examples is used with the device of Figure 2. The device in conjunction with a nucleic acid deactivating agent has a particular advantage in qPCR.

[00167] Photobleaching of fluorescent dyes is a known problem in qPCR, and it has led to a significant investment in the development of more photostable DNA-binding dyes for use with qPCR (Mao et al., 2007). The surprising ability to incorporate a deactivation of contaminating nucleic acids step into qPCR, allows for higher photostability of the DNA-binding dyes in qPCR and ultimately higher sensitivity.

[Θ0168] Such a device could become an integrated part of a thermal cycler or a real-time PCR machine thereby creating a single piece of hardware capable of carrying out all of the steps from decontamination, through nucleic acid extraction, to amplification and detection.

REFERENCES

Bolton, P. H. and Kearns, D. R. (1978). Spectroscopic properties of ethidium monoazide: a fluorescent photoaffϊnity label for nucleic acid. Nucleic Acid Research 5(12), 4891-4903.

Bottger, E., C. (1990). Frequent contamination of Taq polymerase with DNA. Clinical

Chemistry 36(6), 1258-1259.

Cantrell, C. E., Yielding, K. L., Pruitt, K. M. (1979). Efficiency of photolytic binding of ' ethidium monoazide to nucleic acids and synthetic polynucleotides. Molecular Pharmacology 15(2), 322-330.

Carracedo, A., Bar, W., Lincoln, P., Mayr,W., Morling, N., Olaisen, B., Schneider, P., Budowle, B., Brinkmann, B:, Gill, P., Holland, M., Tully, G.,and Wilson, M. (2000) DNA Commission of the International Society for Forensic Genetics: guidelines for mitochondrial DNA typing. DNA Commission of the International Society for Forensic Genetics. Forensic Science International 10(2), 79-85.

Corless, C. E., Guiver,- M., Borrow, R., Edwards- Jones, V., Kaczmarski, E. B. and Fox. A. J. (2000). Contamination and sensitivity issues with a real-time universal 16S rRNA PCR. Journal of Clinical Microbiology 38(5), 1747-1752.

Garland, F., Graves, D., E., Yielding, L., W. and Cheung, H., C. (1980). Comparative studies of the binding of ethidium bromide and its photoreactive analogues to nucleic acids by fluorescence and rapid kinetics. Biochemistry 19(14), 3221-3226. Goto, M., Ando, S., Hachisuka, Y. and Yoneyama, T. (2005). Contamination of diverse nifH and nifH-like DNA into commercial PCR primers. FEMS Microbiologic Letters 246(1), 33-88.

Grahn, N., Olofsson, M., Ellnebo-Svedlund, K., Monstein, H., and Jonasson, J (2003)

Identification of mixed bacterial DNA contamination in broad-range PCR amplification of 16S rDNA Vl and V3 variable regions by pyrosequencing of cloned amplicons FEMS Microbiology Letters 219:87-91.

Graves, D. E., Watkins, C. L. and Yielding, L. W. (1981). Ethidium bromide and its

photoreactive analogues: spectroscopic analysis of deoxyribonucleic acid binding properties. Biochemistry 20(7), 1887-1892.

Hardwick J. M., von Sprecken R. S., Yielding, K. L., Yielding, L. W. (1984). Ethidium binding sites on plasmid DNA determined by photoaffinity labeling. Journal of Biological Chemistry 1259(17), 11090-11097.

Hilali, F., Saulnier, P., Chachaty, E. and Andremont, A. (1997). Decontamination of polymerase chain reaction reagents for detection of low concentrations of 16S rRNA genes. Molecular Biotechnology 7(3), 207-16.

Kitchin, P. A., Szotyori, A., Fromholc, C. and Almond N., 1990. Avoidance of false positive. Nature 344(6263), 201.

Lourdes Sampietro, M., Gilbert, T. P., Lao, O., Carmelli, D., Lari, M., Bertranpetit, J., Lalueza- Fox, C. (2006) Tracking down human contamination in ancient human teeth. Molecular Biology and Evolution 23(9) 1801-1807.

Mao, F, Leung, W, and Xin, X (2007) Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications BMC Biotechnol. 2007; 7: 76.

Millar, B. C, Xu, J. and Moore, J. E. (2002). Risk assessment models and contamination management: implications for broad-range ribosomal DNA PCR as a diagnostic tool in medical bacteriology. Journal of Clinical Microbiology 40(5), 1575-1580.

