EP2339925B1 - Food compositions of microalgal biomass - Google Patents
Food compositions of microalgal biomass Download PDFInfo
- Publication number
- EP2339925B1 EP2339925B1 EP09821204.6A EP09821204A EP2339925B1 EP 2339925 B1 EP2339925 B1 EP 2339925B1 EP 09821204 A EP09821204 A EP 09821204A EP 2339925 B1 EP2339925 B1 EP 2339925B1
- Authority
- EP
- European Patent Office
- Prior art keywords
- algal
- biomass
- oil
- microalgal
- fat
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A21—BAKING; EDIBLE DOUGHS
- A21D—TREATMENT OF FLOUR OR DOUGH FOR BAKING, e.g. BY ADDITION OF MATERIALS; BAKING; BAKERY PRODUCTS
- A21D2/00—Treatment of flour or dough by adding materials thereto before or during baking
- A21D2/08—Treatment of flour or dough by adding materials thereto before or during baking by adding organic substances
- A21D2/14—Organic oxygen compounds
- A21D2/16—Fatty acid esters
- A21D2/165—Triglycerides
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23D—EDIBLE OILS OR FATS, e.g. MARGARINES, SHORTENINGS OR COOKING OILS
- A23D7/00—Edible oil or fat compositions containing an aqueous phase, e.g. margarines
- A23D7/001—Spread compositions
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23D—EDIBLE OILS OR FATS, e.g. MARGARINES, SHORTENINGS OR COOKING OILS
- A23D7/00—Edible oil or fat compositions containing an aqueous phase, e.g. margarines
- A23D7/003—Compositions other than spreads
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23D—EDIBLE OILS OR FATS, e.g. MARGARINES, SHORTENINGS OR COOKING OILS
- A23D7/00—Edible oil or fat compositions containing an aqueous phase, e.g. margarines
- A23D7/005—Edible oil or fat compositions containing an aqueous phase, e.g. margarines characterised by ingredients other than fatty acid triglycerides
- A23D7/0053—Compositions other than spreads
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23D—EDIBLE OILS OR FATS, e.g. MARGARINES, SHORTENINGS OR COOKING OILS
- A23D7/00—Edible oil or fat compositions containing an aqueous phase, e.g. margarines
- A23D7/005—Edible oil or fat compositions containing an aqueous phase, e.g. margarines characterised by ingredients other than fatty acid triglycerides
- A23D7/0056—Spread compositions
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K10/00—Animal feeding-stuffs
- A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
- A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/158—Fatty acids; Fats; Products containing oils or fats
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
- Y02A40/818—Alternative feeds for fish, e.g. in aquacultures
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
- Y02W90/00—Enabling technologies or technologies with a potential or indirect contribution to greenhouse gas [GHG] emissions mitigation
- Y02W90/10—Bio-packaging, e.g. packing containers made from renewable resources or bio-plastics
Definitions
- the invention resides in the fields of microbiology, food preparation, and human and animal nutrition.
- algae have long been looked to as a potential source of food. While certain types of algae, primarily seaweed, do indeed provide important foodstuffs for human consumption, the promise of algae as a foodstuff has not been realized.
- Algal powders made with algae grown photosynthetically in outdoor ponds or photobioreactors are commercially available but have a deep green color (from the chlorophyll) and a strong, unpleasant taste. When formulated into food products or as nutritional supplements, these algal powders impart a visually unappealing green color to the food product or nutritional supplement and have an unpleasant fishy or seaweed flavor.
- microalgae such as kelp, purple laver (Porphyra, used in nori), dulse ( Palmaria palmate) and sea lettuce ( Ulva lactuca).
- Microalgae such as Spirulina ( Arthrospira platensis) are grown commercially in open ponds (photosynthetically) for use as a nutritional supplement or incorporated in small amounts in smoothies or juice drinks (usually less than 0.5% w/w).
- Other microalgae, including some species of Chlorella are popular in Asian countries as a nutritional supplement.
- algal oil with high docosahexanoic acid (DHA) content is used as an ingredient in infant formulas.
- DHA is a highly polyunsaturated oil.
- DHA has anti-inflammatory properties and is a well known supplement as well as an additive used in the preparation of foodstuffs.
- DHA is not suitable for cooked foods because it oxidizes with heat treatment.
- DHA is unstable when exposed to oxygen even at room temperature in the presence of antioxidants. The oxidation of DHA results in a fishy tasteand unpleasant aroma.
- the present invention provides a food composition comprising at least 0.1% w/w Chlorella protothecoides microalgal biomass and one or more other edible ingredient, wherein the microalgal biomass (i) comprises microalgal cells cultured under heterotrophic conditions, (ii) is reduced in green pigmentation, and (iii) comprises at least 10% oil by dry weight, wherein less than 5% by weight of the oil is docosahexanoic acid (DHA) (C22:6).
- DHA docosahexanoic acid
- the present invention also provides a method of making a food composition of the invention comprising combining the Chlorella protothecoides microalgal biomass with at least one other edible ingredient.
- the present invention further provides a microalgal powder that (i) comprises Chlorella protothecoides microalgal cells cultured under heterotrophic conditions, (ii) is reduced in green pigmentation, and (iii) comprises at least 10% oil by dry weight, wherein less than 5% by weight of the oil is docosahexanoic acid (DHA) (C22:6), wherein the microalgal powder has been pasteurized.
- a microalgal powder that (i) comprises Chlorella protothecoides microalgal cells cultured under heterotrophic conditions, (ii) is reduced in green pigmentation, and (iii) comprises at least 10% oil by dry weight, wherein less than 5% by weight of the oil is docosahexanoic acid (DHA) (C22:6), wherein the microalgal powder has been pasteurized.
- DHA docosahexanoic acid
- the present invention provides foods that incorporate at least 0.1% w/w Chlorella protothecoides microalgal biomass in the form of an algal powder, algal flour, and/or algal oil.
- the food is a baked good, dressing, sauce, or mayonnaise in which, relative to the same food produced using conventional recipes, all or a portion of the egg or butter has been replaced by an algal flour rich in algal oil.
- the food is a powdered egg product containing an algal flour rich in algal oil.
- the food is a liquid egg product containing an algal flour rich in algal oil.
- the food is a liquid milk product containing algal protein, fiber, and oil.
- the food is a meat product in which, relative to previously available meat products, a portion or all (a meat substitute) of the meat has been replaced by an algal flour, algal powder, or algal flake rich in protein.
- Section I provides definitions for various terms used herein.
- Section II in parts A-E, describes methods for preparing microalgal biomass, including suitable organisms (A), methods of generating a microalgae strain lacking in or has significantly reduced pigmentation (B) culture conditions (C), concentration conditions (D), and chemical composition of the biomass(E).
- Section III in parts A-D, describes methods for processing the microalgal biomass into algal flake (A), algal powder (B), algal flour (C); and algal oil (D).
- Section IV describes various foods of the invention and methods of combining microalgal biomass with other food ingredients.
- GMP regulations for manufacturing, packing, or holding human food are codified at 21 C.F.R. 110.
- GMP conditions in the Unites States, and equivalent conditions in other jurisdictions apply in determining whether a food is adulterated (the food has been manufactured under such conditions that it is unfit for food) or has been prepared, packed, or held under unsanitary conditions such that it may have become contaminated or otherwise may have been rendered injurious to health.
- GMP conditions can include adhering to regulations governing: disease control; cleanliness and training of personnel; maintenance and sanitary operation of buildings and facilities; provision of adequate sanitary facilities and accommodations; design, construction, maintenance, and cleanliness of equipment and utensils; provision of appropriate quality control procedures to ensure all reasonable precautions are taken in receiving, inspecting, transporting, segregating, preparing, manufacturing, packaging, and storing food products according to adequate sanitation principles to prevent contamination from any source; and storage and transportation of finished food under conditions that will protect food against physical, chemical, or undesirable microbial contamination, as well as against deterioration of the food and the container.
- Axenic means a culture of an organism that is not contaminated by other living organisms.
- Baked good means a food item, typically found in a bakery, that is prepared by using an oven. Baked goods include, but are not limited to brownies, cookies, pies, cakes and pastries.
- Bioreactor and “fermentor” mean an enclosure or partial enclosure, such as a fermentation tank or vessel, in which cells are cultured typically in suspension.
- “Bread” means a food item that contains flour, liquid, and a leavening agent. Breads are usually prepared by baking in an oven, although other methods of cooking are also acceptable.
- the leavening agent can be chemical or organic in nature. Typically, the organic leavening agent is yeast. In the case where the leavening agent is chemical in nature (such as baking powder and/or baking soda), these food products are referred to as "quick breads”.
- Cellulosic material means the products of digestion of cellulose, particularly glucose and xylose. Cellulose digestion typically produces additional compounds such as disaccharides, oligosaccharides, lignin, furfurals and other compounds. Sources of cellulosic material include, for example and without limitation, sugar cane bagasse, sugar beet pulp, corn stover, wood chips, sawdust, and switchgrass.
- Co-culture and variants thereof such as “co-cultivate” and “co-ferment” mean that two or more types of cells are present in the same bioreactor under culture conditions.
- the two or more types of cells are, for purposes of the present invention, typically both microorganisms, typically both microalgae, but may in some instances include one non-microalgal cell type.
- Culture conditions suitable for co-culture include, in some instances, those that foster growth and/or propagation of the two or more cell types, and, in other instances, those that facilitate growth and/or proliferation of only one, or only a subset, of the two or more cells while maintaining cellular growth for the remainder.
- Cofactor means a molecule, other than the substrate, required for an enzyme to carry out its enzymatic activity.
- Conventional food product means a composition intended for consumption, e.g., by a human, that lacks algal biomass or other algal components and includes ingredients ordinarily associated with the food product, particularly a vegetable oil, animal fat, and/or egg(s), together with other edible ingredients.
- Conventional food products include food products sold in shops and restaurants and those made in the home. Conventional food products are often made by following conventional recipes that specify inclusion of an oil or fat from a non-algal source and/or egg(s) together with other edible ingredient(s).
- Cooked product means a food that has been heated, e.g., in an oven, for a period of time.
- “Creamy salad dressing” means a salad dressing that is a stable dispersion with high viscosity and a slow pour-rate. Generally, creamy salad dressings are opaque.
- “Cultivate,” “culture,” and “ferment”, and variants thereof, mean the intentional fostering of growth and/or propagation of one or more cells, typically microalgae, by use of culture conditions. Intended conditions exclude the growth and/or propagation of microorganisms in nature (without direct human intervention).
- Cytolysis means the lysis of cells in a hypotonic environment. Cytolysis results from osmosis, or movement of water, to the inside of a cell to a state of hyperhydration, such that the cell cannot withstand the osmotic pressure of the water inside, and so bursts.
- Dietary fiber means non-starch carbohydrates found in plants and other organisms containing cell walls, including microalgae. Dietary fiber can be soluble (dissolved in water) or insoluble (not able to be dissolved in water). Soluble and insoluble fiber makes up total dietary fiber.
- Delipidated meal means algal biomass that has undergone an oil extraction process and so contains less oil, relative to the biomass prior to oil extraction. Cells in delipidated meal are predominantly lysed. Delipidated meal include algal biomass that has been solvent (hexane) extracted.
- Digestible crude protein is the portion of protein that is available or can be converted into free nitrogen (amino acids) after digesting with gastric enzymes.
- In vitro measurement of digestible crude protein is accomplished by using gastric enzymes such as pepsin and digesting a sample and measuring the free amino acid after digestion.
- In vivo measurement of digestible crude protein is accomplished by measuring the protein levels in a feed/food sample and feeding the sample to an animal and measuring the amount of nitrogen collected in the animal's feces.
- Dry weight and dry cell weight mean weight determined in the relative absence of water. For example, reference to microalgal biomass as comprising a specified percentage of a particular component by dry weight means that the percentage is calculated based on the weight of the biomass after substantially all water has been removed.
- Edible ingredient means any substance or composition which is fit to be eaten.
- Edible ingredients include, without limitation, grains, fruits, vegetables, proteins, herbs, spices, carbohydrates, and fats.
- Exogenously provided means a molecule provided to a cell (including provided to the media of a cell in culture).
- “Fat” means a lipid or mixture of lipids that is generally solid at ordinary room temperatures and pressures. “Fat” includes, without limitation, lard and butter.
- Fiber means non-starch carbohydrates in the form of polysaccharide. Fiber can be soluble in water or insoluble in water. Many microalgae produce both soluble and insoluble fiber, typically residing in the cell wall.
- Finished food product and “finished food ingredient” mean a food composition that is ready for packaging, use, or consumption.
- a “finished food product” may have been cooked or the ingredients comprising the “finished food product” may have been mixed or otherwise integrated with one another.
- a “finished food ingredient” is typically used in combination with other ingredients to form a food product.
- Fiberd carbon source means molecule(s) containing carbon, typically organic molecules, that are present at ambient temperature and pressure in solid or liquid form.
- Food means any composition intended to be or expected to be ingested by humans as a source of nutrition and/or calories.
- Food compositions are composed primarily of carbohydrates, fats, water and/or proteins and make up substantially all of a person's daily caloric intake.
- a “food composition” can have a weight minimum that is at least ten times the weight of a typical tablet or capsule (typical tablet/capsule weight ranges are from less than or equal to 100 mg up to 1500 mg).
- a "food composition” is not encapsulated or in tablet form.
- Glycerolipid profile means the distribution of different carbon chain lengths and saturation levels of glycerolipids in a particular sample of biomass or oil.
- a sample could have a glycerolipid profile in which approximately 60% of the glycerolipid is C18:1, 20% is C18:0, 15% is C16:0, and 5% is C14:0.
- C:18 such reference can include any amount of saturation; for example, microalgal biomass that contains 20% lipid as C:18 can include C18:0, C18:1, C18:2, and the like, in equal or varying amounts, the sum of which constitute 20% of the biomass.
- references to percentages of a certain saturation type such as "at least 50% monounsaturated in an 18:1 glycerolipid form” means the aliphatic side chains of the glycerolipids are at least 50% 18:1, but does not necessarily mean that at least 50% of the triglycerides are triolein (three 18:1 chains attached to a single glycerol backbone); such a profile can include glycerolipids with a mixture of 18:1 and other side chains, provided at least 50% of the total side chains are 18:1.
- Good manufacturing practice and “GMP” mean those conditions established by regulations set forth at 21 C.F.R. 110 (for human food) and 111 (for dietary supplements), or comparable regulatory schemes established in locales outside the United States.
- the U.S. regulations are promulgated by the U.S. Food and Drug Administration under the authority of the Federal Food, Drug, and Cosmetic Act to regulate manufacturers, processors, and packagers of food products and dietary supplements for human consumption.
- “Growth” means an increase in cell size, total cellular contents, and/or cell mass or weight of an individual cell, including increases in cell weight due to conversion of a fixed carbon source into intracellular oil.
- Homogenate means biomass that has been physically disrupted. Homogenization is a fluid mechanical process that involves the subdivision of particles into smaller and more uniform sizes, forming a dispersion that may be subjected to further processing. Homogenization is used in treatment of several foods and dairy products to improve stability, shelf-life, digestion, and taste.
- Increased lipid yield means an increase in the lipid/oil productivity of a microbial culture that can achieved by, for example, increasing the dry weight of cells per liter of culture, increasing the percentage of cells that contain lipid, and/or increasing the overall amount of lipid per liter of culture volume per unit time.
- a culture may contain a first microalgal cell type secreting a catalyst and a second microorganism cell type secreting a substrate, wherein the first and second cell types produce the components necessary for a particular chemical reaction to occur in situ in the co-culture without requiring further separation or processing of the materials.
- Lipid means any of a class of molecules that are soluble in nonpolar solvents (such as ether and hexane) and relatively or completely insoluble in water. Lipid molecules have these properties, because they are largely composed of long hydrocarbon tails that are hydrophobic in nature.
- lipids include fatty acids (saturated and unsaturated); glycerides or glycerolipids (such as monoglycerides, diglycerides, triglycerides or neutral fats, and phosphoglycerides or glycerophospholipids); and nonglycerides (sphingolipids, tocopherols, tocotrienols, sterol lipids including cholesterol and steroid hormones, prenol lipids including terpenoids, fatty alcohols, waxes, and polyketides).
- glycerides or glycerolipids such as monoglycerides, diglycerides, triglycerides or neutral fats, and phosphoglycerides or glycerophospholipids
- nonglycerides sphingolipids, tocopherols, tocotrienols, sterol lipids including cholesterol and steroid hormones, prenol lipids including terpenoids, fatty alcohols,
- Lysate means a solution containing the contents of lysed cells.
- Lysis means the breakage of the plasma membrane and optionally the cell wall of a microorganism sufficient to release at least some intracellular content, which is often achieved by mechanical or osmotic mechanisms that compromise its integrity.
- “Lysing” means disrupting the cellular membrane and optionally the cell wall of a biological organism or cell sufficient to release at least some intracellular content.
- Microalgae means a eukarytotic microbial organism that contains a chloroplast, and which may or may not be capable of performing photosynthesis.
- Microalgae include obligate photoautotrophs, which cannot metabolize a fixed carbon source as energy, as well as heterotrophs, which can live solely off of a fixed carbon source, including obligate heterotrophs, which cannot perform photosynthesis.
- Microalgae include unicellular organisms that separate from sister cells shortly after cell division, such as Chlamydomonas, as well as microbes such as, for example, Volvox, which is a simple multicellular photosynthetic microbe of two distinct cell types.
- “Microalgae” also include cells such as Chlorella, Parachlorella and Dunaliella.
- Microalgal biomass means a material produced by growth and/or propagation of microalgal cells. Biomass may contain cells and/or intracellular contents as well as extracellular material. Extracellular material includes, but is not limited to, compounds secreted by a cell.
- Microalgal oil and “algal oil” mean any of the lipid components produced by microalgal cells, including triacylglycerols.
- Micronized means biomass that has been homogenized under high pressure (or an equivalent process) so that at least 50% of the particle size is no more 10 ⁇ m in their longest dimension. Typically, at least 50% to 90% or more of such particles are less than 5 ⁇ m in their longest dimension. In any case, the average particle size of micronized biomass is smaller than the intact microalgal cell.
- Microorganism and “microbe” mean any microscopic unicellular organism.
- Nutritional supplement means a composition intended to supplement the diet by providing specific nutrients as opposed to bulk calories.
- a nutritional supplement may contain any one or more of the following ingredients: a vitamin, a mineral, an herb, an amino acid, an essential fatty acid, and other substances.
- Nutritional supplements are typically tableted or encapsulated. A single tableted or encapsulated nutritional supplement is typically ingested at a level no greater than 15 grams per day.
- Nutritional supplements can be provided in ready-to-mix sachets that can be mixed with food compositions, such as yogurt or a "smoothie", to supplement the diet, and are typically ingested at a level of no more than 25 grams per day.
- Oil means any triacylglyceride, produced by organisms, including microalgae, other plants, and/or animals. "Oil,” as distinguished from “fat”, refers, unless otherwise indicated, to lipids that are generally liquid at ordinary room temperatures and pressures.
- oil includes vegetable or seed oils derived from plants, including without limitation, an oil derived from soy, rapeseed, canola, palm, palm kernel, coconut, corn, olive, sunflower, cotton seed, cuphea, peanut, camelina sativa, mustard seed, cashew nut, oats, lupine, kenaf, calendula, hemp, coffee, linseed, hazelnut, euphorbia, pumpkin seed, coriander, camellia, sesame, safflower, rice, tung oil tree, cocoa, copra, pium poppy, castor beans, pecan, jojoba, jatropha, macadamia, Brazil nuts, and avocado, as well as combinations thereof.
- Oxidative shock means the rupture of cells in a solution following a sudden reduction in osmotic pressure and can be used to induce the release of cellular components of cells into a solution.
- Pasteurization means a process of heating which is intended to slow microbial growth in food products. Typically pasteurization is performed at a high temperature (but below boiling) for a short amount of time. As described herein, pasteurization can not only reduce the number of undesired microbes in food products, but can also inactivate certain enzymes present in the food product.
- Polysaccharide and “glycan” means any carbohydrate made of monosaccharides joined together by glycosidic linkages.
- Cellulose is an example of a polysaccharide that makes up certain plant cell walls.
- Port means an opening in a bioreactor that allows influx or efflux of materials such as gases, liquids, and cells; a port is usually connected to tubing.
- Predominantly encapsulated means that more than 50% and typically more than 75% to 90% of a referenced component, e.g., algal oil, is sequestered in a referenced container, which can include, e.g., a microalgal cell.
- a referenced component e.g., algal oil
- Predominantly intact cells and “predominantly intact biomass” mean a population of cells that comprise more than 50, and oftern more than 75, 90, and 98% intact cells.
- Predominantly lysed means a population of cells in which more than 50%, and typically more than 75 to 90%, of the cells have been disrupted such that the intracellular components of the cell are no longer completely enclosed within the cell membrane.
- Proliferation means a combination of both growth and propagation.
- Propagation means an increase in cell number via mitosis or other cell division.
- Proximate analysis means analysis of foodstuffs for fat, nitrogen/protein, crude fiber (cellulose and lignin as main components), moisture and ash. Soluble carbohydrate (total dietary fiber and free sugars) can be calculated by subtracting the total of the known values of the proximate analysis from 100 (carbohydrate by difference).
- Sonication means disrupting biological materials, such as a cell, by sound wave energy.
- “Stover” means the dried stalks and leaves of a crop remaining after a grain has been harvested from that crop.
- Suitable for human consumption means a composition can be consumed by humans as dietary intake without ill health effects and can provide significant caloric intake due to uptake of digested material in the gastrointestinal tract.
- Uncooked product means a composition that has not been subjected to heating but may include one or more components previously subjected to heating.
- V/V in reference to proportions by volume, means the ratio of the volume of one substance in a composition to the volume of the composition.
- reference to a composition that comprises 5% v/v microalgal oil means that 5% of the composition's volume is composed of microalgal oil (e.g., such a composition having a volume of 100 mm 3 would contain 5 mm 3 of microalgal oil), and the remainder of the volume of the composition ( e.g., 95 mm 3 in the example) is composed of other ingredients.
- W/W or "w/w”, in reference to proportions by weight means the ratio of the weight of one substance in a composition to the weight of the composition.
- reference to a composition that comprises 5% w/w microalgal biomass means that 5% of the composition's weight is composed of microalgal biomass (e.g., such a composition having a weight of 100 mg would contain 5 mg of microalgal biomass) and the remainder of the weight of the composition ( e.g., 95 mg in the example) is composed of other ingredients.
- algal biomass suitable for human consumption that is rich in nutrients, including lipid and/or protein constituents, methods of combining the same with edible ingredients and food compositions containing the same.
- Algal oil which can comprise predominantly monosaturated oil, provides health benefits compared with saturated, hydrogenated (trans fats) and polyunsaturated fats often found in conventional food products. Algal oil also can be used as a healthy stable cooking oil free of trans fats.
- the remainder of the algal biomass can encapsulate the oil at least until a food product is cooked, thereby increasing shelf-life of the oil.
- the biomass along with natural antioxidants found in the oil, also protects the oil from oxidation, which would otherwise create unpleasant odors, tastes, and textures.
- the biomass also provides several beneficial micro-nutrients in addition to the oil and/or protein, such as algal-derived dietary fibers (both soluble and insoluble carbohydrates), phospholipids, glycoprotein, phytosterols, tocopherols, tocotrieneols, and selenium.
- part A This section first reviews the types of microalgae suitable for use with the invention (part A), methods of generating a microalgae strain lacking or has significantly reduced pigmentation (part B), then the culture conditions (part C) that are used to propagate the biomass, then the concentration steps that are used to prepare the biomass for further processing (part D), and concludes with a description of the chemical composition of the biomass prepared in accordance with the methods of the invention (part E).
- Example 5 demonstrates dried microalgal biomass and oils or lipids extracted from the biomass lacks algal toxins.
- the cell wall of the microalgae must be disrupted during food processing (e.g., cooking) to release the active components or for digestion, and strains of microalgae with cell walls susceptible to digestion in the gastrointestinal tract of an animal, e.g., a human or other monogastrics, are preferred, especially if the algal biomass is to be used in uncooked food products.
- Digestibility is generally decreased for microalgal strains which have a high content of cellulose/hemicellulose in the cell walls. Digestibility can be evaluated using a standard pepsin digestibility assay.
- the microalgae comprise cells that are at least 10% or more oil by dry weight. In other cases, the microalgae contain at least 25-35% or more oil by dry weight. Generally, the more oil contained in the microalgae, the more nutritious the biomass, so microalgae that can be cultured to contain at least 40%, at least 50%, 75%, or more oil by dry weight are especially preferred.
- Preferred microalgae for use with the invention can grow heterotrophically (on sugars in the absence of light) or are obligate heterotrophs.
- lipids are desirable for use in foods and/or nutraceuticals, as they may have an undesirable taste or unpleasant odor, as well as exhibit poor stability or provide a poor mouth feel, and these considerations also influence the selection of microalgae for use with the invention.
- Chlorella is a genus of single-celled green algae, belonging to the phylum Chlorophyta. Chlorella cells are generally spherical in shape, about 2 to 10 ⁇ m in diameter, and lack flagella. Some species of Chlorella are naturally heterotrophic.
- the microalgae used with the invention is Chlorella protothecoides. Chlorella protothecoides is the microorganism used in the methods of the invention because of its high composition of lipid. Particularly preferred species of Chlorella protothecoides for use in the methods of the invention include those exemplified in the examples below.
- Species of Chlorella can be identified by comparison of certain target regions of their genome with those same regions of species identified herein; preferred species are those that exhibit identity or at least a very high level of homology with the species identified herein.
- identification of a specific Chlorella species or strain can be achieved through amplification and sequencing of nuclear and/or chloroplast DNA using primers and methodology using appropriate regions of the genome, for example using the methods described in Wu et al., Bot. Bull. Acad. Sin. 42:115-121 (2001 ), Identification of Chlorella spp. isolates using ribosomal DNA sequences.
- ITS1 and ITS2 rDNA ribosomal internal transcribed spacer
- 23S RNA 23S RNA
- 18S rRNA conserved genomic regions
- genomic DNA comparison can be used to identify suitable species of microalgae to be used in the present invention.
- Regions of conserved genomic DNA such as and not limited to DNA encoding for 23S rRNA, can be amplied from microalgal species that may be, for example, taxonomically related to the preferred microalgae and compared to the corresponding regions of those preferred species. Species that exhibit a high level of similarity are then selected for use with the invention. Illustrative examples of such DNA sequence comparison among species within the Chlorella genus are presented below.
- the microalgae have genomic DNA sequences encoding for 23S rRNA that have at least 65% nucleotide identity to at least one of the sequences listed in SEQ ID NOs: 1-23 and 26-27. In other cases, microalgae have genomic DNA sequences encoding for 23S rRNA that have at least 75%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater nucleotide identity to at least one or more of the sequences listed in SEQ ID NOs: 1-23 and 26-27. Genotyping of a food composition and/or of algal biomass before it is combined with other ingredients to formulate a food composition is also a reliable method for determining if algal biomass is from more than a single strain of microalgae.
- sequence comparison For sequence comparison to determine percent nucleotide or amino acid identity, typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
- sequence comparison algorithm calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
- Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981 ), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol.
- Microalgae such as Chlorella
- the normally green colored microalgae When grown in heterotrophic conditions where the carbon source is a fixed carbon source and in the absence of light, the normally green colored microalgae has a yellow color, lacking or is significantly reduced in green pigmentation.
- Microalgae of reduced (or lacking in) green pigmentation can be advantageous as a food ingredient.
- One advantage of microalgae of reduced (or is lacking) in green pigmentation is that the microalgae has a reduced chlorophyll flavor.
- microalgae of reduced (or is lacking in) green pigmentation is that as a food ingredient, the addition of the microalgae to foodstuffs will not impart a green color that can be unappealing to the consumer.
- the reduced green pigmentation of microalgae grown under heterotrophic conditions is transient. When switched back to phototrophic growth, microalgae capable of both phototrophic and heterotrophic growth will regain the green pigmentation.
- heterotrophically grown microalgae is a yellow color and this may be unsuitable for some food applications where the consumer expects the color of the foodstuff to be white or light in color.
- Urano et al. Urano et al., J Bioscience Bioengineering (2000) v. 90(5): pp. 567-569 ) describes yellow and white color mutants of Chlorella ellipsoidea generated using UV irradiation.
- Kamiya Kamiya, Plant Cell Physiol. (1989) v. 30(4): 513-521 ) describes a colorless strain of Chlorella vulgaris, 11h (M125).
- chemical mutagenesis can also be employed in order to generate microalgae with reduced (or lacking in) pigmentation.
- Chemical mutagens such as ethyl methanesulfonate (EMS) or N-methyl-N'nitro-N-nitroguanidine (NTG) have been shown to be effective chemical mutagens on a variety of microbes including yeast, fungi, mycobacterium and microalgae.
- Mutagenesis can also be carried out in several rounds, where the microalgae is exposed to the mutagen (either UV or chemical or both) and then screened for the desired reduced pigmentation phenotype. Colonies with the desired phenotype are then streaked out on plates and reisolated to ensure that the mutation is stable from one generation to the next and that the colony is pure and not of a mixed population.
- Chlorella protothecoides was used to generate strains lacking in or with reduced pigmentation using a combination of UV and chemical mutagenesis. Chlorella protothecoides was exposed to a round of chemical mutagenesis with NTG and colonies were screened for color mutants. Colonies not exhibiting color mutations were then subjected to a round of UV irradiation and were again screened for color mutants.
- a Chlorella protothecoides strain lacking in pigmentation was isolated and is Chlorella protothecoides 33-55, deposited on October 13, 2009 at the American Type Culture Collection at 10801 University Boulevard, Manassas, VA 20110-2209, in accordance with the Budapest Treaty, with a Patent Deposit Designation of PTA-XXXX.
- a Chlorella protothecoides strain with reduced pigmentation was isolated and is Chlorella protothecoides 25-32, deposited on October 13, 2009 at the American Type Culture Collection at 10801 University Boulevard, Manassas, VA 20110-2209, in accordance with the Budapest Treaty, with a Patent Deposit Designation of PTA-XXXX.
- Microalgae are cultured in liquid media to propagate biomass to be used with the invention.
- Microalgal species are grown in a medium containing a fixed carbon and/or fixed nitrogen source in the absence of light. Such growth is known as heterotrophic growth.
- heterotrophic growth for some species of microalgae, for example, heterotrophic growth for extended periods of time such as 10 to 15 or more days under limited nitrogen conditions results accumulation of high lipid content in cells.
- Microalgal culture media typically contains components such as a fixed carbon source (discussed below), a fixed nitrogen source (such as protein, soybean meal, yeast extract, cornsteep liquor, ammonia (pure or in salt form), nitrate, or nitrate salt), trace elements (for example, zinc, boron, cobalt, copper, manganese, and molybdenum in, e.g., the respective forms of ZnCl 2 , H3BO3, CoCl 2 ⁇ 6H 2 O, CuCl 2 ⁇ 2H 2 O, MnCl 2 ⁇ 4H 2 O and (NH 4 ) 6 Mo 7 O 24 ⁇ 4H 2 O), optionally a buffer for pH maintenance, and phosphate (a source of phosphorous; other phosphate salts can be used).
- Other components include salts such as sodium chloride, particularly for seawater microalgae.
- a medium suitable for culturing Chlorella protothecoides comprises Proteose Medium.
- This medium is suitable for axenic cultures, and a 1L volume of the medium (pH -6.8) can be prepared by addition of 1g of proteose peptone to 1 liter of Bristol Medium.
- Bristol medium comprises 2.94 mM NaNO 3 , 0.17 mM CaCl 2 ⁇ 2H 2 O, 0.3 mM MgSO 4 ⁇ 7H 2 O, 0.43 mM, 1.29 mM KH 2 PO 4 , and 1.43 mM NaCl in an aqueous solution.
- 15 g of agar can be added to 1 L of the solution.
- Solid and liquid growth media are generally available from a wide variety of sources, and instructions for the preparation of particular media that is suitable for a wide variety of strains of microorganisms can be found, for example, online at http://www.utex.org/, a site maintained by the University of Texas at Austin for its culture collection of algae (UTEX).
- various fresh water media include 1/2, 1/3, 1/5, 1X, 2/3, 2X CHEV Diatom Medium; 1:1 DYIII/PEA + Gr+; Ag Diatom Medium; Allen Medium; BG11-1 Medium; Bold 1NV and 3N Medium; Botryococcus Medium; Bristol Medium; Chu's Medium; CR1, CR1-S, and CR1+ Diatom Medium; Cyanidium Medium; Cyanophycean Medium; Desmid Medium; DYIII Medium; Euglena Medium; HEPES Medium; J Medium; Malt Medium; MES Medium; Modified Bold 3N Medium; Modified COMBO Medium; N/20 Medium; Ochromonas Medium; P49 Medium; Polytomella Medium; Proteose Medium; Snow Algae Media; Soil Extract Medium; Soilwater: BAR, GR-, GR-/NH4, GR+, GR+/NH4, PEA, Peat, and VT Medium; Spirulina Medium; Tap Medium; Trebouxia Medium; Volvocacean
- Various Salt Water Media include: 1%, 5%, and 1X F/2 Medium; 1/2, 1X, and 2X Erdschreiber's Medium; 1/2, 1/3, 1/4, 1/5, 1X, 5/3, and 2X Soil+Seawater Medium; 1/4 ERD; 2/3 Enriched Seawater Medium; 20% Allen + 80 % ERD; Artificial Seawater Medium; BG11-1 + .36% NaCl Medium; BG11-1 + 1% NaCl Medium; Bold 1NV:Erdshreiber (1:1) and (4:1); Bristol-NaCl Medium; Dasycladales Seawater Medium; 1/2 and 1X Enriched Seawater Medium, including ES/10, ES/2, and ES/4; F/2+NH4; LDM Medium; Modified 1X and 2X CHEV; Modified 2 X CHEV + Soil; Modified Artificial Seawater Medium; Porphridium Medium; and SS Diatom Medium.
- SAG refers to the Culture Collection of Algae at the University of Göttingen (Göttingen, Germany)
- CCAP refers to the culture collection of algae and protozoa managed by the Scottish Association for Marine Science (Scotland, United Kingdom)
- CCALA refers to the culture collection of algal laboratory at the Institute of Botany (T ⁇ ebo ⁇ , Czech Republic).
- Microorganisms useful in accordance with the methods of the present invention are found in various locations and environments throughout the world. As a consequence of their isolation from other species and their resulting evolutionary divergence, the particular growth medium for optimal growth and generation of oil and/or lipid and/or protein from any particular species of microbe can be difficult or impossible to predict, but those of skill in the art can readily find appropriate media by routine testing in view of the disclosure herein. In some cases, certain strains of microorganisms may be unable to grow on a particular growth medium because of the presence of some inhibitory component or the absence of some essential nutritional requirement required by the particular strain of microorganism.
- the examples below provide exemplary methods of culturing various species of microalgae to accumulate high levels of lipid as a percentage of dry cell weight.
- the fixed carbon source is a key component of the medium.
- Suitable fixed carbon sources for purposes of the present invention include, for example, glucose, fructose, sucrose, galactose, xylose, mannose, rhamnose, arabinose, N-acetylglucosamine, glycerol, floridoside, glucuronic acid, and/or acetate.
- Other carbon sources for culturing microalgae in accordance with the present invention include mixtures, such as mixtures of glycerol and glucose, mixtures of glucose and xylose, mixtures of fructose and glucose, and mixtures of sucrose and depolymerized sugar beet pulp.
- carbon sources suitable for use in culturing microalgae include, black liquor, corn starch, depolymerized cellulosic material (derived from, for example, corn stover, sugar beet pulp, and switchgrass, for example), lactose, milk whey, molasses, potato, rice, sorghum, sucrose, sugar beet, sugar cane, and wheat.
- the one or more carbon source(s) can be supplied at a concentration of at least about 50 ⁇ M, at least about 100 ⁇ M, at least about 500 ⁇ M, at least about 5 mM, at least about 50 mM, and at least about 500 mM.
- the fixed carbon energy source used in the growth medium comprises glycerol and/or 5- and/or 6-carbon sugars, such as glucose, fructose, and/or xylose, which can be derived from sucrose and/or cellulosic material, including depolymerized cellulosic material.
- glycerol and/or 5- and/or 6-carbon sugars such as glucose, fructose, and/or xylose
- sucrose and/or cellulosic material including depolymerized cellulosic material.
- Multiple species of Chlorella and multiple strains within a species can be grown in the presence of sucrose, depolymerized cellulosic material, and glycerol, as described in US Patent Application Publication Nos. 20090035842 , 20090011480 , 20090148918 , respectively, and see also, PCT Patent Application Publication No. 2008/151149 .
- microorganisms are cultured using depolymerized cellulosic biomass as a feedstock.
- cellulosic biomass depolymerized or otherwise
- Microalgae can proliferate on depolymerized cellulosic material.
- Cellulosic materials generally include cellulose at 40-60% dry weight; hemicellulose at 20-40% dry weight; and lignin at 10-30% dry weight.
- Suitable cellulosic materials include residues from herbaceous and woody energy crops, as well as agricultural crops, i.e., the plant parts, primarily stalks and leaves, not removed from the fields with the primary food or fiber product.
- agricultural wastes such as sugarcane bagasse, rice hulls, corn fiber (including stalks, leaves, husks, and cobs), wheat straw, rice straw, sugar beet pulp, citrus pulp, citrus peels; forestry wastes such as hardwood and softwood thinnings, and hardwood and softwood residues from timber operations; wood wastes such as saw mill wastes (wood chips, sawdust) and pulp mill waste; urban wastes such as paper fractions of municipal solid waste, urban wood waste and urban green waste such as municipal grass clippings; and wood construction waste.
- Additional cellulosics include dedicated cellulosic crops such as switchgrass, hybrid poplar wood, and miscanthus, fiber cane, and fiber sorghum.
- Five-carbon sugars that are produced from such materials include xylose.
- Example 20 describes Chlorella protothecoides successfully being cultivated under heterotrophic conditions using cellulosic-dervied sugars from cornstover and sugar beet pulp.
- Some microbes are able to process cellulosic material and directly utilize cellulosic materials as a carbon source.
- cellulosic material typically needs to be treated to increase the accessible surface area or for the cellulose to be first broken down as a preparation for microbial utilization as a carbon source.
- Ways of preparing or pretreating cellulosic material for enzyme digestion are well known in the art. The methods are divided into two main categories: (1) breaking apart the cellulosic material into smaller particles in order to increase the accessible surface area; and (2) chemically treating the cellulosic material to create a useable substrate for enzyme digestion.
- Methods for increasing the accessible surface area include steam explosion, which involves the use of steam at high temperatures to break apart cellulosic materials. Because of the high temperature requirement of this process, some of the sugars in the cellulosic material may be lost, thus reducing the available carbon source for enzyme digestion (see for example, Chahal, D.S. et al., Proceedings of the 2nd World Congress of Chemical Engineering; (1981 ) and Kaar et al., Biomass and Bioenergy (1998) 14(3): 277-87 ). Ammonia explosion allows for explosion of cellulosic material at a lower temperature, but is more costly to perform, and the ammonia might interfere with subsequent enzyme digestion processes (see for example, Dale, B.E.
- U.S. Patent No. 7,413,882 describes the use of genetically engineered microbes that secrete beta-glucosidase into the fermentation broth and treating cellulosic material with the fermentation broth to enhance the hydrolysis of cellulosic material into glucose. Cellulosic material can also be treated with strong acids and bases to aid subsequent enzyme digestion.
- U.S. Patent No. 3,617,431 describes the use of alkaline digestion to break down cellulosic materials.
- Chlorella can proliferate on media containing combinations of xylose and glucose, such as depolymerized cellulosic material, and surprisingly, some species even exhibit higher levels of productivity when cultured on a combination of glucose and xylose than when cultured on either glucose or xylose alone.
- certain microalgae can both utilize an otherwise inedible feedstock, such as cellulosic material (or a pre-treated cellulosic material) or glycerol, as a carbon source and produce edible oils.
- the invention provides methods for turning inedible feedstock into high nutrition edible oils, food products, and food compositions.
- Microalgae co-cultured with an organism expressing a secretable sucrose invertase or cultured in media containing a sucrose invertase or expressing an exogenous sucrose invertase gene can proliferate on waste molasses from sugar cane or other sources of sucrose.
- the use of such low-value, sucrose-containing waste products can provide significant cost savings in the production of edible oils.
- the methods of cultivating microalgae on a sucrose feedstock and formulating food compositions and nutritional supplements, as described herein, provide a means to convert low-nutrition sucrose into high nutrition oils (oleic acid, DHA, ARA, etc.) and biomass containing such oils.
- oils oleic acid, DHA, ARA, etc.
- Chlorella species and strains proliferate very well on not only purified reagent-grade glycerol, but also on acidulated and non-acidulated glycerol byproducts from biodiesel transesterification.
- some Chlorella strains undergo cell division faster in the presence of glycerol than in the presence of glucose.
- Two-stage growth processes in which cells are first fed glycerol to increase cell density rapidly and then fed glucose to accumulate lipids, can improve the efficiency with which lipids are produced.
- the microbe is cultured in the presence of a sufficient amount of acetate to increase microbial lipid and/or fatty acid yield, specifically, relative to the yield in the absence of acetate.
- Acetate feeding is a useful component of the methods provided herein for generating microalgal biomass that has a high percentage of dry cell weight as lipid.
- lipid yield is increased by culturing a lipid-producing microalgae in the presence of one or more cofactor(s) for a lipid pathway enzyme (e.g., a fatty acid synthetic enzyme).
- a lipid pathway enzyme e.g., a fatty acid synthetic enzyme
- the concentration of the cofactor(s) is sufficient to increase microbial lipid (e.g., fatty acid) yield over microbial lipid yield in the absence of the cofactor(s).
- the cofactor(s) is provided to the culture by including in the culture a microbe secreting the cofactor(s) or by adding the cofactor(s) to the culture medium.
- the microalgae can be engineered to express an exogenous gene that encodes a protein that participates in the synthesis of the cofactor.
- suitable cofactors include any vitamin required by a lipid pathway enzyme, such as, for example, biotin or pantothenate.
- High lipid biomass from microalgae is an advantageous material for inclusion in food products compared to low lipid biomass, because it allows for the addition of less microalgal biomass to incorporate the same amount of lipid into a food composition. This is advantageous, because healthy oils from high lipid microalgae can be added to food products without altering other attributes such as texture and taste compared with low lipid biomass.
- the lipid-rich biomass used in the invention typically has at least 25% lipid by dry cell weight. Process conditions can be adjusted to increase the percentage weight of cells that is lipid.
- a microalgae is cultured in the presence of a limiting concentration of one or more nutrients, such as, for example, nitrogen, phosphorous, or sulfur, while providing an excess of a fixed carbon source, such as glucose.
- Nitrogen limitation tends to increase microbial lipid yield over microbial lipid yield in a culture in which nitrogen is provided in excess.
- the increase in lipid yield is at least about 10%, 50%, 100%, 200%, or 500%.
- the microbe can be cultured in the presence of a limiting amount of a nutrient for a portion of the total culture period or for the entire period.
- the nutrient concentration is cycled between a limiting concentration and a non-limiting concentration at least twice during the total culture period.
- the cells In a steady growth state, the cells accumulate oil but do not undergo cell division.
- the growth state is maintained by continuing to provide all components of the original growth media to the cells with the exception of a fixed nitrogen source. Cultivating microalgal cells by feeding all nutrients originally provided to the cells except a fixed nitrogen source, such as through feeding the cells for an extended period of time, results in a higher percentage of lipid by dry cell weight.
- high lipid biomass is generated by feeding a fixed carbon source to the cells after all fixed nitrogen has been consumed for extended periods of time, such as at least one or two weeks.
- cells are allowed to accumulate oil in the presence of a fixed carbon source and in the absence of a fixed nitrogen source for over 20 days.
- Microalgae grown using conditions described herein or otherwise known in the art can comprise at least about 20% lipid by dry weight, and often comprise 35%, 45%, 55%, 65%, and even 75% or more lipid by dry weight. Percentage of dry cell weight as lipid in microbial lipid production can therefore be improved by holding cells in a heterotrophic growth state in which they consume carbon and accumulate oil but do not undergo cell division.
- High protein biomass from algae is another advantageous material for inclusion in food products.
- the disclosed methods can also provide biomass that has at least 30% of its dry cell weight as protein. Growth conditions can be adjusted to increase the percentage weight of cells that is protein.
- a microalgae is cultured in a nitrogen rich environment and an excess of fixed carbon energy such as glucose or any of the other carbon sources discussed above. Conditions in which nitrogen is in excess tends to increase microbial protein yield over microbial protein yield in a culture in which nitrogen is not provided in excess.
- the microbe is preferably cultured in the presence of excess nitrogen for the total culture period.
- Suitable nitrogen sources for microalgae may come from organic nitrogen sources and/or inorganic nitrogen sources.
- Organic nitrogen sources have been used in microbial cultures since the early 1900s.
- the use of organic nitrogen sources, such as corn steep liquor was popularized with the production of penicillin from mold.
- An analysis of corn steep liquor determined that it was a rich source of nitrogen and also vitamins such as B-complex vitamins, riboflavin panthothenic acid, niacin, inositol and nutrient minerals such as calcium, iron, magnesium, phosphorus and potassium ( Ligget and Koffler, Bacteriological Reviews (1948);12(4): 297-311 ).
- Organic nitrogen sources such as corn steep liquor, have been used in fermentation media for yeasts , bacteria, fungi and other microorganisms.
- organic nitrogen sources are yeast extract, peptone, corn steep liquor and corn steep powder.
- preferred inorganic nitrogen sources include, for example, and without limitation, (NH 4 ) 2 SO 4 and NH 4 OH.
- the culture media for carrying out the invention contains only inorganic nitrogen sources.
- the culture media for carrying out the invention contains only organic nitrogen sources.
- the culture media for carrying out the invention contains a mixture of organic and inorganic nitrogen sources.
- a bioreactor or fermentor is used to culture microalgal cells through the various phases of their physiological cycle.
- an inoculum of lipid-producing microalgal cells is introduced into the medium; there is a lag period (lag phase) before the cells begin to propagate.
- lag phase a lag period
- the exponential phase is in turn followed by a slowing of propagation due to decreases in nutrients such as nitrogen, increases in toxic substances, and quorum sensing mechanisms. After this slowing, propagation stops, and the cells enter a stationary phase or steady growth state, depending on the particular environment provided to the cells.
- the culture is typically harvested during or shortly after then end of the exponential phase.
- the culture is typically harvested well after then end of the exponential phase, which may be terminated early by allowing nitrogen or another key nutrient (other than carbon) to become depleted, forcing the cells to convert the carbon sources, present in excess, to lipid.
- Culture condition parameters can be manipulated to optimize total oil production, the combination of lipid species produced, and/or production of a specific oil.
- Bioreactors offer many advantages for use in heterotrophic growth and propagation methods. As will be appreciated, provisions made to make light available to the cells in photosynthetic growth methods are unnecessary when using a fixed-carbon source in the heterotrophic growth and propagation methods described herein.
- microalgae are preferably fermented in large quantities in liquid, such as in suspension cultures as an example.
- Bioreactors such as steel fermentors (5000 liter, 10,000 liter, 40,000 liter, and higher are used in various embodiments of the invention) can accommodate very large culture volumes. Bioreactors also typically allow for the control of culture conditions such as temperature, pH, oxygen tension, and carbon dioxide levels.
- bioreactors are typically configurable, for example, using ports attached to tubing, to allow gaseous components, like oxygen or nitrogen, to be bubbled through a liquid culture.
- Bioreactors can be configured to flow culture media though the bioreactor throughout the time period during which the microalgae reproduce and increase in number.
- media can be infused into the bioreactor after inoculation but before the cells reach a desired density.
- a bioreactor is filled with culture media at the beginning of a culture, and no more culture media is infused after the culture is inoculated.
- the microalgal biomass is cultured in an aqueous medium for a period of time during which the microalgae reproduce and increase in number; however, quantities of aqueous culture medium are not flowed through the bioreactor throughout the time period.
- aqueous culture medium is not flowed through the bioreactor after inoculation.
- Bioreactors equipped with devices such as spinning blades and impellers, rocking mechanisms, stir bars, means for pressurized gas infusion can be used to subject microalgal cultures to mixing. Mixing may be continuous or intermittent. For example, in some embodiments, a turbulent flow regime of gas entry and media entry is not maintained for reproduction of microalgae until a desired increase in number of said microalgae has been achieved.
- bioreactors are often equipped with various ports that, for example, allow the gas content of the culture of microalgae to be manipulated.
- part of the volume of a bioreactor can be gas rather than liquid, and the gas inlets of the bioreactor to allow pumping of gases into the bioreactor.
- Gases that can be beneficially pumped into a bioreactor include air, air/CO 2 mixtures, noble gases, such as argon, and other gases.
- Bioreactors are typically equipped to enable the user to control the rate of entry of a gas into the bioreactor.
- increasing gas flow into a bioreactor can be used to increase mixing of the culture.
- Turbulence can be achieved by placing a gas entry port below the level of the aqueous culture media so that gas entering the bioreactor bubbles to the surface of the culture.
- One or more gas exit ports allow gas to escape, thereby preventing pressure buildup in the bioreactor.
- a gas exit port leads to a "one-way" valve that prevents contaminating microorganisms from entering the bioreactor.
- bioreactors, culture conditions, and heterotrophic growth and propagation methods described herein can be combined in any suitable manner to improve efficiencies of microbial growth and lipid and/or protein production.
- Microalgal cultures generated according to the methods described above yield microalgal biomass in fermentation media.
- the biomass is concentrated, or harvested, from the fermentation medium.
- the biomass comprises predominantly intact cells suspended in an aqueous culture medium.
- a dewatering step is performed. Dewatering or concentrating refers to the separation of the biomass from fermentation broth or other liquid medium and so is solid-liquid separation.
- the culture medium is removed from the biomass (for example, by draining the fermentation broth through a filter that retains the biomass), or the biomass is otherwise removed from the culture medium.
- Common processes for dewatering include centrifugation, filtration, and the use of mechanical pressure. These processes can be used individually or in any combination.
- Centrifugation involves the use of centrifugal force to separate mixtures. During centrifugation, the more dense components of the mixture migrate away from the axis of the centrifuge, while the less dense components of the mixture migrate towards the axis. By increasing the effective gravitational force (i.e., by increasing the centrifugation speed), more dense material, such as solids, separate from the less dense material, such as liquids, and so separate out according to density. Centrifugation of biomass and broth or other aqueous solution forms a concentrated paste comprising the microalgal cells. Centrifugation does not remove significant amounts of intracellular water. In fact, after centrifugation, there may still be a substantial amount of surface or free moisture in the biomass ( e.g., upwards of 70%), so centrifugation is not considered to be a drying step.
- Filtration can also be used for dewatering.
- One example of filtration that is suitable for the present invention is tangential flow filtration (TFF), also known as cross-flow filtration.
- Tangential flow filtration is a separation technique that uses membrane systems and flow force to separate solids from liquids.
- tangential flow filtration is a separation technique that uses membrane systems and flow force to separate solids from liquids.
- Millipore Pellicon ® devices used with 100kD, 300kD, 1000 kD (catalog number P2C01MC01), 0.1uM (catalog number P2VVPPV01), 0.22uM (catalog number P2GVPPV01), and 0.45uM membranes (catalog number P2HVMPV01).
- the retentate preferably does not pass through the filter at a significant level, and the product in the retentate preferably does not adhere to the filter material.
- TFF can also be performed using hollow fiber filtration systems.
- Filters with a pore size of at least about 0.1 micrometer, for example about 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.45, or at least about 0.65 micrometers, are suitable.
- Preferred pore sizes of TFF allow solutes and debris in the fermentation broth to flow through, but not microbial cells.
- Dewatering can also be effected with mechanical pressure directly applied to the biomass to separate the liquid fermentation broth from the microbial biomass sufficient to dewater the biomass but not to cause predominant lysis of cells.
- Mechanical pressure to dewater microbial biomass can be applied using, for example, a belt filter press.
- a belt filter press is a dewatering device that applies mechanical pressure to a slurry (e.g., microbial biomass taken directly from the fermentor or bioreactor) that is passed between the two tensioned belts through a serpentine of decreasing diameter rolls.
- the belt filter press can actually be divided into three zones: the gravity zone, where free draining water/liquid is drained by gravity through a porous belt; a wedge zone, where the solids are prepared for pressure application; and a pressure zone, where adjustable pressure is applied to the gravity drained solids.
- microalgal biomass can be processed, as described hereinbelow, to produce vacuum-packed cake, algal flakes, algal homogenate, algal powder, algal flour, or algal oil.
- microalgal biomass generated by the culture methods described herein comprises microalgal oil and/or protein as well as other constituents generated by the microorganisms or incorporated by the microorganisms from the culture medium during fermentation.
- Microalgal biomass with a high percentage of oil/lipid accumulation by dry weight has been generated using different methods of culture, including methods known in the art. Microalgal biomass with a higher percentage of accumulated oil/lipid is useful in accordance with the present invention. Chlorella vulgaris cultures with up to 56.6% lipid by dry cell weight (DCW) in stationary cultures grown under autotrophic conditions using high iron (Fe) concentrations have been described ( Li et al., Bioresource Technology 99(11):4717-22 (2008 ). Nanochloropsis sp.
- Chlorella species including Chlorella emersonii, Chlorella sorokiniana and Chlorella minutissima have been described to have accumulated up to 63% oil by DCW when grown in stirred tank bioreactors under low-nitrogen media conditions ( Illman et al., Enzyme and Microbial Technology 27:631-635 (2000 ).
- Heterotrophic growth results in relatively low chlorophyll content (as compared to phototrophic systems such as open ponds or closed photobioreactor systems).
- Reduced chlorophyll content generally improves organoleptic properties of microalgae and therefore allows more algal biomass (or oil prepared therefrom) to be incorporated into a food product.
- the reduced chlorophyll content found in heterotrophically grown microalgae e.g., Chlorella
- the reduced chlorophyll content avoids an often undesired green coloring associated with food products containing phototrophically grown microalgae and allows for the incorporation or an increased incorporation of algal biomass into a food product.
- the food product contains heterotrophically grown microalgae of reduced chlorophyll content compared to phototrophically grown microalgae.