Mohammadi, T., Reesink, H. W., Vandenbroucke-Grauls, C. M. J. E. and Savelkoul, P. H. M. (2003). Optimization of real-time PCR assay for rapid and sensitive detection of eubacterial 16S ribosomal DNA in platelet concentrates. Journal of Clinical Microbiology 41(10), 4796-4798.

Nogva, H. K., Dromtorp, S.M., Nissen, H. and Rudi, K. (2003) Ethidium monoazide for DNA- based differentiation of viable and dead bacteria by 5'-nuclease PCR. Biotechniques 34(4), 804- 813.

Olivier M. (2005) The Invader assay for SNP genotyping. Mutation Res. 573(1-2): 103- 10.

Rand, K. H., and Houck, H. (1990). Taq polymerase contains bacterial DNA of unknown origin. Molecular and Cellular Probes 4, 445-450.

Rudi, K., Moen, B., Dromtorp, S. M. and Hoick, A. L. (2005). Use of ethidium monoazide and PCR in combination for quantification of viable and dead cells in complex samples. Applied and Environmental Microbiology 71(2), 1018-1024.

Saksena, N. K., Dwyer, D. and Barre-Sinausi. F. (1991). A "sentinel" technique for monitoring viral aerosol contamination. The Journal of Infectious Diseases 164, 1021-1022. Sambrook, J., Russel, D. W. (2001). Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y.

Schmidt, T. M., Pace, B. and Pace, N. R. (1991). Detection of DNA contamination in Taq polymerase. Biotechniques 11 (2), 176-177.

Wilson, K. H., Blitchington, R. B., and Greene, R. C. (1990). Amplification of bacterial 16S ribosomal DNA with polymerase chain reaction. Journal of Clinical Microbiology 28(9), 1942- 1946.

Claims

CLAIMS What is claimed:

1. A method of amplifying target nucleic acid in a closed system, the method comprising: i) adding nucleic acid deactivating reagent, thermophilic proteinase, and nucleic acid amplifying reagent to a sample comprising target nucleic acid to form the system, wherein the nucleic acid deactivating reagent has an active form and an inactive form and only the active form deactivates contaminating nucleic acids in the system causing the contaminating nucleic acids to become unreactive to nucleic acid amplifying reagent, wherein the nucleic acid deactivating reagent is converted to the active form only when an external stimulus is applied, and wherein the thermophilic proteinase is in an active form at about 65-80⁰C and in an inactive form at or above about 90⁰C; ii) closing the system;

iii) applying the external stimulus for a period of time sufficient to convert the nucleic acid deactivating reagent from the inactive form to the active form, wherein the applying causes contaminating nucleic acids in the system to become unreactive to nucleic acid amplifying reagent and wherein the nucleic acid deactivating reagent is converted to the inactive form subsequent to causing contaminating nucleic acids to become unreactive to nucleic acid amplifying reagent;

iv) incubating the sample for a period of time at about 65-8O⁰C, wherein the incubating activates the thermophilic proteinase and extracts the target nucleic acid for amplification by effecting one or more of lysis of cells, digestion of proteins, and digestion of cell-wall enzymes;

v) incubating the sample at or above about 9O⁰C, wherein the incubating causes auto-catalysis of the thermophilic proteinase; and

vi) amplifying the target nucleic acid, wherein the closed system comprises a single vessel or tube.

2. The method of claim 1 , wherein the nucleic acid deactivating reagent is converted to the inactive form before or concurrent with incubating the sample at about 65-8O⁰C.

3. The method of claim 1, wherein the nucleic acid deactivating reagent is converted to the inactive form subsequent to causing contaminating nucleic acids to become unreactive to nucleic acid amplifying reagent by applying the external stimulus for a period of time sufficient to convert the nucleic acid deactivating reagent to the inactive form.

4. The method of claim 1, wherein the nucleic acid deactivating reagent is converted to the inactive form subsequent to causing contaminating nucleic acids to become unreactive to nucleic acid amplifying reagent by removing the external stimulus.

5. The method of claim 1, wherein the nucleic acid deactivating reagent is provided at a concentration sufficient to deactivate contaminating nucleic acids without inhibiting the thermophilic proteinase, the amplifying reagent, or amplification of the target nucleic acid.

6. The method of claim 1 , wherein the nucleic acid deactivating reagent is a mesophilic nucleic acid modifying enzyme.

7. The method of claim 6, wherein the mesophilic nucleic acid modifying enzyme is

selected from the group consisting of: a double-stranded specific endonuclease, a double- stranded specific exonuclease, a single-stranded specific nuclease, a restriction endonuclease, an RNAses, RNAseH, and an RNA modifying enzyme.

8. The method of claim 6, wherein the mesophilic nucleic acid modifying enzyme is

activated by incubating at about 25-40 ⁰C for a period of time sufficient to convert the mesophilic nucleic acid modifying enzyme to the active form.

9. The method of claim 6, wherein the mesophilic nucleic acid modifying enzyme is

inactivated by incubating at about 65-80⁰C for a period of time sufficient to convert the mesophilic nucleic acid modifying enzyme to the inactive form.

10. The method of claim 1, wherein the nucleic acid deactivating reagent is a nucleic acid intercalating agent.

11. The method of claim 10, wherein the applying the external stimulus converts the nucleic acid intercalating agent to the active form by effecting photolysis of the nucleic acid intercalating agent.

12. The method of claim 11, wherein the active form of the nucleic acid intercalating agent covalently binds to double-stranded nucleic acids.

13. The method of claim 10, wherein the nucleic acid intercalating agent is ethidium

monoazide. ^•

14. The method of claim 13, wherein the ethidium monoazide is provided at a concentration between about lμg/ml and about 5μg/ml.

15. The method of claim 14, wherein the ethidium monoazide is provided at a concentration of about 3μg/ml.

16. The method of claim 1, wherein the external stimulus is a specific narrow spectrum

wavelength light, broad spectrum white light or UV light.

17. The method of claim 10, wherein the external stimulus is a specific narrow spectrum wavelength light, broad spectrum white light or UV light sufficient to activate the nucleic acid intercalating agent by effecting photolysis of the nucleic acid.intercalating agent.

18. The method of claim 1, wherein the external stimulus is thermal energy sufficient to activate the nucleic acid deactivating agent without substantially activating the thermophilic proteinase.

19. The method of claim 18, wherein the external stimulus is thermal energy sufficient to raise the system to a temperature of about 25-4O⁰C for a period of time sufficient to convert the mesophilic nucleic acid modifying enzyme to the active form.

20. The method of claim 1, wherein the thermophilic proteinase is EAl.

21. The method of claim 1, further comprising the steps of:

i) treating the sample with a mesophilic enzyme, and

ii) incubating the sample at a temperature below about 4O⁰C for a period of time that is sufficient to effect removal of cell walls from cells.

22. The method of claim 21, wherein the mesophilic enzyme is a cellulase or lysozyme.

23. The method of claim 1, wherein the amplifying is detected by fluorescence.

24. The method of claim 1, wherein the amplifying comprises performing a PCR detection method.

25. The method of claim 24, wherein the PCR detection method is selected from the group consisting of: qPCR, multiplex PCR, and reverse-transcription PCR.

26. The method of claim 1, wherein the amplifying comprises performing an isothermal detection method.

27. The method of claim 26, wherein the isothermal detection method is selected from the group consisting of strand displacement amplification, rolling circle amplification, loop- mediated isothermal amplification, isothermal chimeric primer-initiated amplification of nucleic acids, Q-beta amplification systems, and OneCutEventAmplificatioN.

28. The method of claim 26, wherein the isothermal detection method utilizes a technique selected from the group consisting of: Nuclease Chain Reaction (NCR), RNAse-mediated Nucleases Chain Reaction (RNCR), Polymerase Nuclease Chain Reaction (PNCR), RNAse -Mediated Detection (RMD), Tandem Repeat Restriction Enzyme Facilitated (TR-REF) Chain Reaction, and Inverted reverse Complement Restriction Enzyme Facilitated (IRC-REF) Chain Reaction.

29. The method of claim 1, wherein the amplifying comprises performing a SNP detecting assay.

30. The method of claim 1, wherein the amplifying the target nucleic acid is automated.

31. The method of claim 1, wherein adding the amplifying reagent is by microfluidics or a solid dispenser.

32. The method of claim 1, wherein adding the amplifying reagent is by microcapsules

comprising the amplifying reagent.

33. The method of claim 32, wherein the microcapsules are pre-disposed in the vessel or tube.

34. The method of claim 32, wherein the microcapsules are heat-labile capsules.

35. The method of claim 34, wherein the heat-labile capsules are agarose or wax beads.

36. The method of claim 36, wherein the heat-labile capsules release detecting reagents when exposed at a sufficient temperature to melt or dissolve the capsules.

37. The method of claim 1, wherein the amplifying reagent is resistant to proteolytic

cleavage by the thermophilic proteinase.

38. The method of claim 1, wherein the sample is selected from the group consisting of: blood, urine, saliva, semen, stool, tissue, swabs, tears, bone, teeth, hair, and mucus.