- Oil rich microalgal biomass generated by the culture methods described herein and useful in accordance with the present invention comprises at least 10% microalgal oil by DCW.
- the microalgal biomass comprises at least 15%, 25%, 50%, 75% or at least 90% microalgal oil by DCW.
- the microalgal oil of the biomass described herein can comprise glycerolipids with one or more distinct fatty acid ester side chains.
- Glycerolipids are comprised of a glycerol molecule esterified to one, two, or three fatty acid molecules, which can be of varying lengths and have varying degrees of saturation.
- Specific blends of algal oil can be prepared either within a single species of algae, or by mixing together the biomass (or algal oil) from two or more species of microalgae.
- the oil composition i.e., the properties and proportions of the fatty acid constituents of the glycerolipids
- the oil composition can also be manipulated by combining biomass (or oil) from at least two distinct species of microalgae. At least two of the distinct species of microalgae have different glycerolipid profiles.
- the distinct species of microalgae can be cultured together or separately as described herein, preferably under heterotrophic conditions, to generate the respective oils. Different species of microalgae can contain different percentages of distinct fatty acid constituents in the cell's glycerolipids.
- the microalgal oil is primarily comprised of monounsaturated oil.
- the algal oil is at least 20% monounsaturated oil by weight.
- the algal oil is at least 25%, 50%, 75% or more monounsaturated oil by weight or by volume.
- the monounsaturated oil is 18:1, 16:1, 14:1 or 12:1.
- the microalgal oil comprises at least 10%, 20%, 25%, or 50% or more esterified oleic acid or esterified alpha-linolenic acid by weight of by volume.
- the algal oil comprises less than 10%, less than 5%, less than 3%, less than 2%, or less than 1% by weight or by volume, or is substantially free of, esterified docosahexanoic acid (DHA (22:6)).
- DHA docosahexanoic acid
- High protein microalgal biomass has been generated using different methods of culture. Microalgal biomass with a higher percentage of protein content is useful in accordance with the present invention.
- the protein content of various species of microalgae has been reported (see Table 1 of Becker, Biotechnology Advances (2007) 25:207-210 ). Controlling the renewal rate in a semi-continous photoautotrophic culture of Tetraselmis suecica has been reported to affect the protein content per cell, the highest being approximately 22.8% protein ( Fabregas, et al., Marine Biotechnology (2001) 3:256-263 ).
- Microalgal biomass generated by culture methods described herein relating to high protein typically comprises at least 30% protein by dry cell weight.
- the microalgal biomass comprises at least 40%, 50%, 75% or more protein by dry cell weight.
- the microalgal biomass comprises from 30-75% protein by dry cell weight or from 40-60% protein by dry cell weight.
- the protein in the microalgal biomass comprises at least 40% digestible crude protein.
- the protein in the microalgal biomass comprises at least 50%, 60%, 70%, 80%, or at least 90% digestible crude protein.
- the protein in the microalgal biomass comprises from 40-90% digestible crude protein, from 50-80% digestible crude protein, or from 60-75% digestible crude protein.
- Microalgal biomass (and oil extracted therefrom), can also include other constituents produced by the microalgae, or incorporated into the biomass from the culture medium. These other constituents can be present in varying amounts depending on the culture conditions used and the species of microalgae (and, if applicable, the extraction method used to recover microalgal oil from the biomass).
- the other constituents can include, without limitation, phospholipids (e.g., algal lecithin), carbohydrates, soluble and insoluble fiber, glycoproteins, phytosterols (e.g., ⁇ -sitosterol, campesterol, stigmasterol, ergosterol, and brassicasterol), tocopherols, tocotrienols, carotenoids (e.g., ⁇ -carotene, ⁇ -carotene, and lycopene), xanthophylls ( e.g., lutein, zeaxanthin, ⁇ -cryptoxanthin, and ⁇ -cryptoxanthin), proteins, polysaccharides (e.g., arabinose, mannose, galactose, 6-methyl galactose and glucose) and various organic or inorganic compounds (e.g., selenium).
- phospholipids e.g., algal lecithin
- carbohydrates soluble and insoluble fiber
- the biomass comprises at least 10 ppm selenium. In some cases, the biomass comprises at least 25% w/w algal polysaccharide. In some cases, the biomass comprises at least 15% w/w algal glycoprotein. In some cases, the biomass comprises between 0-115mcg/g total carotenoids. In some cases, the biomass comprises at least 0.5% algal phospholipids. In some cases, the oil derived from the algal biomass contains at least 0.10 mg/g total tocotrienols. In some cases, the oil derived from the algal biomass contains between 0.125 mg/g to 0.35 mg/g total tocotrienols. In some cases, the oil derived from the algal biomass contains at least 5.0 mg/100g total tocopherols.
- the oil derived from the algal biomass contains between 5.0mg/100g to 10mg/100g tocopherols.
- a detailed description of tocotrienols and tocopherols composition in Chlorella protothecoides is included in the Examples below.
- the microalgal biomass comprises at least 10% soluble fiber. In other cases, the microalgal biomass comprises at least 20% to 25% soluble fiber. In some cases, the microalgal biomass comprises at least 30% insoluble fiber. In other cases, the microalgal biomass comprises at least 50% to at least 70% insoluble fiber. Total dietary fiber is the sum of soluble fiber and insoluble fiber. In some cases, the microalgal biomass comprises at least 40% total dietary fiber. In other cases, the microalgal biomass comprises at least 50%, 55%, 60%, 75%, 80%, 90%, to 95% total dietary fiber.
- the concentrated microalgal biomass produced in the invention is itself a finished food ingredient and may be used in foodstuffs without further, or with only minimal, modification.
- the cake can be vacuum-packed or frozen.
- the biomass may be dried via lyophilization, a "freeze-drying" process, in which the biomass is frozen in a freeze-drying chamber to which a vacuum is applied.
- the application of a vacuum to the freeze-drying chamber results in sublimation (primary drying) and desorption (secondary drying) of the water from the biomass.
- the present invention provides a variety of microalgal derived finished food ingredients with enhanced properties resulting from processing methods that can be applied to the concentrated microalgal biomass.
- Drying the microalgal biomass is advantageous to facilitate further processing or for use of the biomass in the methods and compositions described herein. Drying refers to the removal of free or surface moisture/water from predominantly intact biomass or the removal of surface water from a slurry of homogenized (e.g., by micronization)biomass. Different textures and flavors can be conferred on food products depending on whether the algal biomass is dried, and if so, the drying method. Drying the biomass generated from the cultured microalgae described herein removes water that may be an undesirable component of finished food products or food ingredients. In some cases, drying the biomass may facilitate a more efficient microalgal oil extraction process.
- the concentrated microalgal biomass is drum dried to a flake form to produce algal flake, as described in part A of this section.
- the concentrated micralgal biomass is spray or flash dried ( i.e., subjected to a pneumatic drying process) to form a powder containing predominantly intact cells to produce algal powder, as described in part B of this section.
- the concentratedmicroalgal biomass is micronized (homogenized) to form a homogenate of predominantly lysed cells that is then spray or flash dried to produce algal flour, as described in part C of this section.
- oil is extracted from the concentrated microalgal biomass to form algal oil, as described in part D of this section.
- Algal flake is prepared from concentrated microalgal biomass that is applied as a film to the surface of a rolling, heated drum. The dried solids are then scraped off with a knife or blade, resulting in a small flakes.
- U.S. Patent No. 6,607,900 describes drying microalgal biomass using a drum dryer without a prior centrifugation (concentration) step, and such a process may be used with the invention.
- an antioxidant may be added to the biomass prior to drying.
- an antioxidant will not only protect the biomass during drying, but also extend the shelf-life of the dried microalgal biomass when stored.
- an antioxidant is added to the microalgal biomass prior to subsequent processing such as drying or homogenization. Antioxidants that are suitable for use are discussed in detail below.
- pasteurized microalgal biomass is disclosed.
- the pasteurized microalgal biomass is an algal flake.
- Algal powder of the invention is prepared from concentrated microalgal biomass using a pneumatic or spray dryer (see for example U.S. Patent No. 6,372,460 ).
- a spray dryer material in a liquid suspension is sprayed in a fine droplet dispersion into a current of heated air. The entrained material is rapidly dried and forms a dry powder.
- a pulse combustion dryer can also be used to achieve a powdery texture in the final dried material.
- a combination of spray drying followed by the use of a fluid bed dryer is used to achieve the optimal conditions for dried microbial biomass (see, for example, U.S. Patent No. 6,255,505 ).
- pneumatic dryers can also be used in the production of algal powder.
- Pneumatic dryers draw or entrain the material that is to be dried in a stream of hot air. While the material is entrained in the hot air, the moisture is rapidly removed. The dried material is then separated from the moist air and the moist air is then recirculated for further drying.
- Algal flour is prepared from concentrated microalgal biomass that has been mechanically lysed and homogenized and the homogenate spray or flash dried (or dried using another pneumatic drying system).
- the production of algal flour requires that cells be lysed to release their oil and that cell wall and intracellular components be micronized or reduced in particle size to an average size of no more than 10 ⁇ m.
- the resulting oil, water, and micronized particles are emulsified such that the oil does not separate from the dispersion prior to drying.
- a pressure disrupter can be used to pump a cell containing slurry through a restricted orifice valve to lyse the cells. High pressure (up to 1500 bar) is applied, followed by an instant expansion through an exiting nozzle.
- Niro Niro Soavi GEA
- a Niro (Niro Soavi GEA) homogenizer can be used to process cells to particles predominantly 0.2 to 5 microns in length. Processing of algal biomass under high pressure (approximately 1000 bar) typically lyses over 90% of the cells and reduces particle size to less than 5 microns.
- a ball mill can be used.
- cells are agitated in suspension with small abrasive particles, such as beads. Cells break because of shear forces, grinding between beads, and collisions with beads. The beads disrupt the cells to release cellular contents.
- algal biomass is disrupted and formed into a stable emulsion using a Dyno-mill ECM Ultra (CB Mills) ball mill. Cells can also be disrupted by shear forces, such as with the use of blending (such as with a high speed or Waring blender as examples), the french press, or even centrifugation in case of weak cell walls, to disrupt cells.
- a suitable ball mill including specifics of ball size and blade is described in US Patent No. 5,330,913 .
- the immediate product of homogenization is a slurry of particles smaller in size than the original cells that is suspended in in oil and water.
- the particles represent cellular debris.
- the oil and water are released by the cells. Additional water may be contributed by aqueous media containing the cells before homogenization.
- the particles are preferably in the form of a micronized homogenate. If left to stand, some of the smaller particles may coalesce. However, an even dispersion of small particles can be preserved by seeding with a microcrystalline stabilizer, such as microcrystalline cellulose.
- the slurry is spray or flash dried, removing water and leaving a dry power containing cellular debris and oil.
- the oil content of the powder can be at least 10, 25 or 50% by weight of the dry powder, the powder can have a dry rather than greasy feel and appearance (e.g., lacking visible oil) and can also flow freely when shaken.
- Various flow agents can also be added.
- the water or moisture content of the powder is typically less than 10%, 5%, 3% or 1% by weight.
- Other dryers such as pneumatic dryers or pulse combustion dryers can also be used to produce algal flour.
- the oil content of algal flour can vary depending on the percent oil of the algal biomass.
- Algal flour can be produced from algal biomass of varying oil content. In certain cases, the algal flour is produced from algal biomass of the same oil content. In other cases, the algal flour is produced from alglal biomass of different oil content. In the latter case, algal biomass of varying oil content can be combined and then the homogenization step performed. In other cases, algal flour of varying oil content is produced first and then blended together in various proportions in order to achieve an algal flour product that contains the final desired oil content. In a further case, algal biomass of different lipid profiles can be combined together and then homogenized to produce algal flour. In another case, algal flour of different lipid profiles is produced first and then blended together in various proportions in order to achieve an algal flour product that contains the final desired lipid profile.
- algal flour is useful for a wide range of food preparations. Because of the oil content, fiber content and the micronized particles, algal flour is a multifunctional food ingredient. Algal flour can be used in baked goods, quick breads, yeast dough products, egg products, dressing, sauces, nutritional beverages, algal milk, pasta and gluten free products. Additional details of formulating these food products and more with algal flour is described in the Examples below.
- Algal flour can be used in baked goods in place of convention fat sources (e.g., oil, butter or margarine) and eggs.
- Baked goods and gluten free products have superior moisture content and a cumb structure that is indistinguishable from conventional baked goods made with butter and eggs. Because of the superior moisture content, these baked goods have a longer shelf life and retain their original texture longer than conventional baked goods that are produced without algal flour.
- Algal flour can also act as a fat extender with used in smoothies, sauces, or dressings.
- the composition of algal flour is unique in its ability to convey organoleptic qualities and mouth-feel comparable to a food product with a higher fat content.
- Dressings, sauces and beverages made with algal flour have a rheology and opacity that is close to conventional higher fat recipes although these food products contains about half the fat/oil levels.
- Algal flour is also a superior emulsifier and is suitable in use in food preparation that requires thickness, opacity and viscosity, such as, sauces, dressings and soups.
- the lipid profile found in algal flour described herein does not contain trans-fat and have a higher level of healthy, unsaturated fats as compared to butter or margarine (or other animal fats).
- products made with algal flour can have a lower fat content (with healthier fats) without sacrificing the mouthfeel and organoleptic qualities of the same food product that is made using a conventional recipe using a conventional fat source.
- Algal flour can also be added to powdered or liquid eggs, which are typically served in a food service setting.
- the addition of algal flour improves the appearance, texture and mouthfeel of powdered and liquid eggs and also extends improved appearance, texture and mouthfeel over time, even when the prepared eggs are held on a steam table. Specific formulations and sensory panel results are described below in the Examples.
- the algal biomass comprises a mixture of at least two distinct species of microalgae. In some cases, at least two of the distinct species of microalgae have been separately cultured. In at least one case, at least two of the distinct species of microalgae have different glycerolipid profiles. In some cases, the algal biomass is derived from algae grown heterotrophically. In some cases, all of the at least two distinct species of microalgae contain at least 15% oil by dry weight.
- a method of making a food composition comprising combining algal oil obtained from algal cells containing at least 10%, or at least 15% oil by dry weight with one or more other edible ingredients to form the food composition.
- the method further comprises preparing the algal oil under GMP conditions.
- Algal oil can be separated from lysed biomass for use in food product (among other applications).
- the algal biomass remaining after oil extraction is referred to as delipidated meal.
- Delipidated meal contains less oil by dry weight or volume than the microalgae contained before extraction. Typically 50-90% of oil is extracted so that delipidated meal contains, for example, 10-50% of the oil content of biomass before extraction.
- the biomass still has a high nutrient value in content of protein and other constituents discussed above.
- the delipidated meal can be used in animal feed or in human food applications.
- the algal oil is at least 50% w/w oleic acid and contains less than 5% DHA. In some aspects of the method, the algal oil is at least 50% w/w oleic acid and contains less than 0.5% DHA. In some aspects of the method, the algal oil is at least 50% w/w oleic acid and contains less than 5% glycerolipid containing carbon chain length greater than 18. In some cases, the algal cells from which the algal oil is obtained comprise a mixture of cells from at least two distinct species of microalgae. In some cases, at least two of the distinct species of microalgae have been separately cultured.
- At least two of the distinct species of microalgae have different glycerolipid profiles.
- the algal cells are cultured under heterotrophic conditions.
- all of the at least two distinct species of microalgae contain at least 10%, or at least 15% oil by dry weight.
- an algal oil containing at least 50% monounsaturated oil and containing less than 1% DHA prepared under GMP conditions.
- the monounsaturated oil is 18:1 lipid.
- the algal oil is packaged in a capsule for delivery of a unit dose of oil.
- the algal oil is derived from a mixture of at least two distinct species of microalgae. In some cases, at least two of the distinct species of microalgae have been separately cultured. In at least one case, at least two of the distinct species of microalgae have different glycerolipid profiles. In some cases, the algal oil is derived from algal cells cultured under heterotrophic conditions.
- an oil comprising greater than 60% 18:1, and at least 0.20mg/g tocotrienol.
- a fatty acid alkyl ester composition comprising greater than 60% 18:1 ester, and at least 0.20mg/g tocotrienol.
- Algal oil is prepared from concentrated, washed microalgal biomass by extraction.
- the cells in the biomass are lysed prior to extraction.
- the microbial biomass may also be dried (oven dried, lyophilized, etc.) prior to lysis (cell disruption).
- cells can be lysed without separation from some or all of the fermentation broth when the fermentation is complete.
- the cells can be at a ratio of less than 1:1 v:v cells to extracellular liquid when the cells are lysed.
- Microalgae containing lipids can be lysed to produce a lysate.
- the step of lysing a microorganism can be achieved by any convenient means, including heat-induced lysis, adding a base, adding an acid, using enzymes such as proteases and polysaccharide degradation enzymes such as amylases, using ultrasound, mechanical pressure-based lysis, and lysis using osmotic shock.
- Each of these methods for lysing a microorganism can be used as a single method or in combination simultaneously or sequentially.
- the extent of cell disruption can be observed by microscopic analysis. Using one or more of the methods above, typically more than 70% cell breakage is observed. Preferably, cell breakage is more than 80%, more preferably more than 90% and most preferred about 100%.
- Lipids and oils generated by the microalgae can be recovered by extraction.
- extraction can be performed using an organic solvent or an oil, or can be performed using a solventless-extraction procedure.
- the preferred organic solvent is hexane.
- the organic solvent is added directly to the lysate without prior separation of the lysate components.
- the lysate generated by one or more of the methods described above is contacted with an organic solvent for a period of time sufficient to allow the lipid components to form a solution with the organic solvent.
- the solution can then be further refined to recover specific desired lipid components.
- the mixture can then be filtered and the hexane removed by, for example, rotoevaporation.
- Hexane extraction methods are well known in the art. See, e.g., Frenz et al., Enzyme Microb. Technol., 11:717 (1989 ).
- Miao and Wu describe a protocol of the recovery of microalgal lipid from a culture of Chlorella protothecoides in which the cells were harvested by centrifugation, washed with distilled water and dried by freeze drying. The resulting cell powder was pulverized in a mortar and then extracted with n -hexane. Miao and Wu, Biosource Technology 97:841-846 (2006 ).
- microalgal oils can be extracted using liquefaction (see for example Sawayama et al., Biomass and Bioenergy 17:33-39 (1999 ) and Inoue et al., Biomass Bioenergy 6(4):269-274 (1993 )); oil liquefaction (see for example Minowa et al., Fuel 74(12):1735-1738 (1995 )); or supercritical CO 2 extraction (see for example Mendes et al., Inorganica Chimica Acta 356:328-334 (2003 )).
- Oil extraction includes the addition of an oil directly to a lysate without prior separation of the lysate components.
- the lysate separates either of its own accord or as a result of centrifugation or the like into different layers.
- the layers can include in order of decreasing density: a pellet of heavy solids, an aqueous phase, an emulsion phase, and an oil phase.
- the emulsion phase is an emulsion of lipids and aqueous phase.
- the force of centrifugation if any, volume of aqueous media and other factors, either or both of the emulsion and oil phases can be present.
- Incubation or treatment of the cell lysate or the emulsion phase with the oil is performed for a time sufficient to allow the lipid produced by the microorganism to become solubilized in the oil to form a heterogeneous mixture.
- the oil used in the extraction process is selected from the group consisting of oil from soy, rapeseed, canola, palm, palm kernel, coconut, corn, waste vegetable oil, Chinese tallow, olive, sunflower, cotton seed, chicken fat, beef tallow, porcine tallow, microalgae, macroalgae, Cuphea, flax, peanut, choice white grease (lard), Camelina sativa mustard seedcashew nut, oats, lupine, kenaf, calendula, hemp, coffee, linseed, hazelnut, euphorbia, pumpkin seed, coriander, camellia, sesame, safflower, rice, tung oil tree, cocoa, copra, pium poppy, castor beans, pecan, jojoba, jatropha, macadamia, Brazil nuts, and avocado.
- the amount of oil added to the lysate is typically greater than 5% (measured by v/v and/or w/w) of the lysate with which the oil is being combined.
- a preferred v/v or w/w of the oil is greater than 5%, 10%, 20%, 25%, 50%, 70%, 90%, or at least 95% of the cell lysate.
- Lipids can also be extracted from a lysate via a solventless extraction procedure without substantial or any use of organic solvents or oils by cooling the lysate. Sonication can also be used, particularly if the temperature is between room temperature and 65°C. Such a lysate on centrifugation or settling can be separated into layers, one of which is an aqueous:lipid layer. Other layers can include a solid pellet, an aqueous layer, and a lipid layer. Lipid can be extracted from the emulsion layer by freeze thawing or otherwise cooling the emulsion. In such methods, it is not necessary to add any organic solvent or oil. If any solvent or oil is added, it can be below 5% v/v or w/w of the lysate.
- the present invention is directed to a food composition
- a food composition comprising at least 0.1% w/w Chlorella protothecoides microalgal biomass and one or more other edible ingredients, wherein the algal biomass comprises at least 10% oil by dry weight, optionally wherein at least 90% of the oil is glycerolipid.
- the algal biomass contains at least 25%, 40%, 50% or 60% oil by dry weight.
- the algal biomass contains 10-90%, 25-75%, 40-75% or 50-70% oil by dry weight, optionally wherein at least 90% of the oil is glycerolipid.
- at least 50% by weight of the oil is monounsaturated glycerolipid oil.
- At least 50% by weight of the oil is an 18:1 lipid in glycerolipid form. In some cases, less than 5% by weight of the oil is docosahexanoic acid (DHA) (22:6). In at least one embodiment, less than 1% by weight of the oil is DHA.
- DHA docosahexanoic acid
- An algal lipid content with low levels of polyunsaturated fatty acids (PUFA) is preferred to ensure chemical stability of the biomass.
- the algal biomass is grown under heterotrophic conditions and has reduced green pigmentation.
- the microalgae is a color mutant that lacks or is reduced in pigmentation.
- a food composisiton comprising at least 0.1% w/w algal biomass and one or more other edible ingredients, wherein the algal biomass comprises at least 30% protein by dry weight, at least 40% protein by dry weight, at least 45% protein by dry weight, at least 50% protein by dry weight, at least 55% protein by dry weight, at least 60% protein by dry weight or at least 75% protein by dry weight.
- the algal biomass contains 30-75% or 40-60% protein by dry weight.
- the algal biomass is grown under heterotrophic conditions. In at least one cases, the algal biomass is grown under nitrogen-replete conditions. In other cases, the microalgae is a color mutant that lacks or is reduced in pigmentation.
- the algal biomass comprises predominantly intact cells.
- the food composition comprises oil which is predominantly or completely encapsulated inside cells of the biomass.
- the food composition comprises predominantly intact microalgal cells.
- the algal oil is predominantly encapsulated in cells of the biomass.
- the biomass comprises predominantly lysed cells (e.g., a homogenate). As discussed above, such a homogenate can be provided as a slurry, flake, powder, or flour.
- the algal biomass further comprises at least 10 ppm selenium. In some cases, the biomass further comprises at least 15% w/w algal polysaccharide. In some cases, the biomass further comprises at least 5% w/w algal glycoprotein. In some cases, the biomass comprises between 0 and 115 mcg/g total carotenoids. In some cases, the biomass comprises at least 0.5% w/w algal phospholipids. In all cases, as just noted, these components are true cellular components and not extracellular.
- the algal biomass of the food composition contains components that have antioxidant qualities.
- the strong antioxidant qualities can be attributed to the multiple antioxidants present in the algal biomass, which include, but are not limited to carotenoids, essential minerals such as zinc, copper, magnesium, calcium, and manganese.
- Algal biomass has also been shown to contain other antioxidants such as tocotrienols and tocopherols. These members of the vitamin E family are important antioxidants and have other health benefits such as protective effects against stroke-induced injuries, reversal of arterial blockage, growth inhibition of breast and prostate cancer cells, reduction in cholesterol levels, a reduced-risk of type II diabetes and protective effects against glaucomatous damage.
- Natural sources of tocotrienols and tocopherols can be found in oils produced from palm, sunflower, corn, soybean and olive oil, however compositions provided herein have significantly greater levels of tocotrienols than heretofore known materials.
- food compositions of the present invention contain algal oil comprising at least 5mg/100g, at least 7mg/100g or at least 8mg/100g total tocopherol. In some cases, food compositions of the present invention contain algal oil comprising at least 0.15mg/g, at least 0.20mg/g or at least 0.25mg/g total tocotrienol.
- the microalgae can produce carotenoids.
- the carotenoids produced by the microalgae can be co-extracted with the lipids or oil produced by the microalgae ( i.e., the oil or lipid will contain the carotenoids).
- the carotenoids produced by the microalgae are xanthophylls.
- the carotenoids produced by the microalgae are carotenes.
- the carotenoids produced by the microalgae are a mixture of carotenes and xanthophylls.
- the carotenoids produced by the microalgae comprise at least one carotenoid selected from the group consisting of astaxanthin, lutein, zeaxanthin, alpha-carotene, trans-beta carotene, cis-beta carotene, lycopene and any combination thereof.
- carotenoid profile of oil from Chlorella protothecoides is included below in the Examples.
- the algal biomass is derived from algae cultured and dried under good manufacturing practice (GMP) conditions.
- the algal biomass is combined with one or more other edible ingredients, including without limitation, grain, fruit, vegetable, protein, lipid, herb and/or spice ingredients.
- the food composition is a salad dressing, egg product, baked good, bread, bar, pasta, sauce, soup drink, beverage, frozen dessert, butter or spread.
- the food composition is not a pill or powder.
- the food composition in accordance with the present invention weighs at least 50g, or at least 100g.
- Biomass can be combined with one or more other edible ingredients to make a food product.
- the biomass can be from a single algal source (e.g., strain) or algal biomass from multiple sources ( e.g., different strains).
- the biomass can also be from a single algal species, but with different composition profile.
- a manufacturer can blend microalgae that is high in oil content with microalgae that is high in protein content to the exact oil and protein content that is desired in the finished food product.
- the combination can be performed by a food manufacturer to make a finished product for retail sale or food service use.
- a manufacturer can sell algal biomass as a product, and a consumer can incorporate the algal biomass into a food product, for example, by modification of a conventional recipe.
- the algal biomass is typically used to replace all or part of the oil, fat, eggs, or the like used in many conventional food products.
- a food composition comprising at least 0.1% w/w algal biomass and one or more other edible ingredients, wherein the algal biomass is formulated thorugh blending of algal biomass that contains at least 40% protein by dry weight with algal biomass that contains 40% lipid by dry weight to obtain a blend of a desired percent protein and lipid by dry weight.
- the biomass is from the same strain of algae.
- algal biomass that contains at least 40% lipid by dry weight containing less than 1% of its lipid as DHA is blended with algal biomass that contains at lest 20% lipid by dry weight containing at least 5% of its lipid as DHA to obtain a blend of dry biomass that contains in the aggregate at least 10% lipid and 1% DHA by dry weight.
- Disclosed herein is a method of preparing algal biomass by drying an algal culture to provide algal biomass comprising at least 15% oil by dry weight under GMP conditions, in which the algal oil is greater than 50% monounsaturated lipid.
- algal biomass containing at least 15% oil by dry weight manufactured under GMP conditions, in which the algal oil is greater than 50% 18:1 lipid. Also disclosed herein is algal biomass containing at least 40% oil by dry weight manufactured under GMP conditions. Further disclosed herein is algal biomass containing at least 55% oil by dry weight manufactured under GMP conditions. In some cases, the algal biomass is packaged as a tablet for delivery of a unit dose of biomass. In some cases, the algal biomass is packaged with or otherwise bears a label providing directions for combining the algal biomass with other edible ingredients.
- the present invention is directed to methods of combining at least 0.1% w/w Chlorella protothecoides microalgal biomass and/or materials derived therefrom, as described above, with at least one other finished food ingredient, as described below, to form a food composition or foodstuff.
- the food composition formed by the methods of the invention comprises an egg product (powdered or liquid), a pasta product, a dressing product, a mayonnaise product, a cake product, a bread product, an energy bar, a milk product, a juice product, a spread, or a smoothie.
- the food composition is not a pill or powder.
- the food composition weighs at least 10 g, at least 25 g, at least 50 g, at least 100 g, at least 250 g, or at least 500 g or more.
- the food composition formed by the combination of microalgal biomass and/or product derived therefrom is an uncooked product. In other cases, the food composition is a cooked product.
- the food composition is a cooked product.
- the food composition contains less than 25% oil or fat by weight excluding oil contributed by the algal biomass.
- Fat in the form of saturated triglycerides (TAGs or trans fats), is made when hydrogenating vegetable oils, as is practiced when making spreads such as margarines.
- the fat contained in algal biomass has no trans fats present.
- the food composition contains less than 10% oil or fat by weight excluding oil contributed by the biomass.
- the food composition is free of oil or fat excluding oil contributed by the biomass.
- the food composition is free of oil other than oil contributed by the biomass.
- the food composition is free of egg or egg products.
- the present invention is directed to a method of making a food composition in which the fat or oil in a conventional food product is fully or partially substituted with Chlorella protothecoides microalgal biomass containing at least 10% by weight oil.
- the method comprises determining an amount of the algal biomass for substitution using the proportion of algal oil in the biomass and the amount of oil or fat in the conventional food product, and combining the algal biomass with at least one other edible ingredient and less than the amount of oil or fat contained in the conventional food product to form a food composition.
- the amount of algal biomass combined with the at least one other ingredient is 1-4 times the mass or volume of oil and/or fat in the conventional food product.
- the method described above further includes providing a recipe for a conventional food product containing the at least one other edible ingredient combined with an oil or fat, and combining 1-4 times the mass or volume of the algal biomass with the at least one other edible ingredient as the mass or volume of fat or oil in the conventional food product.
- the method further includes preparing the algal biomass under GMP conditions.
- the food composition formed by the combination of microalgal biomass and/or product derived therefrom comprises at least 0.1%, at least 0.5%, at least 1%, at least 5%, at least 10%, at least 25%, or at least 50% w/w or v/v microalgal biomass or microalgal oil.
- food compositions formed as described herein comprise at least 2%, at least 5%, at least 10%, at least 25%, at least 50%, at least 75%, at least 90%, or at least 95% w/w microalgal biomass or product derived therefrom.
- the food composition comprises 5-50%, 10-40%, or 15-35% algal biomass or product derived therefrom by weight or by volume.
- microalgal biomass can be substituted for other components that would otherwise be conventionally included in a food product.
- the food composition contains less than 50%, less than 40%, or less than 30% oil or fat by weight excluding microalgal oil contributed by the biomass or from microalgal sources.
- the food composition contains less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% oil or fat by weight excluding microalgal oil contributed by the biomass or from microalgal sources.
- the food composition is free of oil or fat excluding microalgal oil contributed by the biomass or from microalgal sources.
- the food composition is free of eggs, butter, or other fats/oils or at least one other ingredient that would ordinarily be included in a comparable conventional food product.
- Some food products are free of dairy products (e.g., butter, cream and/or cheese).
- the amount of algal biomass used to prepare a food composition depends on the amount of non-algal oil, fat, eggs, or the like to be replaced in a conventional food product and the percentage of oil in the algal biomass.
- the methods of the invention include determining an amount of the algal biomass to combine with at least one other edible ingredient from a proportion of oil in the biomass and a proportion of oil and/or fat that is ordinarily combined with the at least one other edible ingredient in a conventional food product. For example, if the algal biomass is 50% w/w microalgal oil, and complete replacement of oil or fat in a conventional recipe is desired, then the oil can for example be replaced in a 2:1 ratio.
- the ratio can be measured by mass, but for practical purposes, it is often easier to measure volume using a measuring cup or spoon, and the replacement can be by volume.
- the volume or mass of oil or fat to be replaced is replaced by (100/100-X) volume or mass of algal biomass, where X is the percentage of microalgal oil in the biomass.
- oil and fats to be replaced in conventional recipes can be replaced in total by algal biomass, although total replacement is not necessary and any desired proportion of oil and/or fats can be retained and the remainder replaced according to taste and nutritional needs. Because the algal biomass contains proteins and phospholipids, which function as emulsifiers, items such as eggs can be replaced in total or in part with algal biomass.
- an egg is replaced in total with biomass, it is sometimes desirable or necessary to augment the emulsifying properties in the food composition with an additional emulsifying agent(s) and/or add additional water or other liquid(s) to compensate for the loss of these components that would otherwise be provided by the egg.
- an egg is not all fat, the amount of biomass used to replace an egg may be less than that used to replace pure oil or fat.
- An average egg weighs about 58 g and comprises about 11.2% fat. Thus, about 13 g of algal biomass comprising 50% microalgal oil by weight can be used to replace the total fat portion of an egg in total. Replacing all or part of the eggs in a food product has the additional benefit of reducing cholesterol.
- substitution ratios can also be provided in terms of mass or volume of oil, fat and/or eggs replaced with mass or volume of biomass.
- the mass or volume of oil, fat and/or eggs in a conventional recipe is replaced with 5-150%, 25-100% or 25-75% of the mass or volume of oil, fat and/or eggs.
- the replacement ratio depends on factors such as the food product, desired nutritional profile of the food product, overall texture and appearance of the food product, and oil content of the biomass.
- the determination of percentages can be made before or after cooking.
- the percentage of algal biomass can increase during the cooking process because of loss of liquids. Because some algal biomass cells may lyse in the course of the cooking process, it can be difficult to measure the content of algal biomass directly in a cooked product. However, the content can be determined indirectly from the mass or volume of biomass that went into the raw product as a percentage of the weight or volume of the finished product (on a biomass dry solids basis), as well as by methods of analyzing components that are unique to the algal biomass such as genomic sequences or compounds that are delivered solely by the algal biomass, such as certain carotenoids.
- algal biomass with the at least one other edible ingredient in an amount that exceeds the proportional amount of oil, fat, eggs, or the like that is present in a conventional food product.
- one may replace the mass or volume of oil and/or fat in a conventional food product with 1, 2, 3, 4, or more times that amount of algal biomass.
- Some aspects of the methods include providing a recipe for a conventional food product containing the at least one other edible ingredient combined with an oil or fat, and combining 1-4 times the mass or volume of algal biomass with the at least one other edible ingredient as the mass or volume of fat or oil in the conventional food product.
- Algal biomass (predominantly intact or homogenized or micronized) and/or algal oil are combined with at least one other edible ingredient to form a food product.
- the algal biomass and/or algal oil is combined with 1-20, 2-10, or 4-8 other edible ingredients.
- the edible ingredients can be selected from all the major food groups, including without limitation, fruits, vegetables, legumes, meats, fish, grains ( e.g., wheat, rice, oats, cornmeal, barley), herbs, spices, water, vegetable broth, juice, wine, and vinegar.
- at least 2, 3, 4, or 5 food groups are represented as well as the algal biomass or algal oil.
- Oils, fats, eggs and the like can also be combined into food compositions, but, as has been discussed above, are usually present in reduced amounts ( e.g., less than 50%, 25%, or 10% of the mass or volume of oil, fat or eggs compared with conventional food products.
- Some food products of the invention are free of oil other than that provided by algal biomass and/or algal oil. Some food products are free of oil other than that provided by algal biomass. Some food products are free of fats other than that provided by algal biomass or algal oil. Some food products are free of fats other than that provided by algal biomass. Some food products are free of both oil and fats other than that provided by algal biomass or algal oil. Some food products are free of both oil and fats other than that provided by algal biomass. Some food products are free of eggs.
- the oils produced by the microalgae can be tailored by culture conditions or strain selection to comprise a particular fatty acid component(s) or levels.
- the algal biomass used in making the food composition comprises a mixture of at least two distinct species of microalgae. In some cases, at least two of the distinct species of microalgae have been separately cultured. In at least one case, at least two of the distinct species of microalgae have different glycerolipid profiles. In some cases, the method described above further comprises culturing algae under heterotrophic conditions and preparing the biomass from the algae. In some cases, all of the at least two distinct species of microalgae contain at least 10%, or at least 15% oil by dry weight.
- a food composition contains a blend of two distinct preparations of biomass of the same species, wherein one of the preparations contains at least 30% oil by dry weight and the second contains less than 15% oil by dry weight. In some cases, a food composition contains a blend of two distinct preparations of biomass of the same species, wherein one of the preparations contains at least 50% oil by dry weight and the second contains less than 15% oil by dry weight, and further wherein the species is Chlorella protothecoides.
- algal biomass can be used as a supplement in foods that do not normally contain oil, such as a smoothie.
- the combination of oil with products that are mainly carbohydrate can have benefits associated with the oil, and from the combination of oil and carbohydrate by reducing the glycemic index of the carbohydrate.
- the provision of oil encapsulated in biomass is advantageous in protecting the oil from oxidation and can also improve the taste and texture of the smoothie.
- Oil extracted from algal biomass can be used in the same way as the biomass itself, that is, as a replacement for oil, fat, eggs, or the like in conventional recipes.
- the oil can be used to replace conventional oil and/or fat on about a 1:1 weight/weight or volume/volume basis.
- the oil can also be incorporated into dressings, sauces, soups, margarines, creamers, shortenings and the like.
- the oil is particularly useful for food products in which combination of the oil with other food ingredients is needed to give a desired taste, texture and/or appearance.
- the content of oil by weight or volume in food products can be at least 5, 10, 25, 40
- oil extracted from algal biomass can also be used as a cooking oil by food manufacturers, restaurants and/or consumers.
- algal oil can replace conventional cooking oils such as safflower oil, canola oil, olive oil, grape seed oil, corn oil, sunflower oil, coconut oil, palm oil, or any other conventionally used cooking oil.
- the oil obtained from algal biomass as with other types of oil can be subjected to further refinement to increase its suitability for cooking ( e.g., increased smoke point).
- Oil can be neutralized with caustic soda to remove free fatty acids.
- the free fatty acids form a removable soap stock.
- the color of oil can be removed by bleaching with chemicals such as carbon black and bleaching earth.
- the bleaching earth and chemicals can be separated from the oil by filtration.
- Oil can also be deodorized by treating with steam.
- Predominantly intact biomass, homogenized or micronized biomass (as a slurry, flake, powder or flour) and purified algal oil can all be combined with other food ingredients to form food products. All are a source of oil with a favorable nutritional profile (relatively high monounsaturated content).
- Predominantly intact, homogenized, and micronized biomass also supply high quality protein (balanced amino acid composition), carbohydrates, fiber and other nutrients as dicussed above. Foods incorporating any of these products can be made in vegan or vegetarian form.
- microalgal biomass either predominantly intact or homogenized (or micronized) or both
- a protein source is that it is a vegan/vegetarian protein source that is not from a major allergen source, such as soy, eggs or dairy.
- algal biomass and/or algal oil include, without limitation, grains, fruits, vegetables, proteins, meats, herbs, spices, carbohydrates, and fats.
- the other edible ingredients with which the algal biomass and/or algal oil is combined to form food compositions depend on the food product to be produced and the desired taste, texture and other properties of the food product.
- any of these sources of algal oil can be used in any food product, the preferred source depends in part whether the oil is primarily present for nutritional or caloric purposes rather than for texture, appearance or taste of food, or alternatively whether the oil in combination with other food ingredients is intended to contribute a desired taste, texture or appearance of the food as well as or instead of improving its nutritional or caloric profile.
- the food products can be cooked by conventional procedures as desired. Depending on the length and temperature, the cooking process may break down some cell walls, releasing oil such that it combines with other ingredients in the mixture. However, at least some algal cells often survive cooking intact. Alternatively, food products can be used without cooking. In this case, the algal wall remains intact, protecting the oil from oxidation.
- the algal biomass if provided in a form with cells predominantly intact, or as a homogenate powder, differs from oil, fat or eggs in that it can be provided as a dry ingredient, facilitating mixing with other dry ingredients, such as flour.
- the algal biomass is provided as a dry homogenate that contains between 25 and 40% oil by dry weight.
- a biomass homogenate can also be provided as slurry. After mixing of dry ingredients (and biomass homogenate slurry, if used), liquids such as water can be added.
- the amount of liquid required is somewhat higher than in a conventional food product because of the non-oil component of the biomass and/or because water is not being supplied by other ingredients, such as eggs. However, the amount of water can readily be determined as in conventional cooking.
- the present invention is directed to a food ingredient composition
- a food ingredient composition comprising at least 0.5% w/w Chlorella protothecoides microalgal biomass containing at least 10% algal oil by dry weight and at least one other edible ingredient, in which the food ingredient can be converted into a reconstituted food product by addition of a liquid to the food ingredient composition.
- the liquid is water.
- Homogenized or micronized high-oil biomass is particularly advantageous in liquid,and/or emulsified food products (water in oil and oil in water emulsions), such as sauces, soups, drinks, salad dressings, butters, spreads and the like in which oil contributed by the biomass forms an emulsion with other liquids.
- emulsified food products water in oil and oil in water emulsions
- sauces soups, drinks, salad dressings, butters, spreads and the like in which oil contributed by the biomass forms an emulsion with other liquids.
- Products that benefit from improved rheology, such as dressings, sauces and spreads are described below in the Examples.
- Using homogenized biomass an emulsion with desired texture (e.g., mouth-feel), taste and appearance (e.g., opacity) can form at a lower oil content (by weight or volume of overall product) than is the case with conventional products employing conventional oils, thus can be used as a fat extender.
- Purified algal oil is also advantageous for such liquid and/or emulsified products. Both homogenized or micronized high-oil biomass and purified algal oil combine well with other edible ingredients in baked goods achieving similar or better taste, appearance and texture to otherwise similar products made with conventional oils, fats and/or eggs but with improved nutritional profile (e.g., higher content of monosaturated oil, and/or higher content or quality of protein, and/or higher content of fiber and/or other nutrients).
- Predominantly intact biomass is particularly useful in situations in which it is desired to change or increase the nutritional profile of a food (e.g., higher oil content, different oil content (e.g., more monounsaturated oil), higher protein content, higher calorie content, higher content of other nutrients). Such foods can be useful for example, for athletes or patients suffering from wasting disorders.
- Predominantly intact biomass can be used as a bulking agent. Bulking agents can be used, for example, to augment the amount of a more expensive food (e.g., meat helper and the like) or in simulated or imitation foods, such as vegetarian meat substitutes. Simulated or imitation foods differ from natural foods in that the flavor and bulk are usually provided by different sources.
- flavors of natural foods can be imparted into a bulking agent holding the flavor.
- Predominantly intact biomass can be used as a bulking agent in such foods.
- Predominantly intact biomass is also particularly useful in dried food, such as pasta because it has good water binding properties, and can thus facilitate rehydration of such foods.
- Predominantly intact biomass is also useful as a preservative, for example, in baked goods. The predominantly intact biomass can improve water retention and thus shelf-life.
- Algal biomass that has been disrupted or micronized can also improve water retention and thus shelf-life. Increased moisture retention is especially desirable in gluten-free products, such as gluten-free baked goods.
- a detailed description of formulation of a gluten-free cookie using disrupted algal biomass and subsequent shelf-life study is described in the Examples below.
- the algal biomass can be used in egg preparations.
- algal biomass e.g., algal flour
- algal biomass is added to whole liquid eggs in order to improve the overall texture and moisture of eggs that are prepared and then held on a steam table. Specific examples of the foregoing preparations are described in the Examples below.
- Algal biomass predominantly intact and/or homogenized or micronized
- algal oil can be incorporated into virtually any food composition.
- Some examples include baked goods, such as cakes, brownies, yellow cake, bread including brioche, cookies including sugar cookies, biscuits, and pies.
- Other examples include products often provided in dried form, such as pastas or powdered dressing, dried creamers, commuted meats and meat substitutes.
- Incorporation of predominantly intact biomass into such products as a binding and/or bulking agent can improve hydration and increase yield due to the water binding capacity of predominantly intact biomass.
- Re-hydrated foods such as scrambled eggs made from dried powdered eggs, may also have improved texture and nutritional profile.
- liquid food products such as sauces, soups, dressings (ready to eat), creamers, milk drinks, juice drinks, smoothies, creamers.
- liquid food products include nutritional beverages that serve as a meal replacement or algal milk.
- Other food products include butters or cheeses and the like including shortening, margarine/spreads, nut butters, and cheese products, such as nacho sauce.
- Other food products include energy bars, chocolate confections-lecithin replacement, meal replacement bars, granola bar-type products.
- Another type of food product is batters and coatings.
- the food can retain the benefits of high monounsaturated oil content of coating without picking up less desirable oils (e.g., trans fats, saturated fats, and by products from the cooking oil).
- the coating of biomass can also provide a desirable (e.g., crunchy) texture to the food and a cleaner flavor due to less absorption of cooking oil and its byproducts.
- uncooked products such as a salad dressing
- oil imparts a desired mouth feeling e.g., as an emulsion with an aqueous solution such as vinegar
- purified algal oil or micronized biomass is preferred.
- some algal cells of original intact biomass may be lysed but other algal cells may remain intact. The ratio of lysed to intact cells depends on the temperature and duration of the cooking process.
- dispersion of oil in a uniform way with other ingredients is desired for taste, texture and/or appearance (e.g., baked goods)
- use of micronized biomass or purified algal oil is preferred.
- algal biomass is used to supply oil and/or protein and other nutrients, primarily for their nutritional or caloric value rather than texture.
- Algal biomass can also be useful in increasing the satiety index of a food product (e.g., a meal-replacement drink or smoothie) relative to an otherwise similar conventional product made without the algal biomass.
- the satiety index is a measure of the extent to which the same number of calories of different foods satisfy appetite. Such an index can be measured by feeding a food being tested and measuring appetite for other foods at a fixed interval thereafter. The less appetite for other foods thereafter, the higher the satiety index. Values of satiety index can be expressed on a scale in which white bread is assigned a value of 100. Foods with a higher satiety index are useful for dieting.
- algal biomass is believed to increase the satiety index of a food by increasing the protein and/or fiber content of the food for a given amount of calories.
- Algal biomass (predominantly intact and homogenized or micronized) and/or algal oil can also be manufactured into nutritional or dietary supplements.
- algal oil can be encapsulated into digestible capsules in a manner similar to fish oil. Such capsules can be packaged in a bottle and taken on a daily basis (e.g., 1-4 capsules or tablets per day).
- a capsule can contain a unit dose of algal biomass or algal oil.
- biomass can be optionally compressed with pharmaceutical or other excipients into tablets.
- the tablets can be packaged, for example, in a bottle or blister pack, and taken daily at a dose of, e.g., 1-4 tablets per day.
- the tablet or other dosage formulation comprises a unit dose of biomass or algal oil.
- the algal biomass can be mixed with other powders and be presented in sachets as a ready-to-mix material (e.g., with water, juice, milk or other liquids).
- the algal biomass can also be mixed into products such as yogurts.
- algal biomass and/or algal oil can be incorporated into nutritional supplements
- the functional food products discussed above have distinctions from typical nutritional supplements, which are in the form of pills, capsules, or powders.
- the serving size of such food products is typically much larger than a nutritional supplement both in terms of weight and in terms of calories supplied.
- food products often have a weight of over 100g and/or supply at least 100 calories when packaged or consumed at one time.
- food products typically contain at least one ingredient that is either a protein, a carbohydrate or a liquid and often contain two or three such other ingredients.
- the protein or carbohydrate in a food product often supplies at least 30%, 50%, or 60% of the calories of the food product.
- algal biomass can be made by a manufacturer and sold to a consumer, such as a restaurant or individual, for use in a commercial setting or in the home.
- Such algal biomass is preferably manufactured and packaged under Good Manufacturing Practice (GMP) conditions for food products.
- GMP Good Manufacturing Practice
- the algal biomass in predominantly intact form or homogenized or micronized form as a powder is often packaged dry in an airtight container, such as a sealed bag.
- Homogenized or micronized biomass in slurry form can be conveniently packaged in a tub among other containers.
- the algal biomass can be packaged under vacuum to enhance shelf life. Refrigeration of packaged algal biomass is not required.
- the packaged algal biomass can contain instructions for use including directions for how much of the algal biomass to use to replace a given amount of oil, fat or eggs in a conventional recipe, as discussed above.
- the directions can state that oil or fat are to be replaced on a 2:1 ratio by mass or volume of biomass, and eggs on a ratio of 11g biomass or 1 teaspoon of algal oil per egg.
- other ratios are possible, for example, using a ratio of 10-175% mass or volume of biomass to mass or volume of oil and/or fat and/or eggs in a conventional recipe.
- the instructions may direct the user to keep the algal biomass in an airtight container, such as those widely commercially available (e.g., Glad), optionally with refrigeration.
- Algal biomass (predominantly intact or homogenized or micronized powder) can also be packaged in a form combined with other dry ingredients (e.g., sugar, flour, dry fruits, flavorings) and portioned packed to ensure uniformity in the final product.
- the mixture can then be converted into a food product by a consumer or food service company simply by adding a liquid, such as water or milk, and optionally mixing, and/or cooking without adding oils or fats. In some cases, the liquid is added to reconstitute a dried algal biomass composition.
- Cooking can optionally be performed using a microwave oven, convection oven, conventional oven, or on a cooktop.
- Such mixtures can be used for making cakes, breads, pancakes, waffles, drinks, sauces and the like. Such mixtures have advantages of convenience for the consumer as well as long shelf life without refrigeration.
- Such mixtures are typically packaged in a sealed container bearing instructions for adding liquid to convert the mixture into a food product.
- Algal oil for use as a food ingredient is likewise preferably manufactured and packaged under GMP conditions for a food.
- the algal oil is typically packaged in a bottle or other container in a similar fashion to conventionally used oils.
- the container can include an affixed label with directions for using the oil in replacement of conventional oils, fats or eggs in food products, and as a cooking oil.
- the oil When packaged in a sealed container, the oil has a long shelf-life (at least one year) without substantial deterioration.
- algal oil comprised primarily of monounsaturated oils is not acutely sensitive to oxidation. However, unused portions of the oil can be kept longer and with less oxidation if kept cold and/or out of direct sunlight ( e.g., within an enclosed space, such as a cupboard).
- the directions included with the oil can contain such preferred storage information.
- the algal biomass and/or the algal oil may contain a food approved preservative/antioxidant to maximize shelf-life, including but not limited to, carotenoids (e.g., astaxanthin, lutein, zeaxanthin, alpha-carotene, beta-carotene and lycopene), phospholipids ( e.g., N-acylphosphatidylethanolamine, phosphatidic acid, phosphatidylethanolamine, phosphatidylcholine, phosphatidylinositol and lysophosphatidylcholine), tocopherols ( e.g., alpha tocopherol, beta tocopherol, gamma tocopherol and delta tocopherol), tocotrienols ( e.g., alpha tocotrienol, beta tocotrienol, gamma tocotrienol and delta tocotrienol), Butylated hydroxytoluene,
- the biomass imparts high quality oil or proteins or both in such foods.
- the content of algal oil is preferably at least 10 or 20% by weight as is the content of algal protein.
- Obtaining at least some of the algal oil and/or protein from predominantly intact biomass is sometimes advantageous for food for high performance animals, such as sport dogs or horses.
- Predominantly intact biomass is also useful as a preservative.
- Algal biomass or oil is combined with other ingredients typically found in animal foods (e.g., a meat, meat flavor, fatty acid, vegetable, fruit, starch, vitamin, mineral, antioxidant, probiotic) and any combination thereof.
- Such foods are also suitable for companion animals, particularly those having an active life style.
- Inclusion of taurine is recommended for cat foods.
- the food can be provided in bite-size particles appropriate for the intended animal.
- Delipidated meal is useful as animal feed for farm animals, e.g., ruminants, poultry, swine, and aquaculture.
- Delipidated meal is a byproduct of preparing purified algal oil either for food or other purposes.
- the resulting meal although of reduced oil content still contains high quality proteins, carbohydrates, fiber, ash and other nutrients appropriate for an animal feed. Because the cells are predominantly lysed, delipidated meal is easily digestible by such animals.
- Delipidated meal can optionally be combined with other ingredients, such as grain, in an animal feed. Because delipidated meal has a powdery consistency, it can be pressed into pellets using an extruder or expanders, which are commercially available.
- Microalgae strains were cultivated in shake flasks with a goal to achieve over 20% of oil by dry cell weight.
- the flask media used was as follows: K 2 HPO 4 : 4.2 g/L, NaH 2 PO 4 : 3.1g/L, MgSO 4 ⁇ 7H 2 O: 0.24g/L, Citric Acid monohydrate: 0.25g/L, CaCl 2 2H 2 O: 0.025g/L, yeast extract: 2g/L, and 2% glucose.
- Cryopreserved cells were thawed at room temperature and 500 ul of cells were added to 4.5 ml of medium and grown for 7 days at 28°C with agitation (200 rpm) in a 6-well plate.
- Dry cell weights were determined by centrifuging 1 ml of culture at 14,000 rpm for 5 min in a pre-weighed Eppendorf tube. The culture supernatant was discarded and the resulting cell pellet washed with 1 ml of deionized water. The culture was again centrifuged, the supernatant discarded, and the cell pellets placed at -80°C until frozen. Samples were then lyophyllized for 24 hrs and dry cell weights calculated. For determination of total lipid in cultures, 3 ml of culture was removed and subjected to analysis using an Ankom system (Ankom Inc., Cincinnati, NY) according to the manufacturer's protocol.
- Chlorella sp. CCAP 211/92 46.51 15 Chlorella sorokiniana SAG 211.40B 46.67 16 Parachlorella beijerinkii SAG 2046 30.98 17 Chlorella luteoviridis SAG 2203 37.88 18 Chlorella vulgaris CCAP 211/11K 35.85 19 Chlorella reisiglii CCAP 11/8 31.17 20 Chlorella ellipsoidea CCAP 211/42 32.93 21 Chlorella saccharophila CCAP 211/31 34.84 22 Chlorella saccharophila CCAP 211/32 30.51 23
- the first formulation (Media 1) was based on medium described in Wu et al. (1994 Science in China, vol. 37, No. 3, pp. 326-335 ) and consisted of per liter: KH 2 PO 4 , 0.7g; K 2 HPO 4 , 0.3g; MgSO 4 -7H 2 O, 0.3g; FeSO 4 -7H 2 O, 3mg; thiamine hydrochloride, 10 ⁇ g; glucose, 20g; glycine, 0.1g; H 3 BO 3 , 2.9mg; MnCl 2 -4H 2 O, 1.8mg; ZnSO 4 -7H 2 O, 220 ⁇ g; CuSO 4 -5H 2 O, 80 ⁇ g; and NaMoO 4 -2H 2 O, 22.9mg.
- the second medium (Media 2) was derived from the flask media described in Example 1 and consisted of per liter: K 2 HPO 4 , 4.2g; NaH 2 PO 4 , 3.1g; MgSO 4 -7H 2 O, 0.24g; citric acid monohydrate, 0.25g; calcium chloride dehydrate, 25mg; glucose, 20g; yeast extract, 2g.
- the third medium (Media 3) was a hybrid and consisted of per liter: K 2 HPO 4 , 4.2g; NaH 2 PO 4 , 3.1g; MgSO 4 -7H 2 O, 0.24g; citric acid monohydrate, 0.25g; calcium chloride dehydrate, 25mg; glucose, 20g; yeast extract, 2g; H 3 BO 3 , 2.9mg; MnCl 2 -4H 2 O, 1.8 mg; ZnSO 4 -7H 2 O, 220 ⁇ g; CuSO 4 -5H 2 O, 80 ⁇ g; and NaMoO 4 -2H 2 O, 22.9mg. All three media formulations were prepared and autoclave sterilized in lab scale fermentor vessels for 30 minutes at 121°C. Sterile glucose was added to each vessel following cool down post autoclave sterilization.
- Inoculum for each fermentor was Chlorella protothecoides (UTEX 250), prepared in two flask stages using the medium and temperature conditions of the fermentor inoculated. Each fermentor was inoculated with 10% (v/v) mid-log culture. The three lab scale fermentors were held at 28°C for the duration of the experiment. The microalgal cell growth in Media 1 was also evaluated at a temperature of 23°C. For all fermentor evaluations, pH was maintained at 6.6-6.8, agitations at 500rpm, and airflow at 1 vvm. Fermentation cultures were cultivated for 11 days. Biomass accumulation was measured by optical density at 750 nm and dry cell weight.
- Lipid/oil concentration was determined using direct transesterification with standard gas chromatography methods. Briefly, samples of fermentation broth with biomass was blotted onto blotting paper and transferred to centrifuge tubes and dried in a vacuum oven at 65-70°C for 1 hour. When the samples were dried, 2mL of 5% H 2 SO 4 in methanol was added to the tubes. The tubes were then heated on a heat block at 65-70°C for 3.5hours, while being vortexed and sonicated intermittently. 2ml of heptane was then added and the tubes were shaken vigorously. 2M1 of 6% K 2 CO 3 was added and the tubes were shaken vigorously to mix and then centrifuged at 800rpm for 2 minutes.
- Percent oil/lipid was based on a dry cell weight basis.
- the lipid profiles (in area %, after normalizing to the internal standard) for algal biomass generated using the three different media formulations at 28°C are summarized below in Table 2. Table 2. Lipid profiles for Chlorella protothecoides grown under different media conditions.
- Microalgal biomass is generated by culturing microalgae as described in any one of Examples 1-2.
- the microalgal biomass is harvested from the fermentor, flask, or other bioreactor.
- GMP procedures are followed. Any person who, by medical examination or supervisory observation, is shown to have, or appears to have, an illness, open lesion, including boils, sores, or infected wounds, or any other abnormal source of microbial contamination by which there is a reasonable possibility of food, food-contact surfaces, or food packaging materials becoming contaminated, is to be excluded from any operations which may be expected to result in such contamination until the condition is corrected. Personnel are instructed to report such health conditions to their supervisors. All persons working in direct contact with the microalgal biomass, biomass-contact surfaces, and biomass-packaging materials conform to hygienic practices while on duty to the extent necessary to protect against contamination of the microalgal biomass.
- the methods for maintaining cleanliness include, but are not limited to: (1) Wearing outer garments suitable to the operation in a manner that protects against the contamination of biomass, biomass-contact surfaces, or biomass packaging materials. (2) Maintaining adequate personal cleanliness. (3) Washing hands thoroughly (and sanitizing if necessary to protect against contamination with undesirable microorganisms) in an adequate hand-washing facility before starting work, after each absence from the work station, and at any other time when the hands may have become soiled or contaminated. (4) Removing all unsecured jewelry and other objects that might fall into biomass, equipment, or containers, and removing hand jewelry that cannot be adequately sanitized during periods in which biomass is manipulated by hand.
- Such hand jewelry cannot be removed, it may be covered by material which can be maintained in an intact, clean, and sanitary condition and which effectively protects against the contamination by these objects of the biomass, biomass-contact surfaces, or biomass-packaging materials.
- Maintaining gloves if they are used in biomass handling, in an intact, clean, and sanitary condition.
- the gloves should be of an impermeable material.
- Wearing where appropriate, in an effective manner, hair nets, headbands, caps, beard covers, or other effective hair restraints.
- microalgal biomass can optionally be subjected to a cell disruption procedure to generate a lysate and/or optionally dried to form a microalgal biomass composition.
- Chlorella protothecoides (UTEX 250) biomass was produced using 5,000L fermentation tanks using processes described in Examples 2 and 3. Glucose (corn syrup) concentration was between was monitored throughout the run. When the glucose concentration was low, more glucose was added to the fermentation tank. After all nitrogen was consumed, the cells began accumulating lipid. Samples of biomass were taken throughout the run to monitor lipid levels and the run was stopped when the biomass reached the desired lipid content (over 40% lipid by dry cell weight). In this case, the biomass was harvested when it reached approximately 50% lipid by dry cell weight.
- the harvested Chlorella protothecoides biomass was separated from the culture medium using centrifugation and dried on a drum dryer using standard methods at approximately 150-170°C..
- the resulting drum-dried Chlorella protothecoides biomass with approximately 50% lipid by dry cell weight (high lipid) was packaged and stored for use as algal flakes.
- LC-MS/MS liquid chromatography-mass spectrometry/mass spectrometry
- Toxin Category Toxin Result Limit of detection (LC/MS) Amnesic Shellfish Poisoning (ASP) Toxins Domoic Acid Not detectable 1 ⁇ g/g Diarrhetic Shellfish Poisoning (DSP) Toxins Okadaic acid and Dinophysistoxins Not detectable 0.1 ⁇ g/g Pectenotoxins Not detectable 0.1 ⁇ g/g Yessotoxins Not detectable 0.1 ⁇ g/g Azaspiracides Not detectable 0.1 ⁇ g/g Gymnodimines Not detectable 0.1 ⁇ g/g Paralytic Shellfish Poisoning (PSP) Toxins Saxitoxin Not detectable (HPLC/FD) 0.3 ⁇ g/g Neosaxitoxin Not detectable (HPLC/FD) 0.3 ⁇ g/g Decarbamoylsaxitoxin Not detectable (HPLC/FD) ) 0.3 ⁇ g/g Gonyautoxins Not detectable (HPLC/FD) 0.3
- the crude protein determined by the amount of nitrogen released from burning each biomass, was 5% for the high lipid biomass and 50% for the high protein biomass.
- Carbohydrate content was calculated by difference, taking the above known values for fat, crude fiber, moisture, ash and crude protein and subtracting that total from 100.
- the calculated carbohydrate content for the high lipid biomass was 36% and the carbohydrate content for the high protein biomass as 24%.
- the analysis of the total dietary fiber content (within the carbohydrate fraction of the algal biomass) of both algal biomass was performed using methods in accordance with Offical Methods of ACOC International (AOAC Method 991.43).
- the high lipid biomass contained 19.58% soluble fiber and 9.86% insoluble fiber, for a total dietary fiber of 29.44%.
- the high protein biomass contained 10.31% soluble fiber and 4.28% insoluble fiber, for a total dietary fiber of 14.59%.
- a sample of dried Chlorella protothecoides (UTEX 250) biomass with approximately 50% lipid by dry cell weight, grown and prepared using the methods described in Example 4 was analyzed for amino acid content in accordance with Official Methods of AOAC International (tryptophan analysis: AOAC method 988.15; methionine and cystine analysis: AOAC method 985.28 and the other amino acids: AOAC method 994.12).
- the amino acid profile from the dried algal biomass (expressed in percentage of total protein) was compared to the amino acid profile of dried whole egg (profile from product specification sheet for Whole Egg, Protein Factory Inc., New Jersey), and the results show that the two sources have comparable protein nutritional values.
- Example 4 A sample of algal biomass produced using methods described in Example 4 was analyzed for tocotrienol and tocopherol content using normal phase HPLC, AOCS Method Ce 8-89. The tocotrienol and tocopherol-containing fraction of the biomass was extracted using hexane or another non-polar solvent. The complete tocotrienol and tocopherol composition results are summarized in Table 4. Table 4. Tocotrienol and tocopherol content in algal biomass.
- Tocotrienol and tocopherol composition of Chlorella protothecoides UTEX 250 Tocopherols Alpha tocopherol 6.29 mg/100g Delta tocopherol 0.47 mg/100g Gamma tocopherol 0.54 mg/100g Total tocopherols 7.3 mg/100g Tocotrienols Alpha tocotrienol 0.13 mg/g Beta tocotrienol 0 Gamma tocotrienol 0.09 mg/g Delta tocotrienol 0 Total tocotrienols 0.22 mg/g
- the carotenoid-containing fraction of the biomass was isolated and analyized fpr carotenoids using HPLC methods.
- the carotenoid-containing fraction was prepared by mixing lyophilized algal biomass (produced using methods described in Example 3) with silicon carbide in an aluminum mortar and ground four times for 1 minute each time, with a mortar and pestle. The ground biomass and silicon mixture was then rinsed with tetrahydrofuran (THF) and the supernatant was collected. Extraction of the biomass was repeated until the supernatant was colorless and the THF supernatant from all of the extractions were pooled and analyzed for carotenoid content using standard HPLC methods. The carotenoid content for algal biomass that was dried using a drum dryer was also analyzed using the methods described above.
- the carotenoid content of freeze dried algal biomass was: total lutein (66.9-68.9mcg/g: with cis-lutein ranging from 12.4-12.7mcg/g and trans-lutein ranging from 54.5-56.2mcg/g); trans-zeaxanthin (31.427-33.451mcg/g); cis-zeaxanthin (1.201-1.315mcg/g); t-alpha cryptoxanthin (3.092-3.773mcg/g); t-beta cryptoxanthin (1.061-1.354mcg/g); 15-cis-beta carotene (0.625-.0675mcg/g); 13-cis-beta carotene (.0269-.0376mcg/g); t-alpha carotene (0.269-.0376mcg/g); c-alpha carotene (0.043-.010mcg/g); t-beta car
- the carotenoid content of the drum-dried algal biomass was significantly lower: total lutein (0.709mcg/g: with trans-lutein being 0.091mcg/g and cis-lutein being 0.618mcg/g); trans-zeaxanthin (0.252mcg/g); cis-zeaxanthin (0.037mcg/g); alpha-cryptoxanthin (0.010mcg/g); beta-cryptoxanthin (0.010mcg/g) and t-beta-carotene (0.008mcg/g).
- the total reported carotenoids were 1.03mcg/g.
- Phospholipid analysis was also performed on the algal biomasss.
- the phospholipid containing fraction was extracted using the Folch extraction method (chloroform, methanol and water mixture) and the oil sample was analyzed using AOCS Official Method Ja 7b-91, HPLC determination of hydrolysed lecithins (International Lecithin and Phopholipid Society 1999), and HPLC analysis of phospholipids with light scatting detection (International Lecithin and Phospholipid Society 1995) methods for phospholipid content.
- the total phospholipids by percent w/w was 1.18%.
- the phospholipid profile of algal oil was phosphatidylcholine (62.7%), phosphatidylethanolamine (24.5%), lysophosphatidiylcholine (1.7%) and phosphatidylinositol (11%). Similar analysis using hexane extraction of the phospholipid-containing fraction from the algal biomass was also performed. The total phospholipids by percent w/w was 0.5%. The phospholipid profile was phosphatidylethanolamine (44%), phosphatidylcholine (42%) and phosphatidylinositol (14%).
- the ingredients of the cardio/metabolic health bar consisted of quick oats (30.725%), crisp rice (9.855%), fine granular sugar (sucrose) (14.590%), light brown sugar (6.080%), salt (0.550%), canola oil (10.940%), corn syrup 42 DE (7.700%), honey (3.650%), water (7.700%), lecithin (0.180%), baking soda (0.180%), dried algal biomass (Chlorella protothecoides UTEX 250, 48% lipid) (1.540%), corowise plant sterol (1.060%), inulin (soluble fiber) (4.280%), and psyllium (insoluble fiber) (0.970%).
- Cardio Daily Shot (a liquid food containing intact high oil algal biomass)
- the ingredients of the orange flavored cardio shot consisted of distilled water (869.858 g), sodium benzoate (0.100 g), Ticaloid 5415 powder (1.000 g), evaporated cane juice sugar (88.500 g), dried algal biomass (over 40% oil) (16.930 g), fibersol - 2 ADM (47.000 g), corowise ES-200 plant sterol (18.300 g), granular citric acid (1.312 g), orange extract (WONF, Flavor 884.0062U) (1.000 g). The ingredients were combined and blended until smooth.
- the ingredients of the fruit-based smoothie consisted of distilled water (815.365g), stabilizer (4.5g), apple juice concentrate (58g), orange juice concentrate (46.376g), lemon juice concentrate (1.913g), mango puree concentrate (42.5g), banana puree (40.656g), passionfruit juice concentrate (8.4g), ascorbic acid (0.320g), algal flakes (46.41g), orange flavor extract (1g), pineapple flavor (0.4g) and mango flavor (0.16g). The ingredients were combined and blended until smooth.
- the ingredients of the metabolic health tablet (1.25-1.75 g size) consisted of Chlorella protothecoides dried microalgae biomass (UTEX 250, over 40% lipid dry cell weight) (1000 mg/tablet), betatene beta carotene (beta carotene 20% from Dunaliella) (15 mg/tablet), vitamin C as ascorbic acid (100 mg/tablet), and bioperine (piper nigrem bioavailability enhancer) (2.5 mg/tablet).
- the ingredients of the algae snack chips consisted of unbleached white flour (1 cup), potato flour (1/2 cup), algal biomass (over 40% lipid dry cell weight) (3 tablespoons), salt (3/4 teaspoon, adjust to taste), barley flour (2 tablespoons), water (1/3 - 1 cup), and seasonings (e.g., cumin, curry, ranch dressing) (to taste).
- Preparation procedure The dry ingredients were mixed and 1/3 cup of water was added to the dry ingredients. Additional water was added (up to 1 cup total) to form dough. The dough was kneaded into a uniformed product and then was allowed to rest for 30 minutes at room temperature. The rested dough was cut and formed into thin chips and baked at 275°F for 20-30 minutes, or until crispy.
- the ingredients of the algae raisin cookies consisted of butter or margarine (1/2 cup, conventional food recipe calls for 3/4 cup), barley flakes or oatmeal ( 1 3/4 cup), nutmeg (1/4 teaspoon), water or milk (2-3 tablespoons), brown sugar (1 cup), salt (1/2 teaspoon), baking powder (1/2 teaspoon), vanilla (1 teaspoon), cinnamon (1 teaspoon), raisins (optionally presoaked in brandy or orange juice) (3/4 cup), and dried algal biomass (over 30% oil) (1/3 cup). This recipe made about 2 dozen cookies.
- the conventional food recipe calls for 2 eggs and 3 ⁇ 4 cup of butter or margarine. With the use of dried algal biomass, 1 ⁇ 4 cup of butter or margarine and eggs are eliminated by substitution with algal biomass containing oil.
- Preparation procedure Cream the butter and sugar. Beat until fairly fluffy. Add the vanilla. Combine the flour and barley flakes and algae. Combine the butter mixture with the flour-flakes mixture. Add the raisins. Drop by teaspoonfuls, and flatten, slightly. Bake about 9-10 minutes at 375 degrees F.
- the ingredients of the barley pasta with algae consisted of barley flour (3/4 cup), dried algal biomass with at least 20% lipid by dry cell weight (2 tablespoons), large egg (1), and salt (1/2 teaspoon).
- Preparation procedure Place flour in bowl and add algae and salt. Whisk together. Add egg in middle (make a well), and gradually stir in flour. If difficult to stir in, add 1 tablespoon water, sprinkling it around. When all the flour has been incorporated, begin to knead the dough to make it more uniform. This should be done for 5- 8 minutes. When the dough is uniform, divide it into two small balls, and rub olive oil on the outside. Cover and let rest about 30 minutes. Flatten the dough, then roll it with a rolling pin to a thickness of about an eighth of an inch, for fettucine-like pasta. Slice the pasta into thin strips. Drop into boiling, salted water. Cook about 8-10 minutes. The pasta can be served with a small amount of grated parmesan cheese on top, and some cracked pepper.
- This example compares pasta made by a conventional recipe and a whole cell high-lipid biomass ( Chlorella protothecoides (strain UTEX 250) with 48% lipid by dry cell weight) to replace the egg in the conventional recipe.
- Table 5 Recipe for traditional pasta control. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Whole Egg (beaten) 1 55.67 24.97% 1.87% Salt, Table 1 ⁇ 2 tsp. 3.74 1.68% 0.00% Flour, All-purpose 1 cup 133.18 59.74% 0.00% Water 1-2 tbsp. 30.35 13.61% 0.00% Yield: 3 222.94 100.00% 1.87% Table 6. Recipe for whole cell algal biomass replacing the whole egg.
- the whole cell biomass pasta had similar texture and appearance to the conventional recipe. No prominent algal flavor was evident.
- the whole cell algal biomass improved yield in the dry pasta, most likely due to a water binding function.
- Algal milk contains about 8% solids, which is comprised of 4% heart healthy lipids, 2.5% of essential amino acid-rich proteins, 1.5% carbohydrates and 0.5% fiber, and is fortified with vitamins A and D.
- Algal milk is extremely healthy; it is vegan, and can be used as a substitute for cow's milk and soy milk. Unlike cow's milk, it is very low in saturated fat, and unlike soy milk, the fat is primarily a mono-unsaturate (over 50% C18:1).
- the algal milk has a bland taste; not "beany" as in soy milk. Flavors can be added, such as strawberry or raspberry.
- the ingredients of the algal milk consisted of dried whole algal cells containing about 40% lipid (8%), vitamin D (200 units), vitamin A (200 units), xanthan gum (0.2%), and water (to 100%). The water was warmed the the xanthan gum was dispersed. The whole, dried algal cells were then dispersed in the warm xanthan gum solution and vitamins were added. The solution was then homogenized using a high pressure homogenizer and pasteurized. An additional formulation is included below using algal flour.
- High lipid containing Chlorella protothecoides grown using the methods and conditions described in Example 4 was processed into a high lipid algal homogenate.
- the harvested Chlorella protothecoides biomass was first processed into algal flakes (see Example 4).
- the dried algal flakes were then rehydrated in deionized water at approximately 40% solids concentration.
- the resulting algal flake suspension was then micronized using a high pressure homogenizer (GEA model NS1001) operating at a pressure level of 1000-1200 Bar until the average particle size of the biomass was less than 10 ⁇ m.
- the resulting algal homogenate was packaged and stored until use.
- High lipid algal flakes were prepared using the methods described in Example 4.
- High lipid algal homogenate was prepared using the methods described in Example 8.
- This example compares chocolate brownies made using a conventional recipe, a low fat control recipie and with high lipid algal flakes ( Chlorella protothecoides (strain UTEX 250) with 48% lipid by dry cell weight) replacing some of the fat in the conventional recipe.
- the low fat control brownies did not have the same crumb structure as compared to the brownies made with the algal flakes or the conventional brownies.
- the algal flakes brownies had a nice, visible crumb structure, but were a little denser and gummier than the full fat brownies.
- the brownies made with the algal flakes had about a 64% reduction in the fat content when compared to the conventional brownies.
- This example compares yellow cake made by a conventional recipe, a low fat recipe, high-lipid algal homogenate (HL-AH) to replace the eggs and butter in the conventional recipe, and high lipid algal flakes to replace the eggs in the conventional recipe.
- Both the algal homogenate and the algal flakes were from Chlorella protothecoides (strain UTEX 250) with 48% lipid by dry cell weight.
- Table 10 Conventional yellow cake recipe.
- Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Butter 1 cup 222.20 11.38% 9.11% Sugar, granulated 2 1 ⁇ 2 cups 476.16 24.40% 0.00% Eggs, Whole 3 148.26 7.60% 0.57% Vanilla Extract 1 1 ⁇ 2 tsp.
- the yellow cake made with the high lipid algal flakes (as an egg replacer) was very dense, with almost no crumb structure. However, the yellow cake made with high lipid algal flakes was moist when compared to the low fat negative control, which was very dense and dry.
- the cake made with high lipid algal homogenate (HL-AH) (replacing all the butter and eggs in the full fat cake) was very moist and buttery in texture and had very good crumb structure that was similar to the conventional recipe cake. In tasting, the cake made with HL-AH lacked a buttery flavor that was present in the conventional cake.. Overall, the HL-AH was a good replacer of butter and eggs in a conventional yellow cake recipe. The cake with the HL-AH contained about 75% less fat than the conventional yellow cake, but produced a cake with good crumb structure, texture and moistness.
- This example compares biscuits made by a conventional recipe, high-lipid algal flake to replace the eggs and shortening in the conventional recipe, and high-lipid algal homogenate (HL-AH) to replace the eggs and shortening in the conventional recipe.
- Both the algal flake and the algal homogenate biomass were from Chlorella protothecoides (strain UTEX 250) with 48% lipid by dry cell weight.
- Table 14 Conventional recipe for biscuits. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Flour, All Purpose 2 cups 277.73 44.59% 0.00% Baking Powder 4 tsp. 20.28 3.26% 0.00% Sugar, granulated 3 tsp.
- the sample made with HL-AH appeared similar to the full fat control in texture and appearance. Overall, the HL-AH biscuits were the closest to the conventional recipe biscuits, producing a biscuit with 65% less fat, but still retained the texture and rise of a conventional recipe biscuit.
- This example compares mayonnaise/salad dressing using a conventional recipe with 40% fat control, a low fat recipe with 20% fat control, and a recipe with high-lipid algal homogenate (HL-AH) (with -20% fat by weight) from Chlorella protothecoides (strain UTEX 250) with 48% lipid by dry cell weight.
- Table 17. Recipe for 40% fat control. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Oil, Canola 200.00 40.00% 40.00% Liquid Egg Yolk 15.00 3.00% 3.00% Vinegar, distilled, 60 grain 200.00 40.00% 0.00% Salt, Table 0.00 0.00% 0.00% Water 85.00 17.00% 0.00% 500.00 100.00% 43.00% Table 18.
- the 20% fat control dressing (made with canola oil) did not have any viscosity and failed to form an emulsion.
- the surface was foamy and oil droplets formed after letting the dressing sit.
- the dressing made with the HL-AH had an algal biomass flavor, good opacity and viscosity, and a creamy mouthfeel.
- the HL-AH imparted a better opacity and viscosity to the dressing when compared to both the 20% and the 40% fat dressings.
- the HL-AH functioned as a great emulsifier and produced a dressing that had the properties of a 40% fat dressing with the proper mouthfeel at half the fat content.
- This example compares a model chocolate nutritional beverage made with a conventional recipe, with high lipid algal homogenate (HL-AH)to replace milk and oil in the conventional recipe, and one with high-lipid algal flake biomass to replace milk and oil in the conventional recipe.
- Both the algal flake biomass and the HL-AH were from Chlorella protothecoides (strain UTEX 250) with 48% lipid by dry cell weight.
- Table 20 Recipe for the conventional chocolate beverage control.
- the chocolate beverage containing the HL-AH had a thicker, richer appearance than the chocolate beverage containing the algal flakes, and was closer in appearance to the conventional chocolate beverage.
- the micronized HL-AH sample more closely resembled the conventional chocolate beverage control, imparting a good viscosity and with slightly more opacity than the conventional chocolate beverage control.
- High lipid containing Chlorella protothecoides grown using the fermentation methods and conditions described in Example 4 was processed into a high lipid algal powder.
- the harvested Chlorella protothecoides biomass was separated from the culture medium and then concentrated using centrifugation and dried using a spray dryer according to standard methods.
- the resulting algal powder (whole algal cells that have been spray dried into a powder form) was packaged and stored until use.
- High lipid containing Chlorella protothecoides grown using the fermentation methods and conditions described in Example 4 was processed into a high lipid algal flour.
- the harvested Chlorella protothecoides biomass was separated from the culture medium using centrifugation.
- the resulting concentrated biomass, containing over 40% moisture, was micronized using a high pressure homogenizer ((GEA model NS1001) operating at a pressure level of 1000-1200 Bar until the average particle size of the biomass was less than 10 ⁇ m.
- the algal homogenate was then spray dried using standard methods.
- the resulting algal flour (micronized algal cell that have been spray dried into a powder form) was packaged and stored until use.
- the following examples describe the use of high lipid (at least 20% by weight, typically 25-60% lipid by weight) algal flour as a fat replacement in conventional recipes. Additional examples also demonstrate unique functionality of the algal flour in increased moisture retention and improved texture when used in prepared foods such as powdered scrambled eggs.
- the high lipid algal flour used the examples below was prepared using the methods described in Example 13.
- chocolate brownies made with a conventional recipe was compared to brownies made with brownies made with algal flour and a conventional reduced-fat brownie.
- High lipid (approximately 53% lipid by dry weight) algal flour was used in place of butter and eggs.
- Table 23 Conventional brownie recipe.
- the dry ingredients were combined and the algal flour was then added to the dry ingredients.
- the wet ingredients water and vanilla were then slowly blended into the dry ingredients. Spread batter into pan and bake for 27-28 minutes.
- the conventional reduced fat recipe produced a brownie that had a dry texture and was more cake-like than a brownie texture.
- the brownies made with algal flour (which had similar fat percentage as the reduced fat recipe brownies, approximately 8% fat) were very moist and had a brownie texture, but had a more fragile crumb structure when compared to the conventional brownie recipe (approximately 19% fat).
- the brownies made with algal flour were not as dense, had a softer crumb structure.
- the algal flour was an effective replacement for butter and eggs in a baked good recipe, and produced a product similar in texture, taste and appearance to the conventional recipie product.
- the algal flour exhibit unique functionality (e . g ., finer crumb structure, not as gummy, and light texture) not seen with the use of algal flakes.
- mayonnaise made with algal flour that has been reconstituted in water (40% by w/v) and homogenized at low pressure (100-200 bar) to produce a slurry was compared to mayonnaise made with a conventional recipe and a reduced fat mayonnaise.
- the algal flour slurry was made with high lipid algal flour having approximately 53% lipid by dry weight and completely replaced the oil and egg yolks in the conventional recipes.
- Table 26 Conventional mayonnaise recipe.
- the mayonnaise made with the algal flour slurry had the viscosity of between the conventional and the reduced fat mayonnaise.
- the mouthfeel of the algal flour slurry mayonnaise was comparable to that of the conventional mayonnaise (but contains less than 50% of total fat).
- Instant food starch was needed in both the reduced fat mayonnaise and the algal flour slurry mayonnaise in order to bind more water and tighten the product to be more "spreadable”.
- using the algal flour slurry to replace all of the fat sources (e.g. , oil and egg yolks) in a conventional mayonnaise recipe produced a mayonnaise with good viscosity and a mouthfeel that was indistinguishable from conventional mayonnaise.
- the algal flour slurry functioned as an effective emulsifier, successfully replacing the functionality of oil and egg yolks found in conventional mayonnaise.
- high lipid algal flour slurry was used to make a reduced fat honey mustard dipping sauce/dressing.
- Honey, mustard, white vinegar, lemon juice flavor and sea salt was added to the prepared mayonnaise (modified slightly to achieve the proper consistency of a dipping sauce/dressing) described above. All ingredients were combined and mixed in a food processor until homogenous and smooth.
- the end product contained approximately 14% algal flour by weight, and had approximately 8% total fat.
- the honey mustard dipping sauce/dressing containing algal flour had a creamy mouthfeel comparable to a conventional (full fat) honey mustard dipping sauce.
- miso salad dressing was prepared using a conventional recipe and a recipe containing high lipid algal flour reconstituted as a slurry (40% solids), produced using methods as described in the preceeding mayonnaise formulation.
- Table 29 Recipe for the conventional miso salad dressing.
- Component Weight(g) Percent (by weight) Oil Phase Canola oil 294.00 98.00 Sesame oil 6.00 2.00 300.00 100%
- Aqueous Phase Vinegar, rice wine 143.50 20.50 Miso paste, red 166.25 23.70 Sugar, granulated 78.75 11.250 Garlic powder 3.5 0.50 Mustard flour 5.25 0.75 Ginger powder 5.25 0.75 Xanthan gum 1.50 0.214 Potassium sorbate 0.88 0.125 Calcium disodium EDTA 0.18 0.025 Water 294.95 42.136 700.00 100.00% Table 30. Recipe for miso salad dressing made with algal flour slurry.
- Component Weight(g) Percent (by weight) Oil Phase Canola oil 94.0 94.00 Sesame oil 6.00 6.00 100.00 100%
- Aqueous Phase Algal flour, slurry 125.00 13.889 Vinegar, rice wine 80.00 8.889 Vinegar, distilled 60.00 6.667 Miso paste, red 225.00 25.00 Sugar, granulated 85.00 9.444 Garlic powder 3.5 0.389 Mustard flour 5.25 0.583 Ginger powder 5.25 0.583 Xanthan gum 2.70 0.300 Potassium sorbate 0.88 0.097 Calcium disodium EDTA 0.18 0.019 Titanium dioxide 4.20 0.467 Water 300.00 33.344 900.00 100.00%
- the dry ingredients were blended together set aside.
- the water, vinegar and acid were blended together and set aside.
- the miso paste was measured out separately.
- the oils were combined together and set aside.
- the algal flour-containing recipe the algal flour slurry, oil, and titanium dioxide was weighed out separately and combined.
- the water/vinegar mixture was then blended with a high shear blender.
- the dry ingredients were added into the water/vinegar mixture.
- the oils mixture was then streamed in slowly while the water/vinegar and dry ingredients were being blended with a high shear blender.
- the dressing was then heated to 190°F for 2 minutes and then the dressing was run through a colloid mill on the tightest setting.
- the finished dressing was then bottled and refridgerated until use.
- both the conventional and the algal flour containing recipes produced a thick and opaque creamy salad dressing.
- the two dressings were comparable in color and texture.
- the miso salad dressing made with the convention recipe contained approximately 30% fat
- the miso salad dressing made with the algal flour slurry contained approximately 12.65% fat.
- the miso dressing made with the algal flour slurry contained less than half the fat of the miso dressing made with the conventional recipe, while preserving the creamy mouthfeel and opacity.
- the ability of the algal flour to function in a yeast dough application was tested using a conventional pizza dough/breakstick recipe and a pizzadough/breadstick recipe containing 5% or 10% by weight algal flour.
- the pizzadough/breadsticks containing algal flour was made with high lipid algal flour slurry (40% solids), produced using the methods as described in the preceeding mayonnaise formulation.
- the conventional recipe pizza dough and breadsticks were chewy with a traditional crust.
- the pizza dough containing 5% algal flour slurry had a more cracker-like texture and was crisper than the conventional recipe pizza dough.
- the pizza dough containing 10% algal flour slurry was crisper than the pizza dough containing 5% algal flour slurry.
- the 5% algal breadsticks had a moist, chewy center when compared to the conventional recipe breadsticks.
- the breadsticks containing 10% algal flour slurry was even more moist than the 5% algal breadsticks.
- the baking time was increased with both breadsticks containing algal flour.
- algal flour slurry increased the crispness of the pizza dough and gave it a more cracker-like texture, and increased the moistness of the breadsticks when compared to the conventional recipe breadsticks.
- high lipid algal flour slurry (40% solids) were used in a corn tortilla recipe and compared to corn tortillas made from a conventional recipe. Similar to the pizza dough results, the corn tortillas containing algal flour slurry were more cracker-like in texture and crunchier than the conventional recipe tortillas.
- the ability of the algal flour to function in a cookie application was tested using a conventional soft-baked chocolate chip cookie recipe, a reduced fat soft-baked chocolate chip cookie recipe and a chocolate chip cookie made with high lipid algal flour slurry (produced using the same methods as described in the preceeding mayonnaise formulation).
- the algal flour slurry also replaced all of the butter and eggs in both the conventional and reduced fat cookie recipes.
- Table 31 Recipe for conventional soft-baked chocolate chip cookie.
- the conventional recipe cookie had good spreading during baking and was soft and fluffy out of the oven.
- the dough did not spread in the first batch, so in subsequent batches, the dough was flattened prior to baking.
- the reduced fat cookie was soft out of the oven, and firmed into a dense cookie upon cooling.
- the reduced fat cookie also had pronounced upfront corn syrup flavor.
- the algal flour cookie had similar spreading during baking as the conventional recipe cookie and was texturally better than the reduced fat cookie. After three days at ambient temperature, the algal flour cookie was more moist than both the conventional recipe cookie and the reduced fat cookie.
- the algal biomass slurry was effective as a replacement for butter and eggs in a cookie application. Functionally, the algal biomass slurry extended the shelf-life of the cookie, in that the cookie retained more moisture after three days in ambient temperature.
- a gluten-free oatmeal raisin cookie was made using high lipid algal flour (approximately 53% lipid by dry weight), produced using methods described in Example 13.
- the cookies were baked and then held at ambient temperature for seven days. Initial sensory tests and water activity were performed on the cookies immediately after baking and cooling. Additional sensory tests and water activity tests were performed on day 1, 3 and 7. On each test day, one cookie was chopped into small pieces so the raisins and oats were evenly distributed in the sample. At least two samples per cookie were assayed in the water activity tes to ensure accuracy of the measurement. Water activity (Aw) tests were performed according to manufacturer's protocols using an Aqua Lab, Model Series 3 TE (Decagon Devices, Inc.) instrument.
- water activity measures the water vapor pressure which quantifies the available, non-chemically bound water in a product; the higher the Aw value, the more moist the product. In this cookie application, the higher the Aw value correlates with a longer shelf-life. An Aw level of 0.65 was the desired target.
- Table 34 Recipe for gluten-free oatmeal raisin cookies made with algal flour slurry.
- the ability of the algal flour to retain moisture and offer textural improvement was tested in a reconstituted powdered eggs application.
- Powdered eggs were prepared using a conventional recipe, and with varying levels (5%, 10% and 20%) of high lipid algal flour as a replacement for the corresponding percentage (w/w) of powdered eggs.
- the algal flour used in the formulations below was prepared using the methods described in Example 13 and contained approximately 53% lipid by dry weight. Table 36. Conventional recipe for scrambled eggs from powdered eggs.
- the ability of the algal flour to improve texture and mouthfeel of scrambled egg whites was tested using Egg Beaters ® .
- 100 grams of Egg Beaters ® was scrambled using a small non-stick frying pan for approximately 1-2 minutes until the eggs were set. No butter or seasonings were used.
- a sample with 10% w/w substitution of high lipid algal flour slurry (prepared using methods described above in the mayonnaise application with algal flour containing approximately 53% lipid by dry weight).
- the Egg Beaters ® with the algal flour was prepared in a manner identical to the control.
- the control sample had a more watery consistency and dissolved in the mouth more like water, with relatively little or no texture.
- the sample containing 10% algal flour slurry cooked up more like scrambled eggs made with fresh eggs.
- the 10% algal flour slurry sample also had more of a scrambled eggs texture and had a full mouthfeel, similar to that of scrambled eggs made with fresh eggs.
- the addition of the algal flour slurry was very successful in improving the texture and mouthfeel of scrambled egg whites, making the egg whites taste more like scrambled eggs made with fresh whole eggs.
- algal flour The ability of algal flour to improve texture and moisture of scrambled eggs using liquid whole eggs was testing in a holding study and using a sensory panel.
- Liquid whole eggs was prepared according to manufacturer's directions as a control and compared to prepared liquid whole eggs with 10% algal flour slurry (2.5% algal flour with 7.5% water). Both control and 10% algal flour eggs were cooked up as scrambled eggs and held on a steam table for 60 minutes total. Samples of each scrambled egg product were taken and tested in a sensory panel every 10 minutes. The sensory panel judged the overall appearance, moisture level, texture and mouthfeel of the scrambled egg product on a scale of 1 to 9, with 1 being unacceptable, 3 being moderately unacceptable, 5 being fair, 7 being acceptable and 9 being excellent.
- Pancake/waffle mixes found in retail stores contain whole powdered eggs as an ingredient. As show above in the powdered eggs formulation, the addition of high lipid algal flour improved the texture and mouthfeel of the prepared egg product. The ability of high lipid algal flour to improve the texture and mouthfeel of pancakes made with ready-mixed pancake mixes was tested. Table 41. Recipe for the control pancakes. Component Weight(g) Percent Whole powdered eggs 10.1 4.6 Non-fat milk solids 10.9 5 All purpose wheat flour 65.5 29.8 Canola oil 7.3 3.3 Baking powder 3.6 1.6 Salt 0.9 0.41 Sugar 1.8 0.82 Water 120 54.5 Total 220.1 Table 42. Recipe for pancakes containing high lipid algal flour.
- the water was used to rehydrate the powdered eggs, algal flour, and non-fat milk solids. The remaining ingredients were then added and whisked until the batter was smooth.
- the batter was poured into a hot ungreased non-stick pan in pancake-sized portions. The pancakes were cooked until the bubbles on top burst and were then flipped over and cooked until done.
- algal milk An additional formulation for algal milk was produced using high lipid algal flour.
- the algal milk contained the following ingredients (by weight): 88.4% water, 6.0% flour, 3.0% whey protein concentrate, 1.7% sugar, 0.6% vanilla extract, 0.2% salt and 0.1% stabilizers.
- the ingredients were combined and homogenized on low pressure using a handheld homogenizer.
- the resulting algal milk was chilled before serving.
- the mouthfeel was comparable to that of whole milk and had good opacity.
- the algal flour used contained about 50% lipid, so the resulting algal milk contained about 3% fat.
- the algal milk had a comparable mouthfeel and opacity and lacked the beany flavor of soy milk.
- the algal milk was then combined with additional sugar and vanilla extract and mixed until homogenous in a blender for 2-4 minutes.
- the mixture was placed in a prechilled ice cream maker (Cuisinart) for 1-2 hours until the desired consistency was reached.
- a conventional recipe ice cream made with 325 grams of half and half, 220 grams of 2% milk and 1 egg yolk was prepared as a comparison.
- the conventional recipe ice cream had the consistency comparable to that of soft served ice cream, and was a rich tasting, smooth-textured ice cream.
- the ice cream made from algal milk lacked the overall creaminess and mouthfeel of the conventional recipe ice cream, the consistency and mouthfeel was comparable to a rich tasting ice milk..
- the use of algal milk in a frozen dessert application was successful: the frozen dessert algal milk produced was a lower fat alternative to a conventional ice cream.
- Algal oil is extracted from microalgal biomass prepared as described in Examples 1-4 by drying the biomass using methods disclosed herein, disrupting the biomass using methods disclosed herein, and contacting the disrupted biomass with an organic solvent, e.g., hexane, for a period of time sufficient to allow the oil to form a solution with the hexane. The solution is then filtered and the hexane removed by rotoevaporation to recover the extracted oil.
- an organic solvent e.g., hexane
- Algal oil is extracted from the microalgal biomass prepared as described in Examples 1-4, drying the biomass, and physically disrupting the biomass in an oilseed press, wherein the algal oil becomes liberated from the biomass. The oil, thus separated from the disrupted biomass, is then recovered.
- Lipid samples from a subset of strains grown in Example 1 were analyzed for lipid profile using HPLC. Results are shown in Figure 1 .
- Algal Oil Capsules (encapsulated oil that has been extracted from algae (a) via solvent
- Algal Oil Heart Health Capsules (Softgel) Ingredient (Trade name) Description Amount per Softgel (mg) DHA-S Oil Algal Oil DHA 35% 100 --- DHA 35 Phycosterols TM - Heart Health Super Food Blend Pressed Algal Oil (from a Chlorella species listed in Table 12) 100 - Omega 9 (as oleic acid) 70 - Omega 6 (as linoleic and linolenic acid) 17 lutein 0.0075 Plant Sterols Plant Sterol esters 400 Coenzyme Q10 Coenzyme Q10 15 Vitamin E, oil USP BASF D-Alpha Tocopheryl 10 Bioperine Piper nigrem bioavailability enhancer 2.5 Excipients: Beeswax, lecithin and purified water
- Algal Oil oil that has been extracted from algae either via solvent extraction or via non-solvent
- Algal Oil Softgel
- Ingredient Description Amount per Softgel (mg) Chlorella protothecoides (UTEX 250) oil Pressed Algal Oil 400 - Omega 9 (as oleic acid) 280 - Omega 6 (as linoleic and linolenic acid) 68 Vitamin E Acetate, oil USP BASF D-Alpha Tocopheryl Acetate 10
- Excipients Beeswax, lecithin, purified water
- Oil extracted from Chlorella protothecoides (UTEX 250) grown using the fermentation methods described in Example 4 was used in baked good applications. Yellow cake (Moist Deluxe, Duncan Hines) and brownies (Chocolate Chunk, Pillsbury) were produced using 1/3 cup of oil extracted from Chlorella protothecoides according to manufacturer's suggested instructions. The results of both the yellow cake and brownies were indistinguishable from yellow cake and brownies produced using vegetable oil and the same box mix.
- Heterotrophically produced Chlorella protothecoides (UTEX 250) was grown under nitrogen-rich conditions supplied by one or more of the following: yeast extract (organic nitrogen source), NH 4 OH and (NH 4 ) 2 SO 4 , supplementing the medium described in Examples 2-4. Other than the culture media, the fermentation conditions were identical to the conditions described in Example 2.
- the high protein algal biomass was harvested after approximately 3-5 days of exponential growth, when it reached the desired culture density. Any of the above-described processing methods (algal flakes in Example 4, algal homogenate in Example 10, algal powder in Example 12 and algal flour in Example 13) can be applied to the high protein algal biomass.
- the high protein biomass was processed into algal flakes using methods described in Example 4. Both dried biomass, high lipid (Example 4) and high protein, were analyzed for moisture, fat, fiber, ash, crude protein and protein digestibility using methods in accordance with Official Methods of ACOC International. The results are summarized in Table 45 below. Table 45. Proximate analysis of microalgae with high protein content.
- Total carbohydrates were calculated by difference: 100% minus the known percentages from proximate analysis. Total carbohydrate by weight for the high lipid biomass was approximately 36% and total carbohydrate by weight for the high protein biomass was approximately 24%.
- the above crude fiber represents the amount of cellulose and lignin (among other components) in the biomass samples.
- Both biomass were subjected to soluble and insoluble fiber (together is the total dietary fiber) measurements, which is part of the carbohydrate component of the biomass, using methods in accordance with Official Methods of ACOC International (AOAC method 991.43).
- the soluble fiber was 19.58% and the insoluble fiber was 9.86% (total dietary fiber of 29.44%).
- the soluble fiber was 10.31% and the insoluble fiber was 4.28% (total dietary fiber of 14.59%.
- the high protein algal biomass When compared to whole bean soy flour that has a percent total crude protein of about 40.9% and 95.35% total digestible protein, the high protein algal biomass had a percent total digestible protein that was a little less than whole bean soy flour. Additional assays were performed on high protein algal biomass that had been processed so that the algal cells were predominantly lysed. These assays resulted in the percent total digestible protein to be comparable to that of whole bean soy flour (approximately 95% total digestible protein). Overall, the percent total crude protein and the percent total digestible protein levels of the high protein biomass are comparable to that of whole bean soy flour.
- the digestibility assay results of the hexane-extracted biomeal indicated that the biomeal can be a viable additive for animal feed.
- the biomeal had both residual protein and oil and had a percent total digestible protein level of approximately 80%.
- the high protein algal biomass used in the recipes below was produced with the methods described in Example 17 above.
- the algal biomass used in the recipes below came from Chlorella protothecoides UTEX 250, which contained approximately 51% protein by weight and is referred to below as high protein algal biomass and designated either as algal flakes or algal homogenate.
- This example compares vegetarian burger patties made by a conventional recipe, with high protein algal biomass, either algal flakes or algal homogenate (AH), replacing vegetarian protein sources (textured soy protein (TSP), wheat gluten and/or soy protein isolate (SPI)).
- Table 46 Conventional vegetarian burger patty recipe.
- Component Weight (g) % % Fiber % Protein % Fat Water 62.0 62.0 0 0 0 TSP (Arcon T U272) 11.0 11.0 2.09 7.59 0.22 TSP (Arcon T U218) 10.0 10.0 1.9 6.90 0.20 Canola Oil 4.0 4.0 0 0 4.0 SPI 5.5 5.5 0 4.95 0.22 Wheat gluten 3.0 3.0 0 2.46 0.03 Nat. Veg.
- the protein bar made with the high protein algal homogenate showed slightly better binding compared to the protein bar made with the algal flakes. Also, the protein bar made with the algal homogenate required the least amount of corn syrup to bind the ingredients together. The protein bar made with the high protein algal homogenate was the more successful compostion compared to the conventional protein bar: for comparable amount of protein and fat, it contained about 3 times more dietary fiber.
- the high protein algal homogenate produced a nutrional beverage that was thicker in body when compared to the conventional recipe beverage.
- the high protein algal flakes produced a nutritional beverage that was thinner than the control beverage.
- the beverage containing high protein algal homogenate was more successful in this application, producing a thick nutritional beverage with great opacity.
- the nutritional beverage made with algal homogenate was comparable to the conventional beverage in sugar, fat and protein levels, while containing almost ten times more fiber.
- Genomic DNA was isolated from algal biomass as follows. Cells (approximately 200 mg) were centifuged from liquid cultures 5 minutes at 14,000 x g. Cells were then resuspended in sterile distilled water, centrifuged 5 minutes at 14,000 x g and the supernatant discarded. A single glass bead ⁇ 2mm in diameter was added to the biomass and tubes were placed at -80°C for at least 15 minutes. Samples were removed and 150 ⁇ l of grinding buffer (1% Sarkosyl, 0.25 M Sucrose, 50 mM NaCl, 20 mM EDTA, 100 mM Tris-HCl, pH 8.0, RNase A 0.5 ug/ul) was added.
- grinding buffer 1% Sarkosyl, 0.25 M Sucrose, 50 mM NaCl, 20 mM EDTA, 100 mM Tris-HCl, pH 8.0, RNase A 0.5 ug/ul
- the resulting aqueous phase was transferred to a fresh tube containing 0.7 vol of isopropanol ( ⁇ 190 ⁇ l), mixed by inversion and incubated at room temperature for 30 minutes or overnight at 4°C. DNA was recovered via centrifugation at 14,000 x g for 10 minutes. The resulting pellet was then washed twice with 70% ethanol, followed by a final wash with 100% ethanol. Pellets were air dried for 20-30 minutes at room temperature followed by resuspension in 50 ⁇ l of 10mM TrisCl, 1mM EDTA (pH 8.0).
- primer SZ02615 (5'-CAGTGAGCTATTACGCACTC-3' (SEQ ID NO:25) at 10 mM stock concentration). This primer sequence is complementary to position 1112-1093 in Gen Bank accession no. L43357 and is highly conserved in higher plants and algal plastid genomes.
- 5 ⁇ l of diluted total DNA and 3.2 ⁇ l dH 2 O were added. PCR reactions were run as follows: 98°C, 45"; 98°C, 8"; 53°C, 12"; 72°C, 20" for 35 cycles followed by 72°C for 1 min and holding at 25°C.
- Genomic DNA from 8 strains of Chlorella protothecoides (UTEX 25, UTEX 249, UTEX 250, UTEX 256, UTEX 264, UTEX 411, CCAP 211/17, and CCAP 211/8d) were isolated and genomic DNA analysis of 23S rRNA was performed according to the methods described above in Example 30. All strains of Chlorella protothecoides tested were identical in sequence except for UTEX 25. Results are summarized in Cladograms in Figures 13a-13c. Sequences for all eight strains are listed as SEQ ID NOs: 26 and 27 in the attached Sequence Listing.
- Chlorella regularis New Chapter, 390mg/gelcap
- Whole Foods Broken Cell Wall Chlorella Whole Foods, 500mg/pressed tablet
- NutriBiotic CGF Chlorella NutriBiotic, 500mg/pressed tablet
- the resulting PCR products were isolated and cloned into vectors and sequenced using M13 forward and reverse primers. The sequences were compared to known sequences using a BLAST search.
- Chlorella protothecoides (UTEX 250) was grown according to the methods and conditions described in Example 1. Chemical mutagenesis was performed on the algal strain using N-methyl-N'-nitro-N-nitroguanidine (NTG). The algal culture was subjected to the mutagen (NTG) and then selected through rounds of reisolation on 2.0% glucose agar plates. The colonies were screened for color mutants. Chlorella protothecoides (wildtype) appears to be a golden color when grown heterotophically. The screen produced one strain that appeared white in color on the agar plate.
- This color mutant was named 33-55 (deposited on October 13, 2009 in accordance with the Budapest Treaty at the American Type Culture Collection at 10801 University Boulevard, Manassas, VA 20110-2209 with a Patent Deposit Designation of PTA-XXXX). Another colony was also isolated and went through three rounds of reisolation to confirm that this mutation was stable. This mutant appeared to be light yellow in color on the agar plate and was named 25-32 (deposited on October 13, 2009 in accordance with the Budapest Treaty at the American Type Culture Collection at 10801 University Boulevard, Manassas, VA 20110-2209 with a Patent Deposit Designation of PTA-XXXX).
- Chlorella protothecoides 33-55 and the parental Chlorella protothecoides were grown according to the methods and conditions described in Example 1. The percent lipid (by dry cell weight) was determined for both strains: Chlorella protothecoides 33-55 was at 68% lipid and the parental strain was at 62% lipid.
- the lipid profiles were determined for both strains and were as follows (expressed as area %): Chlorella protothecoides 33-55, C14:0 (0.81); C16:0 (10.35); C16:1 (0.20); C18:0 (4.09); C18:1 (72.16); C18:2 (10.60); C18:3 (0.10); and others (1.69); for the parental strain, C14:0 (0.77); C16:0 (9.67); C16:1 (0.22); C18:0 (4.73); C18:1 (71.45); C18:2 (10.99); C18:3 (0.14); and others (2.05).
- Chlorella protothecoides (UTEX 250) was able to utilize a non-food carbon source
- cellulosic materials (exploded corn stover) was prepared for use as a carbon source for heterotrophic cultivation of Chlorella protothecoides that is suitable for use in any of the food applications described above in the preceeding Examples.
- Glucose concentrations were determined using Sigma Glucose Assay Reagent #G3293. Samples, treated as outlined above, were diluted 400 fold and 40 ⁇ l was added to the reaction. The corn stover cellulosic preparation was determined to contain approximately 23 g/L glucose.
- the material prepared above was evaluated as a feedstock for the growth of Chlorella protothecoides (UTEX 250) using the medium described in Example 1. Varying concentrations of cellulosic sugars mixed with pure glucose were tested (0, 12.5, 25, 50 and 100% cellulosic sugars). Cells were incubated in the dark on the varying concentrations of cellulosic sugars at 28°C with shaking (300 rpm). Growth was assessed by measurement of absorbance at 750nm in a UV spectrophotometer.
- Chlorella protothecoides cultures grew on the corn stover material prepared with Celluclast, including media conditions in which 100% of fermentable sugar was cellulosic-derived. Similar experiments were also performed using sugarbeet pulp treated with Accellerase as the cellulosic feedstock. Like the results obtained with corn stover material, all of the Chlorella protothecoides cultures were able to utilize the cellulosic-derived sugar as a carbon source.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Polymers & Plastics (AREA)
- Food Science & Technology (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Microbiology (AREA)
- Zoology (AREA)
- Animal Husbandry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Physiology (AREA)
- Biochemistry (AREA)
- Health & Medical Sciences (AREA)
- Coloring Foods And Improving Nutritive Qualities (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Fruits And Vegetables (AREA)
- Fodder In General (AREA)
- Bakery Products And Manufacturing Methods Therefor (AREA)
- Noodles (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Non-Alcoholic Beverages (AREA)
Description
- This application includes a Sequence Listing.
- The invention resides in the fields of microbiology, food preparation, and human and animal nutrition.
- As the human population continues to increase, there's a growing need for additional food sources, particularly food sources that are inexpensive to produce but nutritious. Moreover, the current reliance on meat as the staple of many diets, at least in the most developed countries, contributes significantly to the release of greenhouse gases, and there's a need for new foodstuffs that are equally tasty and nutritious yet less harmful to the environment to produce.
- Requiring only "water and sunlight" to grow, algae have long been looked to as a potential source of food. While certain types of algae, primarily seaweed, do indeed provide important foodstuffs for human consumption, the promise of algae as a foodstuff has not been realized. Algal powders made with algae grown photosynthetically in outdoor ponds or photobioreactors are commercially available but have a deep green color (from the chlorophyll) and a strong, unpleasant taste. When formulated into food products or as nutritional supplements, these algal powders impart a visually unappealing green color to the food product or nutritional supplement and have an unpleasant fishy or seaweed flavor.
- There are several species of algae that are used in foodstuffs today, most being macroalgae such as kelp, purple laver (Porphyra, used in nori), dulse (Palmaria palmate) and sea lettuce (Ulva lactuca). Microalgae, such as Spirulina (Arthrospira platensis) are grown commercially in open ponds (photosynthetically) for use as a nutritional supplement or incorporated in small amounts in smoothies or juice drinks (usually less than 0.5% w/w). Other microalgae, including some species of Chlorella are popular in Asian countries as a nutritional supplement.
- In addition to these products, algal oil with high docosahexanoic acid (DHA) content is used as an ingredient in infant formulas. DHA is a highly polyunsaturated oil. DHA has anti-inflammatory properties and is a well known supplement as well as an additive used in the preparation of foodstuffs. However, DHA is not suitable for cooked foods because it oxidizes with heat treatment. Also, DHA is unstable when exposed to oxygen even at room temperature in the presence of antioxidants. The oxidation of DHA results in a fishy tasteand unpleasant aroma. Wu et al. (1994) discusses heterotrophically culturing Chlorella protothecoides to obtain a yellow powdered biomass that lacks chlorophyll, is high in lipids and low in proteins in Science in China (vol. 37, no. 3, 1 March 1994, pages 326-335).
) discusses masking the taste of Chlorella biomass.JP S51 7138 A (1976 - There remains a need for methods to produce foodstuffs from algae cheaply and efficiently, at large scale, particularly foodstuffs that are tasty and nutritious. The present invention meets these and other needs.