39. The method of claim 1, wherein the sample is selected from the group consisting of: bacteria, fungi, archaea, eukarya, protozoa, and virus.

40. The method of claim 39, wherein the sample is selected from the group consisting of: salt water, freshwater, ice, soil, waste material, and food.

41. The method of claim 1, wherein the vessel or tube is a device.

42. The method of claim 41, wherein the device is a hand-held device.

43. The method of claim 41, wherein the device or components of the device are disposable.

44. The method of claim 41, wherein the device comprises an inlet port, an outlet port, a chamber, a detector for emitted fluorescence and an excitation light source.

45. The method of claim 41, wherein the device further comprises microfluidics, microchips, nanopore technologies and miniature devices.

46. The method of claim 41, wherein the device comprises a sealed unit, a light-tight

chamber, a nucleic acid deactivating reagent-activating light source, a detector for emitted fluorescence and an excitation light source.

47. The method of claim 46, wherein the nucleic acid deactivating reagent-activating light source is selected from the group consisting of: an incandescent lamp, a fluorescent lamp, and an array of light emitting diodes.

48. A method of amplifying target nucleic acid in a closed system, the method comprising: i) adding mesophilic nucleic acid modifying enzyme, EAl proteinase, and PCR amplifying reagent to a sample comprising target nucleic acid to form the system, wherein the mesophilic nucleic acid modifying enzyme has an active form and an inactive form and only the active form deactivates contaminating nucleic acids in the system causing the contaminating nucleic acids to become unreactive to PCR amplifying reagent, wherein the mesophilic nucleic acid modifying enzyme is in an active form at about 25-4O⁰C and in an inactive form at about 65-80⁰C, and wherein the EAl proteinase is in an active form at about 65-8O⁰C and is in an inactive form at or above about 90⁰C;

ii) closing the system;

iii) incubating the sample for a period of time at about 25-4O⁰C, wherein the

incubating activates the mesophilic nucleic acid modifying enzyme and causes contaminating nucleic acids in the system to become unreactive to PCR amplifying reagent;

iv) incubating the sample for a period of time at 65-8O⁰C, wherein the incubating inactivates the mesophilic nucleic acid modifying enzyme, activated the EAl proteinase, and extracts the target nucleic acid for amplification by effecting one or more of lysis of cells, digestion of proteins, and digestion of cell-wall enzymes;

v) incubating the sample at or above about 90⁰C, wherein the incubating causes auto-catalysis of the EAl proteinase; and

vi) amplifying the target nucleic acid,

wherein the closed system comprises a single vessel or tube.

49. A method of amplifying target nucleic acid in a closed system, the method comprising: i) adding ethidium monoazide, EAl proteinase, and PCR amplifying reagent to a sample comprising target nucleic acid to form the system, wherein the ethidium monoazide has an active form and an inactive form and only the active form deactivates contaminating nucleic acids in the system causing the contaminating nucleic acids to become unreactive to PCR amplifying reagent, wherein the ethidium monoazide is converted to the active form only when narrow spectrum wavelength light, broad spectrum white light, or UV light is applied to effect photolysis of the ethidium monoazide, and wherein the EAl proteinase is in an active form at about 65-80⁰C and is in an inactive form at or above about 90°C; ii) closing the system;

iii) applying the narrow spectrum wavelength, broad spectrum white light, or UV light for a first period of time sufficient to convert the ethidium monoazide from the inactive form to the active form, wherein the applying causes contaminating nucleic acids in the system to become unreactive to the PCR amplifying reagent and wherein the photolysis of the ethidium monoazide by the applying causes the ethidium monoazide to become inactive to subsequent nucleic acids;

iv) incubating the sample for a second period of time at about 65-8O⁰C, wherein the incubating activates the EAl proteinase and extracts the target nucleic acid for amplification by effecting one or more of lysis of cells, digestion of proteins, and digestion of cell-wall enzymes;

v) incubating the sample at or above 9O⁰C, wherein the incubating causes the auto-catalysis of the EAl proteinase; and

vi) amplifying the target nucleic acid,

wherein the closed system comprises a single vessel or tube.

50. The method of claim 1, wherein amplification detection sensitivity of the method is at least about 2-fold greater than amplification detection sensitivity of the method performed without the nucleic acid deactivating reagent.

51. The method of claim 1, wherein amplification detection sensitivity of the method performed in a closed system is at least about 2-fold greater than amplification detection sensitivity of the method performed in an open system.