- The present invention is set out in the appended claims. In particular, the present invention provides a food composition comprising at least 0.1% w/w Chlorella protothecoides microalgal biomass and one or more other edible ingredient, wherein the microalgal biomass (i) comprises microalgal cells cultured under heterotrophic conditions, (ii) is reduced in green pigmentation, and (iii) comprises at least 10% oil by dry weight, wherein less than 5% by weight of the oil is docosahexanoic acid (DHA) (C22:6).
The present invention also provides a method of making a food composition of the invention comprising combining the Chlorella protothecoides microalgal biomass with at least one other edible ingredient.
The present invention further provides a microalgal powder that (i) comprises Chlorella protothecoides microalgal cells cultured under heterotrophic conditions, (ii) is reduced in green pigmentation, and (iii) comprises at least 10% oil by dry weight, wherein less than 5% by weight of the oil is docosahexanoic acid (DHA) (C22:6), wherein the microalgal powder has been pasteurized. - The present invention provides foods that incorporate at least 0.1% w/w Chlorella protothecoides microalgal biomass in the form of an algal powder, algal flour, and/or algal oil. In one embodiment, the food is a baked good, dressing, sauce, or mayonnaise in which, relative to the same food produced using conventional recipes, all or a portion of the egg or butter has been replaced by an algal flour rich in algal oil. In another embodiment, the food is a powdered egg product containing an algal flour rich in algal oil. In another embodiment, the food is a liquid egg product containing an algal flour rich in algal oil. In another embodiment, the food is a liquid milk product containing algal protein, fiber, and oil. In another embodiment, the food is a meat product in which, relative to previously available meat products, a portion or all (a meat substitute) of the meat has been replaced by an algal flour, algal powder, or algal flake rich in protein.
- These and other aspects and embodiments of the invention are described in the accompanying drawings, a brief description of which immediately follows, and the detailed description below, and exemplified in the examples below.
-
-
Figure 1 shows the lipid profile of selected strains of microalgae as a percentage of total lipid content. The species/strain corresponding to each strain number is shown in Table 1 of Example 1. -
Figure 2 shows the amino acid profile of Chlorella protothecoides biomass compared to the amino acid profile of whole egg protein. -
Figure 3 shows the sensory scores of liquid whole egg with and without algal flour held on a steam table for 60 minutes. The appearance, texture and mouthfeel of the eggs were evaluated every 10 minutes. - This detailed description is divided into sections and subsections for the convenience of the reader. Section I provides definitions for various terms used herein. Section II, in parts A-E, describes methods for preparing microalgal biomass, including suitable organisms (A), methods of generating a microalgae strain lacking in or has significantly reduced pigmentation (B) culture conditions (C), concentration conditions (D), and chemical composition of the biomass(E). Section III, in parts A-D, describes methods for processing the microalgal biomass into algal flake (A), algal powder (B), algal flour (C); and algal oil (D). Section IV describes various foods of the invention and methods of combining microalgal biomass with other food ingredients.
- All of the processes described herein can be performed in accordance with GMP or equivalent regulations. In the United States, GMP regulations for manufacturing, packing, or holding human food are codified at 21 C.F.R. 110. GMP conditions in the Unites States, and equivalent conditions in other jurisdictions, apply in determining whether a food is adulterated (the food has been manufactured under such conditions that it is unfit for food) or has been prepared, packed, or held under unsanitary conditions such that it may have become contaminated or otherwise may have been rendered injurious to health. GMP conditions can include adhering to regulations governing: disease control; cleanliness and training of personnel; maintenance and sanitary operation of buildings and facilities; provision of adequate sanitary facilities and accommodations; design, construction, maintenance, and cleanliness of equipment and utensils; provision of appropriate quality control procedures to ensure all reasonable precautions are taken in receiving, inspecting, transporting, segregating, preparing, manufacturing, packaging, and storing food products according to adequate sanitation principles to prevent contamination from any source; and storage and transportation of finished food under conditions that will protect food against physical, chemical, or undesirable microbial contamination, as well as against deterioration of the food and the container.
- Unless defined otherwise below, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. General definitions of many of the terms used herein may be found in Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991).
- "Axenic" means a culture of an organism that is not contaminated by other living organisms.
- "Baked good" means a food item, typically found in a bakery, that is prepared by using an oven. Baked goods include, but are not limited to brownies, cookies, pies, cakes and pastries.
- "Bioreactor" and "fermentor" mean an enclosure or partial enclosure, such as a fermentation tank or vessel, in which cells are cultured typically in suspension.
- "Bread" means a food item that contains flour, liquid, and a leavening agent. Breads are usually prepared by baking in an oven, although other methods of cooking are also acceptable. The leavening agent can be chemical or organic in nature. Typically, the organic leavening agent is yeast. In the case where the leavening agent is chemical in nature (such as baking powder and/or baking soda), these food products are referred to as "quick breads".
- "Cellulosic material" means the products of digestion of cellulose, particularly glucose and xylose. Cellulose digestion typically produces additional compounds such as disaccharides, oligosaccharides, lignin, furfurals and other compounds. Sources of cellulosic material include, for example and without limitation, sugar cane bagasse, sugar beet pulp, corn stover, wood chips, sawdust, and switchgrass.
- "Co-culture" and variants thereof such as "co-cultivate" and "co-ferment" mean that two or more types of cells are present in the same bioreactor under culture conditions. The two or more types of cells are, for purposes of the present invention, typically both microorganisms, typically both microalgae, but may in some instances include one non-microalgal cell type. Culture conditions suitable for co-culture include, in some instances, those that foster growth and/or propagation of the two or more cell types, and, in other instances, those that facilitate growth and/or proliferation of only one, or only a subset, of the two or more cells while maintaining cellular growth for the remainder.
- "Cofactor" means a molecule, other than the substrate, required for an enzyme to carry out its enzymatic activity.
- "Conventional food product" means a composition intended for consumption, e.g., by a human, that lacks algal biomass or other algal components and includes ingredients ordinarily associated with the food product, particularly a vegetable oil, animal fat, and/or egg(s), together with other edible ingredients. Conventional food products include food products sold in shops and restaurants and those made in the home. Conventional food products are often made by following conventional recipes that specify inclusion of an oil or fat from a non-algal source and/or egg(s) together with other edible ingredient(s).
- "Cooked product" means a food that has been heated, e.g., in an oven, for a period of time.
- "Creamy salad dressing" means a salad dressing that is a stable dispersion with high viscosity and a slow pour-rate. Generally, creamy salad dressings are opaque.
- "Cultivate," "culture," and "ferment", and variants thereof, mean the intentional fostering of growth and/or propagation of one or more cells, typically microalgae, by use of culture conditions. Intended conditions exclude the growth and/or propagation of microorganisms in nature (without direct human intervention).
- "Cytolysis" means the lysis of cells in a hypotonic environment. Cytolysis results from osmosis, or movement of water, to the inside of a cell to a state of hyperhydration, such that the cell cannot withstand the osmotic pressure of the water inside, and so bursts.
- "Dietary fiber" means non-starch carbohydrates found in plants and other organisms containing cell walls, including microalgae. Dietary fiber can be soluble (dissolved in water) or insoluble (not able to be dissolved in water). Soluble and insoluble fiber makes up total dietary fiber.
- "Delipidated meal" means algal biomass that has undergone an oil extraction process and so contains less oil, relative to the biomass prior to oil extraction. Cells in delipidated meal are predominantly lysed. Delipidated meal include algal biomass that has been solvent (hexane) extracted.
- "Digestible crude protein" is the portion of protein that is available or can be converted into free nitrogen (amino acids) after digesting with gastric enzymes. In vitro measurement of digestible crude protein is accomplished by using gastric enzymes such as pepsin and digesting a sample and measuring the free amino acid after digestion. In vivo measurement of digestible crude protein is accomplished by measuring the protein levels in a feed/food sample and feeding the sample to an animal and measuring the amount of nitrogen collected in the animal's feces.
- "Dry weight" and "dry cell weight" mean weight determined in the relative absence of water. For example, reference to microalgal biomass as comprising a specified percentage of a particular component by dry weight means that the percentage is calculated based on the weight of the biomass after substantially all water has been removed.
- "Edible ingredient" means any substance or composition which is fit to be eaten. "Edible ingredients" include, without limitation, grains, fruits, vegetables, proteins, herbs, spices, carbohydrates, and fats.
- "Exogenously provided" means a molecule provided to a cell (including provided to the media of a cell in culture).
- "Fat" means a lipid or mixture of lipids that is generally solid at ordinary room temperatures and pressures. "Fat" includes, without limitation, lard and butter.
- "Fiber" means non-starch carbohydrates in the form of polysaccharide. Fiber can be soluble in water or insoluble in water. Many microalgae produce both soluble and insoluble fiber, typically residing in the cell wall.
- "Finished food product" and "finished food ingredient" mean a food composition that is ready for packaging, use, or consumption. For example, a "finished food product" may have been cooked or the ingredients comprising the "finished food product" may have been mixed or otherwise integrated with one another. A "finished food ingredient" is typically used in combination with other ingredients to form a food product.
- "Fixed carbon source" means molecule(s) containing carbon, typically organic molecules, that are present at ambient temperature and pressure in solid or liquid form.
- "Food", "food composition", "food product" and "foodstuff mean any composition intended to be or expected to be ingested by humans as a source of nutrition and/or calories. Food compositions are composed primarily of carbohydrates, fats, water and/or proteins and make up substantially all of a person's daily caloric intake. A "food composition" can have a weight minimum that is at least ten times the weight of a typical tablet or capsule (typical tablet/capsule weight ranges are from less than or equal to 100 mg up to 1500 mg). A "food composition" is not encapsulated or in tablet form.
- "Glycerolipid profile" means the distribution of different carbon chain lengths and saturation levels of glycerolipids in a particular sample of biomass or oil. For example, a sample could have a glycerolipid profile in which approximately 60% of the glycerolipid is C18:1, 20% is C18:0, 15% is C16:0, and 5% is C14:0. When a carbon length is referenced generically, such as "C:18", such reference can include any amount of saturation; for example, microalgal biomass that contains 20% lipid as C:18 can include C18:0, C18:1, C18:2, and the like, in equal or varying amounts, the sum of which constitute 20% of the biomass. Reference to percentages of a certain saturation type, such as "at least 50% monounsaturated in an 18:1 glycerolipid form" means the aliphatic side chains of the glycerolipids are at least 50% 18:1, but does not necessarily mean that at least 50% of the triglycerides are triolein (three 18:1 chains attached to a single glycerol backbone); such a profile can include glycerolipids with a mixture of 18:1 and other side chains, provided at least 50% of the total side chains are 18:1.
- "Good manufacturing practice" and "GMP" mean those conditions established by regulations set forth at 21 C.F.R. 110 (for human food) and 111 (for dietary supplements), or comparable regulatory schemes established in locales outside the United States. The U.S. regulations are promulgated by the U.S. Food and Drug Administration under the authority of the Federal Food, Drug, and Cosmetic Act to regulate manufacturers, processors, and packagers of food products and dietary supplements for human consumption.
- "Growth" means an increase in cell size, total cellular contents, and/or cell mass or weight of an individual cell, including increases in cell weight due to conversion of a fixed carbon source into intracellular oil.
- "Homogenate" means biomass that has been physically disrupted. Homogenization is a fluid mechanical process that involves the subdivision of particles into smaller and more uniform sizes, forming a dispersion that may be subjected to further processing. Homogenization is used in treatment of several foods and dairy products to improve stability, shelf-life, digestion, and taste.
- "Increased lipid yield" means an increase in the lipid/oil productivity of a microbial culture that can achieved by, for example, increasing the dry weight of cells per liter of culture, increasing the percentage of cells that contain lipid, and/or increasing the overall amount of lipid per liter of culture volume per unit time.
- "In situ" means "in place" or "in its original position". For example, a culture may contain a first microalgal cell type secreting a catalyst and a second microorganism cell type secreting a substrate, wherein the first and second cell types produce the components necessary for a particular chemical reaction to occur in situ in the co-culture without requiring further separation or processing of the materials.
- "Lipid" means any of a class of molecules that are soluble in nonpolar solvents (such as ether and hexane) and relatively or completely insoluble in water. Lipid molecules have these properties, because they are largely composed of long hydrocarbon tails that are hydrophobic in nature. Examples of lipids include fatty acids (saturated and unsaturated); glycerides or glycerolipids (such as monoglycerides, diglycerides, triglycerides or neutral fats, and phosphoglycerides or glycerophospholipids); and nonglycerides (sphingolipids, tocopherols, tocotrienols, sterol lipids including cholesterol and steroid hormones, prenol lipids including terpenoids, fatty alcohols, waxes, and polyketides).
- "Lysate" means a solution containing the contents of lysed cells.
- "Lysis" means the breakage of the plasma membrane and optionally the cell wall of a microorganism sufficient to release at least some intracellular content, which is often achieved by mechanical or osmotic mechanisms that compromise its integrity.
- "Lysing" means disrupting the cellular membrane and optionally the cell wall of a biological organism or cell sufficient to release at least some intracellular content.
- "Microalgae" means a eukarytotic microbial organism that contains a chloroplast, and which may or may not be capable of performing photosynthesis. Microalgae include obligate photoautotrophs, which cannot metabolize a fixed carbon source as energy, as well as heterotrophs, which can live solely off of a fixed carbon source, including obligate heterotrophs, which cannot perform photosynthesis. Microalgae include unicellular organisms that separate from sister cells shortly after cell division, such as Chlamydomonas, as well as microbes such as, for example, Volvox, which is a simple multicellular photosynthetic microbe of two distinct cell types. "Microalgae" also include cells such as Chlorella, Parachlorella and Dunaliella.
- "Microalgal biomass," "algal biomass," and "biomass" mean a material produced by growth and/or propagation of microalgal cells. Biomass may contain cells and/or intracellular contents as well as extracellular material. Extracellular material includes, but is not limited to, compounds secreted by a cell.
- "Microalgal oil" and "algal oil" mean any of the lipid components produced by microalgal cells, including triacylglycerols.
- "Micronized" means biomass that has been homogenized under high pressure (or an equivalent process) so that at least 50% of the particle size is no more 10 µm in their longest dimension. Typically, at least 50% to 90% or more of such particles are less than 5 µm in their longest dimension. In any case, the average particle size of micronized biomass is smaller than the intact microalgal cell.
- "Microorganism" and "microbe" mean any microscopic unicellular organism.
- "Nutritional supplement" means a composition intended to supplement the diet by providing specific nutrients as opposed to bulk calories. A nutritional supplement may contain any one or more of the following ingredients: a vitamin, a mineral, an herb, an amino acid, an essential fatty acid, and other substances. Nutritional supplements are typically tableted or encapsulated. A single tableted or encapsulated nutritional supplement is typically ingested at a level no greater than 15 grams per day. Nutritional supplements can be provided in ready-to-mix sachets that can be mixed with food compositions, such as yogurt or a "smoothie", to supplement the diet, and are typically ingested at a level of no more than 25 grams per day.
- "Oil" means any triacylglyceride, produced by organisms, including microalgae, other plants, and/or animals. "Oil," as distinguished from "fat", refers, unless otherwise indicated, to lipids that are generally liquid at ordinary room temperatures and pressures. For example, "oil" includes vegetable or seed oils derived from plants, including without limitation, an oil derived from soy, rapeseed, canola, palm, palm kernel, coconut, corn, olive, sunflower, cotton seed, cuphea, peanut, camelina sativa, mustard seed, cashew nut, oats, lupine, kenaf, calendula, hemp, coffee, linseed, hazelnut, euphorbia, pumpkin seed, coriander, camellia, sesame, safflower, rice, tung oil tree, cocoa, copra, pium poppy, castor beans, pecan, jojoba, jatropha, macadamia, Brazil nuts, and avocado, as well as combinations thereof.
- "Osmotic shock" means the rupture of cells in a solution following a sudden reduction in osmotic pressure and can be used to induce the release of cellular components of cells into a solution.
- "Pasteurization" means a process of heating which is intended to slow microbial growth in food products. Typically pasteurization is performed at a high temperature (but below boiling) for a short amount of time. As described herein, pasteurization can not only reduce the number of undesired microbes in food products, but can also inactivate certain enzymes present in the food product.
- "Polysaccharide" and "glycan" means any carbohydrate made of monosaccharides joined together by glycosidic linkages. Cellulose is an example of a polysaccharide that makes up certain plant cell walls.
- "Port" means an opening in a bioreactor that allows influx or efflux of materials such as gases, liquids, and cells; a port is usually connected to tubing.
- "Predominantly encapsulated" means that more than 50% and typically more than 75% to 90% of a referenced component, e.g., algal oil, is sequestered in a referenced container, which can include, e.g., a microalgal cell.
- "Predominantly intact cells" and "predominantly intact biomass" mean a population of cells that comprise more than 50, and oftern more than 75, 90, and 98% intact cells. "Intact", in this context, means that the physical continuity of the cellular membrane and/or cell wall enclosing the intracellular components of the cell has not been disrupted in any manner that would release the intracellular components of the cell to an extent that exceeds the permeability of the cellular membrane in culture.
- "Predominantly lysed" means a population of cells in which more than 50%, and typically more than 75 to 90%, of the cells have been disrupted such that the intracellular components of the cell are no longer completely enclosed within the cell membrane.
- "Proliferation" means a combination of both growth and propagation.
- "Propagation" means an increase in cell number via mitosis or other cell division.
- "Proximate analysis" means analysis of foodstuffs for fat, nitrogen/protein, crude fiber (cellulose and lignin as main components), moisture and ash. Soluble carbohydrate (total dietary fiber and free sugars) can be calculated by subtracting the total of the known values of the proximate analysis from 100 (carbohydrate by difference).
- "Sonication" means disrupting biological materials, such as a cell, by sound wave energy.
- "Species of furfural" means 2-furancarboxaldehyde and derivatives thereof that retain the same basic structural characteristics.
- "Stover" means the dried stalks and leaves of a crop remaining after a grain has been harvested from that crop.
- "Suitable for human consumption" means a composition can be consumed by humans as dietary intake without ill health effects and can provide significant caloric intake due to uptake of digested material in the gastrointestinal tract.
- "Uncooked product" means a composition that has not been subjected to heating but may include one or more components previously subjected to heating.
- "V/V" or "v/v", in reference to proportions by volume, means the ratio of the volume of one substance in a composition to the volume of the composition. For example, reference to a composition that comprises 5% v/v microalgal oil means that 5% of the composition's volume is composed of microalgal oil (e.g., such a composition having a volume of 100 mm3 would contain 5 mm3 of microalgal oil), and the remainder of the volume of the composition (e.g., 95 mm3 in the example) is composed of other ingredients.
- "W/W" or "w/w", in reference to proportions by weight, means the ratio of the weight of one substance in a composition to the weight of the composition. For example, reference to a composition that comprises 5% w/w microalgal biomass means that 5% of the composition's weight is composed of microalgal biomass (e.g., such a composition having a weight of 100 mg would contain 5 mg of microalgal biomass) and the remainder of the weight of the composition (e.g., 95 mg in the example) is composed of other ingredients.
- Disclosed below is algal biomass suitable for human consumption that is rich in nutrients, including lipid and/or protein constituents, methods of combining the same with edible ingredients and food compositions containing the same. This workarose in part from the discoveries that algal biomass can be prepared with a high oil content and/or with excellent functionality, and the resulting biomass incorporated into food products in which the oil and/or protein content of the biomass can substitute in whole or in part for oils and/or fats and/or proteins present in conventional food products. Algal oil, which can comprise predominantly monosaturated oil, provides health benefits compared with saturated, hydrogenated (trans fats) and polyunsaturated fats often found in conventional food products. Algal oil also can be used as a healthy stable cooking oil free of trans fats. The remainder of the algal biomass can encapsulate the oil at least until a food product is cooked, thereby increasing shelf-life of the oil. In uncooked products, in which cells remain intact, the biomass, along with natural antioxidants found in the oil, also protects the oil from oxidation, which would otherwise create unpleasant odors, tastes, and textures. The biomass also provides several beneficial micro-nutrients in addition to the oil and/or protein, such as algal-derived dietary fibers (both soluble and insoluble carbohydrates), phospholipids, glycoprotein, phytosterols, tocopherols, tocotrieneols, and selenium.
- This section first reviews the types of microalgae suitable for use with the invention (part A), methods of generating a microalgae strain lacking or has significantly reduced pigmentation (part B), then the culture conditions (part C) that are used to propagate the biomass, then the concentration steps that are used to prepare the biomass for further processing (part D), and concludes with a description of the chemical composition of the biomass prepared in accordance with the methods of the invention (part E).
- The invention uses Chlorella protothecoides microalgae. Example 5 below demonstrates dried microalgal biomass and oils or lipids extracted from the biomass lacks algal toxins.
- Sometimes, the cell wall of the microalgae must be disrupted during food processing (e.g., cooking) to release the active components or for digestion, and strains of microalgae with cell walls susceptible to digestion in the gastrointestinal tract of an animal, e.g., a human or other monogastrics, are preferred, especially if the algal biomass is to be used in uncooked food products. Digestibility is generally decreased for microalgal strains which have a high content of cellulose/hemicellulose in the cell walls. Digestibility can be evaluated using a standard pepsin digestibility assay.
- In particular cases, the microalgae comprise cells that are at least 10% or more oil by dry weight. In other cases, the microalgae contain at least 25-35% or more oil by dry weight. Generally, the more oil contained in the microalgae, the more nutritious the biomass, so microalgae that can be cultured to contain at least 40%, at least 50%, 75%, or more oil by dry weight are especially preferred. Preferred microalgae for use with the invention can grow heterotrophically (on sugars in the absence of light) or are obligate heterotrophs. Not all types of lipids are desirable for use in foods and/or nutraceuticals, as they may have an undesirable taste or unpleasant odor, as well as exhibit poor stability or provide a poor mouth feel, and these considerations also influence the selection of microalgae for use with the invention.
- Chlorella is a genus of single-celled green algae, belonging to the phylum Chlorophyta. Chlorella cells are generally spherical in shape, about 2 to 10 µm in diameter, and lack flagella. Some species of Chlorella are naturally heterotrophic. The microalgae used with the invention is Chlorella protothecoides. Chlorella protothecoides is the microorganism used in the methods of the invention because of its high composition of lipid. Particularly preferred species of Chlorella protothecoides for use in the methods of the invention include those exemplified in the examples below.
- Species of Chlorella (and species from other microalgae genera) can be identified by comparison of certain target regions of their genome with those same regions of species identified herein; preferred species are those that exhibit identity or at least a very high level of homology with the species identified herein. For example, identification of a specific Chlorella species or strain can be achieved through amplification and sequencing of nuclear and/or chloroplast DNA using primers and methodology using appropriate regions of the genome, for example using the methods described in Wu et al., Bot. Bull. Acad. Sin. 42:115-121 (2001), Identification of Chlorella spp. isolates using ribosomal DNA sequences. Well established methods of phylogenetic analysis, such as amplification and sequencing of ribosomal internal transcribed spacer (ITS1 and ITS2 rDNA), 23S RNA, 18S rRNA, and other conserved genomic regions can be used by those skilled in the art to identify species of not only Chlorella, but other oil and lipid producing microalgae suitable for use in the methods disclosed herein. For examples of methods of identification and classification of algae see Genetics, 170(4):1601-10 (2005) and RNA, 11(4):361-4 (2005).
- Thus, genomic DNA comparison can be used to identify suitable species of microalgae to be used in the present invention. Regions of conserved genomic DNA, such as and not limited to DNA encoding for 23S rRNA, can be amplied from microalgal species that may be, for example, taxonomically related to the preferred microalgae and compared to the corresponding regions of those preferred species. Species that exhibit a high level of similarity are then selected for use with the invention. Illustrative examples of such DNA sequence comparison among species within the Chlorella genus are presented below. In some cases, the microalgae have genomic DNA sequences encoding for 23S rRNA that have at least 65% nucleotide identity to at least one of the sequences listed in SEQ ID NOs: 1-23 and 26-27. In other cases, microalgae have genomic DNA sequences encoding for 23S rRNA that have at least 75%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater nucleotide identity to at least one or more of the sequences listed in SEQ ID NOs: 1-23 and 26-27. Genotyping of a food composition and/or of algal biomass before it is combined with other ingredients to formulate a food composition is also a reliable method for determining if algal biomass is from more than a single strain of microalgae.
- For sequence comparison to determine percent nucleotide or amino acid identity, typically one sequence acts as a reference sequence, to which test sequences are compared. In applying a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual inspection (see generally Ausubel et al., supra). Another example algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (at the web address www.ncbi.nlm.nih.gov).
- Microalgae, such as Chlorella, can be capable of either photosynthetic or heterotrophic growth. When grown in heterotrophic conditions where the carbon source is a fixed carbon source and in the absence of light, the normally green colored microalgae has a yellow color, lacking or is significantly reduced in green pigmentation. Microalgae of reduced (or lacking in) green pigmentation can be advantageous as a food ingredient. One advantage of microalgae of reduced (or is lacking) in green pigmentation is that the microalgae has a reduced chlorophyll flavor. Another advantage of microalgae of reduced (or is lacking in) green pigmentation is that as a food ingredient, the addition of the microalgae to foodstuffs will not impart a green color that can be unappealing to the consumer. The reduced green pigmentation of microalgae grown under heterotrophic conditions is transient. When switched back to phototrophic growth, microalgae capable of both phototrophic and heterotrophic growth will regain the green pigmentation. Additionally, even with reduced green pigments, heterotrophically grown microalgae is a yellow color and this may be unsuitable for some food applications where the consumer expects the color of the foodstuff to be white or light in color. Thus, it is advantageous to generate a microalgae strain that is capable of heterotrophic growth (so it is reduced or lacking in green pigmentation) and is also reduced in yellow pigmentation (so that it is a neutral color for food applications).
- One method for generating such microalgae strain lacking in or has significantly reduced pigmentation is through mutagenesis and then screening for the desired phenotype. Several methods of mutagenesis are known and practiced in the art. For example, Urano et al., (Urano et al., J Bioscience Bioengineering (2000) v. 90(5): pp. 567-569) describes yellow and white color mutants of Chlorella ellipsoidea generated using UV irradiation. Kamiya (Kamiya, Plant Cell Physiol. (1989) v. 30(4): 513-521) describes a colorless strain of Chlorella vulgaris, 11h (M125).
- In addition to mutagenesis by UV irradiation, chemical mutagenesis can also be employed in order to generate microalgae with reduced (or lacking in) pigmentation. Chemical mutagens such as ethyl methanesulfonate (EMS) or N-methyl-N'nitro-N-nitroguanidine (NTG) have been shown to be effective chemical mutagens on a variety of microbes including yeast, fungi, mycobacterium and microalgae. Mutagenesis can also be carried out in several rounds, where the microalgae is exposed to the mutagen (either UV or chemical or both) and then screened for the desired reduced pigmentation phenotype. Colonies with the desired phenotype are then streaked out on plates and reisolated to ensure that the mutation is stable from one generation to the next and that the colony is pure and not of a mixed population.
- In a particular example, Chlorella protothecoides was used to generate strains lacking in or with reduced pigmentation using a combination of UV and chemical mutagenesis. Chlorella protothecoides was exposed to a round of chemical mutagenesis with NTG and colonies were screened for color mutants. Colonies not exhibiting color mutations were then subjected to a round of UV irradiation and were again screened for color mutants. In one case, a Chlorella protothecoides strain lacking in pigmentation was isolated and is Chlorella protothecoides 33-55, deposited on October 13, 2009 at the American Type Culture Collection at 10801 University Boulevard, Manassas, VA 20110-2209, in accordance with the Budapest Treaty, with a Patent Deposit Designation of PTA-XXXX. In another case, a Chlorella protothecoides strain with reduced pigmentation was isolated and is Chlorella protothecoides 25-32, deposited on October 13, 2009 at the American Type Culture Collection at 10801 University Boulevard, Manassas, VA 20110-2209, in accordance with the Budapest Treaty, with a Patent Deposit Designation of PTA-XXXX.
- Microalgae are cultured in liquid media to propagate biomass to be used with the invention. Microalgal species are grown in a medium containing a fixed carbon and/or fixed nitrogen source in the absence of light. Such growth is known as heterotrophic growth. For some species of microalgae, for example, heterotrophic growth for extended periods of time such as 10 to 15 or more days under limited nitrogen conditions results accumulation of high lipid content in cells.
- Microalgal culture media typically contains components such as a fixed carbon source (discussed below), a fixed nitrogen source (such as protein, soybean meal, yeast extract, cornsteep liquor, ammonia (pure or in salt form), nitrate, or nitrate salt), trace elements (for example, zinc, boron, cobalt, copper, manganese, and molybdenum in, e.g., the respective forms of ZnCl2, H3BO3, CoCl2·6H2O, CuCl2·2H2O, MnCl2·4H2O and (NH4)6Mo7O24·4H2O), optionally a buffer for pH maintenance, and phosphate (a source of phosphorous; other phosphate salts can be used). Other components include salts such as sodium chloride, particularly for seawater microalgae.
- In a particular example, a medium suitable for culturing Chlorella protothecoides comprises Proteose Medium. This medium is suitable for axenic cultures, and a 1L volume of the medium (pH -6.8) can be prepared by addition of 1g of proteose peptone to 1 liter of Bristol Medium. Bristol medium comprises 2.94 mM NaNO3, 0.17 mM CaCl2·2H2O, 0.3 mM MgSO4·7H2O, 0.43 mM, 1.29 mM KH2PO4, and 1.43 mM NaCl in an aqueous solution. For 1.5% agar medium, 15 g of agar can be added to 1 L of the solution. The solution is covered and autoclaved, and then stored at a refrigerated temperature prior to use. Other methods for the growth and propagation of Chlorella protothecoides to high oil levels as a percentage of dry weight have been described (see for example Miao and Wu, J. Biotechnology, 2004, 11:85-93 and Miao and Wu, Biosource Technology (2006) 97:841-846 (demonstrating fermentation methods for obtaining 55% oil dry cell weight)). High oil algae can typically be generated by increasing the length of a fermentation while providing an excess of carbon source under nitrogen limitation.
- Solid and liquid growth media are generally available from a wide variety of sources, and instructions for the preparation of particular media that is suitable for a wide variety of strains of microorganisms can be found, for example, online at http://www.utex.org/, a site maintained by the University of Texas at Austin for its culture collection of algae (UTEX). For example, various fresh water media include 1/2, 1/3, 1/5, 1X, 2/3, 2X CHEV Diatom Medium; 1:1 DYIII/PEA + Gr+; Ag Diatom Medium; Allen Medium; BG11-1 Medium; Bold 1NV and 3N Medium; Botryococcus Medium; Bristol Medium; Chu's Medium; CR1, CR1-S, and CR1+ Diatom Medium; Cyanidium Medium; Cyanophycean Medium; Desmid Medium; DYIII Medium; Euglena Medium; HEPES Medium; J Medium; Malt Medium; MES Medium; Modified Bold 3N Medium; Modified COMBO Medium; N/20 Medium; Ochromonas Medium; P49 Medium; Polytomella Medium; Proteose Medium; Snow Algae Media; Soil Extract Medium; Soilwater: BAR, GR-, GR-/NH4, GR+, GR+/NH4, PEA, Peat, and VT Medium; Spirulina Medium; Tap Medium; Trebouxia Medium; Volvocacean Medium; Volvocacean-3N Medium; Volvox Medium; Volvox-Dextrose Medium; Waris Medium; and Waris+Soil Extract Medium. Various Salt Water Media include: 1%, 5%, and 1X F/2 Medium; 1/2, 1X, and 2X Erdschreiber's Medium; 1/2, 1/3, 1/4, 1/5, 1X, 5/3, and 2X Soil+Seawater Medium; 1/4 ERD; 2/3 Enriched Seawater Medium; 20% Allen + 80 % ERD; Artificial Seawater Medium; BG11-1 + .36% NaCl Medium; BG11-1 + 1% NaCl Medium; Bold 1NV:Erdshreiber (1:1) and (4:1); Bristol-NaCl Medium; Dasycladales Seawater Medium; 1/2 and 1X Enriched Seawater Medium, including ES/10, ES/2, and ES/4; F/2+NH4; LDM Medium; Modified 1X and 2X CHEV; Modified 2 X CHEV + Soil; Modified Artificial Seawater Medium; Porphridium Medium; and SS Diatom Medium.
- Other suitable media for use with the methods of the invention can be readily identified by consulting the URL identified above, or by consulting other organizations that maintain cultures of microorganisms, such as SAG, CCAP, or CCALA. SAG refers to the Culture Collection of Algae at the University of Göttingen (Göttingen, Germany), CCAP refers to the culture collection of algae and protozoa managed by the Scottish Association for Marine Science (Scotland, United Kingdom), and CCALA refers to the culture collection of algal laboratory at the Institute of Botany (Třeboň, Czech Republic).
- Microorganisms useful in accordance with the methods of the present invention are found in various locations and environments throughout the world. As a consequence of their isolation from other species and their resulting evolutionary divergence, the particular growth medium for optimal growth and generation of oil and/or lipid and/or protein from any particular species of microbe can be difficult or impossible to predict, but those of skill in the art can readily find appropriate media by routine testing in view of the disclosure herein. In some cases, certain strains of microorganisms may be unable to grow on a particular growth medium because of the presence of some inhibitory component or the absence of some essential nutritional requirement required by the particular strain of microorganism. The examples below provide exemplary methods of culturing various species of microalgae to accumulate high levels of lipid as a percentage of dry cell weight.
- The fixed carbon source is a key component of the medium. Suitable fixed carbon sources for purposes of the present invention, include, for example, glucose, fructose, sucrose, galactose, xylose, mannose, rhamnose, arabinose, N-acetylglucosamine, glycerol, floridoside, glucuronic acid, and/or acetate. Other carbon sources for culturing microalgae in accordance with the present invention include mixtures, such as mixtures of glycerol and glucose, mixtures of glucose and xylose, mixtures of fructose and glucose, and mixtures of sucrose and depolymerized sugar beet pulp. Other carbon sources suitable for use in culturing microalgae include, black liquor, corn starch, depolymerized cellulosic material (derived from, for example, corn stover, sugar beet pulp, and switchgrass, for example), lactose, milk whey, molasses, potato, rice, sorghum, sucrose, sugar beet, sugar cane, and wheat. The one or more carbon source(s) can be supplied at a concentration of at least about 50 µM, at least about 100 µM, at least about 500 µM, at least about 5 mM, at least about 50 mM, and at least about 500 mM.
- Thus, in various embodiments, the fixed carbon energy source used in the growth medium comprises glycerol and/or 5- and/or 6-carbon sugars, such as glucose, fructose, and/or xylose, which can be derived from sucrose and/or cellulosic material, including depolymerized cellulosic material. Multiple species of Chlorella and multiple strains within a species can be grown in the presence of sucrose, depolymerized cellulosic material, and glycerol, as described in
US Patent Application Publication Nos. 20090035842 ,20090011480 ,20090148918 , respectively, and see also,PCT Patent Application Publication No. 2008/151149 . - Thus, in one embodiment of the present invention, microorganisms are cultured using depolymerized cellulosic biomass as a feedstock. As opposed to other feedstocks, such as corn starch or sucrose from sugar cane or sugar beets, cellulosic biomass (depolymerized or otherwise) is not suitable for human consumption and could potentially be available at low cost, which makes it especially advantageous for purposes of the present invention. Microalgae can proliferate on depolymerized cellulosic material. Cellulosic materials generally include cellulose at 40-60% dry weight; hemicellulose at 20-40% dry weight; and lignin at 10-30% dry weight. Suitable cellulosic materials include residues from herbaceous and woody energy crops, as well as agricultural crops, i.e., the plant parts, primarily stalks and leaves, not removed from the fields with the primary food or fiber product. Examples include agricultural wastes such as sugarcane bagasse, rice hulls, corn fiber (including stalks, leaves, husks, and cobs), wheat straw, rice straw, sugar beet pulp, citrus pulp, citrus peels; forestry wastes such as hardwood and softwood thinnings, and hardwood and softwood residues from timber operations; wood wastes such as saw mill wastes (wood chips, sawdust) and pulp mill waste; urban wastes such as paper fractions of municipal solid waste, urban wood waste and urban green waste such as municipal grass clippings; and wood construction waste. Additional cellulosics include dedicated cellulosic crops such as switchgrass, hybrid poplar wood, and miscanthus, fiber cane, and fiber sorghum. Five-carbon sugars that are produced from such materials include xylose. Example 20 describes Chlorella protothecoides successfully being cultivated under heterotrophic conditions using cellulosic-dervied sugars from cornstover and sugar beet pulp.
- Some microbes are able to process cellulosic material and directly utilize cellulosic materials as a carbon source. However, cellulosic material typically needs to be treated to increase the accessible surface area or for the cellulose to be first broken down as a preparation for microbial utilization as a carbon source. Ways of preparing or pretreating cellulosic material for enzyme digestion are well known in the art. The methods are divided into two main categories: (1) breaking apart the cellulosic material into smaller particles in order to increase the accessible surface area; and (2) chemically treating the cellulosic material to create a useable substrate for enzyme digestion.
- Methods for increasing the accessible surface area include steam explosion, which involves the use of steam at high temperatures to break apart cellulosic materials. Because of the high temperature requirement of this process, some of the sugars in the cellulosic material may be lost, thus reducing the available carbon source for enzyme digestion (see for example, Chahal, D.S. et al., Proceedings of the 2nd World Congress of Chemical Engineering; (1981) and Kaar et al., Biomass and Bioenergy (1998) 14(3): 277-87). Ammonia explosion allows for explosion of cellulosic material at a lower temperature, but is more costly to perform, and the ammonia might interfere with subsequent enzyme digestion processes (see for example, Dale, B.E. et al., Biotechnology and Bioengineering (1982); 12: 31-43). Another explosion technique involves the use of supercritical carbon dioxide explosion in order to break the cellulosic material into smaller fragments (see for example, Zheng et al., Biotechnology Letters (1995); 17(8): 845-850).
- Methods for chemically treating the cellulosic material to create useable substrates for enzyme digestion are also known in the art.
U.S. Patent No. 7,413,882 describes the use of genetically engineered microbes that secrete beta-glucosidase into the fermentation broth and treating cellulosic material with the fermentation broth to enhance the hydrolysis of cellulosic material into glucose. Cellulosic material can also be treated with strong acids and bases to aid subsequent enzyme digestion.U.S. Patent No. 3,617,431 describes the use of alkaline digestion to break down cellulosic materials. - Chlorella can proliferate on media containing combinations of xylose and glucose, such as depolymerized cellulosic material, and surprisingly, some species even exhibit higher levels of productivity when cultured on a combination of glucose and xylose than when cultured on either glucose or xylose alone. Thus, certain microalgae can both utilize an otherwise inedible feedstock, such as cellulosic material (or a pre-treated cellulosic material) or glycerol, as a carbon source and produce edible oils. This allows conversion of inedible cellulose and glycerol, which are normally not part of the human food chain (as opposed to corn glucose and sucrose from sugar cane and sugar beet) into high nutrition, edible oils, which can provide nutrients and calories as part of the daily human diet. Thus, the invention provides methods for turning inedible feedstock into high nutrition edible oils, food products, and food compositions.
- Microalgae co-cultured with an organism expressing a secretable sucrose invertase or cultured in media containing a sucrose invertase or expressing an exogenous sucrose invertase gene (where the invertase is either secreted or the organism also expresses a sucrose transporter) can proliferate on waste molasses from sugar cane or other sources of sucrose. The use of such low-value, sucrose-containing waste products can provide significant cost savings in the production of edible oils. Thus, the methods of cultivating microalgae on a sucrose feedstock and formulating food compositions and nutritional supplements, as described herein, provide a means to convert low-nutrition sucrose into high nutrition oils (oleic acid, DHA, ARA, etc.) and biomass containing such oils.
- As detailed in the above-referenced patent publications, multiple distinct Chlorella species and strains proliferate very well on not only purified reagent-grade glycerol, but also on acidulated and non-acidulated glycerol byproducts from biodiesel transesterification. Surprisingly, some Chlorella strains undergo cell division faster in the presence of glycerol than in the presence of glucose. Two-stage growth processes, in which cells are first fed glycerol to increase cell density rapidly and then fed glucose to accumulate lipids, can improve the efficiency with which lipids are produced.
- Another method to increase lipid as a percentage of dry cell weight involves the use of acetate as the feedstock for the microalgae. Acetate feeds directly into the point of metabolism that initiates fatty acid synthesis (i.e., acetyl-CoA); thus providing acetate in the culture can increase fatty acid production. Generally, the microbe is cultured in the presence of a sufficient amount of acetate to increase microbial lipid and/or fatty acid yield, specifically, relative to the yield in the absence of acetate. Acetate feeding is a useful component of the methods provided herein for generating microalgal biomass that has a high percentage of dry cell weight as lipid.
- In another embodiment, lipid yield is increased by culturing a lipid-producing microalgae in the presence of one or more cofactor(s) for a lipid pathway enzyme (e.g., a fatty acid synthetic enzyme). Generally, the concentration of the cofactor(s) is sufficient to increase microbial lipid (e.g., fatty acid) yield over microbial lipid yield in the absence of the cofactor(s). In particular embodiments, the cofactor(s) is provided to the culture by including in the culture a microbe secreting the cofactor(s) or by adding the cofactor(s) to the culture medium. Alternatively, the microalgae can be engineered to express an exogenous gene that encodes a protein that participates in the synthesis of the cofactor. In certain embodiments, suitable cofactors include any vitamin required by a lipid pathway enzyme, such as, for example, biotin or pantothenate.
- High lipid biomass from microalgae is an advantageous material for inclusion in food products compared to low lipid biomass, because it allows for the addition of less microalgal biomass to incorporate the same amount of lipid into a food composition. This is advantageous, because healthy oils from high lipid microalgae can be added to food products without altering other attributes such as texture and taste compared with low lipid biomass. The lipid-rich biomass used in the invention typically has at least 25% lipid by dry cell weight. Process conditions can be adjusted to increase the percentage weight of cells that is lipid. For example, in certain embodiments, a microalgae is cultured in the presence of a limiting concentration of one or more nutrients, such as, for example, nitrogen, phosphorous, or sulfur, while providing an excess of a fixed carbon source, such as glucose. Nitrogen limitation tends to increase microbial lipid yield over microbial lipid yield in a culture in which nitrogen is provided in excess. In particular embodiments, the increase in lipid yield is at least about 10%, 50%, 100%, 200%, or 500%. The microbe can be cultured in the presence of a limiting amount of a nutrient for a portion of the total culture period or for the entire period. In some embodiments, the nutrient concentration is cycled between a limiting concentration and a non-limiting concentration at least twice during the total culture period.
- In a steady growth state, the cells accumulate oil but do not undergo cell division. In one embodiment of the invention, the growth state is maintained by continuing to provide all components of the original growth media to the cells with the exception of a fixed nitrogen source. Cultivating microalgal cells by feeding all nutrients originally provided to the cells except a fixed nitrogen source, such as through feeding the cells for an extended period of time, results in a higher percentage of lipid by dry cell weight.
- In other embodiments, high lipid biomass is generated by feeding a fixed carbon source to the cells after all fixed nitrogen has been consumed for extended periods of time, such as at least one or two weeks. In some embodiments, cells are allowed to accumulate oil in the presence of a fixed carbon source and in the absence of a fixed nitrogen source for over 20 days. Microalgae grown using conditions described herein or otherwise known in the art can comprise at least about 20% lipid by dry weight, and often comprise 35%, 45%, 55%, 65%, and even 75% or more lipid by dry weight. Percentage of dry cell weight as lipid in microbial lipid production can therefore be improved by holding cells in a heterotrophic growth state in which they consume carbon and accumulate oil but do not undergo cell division.
- High protein biomass from algae is another advantageous material for inclusion in food products. The disclosed methods can also provide biomass that has at least 30% of its dry cell weight as protein. Growth conditions can be adjusted to increase the percentage weight of cells that is protein. For example, a microalgae is cultured in a nitrogen rich environment and an excess of fixed carbon energy such as glucose or any of the other carbon sources discussed above. Conditions in which nitrogen is in excess tends to increase microbial protein yield over microbial protein yield in a culture in which nitrogen is not provided in excess. For maximal protein production, the microbe is preferably cultured in the presence of excess nitrogen for the total culture period. Suitable nitrogen sources for microalgae may come from organic nitrogen sources and/or inorganic nitrogen sources.
- Organic nitrogen sources have been used in microbial cultures since the early 1900s. The use of organic nitrogen sources, such as corn steep liquor was popularized with the production of penicillin from mold. Researchers found that the inclusion of corn steep liquor in the culture medium increased the growth of the microoranism and resulted in an increased yield in products (such as penicillin). An analysis of corn steep liquor determined that it was a rich source of nitrogen and also vitamins such as B-complex vitamins, riboflavin panthothenic acid, niacin, inositol and nutrient minerals such as calcium, iron, magnesium, phosphorus and potassium (Ligget and Koffler, Bacteriological Reviews (1948);12(4): 297-311). Organic nitrogen sources, such as corn steep liquor, have been used in fermentation media for yeasts , bacteria, fungi and other microorganisms. Non-limiting examples of organic nitrogen sources are yeast extract, peptone, corn steep liquor and corn steep powder. Non-limiting examples of preferred inorganic nitrogen sources include, for example, and without limitation, (NH4)2SO4 and NH4OH. In one embodiment, the culture media for carrying out the invention contains only inorganic nitrogen sources. In another embodiment, the culture media for carrying out the invention contains only organic nitrogen sources. In yet another embodiment, the culture media for carrying out the invention contains a mixture of organic and inorganic nitrogen sources.
- In the methods of the invention, a bioreactor or fermentor is used to culture microalgal cells through the various phases of their physiological cycle. As an example, an inoculum of lipid-producing microalgal cells is introduced into the medium; there is a lag period (lag phase) before the cells begin to propagate. Following the lag period, the propagation rate increases steadily and enters the log, or exponential, phase. The exponential phase is in turn followed by a slowing of propagation due to decreases in nutrients such as nitrogen, increases in toxic substances, and quorum sensing mechanisms. After this slowing, propagation stops, and the cells enter a stationary phase or steady growth state, depending on the particular environment provided to the cells. For obtaining protein rich biomass, the culture is typically harvested during or shortly after then end of the exponential phase. For obtaining lipid rich biomass, the culture is typically harvested well after then end of the exponential phase, which may be terminated early by allowing nitrogen or another key nutrient (other than carbon) to become depleted, forcing the cells to convert the carbon sources, present in excess, to lipid. Culture condition parameters can be manipulated to optimize total oil production, the combination of lipid species produced, and/or production of a specific oil.
- Bioreactors offer many advantages for use in heterotrophic growth and propagation methods. As will be appreciated, provisions made to make light available to the cells in photosynthetic growth methods are unnecessary when using a fixed-carbon source in the heterotrophic growth and propagation methods described herein. To produce biomass for use in food, microalgae are preferably fermented in large quantities in liquid, such as in suspension cultures as an example. Bioreactors such as steel fermentors (5000 liter, 10,000 liter, 40,000 liter, and higher are used in various embodiments of the invention) can accommodate very large culture volumes. Bioreactors also typically allow for the control of culture conditions such as temperature, pH, oxygen tension, and carbon dioxide levels. For example, bioreactors are typically configurable, for example, using ports attached to tubing, to allow gaseous components, like oxygen or nitrogen, to be bubbled through a liquid culture.
- Bioreactors can be configured to flow culture media though the bioreactor throughout the time period during which the microalgae reproduce and increase in number. In some embodiments, for example, media can be infused into the bioreactor after inoculation but before the cells reach a desired density. In other instances, a bioreactor is filled with culture media at the beginning of a culture, and no more culture media is infused after the culture is inoculated. In other words, the microalgal biomass is cultured in an aqueous medium for a period of time during which the microalgae reproduce and increase in number; however, quantities of aqueous culture medium are not flowed through the bioreactor throughout the time period. Thus in some embodiments, aqueous culture medium is not flowed through the bioreactor after inoculation.
- Bioreactors equipped with devices such as spinning blades and impellers, rocking mechanisms, stir bars, means for pressurized gas infusion can be used to subject microalgal cultures to mixing. Mixing may be continuous or intermittent. For example, in some embodiments, a turbulent flow regime of gas entry and media entry is not maintained for reproduction of microalgae until a desired increase in number of said microalgae has been achieved.
- As briefly mentioned above, bioreactors are often equipped with various ports that, for example, allow the gas content of the culture of microalgae to be manipulated. To illustrate, part of the volume of a bioreactor can be gas rather than liquid, and the gas inlets of the bioreactor to allow pumping of gases into the bioreactor. Gases that can be beneficially pumped into a bioreactor include air, air/CO2 mixtures, noble gases, such as argon, and other gases. Bioreactors are typically equipped to enable the user to control the rate of entry of a gas into the bioreactor. As noted above, increasing gas flow into a bioreactor can be used to increase mixing of the culture.
- Increased gas flow affects the turbidity of the culture as well. Turbulence can be achieved by placing a gas entry port below the level of the aqueous culture media so that gas entering the bioreactor bubbles to the surface of the culture. One or more gas exit ports allow gas to escape, thereby preventing pressure buildup in the bioreactor. Preferably a gas exit port leads to a "one-way" valve that prevents contaminating microorganisms from entering the bioreactor.
- The specific examples of bioreactors, culture conditions, and heterotrophic growth and propagation methods described herein can be combined in any suitable manner to improve efficiencies of microbial growth and lipid and/or protein production.
- Microalgal cultures generated according to the methods described above yield microalgal biomass in fermentation media. To prepare the biomass for use as a food composition, the biomass is concentrated, or harvested, from the fermentation medium. At the point of harvesting the microalgal biomass from the fermentation medium, the biomass comprises predominantly intact cells suspended in an aqueous culture medium. To concentrate the biomass, a dewatering step is performed. Dewatering or concentrating refers to the separation of the biomass from fermentation broth or other liquid medium and so is solid-liquid separation. Thus, during dewatering, the culture medium is removed from the biomass (for example, by draining the fermentation broth through a filter that retains the biomass), or the biomass is otherwise removed from the culture medium. Common processes for dewatering include centrifugation, filtration, and the use of mechanical pressure. These processes can be used individually or in any combination.
- Centrifugation involves the use of centrifugal force to separate mixtures. During centrifugation, the more dense components of the mixture migrate away from the axis of the centrifuge, while the less dense components of the mixture migrate towards the axis. By increasing the effective gravitational force (i.e., by increasing the centrifugation speed), more dense material, such as solids, separate from the less dense material, such as liquids, and so separate out according to density. Centrifugation of biomass and broth or other aqueous solution forms a concentrated paste comprising the microalgal cells. Centrifugation does not remove significant amounts of intracellular water. In fact, after centrifugation, there may still be a substantial amount of surface or free moisture in the biomass (e.g., upwards of 70%), so centrifugation is not considered to be a drying step.
- Filtration can also be used for dewatering. One example of filtration that is suitable for the present invention is tangential flow filtration (TFF), also known as cross-flow filtration. Tangential flow filtration is a separation technique that uses membrane systems and flow force to separate solids from liquids. For an illustrative suitable filtration method, see Geresh, Carb. Polym. 50; 183-189 (2002), which describes the use of a MaxCell A/G Technologies 0.45uM hollow fiber filter. Also see, for example, Millipore Pellicon® devices, used with 100kD, 300kD, 1000 kD (catalog number P2C01MC01), 0.1uM (catalog number P2VVPPV01), 0.22uM (catalog number P2GVPPV01), and 0.45uM membranes (catalog number P2HVMPV01). The retentate preferably does not pass through the filter at a significant level, and the product in the retentate preferably does not adhere to the filter material. TFF can also be performed using hollow fiber filtration systems. Filters with a pore size of at least about 0.1 micrometer, for example about 0.12, 0.14, 0.16, 0.18, 0.2, 0.22, 0.45, or at least about 0.65 micrometers, are suitable. Preferred pore sizes of TFF allow solutes and debris in the fermentation broth to flow through, but not microbial cells.
- Dewatering can also be effected with mechanical pressure directly applied to the biomass to separate the liquid fermentation broth from the microbial biomass sufficient to dewater the biomass but not to cause predominant lysis of cells. Mechanical pressure to dewater microbial biomass can be applied using, for example, a belt filter press. A belt filter press is a dewatering device that applies mechanical pressure to a slurry (e.g., microbial biomass taken directly from the fermentor or bioreactor) that is passed between the two tensioned belts through a serpentine of decreasing diameter rolls. The belt filter press can actually be divided into three zones: the gravity zone, where free draining water/liquid is drained by gravity through a porous belt; a wedge zone, where the solids are prepared for pressure application; and a pressure zone, where adjustable pressure is applied to the gravity drained solids.
- After concentration, microalgal biomass can be processed, as described hereinbelow, to produce vacuum-packed cake, algal flakes, algal homogenate, algal powder, algal flour, or algal oil.
- The microalgal biomass generated by the culture methods described herein comprises microalgal oil and/or protein as well as other constituents generated by the microorganisms or incorporated by the microorganisms from the culture medium during fermentation.
- Microalgal biomass with a high percentage of oil/lipid accumulation by dry weight has been generated using different methods of culture, including methods known in the art. Microalgal biomass with a higher percentage of accumulated oil/lipid is useful in accordance with the present invention. Chlorella vulgaris cultures with up to 56.6% lipid by dry cell weight (DCW) in stationary cultures grown under autotrophic conditions using high iron (Fe) concentrations have been described (Li et al., Bioresource Technology 99(11):4717-22 (2008). Nanochloropsis sp. and Chaetoceros calcitrans cultures with 60% lipid by DCW and 39.8% lipid by DCW, respectively, grown in a photobioreactor under nitrogen starvation conditions have also been described (Rodolfi et al., Biotechnology & Bioengineering (2008)). Parietochloris incise cultures with approximately 30% lipid by DCW when grown phototropically and under low nitrogen condtions have been described (Solovchenko et al., Journal of Applied Phycology 20:245-251 (2008). Chlorella protothecoides can produce up to 55% lipid by DCW when grown under certain heterotrophic conditions with nitrogen starvation (Miao and Wu, Bioresource Technology 97:841-846 (2006)). Other Chlorella species, including Chlorella emersonii, Chlorella sorokiniana and Chlorella minutissima have been described to have accumulated up to 63% oil by DCW when grown in stirred tank bioreactors under low-nitrogen media conditions (Illman et al., Enzyme and Microbial Technology 27:631-635 (2000). Still higher percent lipid by DCW has been reported, including 70% lipid in Dumaliella tertiolecta cultures grown in increased NaCl conditions (Takagi et al., Journal of Bioscience and Bioengineering 101(3): 223-226 (2006)) and 75% lipid in Botryococcus braunii cultures (Banerjee et al., Critical Reviews in Biotechnology 22(3): 245-279 (2002)).
- Heterotrophic growth results in relatively low chlorophyll content (as compared to phototrophic systems such as open ponds or closed photobioreactor systems). Reduced chlorophyll content generally improves organoleptic properties of microalgae and therefore allows more algal biomass (or oil prepared therefrom) to be incorporated into a food product. The reduced chlorophyll content found in heterotrophically grown microalgae (e.g., Chlorella) also reduces the green color in the biomass as compared to phototrophically grown microalgae. Thus, the reduced chlorophyll content avoids an often undesired green coloring associated with food products containing phototrophically grown microalgae and allows for the incorporation or an increased incorporation of algal biomass into a food product. In at least one embodiment, the food product contains heterotrophically grown microalgae of reduced chlorophyll content compared to phototrophically grown microalgae.
- Oil rich microalgal biomass generated by the culture methods described herein and useful in accordance with the present invention comprises at least 10% microalgal oil by DCW. In some embodiments, the microalgal biomass comprises at least 15%, 25%, 50%, 75% or at least 90% microalgal oil by DCW.
- The microalgal oil of the biomass described herein (or extracted from the biomass) can comprise glycerolipids with one or more distinct fatty acid ester side chains. Glycerolipids are comprised of a glycerol molecule esterified to one, two, or three fatty acid molecules, which can be of varying lengths and have varying degrees of saturation. Specific blends of algal oil can be prepared either within a single species of algae, or by mixing together the biomass (or algal oil) from two or more species of microalgae.
- Thus, the oil composition, i.e., the properties and proportions of the fatty acid constituents of the glycerolipids, can also be manipulated by combining biomass (or oil) from at least two distinct species of microalgae. At least two of the distinct species of microalgae have different glycerolipid profiles. The distinct species of microalgae can be cultured together or separately as described herein, preferably under heterotrophic conditions, to generate the respective oils. Different species of microalgae can contain different percentages of distinct fatty acid constituents in the cell's glycerolipids.
- The microalgal oil is primarily comprised of monounsaturated oil. In some cases, the algal oil is at least 20% monounsaturated oil by weight. In some cases, the algal oil is at least 25%, 50%, 75% or more monounsaturated oil by weight or by volume. In some cases, the monounsaturated oil is 18:1, 16:1, 14:1 or 12:1. In some cases, the microalgal oil comprises at least 10%, 20%, 25%, or 50% or more esterified oleic acid or esterified alpha-linolenic acid by weight of by volume. In at least one case, the algal oil comprises less than 10%, less than 5%, less than 3%, less than 2%, or less than 1% by weight or by volume, or is substantially free of, esterified docosahexanoic acid (DHA (22:6)). For examples of production of high DHA-containing microalgae, such as in Crypthecodinium cohnii, see
US Patent Nos. 7,252,979 ,6,812,009 and6,372,460 . - High protein microalgal biomass has been generated using different methods of culture. Microalgal biomass with a higher percentage of protein content is useful in accordance with the present invention. For example, the protein content of various species of microalgae has been reported (see Table 1 of Becker, Biotechnology Advances (2007) 25:207-210). Controlling the renewal rate in a semi-continous photoautotrophic culture of Tetraselmis suecica has been reported to affect the protein content per cell, the highest being approximately 22.8% protein (Fabregas, et al., Marine Biotechnology (2001) 3:256-263).
- Microalgal biomass generated by culture methods described herein relating to high protein typically comprises at least 30% protein by dry cell weight. In some cases, the microalgal biomass comprises at least 40%, 50%, 75% or more protein by dry cell weight. In some cases, the microalgal biomass comprises from 30-75% protein by dry cell weight or from 40-60% protein by dry cell weight. In some cases, the protein in the microalgal biomass comprises at least 40% digestible crude protein. In other cases, the protein in the microalgal biomass comprises at least 50%, 60%, 70%, 80%, or at least 90% digestible crude protein. In some cases, the protein in the microalgal biomass comprises from 40-90% digestible crude protein, from 50-80% digestible crude protein, or from 60-75% digestible crude protein.
- Microalgal biomass (and oil extracted therefrom), can also include other constituents produced by the microalgae, or incorporated into the biomass from the culture medium. These other constituents can be present in varying amounts depending on the culture conditions used and the species of microalgae (and, if applicable, the extraction method used to recover microalgal oil from the biomass). The other constituents can include, without limitation, phospholipids (e.g., algal lecithin), carbohydrates, soluble and insoluble fiber, glycoproteins, phytosterols (e.g., β-sitosterol, campesterol, stigmasterol, ergosterol, and brassicasterol), tocopherols, tocotrienols, carotenoids (e.g., α-carotene, β-carotene, and lycopene), xanthophylls (e.g., lutein, zeaxanthin, α-cryptoxanthin, and β-cryptoxanthin), proteins, polysaccharides (e.g., arabinose, mannose, galactose, 6-methyl galactose and glucose) and various organic or inorganic compounds (e.g., selenium).
- In some cases, the biomass comprises at least 10 ppm selenium. In some cases, the biomass comprises at least 25% w/w algal polysaccharide. In some cases, the biomass comprises at least 15% w/w algal glycoprotein. In some cases, the biomass comprises between 0-115mcg/g total carotenoids. In some cases, the biomass comprises at least 0.5% algal phospholipids. In some cases, the oil derived from the algal biomass contains at least 0.10 mg/g total tocotrienols. In some cases, the oil derived from the algal biomass contains between 0.125 mg/g to 0.35 mg/g total tocotrienols. In some cases, the oil derived from the algal biomass contains at least 5.0 mg/100g total tocopherols. In some cases, the oil derived from the algal biomass contains between 5.0mg/100g to 10mg/100g tocopherols. A detailed description of tocotrienols and tocopherols composition in Chlorella protothecoides is included in the Examples below.
- In some cases, the microalgal biomass comprises at least 10% soluble fiber. In other cases, the microalgal biomass comprises at least 20% to 25% soluble fiber. In some cases, the microalgal biomass comprises at least 30% insoluble fiber. In other cases, the microalgal biomass comprises at least 50% to at least 70% insoluble fiber. Total dietary fiber is the sum of soluble fiber and insoluble fiber. In some cases, the microalgal biomass comprises at least 40% total dietary fiber. In other cases, the microalgal biomass comprises at least 50%, 55%, 60%, 75%, 80%, 90%, to 95% total dietary fiber.
- The concentrated microalgal biomass produced in the invention is itself a finished food ingredient and may be used in foodstuffs without further, or with only minimal, modification. For example, the cake can be vacuum-packed or frozen. Alternatively, the biomass may be dried via lyophilization, a "freeze-drying" process, in which the biomass is frozen in a freeze-drying chamber to which a vacuum is applied. The application of a vacuum to the freeze-drying chamber results in sublimation (primary drying) and desorption (secondary drying) of the water from the biomass. However, the present invention provides a variety of microalgal derived finished food ingredients with enhanced properties resulting from processing methods that can be applied to the concentrated microalgal biomass.
- Drying the microalgal biomass, either predominantly intact or in homogenate form, is advantageous to facilitate further processing or for use of the biomass in the methods and compositions described herein. Drying refers to the removal of free or surface moisture/water from predominantly intact biomass or the removal of surface water from a slurry of homogenized (e.g., by micronization)biomass. Different textures and flavors can be conferred on food products depending on whether the algal biomass is dried, and if so, the drying method. Drying the biomass generated from the cultured microalgae described herein removes water that may be an undesirable component of finished food products or food ingredients. In some cases, drying the biomass may facilitate a more efficient microalgal oil extraction process.
- In one case, the concentrated microalgal biomass is drum dried to a flake form to produce algal flake, as described in part A of this section. In another case, the concentrated micralgal biomass is spray or flash dried (i.e., subjected to a pneumatic drying process) to form a powder containing predominantly intact cells to produce algal powder, as described in part B of this section. In another case, the concentratedmicroalgal biomass is micronized (homogenized) to form a homogenate of predominantly lysed cells that is then spray or flash dried to produce algal flour, as described in part C of this section. In another case, oil is extracted from the concentrated microalgal biomass to form algal oil, as described in part D of this section.
- Algal flake is prepared from concentrated microalgal biomass that is applied as a film to the surface of a rolling, heated drum. The dried solids are then scraped off with a knife or blade, resulting in a small flakes.
U.S. Patent No. 6,607,900 describes drying microalgal biomass using a drum dryer without a prior centrifugation (concentration) step, and such a process may be used with the invention. - Because the biomass may be exposed to high heat during the drying process, it may be advantageous to add an antioxidant to the biomass prior to drying. The addition of an antioxidant will not only protect the biomass during drying, but also extend the shelf-life of the dried microalgal biomass when stored. Preferably, an antioxidant is added to the microalgal biomass prior to subsequent processing such as drying or homogenization. Antioxidants that are suitable for use are discussed in detail below.
- Additionally, if there is significant time between the production of the dewatered microalgal biomass and subsequent processing steps, it may be advantageous to pasteurize the biomass prior to drying. Free fatty acids from lipases may form if there is significant time between producing and drying the biomass. Pasteurization of the biomass inactivates these lipases and prevents the formation of a "soapy" flavor in the resulting dried biomass product. Thus, pasteurized microalgal biomass is disclosed. For example, the pasteurized microalgal biomass is an algal flake.
- Algal powder of the invention is prepared from concentrated microalgal biomass using a pneumatic or spray dryer (see for example
U.S. Patent No. 6,372,460 ). In a spray dryer, material in a liquid suspension is sprayed in a fine droplet dispersion into a current of heated air. The entrained material is rapidly dried and forms a dry powder. In some cases, a pulse combustion dryer can also be used to achieve a powdery texture in the final dried material. In other cases, a combination of spray drying followed by the use of a fluid bed dryer is used to achieve the optimal conditions for dried microbial biomass (see, for example,U.S. Patent No. 6,255,505 ). As an alternative, pneumatic dryers can also be used in the production of algal powder. Pneumatic dryers draw or entrain the material that is to be dried in a stream of hot air. While the material is entrained in the hot air, the moisture is rapidly removed. The dried material is then separated from the moist air and the moist air is then recirculated for further drying. - Algal flour is prepared from concentrated microalgal biomass that has been mechanically lysed and homogenized and the homogenate spray or flash dried (or dried using another pneumatic drying system). The production of algal flour requires that cells be lysed to release their oil and that cell wall and intracellular components be micronized or reduced in particle size to an average size of no more than 10 µm. The resulting oil, water, and micronized particles are emulsified such that the oil does not separate from the dispersion prior to drying. For example, a pressure disrupter can be used to pump a cell containing slurry through a restricted orifice valve to lyse the cells. High pressure (up to 1500 bar) is applied, followed by an instant expansion through an exiting nozzle. Cell disruption is accomplished by three different mechanisms: impingement on the valve, high liquid shear in the orifice, and sudden pressure drop upon discharge, causing an explosion of the cell. The method releases intracellular molecules. A Niro (Niro Soavi GEA) homogenizer (or any other high pressure homogenizer) can be used to process cells to particles predominantly 0.2 to 5 microns in length. Processing of algal biomass under high pressure (approximately 1000 bar) typically lyses over 90% of the cells and reduces particle size to less than 5 microns.
- Alternatively, a ball mill can be used. In a ball mill, cells are agitated in suspension with small abrasive particles, such as beads. Cells break because of shear forces, grinding between beads, and collisions with beads. The beads disrupt the cells to release cellular contents. In one case, algal biomass is disrupted and formed into a stable emulsion using a Dyno-mill ECM Ultra (CB Mills) ball mill. Cells can also be disrupted by shear forces, such as with the use of blending (such as with a high speed or Waring blender as examples), the french press, or even centrifugation in case of weak cell walls, to disrupt cells. A suitable ball mill including specifics of ball size and blade is described in
US Patent No. 5,330,913 . - The immediate product of homogenization is a slurry of particles smaller in size than the original cells that is suspended in in oil and water. The particles represent cellular debris. The oil and water are released by the cells. Additional water may be contributed by aqueous media containing the cells before homogenization. The particles are preferably in the form of a micronized homogenate. If left to stand, some of the smaller particles may coalesce. However, an even dispersion of small particles can be preserved by seeding with a microcrystalline stabilizer, such as microcrystalline cellulose.
- To form the algal flour, the slurry is spray or flash dried, removing water and leaving a dry power containing cellular debris and oil. Although the oil content of the powder can be at least 10, 25 or 50% by weight of the dry powder, the powder can have a dry rather than greasy feel and appearance (e.g., lacking visible oil) and can also flow freely when shaken. Various flow agents (including silica-derived products) can also be added. After drying, the water or moisture content of the powder is typically less than 10%, 5%, 3% or 1% by weight. Other dryers such as pneumatic dryers or pulse combustion dryers can also be used to produce algal flour.
- The oil content of algal flour can vary depending on the percent oil of the algal biomass. Algal flour can be produced from algal biomass of varying oil content. In certain cases, the algal flour is produced from algal biomass of the same oil content. In other cases, the algal flour is produced from alglal biomass of different oil content. In the latter case, algal biomass of varying oil content can be combined and then the homogenization step performed. In other cases, algal flour of varying oil content is produced first and then blended together in various proportions in order to achieve an algal flour product that contains the final desired oil content. In a further case, algal biomass of different lipid profiles can be combined together and then homogenized to produce algal flour. In another case, algal flour of different lipid profiles is produced first and then blended together in various proportions in order to achieve an algal flour product that contains the final desired lipid profile.
- The algal flour is useful for a wide range of food preparations. Because of the oil content, fiber content and the micronized particles, algal flour is a multifunctional food ingredient. Algal flour can be used in baked goods, quick breads, yeast dough products, egg products, dressing, sauces, nutritional beverages, algal milk, pasta and gluten free products. Additional details of formulating these food products and more with algal flour is described in the Examples below.
- Algal flour can be used in baked goods in place of convention fat sources (e.g., oil, butter or margarine) and eggs. Baked goods and gluten free products have superior moisture content and a cumb structure that is indistinguishable from conventional baked goods made with butter and eggs. Because of the superior moisture content, these baked goods have a longer shelf life and retain their original texture longer than conventional baked goods that are produced without algal flour.
- Algal flour can also act as a fat extender with used in smoothies, sauces, or dressings. The composition of algal flour is unique in its ability to convey organoleptic qualities and mouth-feel comparable to a food product with a higher fat content. Dressings, sauces and beverages made with algal flour have a rheology and opacity that is close to conventional higher fat recipes although these food products contains about half the fat/oil levels. Algal flour is also a superior emulsifier and is suitable in use in food preparation that requires thickness, opacity and viscosity, such as, sauces, dressings and soups. Additionally the lipid profile found in algal flour described herein does not contain trans-fat and have a higher level of healthy, unsaturated fats as compared to butter or margarine (or other animal fats). Thus, products made with algal flour can have a lower fat content (with healthier fats) without sacrificing the mouthfeel and organoleptic qualities of the same food product that is made using a conventional recipe using a conventional fat source.
- Algal flour can also be added to powdered or liquid eggs, which are typically served in a food service setting. The addition of algal flour improves the appearance, texture and mouthfeel of powdered and liquid eggs and also extends improved appearance, texture and mouthfeel over time, even when the prepared eggs are held on a steam table. Specific formulations and sensory panel results are described below in the Examples.
- Disclosed herein is a method of preparing algal oil by harvesting algal oil from an algal biomass comprising at least 15% oil by dry weight under GMP conditions, in which the algal oil is greater than 50% 18:1 lipid. In some cases, the algal biomass comprises a mixture of at least two distinct species of microalgae. In some cases, at least two of the distinct species of microalgae have been separately cultured. In at least one case, at least two of the distinct species of microalgae have different glycerolipid profiles. In some cases, the algal biomass is derived from algae grown heterotrophically. In some cases, all of the at least two distinct species of microalgae contain at least 15% oil by dry weight.
- Disclosed herein is a method of making a food composition comprising combining algal oil obtained from algal cells containing at least 10%, or at least 15% oil by dry weight with one or more other edible ingredients to form the food composition. In some cases, the method further comprises preparing the algal oil under GMP conditions.
- Algal oil can be separated from lysed biomass for use in food product (among other applications). The algal biomass remaining after oil extraction is referred to as delipidated meal. Delipidated meal contains less oil by dry weight or volume than the microalgae contained before extraction. Typically 50-90% of oil is extracted so that delipidated meal contains, for example, 10-50% of the oil content of biomass before extraction. However, the biomass still has a high nutrient value in content of protein and other constituents discussed above. Thus, the delipidated meal can be used in animal feed or in human food applications.
- In some aspects of the method, the algal oil is at least 50% w/w oleic acid and contains less than 5% DHA. In some aspects of the method, the algal oil is at least 50% w/w oleic acid and contains less than 0.5% DHA. In some aspects of the method, the algal oil is at least 50% w/w oleic acid and contains less than 5% glycerolipid containing carbon chain length greater than 18. In some cases, the algal cells from which the algal oil is obtained comprise a mixture of cells from at least two distinct species of microalgae. In some cases, at least two of the distinct species of microalgae have been separately cultured. In at least one case, at least two of the distinct species of microalgae have different glycerolipid profiles. In some cases, the algal cells are cultured under heterotrophic conditions. In some cases, all of the at least two distinct species of microalgae contain at least 10%, or at least 15% oil by dry weight.
- Disclosed herein is an algal oil containing at least 50% monounsaturated oil and containing less than 1% DHA prepared under GMP conditions. In some cases, the monounsaturated oil is 18:1 lipid. In some cases, the algal oil is packaged in a capsule for delivery of a unit dose of oil. In some cases, the algal oil is derived from a mixture of at least two distinct species of microalgae. In some cases, at least two of the distinct species of microalgae have been separately cultured. In at least one case, at least two of the distinct species of microalgae have different glycerolipid profiles. In some cases, the algal oil is derived from algal cells cultured under heterotrophic conditions.
- Disclosed herein is an oil comprising greater than 60% 18:1, and at least 0.20mg/g tocotrienol.
- Disclosed herein is a fatty acid alkyl ester composition comprising greater than 60% 18:1 ester, and at least 0.20mg/g tocotrienol.
- Algal oil is prepared from concentrated, washed microalgal biomass by extraction. The cells in the biomass are lysed prior to extraction. Optionally, the microbial biomass may also be dried (oven dried, lyophilized, etc.) prior to lysis (cell disruption). Alternatively, cells can be lysed without separation from some or all of the fermentation broth when the fermentation is complete. For example, the cells can be at a ratio of less than 1:1 v:v cells to extracellular liquid when the cells are lysed.
- Microalgae containing lipids can be lysed to produce a lysate. As detailed herein, the step of lysing a microorganism (also referred to as cell lysis) can be achieved by any convenient means, including heat-induced lysis, adding a base, adding an acid, using enzymes such as proteases and polysaccharide degradation enzymes such as amylases, using ultrasound, mechanical pressure-based lysis, and lysis using osmotic shock. Each of these methods for lysing a microorganism can be used as a single method or in combination simultaneously or sequentially. The extent of cell disruption can be observed by microscopic analysis. Using one or more of the methods above, typically more than 70% cell breakage is observed. Preferably, cell breakage is more than 80%, more preferably more than 90% and most preferred about 100%.
- Lipids and oils generated by the microalgae can be recovered by extraction. In some cases, extraction can be performed using an organic solvent or an oil, or can be performed using a solventless-extraction procedure.
- For organic solvent extraction of the microalgal oil, the preferred organic solvent is hexane. Typically, the organic solvent is added directly to the lysate without prior separation of the lysate components. In one case, the lysate generated by one or more of the methods described above is contacted with an organic solvent for a period of time sufficient to allow the lipid components to form a solution with the organic solvent. In some cases, the solution can then be further refined to recover specific desired lipid components. The mixture can then be filtered and the hexane removed by, for example, rotoevaporation. Hexane extraction methods are well known in the art. See, e.g., Frenz et al., Enzyme Microb. Technol., 11:717 (1989).
- Miao and Wu describe a protocol of the recovery of microalgal lipid from a culture of Chlorella protothecoides in which the cells were harvested by centrifugation, washed with distilled water and dried by freeze drying. The resulting cell powder was pulverized in a mortar and then extracted with n-hexane. Miao and Wu, Biosource Technology 97:841-846 (2006).
- In some cases, microalgal oils can be extracted using liquefaction (see for example Sawayama et al., Biomass and Bioenergy 17:33-39 (1999) and Inoue et al., Biomass Bioenergy 6(4):269-274 (1993)); oil liquefaction (see for example Minowa et al., Fuel 74(12):1735-1738 (1995)); or supercritical CO2 extraction (see for example Mendes et al., Inorganica Chimica Acta 356:328-334 (2003)).
- Oil extraction includes the addition of an oil directly to a lysate without prior separation of the lysate components. After addition of the oil, the lysate separates either of its own accord or as a result of centrifugation or the like into different layers. The layers can include in order of decreasing density: a pellet of heavy solids, an aqueous phase, an emulsion phase, and an oil phase. The emulsion phase is an emulsion of lipids and aqueous phase. Depending on the percentage of oil added with respect to the lysate (w/w or v/v), the force of centrifugation if any, volume of aqueous media and other factors, either or both of the emulsion and oil phases can be present. Incubation or treatment of the cell lysate or the emulsion phase with the oil is performed for a time sufficient to allow the lipid produced by the microorganism to become solubilized in the oil to form a heterogeneous mixture.
- In various cases, the oil used in the extraction process is selected from the group consisting of oil from soy, rapeseed, canola, palm, palm kernel, coconut, corn, waste vegetable oil, Chinese tallow, olive, sunflower, cotton seed, chicken fat, beef tallow, porcine tallow, microalgae, macroalgae, Cuphea, flax, peanut, choice white grease (lard), Camelina sativa mustard seedcashew nut, oats, lupine, kenaf, calendula, hemp, coffee, linseed, hazelnut, euphorbia, pumpkin seed, coriander, camellia, sesame, safflower, rice, tung oil tree, cocoa, copra, pium poppy, castor beans, pecan, jojoba, jatropha, macadamia, Brazil nuts, and avocado. The amount of oil added to the lysate is typically greater than 5% (measured by v/v and/or w/w) of the lysate with which the oil is being combined. Thus, a preferred v/v or w/w of the oil is greater than 5%, 10%, 20%, 25%, 50%, 70%, 90%, or at least 95% of the cell lysate.
- Lipids can also be extracted from a lysate via a solventless extraction procedure without substantial or any use of organic solvents or oils by cooling the lysate. Sonication can also be used, particularly if the temperature is between room temperature and 65°C. Such a lysate on centrifugation or settling can be separated into layers, one of which is an aqueous:lipid layer. Other layers can include a solid pellet, an aqueous layer, and a lipid layer. Lipid can be extracted from the emulsion layer by freeze thawing or otherwise cooling the emulsion. In such methods, it is not necessary to add any organic solvent or oil. If any solvent or oil is added, it can be below 5% v/v or w/w of the lysate.
- In one aspect, the present invention is directed to a food composition comprising at least 0.1% w/w Chlorella protothecoides microalgal biomass and one or more other edible ingredients, wherein the algal biomass comprises at least 10% oil by dry weight, optionally wherein at least 90% of the oil is glycerolipid. In some embodiments, the algal biomass contains at least 25%, 40%, 50% or 60% oil by dry weight. In some cases, the algal biomass contains 10-90%, 25-75%, 40-75% or 50-70% oil by dry weight, optionally wherein at least 90% of the oil is glycerolipid. In at least one embodiment, at least 50% by weight of the oil is monounsaturated glycerolipid oil. In some cases, at least 50% by weight of the oil is an 18:1 lipid in glycerolipid form. In some cases, less than 5% by weight of the oil is docosahexanoic acid (DHA) (22:6). In at least one embodiment, less than 1% by weight of the oil is DHA. An algal lipid content with low levels of polyunsaturated fatty acids (PUFA) is preferred to ensure chemical stability of the biomass. In preferred embodiments, the algal biomass is grown under heterotrophic conditions and has reduced green pigmentation. In other embodiments, the microalgae is a color mutant that lacks or is reduced in pigmentation.
- In another aspect, disclosed herein is a food composisiton comprising at least 0.1% w/w algal biomass and one or more other edible ingredients, wherein the algal biomass comprises at least 30% protein by dry weight, at least 40% protein by dry weight, at least 45% protein by dry weight, at least 50% protein by dry weight, at least 55% protein by dry weight, at least 60% protein by dry weight or at least 75% protein by dry weight. In some cases, the algal biomass contains 30-75% or 40-60% protein by dry weight. In some cases, at least 40% of the crude protein is digestible, at least 50% of the crude protein is digestible, at least 60% of the crude protein is digestible, at least 70% of the crude protein is digestible, at least 80% of the crude protein is digestible, or at least 90% of the crude protein is digestible. In some cases, the algal biomass is grown under heterotrophic conditions. In at least one cases, the algal biomass is grown under nitrogen-replete conditions. In other cases, the microalgae is a color mutant that lacks or is reduced in pigmentation.
- In some cases, the algal biomass comprises predominantly intact cells. In some cases, the food composition comprises oil which is predominantly or completely encapsulated inside cells of the biomass. In some cases, the food composition comprises predominantly intact microalgal cells. In some cases, the algal oil is predominantly encapsulated in cells of the biomass. In other cases, the biomass comprises predominantly lysed cells (e.g., a homogenate). As discussed above, such a homogenate can be provided as a slurry, flake, powder, or flour.
- In some aspects of the food composition, the algal biomass further comprises at least 10 ppm selenium. In some cases, the biomass further comprises at least 15% w/w algal polysaccharide. In some cases, the biomass further comprises at least 5% w/w algal glycoprotein. In some cases, the biomass comprises between 0 and 115 mcg/g total carotenoids. In some cases, the biomass comprises at least 0.5% w/w algal phospholipids. In all cases, as just noted, these components are true cellular components and not extracellular.
- In some cases, the algal biomass of the food composition contains components that have antioxidant qualities. The strong antioxidant qualities can be attributed to the multiple antioxidants present in the algal biomass, which include, but are not limited to carotenoids, essential minerals such as zinc, copper, magnesium, calcium, and manganese. Algal biomass has also been shown to contain other antioxidants such as tocotrienols and tocopherols. These members of the vitamin E family are important antioxidants and have other health benefits such as protective effects against stroke-induced injuries, reversal of arterial blockage, growth inhibition of breast and prostate cancer cells, reduction in cholesterol levels, a reduced-risk of type II diabetes and protective effects against glaucomatous damage. Natural sources of tocotrienols and tocopherols can be found in oils produced from palm, sunflower, corn, soybean and olive oil, however compositions provided herein have significantly greater levels of tocotrienols than heretofore known materials.
- In some cases, food compositions of the present invention contain algal oil comprising at least 5mg/100g, at least 7mg/100g or at least 8mg/100g total tocopherol. In some cases, food compositions of the present invention contain algal oil comprising at least 0.15mg/g, at least 0.20mg/g or at least 0.25mg/g total tocotrienol.
- In particular embodiments of the compositions and/or methods described above, the microalgae can produce carotenoids. In some embodiments, the carotenoids produced by the microalgae can be co-extracted with the lipids or oil produced by the microalgae (i.e., the oil or lipid will contain the carotenoids). In some embodiments, the carotenoids produced by the microalgae are xanthophylls. In some embodiments, the carotenoids produced by the microalgae are carotenes. In some embodiments, the carotenoids produced by the microalgae are a mixture of carotenes and xanthophylls. In various embodiments, the carotenoids produced by the microalgae comprise at least one carotenoid selected from the group consisting of astaxanthin, lutein, zeaxanthin, alpha-carotene, trans-beta carotene, cis-beta carotene, lycopene and any combination thereof. A non-limiting example of a carotenoid profile of oil from Chlorella protothecoides is included below in the Examples.
- In some embodiments of the food composition, the algal biomass is derived from algae cultured and dried under good manufacturing practice (GMP) conditions. In some cases, the algal biomass is combined with one or more other edible ingredients, including without limitation, grain, fruit, vegetable, protein, lipid, herb and/or spice ingredients. In some cases, the food composition is a salad dressing, egg product, baked good, bread, bar, pasta, sauce, soup drink, beverage, frozen dessert, butter or spread. In particular cases, the food composition is not a pill or powder. In some cases, the food composition in accordance with the present invention weighs at least 50g, or at least 100g.
- Biomass can be combined with one or more other edible ingredients to make a food product. The biomass can be from a single algal source (e.g., strain) or algal biomass from multiple sources (e.g., different strains). The biomass can also be from a single algal species, but with different composition profile. For example, a manufacturer can blend microalgae that is high in oil content with microalgae that is high in protein content to the exact oil and protein content that is desired in the finished food product. The combination can be performed by a food manufacturer to make a finished product for retail sale or food service use. Alternatively, a manufacturer can sell algal biomass as a product, and a consumer can incorporate the algal biomass into a food product, for example, by modification of a conventional recipe. In either case, the algal biomass is typically used to replace all or part of the oil, fat, eggs, or the like used in many conventional food products.
- Disclosed herein is a food composition comprising at least 0.1% w/w algal biomass and one or more other edible ingredients, wherein the algal biomass is formulated thorugh blending of algal biomass that contains at least 40% protein by dry weight with algal biomass that contains 40% lipid by dry weight to obtain a blend of a desired percent protein and lipid by dry weight. In some cases, the biomass is from the same strain of algae. Alternatively, algal biomass that contains at least 40% lipid by dry weight containing less than 1% of its lipid as DHA is blended with algal biomass that contains at lest 20% lipid by dry weight containing at least 5% of its lipid as DHA to obtain a blend of dry biomass that contains in the aggregate at least 10% lipid and 1% DHA by dry weight.
- Disclosed herein is a method of preparing algal biomass by drying an algal culture to provide algal biomass comprising at least 15% oil by dry weight under GMP conditions, in which the algal oil is greater than 50% monounsaturated lipid.
- Disclosed herein is algal biomass containing at least 15% oil by dry weight manufactured under GMP conditions, in which the algal oil is greater than 50% 18:1 lipid. Also disclosed herein is algal biomass containing at least 40% oil by dry weight manufactured under GMP conditions. Further disclosed herein is algal biomass containing at least 55% oil by dry weight manufactured under GMP conditions. In some cases, the algal biomass is packaged as a tablet for delivery of a unit dose of biomass. In some cases, the algal biomass is packaged with or otherwise bears a label providing directions for combining the algal biomass with other edible ingredients.
- In one aspect, the present invention is directed to methods of combining at least 0.1% w/w Chlorella protothecoides microalgal biomass and/or materials derived therefrom, as described above, with at least one other finished food ingredient, as described below, to form a food composition or foodstuff. In various embodiments, the food composition formed by the methods of the invention comprises an egg product (powdered or liquid), a pasta product, a dressing product, a mayonnaise product, a cake product, a bread product, an energy bar, a milk product, a juice product, a spread, or a smoothie. In some cases, the food composition is not a pill or powder. In various embodiments, the food composition weighs at least 10 g, at least 25 g, at least 50 g, at least 100 g, at least 250 g, or at least 500 g or more. In some embodiments, the food composition formed by the combination of microalgal biomass and/or product derived therefrom is an uncooked product. In other cases, the food composition is a cooked product.
- In other cases, the food composition is a cooked product. In some cases, the food composition contains less than 25% oil or fat by weight excluding oil contributed by the algal biomass. Fat, in the form of saturated triglycerides (TAGs or trans fats), is made when hydrogenating vegetable oils, as is practiced when making spreads such as margarines. The fat contained in algal biomass has no trans fats present. In some cases, the food composition contains less than 10% oil or fat by weight excluding oil contributed by the biomass. In at least one embodiment, the food composition is free of oil or fat excluding oil contributed by the biomass. In some cases, the food composition is free of oil other than oil contributed by the biomass. In some cases, the food composition is free of egg or egg products.
- In one aspect, the present invention is directed to a method of making a food composition in which the fat or oil in a conventional food product is fully or partially substituted with Chlorella protothecoides microalgal biomass containing at least 10% by weight oil. In one embodiment, the method comprises determining an amount of the algal biomass for substitution using the proportion of algal oil in the biomass and the amount of oil or fat in the conventional food product, and combining the algal biomass with at least one other edible ingredient and less than the amount of oil or fat contained in the conventional food product to form a food composition. In some cases, the amount of algal biomass combined with the at least one other ingredient is 1-4 times the mass or volume of oil and/or fat in the conventional food product.
- In some cases, the method described above further includes providing a recipe for a conventional food product containing the at least one other edible ingredient combined with an oil or fat, and combining 1-4 times the mass or volume of the algal biomass with the at least one other edible ingredient as the mass or volume of fat or oil in the conventional food product. In some cases, the method further includes preparing the algal biomass under GMP conditions.
- In some cases, the food composition formed by the combination of microalgal biomass and/or product derived therefrom comprises at least 0.1%, at least 0.5%, at least 1%, at least 5%, at least 10%, at least 25%, or at least 50% w/w or v/v microalgal biomass or microalgal oil. In some cases, food compositions formed as described herein comprise at least 2%, at least 5%, at least 10%, at least 25%, at least 50%, at least 75%, at least 90%, or at least 95% w/w microalgal biomass or product derived therefrom. In some cases, the food composition comprises 5-50%, 10-40%, or 15-35% algal biomass or product derived therefrom by weight or by volume.
- As described above, microalgal biomass can be substituted for other components that would otherwise be conventionally included in a food product. In some cases, the food composition contains less than 50%, less than 40%, or less than 30% oil or fat by weight excluding microalgal oil contributed by the biomass or from microalgal sources. In some cases, the food composition contains less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% oil or fat by weight excluding microalgal oil contributed by the biomass or from microalgal sources. In at least one case, the food composition is free of oil or fat excluding microalgal oil contributed by the biomass or from microalgal sources. In some cases, the food composition is free of eggs, butter, or other fats/oils or at least one other ingredient that would ordinarily be included in a comparable conventional food product. Some food products are free of dairy products (e.g., butter, cream and/or cheese).
- The amount of algal biomass used to prepare a food composition depends on the amount of non-algal oil, fat, eggs, or the like to be replaced in a conventional food product and the percentage of oil in the algal biomass. Thus, in at least one embodiment, the methods of the invention include determining an amount of the algal biomass to combine with at least one other edible ingredient from a proportion of oil in the biomass and a proportion of oil and/or fat that is ordinarily combined with the at least one other edible ingredient in a conventional food product. For example, if the algal biomass is 50% w/w microalgal oil, and complete replacement of oil or fat in a conventional recipe is desired, then the oil can for example be replaced in a 2:1 ratio. The ratio can be measured by mass, but for practical purposes, it is often easier to measure volume using a measuring cup or spoon, and the replacement can be by volume. In a general case, the volume or mass of oil or fat to be replaced is replaced by (100/100-X) volume or mass of algal biomass, where X is the percentage of microalgal oil in the biomass. In general, oil and fats to be replaced in conventional recipes can be replaced in total by algal biomass, although total replacement is not necessary and any desired proportion of oil and/or fats can be retained and the remainder replaced according to taste and nutritional needs. Because the algal biomass contains proteins and phospholipids, which function as emulsifiers, items such as eggs can be replaced in total or in part with algal biomass. If an egg is replaced in total with biomass, it is sometimes desirable or necessary to augment the emulsifying properties in the food composition with an additional emulsifying agent(s) and/or add additional water or other liquid(s) to compensate for the loss of these components that would otherwise be provided by the egg. Because an egg is not all fat, the amount of biomass used to replace an egg may be less than that used to replace pure oil or fat. An average egg weighs about 58 g and comprises about 11.2% fat. Thus, about 13 g of algal biomass comprising 50% microalgal oil by weight can be used to replace the total fat portion of an egg in total. Replacing all or part of the eggs in a food product has the additional benefit of reducing cholesterol.
- For simplicity, substitution ratios can also be provided in terms of mass or volume of oil, fat and/or eggs replaced with mass or volume of biomass. In some methods, the mass or volume of oil, fat and/or eggs in a conventional recipe is replaced with 5-150%, 25-100% or 25-75% of the mass or volume of oil, fat and/or eggs. The replacement ratio depends on factors such as the food product, desired nutritional profile of the food product, overall texture and appearance of the food product, and oil content of the biomass.
- In cooked foods, the determination of percentages (i.e., weight or volume) can be made before or after cooking. The percentage of algal biomass can increase during the cooking process because of loss of liquids. Because some algal biomass cells may lyse in the course of the cooking process, it can be difficult to measure the content of algal biomass directly in a cooked product. However, the content can be determined indirectly from the mass or volume of biomass that went into the raw product as a percentage of the weight or volume of the finished product (on a biomass dry solids basis), as well as by methods of analyzing components that are unique to the algal biomass such as genomic sequences or compounds that are delivered solely by the algal biomass, such as certain carotenoids.
- In some cases, it may be desirable to combine algal biomass with the at least one other edible ingredient in an amount that exceeds the proportional amount of oil, fat, eggs, or the like that is present in a conventional food product. For example, one may replace the mass or volume of oil and/or fat in a conventional food product with 1, 2, 3, 4, or more times that amount of algal biomass. Some aspects of the methods include providing a recipe for a conventional food product containing the at least one other edible ingredient combined with an oil or fat, and combining 1-4 times the mass or volume of algal biomass with the at least one other edible ingredient as the mass or volume of fat or oil in the conventional food product.
- Algal biomass (predominantly intact or homogenized or micronized) and/or algal oil are combined with at least one other edible ingredient to form a food product. In some food products, the algal biomass and/or algal oil is combined with 1-20, 2-10, or 4-8 other edible ingredients. The edible ingredients can be selected from all the major food groups, including without limitation, fruits, vegetables, legumes, meats, fish, grains (e.g., wheat, rice, oats, cornmeal, barley), herbs, spices, water, vegetable broth, juice, wine, and vinegar. In some food compositions, at least 2, 3, 4, or 5 food groups are represented as well as the algal biomass or algal oil.
- Oils, fats, eggs and the like can also be combined into food compositions, but, as has been discussed above, are usually present in reduced amounts (e.g., less than 50%, 25%, or 10% of the mass or volume of oil, fat or eggs compared with conventional food products. Some food products of the invention are free of oil other than that provided by algal biomass and/or algal oil. Some food products are free of oil other than that provided by algal biomass. Some food products are free of fats other than that provided by algal biomass or algal oil. Some food products are free of fats other than that provided by algal biomass. Some food products are free of both oil and fats other than that provided by algal biomass or algal oil. Some food products are free of both oil and fats other than that provided by algal biomass. Some food products are free of eggs. The oils produced by the microalgae can be tailored by culture conditions or strain selection to comprise a particular fatty acid component(s) or levels.
- In some cases, the algal biomass used in making the food composition comprises a mixture of at least two distinct species of microalgae. In some cases, at least two of the distinct species of microalgae have been separately cultured. In at least one case, at least two of the distinct species of microalgae have different glycerolipid profiles. In some cases, the method described above further comprises culturing algae under heterotrophic conditions and preparing the biomass from the algae. In some cases, all of the at least two distinct species of microalgae contain at least 10%, or at least 15% oil by dry weight. In some cases, a food composition contains a blend of two distinct preparations of biomass of the same species, wherein one of the preparations contains at least 30% oil by dry weight and the second contains less than 15% oil by dry weight. In some cases, a food composition contains a blend of two distinct preparations of biomass of the same species, wherein one of the preparations contains at least 50% oil by dry weight and the second contains less than 15% oil by dry weight, and further wherein the species is Chlorella protothecoides.
- As well as using algal biomass as an oil, fat or egg replacement in otherwise conventional foods, algal biomass can be used as a supplement in foods that do not normally contain oil, such as a smoothie. The combination of oil with products that are mainly carbohydrate can have benefits associated with the oil, and from the combination of oil and carbohydrate by reducing the glycemic index of the carbohydrate. The provision of oil encapsulated in biomass is advantageous in protecting the oil from oxidation and can also improve the taste and texture of the smoothie.
- Oil extracted from algal biomass can be used in the same way as the biomass itself, that is, as a replacement for oil, fat, eggs, or the like in conventional recipes. The oil can be used to replace conventional oil and/or fat on about a 1:1 weight/weight or volume/volume basis. The oil can be used to replace eggs by substitution of about 1 teaspoon of algal oil per egg optionally in combination with additional water and/or an emulsifier (an average 58g egg is about 11.2% fat, algal oil has a density of about 0.915 g/ml, and a teaspoon has a volume of about 5 ml = 1.2 teaspoons of algal oil/egg). The oil can also be incorporated into dressings, sauces, soups, margarines, creamers, shortenings and the like. The oil is particularly useful for food products in which combination of the oil with other food ingredients is needed to give a desired taste, texture and/or appearance. The content of oil by weight or volume in food products can be at least 5, 10, 25, 40 or 50%.
- In at least one case, oil extracted from algal biomass can also be used as a cooking oil by food manufacturers, restaurants and/or consumers. In such cases, algal oil can replace conventional cooking oils such as safflower oil, canola oil, olive oil, grape seed oil, corn oil, sunflower oil, coconut oil, palm oil, or any other conventionally used cooking oil. The oil obtained from algal biomass as with other types of oil can be subjected to further refinement to increase its suitability for cooking (e.g., increased smoke point). Oil can be neutralized with caustic soda to remove free fatty acids. The free fatty acids form a removable soap stock. The color of oil can be removed by bleaching with chemicals such as carbon black and bleaching earth. The bleaching earth and chemicals can be separated from the oil by filtration. Oil can also be deodorized by treating with steam.
- Predominantly intact biomass, homogenized or micronized biomass (as a slurry, flake, powder or flour) and purified algal oil can all be combined with other food ingredients to form food products. All are a source of oil with a favorable nutritional profile (relatively high monounsaturated content). Predominantly intact, homogenized, and micronized biomass also supply high quality protein (balanced amino acid composition), carbohydrates, fiber and other nutrients as dicussed above. Foods incorporating any of these products can be made in vegan or vegetarian form. Another advantage in using microalgal biomass (either predominantly intact or homogenized (or micronized) or both) as a protein source is that it is a vegan/vegetarian protein source that is not from a major allergen source, such as soy, eggs or dairy.
- Other edible ingredients with which algal biomass and/or algal oil can be combined in accordance with the present invention include, without limitation, grains, fruits, vegetables, proteins, meats, herbs, spices, carbohydrates, and fats. The other edible ingredients with which the algal biomass and/or algal oil is combined to form food compositions depend on the food product to be produced and the desired taste, texture and other properties of the food product.
- Although in general any of these sources of algal oil can be used in any food product, the preferred source depends in part whether the oil is primarily present for nutritional or caloric purposes rather than for texture, appearance or taste of food, or alternatively whether the oil in combination with other food ingredients is intended to contribute a desired taste, texture or appearance of the food as well as or instead of improving its nutritional or caloric profile.
- The food products can be cooked by conventional procedures as desired. Depending on the length and temperature, the cooking process may break down some cell walls, releasing oil such that it combines with other ingredients in the mixture. However, at least some algal cells often survive cooking intact. Alternatively, food products can be used without cooking. In this case, the algal wall remains intact, protecting the oil from oxidation.
- The algal biomass, if provided in a form with cells predominantly intact, or as a homogenate powder, differs from oil, fat or eggs in that it can be provided as a dry ingredient, facilitating mixing with other dry ingredients, such as flour. In one case the algal biomass is provided as a dry homogenate that contains between 25 and 40% oil by dry weight. A biomass homogenate can also be provided as slurry. After mixing of dry ingredients (and biomass homogenate slurry, if used), liquids such as water can be added. In some food products, the amount of liquid required is somewhat higher than in a conventional food product because of the non-oil component of the biomass and/or because water is not being supplied by other ingredients, such as eggs. However, the amount of water can readily be determined as in conventional cooking.
- In one aspect, the present invention is directed to a food ingredient composition comprising at least 0.5% w/w Chlorella protothecoides microalgal biomass containing at least 10% algal oil by dry weight and at least one other edible ingredient, in which the food ingredient can be converted into a reconstituted food product by addition of a liquid to the food ingredient composition. In one embodiment, the liquid is water.
- Homogenized or micronized high-oil biomass is particularly advantageous in liquid,and/or emulsified food products (water in oil and oil in water emulsions), such as sauces, soups, drinks, salad dressings, butters, spreads and the like in which oil contributed by the biomass forms an emulsion with other liquids. Products that benefit from improved rheology, such as dressings, sauces and spreads are described below in the Examples. Using homogenized biomass an emulsion with desired texture (e.g., mouth-feel), taste and appearance (e.g., opacity) can form at a lower oil content (by weight or volume of overall product) than is the case with conventional products employing conventional oils, thus can be used as a fat extender. Such is useful for low-calorie (i.e., diet) products. Purified algal oil is also advantageous for such liquid and/or emulsified products. Both homogenized or micronized high-oil biomass and purified algal oil combine well with other edible ingredients in baked goods achieving similar or better taste, appearance and texture to otherwise similar products made with conventional oils, fats and/or eggs but with improved nutritional profile (e.g., higher content of monosaturated oil, and/or higher content or quality of protein, and/or higher content of fiber and/or other nutrients).
- Predominantly intact biomass is particularly useful in situations in which it is desired to change or increase the nutritional profile of a food (e.g., higher oil content, different oil content (e.g., more monounsaturated oil), higher protein content, higher calorie content, higher content of other nutrients). Such foods can be useful for example, for athletes or patients suffering from wasting disorders. Predominantly intact biomass can be used as a bulking agent. Bulking agents can be used, for example, to augment the amount of a more expensive food (e.g., meat helper and the like) or in simulated or imitation foods, such as vegetarian meat substitutes. Simulated or imitation foods differ from natural foods in that the flavor and bulk are usually provided by different sources. For example, flavors of natural foods, such as meat, can be imparted into a bulking agent holding the flavor. Predominantly intact biomass can be used as a bulking agent in such foods. Predominantly intact biomass is also particularly useful in dried food, such as pasta because it has good water binding properties, and can thus facilitate rehydration of such foods. Predominantly intact biomass is also useful as a preservative, for example, in baked goods. The predominantly intact biomass can improve water retention and thus shelf-life.
- Algal biomass that has been disrupted or micronized can also improve water retention and thus shelf-life. Increased moisture retention is especially desirable in gluten-free products, such as gluten-free baked goods. A detailed description of formulation of a gluten-free cookie using disrupted algal biomass and subsequent shelf-life study is described in the Examples below.
- In some cases, the algal biomass can be used in egg preparations. In some cases, algal biomass (e.g., algal flour) added to a conventional dry powder egg preparation to create scrambled eggs that are creamier, have more moisture and a better texture than dry powdered eggs prepared without the algal biomass. In other cases, algal biomass is added to whole liquid eggs in order to improve the overall texture and moisture of eggs that are prepared and then held on a steam table. Specific examples of the foregoing preparations are described in the Examples below.
- Algal biomass (predominantly intact and/or homogenized or micronized) and/or algal oil can be incorporated into virtually any food composition. Some examples include baked goods, such as cakes, brownies, yellow cake, bread including brioche, cookies including sugar cookies, biscuits, and pies. Other examples include products often provided in dried form, such as pastas or powdered dressing, dried creamers, commuted meats and meat substitutes. Incorporation of predominantly intact biomass into such products as a binding and/or bulking agent can improve hydration and increase yield due to the water binding capacity of predominantly intact biomass. Re-hydrated foods, such as scrambled eggs made from dried powdered eggs, may also have improved texture and nutritional profile. Other examples include liquid food products, such as sauces, soups, dressings (ready to eat), creamers, milk drinks, juice drinks, smoothies, creamers. Other liquid food products include nutritional beverages that serve as a meal replacement or algal milk. Other food products include butters or cheeses and the like including shortening, margarine/spreads, nut butters, and cheese products, such as nacho sauce. Other food products include energy bars, chocolate confections-lecithin replacement, meal replacement bars, granola bar-type products. Another type of food product is batters and coatings. By providing a layer of oil surrounding a food, predominantly intact biomass or a homogenate repel additional oil from a cooking medium from penetrating a food. Thus, the food can retain the benefits of high monounsaturated oil content of coating without picking up less desirable oils (e.g., trans fats, saturated fats, and by products from the cooking oil). The coating of biomass can also provide a desirable (e.g., crunchy) texture to the food and a cleaner flavor due to less absorption of cooking oil and its byproducts.
- In uncooked foods, most algal cells in the biomass remain intact. This has the advantage of protecting the algal oil from oxidation, which confers a long shelf-life and minimizes adverse interaction with other ingredients. Depending on the nature of the food products, the protection conferred by the cells may reduce or avoid the need for refrigeration, vacuum packaging or the like. Retaining cells intact also prevents direct contact between the oil and the mouth of a consumer, which reduces the oily or fatty sensation that may be undesirable. In food products in which oil is used more as nutritional supplement, such can be an advantage in improving the organoleptic properties of the product. Thus, predominantly intact biomass is suitable for use in such products. However, in uncooked products, such as a salad dressing, in which oil imparts a desired mouth feeling (e.g., as an emulsion with an aqueous solution such as vinegar), use of purified algal oil or micronized biomass is preferred. In cooked foods, some algal cells of original intact biomass may be lysed but other algal cells may remain intact. The ratio of lysed to intact cells depends on the temperature and duration of the cooking process. In cooked foods in which dispersion of oil in a uniform way with other ingredients is desired for taste, texture and/or appearance (e.g., baked goods), use of micronized biomass or purified algal oil is preferred. In cooked foods, in which algal biomass is used to supply oil and/or protein and other nutrients, primarily for their nutritional or caloric value rather than texture.
- Algal biomass can also be useful in increasing the satiety index of a food product (e.g., a meal-replacement drink or smoothie) relative to an otherwise similar conventional product made without the algal biomass. The satiety index is a measure of the extent to which the same number of calories of different foods satisfy appetite. Such an index can be measured by feeding a food being tested and measuring appetite for other foods at a fixed interval thereafter. The less appetite for other foods thereafter, the higher the satiety index. Values of satiety index can be expressed on a scale in which white bread is assigned a value of 100. Foods with a higher satiety index are useful for dieting. Although not dependent on an understanding of mechanism, algal biomass is believed to increase the satiety index of a food by increasing the protein and/or fiber content of the food for a given amount of calories.
- Algal biomass (predominantly intact and homogenized or micronized) and/or algal oil can also be manufactured into nutritional or dietary supplements. For example, algal oil can be encapsulated into digestible capsules in a manner similar to fish oil. Such capsules can be packaged in a bottle and taken on a daily basis (e.g., 1-4 capsules or tablets per day). A capsule can contain a unit dose of algal biomass or algal oil. Likewise, biomass can be optionally compressed with pharmaceutical or other excipients into tablets. The tablets can be packaged, for example, in a bottle or blister pack, and taken daily at a dose of, e.g., 1-4 tablets per day. In some cases, the tablet or other dosage formulation comprises a unit dose of biomass or algal oil. Manufacturing of capsule and tablet products and other supplements is preferably performed under GMP conditions appropriate for nutritional supplements as codified at 21 C.F.R. 111, or comparable regulations established by foreign jurisdictions. The algal biomass can be mixed with other powders and be presented in sachets as a ready-to-mix material (e.g., with water, juice, milk or other liquids). The algal biomass can also be mixed into products such as yogurts.
- Although algal biomass and/or algal oil can be incorporated into nutritional supplements, the functional food products discussed above have distinctions from typical nutritional supplements, which are in the form of pills, capsules, or powders. The serving size of such food products is typically much larger than a nutritional supplement both in terms of weight and in terms of calories supplied. For example, food products often have a weight of over 100g and/or supply at least 100 calories when packaged or consumed at one time. Typically food products contain at least one ingredient that is either a protein, a carbohydrate or a liquid and often contain two or three such other ingredients. The protein or carbohydrate in a food product often supplies at least 30%, 50%, or 60% of the calories of the food product.
- As discussed above, algal biomass can be made by a manufacturer and sold to a consumer, such as a restaurant or individual, for use in a commercial setting or in the home. Such algal biomass is preferably manufactured and packaged under Good Manufacturing Practice (GMP) conditions for food products. The algal biomass in predominantly intact form or homogenized or micronized form as a powder is often packaged dry in an airtight container, such as a sealed bag. Homogenized or micronized biomass in slurry form can be conveniently packaged in a tub among other containers. Optionally, the algal biomass can be packaged under vacuum to enhance shelf life. Refrigeration of packaged algal biomass is not required. The packaged algal biomass can contain instructions for use including directions for how much of the algal biomass to use to replace a given amount of oil, fat or eggs in a conventional recipe, as discussed above. For simplicity, the directions can state that oil or fat are to be replaced on a 2:1 ratio by mass or volume of biomass, and eggs on a ratio of 11g biomass or 1 teaspoon of algal oil per egg. As discussed above, other ratios are possible, for example, using a ratio of 10-175% mass or volume of biomass to mass or volume of oil and/or fat and/or eggs in a conventional recipe. Upon opening a sealed package, the instructions may direct the user to keep the algal biomass in an airtight container, such as those widely commercially available (e.g., Glad), optionally with refrigeration.
- Algal biomass (predominantly intact or homogenized or micronized powder) can also be packaged in a form combined with other dry ingredients (e.g., sugar, flour, dry fruits, flavorings) and portioned packed to ensure uniformity in the final product. The mixture can then be converted into a food product by a consumer or food service company simply by adding a liquid, such as water or milk, and optionally mixing, and/or cooking without adding oils or fats. In some cases, the liquid is added to reconstitute a dried algal biomass composition. Cooking can optionally be performed using a microwave oven, convection oven, conventional oven, or on a cooktop. Such mixtures can be used for making cakes, breads, pancakes, waffles, drinks, sauces and the like. Such mixtures have advantages of convenience for the consumer as well as long shelf life without refrigeration. Such mixtures are typically packaged in a sealed container bearing instructions for adding liquid to convert the mixture into a food product.
- Algal oil for use as a food ingredient is likewise preferably manufactured and packaged under GMP conditions for a food. The algal oil is typically packaged in a bottle or other container in a similar fashion to conventionally used oils. The container can include an affixed label with directions for using the oil in replacement of conventional oils, fats or eggs in food products, and as a cooking oil. When packaged in a sealed container, the oil has a long shelf-life (at least one year) without substantial deterioration. After opening, algal oil comprised primarily of monounsaturated oils is not acutely sensitive to oxidation. However, unused portions of the oil can be kept longer and with less oxidation if kept cold and/or out of direct sunlight (e.g., within an enclosed space, such as a cupboard). The directions included with the oil can contain such preferred storage information.
- Optionally, the algal biomass and/or the algal oil may contain a food approved preservative/antioxidant to maximize shelf-life, including but not limited to, carotenoids (e.g., astaxanthin, lutein, zeaxanthin, alpha-carotene, beta-carotene and lycopene), phospholipids (e.g., N-acylphosphatidylethanolamine, phosphatidic acid, phosphatidylethanolamine, phosphatidylcholine, phosphatidylinositol and lysophosphatidylcholine), tocopherols (e.g., alpha tocopherol, beta tocopherol, gamma tocopherol and delta tocopherol), tocotrienols (e.g., alpha tocotrienol, beta tocotrienol, gamma tocotrienol and delta tocotrienol), Butylated hydroxytoluene, Butylated hydroxyanisole, polyphenols, rosmarinic acid, propyl gallate, ascorbic acid, sodium ascorbate, sorbic acid, benzoic acid, methyl parabens, levulinic acid, anisic acid, acetic acid, citric acid, and bioflavonoids.
- The description of incorporation of predominantly intact biomass, homogenized, or micronized biomass (slurry, flake, powder, or flour) or algal oil into food for human nutrition is in general also applicable to food products for non-human animals.
- The biomass imparts high quality oil or proteins or both in such foods. The content of algal oil is preferably at least 10 or 20% by weight as is the content of algal protein. Obtaining at least some of the algal oil and/or protein from predominantly intact biomass is sometimes advantageous for food for high performance animals, such as sport dogs or horses. Predominantly intact biomass is also useful as a preservative. Algal biomass or oil is combined with other ingredients typically found in animal foods (e.g., a meat, meat flavor, fatty acid, vegetable, fruit, starch, vitamin, mineral, antioxidant, probiotic) and any combination thereof. Such foods are also suitable for companion animals, particularly those having an active life style. Inclusion of taurine is recommended for cat foods. As with conventional animal foods, the food can be provided in bite-size particles appropriate for the intended animal.
- Delipidated meal is useful as animal feed for farm animals, e.g., ruminants, poultry, swine, and aquaculture. Delipidated meal is a byproduct of preparing purified algal oil either for food or other purposes. The resulting meal although of reduced oil content still contains high quality proteins, carbohydrates, fiber, ash and other nutrients appropriate for an animal feed. Because the cells are predominantly lysed, delipidated meal is easily digestible by such animals. Delipidated meal can optionally be combined with other ingredients, such as grain, in an animal feed. Because delipidated meal has a powdery consistency, it can be pressed into pellets using an extruder or expanders, which are commercially available.
- The following examples are offered to illustrate, but not to limit, the claimed invention.
- Microalgae strains were cultivated in shake flasks with a goal to achieve over 20% of oil by dry cell weight. The flask media used was as follows: K2HPO4: 4.2 g/L, NaH2PO4: 3.1g/L, MgSO4·7H2O: 0.24g/L, Citric Acid monohydrate: 0.25g/L, CaCl2 2H2O: 0.025g/L, yeast extract: 2g/L, and 2% glucose. Cryopreserved cells were thawed at room temperature and 500 ul of cells were added to 4.5 ml of medium and grown for 7 days at 28°C with agitation (200 rpm) in a 6-well plate. Dry cell weights were determined by centrifuging 1 ml of culture at 14,000 rpm for 5 min in a pre-weighed Eppendorf tube. The culture supernatant was discarded and the resulting cell pellet washed with 1 ml of deionized water. The culture was again centrifuged, the supernatant discarded, and the cell pellets placed at -80°C until frozen. Samples were then lyophyllized for 24 hrs and dry cell weights calculated. For determination of total lipid in cultures, 3 ml of culture was removed and subjected to analysis using an Ankom system (Ankom Inc., Macedon, NY) according to the manufacturer's protocol. Samples were subjected to solvent extraction with an Amkom XT10 extractor according to the manufacturer's protocol. Total lipid was determined as the difference in mass between acid hydrolyzed dried samples and solvent extracted, dried samples. Percent oil dry cell weight measurements are shown in Table 1.
Table 1. Percent oil by dry cell weight Species Strain % oil Figure 1 strain #Chlorella protothecoides UTEX 250 34.24 1 Chlorella protothecoides UTEX 25 40.00 2 Chlorella protothecoides CCAP 211/8D 47.56 3 Chlorella kessleri UTEX 397 39.42 4 Chlorella kessleri UTEX 2229 54.07 5 Chlorella kessleri UTEX 398 41.67 6 Parachlorella kessleri SAG 11.80 37.78 7 Parachlorella kessleri SAG 14.82 50.70 8 Parachlorella kessleri SAG 21.11 H9 37.92 9 Prototheca stagnora UTEX 327 13.14 10 Prototheca moriformis UTEX 1441 18.02 11 Prototheca moriformis UTEX 1435 27.17 12 Chlorella minutissima UTEX 2341 31.39 13 Chlorella sp. UTEX 2068 45.32 14 Chlorella sp. CCAP 211/92 46.51 15 Chlorella sorokiniana SAG 211.40B 46.67 16 Parachlorella beijerinkii SAG 2046 30.98 17 Chlorella luteoviridis SAG 2203 37.88 18 Chlorella vulgaris CCAP 211/11K 35.85 19 Chlorella reisiglii CCAP 11/8 31.17 20 Chlorella ellipsoidea CCAP 211/42 32.93 21 Chlorella saccharophila CCAP 211/31 34.84 22 Chlorella saccharophila CCAP 211/32 30.51 23 - Three fermentation processes were performed with three different media formulations with the goal of generating algal biomass with high oil content. The first formulation (Media 1) was based on medium described in Wu et al. (1994 Science in China, vol. 37, No. 3, pp. 326-335) and consisted of per liter: KH2PO4, 0.7g; K2HPO4, 0.3g; MgSO4-7H2O, 0.3g; FeSO4-7H2O, 3mg; thiamine hydrochloride, 10 µg; glucose, 20g; glycine, 0.1g; H3BO3, 2.9mg; MnCl2-4H2O, 1.8mg; ZnSO4-7H2O, 220µg; CuSO4-5H2O, 80µg; and NaMoO4-2H2O, 22.9mg. The second medium (Media 2) was derived from the flask media described in Example 1 and consisted of per liter: K2HPO4, 4.2g; NaH2PO4, 3.1g; MgSO4-7H2O, 0.24g; citric acid monohydrate, 0.25g; calcium chloride dehydrate, 25mg; glucose, 20g; yeast extract, 2g. The third medium (Media 3) was a hybrid and consisted of per liter: K2HPO4, 4.2g; NaH2PO4, 3.1g; MgSO4-7H2O, 0.24g; citric acid monohydrate, 0.25g; calcium chloride dehydrate, 25mg; glucose, 20g; yeast extract, 2g; H3BO3, 2.9mg; MnCl2-4H2O, 1.8 mg; ZnSO4-7H2O, 220µg; CuSO4-5H2O, 80µg; and NaMoO4-2H2O, 22.9mg. All three media formulations were prepared and autoclave sterilized in lab scale fermentor vessels for 30 minutes at 121°C. Sterile glucose was added to each vessel following cool down post autoclave sterilization.
- Inoculum for each fermentor was Chlorella protothecoides (UTEX 250), prepared in two flask stages using the medium and temperature conditions of the fermentor inoculated. Each fermentor was inoculated with 10% (v/v) mid-log culture. The three lab scale fermentors were held at 28°C for the duration of the experiment. The microalgal cell growth in
Media 1 was also evaluated at a temperature of 23°C. For all fermentor evaluations, pH was maintained at 6.6-6.8, agitations at 500rpm, and airflow at 1 vvm. Fermentation cultures were cultivated for 11 days. Biomass accumulation was measured by optical density at 750 nm and dry cell weight. - Lipid/oil concentration was determined using direct transesterification with standard gas chromatography methods. Briefly, samples of fermentation broth with biomass was blotted onto blotting paper and transferred to centrifuge tubes and dried in a vacuum oven at 65-70°C for 1 hour. When the samples were dried, 2mL of 5% H2SO4 in methanol was added to the tubes. The tubes were then heated on a heat block at 65-70°C for 3.5hours, while being vortexed and sonicated intermittently. 2ml of heptane was then added and the tubes were shaken vigorously. 2M1 of 6% K2CO3 was added and the tubes were shaken vigorously to mix and then centrifuged at 800rpm for 2 minutes. The supernatant was then transferred to GC vials containing Na2SO4 drying agent and ran using standard gas chromatography methods. Percent oil/lipid was based on a dry cell weight basis. The dry cell weights for cells grown using:
Media 1 at 23°C was 9.4g/L;Media 1 at 28°C was 1.0g/L,Media 2 at 28°C was 21.2g/L; andMedia 3 at 28°C was 21.5g/L. The lipid/oil concentration for cells grown using:Media 1 at 23°C was 3g/L;Media 1 at 28°C was 0.4g/L;Media 2 at 28°C was 18 g/L; andMedia 3 at 28°C was 19g/L. The percent oil based on dry cell weight for cells grown using:Media 1 at 23°C was 32%;Media 1 at 28°C was 40%;Media 2 at 28°C was 85%; andMedia 3 at 28°C was 88%. The lipid profiles (in area %, after normalizing to the internal standard) for algal biomass generated using the three different media formulations at 28°C are summarized below in Table 2.Table 2. Lipid profiles for Chlorella protothecoides grown under different media conditions. Media 1 28°C (in Area %)Media 2 28°C (in Area %)Media 3 28°C (in Area %)C14:0 1.40 0.85 0.72 C16:0 8.71 7.75 7.43 C16:1 -- 0.18 0.17 C17:0 -- 0.16 0.15 C17:1 -- 0.15 0.15 C18:0 3.77 3.66 4.25 C18:1 73.39 72.72 73.83 C18:2 11.23 12.82 11.41 C18:3 alpha 1.50 0.90 1.02 C20:0 -- 0.33 0.37 C20:1 -- 0.10 0.39 C20:1 -- 0.25 -- C22:0 -- 0.13 0.11 - Microalgal biomass is generated by culturing microalgae as described in any one of Examples 1-2. The microalgal biomass is harvested from the fermentor, flask, or other bioreactor.
- GMP procedures are followed. Any person who, by medical examination or supervisory observation, is shown to have, or appears to have, an illness, open lesion, including boils, sores, or infected wounds, or any other abnormal source of microbial contamination by which there is a reasonable possibility of food, food-contact surfaces, or food packaging materials becoming contaminated, is to be excluded from any operations which may be expected to result in such contamination until the condition is corrected. Personnel are instructed to report such health conditions to their supervisors. All persons working in direct contact with the microalgal biomass, biomass-contact surfaces, and biomass-packaging materials conform to hygienic practices while on duty to the extent necessary to protect against contamination of the microalgal biomass. The methods for maintaining cleanliness include, but are not limited to: (1) Wearing outer garments suitable to the operation in a manner that protects against the contamination of biomass, biomass-contact surfaces, or biomass packaging materials. (2) Maintaining adequate personal cleanliness. (3) Washing hands thoroughly (and sanitizing if necessary to protect against contamination with undesirable microorganisms) in an adequate hand-washing facility before starting work, after each absence from the work station, and at any other time when the hands may have become soiled or contaminated. (4) Removing all unsecured jewelry and other objects that might fall into biomass, equipment, or containers, and removing hand jewelry that cannot be adequately sanitized during periods in which biomass is manipulated by hand. If such hand jewelry cannot be removed, it may be covered by material which can be maintained in an intact, clean, and sanitary condition and which effectively protects against the contamination by these objects of the biomass, biomass-contact surfaces, or biomass-packaging materials. (5) Maintaining gloves, if they are used in biomass handling, in an intact, clean, and sanitary condition. The gloves should be of an impermeable material. (6) Wearing, where appropriate, in an effective manner, hair nets, headbands, caps, beard covers, or other effective hair restraints. (7) Storing clothing or other personal belongings in areas other than where biomass is exposed or where equipment or utensils are washed. (8) Confining the following to areas other than where biomass may be exposed or where equipment or utensils are washed: eating biomass, chewing gum, drinking beverages, or using tobacco. (9) Taking any other necessary precautions to protect against contamination of biomass, biomass-contact surfaces, or biomass-packaging materials with microorganisms or foreign substances including, but not limited to, perspiration, hair, cosmetics, tobacco, chemicals, and medicines applied to the skin. The microalgal biomass can optionally be subjected to a cell disruption procedure to generate a lysate and/or optionally dried to form a microalgal biomass composition.
- Chlorella protothecoides (UTEX 250) biomass was produced using 5,000L fermentation tanks using processes described in Examples 2 and 3. Glucose (corn syrup) concentration was between was monitored throughout the run. When the glucose concentration was low, more glucose was added to the fermentation tank. After all nitrogen was consumed, the cells began accumulating lipid. Samples of biomass were taken throughout the run to monitor lipid levels and the run was stopped when the biomass reached the desired lipid content (over 40% lipid by dry cell weight). In this case, the biomass was harvested when it reached approximately 50% lipid by dry cell weight.
- To process the microaglal biomass into algal flakes, the harvested Chlorella protothecoides biomass was separated from the culture medium using centrifugation and dried on a drum dryer using standard methods at approximately 150-170°C.. The resulting drum-dried Chlorella protothecoides biomass with approximately 50% lipid by dry cell weight (high lipid) was packaged and stored for use as algal flakes.
- A sample of Chlorella protothecoides (UTEX 250) biomass was grown and prepared using the methods described in Example 4. The dried biomass was analyzed using liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) analysis for the presence of contaminating algal and cyanobacterial toxins. The analyses covered all groups of algal and cyanobacterial toxins published in the literature and mentioned in international food regulations. The results show that the biomass sample did not contain any detectable levels of any of the algal or cyanobacterial toxins that were tested. The results are summarized in Table 3.
Table 3. LC-MS/MS analytical results for algal and cyanobacterial toxins. Toxin Category Toxin Result Limit of detection (LC/MS) Amnesic Shellfish Poisoning (ASP) Toxins Domoic Acid Not detectable 1 µg/g Diarrhetic Shellfish Poisoning (DSP) Toxins Okadaic acid and Dinophysistoxins Not detectable 0.1 µg/g Pectenotoxins Not detectable 0.1 µg/g Yessotoxins Not detectable 0.1 µg/g Azaspiracides Not detectable 0.1 µg/g Gymnodimines Not detectable 0.1 µg/g Paralytic Shellfish Poisoning (PSP) Toxins Saxitoxin Not detectable (HPLC/FD) 0.3 µg/g Neosaxitoxin Not detectable (HPLC/FD) 0.3 µg/g Decarbamoylsaxitoxin Not detectable (HPLC/FD) ) 0.3 µg/g Gonyautoxins Not detectable (HPLC/FD) 0.3 µg/g Neurotoxic Shellfish Poisoning (NSP) Toxins Brevetoxins Not detectable 0.1 µg/g Cyanobacterial toxins Microsystins MC-RR, MC-LR, MC-YR, MC-LA, MC-LW and MC-LF Not detectable 0.1 µg/g Nodularin Not detectable 0.1 µg/g Anatoxin-a Not detectable 0.5 µg/g Cylindrospermopsins Not detectable 0.2 µg/g Beta-Methylamino-L-Alanine Not detectable 2.5 µg/g - Proximate analysis was performed on samples of dried Chlorella protothecoides (UTEX 250) biomass grown and prepared using the methods described in Example 4 and Example 17 in accordance with Official Methods of ACOC International (AOAC Method 991.43). Acid hydrolysis for total fat content (lipid/oil) was performed on both samples and the fat content for the high lipid algal biomass was approximately 50% and for high protein algal biomass was approximately 15%. The crude fiber content was 2% for both high lipid and high protein algal biomass. The moisture (determined gravimetrically) was 5% for both high lipid and high protein algal biomass. The ash content, determined by crucible burning and analysis of the inorganic ash, was 2% for the high lipid algal biomass and 4% for the high protein biomass. The crude protein, determined by the amount of nitrogen released from burning each biomass, was 5% for the high lipid biomass and 50% for the high protein biomass. Carbohydrate content was calculated by difference, taking the above known values for fat, crude fiber, moisture, ash and crude protein and subtracting that total from 100. The calculated carbohydrate content for the high lipid biomass was 36% and the carbohydrate content for the high protein biomass as 24%.
- Further analysis of the carbohydrate content of both algal biomass showed approximately 4-8% (w/w) free sugars (predominantly sucrose) in the samples. Multiple lots of high lipid-containing algal biomass were tested for free sugars (assays for fructose, glucose, sucrose maltose and lactose) and the amount of sucrose ranged from 2.83%-to 5.77%; maltose ranged from undected to 0.6%; and glucose ranged from undetected to 0.6%. The other sugars, namely fructose, maltose and lactose, were undetected in any of the assayed lots. Multiple lots of high protein-containing algal biomass were also tested for free sugars and only sucrose was detected in any of the lots at a range of 6.93% to 7.95%.
- The analysis of the total dietary fiber content (within the carbohydrate fraction of the algal biomass) of both algal biomass was performed using methods in accordance with Offical Methods of ACOC International (AOAC Method 991.43). The high lipid biomass contained 19.58% soluble fiber and 9.86% insoluble fiber, for a total dietary fiber of 29.44%. The high protein biomass contained 10.31% soluble fiber and 4.28% insoluble fiber, for a total dietary fiber of 14.59%.
- A sample of dried Chlorella protothecoides (UTEX 250) biomass with approximately 50% lipid by dry cell weight, grown and prepared using the methods described in Example 4 was analyzed for amino acid content in accordance with Official Methods of AOAC International (tryptophan analysis: AOAC method 988.15; methionine and cystine analysis: AOAC method 985.28 and the other amino acids: AOAC method 994.12). The amino acid profile from the dried algal biomass (expressed in percentage of total protein) was compared to the amino acid profile of dried whole egg (profile from product specification sheet for Whole Egg, Protein Factory Inc., New Jersey), and the results show that the two sources have comparable protein nutritional values. Results of the relative amino acid profile (to total protein) of a sample of Chlorella protothecoides show the biomass contains methionine (2.25%), cysteine (1.69%), lysine (4.87%), phenylalanine (4.31%), leucine (8.43%), isoleucine (3.93%), threonine (5.62%), valine (6.37%), histidine (2.06%), arginine (6.74%), glycine (5.99%), aspartic acid (9.55%), serine (6.18%), glutamic acid (12.73%), praline (4.49%) hydroxyproline (1.69%), alanine (10.11%), tyrosine (1.87%), and tryptophan (1.12%). The comparison of the algal biomass and whole egg amino acid profiles are shown in
Figure 2 . - A sample of algal biomass produced using methods described in Example 4 was analyzed for tocotrienol and tocopherol content using normal phase HPLC, AOCS Method Ce 8-89. The tocotrienol and tocopherol-containing fraction of the biomass was extracted using hexane or another non-polar solvent. The complete tocotrienol and tocopherol composition results are summarized in Table 4.
Table 4. Tocotrienol and tocopherol content in algal biomass. Tocotrienol and tocopherol composition of Chlorella protothecoides UTEX 250 Tocopherols Alpha tocopherol 6.29 mg/100g Delta tocopherol 0.47 mg/100g Gamma tocopherol 0.54 mg/100g Total tocopherols 7.3 mg/100g Tocotrienols Alpha tocotrienol 0.13 mg/ g Beta tocotrienol 0 Gamma tocotrienol 0.09 mg/g Delta tocotrienol 0 Total tocotrienols 0.22 mg/g - The carotenoid-containing fraction of the biomass was isolated and analyized fpr carotenoids using HPLC methods. The carotenoid-containing fraction was prepared by mixing lyophilized algal biomass (produced using methods described in Example 3) with silicon carbide in an aluminum mortar and ground four times for 1 minute each time, with a mortar and pestle. The ground biomass and silicon mixture was then rinsed with tetrahydrofuran (THF) and the supernatant was collected. Extraction of the biomass was repeated until the supernatant was colorless and the THF supernatant from all of the extractions were pooled and analyzed for carotenoid content using standard HPLC methods. The carotenoid content for algal biomass that was dried using a drum dryer was also analyzed using the methods described above.
- The carotenoid content of freeze dried algal biomass was: total lutein (66.9-68.9mcg/g: with cis-lutein ranging from 12.4-12.7mcg/g and trans-lutein ranging from 54.5-56.2mcg/g); trans-zeaxanthin (31.427-33.451mcg/g); cis-zeaxanthin (1.201-1.315mcg/g); t-alpha cryptoxanthin (3.092-3.773mcg/g); t-beta cryptoxanthin (1.061-1.354mcg/g); 15-cis-beta carotene (0.625-.0675mcg/g); 13-cis-beta carotene (.0269-.0376mcg/g); t-alpha carotene (0.269-.0376mcg/g); c-alpha carotene (0.043-.010mcg/g); t-beta carotene (0.664-0.741mcg/g); and 9-cis-beta carotene (0.241-0.263mcg/g). The total reported carotenoids ranged from 105.819mcg/g to 110.815mcg/g.
- The carotenoid content of the drum-dried algal biomass was significantly lower: total lutein (0.709mcg/g: with trans-lutein being 0.091mcg/g and cis-lutein being 0.618mcg/g); trans-zeaxanthin (0.252mcg/g); cis-zeaxanthin (0.037mcg/g); alpha-cryptoxanthin (0.010mcg/g); beta-cryptoxanthin (0.010mcg/g) and t-beta-carotene (0.008mcg/g). The total reported carotenoids were 1.03mcg/g. These data suggest that the method used for drying the algal biomass can significantly affect the carotenoid content.
- Phospholipid analysis was also performed on the algal biomasss. The phospholipid containing fraction was extracted using the Folch extraction method (chloroform, methanol and water mixture) and the oil sample was analyzed using AOCS Official Method Ja 7b-91, HPLC determination of hydrolysed lecithins (International Lecithin and Phopholipid Society 1999), and HPLC analysis of phospholipids with light scatting detection (International Lecithin and Phospholipid Society 1995) methods for phospholipid content. The total phospholipids by percent w/w was 1.18%. The phospholipid profile of algal oil was phosphatidylcholine (62.7%), phosphatidylethanolamine (24.5%), lysophosphatidiylcholine (1.7%) and phosphatidylinositol (11%). Similar analysis using hexane extraction of the phospholipid-containing fraction from the algal biomass was also performed. The total phospholipids by percent w/w was 0.5%. The phospholipid profile was phosphatidylethanolamine (44%), phosphatidylcholine (42%) and phosphatidylinositol (14%).
- The ingredients of the cardio/metabolic health bar consisted of quick oats (30.725%), crisp rice (9.855%), fine granular sugar (sucrose) (14.590%), light brown sugar (6.080%), salt (0.550%), canola oil (10.940%), corn syrup 42 DE (7.700%), honey (3.650%), water (7.700%), lecithin (0.180%), baking soda (0.180%), dried algal biomass (Chlorella protothecoides UTEX 250, 48% lipid) (1.540%), corowise plant sterol (1.060%), inulin (soluble fiber) (4.280%), and psyllium (insoluble fiber) (0.970%).
- Instructions: (1) Preheat oven at 325 degrees Fahrenheit with convection. (2) Weigh out the first 5 ingredients in a bowl. (3) Mix water, lecithin and baking soda in a Hobart mixer. (4) Mix together honey, corn syrup and canola oil; heat in microwave for 30-40 seconds. Hand mix with a spatula and pour the mixture into the Hobart mixer. (5) Add desired standard food flavor. (6) Add the dry nutraceuticals (algal biomass, plant sterol, fiber) into the Hobart mixer. (7) Add the remaining dry ingredients. (8) Form and bake at 325 degrees Farenheit for 20-25 minutes with convection.
- The ingredients of the orange flavored cardio shot consisted of distilled water (869.858 g), sodium benzoate (0.100 g), Ticaloid 5415 powder (1.000 g), evaporated cane juice sugar (88.500 g), dried algal biomass (over 40% oil) (16.930 g), fibersol - 2 ADM (47.000 g), corowise ES-200 plant sterol (18.300 g), granular citric acid (1.312 g), orange extract (WONF, Flavor 884.0062U) (1.000 g). The ingredients were combined and blended until smooth.
- The ingredients of the fruit-based smoothie consisted of distilled water (815.365g), stabilizer (4.5g), apple juice concentrate (58g), orange juice concentrate (46.376g), lemon juice concentrate (1.913g), mango puree concentrate (42.5g), banana puree (40.656g), passionfruit juice concentrate (8.4g), ascorbic acid (0.320g), algal flakes (46.41g), orange flavor extract (1g), pineapple flavor (0.4g) and mango flavor (0.16g). The ingredients were combined and blended until smooth.
- The ingredients of the metabolic health tablet (1.25-1.75 g size) consisted of Chlorella protothecoides dried microalgae biomass (UTEX 250, over 40% lipid dry cell weight) (1000 mg/tablet), betatene beta carotene (
beta carotene 20% from Dunaliella) (15 mg/tablet), vitamin C as ascorbic acid (100 mg/tablet), and bioperine (piper nigrem bioavailability enhancer) (2.5 mg/tablet). - The ingredients of the algae snack chips consisted of unbleached white flour (1 cup), potato flour (1/2 cup), algal biomass (over 40% lipid dry cell weight) (3 tablespoons), salt (3/4 teaspoon, adjust to taste), barley flour (2 tablespoons), water (1/3 - 1 cup), and seasonings (e.g., cumin, curry, ranch dressing) (to taste).
- Preparation procedure: The dry ingredients were mixed and 1/3 cup of water was added to the dry ingredients. Additional water was added (up to 1 cup total) to form dough. The dough was kneaded into a uniformed product and then was allowed to rest for 30 minutes at room temperature. The rested dough was cut and formed into thin chips and baked at 275°F for 20-30 minutes, or until crispy.
- The ingredients of the algae raisin cookies consisted of butter or margarine (1/2 cup, conventional food recipe calls for 3/4 cup), barley flakes or oatmeal ( 1 3/4 cup), nutmeg (1/4 teaspoon), water or milk (2-3 tablespoons), brown sugar (1 cup), salt (1/2 teaspoon), baking powder (1/2 teaspoon), vanilla (1 teaspoon), cinnamon (1 teaspoon), raisins (optionally presoaked in brandy or orange juice) (3/4 cup), and dried algal biomass (over 30% oil) (1/3 cup). This recipe made about 2 dozen cookies.
- The conventional food recipe calls for 2 eggs and ¾ cup of butter or margarine. With the use of dried algal biomass, ¼ cup of butter or margarine and eggs are eliminated by substitution with algal biomass containing oil.
- Preparation procedure: Cream the butter and sugar. Beat until fairly fluffy. Add the vanilla. Combine the flour and barley flakes and algae. Combine the butter mixture with the flour-flakes mixture. Add the raisins. Drop by teaspoonfuls, and flatten, slightly. Bake about 9-10 minutes at 375 degrees F.
- The ingredients of the barley pasta with algae consisted of barley flour (3/4 cup), dried algal biomass with at least 20% lipid by dry cell weight (2 tablespoons), large egg (1), and salt (1/2 teaspoon).
- Preparation procedure: Place flour in bowl and add algae and salt. Whisk together. Add egg in middle (make a well), and gradually stir in flour. If difficult to stir in, add 1 tablespoon water, sprinkling it around. When all the flour has been incorporated, begin to knead the dough to make it more uniform. This should be done for 5- 8 minutes. When the dough is uniform, divide it into two small balls, and rub olive oil on the outside. Cover and let rest about 30 minutes. Flatten the dough, then roll it with a rolling pin to a thickness of about an eighth of an inch, for fettucine-like pasta. Slice the pasta into thin strips. Drop into boiling, salted water. Cook about 8-10 minutes. The pasta can be served with a small amount of grated parmesan cheese on top, and some cracked pepper.
- This example compares pasta made by a conventional recipe and a whole cell high-lipid biomass (Chlorella protothecoides (strain UTEX 250) with 48% lipid by dry cell weight) to replace the egg in the conventional recipe.
Table 5. Recipe for traditional pasta control. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Whole Egg (beaten) 1 55.67 24.97% 1.87% Salt, Table ½ tsp. 3.74 1.68% 0.00% Flour, All- purpose 1 cup 133.18 59.74% 0.00% Water 1-2 tbsp. 30.35 13.61% 0.00% Yield: 3 222.94 100.00% 1.87% Table 6. Recipe for whole cell algal biomass replacing the whole egg. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt Whole cell biomass 7.55 3.16% 1.52% Salt, Table ½ tsp. 3.61 1.51% 0.00% Flour, All- purpose 1 cup 146.28 61.25% 0.00% Water 81.37 34.07% 0.00% Yield: 3 238.81 100.00% 1.52% - In each case the cooking procedure was:
- 1. In a kitchen aid bowl using dough hook, combine flour and salt.
- 2. Lightly beat the egg. On a low speed (Speed #2), add the slightly beaten egg until forms a stiff dough.
- 3. If needed, stir in 1-2 Tbsp water.
- 4. Mix for 3-4 minutes, add a little extra flour if dough too sticky.
- 5. Portion dough into sheetable portions. Allow dough to rest 1 hour prior to sheeting.
- 6. Using a pasta sheeter, sheet dough to desired thickness.
- 7. Cut pasta into strips.
- 8. Place a pot of water on the stove to boil.
- 9. Cook pasta and toss with oil/butter to prevent sticking. Serve with sauce.
- The whole cell biomass pasta had similar texture and appearance to the conventional recipe. No prominent algal flavor was evident. The whole cell algal biomass improved yield in the dry pasta, most likely due to a water binding function. These observations are consistent with the idea that the whole cell algal biomass can act as a good bulking agent in dried or processed foods.
- Algal milk contains about 8% solids, which is comprised of 4% heart healthy lipids, 2.5% of essential amino acid-rich proteins, 1.5% carbohydrates and 0.5% fiber, and is fortified with vitamins A and D. Algal milk is extremely healthy; it is vegan, and can be used as a substitute for cow's milk and soy milk. Unlike cow's milk, it is very low in saturated fat, and unlike soy milk, the fat is primarily a mono-unsaturate (over 50% C18:1). The algal milk has a bland taste; not "beany" as in soy milk. Flavors can be added, such as strawberry or raspberry.
- The ingredients of the algal milk consisted of dried whole algal cells containing about 40% lipid (8%), vitamin D (200 units), vitamin A (200 units), xanthan gum (0.2%), and water (to 100%). The water was warmed the the xanthan gum was dispersed. The whole, dried algal cells were then dispersed in the warm xanthan gum solution and vitamins were added. The solution was then homogenized using a high pressure homogenizer and pasteurized. An additional formulation is included below using algal flour.
- High lipid containing Chlorella protothecoides grown using the methods and conditions described in Example 4 was processed into a high lipid algal homogenate. To process the microaglal biomass into an algal homogenate, the harvested Chlorella protothecoides biomass was first processed into algal flakes (see Example 4). The dried algal flakes were then rehydrated in deionized water at approximately 40% solids concentration. The resulting algal flake suspension was then micronized using a high pressure homogenizer (GEA model NS1001) operating at a pressure level of 1000-1200 Bar until the average particle size of the biomass was less than 10 µm. The resulting algal homogenate was packaged and stored until use.
- The following examples describe the use of high lipid (above 40% by weight) algal flakes or algal homogenate as a fat replacement in conventional and low-fat recipes. High lipid algal flakes were prepared using the methods described in Example 4. High lipid algal homogenate was prepared using the methods described in Example 8.
- This example compares chocolate brownies made using a conventional recipe, a low fat control recipie and with high lipid algal flakes (Chlorella protothecoides (strain UTEX 250) with 48% lipid by dry cell weight) replacing some of the fat in the conventional recipe.
-
Table 7. Recipe for the conventional chocolate brownie control. Component Recipe Measures Weight(g) Percent % Fat, Wet Wt, Butter 1 stick, 1/41b 114.00 19.05% 15.24 % Cocoa powder 1/4 cup 48.00 8.02% 0.80 % Whole Eggs 3 156.00 26.07% 1.96% Sugar, granulated 1 cup 140.92 23.55% 0.00% Flour, all- purpose 1 cup 130.40 21.79% 0.00 % Baking Powder 1 tsp. 3.97 0.66% 0.00 % Vanilla Extract 1 tsp. 5.07 0.85% 0.00% Yield: 1 pan 598.36 100.00% 18.00% -
Table 8. Recipe for the low fat control. Component Recipe Measures Weight(g) Percent % Fat, Wet Wt, Butter 0.00 0.00% 0.00 % Cocoa powder 1/4 cup 48.00 10.25% 1.03% Water 139.80 29.86% 0.00% Whole Eggs 0.00 0.00 0.00% 0.00% Sugar, granulated 1 cup 140.92 30.10% 0.00% Flour, all- purpose 1 cup 130.40 27.85% 0.00 % Baking Powder 1 tsp. 3.97 0.85% 0.00 % Vanilla Extract 1 tsp. 5.07 1.08% 0.00% Yield: 1 pan 468.16 100.00% 1.03% -
Table 9. Recipe for whole algal biomass brownies as replaced for butter and eggs. Component Recipe Measures Weight(g) Percent % Fat, Wet Wt, Whole cell biomass 73.00g 12.59% 6.5 % Cocoa powder 1/4 cup 24.00 4.14 % Water 3 148.00 25.52% Sugar, granulated 1 cup 183.00 31.55% Flour, all- purpose 1 cup 133.00 22.93 % Baking Powder 1 tsp. 4.00 0.69% Pecans, chopped 1 cup 0.00 0.00 % Vanilla Extract 1 tsp. 15.00 2.59% Yield: 1 pan 580.00 100.00% 6.5% - In each case, the cooking procedure was:
- 1. Preheat oven to 350°F. Grease and flour 8x8 baking pan.
- 2. In a small saucepan, melt butter with cocoa powder. Set aside to cool.
- 3. In a kitchen-aid bowl with paddle attachment, beat eggs until foamy. Gradually add in sugar.
- 4. Add room temp/sl warm butter/cocoa powder mixture to egg mixture.
- 5. Mix flour and baking powder together. Add 1/2 mixture slowly to batter.
- 6. Add pecans to remaining portion of flour. Add mixture to batter. Mix on low (Speed #2) until well blended. Add vanilla extract and mix.
- 7. Spread batter into pan. Bake for 20-25mins.
- 8. Cool brownies and ice if desired.
- The low fat control brownies (with the butter and eggs omitted) did not have the same crumb structure as compared to the brownies made with the algal flakes or the conventional brownies. The algal flakes brownies had a nice, visible crumb structure, but were a little denser and gummier than the full fat brownies. Overall, the brownies made with the algal flakes had about a 64% reduction in the fat content when compared to the conventional brownies.
- This example compares yellow cake made by a conventional recipe, a low fat recipe, high-lipid algal homogenate (HL-AH) to replace the eggs and butter in the conventional recipe, and high lipid algal flakes to replace the eggs in the conventional recipe. Both the algal homogenate and the algal flakes were from Chlorella protothecoides (strain UTEX 250) with 48% lipid by dry cell weight.
Table 10. Conventional yellow cake recipe. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Butter 1 cup 222.20 11.38% 9.11% Sugar, granulated 2 ½ cups 476.16 24.40% 0.00% Eggs, Whole 3 148.26 7.60% 0.57 % Vanilla Extract 1 ½ tsp. 6.50 0.33% 0.00% Buttermilk. 1 % MF 2 ½ cups 575.00 29.46% 0.29% Flour, All purpose 3 ¾ cups 502.96 25.77% 0.00 % Baking powder 2 ¼ tsp. 8.35 0.43% 0.00 % Baking soda 2 ½ tsp. 12.44 0.64% 0.00% Yield: 2 pans 1951.87 100.00% 9.97% Table 11. Recipe for the low fat negative control. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Butter 0.00 0.00 0.00% 0.00% Sugar, granulated 2 ½ cups 475.00 30.36% 0.00% Eggs, Whole 0.00 0.00 0.00% 0.00 % Vanilla Extract 1 ½ tsp. 6.50 0.42% 0.00% Buttermilk. 1 % MF 2 ½ cups 575.00 36.75% 0.37% Flour, All purpose 3 ¾ cups 487.69 31.17% 0.00 % Baking powder 2 ¼ tsp. 8.52 0.54% 0.00 % Baking soda 2 ½ tsp. 11.90 0.76% 0.00% Yield: 2 pans 1564.61 100.00% 0.37% Table 12. Recipe for micronized high lipid algal biomass as a replacement for egg and butter. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Butter 0.00 0.00 0.00 0.00 Sugar, granulated 2 ½ cups 457.00 22.98% Micronized HL-AH 100.00 5.03% 2.41% Water (as from egg, butter) + additional 308.47 15.51 % Vanilla Extract 1 ½ tsp. 20.00 1.01 % Buttermilk 2 ½ cups 575.00 28.92% Flour, All purpose 3 ¾ cups 505.00 25.40 % Baking powder 2 ¼ tsp. 9.80 0.49 % Baking soda 2 ½ tsp. 13.30 0.67% 1988.57 100.00% 2.41% Table 13. Recipe for high lipid algal flakes as egg replacer. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Butter 1 Cup 227.00 11.69% 9.35% Sugar, granulated 2 ½ cups 457.00 23.53% Algal flakes 22.50 1.16% 0.56% Water (as from egg) 112.50 5.79 % Vanilla Extract 1 ½ tsp. 20.00 1.03 % Buttermilk 2 ½ cups 575.00 29.61% Flour, All purpose 3 ¾ cups 505.00 26.00 % Baking powder 2 ¼ tsp. 9.80 0.50 % Baking soda 2 ½ tsp 13.30 0.68% Yield: 2 pans 1942.10 100.00% 9.91% - In each case the cooking procedure was:
- 1. Preheat oven to 350°F. Grease and flour two 9x13 in pans.
- 2. Sift together flour, baking powder and baking soda. Set aside.
- 3. In a kitchen aid bowl, cream butter and sugar together until light. Beat eggs in 1 at a time.
- 4. Add in vanilla extract.
- 5. Add flour mixture alternately with buttermilk to batter. Mix until just incorporated.
- 6. Pour batter into prepared pans.
- 7. Bake cakes for 35-40 minutes, or until toothpick comes out clean.
- 8. Cool.
- The yellow cake made with the high lipid algal flakes (as an egg replacer) was very dense, with almost no crumb structure. However, the yellow cake made with high lipid algal flakes was moist when compared to the low fat negative control, which was very dense and dry. The cake made with high lipid algal homogenate (HL-AH) (replacing all the butter and eggs in the full fat cake) was very moist and buttery in texture and had very good crumb structure that was similar to the conventional recipe cake. In tasting, the cake made with HL-AH lacked a buttery flavor that was present in the conventional cake.. Overall, the HL-AH was a good replacer of butter and eggs in a conventional yellow cake recipe. The cake with the HL-AH contained about 75% less fat than the conventional yellow cake, but produced a cake with good crumb structure, texture and moistness.
- This example compares biscuits made by a conventional recipe, high-lipid algal flake to replace the eggs and shortening in the conventional recipe, and high-lipid algal homogenate (HL-AH) to replace the eggs and shortening in the conventional recipe. Both the algal flake and the algal homogenate biomass were from Chlorella protothecoides (strain UTEX 250) with 48% lipid by dry cell weight.
Table 14. Conventional recipe for biscuits. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Flour, All Purpose 2 cups 277.73 44.59% 0.00% Baking Powder 4 tsp. 20.28 3.26% 0.00% Sugar, granulated 3 tsp. 12.61 2.02% 0.00% Salt, Table ½ tsp. 3.40 0.55% 0.00% Shortening (Crisco) ½ cup 82.04 13.17% 13.17% Egg, Whole 1 53.15 8.53% 0.64% Milk. 2% 2/3 cup 173.68 27.88% 0.56% Yield: 12 622.89 100.00% 14.37% Table 15. Recipe for high lipid algal flakes to substitute egg and shortening. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Flour, All Purpose 2 cups 275.00 46.08% Baking Powder 4 tsp. 17.20 2.88% Sugar, granulated 3 tsp. 11.28 1.89% Salt, Table ½ tsp. 3.30 0.55% Algal flakes 50.00 8.38% 4.02% Water 56.00 9.38% Milk. 2% 2/3 cup 184.00 30.83% 0.62% Yield: 12 596.78 100.00% 4.64% Table 16. Biscuit recipe using high lipid algal homogenate (HL-AH). Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Flour, All Purpose 2 cups 137.50 46.08% Baking Powder 4 tsp. 8.60 2.88% Sugar, granulated 3 tsp. 5.65 1.89% Salt, Table ½ tsp. 1.65 0.55% HL-AH 25.00 8.38% 4.02% Water 28.00 9.38% Milk. 2% 2/3 cup 92.00 30.83% 0.62% Yield: 12 298.40 100.00% 4.64% - In each case the cooking procedure was:
- 1. Preheat oven to 450°F.
- 2. In a kitchen aid bowl, combine flour, baking powder, sugar and salt.
- 3. Add shortening into mixture until forms coarse crumbs. (Speed #2).
- 4. Beat egg with milk. Add wets to dry ingredients and mix just until dry ingredients are moistened.
- 5. Mix until forms a dough (
Speed # 2 for 15 seconds). - 6. Roll to 3/4" thickness (or sheet if desired). Cut with a floured 2 1/2" biscuit cutter.
- 7. Place on a lightly greased sheet pan. Bake for 8-10mins, or until golden.
- 8. Serve warm.
- The sample made with HL-AH appeared similar to the full fat control in texture and appearance. Overall, the HL-AH biscuits were the closest to the conventional recipe biscuits, producing a biscuit with 65% less fat, but still retained the texture and rise of a conventional recipe biscuit.
- This example compares mayonnaise/salad dressing using a conventional recipe with 40% fat control, a low fat recipe with 20% fat control, and a recipe with high-lipid algal homogenate (HL-AH) (with -20% fat by weight) from Chlorella protothecoides (strain UTEX 250) with 48% lipid by dry cell weight.
Table 17. Recipe for 40% fat control. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Oil, Canola 200.00 40.00% 40.00% Liquid Egg Yolk 15.00 3.00% 3.00% Vinegar, distilled, 60 grain 200.00 40.00% 0.00% Salt, Table 0.00 0.00% 0.00% Water 85.00 17.00% 0.00% 500.00 100.00% 43.00% Table 18. Recipe for 20% fat control. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. Oil, Canola 100.00 20.00% 20.00% Liquid Egg Yolk 14.78 2.96% 2.96% Vinegar, distilled, 60 grain 200.00 40.00% 0.00% Salt, Table 0.00 0.00% 0.00% Water 185.22 37.04% 0.00% 500.00 100.00% 22.96% Table 19. Recipe for HL-AH creamy salad dressing. Component Recipe Measures Weight(g) Percent % Fat. Wet Wt. HL-AH 200.00 40.00% 19.0 Water 180.00 36.00% Vinegar (5% acid) 120.00 24.00% Salt. Table 0.00 0.00% 500.00 100.00% 19.0% - In each case the cooking procedure was:
- 1. Using a food processor, combine egg yolk, acid, water and salt.
- 2. Slowly stream in oil, until a tight emulsion is formed.
- 3. If emulsion is too tight, add some additional water.
- 4. Scrape down sides and shear again for 10 seconds to incorporate any oil droplets.
- The 20% fat control dressing (made with canola oil) did not have any viscosity and failed to form an emulsion. The surface was foamy and oil droplets formed after letting the dressing sit. The dressing made with the HL-AH had an algal biomass flavor, good opacity and viscosity, and a creamy mouthfeel. Overall, the HL-AH imparted a better opacity and viscosity to the dressing when compared to both the 20% and the 40% fat dressings. The HL-AH functioned as a great emulsifier and produced a dressing that had the properties of a 40% fat dressing with the proper mouthfeel at half the fat content. Similar results were obtained with the micronized HL-AH (at a 19% fat content) in a Hollandiase sauce recipe (conventional recipe control was at 80% fat). The Hollandaise sauce produced with the HL-AH was smooth and rich tasting, with a creamy mouthfeel and good viscosity. The color of the sauce was a little darker yellow than the full fat control. Overall, the Hollandiase sauce with the micronized HL-AH produced a product that was comparable to the full fat control with 75% less fat.
- This example compares a model chocolate nutritional beverage made with a conventional recipe, with high lipid algal homogenate (HL-AH)to replace milk and oil in the conventional recipe, and one with high-lipid algal flake biomass to replace milk and oil in the conventional recipe. Both the algal flake biomass and the HL-AH were from Chlorella protothecoides (strain UTEX 250) with 48% lipid by dry cell weight.
Table 20. Recipe for the conventional chocolate beverage control. Component Weight(g) 1000.00g Percent % Fat Water 278.60 g 835.81 g 83.581% Nonfat Dry Milk 17.88 g 53.64 g 5.364% Alkalized Cocoa Powder 11.38 g 34.14 g 3.414% 0.376% Soy Protein Isolate 8.12 g 24.36 g 2.436% Maltodextrin 5.00 g 15.00 g 1.500% Flavor, Choc 1.62 g 4.86 g 0.486% Lecithin 1.14 g 1 g 0.1% Gum Blend 0.81 g 2.43 g 0.243% Disodium Phosphate 0.32 g 0.96 g 0.096% Sucralose 0.13 g 0.39 g 0.039% Canola Oil 8.33 g 24.99 g 2.499% 2.499% 333.33 g 1000.00 g 100.000% 2.875% Table 21. Recipe for the chocolate beverage using HL-AH to replace milk and oil. Component Weight(g) 1000.00g Percent % Fat Water 278.60 g 857.23 g 85.723% HL-AH 17.88 g 55.02g 5.502% 2.641% Alkalized Cocoa Powder 11.38 g 35.02 g 3.502% 0.385% Soy Protein Isolate 8.12 g 24.98 g 2.498% Maltodextrin 5.00 g 15.38 g 1.538% Flavor, Choc 1.62 g 4.98 g 0.498% Gum Blend 0.81 g 2.49 g 0.249% Disodium Phosphate 0.32 g 0.98 g 0.098% Sucralose 0.13 g 0.40 g 0.040% 325.00 g 1000.00 g 100.000% 3.026% Table 22. Recipe for a chocolate beverage using algal flake biomass to replace milk and oil. Component Weight(g) 1000.00g Percent % Fat Water 278.60 g 857.23 g 85.723% Algal flake (48% lipid) 17.88 g 55.02g 5.502% 2.641% Alkalized Cocoa Powder 11.38 g 35.02 g 3.502% 0.385% Soy Protein Isolate 8.12 g 24.98 g 2.498% Maltodextrin 5.00 g 15.38 g 1.538% Flavor, Choc 1.62 g 4.98 g 0.498% Gum Blend 0.81 g 2.49 g 0.249% Disodium Phosphate 0.32 g 0.98 g 0.098% Sucralose 0.13 g 0.40 g 0.040% 325.00 g 1000.00 g 100.00% 3.026% - In each case the cooking procedure was:
- 1) Blend dry ingredients
- 2) Add wets (except flavor) to pot.
- 3) Whisk in dry ingredients.
- 4) Shear with stick blender for 1 minute
- 5) Heat on stove top to 200° F.
- 6) Homogenize at 2500/500 psi.
- 7) Chill to <40° F and refrigerate.
- The chocolate beverage containing the HL-AH had a thicker, richer appearance than the chocolate beverage containing the algal flakes, and was closer in appearance to the conventional chocolate beverage. Overall, the micronized HL-AH sample more closely resembled the conventional chocolate beverage control, imparting a good viscosity and with slightly more opacity than the conventional chocolate beverage control.
- High lipid containing Chlorella protothecoides grown using the fermentation methods and conditions described in Example 4 was processed into a high lipid algal powder. To process the microaglal biomass into algal powder, the harvested Chlorella protothecoides biomass was separated from the culture medium and then concentrated using centrifugation and dried using a spray dryer according to standard methods. The resulting algal powder (whole algal cells that have been spray dried into a powder form) was packaged and stored until use.
- High lipid containing Chlorella protothecoides grown using the fermentation methods and conditions described in Example 4 was processed into a high lipid algal flour. To process the microaglal biomass into algal flour, the harvested Chlorella protothecoides biomass was separated from the culture medium using centrifugation. The resulting concentrated biomass, containing over 40% moisture, was micronized using a high pressure homogenizer ((GEA model NS1001) operating at a pressure level of 1000-1200 Bar until the average particle size of the biomass was less than 10 µm. The algal homogenate was then spray dried using standard methods. The resulting algal flour (micronized algal cell that have been spray dried into a powder form) was packaged and stored until use.
- The following examples describe the use of high lipid (at least 20% by weight, typically 25-60% lipid by weight) algal flour as a fat replacement in conventional recipes. Additional examples also demonstrate unique functionality of the algal flour in increased moisture retention and improved texture when used in prepared foods such as powdered scrambled eggs. The high lipid algal flour used the examples below was prepared using the methods described in Example 13.
- In an effort to evaluate functional and taste profile differences using high lipid algal flour, chocolate brownies made with a conventional recipe was compared to brownies made with brownies made with algal flour and a conventional reduced-fat brownie. High lipid (approximately 53% lipid by dry weight) algal flour was used in place of butter and eggs.
Table 23. Conventional brownie recipe. Component Weight(g) 650.00g Percent % Fat Butter, unsalted 170.00 135.75 20.88 16.71 Cocoa powder 50.00 39.93 6.14 0.61 Whole eggs 200.00 159.71 24.57 1.84 Sugar, granulated 250.00 199.63 30.71 0.00 Flour, all-purpose 130.00 103.81 15.97 0.00 Baking powder 4.00 3.19 0.49 0.00 Salt 3.00 2.40 0.37 0.00 Vanilla extract 7.00 5.59 0.86 0.00 814.00 650.00 100.00% 19.16% Table 24. Reduced-fat brownie recipe. Component Weieht(g) 650.00g Percent % Fat Butter, unsalted 60.00 57.44 8.84 7.07 Cocoa powder 50.00 47.86 7.36 0.74 Whole eggs 100.00 95.73 14.73 1.10 Sugar, granulated 225.00 215.39 33.14 0.00 Water 50.00 47.86 7.36 0.00 Corn syrup 50.00 47.86 7.36 0.00 Flour, all-purpose 130.00 124.45 19.15 0.00 Baking powder 4.00 3.83 0.59 0.00 Salt 3.00 2.87 0.44 0.00 Vanilla extract 7.00 6.70 1.03 0.00 679.00 650.00 100.00% 8.91% Table 25. Algal flour brownie recipe. Component Weight(g) 600.00g Percent % Fat Algal flour 195.00 206.72 34.45 7.30 Cocoa powder 48.00 50.88 8.48 0.85 Water 41.00 43.46 7.24 0.00 Sugar, granulated 140.92 149.39 24.90 0.00 Flour, all-purpose 130.40 138.24 23.04 0.00 Baking powder 4.00 4.24 0.71 0.00 Salt 1.67 1.77 0.30 0.00 Vanilla extract 5.00 5.30 0.88 0.00 565.99 600.00 100.00% 8.15% - In each case, the baking procedure was:
- 1. Preheat oven to 350°F. Grease and flour a 8"x 8" baking pan.
- 2. In a small saucepan, melt butter with cocoa powder. Set aside to cool.
- 3. Beat eggs together with vanilla until slightly foamy. Gradually add in sugar and rest of the wet ingredients.
- 4. Add butter/cocoa mixture to egg mixture. Combine rest of dry ingredients and slowly add to wet mixture until blended.
- 5. Spread batter into pan and bake for 20-25 minutes, or until set.
- For the brownies with algal flour, the dry ingredients were combined and the algal flour was then added to the dry ingredients. The wet ingredients (water and vanilla) were then slowly blended into the dry ingredients. Spread batter into pan and bake for 27-28 minutes.
- The conventional reduced fat recipe produced a brownie that had a dry texture and was more cake-like than a brownie texture. The brownies made with algal flour (which had similar fat percentage as the reduced fat recipe brownies, approximately 8% fat) were very moist and had a brownie texture, but had a more fragile crumb structure when compared to the conventional brownie recipe (approximately 19% fat). When compared to the brownies made with algal flakes that were described in Example 11, the brownies made with algal flour were not as dense, had a softer crumb structure. Overall, the algal flour was an effective replacement for butter and eggs in a baked good recipe, and produced a product similar in texture, taste and appearance to the conventional recipie product. The algal flour exhibit unique functionality (e.g., finer crumb structure, not as gummy, and light texture) not seen with the use of algal flakes.
- In order to evaluate the emulsifying abilities of algal flour, mayonnaise made with algal flour that has been reconstituted in water (40% by w/v) and homogenized at low pressure (100-200 bar) to produce a slurry was compared to mayonnaise made with a conventional recipe and a reduced fat mayonnaise. The algal flour slurry was made with high lipid algal flour having approximately 53% lipid by dry weight and completely replaced the oil and egg yolks in the conventional recipes.
Table 26. Conventional mayonnaise recipe. Component Weight(g) 1000.00g Percent % Fat Oil, soybean 344.00 573.33 57.33 57.33 Liquid egg yolk 60.00 100.00 10.00 2.65 Vinegar, distilled 47.50 79.17 7.92 0.00 Sugar, granulated 12.00 20.00 2.00 0.00 Salt 11.00 18.33 1.83 0.00 Lemon juice concentrate 1.25 2.08 0.21 0.00 Xanthan gum 1.20 2.00 0.20 0.00 Garlic powder 0.50 0.83 0.08 0.00 Onion powder 0.75 1.25 0.13 0.00 Water 121.80 203.00 20.30 0.00 600.00 1000.00 100.00% 59.98% Table 27. Conventional reduced fat mayonnaise recipe. Component Weight(g) 1000.00g Percent % Fat Oil, soybean 152.00 253.33 25.33 25.33 Liquid egg yolk 15.00 25.00 2.50 0.66 Vinegar, distilled 47.50 79.07 7.91 0.00 Instant Food Starch 15.00 24.97 2.50 0.00 Sugar, granulated 15.50 25.80 2.58 0.00 Salt 11.00 18.31 1.83 0.00 Lemon juice concentrate 1.25 2.08 0.21 0.00 Phosphoric acid 5.70 9.49 0.95 0.00 Xanthan gum 1.80 3.00 0.30 0.00 Garlic powder 0.50 0.83 0.08 0.00 Onion powder 0.75 1.25 0.13 0.00 Water 333.00 555.00 55.50 0.00 600.00 1000.00 100.00% 26.00% Table 28. Recipe for mayonnaise made with algal flour slurry. Component Weight(g) 1000.00g Percent % Fat Algal flour, slurry 344.00 499.38 49.94 26.47 Liquid egg yolk 0.00 0.00 0.00 0.00 Vinegar, distilled 47.50 79.07 7.91 0.00 Instant food starch 15.00 24.97 2.50 0.00 Sugar, granulated 15.50 25.80 2.58 0.00 Salt 11.00 18.31 1.83 0.00 Lemon juice concentrate 1.25 2.08 0.21 0.00 Phosphoric Acid 5.70 9.49 0.95 0.00 Xanthan gum 1.80 3.00 0.30 0.00 Garlic powder 1.50 2.50 0.25 0.00 Onion powder 1.50 2.50 0.25 0.00 Water 200.00 332.92 33.29 0.00 600.75 1000.00 100.00% 26.47% - In each case, the procedure was:
- 1. Using a food processor, combine acids, water, and dry ingredients.
- 2. Add egg yolks and slowly stream in oil or algal flour slurry. A tight emulsion should form. If the emulsion is too tight, add additional water until the emulsion reaches desired consistency.
- 3. Scrape down sides and shear again for 10 seconds to incorporate any oil/slurry droplets.
- The mayonnaise made with the algal flour slurry had the viscosity of between the conventional and the reduced fat mayonnaise. The mouthfeel of the algal flour slurry mayonnaise was comparable to that of the conventional mayonnaise (but contains less than 50% of total fat). Instant food starch was needed in both the reduced fat mayonnaise and the algal flour slurry mayonnaise in order to bind more water and tighten the product to be more "spreadable". Overall, using the algal flour slurry to replace all of the fat sources (e.g., oil and egg yolks) in a conventional mayonnaise recipe produced a mayonnaise with good viscosity and a mouthfeel that was indistinguishable from conventional mayonnaise. The algal flour slurry functioned as an effective emulsifier, successfully replacing the functionality of oil and egg yolks found in conventional mayonnaise.
- In an additional application, high lipid algal flour slurry was used to make a reduced fat honey mustard dipping sauce/dressing. Honey, mustard, white vinegar, lemon juice flavor and sea salt was added to the prepared mayonnaise (modified slightly to achieve the proper consistency of a dipping sauce/dressing) described above. All ingredients were combined and mixed in a food processor until homogenous and smooth. The end product contained approximately 14% algal flour by weight, and had approximately 8% total fat. The honey mustard dipping sauce/dressing containing algal flour had a creamy mouthfeel comparable to a conventional (full fat) honey mustard dipping sauce.
- In order to evaluate algal flour in a creamy salad dressing application, miso salad dressing was prepared using a conventional recipe and a recipe containing high lipid algal flour reconstituted as a slurry (40% solids), produced using methods as described in the preceeding mayonnaise formulation.
Table 29. Recipe for the conventional miso salad dressing. Component Weight(g) Percent (by weight) Oil Phase: Canola oil 294.00 98.00 Sesame oil 6.00 2.00 300.00 100% Aqueous Phase: Vinegar, rice wine 143.50 20.50 Miso paste, red 166.25 23.70 Sugar, granulated 78.75 11.250 Garlic powder 3.5 0.50 Mustard flour 5.25 0.75 Ginger powder 5.25 0.75 Xanthan gum 1.50 0.214 Potassium sorbate 0.88 0.125 Calcium disodium EDTA 0.18 0.025 Water 294.95 42.136 700.00 100.00% Table 30. Recipe for miso salad dressing made with algal flour slurry. Component Weight(g) Percent (by weight) Oil Phase: Canola oil 94.0 94.00 Sesame oil 6.00 6.00 100.00 100% Aqueous Phase: Algal flour, slurry 125.00 13.889 Vinegar, rice wine 80.00 8.889 Vinegar, distilled 60.00 6.667 Miso paste, red 225.00 25.00 Sugar, granulated 85.00 9.444 Garlic powder 3.5 0.389 Mustard flour 5.25 0.583 Ginger powder 5.25 0.583 Xanthan gum 2.70 0.300 Potassium sorbate 0.88 0.097 Calcium disodium EDTA 0.18 0.019 Titanium dioxide 4.20 0.467 Water 300.00 33.344 900.00 100.00% - In each case, the dry ingredients were blended together set aside. The water, vinegar and acid were blended together and set aside. The miso paste was measured out separately. For the conventional recipe, the oils were combined together and set aside. For the algal flour-containing recipe, the algal flour slurry, oil, and titanium dioxide was weighed out separately and combined. The water/vinegar mixture was then blended with a high shear blender. After blending, the dry ingredients were added into the water/vinegar mixture. The oils mixture was then streamed in slowly while the water/vinegar and dry ingredients were being blended with a high shear blender. The dressing was then heated to 190°F for 2 minutes and then the dressing was run through a colloid mill on the tightest setting. The finished dressing was then bottled and refridgerated until use.
- Both the conventional and the algal flour containing recipes produced a thick and opaque creamy salad dressing. Visually, the two dressings were comparable in color and texture. The miso salad dressing made with the convention recipe contained approximately 30% fat, while the miso salad dressing made with the algal flour slurry contained approximately 12.65% fat. Overall, the miso dressing made with the algal flour slurry contained less than half the fat of the miso dressing made with the conventional recipe, while preserving the creamy mouthfeel and opacity.
- The ability of the algal flour to function in a yeast dough application was tested using a conventional pizza dough/breakstick recipe and a pizzadough/breadstick recipe containing 5% or 10% by weight algal flour. The pizzadough/breadsticks containing algal flour was made with high lipid algal flour slurry (40% solids), produced using the methods as described in the preceeding mayonnaise formulation.
- In each case, 7.3 grams of yeast was combined with 9.3 grams of all-purpose flour and mixed with 58 grams of warm water. The yeast mixture was allowed to sit at room temperature for at least 10 minutes. In the samples containing algal flour slurry, the slurry was mixed with 167 grams of water and combined with 217 grams of all-purpose flour and 4.9 grams of salt in a mixer. In the conventional recipe, the water was just combined with the flour and salt in the mixer. After being combined, the yeast mixture was added to the dough and an additional 90 grams of all-purpose flour was added. The dough was then kneaded by hand, adding additional flour as needed if the dough was too wet. The dough was covered and allowed to rise for 1 hour in a warm location. After allowing it to rise, the dough was portioned and either rolled out as pizza dough or shaped into breadsticks. The dough was then baked in a 450°F oven for 8-12 minutes or until done.
- The conventional recipe pizza dough and breadsticks were chewy with a traditional crust. The pizza dough containing 5% algal flour slurry had a more cracker-like texture and was crisper than the conventional recipe pizza dough. The pizza dough containing 10% algal flour slurry was crisper than the pizza dough containing 5% algal flour slurry. In the breadsticks made with algal flour slurry, the 5% algal breadsticks had a moist, chewy center when compared to the conventional recipe breadsticks. The breadsticks containing 10% algal flour slurry was even more moist than the 5% algal breadsticks. The baking time was increased with both breadsticks containing algal flour. Again, there was minimal algal flavor in the breadsticks containing algal flour slurry, which did not interfere with the overall taste. Overall, the algal flour slurry increased the crispness of the pizza dough and gave it a more cracker-like texture, and increased the moistness of the breadsticks when compared to the conventional recipe breadsticks. In another application, high lipid algal flour slurry (40% solids) were used in a corn tortilla recipe and compared to corn tortillas made from a conventional recipe. Similar to the pizza dough results, the corn tortillas containing algal flour slurry were more cracker-like in texture and crunchier than the conventional recipe tortillas.
- The ability of the algal flour to function in a cookie application was tested using a conventional soft-baked chocolate chip cookie recipe, a reduced fat soft-baked chocolate chip cookie recipe and a chocolate chip cookie made with high lipid algal flour slurry (produced using the same methods as described in the preceeding mayonnaise formulation). The algal flour slurry also replaced all of the butter and eggs in both the conventional and reduced fat cookie recipes.
Table 31. Recipe for conventional soft-baked chocolate chip cookie. Component Weight (g) Percent % Fat Flour, all purpose 2 cups 284.00 24.88 0.00 Baking soda ½ tsp 2.50 0.22 0.00 Baking powder ¼ tsp 1.23 0.11 0.00 Salt ½ tsp 3.35 0.29 0.00 Light brown sugar 1 cup 239.00 20.94 0.00 Unsalted butter, softened 1 ½ sticks 170.25 14.92 11.93 Corn syrup ¼ cup 82.00 7.18 0.00 Egg, whole 2 100.00 8.76 0.66 Vanilla extract 1 tsp 4.00 0.35 0.00 Semi-sweet chocolate chips 1 ½ cups 255.00 22.34 6.37 1141.33 100.00% 18.96% Table 32. Recipe for the reduced fat soft-baked chocolate chip cookie. Component Weight (2) Percent % Fat Flour, all purpose 2 ½ cups 355.00 33.58 0.00 Baking soda ½ tsp 2.50 0.24 0.00 Baking powder ¼ tsp 1.23 0.12 0.00 Salt ½ tsp 3.35 0.32 0.00 Light brown sugar 1 cup 239.00 22.61 0.00 Unsalted butter, softened ½ stick 40.00 3.78 3.03 Corn syrup ¼ cup 82.00 7.76 0.00 Egg, whole 1 50.00 4.73 0.35 Egg, white 1 25.00 2.37 0.00 Vanilla extract 1 tsp 4.00 0.38 0.00 Semi-sweet chocolate chips 1 ½ cups 255.00 24.12 6.88 1057.08 100.00% 10.26% Table 33. Recipe for soft-baked chocolate chip cookies with algal flour slurry. Component Weight (g) Percent % Fat Flour, all purpose 2 ½ cups 355.00 31.08 0.00 Baking soda ½ tsp 2.50 0.22 0.00 Baking powder ¼ tsp 1.23 0.11 0.00 Salt ½ tsp 3.35 0.29 0.00 Light brown sugar 1 cup 239.00 20.93 0.00 Algal flour slurry 200.00 17.51 3.71 Corn syrup ¼ cup 82.00 7.18 0.00 Vanilla extract 1 tsp 4.00 0.35 0.00 Semi-sweet chocolate chips 1 ½ cups 255.00 22.33 6.36 1142.08 100.00% 10.08% - In each case, the procedure was:
- 1. Preheat oven to 350°F. In a bowl, combine flour, baking soda, baking powder and salt. Set aside.
- 2. Cream butter/algal flour slurry with sugar and corn syrup until smooth. Beat in egg (if any) and vanilla.
- 3. Gradually add in dry ingredients and mix until it just forms a dough. Fold in chocolate chips.
- 4. Take tablespoons of dough; drop onto cookie sheet or roll into balls and place onto cookie sheet.
- 5. Bake for 16-18 minutes or until golden brown, rotate cookie sheet half-way through baking.
- The conventional recipe cookie had good spreading during baking and was soft and fluffy out of the oven. In the reduced fat cookie, the dough did not spread in the first batch, so in subsequent batches, the dough was flattened prior to baking. The reduced fat cookie was soft out of the oven, and firmed into a dense cookie upon cooling. The reduced fat cookie also had pronounced upfront corn syrup flavor. The algal flour cookie had similar spreading during baking as the conventional recipe cookie and was texturally better than the reduced fat cookie. After three days at ambient temperature, the algal flour cookie was more moist than both the conventional recipe cookie and the reduced fat cookie. Overall, the algal biomass slurry was effective as a replacement for butter and eggs in a cookie application. Functionally, the algal biomass slurry extended the shelf-life of the cookie, in that the cookie retained more moisture after three days in ambient temperature.
- With the extended shelf-life results from the chocolate chip cookie experiments above, a gluten-free oatmeal raisin cookie was made using high lipid algal flour (approximately 53% lipid by dry weight), produced using methods described in Example 13. The cookies were baked and then held at ambient temperature for seven days. Initial sensory tests and water activity were performed on the cookies immediately after baking and cooling. Additional sensory tests and water activity tests were performed on
1, 3 and 7. On each test day, one cookie was chopped into small pieces so the raisins and oats were evenly distributed in the sample. At least two samples per cookie were assayed in the water activity tes to ensure accuracy of the measurement. Water activity (Aw) tests were performed according to manufacturer's protocols using an Aqua Lab,day Model Series 3 TE (Decagon Devices, Inc.) instrument. Briefly, water activity measures the water vapor pressure which quantifies the available, non-chemically bound water in a product; the higher the Aw value, the more moist the product. In this cookie application, the higher the Aw value correlates with a longer shelf-life. An Aw level of 0.65 was the desired target.Table 34. Recipe for gluten-free oatmeal raisin cookies made with algal flour slurry. Component Weieht(g) 1000.00g Percent Gluten-free flour 225.00 174.69 17.47 Brown rice flour 25.00 19.41 1.94 Baking soda 4.00 3.11 0.31 Baking powder 2.00 1.55 0.16 Salt 3.50 2.72 0.27 Ground cinnamon 1.30 1.01 0.10 Ground nutmeg 1.20 0.93 0.09 Xanthan gum 2.50 1.94 0.19 Water, filtered 215.00 166.93 16.69 Algal flour 110.00 85.40 8.54 Light brown sugar 270.00 209.63 20.96 Sugar, granulated 45.00 34.94 3.49 Vanilla extract 8.50 6.60 0.66 Raisins 125.00 97.05 9.70 Rolled oats 250.00 194.10 19.41 600.75 1000.00 100.00% - The procedure was:
- 1. Preheat oven to 375°F.
- 2. Blend dry ingredients together except for oats and algal flour. Hydrate oats in ¼ the water. Hydrate the algal flour in ¾ the water and blend well using a hand held mixer. Allow oats and algal flour to hydrate for 10 minutes.
- 3. Add the hydrated algal flour to the dry ingredients mix well. Add vanilla and mix well until blended and smooth.
- 4. Add oats and raisins and mix until just homogeneous.
- 5. Portion out cookies on a cookie sheet and lightly press down each one.
- 6. Bake cookies in the oven for 20 minutes, rotating the cookie sheet half-way through baking.
- The results of the sensory and water activity tests are summarized below in Table 5. Samples for the sensory test were evaluated on a 10 point scale: 1-2 = unacceptable; 3-4 = poor; 5-6 = fair; 7-8 = good; and 9-10 = excellent. Overall, cookies prepared with algal flour retained a good moisture level when held at ambient temperature for seven days, with little deterioration to taste and texture.
Table 35. Sensory scores and water activity results for oatmeal raisin cookies at ambient temperature. Sensory Score Sensory Comments Aw Other Initial 8 Moist interior, crisp texture, good oatmeal raisin flvor with minimal algal biomass notes. Cookie structure was developed with light surface color. 0.776 Aw higher than desired target of 0.65. Day 1 7.5 Moist, soft, not crisp exterior, slightly chewy, not as firm as initial. Slightly less buttery flavor, but flavor is still good with minimal algal biomass notes 0.717 Aw continutes to be higher than targe of 0.65. Day 3 7 Very moist and chewy; still has typical oatmeal raisin flavor with minimal algal biomass notes. Not crisp 0.735 Aw continutes to be higher than targe of 0.65. Day 7 7.5 Slightly drier, not "fresh baked crisp"; cookie slightly drier in the interior; more chewy, sweet oatmeal flavor; moisture is even throughout product. Product still very good. 0.719 Aw continutes to be higher than targe of 0.65. - The ability of the algal flour to retain moisture and offer textural improvement was tested in a reconstituted powdered eggs application. Powdered eggs were prepared using a conventional recipe, and with varying levels (5%, 10% and 20%) of high lipid algal flour as a replacement for the corresponding percentage (w/w) of powdered eggs. The algal flour used in the formulations below was prepared using the methods described in Example 13 and contained approximately 53% lipid by dry weight.
Table 36. Conventional recipe for scrambled eggs from powdered eggs. Component Weight(g) 200.00g Percent % Fat Powdered eggs, whole 25.00 49.83 24.91 9.77 Salt 0.25 0.50 0.25 0.00 Black pepper, ground 0.10 0.20 0.10 0.00 Water 75.00 149.48 74.74 0.00 100.35 200.00 100.00% 9.77% Table 37. Recipe for scrambled eggs from powdered eggs with 5% algal flour. Component Weight(g) 200.00g Percent % Fat Powdered eggs, whole 23.75 47.33 23.67 9.28 Algal flour 1.25 2.49 1.25 0.66 Salt 0.25 0.50 0.25 0.00 Black pepper, ground 0.10 0.20 0.10 0.00 Water 75.00 149.48 74.74 0.00 100.35 200.00 100.00% 9.94% Table 38. Recipe for scrambled eggs from powdered eggs with 10% algal flour. Component Weight(g) 200.00g Percent % Fat Powdered eggs, whole 22.50 44.84 22.42 8.79 Algal flour 2.50 4.98 2.49 1.32 Salt 0.25 0.50 0.25 0.00 Black pepper, ground 0.10 0.20 0.10 0.00 Water 75.00 149.48 74.74 0.00 100.35 200.00 100.00% 10.11% Table 39. Recipe for scrambed eggs from powdered eggs with 20% algal flour. Component Weight(g) 200.00g Percent % Fat Powdered eggs, whole 20.00 39.86 19.93 7.81 Algal flour 5.00 9.97 4.98 2.64 Salt 0.25 0.50 0.25 0.00 Black pepper, ground 0.10 0.20 0.10 0.00 Water 75.00 149.48 74.74 0.00 100.35 200.00 100.00% 10.45% - In all cases, the eggs were prepared as follows:
- 1. Mix algal flour (if any) with powdered eggs. Mix eggs with water. Whisk until smooth. If needed, use handheld blender to shear in any clumps.
- 2. In a preheated, non-stick pan, pour egg mixture.
- 3. Cook egg mixture until set and season as desired.
- All preparations were similar in color and there were no noticeable color differences between the conventional recipe eggs and the eggs containing algal flour. The conventional recipe eggs were dry, overly aerated, spongy in texture and was missing a creamy mouthfeel. The eggs prepared with 5% algal biomass were more moist and was more firm in texture than the conventional recipe eggs. The mouthfeel was more creamy than the conventional recipe eggs. The eggs prepared with 10% algal flour were even more moist than the conventional recipe eggs and had the texture and mouthfeel of scrambled eggs prepared from fresh eggs. The eggs pepared with 20% algal flour were too wet and had the texture of undercooked, runny eggs. Overall, the inclusion of algal flour improved the mouthfeel, texture and moisture of prepared powdered eggs as compared to conventional prepared powdered eggs. At 5% and 10%, the algal flour worked well in the egg application without significantly increasing the fat content. At 20%, the algal flour imparted too much moisture, making the texture of the prepared powdered eggs unacceptable.
- Because the algal flour was able to add significant moisture and improve the texture of powdered eggs, the following holding test was performed in order to evaluate how the cooked eggs would perform when held in a steam table. Scrambled eggs made with a conventional recipe using powdered eggs, 5% algal flour and 10% algal flour (all made using methods described above) were hydrated 10-15 minutes prior to being stove top cooked. After cooking, samples were immediately transferred to a steam table, where they were held covered for 30 minutes at a temperature between 160-200°
F. Every 10 minutes, fresh samples were made to compare against the held samples. Samples were evaluated on a 10 point scale: 1-2 = unacceptable; 3-4 = poor; 5-6 = fair; 7-8 = good; and 9-10 = excellent. The results of the test are summarized below in Table 40.Table 40. Sensory results from powdered eggs holding test. Holding Time Variable Initial 10 minutes 20 minutes 30 minutes Convential recipe 6: rubbery in texture and tough; but egg-like 5: slightly drier/tougher, but still acceptable 4: drier, more tough; chewy texture 3: brigher yellow in color, hard edges, dry, tough and rubbery; unacceptable 5% Algal flour 8: moist, tender 7: slightly tougher than initial 5% algal flour sample, but still acceptable 6: drier than initial 5% algal flour sample, but still moister than conventional recipie initial sample 5: not as yellow in color with slightly dull undertone; dry and tough but still better than conventional recipe after 30 minutes (no hard edges) 10 % Algal flour 7: slightly too wet/moist; tender 8: moist, tender, not tough 7: slightly tougher, but interior still moist. Moister than initial conventional recipe sample, but drier than initial 10% algal flour sample 6.5: drier and slightly tougher than initial sample, but still moister than conventional sample and 5% algal flour sample after 30 min.; no dry edges, interior is still moist - The ability of the algal flour to improve texture and mouthfeel of scrambled egg whites was tested using Egg Beaters®. 100 grams of Egg Beaters® was scrambled using a small non-stick frying pan for approximately 1-2 minutes until the eggs were set. No butter or seasonings were used. A sample with 10% w/w substitution of high lipid algal flour slurry (prepared using methods described above in the mayonnaise application with algal flour containing approximately 53% lipid by dry weight). The Egg Beaters® with the algal flour was prepared in a manner identical to the control.
- The control sample had a more watery consistency and dissolved in the mouth more like water, with relatively little or no texture. The sample containing 10% algal flour slurry cooked up more like scrambled eggs made with fresh eggs. The 10% algal flour slurry sample also had more of a scrambled eggs texture and had a full mouthfeel, similar to that of scrambled eggs made with fresh eggs. Overall, the addition of the algal flour slurry was very successful in improving the texture and mouthfeel of scrambled egg whites, making the egg whites taste more like scrambled eggs made with fresh whole eggs.
- The ability of algal flour to improve texture and moisture of scrambled eggs using liquid whole eggs was testing in a holding study and using a sensory panel. Liquid whole eggs was prepared according to manufacturer's directions as a control and compared to prepared liquid whole eggs with 10% algal flour slurry (2.5% algal flour with 7.5% water). Both control and 10% algal flour eggs were cooked up as scrambled eggs and held on a steam table for 60 minutes total. Samples of each scrambled egg product were taken and tested in a sensory panel every 10 minutes. The sensory panel judged the overall appearance, moisture level, texture and mouthfeel of the scrambled egg product on a scale of 1 to 9, with 1 being unacceptable, 3 being moderately unacceptable, 5 being fair, 7 being acceptable and 9 being excellent.
- Overall, the addition of 10% algal flour slurry (2.5% algal flour solids) improved the texture, moisture level, and mouthfeel of the prepared eggs. After 60 minutes on the steam table, the scrambled egg product with 10% algal flour slurry was still acceptable (5 on the sensory scale) as compared to the control scrambled eggs, which was in the unacceptable to moderately unacceptable range (2.7 on the sensory scale). Results from all time points are summarized in
Figure 3 . - Pancake/waffle mixes found in retail stores contain whole powdered eggs as an ingredient. As show above in the powdered eggs formulation, the addition of high lipid algal flour improved the texture and mouthfeel of the prepared egg product. The ability of high lipid algal flour to improve the texture and mouthfeel of pancakes made with ready-mixed pancake mixes was tested.
Table 41. Recipe for the control pancakes. Component Weight(g) Percent Whole powdered eggs 10.1 4.6 Non-fat milk solids 10.9 5 All purpose wheat flour 65.5 29.8 Canola oil 7.3 3.3 Baking powder 3.6 1.6 Salt 0.9 0.41 Sugar 1.8 0.82 Water 120 54.5 Total 220.1 Table 42. Recipe for pancakes containing high lipid algal flour. Component Weight(g) Percent Whole powdered eggs 5.05 2.3 Algal flour 5.05 2.3 Non-fat milk solids 10.9 5 All purpose wheat flour 65.5 29.8 Canola oil 7.3 3.3 Baking powder 3.6 1.6 Salt 0.9 0.41 Sugar 1.8 0.82 Water 120 54.5 Total 220.1 - In both cases, the water was used to rehydrate the powdered eggs, algal flour, and non-fat milk solids. The remaining ingredients were then added and whisked until the batter was smooth. The batter was poured into a hot ungreased non-stick pan in pancake-sized portions. The pancakes were cooked until the bubbles on top burst and were then flipped over and cooked until done.
- Both batters were similar in appearance and both pancakes took approximately the same amount of time to cook. The pancakes containing algal flour were lighter, creamier and fluffier in texture and were less rubbery than the control pancakes. Overall, the substitution of 50% by weight of the powdered whole eggs with algal flour produced a texturally better pancake with a better mouthfeel.
- An additional formulation for algal milk was produced using high lipid algal flour. The algal milk contained the following ingredients (by weight): 88.4% water, 6.0% flour, 3.0% whey protein concentrate, 1.7% sugar, 0.6% vanilla extract, 0.2% salt and 0.1% stabilizers. The ingredients were combined and homogenized on low pressure using a handheld homogenizer. The resulting algal milk was chilled before serving. The mouthfeel was comparable to that of whole milk and had good opacity. The algal flour used contained about 50% lipid, so the resulting algal milk contained about 3% fat. When compared to vanilla flavored soy milk (Silk), the algal milk had a comparable mouthfeel and opacity and lacked the beany flavor of soy milk.
- The algal milk was then combined with additional sugar and vanilla extract and mixed until homogenous in a blender for 2-4 minutes. The mixture was placed in a prechilled ice cream maker (Cuisinart) for 1-2 hours until the desired consistency was reached. A conventional recipe ice cream made with 325 grams of half and half, 220 grams of 2% milk and 1 egg yolk was prepared as a comparison. The conventional recipe ice cream had the consistency comparable to that of soft served ice cream, and was a rich tasting, smooth-textured ice cream. Although the ice cream made from algal milk lacked the overall creaminess and mouthfeel of the conventional recipe ice cream, the consistency and mouthfeel was comparable to a rich tasting ice milk.. Overall, the use of algal milk in a frozen dessert application was successful: the frozen dessert algal milk produced was a lower fat alternative to a conventional ice cream.
- Algal oil is extracted from microalgal biomass prepared as described in Examples 1-4 by drying the biomass using methods disclosed herein, disrupting the biomass using methods disclosed herein, and contacting the disrupted biomass with an organic solvent, e.g., hexane, for a period of time sufficient to allow the oil to form a solution with the hexane. The solution is then filtered and the hexane removed by rotoevaporation to recover the extracted oil.
- Algal oil is extracted from the microalgal biomass prepared as described in Examples 1-4, drying the biomass, and physically disrupting the biomass in an oilseed press, wherein the algal oil becomes liberated from the biomass. The oil, thus separated from the disrupted biomass, is then recovered.
- Lipid samples from a subset of strains grown in Example 1 were analyzed for lipid profile using HPLC. Results are shown in
Figure 1 . - Complete protection system - Algal oil that provides naturally-occurring tocotrienols, tocopherols, carotenoids, Omega 3s and sterols. It offers a plant-based, non-animal alternative to fish oil use.
Table 43. Ingredients of exemplary nutraceutical composition. Algal Oil Heart Health Capsules (Softgel) Ingredient (Trade name) Description Amount per Softgel (mg) DHA-S Oil Algal Oil DHA 35% 100 --- DHA 35 Phycosterols™ - Heart Health Super Food Blend Pressed Algal Oil (from a Chlorella species listed in Table 12) 100 - Omega 9 (as oleic acid) 70 - Omega 6 (as linoleic and linolenic acid) 17 lutein 0.0075 Plant Sterols Plant Sterol esters 400 Coenzyme Q10 Coenzyme Q10 15 Vitamin E, oil USP BASF D- Alpha Tocopheryl 10 Bioperine Piper nigrem bioavailability enhancer 2.5 Excipients: Beeswax, lecithin and purified water -
Table 44. Ingredients of exemplary nutraceutical composition. Algal Oil (Softgel) Ingredient Description Amount per Softgel (mg) Chlorella protothecoides (UTEX 250) oil Pressed Algal Oil 400 - Omega 9 (as oleic acid) 280 - Omega 6 (as linoleic and linolenic acid) 68 Vitamin E Acetate, oil USP BASF D- Alpha Tocopheryl Acetate 10 Excipients: Beeswax, lecithin, purified water - Oil extracted from Chlorella protothecoides (UTEX 250) grown using the fermentation methods described in Example 4 was used in baked good applications. Yellow cake (Moist Deluxe, Duncan Hines) and brownies (Chocolate Chunk, Pillsbury) were produced using 1/3 cup of oil extracted from Chlorella protothecoides according to manufacturer's suggested instructions. The results of both the yellow cake and brownies were indistinguishable from yellow cake and brownies produced using vegetable oil and the same box mix.
- Heterotrophically produced Chlorella protothecoides (UTEX 250) was grown under nitrogen-rich conditions supplied by one or more of the following: yeast extract (organic nitrogen source), NH4OH and (NH4)2SO4, supplementing the medium described in Examples 2-4. Other than the culture media, the fermentation conditions were identical to the conditions described in Example 2. The high protein algal biomass was harvested after approximately 3-5 days of exponential growth, when it reached the desired culture density. Any of the above-described processing methods (algal flakes in Example 4, algal homogenate in Example 10, algal powder in Example 12 and algal flour in Example 13) can be applied to the high protein algal biomass.
- The high protein biomass was processed into algal flakes using methods described in Example 4. Both dried biomass, high lipid (Example 4) and high protein, were analyzed for moisture, fat, fiber, ash, crude protein and protein digestibility using methods in accordance with Official Methods of ACOC International. The results are summarized in Table 45 below.
Table 45. Proximate analysis of microalgae with high protein content. Analysis ACOC method # High lipid % by weight High protein % by weight Moisture 930.15 5% 5% Fat 954.02 50% 15% Ash 942.05 2% 4% Crude protein 990.03 5% 50% Pepsin digestible protein 971.09 ND 37.5% (69.7% of crude protein is digestible) Fiber (crude) 991.43 2% 2% ND= not done - Total carbohydrates were calculated by difference: 100% minus the known percentages from proximate analysis. Total carbohydrate by weight for the high lipid biomass was approximately 36% and total carbohydrate by weight for the high protein biomass was approximately 24%.
- The above crude fiber represents the amount of cellulose and lignin (among other components) in the biomass samples. Both biomass were subjected to soluble and insoluble fiber (together is the total dietary fiber) measurements, which is part of the carbohydrate component of the biomass, using methods in accordance with Official Methods of ACOC International (AOAC method 991.43). For the high lipid biomass, the soluble fiber was 19.58% and the insoluble fiber was 9.86% (total dietary fiber of 29.44%). For the high protein biomass, the soluble fiber was 10.31% and the insoluble fiber was 4.28% (total dietary fiber of 14.59%.
- Multiple lots of high protein and high lipid biomass (produced using methods described in Example 4) and high protein biomass were analyzed for digestibility using an in vitro digestibility assay (0.2% pepsin digestibility assay, AOAC Method number 971.09). For the high lipid biomass, the percent total crude protein ranged from 5.4% to 10.3%, with percent total digestible protein ranging from 46.4% to 58.6%. For the high protein biomass, the percent total crude protein ranged from 40.8% to 53.3%, with the percent total digestible protein ranging from 71.6% to 85.3%. The same digestibility assay was also performed on hexane-extracted biomeal (high lipid algal biomass after hexane-extraction of the algal oil). The percent total crude protein was approximately 11-12% for all lots tested, with percent total digestible protein ranging from 76.72% to 80.2%.
- When compared to whole bean soy flour that has a percent total crude protein of about 40.9% and 95.35% total digestible protein, the high protein algal biomass had a percent total digestible protein that was a little less than whole bean soy flour. Additional assays were performed on high protein algal biomass that had been processed so that the algal cells were predominantly lysed. These assays resulted in the percent total digestible protein to be comparable to that of whole bean soy flour (approximately 95% total digestible protein). Overall, the percent total crude protein and the percent total digestible protein levels of the high protein biomass are comparable to that of whole bean soy flour.
- The digestibility assay results of the hexane-extracted biomeal indicated that the biomeal can be a viable additive for animal feed. The biomeal had both residual protein and oil and had a percent total digestible protein level of approximately 80%.
- The high protein algal biomass used in the recipes below was produced with the methods described in Example 17 above. The algal biomass used in the recipes below came from Chlorella protothecoides UTEX 250, which contained approximately 51% protein by weight and is referred to below as high protein algal biomass and designated either as algal flakes or algal homogenate.
- This example compares vegetarian burger patties made by a conventional recipe, with high protein algal biomass, either algal flakes or algal homogenate (AH), replacing vegetarian protein sources (textured soy protein (TSP), wheat gluten and/or soy protein isolate (SPI)).
Table 46. Conventional vegetarian burger patty recipe. Component Weight (g) % % Fiber % Protein % Fat Water 62.0 62.0 0 0 0 TSP (Arcon T U272) 11.0 11.0 2.09 7.59 0.22 TSP (Arcon T U218) 10.0 10.0 1.9 6.90 0.20 Canola Oil 4.0 4.0 0 0 4.0 SPI 5.5 5.5 0 4.95 0.22 Wheat gluten 3.0 3.0 0 2.46 0.03 Nat. Veg. Hamburger Flavor 2.0 2.0 0 0 0 Sensirome Ultra Vegetable 1.0 1.0 0 0 0 Methylcellulose 1.0 1.0 0.09 0 0 Salt 0.5 0.5 0 0 0 Total 100 grams 100 4.08 21.90 4.67 Table 47. Recipe for a vegetarian burger patty made with high protein algal flakes replacing the soy protein isolate (SPI), methylcellulose, and wheat gluten. Component Weight (g) % % Fiber % Protein % Fat Water 54.28 58.82 0 0 0 TSP (Arcon T U272) 11.0 11.92 2.26 8.22 0.24 TSP (Arcon T U218) 10.0 10.84 2.06 7.48 0.22 Canola Oil 4.0 4.33 0 0 4.33 SPI 0 0 0 0 0 High protein algal flakes 9.5 10.29 4.12 5.18 0.51 Wheat gluten 0 0 0 0 0 Nat. Veg. Hamburger Flavor 2.0 2.17 0 0 0 Sensirome Ultra Vegetable 1.0 1.08 0 0 0 Methylcellulose 0 0 0 0 0 Salt 0.5 0.54 0 0 0 Total 92.28 100 8.44 20.88 5.30 Table 48. Recipe for a vegetarian burger patty made with high protein algal flakes replacing textured soy protein concentrate (TSP) and soy protein isolate. Component Weight (g) % % Fiber % Protein % Fat Water 57.5 49.57 0 0 0 TSP (Arcon T U272) 0 0 0 0 0 TSP (Arcon T U218) 0 0 0 0 0 Canola Oil 4.0 3.45 0 0 3.45 Soy Protein Isolate 0 0 0 0 0 High protein algal flakes 47.0 40.52 16.21 20.38 2.03 Wheat Gluten 3.0 2.59 0 2.12 0.03 Nat. Veg. Hamburger Flavor 2.0 1.72 0 0 0 Sensirome Ultra Vegetable 1.0 0.86 0 0 0 Methylcellulose 1.0 0.86 0.08 0 0 Salt 0.50 0.43 0 0 0 Total 116.0 100 16.29 22.50 5.50 Table 49. Recipe for a vegetarian burger patty made with high protein algal homogenate (AH) replacing the soy protein isolate (SPI), methylcellulose, and wheat gluten. Component Weight (g) % % Fiber % Protein % Fat Water 62.0 62.0 0 0 0 TSP (Arcon T U272) 11.0 11.0 2.09 7.59 0.22 TSP (Arcon T U218) 10.0 10.0 1.90 6.90 0.20 Canola Oil 4.0 4.0 0 0 4.0 SPI 0 0 0 0 0 High Protein AH 9.5 9.5 3.80 4.78 0.48 Wheat gluten 0 0 0 0 0 Nat. Veg. Hamburger Flavor 2.0 2.0 0 0 0 Sensirome Ultra Vegetable 1.0 1. 0 0 0 Methylcellulose 0 0 0 0 0 Salt 0.5 0.5 0 0 0 Total 100 100 7.79 19.27 4.90 Table 50. Recipe for a vegetarian burger patty made with high protein algal homogenate replacing textured soy protein concentrate (TSP) and soy protein isolate. Component Weight (g) % % Fiber % Protein % Fat Water 52.570 47.33 0 0 0 TSP (Arcon T U272) 0 0 0 0 0 TSP (Arcon T U218) 0 0 0 0 0 Canola Oil 4.0 3.60 0 0 3.60 Soy Protein Isolate 0 0 0 0 0 High protein AH 47.0 42.32 16.93 21.28 2.12 Wheat Gluten 3.0 2.7 0 2.12 0.03 Nat. Veg. Hamburger Flavor 2.0 1.8 0 0 0 Sensirome Ultra Vegetable 1.0 0.90 0 0 0 Methylcellulose 1.0 0.90 0.08 0 0 Salt 0.50 0.43 0 0 0 Total 111.07 100 17.01 23.50 5.74 - In each case the cooking procedure was:
- 1. Weigh together the two textured soy proteins (if applicable).
- 2. In a stand-mixer bowl, add first portion of water (2.5-3 times weight of TSP and mix for 10 minutes.
- 3. Weigh soy protein concentrate, methylcellulose, wheat gluten, and algae biomass and dry blend together.
- 4. Add dry ingredients to stand-mixer. Add remaining water and mix for 5-10 minutes.
- 5. Weigh salt and flavors. Weigh oil. Add to mixer and mix for 5 minutes.
- 6. Form patties using mold (65-75g per patty), cover and freeze.
- In samples where algal biomass (algal flakes and algal homogenate) replaced TSP, the patties were very sticky had relatively no structure when cooked. Addition of other binders such as oats, oat bran and brown rice flour produced a patty, when cooked, was firm in texture. Recipes where algal flakes replaced the soy protein isolate produced a patty that was softer, mushier and less textured than control. The patties containing algal homogenate that replaced soy protein isolate had a firmness and texture that was comparable to control. Overall, the vegetarian burger patty made with algal homogenate replacing soy protein isolate was the most successful of the recipes tested and produced a patty that was comparable to the vegetarian control patty, but with almost two times more dietary fiber.
- The following example compares a conventional protein bar, with high protein algal biomass, either algal flakes or algal homogenate (AH), replacing the conventional protein sources (soy protein isolate (SPI) and milk protein concentrate (MPC)).
Table 51. Conventional protein bar recipe. Component Weight (g) % % Fiber % Protein % Fat Corn syrup 63/43 53.0 53.7 0 0 0 Brown Rice Flour 8.3 8.41 3.15 0 0 Soy Protein Isolate 9.35 9.47 0 8.24 0 Milk Protein Conc. 9.35 9.47 0 7.67 0.14 Cocoa Powder, Alkalized 8.0 8.11 2.59 1.824 0.89 Non-fat Dry Milk 7.0 7.09 0 2.483 0 Chocolate Flavor 0.5 0.51 0 0 0 Vanilla Flavor 0.4 0.41 0 0 0 Glycerine (99.5% USP) 2.3 2.33 0 0 0 Vitamin Blend 0.49 0.5 0 0 0 Total 98.69 100 5.75 20.22 1.03 Table 52. Recipe for protein bars made with high protein algal flakes replacing SPI and MPC. Component Weight (g) % % Fiber % Protein % Fat Corn syrup 63/43 49.7 52.21 0 0 0 High protein algal flakes 34.0 35.72 14.29 17.97 1.79 Cocoa Powder, Alkalized 8.0 8.40 2.69 1.89 0.92 Chocolate Flavor 0.47 0.49 0 0 0 Vanilla Flavor 0.375 0.39 0 0 0 Glycerine (99.5% USP) 2.16 2.27 0 0 0 Vitamin Blend 0.49 0.51 0 0 0 Total 95.20 100 16.98 19.86 2.71 Table 53. Recipe for protein bars made with high protein algal homogenate (AH) replacing SPI and MPC. Component Weight (g) % % Fiber % Protein % Fat Corn syrup 63/43 48.0 51.4 0 0 0 High Protein AH 34.0 36.41 14.56 18.31 1.82 Cocoa Powder, Alkalized 8.0 8.57 2.741 1.928 0.942 Chocolate Flavor 0.47 0.48 0 0 0 Vanilla Flavor 0.36 0.39 0 0 0 Glycerine (99.5% USP) 2.080 2.23 0 0 0 Vitamin Blend 0.49 0.52 0 0 0 Total 93.38 100 17.31 20.24 2.76 - In each case the cooking procedure was:
- 1. Blend all syrup ingredients.
- 2. Heat on stovetop to 190°F and hole for 10 minutes with the lid on. Stir occasionally.
- 3. Hold off heat for 10 minutes. Cool to about 140°F.
- 4. Combine with dry ingredients.
- 5. Portion into slabs and let set up overnight.
- 6. Cut into bars, coat with compound coating as desired and package.
- Overall, the protein bar made with the high protein algal homogenate showed slightly better binding compared to the protein bar made with the algal flakes. Also, the protein bar made with the algal homogenate required the least amount of corn syrup to bind the ingredients together. The protein bar made with the high protein algal homogenate was the more successful compostion compared to the conventional protein bar: for comparable amount of protein and fat, it contained about 3 times more dietary fiber.
- The following example compares a conventional chocolate flavored, nutritional beverage, with chocolate nutritional beverages made with either high protein algal flakes or high protein algal homogenate (AH), replacing the conventional protein sources (soy protein isolate (SPI) and milk protein concentrate (MPC)).
Table 54. Recipe for the conventional chocolate nutritional beverage. Component Weight (g) % Sugar % Fiber % Protein % Fat Water (filtered) 908.0 72.99 0 0 0 0 Sugar (granulated) 95.0 7.637 7.64 0 0 0 Corn Syrup 70.0 5.627 1.24 0 0 0 Maltodextrin 60.0 4.823 0 0 0 0 Milk Protein Isolate 44.0 3.53 0 0 2.86 0 Canola Oil 29.0 2.33 0 0 0 2.33 Cocoa Powder 15.0 1.206 0 0.39 0.27 0.13 Soy Protein Isolate 11.5 0.924 0 0 0.8 0.04 Disodium Phosphate 2.0 0.161 0 0 0 0 Lecithin 1.7 0.137 0 0 0 0 Stabilizer Blend 2.0 0.161 0 0 0 0 Flavor, vanilla 2.0 0.161 0 0 0 0 Flavor, chocolate 2.0 0.161 0 0 0 0 Vitamin blend 1.8 0.145 0 0 0 0 Total 1244 100 8.88 0.39 3.93 2.5 Table 55. Recipe for the chocolate nutritional beverage made with algal flakes replacing SPI, maltodextrin and milk protein isolate. Component Weight (g) % Sugar % Fiber % Protein % Fat Water (filtered) 910.0 74.959 0 0 0 0 Sugar (granulated) 92.5 7.619 7.62 0 0 0 Corn Syrup 70.0 5.766 1.27 0 0 0 High protein algal flakes 87.0 7.166 0 2.87 3.6 0 Canola Oil 28.0 2.306 0 0 0 2.31 Cocoa Powder 15.0 1.236 0 0.4 0.28 0.14 Disodium Phosphate 2.0 0.165 0 0 0 0 Lecithin 1.7 0.14 0 0 0 0 Stabilizer Blend 2.0 0.165 0 0 0 0 Flavor, vanilla 2.0 0.165 0 0 0 0 Flavor, chocolate 2.0 0.165 0 0 0 0 Vitamin blend 1.8 0.148 0 0 0 0 Total 1214 100 8.89 3.27 3.88 2.45 Table 56. Recipe for chocolate nutritional beverage made with high protein algal homogenate (AH) replacing SPI, maltodextrin and milk protein isolate. Component Weight (g) % Sugar % Fiber % Protein % Fat Water (filtered) 910.0 74.959 0 0 0 0 Sugar (granulated) 92.5 7.619 7.62 0 0 0 Corn Syrup 70.0 5.766 1.27 0 0 0 High protein AH 87.0 7.166 0 2.87 3.6 0 Canola Oil 28.0 2.306 0 0 0 2.31 Cocoa Powder 15.0 1.236 0 0.4 0.28 0.14 Disodium Phosphate 2.0 0.165 0 0 0 0 Lecithin 1.7 0.14 0 0 0 0 Stabilizer Blend 2.0 0.165 0 0 0 0 Flavor, vanilla 2.0 0.165 0 0 0 0 Flavor, chocolate 2.0 0.165 0 0 0 0 Vitamin blend 1.8 0.148 0 0 0 0 Total 1214 100 8.89 3.27 3.88 2.45 - The high protein algal homogenate produced a nutrional beverage that was thicker in body when compared to the conventional recipe beverage. The high protein algal flakes produced a nutritional beverage that was thinner than the control beverage. Overall, the beverage containing high protein algal homogenate was more successful in this application, producing a thick nutritional beverage with great opacity. The nutritional beverage made with algal homogenate was comparable to the conventional beverage in sugar, fat and protein levels, while containing almost ten times more fiber.
- Genomic DNA was isolated from algal biomass as follows. Cells (approximately 200 mg) were centifuged from
liquid cultures 5 minutes at 14,000 x g. Cells were then resuspended in sterile distilled water, centrifuged 5 minutes at 14,000 x g and the supernatant discarded. A single glass bead ~2mm in diameter was added to the biomass and tubes were placed at -80°C for at least 15 minutes. Samples were removed and 150 µl of grinding buffer (1% Sarkosyl, 0.25 M Sucrose, 50 mM NaCl, 20 mM EDTA, 100 mM Tris-HCl, pH 8.0, RNase A 0.5 ug/ul) was added. Pellets were resuspended by vortexing briefly, followed by the addition of 40 ul of 5M NaCl. Samples were vortexed briefly, followed by the addition of 66 µl of 5% CTAB (Cetyl trimethylammonium bromide) and a final brief vortex. Samples were next incubated at 65°C for 10 minutes after which they were centrifuged at 14,000 x g for 10 minutes. The supernatant was transferred to a fresh tube and extracted once with 300 µl of Phenol:Chloroform:Isoamyl alcohol 12:12:1, followed by centrifugation for 5 minutes at 14,000 x g. The resulting aqueous phase was transferred to a fresh tube containing 0.7 vol of isopropanol (~190 µl), mixed by inversion and incubated at room temperature for 30 minutes or overnight at 4°C. DNA was recovered via centrifugation at 14,000 x g for 10 minutes. The resulting pellet was then washed twice with 70% ethanol, followed by a final wash with 100% ethanol. Pellets were air dried for 20-30 minutes at room temperature followed by resuspension in 50 µl of 10mM TrisCl, 1mM EDTA (pH 8.0). - Five µl of total algal DNA, prepared as described above, was diluted 1:50 in 10 mM Tris, pH 8.0. PCR reactions,
final volume 20 µl, were set up as follows. Ten µl of 2 x iProof HF master mix (BIO-RAD) was added to 0.4 µl primer SZ02613 (5'-TGTTGAAGAATGAGCCGGCGAC-3' (SEQ ID NO:24) at 10mM stock concentration). This primer sequence runs from position 567-588 in Gen Bank accession no. L43357 and is highly conserved in higher plants and algal plastid genomes. This was followed by the addition of 0.4 µl primer SZ02615 (5'-CAGTGAGCTATTACGCACTC-3' (SEQ ID NO:25) at 10 mM stock concentration). This primer sequence is complementary to position 1112-1093 in Gen Bank accession no. L43357 and is highly conserved in higher plants and algal plastid genomes. Next, 5 µl of diluted total DNA and 3.2 µl dH2O were added. PCR reactions were run as follows: 98°C, 45"; 98°C, 8"; 53°C, 12"; 72°C, 20" for 35 cycles followed by 72°C for 1 min and holding at 25°C. For purification of PCR products, 20 µl of 10 mM Tris, pH 8.0, was added to each reaction, followed by extraction with 40 µl of Phenol:Chloroform:isoamyl alcohol 12:12:1, vortexing and centrifuging at 14,000 x g for 5 minutes. PCR reactions were applied to S-400 columns (GE Healthcare) and centrifuged for 2 minutes at 3,000 x g. Purified PCR products were subsequently TOPO cloned into PCR8/GW/TOPO and positive clones selected for on LB/Spec plates. Purified plasmid DNA was sequenced in both directions using M13 forward and reverse primers. Sequence alignments and unrooted trees were generated using Geneious DNA analysis software, shown in Figures 12a-12i. Sequences from strains 1-23 (designated in Example 13) are listed as SEQ ID NOs: 1-23 in the attached Sequence Listing. - Genomic DNA from 8 strains of Chlorella protothecoides (UTEX 25, UTEX 249, UTEX 250, UTEX 256, UTEX 264, UTEX 411, CCAP 211/17, and CCAP 211/8d) were isolated and genomic DNA analysis of 23S rRNA was performed according to the methods described above in Example 30. All strains of Chlorella protothecoides tested were identical in sequence except for UTEX 25. Results are summarized in Cladograms in Figures 13a-13c. Sequences for all eight strains are listed as SEQ ID NOs: 26 and 27 in the attached Sequence Listing.
- Three commercially purchased Chlorella samples, Chlorella regularis (New Chapter, 390mg/gelcap), Whole Foods Broken Cell Wall Chlorella (Whole Foods, 500mg/pressed tablet) and NutriBiotic CGF Chlorella (NutriBiotic, 500mg/pressed tablet), were genotyped using the methods described in Example 30. Approximately 200 mg of each commercially purchased Chlorella samples were resuspended and sterile distilled water for genomic DNA isolation.
- The resulting PCR products were isolated and cloned into vectors and sequenced using M13 forward and reverse primers. The sequences were compared to known sequences using a BLAST search.
- Comparison of 23s rRNA DNA sequences revealed that two out of the three commercially purchased Chlorella samples had DNA sequences matching Lyngbya aestuarii present (Whole Foods Broken Wall Chlorella and NutriBiotic CGF). Lyngbya aestuarii is a marine-species cynobacteria. These results show that some commercially available Chlorella contain other species of contaminating microorganisms, including organisms from genera such as Lyngbya that are known to produce toxins (see for example Teneva et. al, Environmental Toxicology, 18(1)1, pp. 9 - 20 (2003); Matthew et al., J Nat Prod., 71(6):pp. 1113-6 (2008); and Carmichael et al., Appl Environ Microbiol, 63(8): pp. 3104-3110 (1997).
- Chlorella protothecoides (UTEX 250) was grown according to the methods and conditions described in Example 1. Chemical mutagenesis was performed on the algal strain using N-methyl-N'-nitro-N-nitroguanidine (NTG). The algal culture was subjected to the mutagen (NTG) and then selected through rounds of reisolation on 2.0% glucose agar plates. The colonies were screened for color mutants. Chlorella protothecoides (wildtype) appears to be a golden color when grown heterotophically. The screen produced one strain that appeared white in color on the agar plate. This color mutant was named 33-55 (deposited on October 13, 2009 in accordance with the Budapest Treaty at the American Type Culture Collection at 10801 University Boulevard, Manassas, VA 20110-2209 with a Patent Deposit Designation of PTA-XXXX). Another colony was also isolated and went through three rounds of reisolation to confirm that this mutation was stable. This mutant appeared to be light yellow in color on the agar plate and was named 25-32 (deposited on October 13, 2009 in accordance with the Budapest Treaty at the American Type Culture Collection at 10801 University Boulevard, Manassas, VA 20110-2209 with a Patent Deposit Designation of PTA-XXXX).
- Chlorella protothecoides 33-55 and the parental Chlorella protothecoides (UTEX 250) were grown according to the methods and conditions described in Example 1. The percent lipid (by dry cell weight) was determined for both strains: Chlorella protothecoides 33-55 was at 68% lipid and the parental strain was at 62% lipid. The lipid profiles were determined for both strains and were as follows (expressed as area %): Chlorella protothecoides 33-55, C14:0 (0.81); C16:0 (10.35); C16:1 (0.20); C18:0 (4.09); C18:1 (72.16); C18:2 (10.60); C18:3 (0.10); and others (1.69); for the parental strain, C14:0 (0.77); C16:0 (9.67); C16:1 (0.22); C18:0 (4.73); C18:1 (71.45); C18:2 (10.99); C18:3 (0.14); and others (2.05).
- In order to evaluate if Chlorella protothecoides (UTEX 250) was able to utilize a non-food carbon source, cellulosic materials (exploded corn stover) was prepared for use as a carbon source for heterotrophic cultivation of Chlorella protothecoides that is suitable for use in any of the food applications described above in the preceeding Examples.
- Wet, exploded corn stover material was prepared by the National Renewable Energy Laboratory (Golden, CO) by cooking corn stover in a 1.4% sulfuric acid solution and dewatering the resultant slurry. Using a Mettler Toledo Moisture analyzer, the dry solids in the wet corn stover were determined to be 24%. A 100 g wet sample was resuspended in deionized water to a final volume of 420 ml and the pH was adjusted to 4.8 using 10 N NaOH. Celluclast™ (Novozymes) (a cellulase) was added to a final concentration of 4% and the resultant slurry incubated with shaking at 50°C for 72 hours. The pH of this material was then adjusted to 7.5 with NaOH (negligible volume change), filter sterilized through a 0.22um filter and stored at -20°C. A sample was reserved for determination of glucose concentration using a hexokinase based kit from Sigma, as described below.
- Glucose concentrations were determined using Sigma Glucose Assay Reagent #G3293. Samples, treated as outlined above, were diluted 400 fold and 40µl was added to the reaction. The corn stover cellulosic preparation was determined to contain approximately 23 g/L glucose.
- After enzymatic treatment and saccharification of cellulose to glucose, xylose, and other monosaccharide sugars, the material prepared above was evaluated as a feedstock for the growth of Chlorella protothecoides (UTEX 250) using the medium described in Example 1. Varying concentrations of cellulosic sugars mixed with pure glucose were tested (0, 12.5, 25, 50 and 100% cellulosic sugars). Cells were incubated in the dark on the varying concentrations of cellulosic sugars at 28°C with shaking (300 rpm). Growth was assessed by measurement of absorbance at 750nm in a UV spectrophotometer. Chlorella protothecoides cultures grew on the corn stover material prepared with Celluclast, including media conditions in which 100% of fermentable sugar was cellulosic-derived. Similar experiments were also performed using sugarbeet pulp treated with Accellerase as the cellulosic feedstock. Like the results obtained with corn stover material, all of the Chlorella protothecoides cultures were able to utilize the cellulosic-derived sugar as a carbon source.
- The publications mentioned herein are cited for the purpose of describing and disclosing reagents, methodologies and concepts that may be used in connection with the present invention. Nothing herein is to be construed as an admission that these references are prior art in relation to the inventions described herein.
- SEQ ID NO:1
- SEQ ID NO:2
- SEQ ID NO:3
- SEQ ID NO:4
- SEQ ID NO:5
- SEQ ID NO:6
- SEQ ID NO:7
- SEQ ID NO:8
- SEQ ID NO:9
- SEQ ID NO:10
- SEQ ID NO:11
- SEQ ID NO:12
- SEQ ID NO:13
- SEQ ID NO:14
- SEQ ID NO:15
- SEQ ID NO:16
- SEQ ID NO:17
- SEQ ID NO:18
- SEQ ID NO:19
- SEQ ID NO:20
- SEQ ID NO:21
- SEQ ID NO:22
- SEQ ID NO:23
- SEQ ID NO:24
- TGTTGAAGAATGAGCCGGCGAC
- SEQ ID NO:25
- CAGTGAGCTATTACGCACTC
- SEQ ID NO:26
- SEQ ID NO:27
Claims (20)
- A food composition comprising at least 0.1% w/w Chlorella protothecoides microalgal biomass and one or more other edible ingredient, wherein the microalgal biomass (i) comprises microalgal cells cultured under heterotrophic conditions, (ii) is reduced in green pigmentation, and (iii) comprises at least 10% oil by dry weight, wherein less than 5% by weight of the oil is docosahexanoic acid (DHA) (C22:6).
- The food composition of claim 1, wherein the microalgal biomass is predominantly intact cells.
- The food composition of claim 1, wherein the microalgal biomass is predominantly lysed cells.
- The food composition of claim 3, wherein the microalgal biomass is a homogenate.
- The food composition of claim 3, wherein the microalgal biomass comprises one or more of the following attributes:a. algal oil that is at least 50% by weight monounsaturated oil; orb. between 0-115 mcg/g of total carotenoids, optionally wherein the total carotenoids comprise between 0-70 mcg/g lutein.
- The food composition of claim 1, wherein the microalgal biomass comprises at least 25% or at least 40% algal oil by dry weight.
- The food composition of claim 1, that is a salad dressing, egg product, baked good, bread, bar, snack chip, pasta, sauce, soup, beverage, frozen dessert, butter or spread.
- The food composition of claim 1, wherein the microalgal biomass is microalgal powder having an average particle size from 0.2 to 10 microns.
- The food composition of any preceding claim that contains 10% less oil or fat by weight compared with conventional food products, optionally 25% less oil or fat by weight compared with conventional food products.
- The food composition of any preceding claim, wherein the microalgal cells are cultured in the presence of a limiting concentration of nitrogen and an excess of a fixed carbon source.
- A method of making a food composition of any one of claims 1 to 10 comprising combining the Chlorella protothecoides microalgal biomass with at least one other edible ingredient.
- The method of claim 11, wherein the microalgal cells are cultured in the presence of a limiting concentration of nitrogen and an excess of a fixed carbon source.
- The method of claim 11 comprising the steps of:a. determining the amount of non-algal oil, non-algal fat or egg in a conventional food product; andb. replacing all or a portion of the non-algal oil, non-algal fat or egg with a specified amount of microalgal biomass.
- The method of claim 13 wherein no non-algal oil, non-algal fat or egg is added to the food composition.
- The method of claim 13, wherein the amount of microalgal biomass is from 0.25 times to 4 times the mass or volume of the non-algal oil, non-algal fat or egg in the conventional food product.
- The method of claim 13, wherein the food composition contains 10% less oil or fat by weight compared to the conventional food, optionally 25% less oil or fat by weight compared to the conventional food.
- A microalgal powder that (i) comprises Chlorella protothecoides microalgal cells cultured under heterotrophic conditions, (ii) is reduced in green pigmentation, and (iii) comprises at least 10% oil by dry weight, wherein less than 5% by weight of the oil is docosahexanoic acid (DHA) (C22:6), wherein the microalgal powder has been pasteurized.
- The microalgal powder of claim 17 that comprises a preservative.
- The microalgal powder of claim 17 comprising between 0-115 mcg/g of total carotenoids, optionally wherein the total carotenoids comprise between 0-70 mcg/g lutein.
- The microalgal powder of claim 17, wherein the microalgal cells are cultured in the presence of a limiting concentration of nitrogen and an excess of a fixed carbon source.
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10512108P | 2008-10-14 | 2008-10-14 | |
| US15718709P | 2009-03-03 | 2009-03-03 | |
| US17316609P | 2009-04-27 | 2009-04-27 | |
| US24607009P | 2009-09-25 | 2009-09-25 | |
| PCT/US2009/060692 WO2010045368A2 (en) | 2008-10-14 | 2009-10-14 | Food compositions of microalgal biomass |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| EP2339925A2 EP2339925A2 (en) | 2011-07-06 |
| EP2339925A4 EP2339925A4 (en) | 2015-04-29 |
| EP2339925B1 true EP2339925B1 (en) | 2022-09-21 |
Family
ID=42107212
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP09821204.6A Active EP2339925B1 (en) | 2008-10-14 | 2009-10-14 | Food compositions of microalgal biomass |
Country Status (11)
| Country | Link |
|---|---|
| US (1) | US20100239712A1 (en) |
| EP (1) | EP2339925B1 (en) |
| JP (4) | JP5731982B2 (en) |
| CN (2) | CN104770424A (en) |
| AU (1) | AU2009303354C9 (en) |
| BR (1) | BRPI0920280B8 (en) |
| CA (1) | CA2740415C (en) |
| DK (1) | DK2339925T3 (en) |
| MX (2) | MX339664B (en) |
| PT (1) | PT2339925T (en) |
| WO (1) | WO2010045368A2 (en) |
Families Citing this family (170)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2352001T3 (en) | 2000-01-19 | 2011-02-14 | Martek Biosciences Corporation | NON-SOLVENT EXTRACTION PROCEDURE. |
| CN104212844A (en) | 2007-06-01 | 2014-12-17 | 索拉兹米公司 | Production of Oil in Microorganisms |
| US20090118228A1 (en) * | 2007-11-07 | 2009-05-07 | Bristol-Myers Squibb Company | Carotenoid-containing compositions and methods |
| EP2238231B1 (en) | 2008-01-03 | 2016-03-23 | Proterro, Inc. | Transgenic photosynthetic microorganisms and photobioreactor |
| US20100170144A1 (en) * | 2008-04-09 | 2010-07-08 | Solazyme, Inc. | Hydroprocessing Microalgal Oils |
| MX338039B (en) | 2008-04-09 | 2016-03-30 | Solazyme Inc | Direct chemical modification of microbial biomass and microbial oils. |
| US20160324167A1 (en) | 2008-10-14 | 2016-11-10 | Terravia Holdings, Inc. | Novel microalgal food compositions |
| US20100303961A1 (en) * | 2008-10-14 | 2010-12-02 | Solazyme, Inc. | Methods of Inducing Satiety |
| US20100297295A1 (en) * | 2008-10-14 | 2010-11-25 | Solazyme, Inc. | Microalgae-Based Beverages |
| US20100297331A1 (en) * | 2008-10-14 | 2010-11-25 | Solazyme, Inc. | Reduced Fat Foods Containing High-Lipid Microalgae with Improved Sensory Properties |
| US20100303989A1 (en) * | 2008-10-14 | 2010-12-02 | Solazyme, Inc. | Microalgal Flour |
| BRPI0920280B8 (en) * | 2008-10-14 | 2022-11-16 | Corbion Biotech Inc | FOOD COMPOSITION AND METHOD FOR MANUFACTURING A FOOD COMPOSITION |
| US20100303957A1 (en) * | 2008-10-14 | 2010-12-02 | Solazyme, Inc. | Edible Oil and Processes for Its Production from Microalgae |
| US20100297325A1 (en) * | 2008-10-14 | 2010-11-25 | Solazyme, Inc. | Egg Products Containing Microalgae |
| US20100303990A1 (en) * | 2008-10-14 | 2010-12-02 | Solazyme, Inc. | High Protein and High Fiber Algal Food Materials |
| US9090881B2 (en) * | 2008-10-21 | 2015-07-28 | Canadian Pacific Algae Inc. | Method for the efficient and continuous growth and harvesting of nutrient-rich phytoplankton and methods of using the same |
| EP2949745A1 (en) * | 2008-11-18 | 2015-12-02 | Asahi Group Holdings, Ltd. | Method for producing amino acid-rich yeast |
| EP2370554B1 (en) | 2008-11-28 | 2019-05-15 | Corbion Biotech, Inc. | Manufacturing of tailored oils in recombinant heterotrophic microorganisms |
| EP2215913A1 (en) | 2009-01-23 | 2010-08-11 | Nutreco Nederland B.V. | Animal feed additive and animal feed comprising alkyl esters of medium chain fatty acids, and their use in animal feed |
| KR101769121B1 (en) * | 2009-04-14 | 2017-08-17 | 테라비아 홀딩스 인코포레이티드 | Novel microalgal food compositions |
| EP2421934A4 (en) | 2009-04-21 | 2014-06-18 | Sapphire Energy Inc | Methods of preparing oil compositions for fuel refining |
| US8202425B2 (en) | 2010-04-06 | 2012-06-19 | Heliae Development, Llc | Extraction of neutral lipids by a two solvent method |
| US8273248B1 (en) | 2010-04-06 | 2012-09-25 | Heliae Development, Llc | Extraction of neutral lipids by a two solvent method |
| US8211309B2 (en) | 2010-04-06 | 2012-07-03 | Heliae Development, Llc | Extraction of proteins by a two solvent method |
| US8313648B2 (en) | 2010-04-06 | 2012-11-20 | Heliae Development, Llc | Methods of and systems for producing biofuels from algal oil |
| US8115022B2 (en) | 2010-04-06 | 2012-02-14 | Heliae Development, Llc | Methods of producing biofuels, chlorophylls and carotenoids |
| US8475660B2 (en) | 2010-04-06 | 2013-07-02 | Heliae Development, Llc | Extraction of polar lipids by a two solvent method |
| US8211308B2 (en) | 2010-04-06 | 2012-07-03 | Heliae Development, Llc | Extraction of polar lipids by a two solvent method |
| US8308951B1 (en) | 2010-04-06 | 2012-11-13 | Heliae Development, Llc | Extraction of proteins by a two solvent method |
| US8476412B2 (en) | 2010-04-06 | 2013-07-02 | Heliae Development, Llc | Selective heated extraction of proteins from intact freshwater algal cells |
| US8053007B2 (en) | 2010-04-13 | 2011-11-08 | Mark Innocenzi | Compositions and methods for fortifying a base food to contain the complete nutritional value of a standard equivalent unit of the nutritional value of one serving of fruits and vegetables (“SFV”) for human consumption |
| WO2011130576A1 (en) * | 2010-04-14 | 2011-10-20 | Solazyme, Inc. | Oleaginous yeast food compositions |
| JP5865894B2 (en) * | 2010-04-14 | 2016-02-17 | ソラザイム ロケット ニュートリショナルズ, エルエルシー | High lipid microalgae powder food composition |
| EP2576800B1 (en) | 2010-05-28 | 2019-01-30 | Corbion Biotech, Inc. | Method for producing oils from Prototheca |
| CA2801011C (en) | 2010-06-01 | 2019-02-26 | Dsm Ip Assests B.V. | Extraction of lipid from cells and products therefrom |
| US8906236B2 (en) | 2010-07-26 | 2014-12-09 | Sapphire Energy, Inc. | Process for the recovery of oleaginous compounds and nutrients from biomass |
| AU2011265588B2 (en) | 2010-07-26 | 2012-05-24 | Sapphire Energy, Inc. | Process for the recovery of oleaginous compounds from biomass |
| US9028696B2 (en) | 2010-07-26 | 2015-05-12 | Sapphire Energy, Inc. | Process for the recovery of oleaginous compounds from biomass |
| AU2011323288B2 (en) | 2010-11-03 | 2016-05-26 | Corbion Biotech, Inc. | Microbial oils with lowered pour points, dielectric fluids produced therefrom, and related methods |
| AU2012212079B2 (en) | 2011-02-02 | 2016-07-28 | Corbion Biotech, Inc. | Tailored oils produced from recombinant oleaginous microorganisms |
| CH704486A2 (en) * | 2011-02-05 | 2012-08-15 | Hanspeter Steffen | Vegetarian feeding method for carnivorous fish and shrimp with spirulina and chlorella algae using electrolysis water and sodium thiosulphate, guar and oligofructans as additives. |
| CN103841825B (en) * | 2011-02-11 | 2017-03-22 | 纳幕尔杜邦公司 | Method for obtaining a lipid-containing composition from microbial biomass |
| MX339607B (en) | 2011-05-06 | 2016-05-31 | Solazyme Inc | Genetically engineered microorganisms that metabolize xylose. |
| EP2543253A1 (en) * | 2011-07-07 | 2013-01-09 | Sime Darby Malaysia Berhad | Use of a fat composition in a dough for bakery products and process for the preparation of said fat composition |
| JP5915831B2 (en) * | 2011-07-28 | 2016-05-11 | 株式会社日健総本社 | Formidium Luldomum culture method |
| AU2012294369A1 (en) | 2011-08-09 | 2014-02-20 | Sapphire Energy, Inc. | Compositions of matter comprising extracted algae oil |
| US20140242109A1 (en) * | 2011-09-09 | 2014-08-28 | Kaneka Corporation | Method for cultivating alga and method for producing alginic acid-containing composition |
| WO2013075116A2 (en) | 2011-11-17 | 2013-05-23 | Heliae Development, Llc | Omega 7 rich compositions and methods of isolating omega 7 fatty acids |
| CA2857017A1 (en) | 2011-11-28 | 2013-06-06 | Solazyme, Inc. | Genetically engineered microbial strains including prototheca lipid pathway genes |
| EP2839018B1 (en) | 2012-04-18 | 2019-06-05 | Corbion Biotech, Inc. | Tailored oils |
| US9719114B2 (en) | 2012-04-18 | 2017-08-01 | Terravia Holdings, Inc. | Tailored oils |
| EP2844735B1 (en) | 2012-05-04 | 2019-06-26 | Corbion Biotech, Inc. | Flavor, odor, and/or colorant compositions with oleaginous microorganisms and related methods |
| MX362256B (en) * | 2012-05-07 | 2019-01-09 | Algal Scient Corporation | Multi-stage process for production of immune modulator. |
| DE102012108840A1 (en) * | 2012-09-20 | 2014-03-20 | Pm-International Ag | Sports drink with algae powder |
| US20140087026A1 (en) * | 2012-09-26 | 2014-03-27 | Dianaplantsciences, S.A.S. | Novel food composition of whole plant cells |
| MX377707B (en) | 2012-10-17 | 2025-03-11 | Corbion Biotech Inc | MICROALGAE FLOUR GRANULES AND PROCESS FOR PREPARING THE SAME. |
| KR101424343B1 (en) | 2012-10-26 | 2014-08-01 | 김병두 | Method for making capsule seaweed using extraction by pressing raw seaweed |
| EP2724625A1 (en) | 2012-10-26 | 2014-04-30 | Roquette Freres | Microalgal flour granules and process for preparation thereof |
| WO2014074770A2 (en) | 2012-11-09 | 2014-05-15 | Heliae Development, Llc | Balanced mixotrophy methods |
| WO2014074772A1 (en) | 2012-11-09 | 2014-05-15 | Heliae Development, Llc | Mixotrophic, phototrophic, and heterotrophic combination methods and systems |
| BR112015013193A2 (en) | 2012-12-07 | 2017-07-11 | Solazyme Inc | recombinant nucleic acid, expression cassette, cell, method for obtaining microbial oil, microbial oil, and method for obtaining microbial oil. |
| US10098371B2 (en) | 2013-01-28 | 2018-10-16 | Solazyme Roquette Nutritionals, LLC | Microalgal flour |
| FR3001736B1 (en) * | 2013-02-06 | 2016-03-04 | Roquette Freres | BIOMASS OF MICROALGUE SCHIZOCHYTRIUM MANGROVEI AND METHOD FOR PREPARING THE SAME |
| EP2777400A1 (en) * | 2013-03-15 | 2014-09-17 | Roquette Freres | Microalgal flour granules and process for preparation thereof |
| US20160046900A1 (en) | 2013-03-29 | 2016-02-18 | Roquette Freres | Microalgal biomass protein enrichment method |
| US9249252B2 (en) | 2013-04-26 | 2016-02-02 | Solazyme, Inc. | Low polyunsaturated fatty acid oils and uses thereof |
| FR3007625B1 (en) * | 2013-06-26 | 2015-07-17 | Roquette Freres | PROCESS FOR PRODUCING MICROALGUES BIOMASS WITH OPTIMIZED SENSORY QUALITY |
| FR3007837B1 (en) * | 2013-06-26 | 2015-07-17 | Roquette Freres | MICROALGUE FLOUR COMPOSITIONS OF OPTIMIZED SENSORY QUALITY |
| FR3008001B1 (en) | 2013-07-04 | 2017-05-05 | Roquette Freres | OPTIMIZED METHOD OF BREAKING CHLORELLA WALLS BY MECHANICAL MILLING |
| WO2015006541A2 (en) * | 2013-07-11 | 2015-01-15 | Cornell University | Algal-based animal feed composition containing exogenous protease animal feed supplement, and uses thereof |
| EP2826384A1 (en) | 2013-07-16 | 2015-01-21 | Evonik Industries AG | Method for drying biomass |
| FR3008581B1 (en) | 2013-07-19 | 2016-11-04 | Roquette Freres | LIPID RICH MICROALGUE FLOUR AND PROCESS FOR PREPARING THE SAME |
| FR3008712B1 (en) | 2013-07-19 | 2016-09-16 | Roquette Freres | OPTIMIZED METHOD OF BREAKING THE WALLS OF CHLORELS BY HOMOGENIZATION AT VERY HIGH PRESSURE |
| US20160194598A1 (en) * | 2013-07-25 | 2016-07-07 | Roquette Freres | Method for optimising the production efficiency, organoleptic quality and stability over time of a protein-rich microalgae biomass |
| FR3009619B1 (en) | 2013-08-07 | 2017-12-29 | Roquette Freres | BIOMASS COMPOSITIONS OF MICROALGUES RICH IN PROTEINS OF SENSORY QUALITY OPTIMIZED |
| KR20160041927A (en) * | 2013-08-13 | 2016-04-18 | 로께뜨프레르 | Method for preparing lipid-rich compositions of microalga flour with optimised organoleptic properties |
| WO2015025111A1 (en) | 2013-08-23 | 2015-02-26 | Roquette Freres | Method for the industrial production of flour from lipid-rich microalga biomass with no "off-notes" by controlling the oxygen availability |
| CN105829521A (en) | 2013-10-04 | 2016-08-03 | 索拉兹米公司 | Tailored oils |
| KR20160070755A (en) * | 2013-10-18 | 2016-06-20 | 로께뜨프레르 | Process for texturing a microalgal biomass |
| WO2015073770A1 (en) * | 2013-11-15 | 2015-05-21 | Archer Daniels Midland Company | Methods of feeding animals fermentation cell mass |
| FR3013186B1 (en) | 2013-11-19 | 2019-07-19 | Roquette Freres | NOVEL NON-ALLERGENIC SNACKS CONTAINING PLANT PROTEINS |
| US10299500B2 (en) | 2013-11-29 | 2019-05-28 | Corbion Biotech, Inc. | Granules of protein-rich microalgal biomass flour and method for preparing same |
| CN106029624B (en) | 2013-12-20 | 2021-12-07 | 帝斯曼知识产权资产管理有限公司 | Method for obtaining microbial oil from microbial cells |
| AR098896A1 (en) | 2013-12-20 | 2016-06-22 | Dsm Ip Assets Bv | PROCESS FOR OBTAINING MICROBIAL OIL FROM MICROBIAL CELLS |
| AU2014369045B2 (en) | 2013-12-20 | 2020-02-27 | Dsm Ip Assets B.V. | Processes for obtaining microbial oil from microbial cells |
| NZ721417A (en) | 2013-12-20 | 2022-07-01 | Dsm Ip Assets Bv | Processes for obtaining microbial oil from microbial cells |
| TWI646189B (en) | 2013-12-20 | 2019-01-01 | 荷蘭商Dsm智慧財產有限公司 | Method for obtaining microbial oil from microbial cells (5) |
| ES2709381T3 (en) * | 2014-01-20 | 2019-04-16 | Corbion Biotech Inc | Method of enrichment of biomass of microalgae with proteins |
| KR20160134657A (en) * | 2014-03-18 | 2016-11-23 | 로께뜨프레르 | Method for thermal permeabilization of a microalgae biomass |
| WO2015149026A1 (en) | 2014-03-28 | 2015-10-01 | Solazyme, Inc. | Lauric ester compositions |
| WO2015191449A2 (en) | 2014-06-08 | 2015-12-17 | Solazyme, Inc. | Personal care products containing microalgae or extracts thereof |
| WO2015200888A1 (en) | 2014-06-27 | 2015-12-30 | Solazyme, Inc. | High-protein food products made using high-protein microalgae |
| JP2016010383A (en) * | 2014-06-30 | 2016-01-21 | Jx日鉱日石エネルギー株式会社 | Dry cell powder containing carotenoid and method for producing the same |
| EP3167053B1 (en) | 2014-07-10 | 2019-10-09 | Corbion Biotech, Inc. | Novel ketoacyl acp synthase genes and uses thereof |
| WO2016011410A1 (en) | 2014-07-17 | 2016-01-21 | Cornell University | Omega-3 fatty acid enrichment of poultry products with defatted microalgae animal feed |
| BR112017000805B1 (en) * | 2014-07-18 | 2023-04-11 | Corbion Biotech, Inc | METHOD FOR PREPARING A PROTEIN ISOLATE FROM MICROALGAE BIOMASS OF THE GENUS CHLORELLA |
| WO2016014912A1 (en) | 2014-07-24 | 2016-01-28 | Solazyme, Inc. | High-protein gelled food products made using high-protein microalgae |
| US11213048B2 (en) | 2014-07-25 | 2022-01-04 | Smallfood, Inc. | Protein rich food ingredient from biomass and methods of preparation |
| US11122817B2 (en) | 2014-07-25 | 2021-09-21 | Smallfood Inc. | Protein rich food ingredient from biomass and methods of production |
| BR112017006838B1 (en) | 2014-10-02 | 2021-07-06 | Evonik Operations Gmbh | PROCESS TO PRODUCE AN ANIMAL FOOD COMPRISING BIOMASS CONTAINING PUFFA, ANIMAL FOOD AND AN ANIMAL BREEDING METHOD |
| EP3200606B1 (en) | 2014-10-02 | 2021-03-31 | Evonik Operations GmbH | Method for producing feed containing pufas by extrusion of a biomass containing pufas of the labyrinthulomycetes type |
| US11464244B2 (en) | 2014-10-02 | 2022-10-11 | Evonik Operations Gmbh | Feedstuff of high abrasion resistance and good stability in water, containing PUFAs |
| EP3200604B2 (en) | 2014-10-02 | 2025-05-07 | Evonik Operations GmbH | Method for preparing an animal feed |
| WO2016100681A1 (en) | 2014-12-17 | 2016-06-23 | Solazyme, Inc. | Microalgal derived cleaners and surfactants |
| FR3030191B1 (en) | 2014-12-18 | 2018-03-23 | Corbion Biotech, Inc. | COMPOSITION FOR FRESH FAT OIL PRODUCT AND METHOD OF MANUFACTURE |
| FR3031985B1 (en) * | 2015-01-26 | 2017-02-17 | Roquette Freres | PROCESS FOR OBTAINING PEPTIDE ISOLATE FROM BIOMASS OF MICROALGUES ENRICHED IN PROTEINS |
| FR3031987B1 (en) * | 2015-01-26 | 2019-05-24 | Corbion Biotech, Inc. | METHOD FOR FRACTIONING COMPONENTS OF A BIOMASS OF MICROALGUES RICH IN PROTEINS |
| SG11201707876YA (en) | 2015-03-24 | 2017-10-30 | Terravia Holdings Inc | Microalgal compositions and uses thereof |
| ES2908296T3 (en) | 2015-03-31 | 2022-04-28 | Corbion Biotech Inc | Microalgae adapted to heterotrophic culture conditions |
| BR112017023059B1 (en) | 2015-04-28 | 2022-07-05 | Mars, Incorporated | PROCESS FOR PREPARING A STERILIZED MOIST FOOD PRODUCT, STERILIZED MOIST FOOD PRODUCT, AND THEIR USE |
| EP3297445A1 (en) * | 2015-05-19 | 2018-03-28 | Roquette Freres | Noodles and noodle dough containing a microalgal flour |
| CN105029428A (en) * | 2015-06-15 | 2015-11-11 | 杭州鑫伟低碳技术研发有限公司 | Method for preparing water-soluble chlorella holographic nutrition powder from fresh chlorella mud |
| CN105028571A (en) * | 2015-06-19 | 2015-11-11 | 惠东县华宝食品有限公司 | Melaleuca cake containing chlorella pyrenoidosa |
| WO2017019125A1 (en) * | 2015-07-24 | 2017-02-02 | Synthetic Genomics, Inc. | A protein rich food ingredient from biomass and methods of production |
| TWI564388B (en) * | 2015-08-04 | 2017-01-01 | 國立中山大學 | Novel tetraselmis sp. ds3 and uses thereof |
| US20170208834A1 (en) * | 2016-01-25 | 2017-07-27 | Synthetic Genomics, Inc. | Protein containing material from biomass and methods of production |
| JP6980283B2 (en) * | 2016-01-27 | 2021-12-15 | スモールフード インコーポレイテッド | Protein-containing material Biomass and production method |
| ES2786195T3 (en) | 2016-02-08 | 2020-10-09 | Corbion Biotech Inc | Procedure for protein enrichment of microalgae biomass |
| KR101901608B1 (en) * | 2016-06-01 | 2018-09-28 | 한양대학교 산학협력단 | Dunaliella mutant and method for preparing pigment using the same |
| US11419350B2 (en) | 2016-07-01 | 2022-08-23 | Corbion Biotech, Inc. | Feed ingredients comprising lysed microbial cells |
| TW201825010A (en) * | 2016-09-26 | 2018-07-16 | 美商新浪食品公司 | Algae or plant based edible compositions |
| SG10201608832TA (en) * | 2016-10-20 | 2018-05-30 | Nissin Foods Holdings Co Ltd | Whole egg powder and puffed egg product using the same |
| WO2018089516A1 (en) * | 2016-11-08 | 2018-05-17 | North Carolina State University | Encapsulation of nutritional and/or compounds for controlled release and enhancing their bioavailability by limiting chemical or microbial exposure |
| EP3569070A4 (en) * | 2017-01-12 | 2020-10-07 | Mitsubishi Gas Chemical Company, Inc. | Capsule containing pyrroloquinoline quinone or salt thereof and branched chain amino acid |
| CN106666671A (en) * | 2017-01-21 | 2017-05-17 | 云南瑞宝生物科技股份有限公司 | Salad sauce containing xangold and preparation method of salad sauce |
| CZ308610B6 (en) * | 2017-02-07 | 2020-12-30 | Ecofuel Laboratories S R O | A liquid or pastelike product based on microalgae and/or cyanobacteria and/or myxomycetes |
| EP3381301A1 (en) | 2017-03-30 | 2018-10-03 | Golden Chlorella SA | Methods of preparation of food products comprising microalgae & products thereof |
| CN109393025A (en) * | 2017-08-16 | 2019-03-01 | 内蒙古伊利实业集团股份有限公司 | A kind of Yoghourt and preparation method thereof |
| MY203865A (en) * | 2018-02-02 | 2024-07-22 | Commw Scient Ind Res Org | Protecting a bioactive and/or precursor thereof |
| US10806169B2 (en) | 2018-05-15 | 2020-10-20 | Kate Farms, Inc. | Hydrolyzed pea protein-based nutrient composition |
| US12558370B2 (en) | 2018-06-12 | 2026-02-24 | Kate Farms, Inc. | Intact pea protein-based nutrient composition |
| CN109181842B (en) * | 2018-08-20 | 2021-03-26 | 梁云 | Microbial oil and extraction method thereof |
| MX2021005444A (en) * | 2018-11-08 | 2021-06-15 | Triton Algae Innovations Inc | Methods for overproducing protoporphyrin ix in algae and compositions therefrom. |
| GB2579099B (en) * | 2018-11-21 | 2020-12-09 | Spicer Consulting Ltd | Modified Chlorella vulgaris strain with very low chlorophyll content |
| AU2019101234B4 (en) * | 2018-12-07 | 2020-09-03 | Atp Institute Pty Ltd | Formulation and method of use |
| SG11202103069VA (en) * | 2019-05-22 | 2021-04-29 | Mizkan Holdings Co Ltd | Solid composition containing insoluble dietary fiber and method for manufacturing the same |
| CA3143901A1 (en) * | 2019-06-28 | 2020-12-30 | Noblegen Inc. | Methods of protein extraction and downstream processing of euglena |
| KR102563596B1 (en) * | 2019-09-06 | 2023-08-04 | 주식회사 에스알씨 | Pork cutlet comprising marine microalgae with enforcing organic selenium and method for manufacturing thereof |
| WO2021116949A1 (en) * | 2019-12-09 | 2021-06-17 | Noblegen Inc. | Egg replacement containing euglena-derived components |
| US20230022786A1 (en) * | 2019-12-13 | 2023-01-26 | Conopco, Inc., D/B/A Unilever | Dressing composition comprising microalgal protein |
| CN118124217A (en) | 2019-12-18 | 2024-06-04 | 格纹蛱蝶公司 | Use of Microbial Derived Materials in Polymer Applications |
| MX2022011034A (en) * | 2020-03-06 | 2022-10-13 | The Protein Brewery B V | Pasteurisation of microbial biomass suitable for food applications. |
| WO2021252670A1 (en) * | 2020-06-09 | 2021-12-16 | Heliae Development, Llc | Chlorella compositions and methods of use thereof to enhance plant growth |
| KR102614724B1 (en) * | 2020-08-28 | 2023-12-15 | 대상 주식회사 | A beverage composition containing chlorophyll-deficient chlorella and a process for preparing the same |
| KR102636793B1 (en) * | 2020-08-28 | 2024-02-15 | 대상 주식회사 | A process for preparing wet noodles using chlorophyll-deficient chlorella |
| CN112293452B (en) * | 2020-09-04 | 2022-05-20 | 天津市利民调料有限公司 | Instant high-fiber soybean dreg red yeast rice crisp chips and preparation method thereof |
| BE1028595B1 (en) | 2020-09-10 | 2022-04-11 | Krias | Improved Pasta |
| NL2026504B1 (en) | 2020-09-18 | 2022-05-23 | Fumi Ingredients B V | A microbial cell product, method for obtaining said microbial cell product, and use of said microbial cell product |
| GB202015836D0 (en) * | 2020-10-06 | 2020-11-18 | Hamlet Pharma Ab | Compositions |
| CN112120109A (en) * | 2020-10-10 | 2020-12-25 | 天津科技大学 | A kind of microalgae energy bar and preparation method thereof |
| AU2022217829A1 (en) * | 2021-02-04 | 2023-09-21 | Lance EDLING | Systems and methods for treating biologically contaminated water streams |
| CN115261126A (en) * | 2021-04-30 | 2022-11-01 | 苏州海益生物医药科技有限公司 | Substance, preparation method and application thereof in medicine |
| WO2022234336A1 (en) * | 2021-05-04 | 2022-11-10 | Sovida Solutions Ltd. | Nicotinamide adenine dinucleotide (nad) compositions, methods of manufacturing thereof, and methods of use thereof |
| CN113142527A (en) * | 2021-05-21 | 2021-07-23 | 甘肃陇萃堂营养保健食品股份有限公司 | High-dilution-factor pre-packaged beef noodle freeze-dried soup block and making method thereof |
| JP7664125B2 (en) * | 2021-09-10 | 2025-04-17 | 株式会社ニップン | Pet food manufacturing method |
| WO2023043945A2 (en) | 2021-09-17 | 2023-03-23 | Checkerspot, Inc. | High oleic oil compositions and uses thereof |
| WO2023091669A1 (en) | 2021-11-19 | 2023-05-25 | Checkerspot, Inc. | Recycled polyurethane formulations |
| WO2023102069A1 (en) | 2021-12-01 | 2023-06-08 | Checkerspot, Inc. | Polyols, polyurethane dispersions, and uses thereof |
| CN114343021B (en) * | 2021-12-22 | 2024-04-05 | 嘉必优生物技术(武汉)股份有限公司 | Application of DHA algae oil for improving fishy smell in edible oil |
| US20230217959A1 (en) * | 2022-01-12 | 2023-07-13 | Hillel Trope | Dog biscuit |
| EP4486138A1 (en) * | 2022-02-28 | 2025-01-08 | Société des Produits Nestlé S.A. | Method of brightening a texturized protein product |
| CN115418320B (en) * | 2022-08-17 | 2023-09-22 | 中国农业科学院都市农业研究所 | A strain of Chlorella pyrenoidosa with high protein production and its cultivation method and application |
| CN115627241B (en) * | 2022-10-13 | 2025-09-16 | 阿尔格河北生命科学有限公司 | Cultivation method of nitrogen-fixing anabaena |
| WO2024160738A1 (en) * | 2023-01-30 | 2024-08-08 | Unilever Ip Holdings B.V. | Food composition |
| EP4658754A1 (en) * | 2023-01-30 | 2025-12-10 | Algenuity BV | Algae biomass |
| GB2628414A (en) * | 2023-03-24 | 2024-09-25 | Bevo Biotehnoloske Resitve D O O | Fat analogue |
| KR20240167375A (en) * | 2023-05-19 | 2024-11-26 | 한국과학기술원 | Production of microbial-based alternative egg liquid and milk and uses thereof |
| CN117678727B (en) * | 2023-12-14 | 2024-07-16 | 山东海之宝海洋科技有限公司 | Use of lactobacillus fermentation in the preparation of a flavoring |
| EP4643657A1 (en) * | 2024-04-30 | 2025-11-05 | Velocity Life Sciences, LLC | Compositions containing short-chain fatty acid, methods of use, and methods of making thereof |
| US12226383B1 (en) | 2024-04-30 | 2025-02-18 | Velocity Life Sciences, LLC | Compositions containing short-chain fatty acid, methods of use, and methods of making thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS517138A (en) * | 1974-06-21 | 1976-01-21 | Chlorella Ind |
Family Cites Families (91)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US2967700A (en) * | 1955-03-01 | 1961-01-10 | Morris B Kallison | Whipping and aerating apparatus |
| US3142135A (en) * | 1962-02-13 | 1964-07-28 | Grain Processing Corp | Production of carotenoids by the cultivation of algae |
| US3280502A (en) * | 1962-11-07 | 1966-10-25 | Hoffmann La Roche | Process for the preparation of lutein |
| US3320693A (en) * | 1964-09-11 | 1967-05-23 | Kk | Method of industral cultivation of unicellular green algae such as chlorella |
| FR1510761A (en) | 1966-03-03 | 1968-01-19 | Mo Och Domsjoe Ab | Process for increasing the yield of alkaline pulp preparation |
| JPS4843872B1 (en) * | 1970-04-23 | 1973-12-21 | ||
| JPS5328989B2 (en) * | 1974-05-27 | 1978-08-17 | ||
| US3957578A (en) * | 1975-01-03 | 1976-05-18 | Hokkaido Sugar Co., Ltd. | Method for manufacture of α-galactosidase by microorganism |
| JPS5254035A (en) * | 1975-10-30 | 1977-05-02 | Idemitsu Kosan Co Ltd | Cosmetic pack |
| US4182777A (en) * | 1977-03-01 | 1980-01-08 | Standard Oil Company (Indiana) | Co-dried yeast whey food product and process |
| IL57712A (en) * | 1979-07-03 | 1984-02-29 | Yissum Res Dev Co | Cultivation of halophilic algae of the dunaliella species for the production of fuel-like product |
| US4373434A (en) * | 1980-11-24 | 1983-02-15 | Simon-Rosedowns Limited | Apparatus for the expansion of oil bearing seeds |
| JPS57150379A (en) * | 1981-03-14 | 1982-09-17 | Kikujiro Ishiwatari | Crushing of cell membrane of chlorella |
| US4390561A (en) * | 1981-11-04 | 1983-06-28 | The Procter & Gamble Company | Margarine oil product |
| US4519845A (en) * | 1984-02-09 | 1985-05-28 | Uop Inc. | Separation of sucrose from molasses |
| US5792631A (en) * | 1985-07-01 | 1998-08-11 | Dcv, Inc. | Microbial process for the production of ascorbic acid using Chlorella protothecoides |
| US5900370A (en) * | 1985-07-01 | 1999-05-04 | Bio-Technical Resources | Process for the production of ascorbic acid with prototheca |
| JPS6261568A (en) * | 1985-09-13 | 1987-03-18 | Iwao Sasaki | Production of fine chlorella powder |
| JPS633764A (en) * | 1986-06-24 | 1988-01-08 | Nisshin Oil Mills Ltd:The | Feed for seeding production |
| FR2626584B1 (en) * | 1988-01-28 | 1990-07-13 | Agronomique Inst Nat Rech | EFFECTIVE ARS SEQUENCE IN YARROWIA LIPOLYTICA AND PROCESS FOR ITS PREPARATION |
| US4901635A (en) * | 1988-04-08 | 1990-02-20 | Anderson International Corp. | Apparatus and method for the continuous extrusion and partial deliquefaction of oleaginous materials |
| US5340742A (en) * | 1988-09-07 | 1994-08-23 | Omegatech Inc. | Process for growing thraustochytrium and schizochytrium using non-chloride salts to produce a microfloral biomass having omega-3-highly unsaturated fatty acids |
| US5130242A (en) * | 1988-09-07 | 1992-07-14 | Phycotech, Inc. | Process for the heterotrophic production of microbial products with high concentrations of omega-3 highly unsaturated fatty acids |
| US5407957A (en) * | 1990-02-13 | 1995-04-18 | Martek Corporation | Production of docosahexaenoic acid by dinoflagellates |
| DE4004800C2 (en) * | 1990-02-13 | 2000-12-21 | Aventis Cropscience Gmbh | Transgenic plants changed in habit and yield |
| JPH04108374A (en) * | 1990-08-27 | 1992-04-09 | Kyowa Hakko Kogyo Co Ltd | New alga of chlorella |
| CU22292A1 (en) * | 1991-05-07 | 1995-01-31 | Cigb | Procedure for obtaining fructose-glucose liquors on an industrial scale from saccharose, and the installations for carrying out the process. |
| JP3143636B2 (en) | 1991-09-11 | 2001-03-07 | 株式会社サン・クロレラ | Method for disrupting chlorella cell wall by cell rupture |
| JPH05137563A (en) * | 1991-11-22 | 1993-06-01 | Fujita Corp | Algae culture device |
| FR2686619B1 (en) * | 1992-01-28 | 1995-07-13 | Commissariat Energie Atomique | PROCESS FOR THE SELECTIVE PRODUCTION OF POLYUNSATURATED LIPIDS FROM A CULTURE OF PORPHYRIDIUM MICROALGAE AND TANK USED IN THIS PROCESS. |
| JPH078215A (en) * | 1993-04-30 | 1995-01-13 | Kawasaki Steel Corp | Docosahexaenoic acid-containing marine microalgae food material and method for producing the same |
| JPH078217A (en) * | 1993-06-29 | 1995-01-13 | Kawasaki Steel Corp | Health food containing docosahexaenoic acid and method for producing the same |
| JP3506740B2 (en) * | 1993-09-09 | 2004-03-15 | 日清オイリオ株式会社 | Method for culturing algae containing docosahexaenoic acid |
| JPH0799931A (en) * | 1993-10-01 | 1995-04-18 | Takae Uechi | Green tea and chlorella packed with gelatin |
| US5756135A (en) * | 1994-09-15 | 1998-05-26 | Robert D. Seeley Trust | Water insoluble yeast solids product and process of making same |
| US5680812A (en) * | 1995-01-23 | 1997-10-28 | Linsgeseder; Helmut | Apparatus and method for the extraction of vegetable oils |
| US5685218A (en) * | 1995-07-14 | 1997-11-11 | The French Oil Mill Machinery Co. | Method for treating oil-bearing material |
| US6255505B1 (en) * | 1996-03-28 | 2001-07-03 | Gist-Brocades, B.V. | Microbial polyunsaturated fatty acid containing oil from pasteurised biomass |
| PT996740E (en) | 1997-08-01 | 2005-11-30 | Martek Biosciences Corp | NUTRIENT COMPOSITIONS CONTAINING DHA AND METHODS FOR ITS PRODUCTION |
| WO1999016860A1 (en) * | 1997-09-29 | 1999-04-08 | Nihon Tobacco Inc. | Yeast extract composition, yeast for obtaining the same, and process for producing yeast extract composition |
| US6166231A (en) * | 1998-12-15 | 2000-12-26 | Martek Biosciences Corporation | Two phase extraction of oil from biomass |
| ES2265945T3 (en) * | 1999-06-04 | 2007-03-01 | Consejo Superior De Investigaciones Cientificas | PLANTS, SEEDS AND SUNFLOWER OILS WITH A HIGH CONTENT OF OLEICO AND HIGH OF ESTEARICO. |
| ES2352001T3 (en) * | 2000-01-19 | 2011-02-14 | Martek Biosciences Corporation | NON-SOLVENT EXTRACTION PROCEDURE. |
| CN105112463A (en) | 2000-01-28 | 2015-12-02 | Dsmip资产公司 | Enhanced production of lipids containing polyenoic fatty acids by very high density cultures of eukaryotic microbes in fermentors |
| US6338866B1 (en) * | 2000-02-15 | 2002-01-15 | Applied Food Biotechnology, Inc. | Pet foods using algal or fungal waste containing fatty acids |
| JP2001292751A (en) * | 2000-04-13 | 2001-10-23 | Yaeyama Shokusan Kk | Powder for chlorella drink |
| AU2001253699B2 (en) * | 2000-04-21 | 2006-04-27 | Martek Biosciences Corporation | Trophic conversion of obligate phototrophic algae through metabolic engineering |
| JP2002125601A (en) * | 2000-10-25 | 2002-05-08 | Kurorera Kogyo Kk | Feed for animal plankton, method for producing the same, and method for culturing animal plankton |
| JP2002238545A (en) * | 2001-02-15 | 2002-08-27 | Kurorera Kogyo Kk | Method for producing chlorella and complex lipid, phospholipid or glycolipid containing highly unsaturated fatty acid obtained by the method, food, food additive |
| EP2266525B1 (en) * | 2002-05-03 | 2012-07-11 | Martek Biosciences Corporation | High quality lipids and methods for producing by enzymatic liberation from biomass |
| JP2004049079A (en) * | 2002-07-18 | 2004-02-19 | Ishikawa Tennen Yakko Busshitsu Kenkyu Center | Ultramicronized chlorella preparation |
| AU2003295624A1 (en) * | 2002-11-18 | 2004-06-15 | Monsanto Technology, Llc | Production of increased oil and protein in plants by the disruption of the phenylpropanoid pathway |
| CA2536635C (en) * | 2003-08-25 | 2015-05-12 | Funzyme Biotechnologies Sa | Novel fungal proteins and nucleic acids encoding same |
| KR101295390B1 (en) | 2003-10-02 | 2013-09-17 | 마텍 바이오싸이언스스 코포레이션 | Production of high levels of DHA in microalgae using modified amounts of chloride and potassium |
| EP1735454B1 (en) | 2004-03-25 | 2017-05-10 | Novozymes, Inc. | Methods for degrading or converting plant cell wall polysaccharides |
| JP2006014700A (en) * | 2004-07-05 | 2006-01-19 | Masahiro Ogaki | New strain of Chlorella |
| JP2006050933A (en) * | 2004-08-11 | 2006-02-23 | Meiji Riken Kk | Chlorella dietary supplement |
| WO2006047445A2 (en) * | 2004-10-22 | 2006-05-04 | Martek Biosciences Corporation | Process for preparing materials for extraction |
| WO2006092449A2 (en) * | 2005-03-02 | 2006-09-08 | Metanomics Gmbh | Process for the production of fine chemicals |
| CA2624616A1 (en) * | 2005-05-12 | 2006-11-23 | Martek Biosciences Corporation | Biomass hydrolysate and uses and production thereof |
| CN101175409B (en) * | 2005-05-19 | 2012-11-14 | 荷兰联合利华有限公司 | Nutritional products |
| US20090274736A1 (en) * | 2006-01-19 | 2009-11-05 | Solazyme Inc. | Nutraceutical Compositions From Microalgae And Related Methods of Production And Administration |
| US20070167396A1 (en) * | 2006-01-19 | 2007-07-19 | Solazyme, Inc. | Methods and compositions for cholesterol reduction in mammals |
| US20070166266A1 (en) * | 2006-01-19 | 2007-07-19 | Solazyme, Inc. | Methods and compositions for improving the health and appearance of skin |
| JP2007215507A (en) * | 2006-02-17 | 2007-08-30 | Kobayashi Pharmaceut Co Ltd | Food composition containing both spirulina and chlorella |
| CA2648266A1 (en) * | 2006-04-03 | 2007-10-18 | Advanced Bionutrition Corporation | Feed formulations containing docosahexaenoic acid |
| KR20090092758A (en) * | 2006-09-18 | 2009-09-01 | 더 아리조나 보드 오브 리전트스, 어 바디 코포레이트 액팅 포 앤드 온 비핼프 오브 아리조나 스테이트 유니버시티 | Algal medium chain length fatty acids and hydrocarbons |
| US9101161B2 (en) * | 2006-11-02 | 2015-08-11 | The Coca-Cola Company | High-potency sweetener composition with phytoestrogen and compositions sweetened therewith |
| US8404004B2 (en) * | 2006-12-29 | 2013-03-26 | Genifuel Corporation | Process of producing oil from algae using biological rupturing |
| CN104212844A (en) * | 2007-06-01 | 2014-12-17 | 索拉兹米公司 | Production of Oil in Microorganisms |
| US7914832B2 (en) * | 2007-06-01 | 2011-03-29 | Kyoto Eiyo Co., Ltd. | Method for producing chlorella fermented food |
| WO2009058799A1 (en) * | 2007-11-01 | 2009-05-07 | Wake Forest University School Of Medicine | Compositions and methods for prevention and treatment of mammalian diseases |
| US8815567B2 (en) * | 2007-11-30 | 2014-08-26 | E I Du Pont De Nemours And Company | Coenzyme Q10 production in a recombinant oleaginous yeast |
| CN101230364A (en) * | 2008-02-25 | 2008-07-30 | 清华大学 | A method for producing biodiesel by high-density fermentation of heterotrophic chlorella |
| MX338039B (en) * | 2008-04-09 | 2016-03-30 | Solazyme Inc | Direct chemical modification of microbial biomass and microbial oils. |
| US20100170144A1 (en) * | 2008-04-09 | 2010-07-08 | Solazyme, Inc. | Hydroprocessing Microalgal Oils |
| CN101280328B (en) * | 2008-05-27 | 2011-06-29 | 清华大学 | Method for producing biodiesel by autotrophic culture and heterotrophic culture of chlorella |
| US20100303957A1 (en) * | 2008-10-14 | 2010-12-02 | Solazyme, Inc. | Edible Oil and Processes for Its Production from Microalgae |
| US20100303990A1 (en) * | 2008-10-14 | 2010-12-02 | Solazyme, Inc. | High Protein and High Fiber Algal Food Materials |
| US20100297325A1 (en) * | 2008-10-14 | 2010-11-25 | Solazyme, Inc. | Egg Products Containing Microalgae |
| US20100303961A1 (en) * | 2008-10-14 | 2010-12-02 | Solazyme, Inc. | Methods of Inducing Satiety |
| US20100297296A1 (en) * | 2008-10-14 | 2010-11-25 | Solazyme, Inc. | Healthier Baked Goods Containing Microalgae |
| US20100303989A1 (en) * | 2008-10-14 | 2010-12-02 | Solazyme, Inc. | Microalgal Flour |
| US20100297331A1 (en) * | 2008-10-14 | 2010-11-25 | Solazyme, Inc. | Reduced Fat Foods Containing High-Lipid Microalgae with Improved Sensory Properties |
| BRPI0920280B8 (en) * | 2008-10-14 | 2022-11-16 | Corbion Biotech Inc | FOOD COMPOSITION AND METHOD FOR MANUFACTURING A FOOD COMPOSITION |
| US20100297323A1 (en) * | 2008-10-14 | 2010-11-25 | Solazyme, Inc. | Gluten-free Foods Containing Microalgae |
| US20100297295A1 (en) * | 2008-10-14 | 2010-11-25 | Solazyme, Inc. | Microalgae-Based Beverages |
| US20100297292A1 (en) * | 2008-10-14 | 2010-11-25 | Solazyme, Inc. | Reduced Pigmentation Microalgae Strains and Products Therefrom |
| EP2370554B1 (en) * | 2008-11-28 | 2019-05-15 | Corbion Biotech, Inc. | Manufacturing of tailored oils in recombinant heterotrophic microorganisms |
| WO2011130576A1 (en) * | 2010-04-14 | 2011-10-20 | Solazyme, Inc. | Oleaginous yeast food compositions |
| JP5865894B2 (en) * | 2010-04-14 | 2016-02-17 | ソラザイム ロケット ニュートリショナルズ, エルエルシー | High lipid microalgae powder food composition |
-
2009
- 2009-10-14 BR BRPI0920280A patent/BRPI0920280B8/en active IP Right Grant
- 2009-10-14 DK DK09821204.6T patent/DK2339925T3/en active
- 2009-10-14 WO PCT/US2009/060692 patent/WO2010045368A2/en not_active Ceased
- 2009-10-14 PT PT98212046T patent/PT2339925T/en unknown
- 2009-10-14 AU AU2009303354A patent/AU2009303354C9/en active Active
- 2009-10-14 CN CN201410764413.7A patent/CN104770424A/en active Pending
- 2009-10-14 US US12/579,091 patent/US20100239712A1/en not_active Abandoned
- 2009-10-14 EP EP09821204.6A patent/EP2339925B1/en active Active
- 2009-10-14 MX MX2011004003A patent/MX339664B/en active IP Right Grant
- 2009-10-14 CA CA2740415A patent/CA2740415C/en active Active
- 2009-10-14 MX MX2016007229A patent/MX352984B/en unknown
- 2009-10-14 JP JP2011532219A patent/JP5731982B2/en active Active
- 2009-10-14 CN CN200980149978.1A patent/CN102271525B/en not_active Ceased
-
2014
- 2014-01-08 JP JP2014001480A patent/JP6386727B2/en not_active Expired - Fee Related
-
2016
- 2016-07-25 JP JP2016145212A patent/JP2016182144A/en active Pending
-
2018
- 2018-05-24 JP JP2018099540A patent/JP2018126167A/en not_active Withdrawn
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS517138A (en) * | 1974-06-21 | 1976-01-21 | Chlorella Ind |
Non-Patent Citations (2)
| Title |
|---|
| ROSENBERG J N ET AL: "A green light for engineered algae: redirecting metabolism to fuel a biotechnology revolution", CURRENT OPINION IN BIOTECHNOLOGY, LONDON, GB, vol. 19, no. 5, 1 October 2008 (2008-10-01), pages 430 - 436, XP025495864, ISSN: 0958-1669, [retrieved on 20080906], DOI: 10.1016/J.COPBIO.2008.07.008 * |
| WU QING-YU AND YIN SHI: "New discoveries in study on hydrocarbons from thermal degradation of heterotrophically yellowing algae", SCIENCE IN CHINA. SERIES B: CHEMISTRY, ZHONGGUO KEXUE ZAZHISHE, BEIJING, CN, vol. 37, no. 3, 1 March 1994 (1994-03-01), pages 326 - 335, XP008147361, ISSN: 1006-9291 * |
Also Published As
| Publication number | Publication date |
|---|---|
| DK2339925T3 (en) | 2022-10-31 |
| MX2011004003A (en) | 2011-06-20 |
| MX352984B (en) | 2017-12-15 |
| JP6386727B2 (en) | 2018-09-05 |
| PT2339925T (en) | 2022-12-30 |
| EP2339925A4 (en) | 2015-04-29 |
| MX339664B (en) | 2016-06-03 |
| CN102271525B (en) | 2015-01-07 |
| US20100239712A1 (en) | 2010-09-23 |
| AU2009303354C9 (en) | 2017-09-07 |
| WO2010045368A2 (en) | 2010-04-22 |
| AU2009303354C1 (en) | 2017-08-10 |
| EP2339925A2 (en) | 2011-07-06 |
| BRPI0920280B8 (en) | 2022-11-16 |
| BRPI0920280A2 (en) | 2015-08-18 |
| AU2009303354B2 (en) | 2015-09-03 |
| WO2010045368A3 (en) | 2010-06-24 |
| JP2016182144A (en) | 2016-10-20 |
| JP2014061009A (en) | 2014-04-10 |
| BRPI0920280B1 (en) | 2022-09-20 |
| CN102271525A (en) | 2011-12-07 |
| JP2018126167A (en) | 2018-08-16 |
| CA2740415C (en) | 2021-08-24 |
| JP5731982B2 (en) | 2015-06-10 |
| HK1164061A1 (en) | 2012-09-21 |
| CA2740415A1 (en) | 2010-04-22 |
| JP2012505656A (en) | 2012-03-08 |
| AU2009303354A1 (en) | 2010-04-22 |
| CN104770424A (en) | 2015-07-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12389932B2 (en) | Microalgal food compositions | |
| US12059006B2 (en) | Microalgal flour | |
| EP3622828B1 (en) | Novel microalgal food compositions | |
| JP6386727B2 (en) | Food composition of microalgal biomass | |
| US20190254292A1 (en) | Gluten-free foods containing microalgae | |
| EP2557937B1 (en) | Food compositions containing lipid-rich microalgal flour | |
| US20180139994A1 (en) | Microalgal food compositions | |
| US20120128851A1 (en) | Novel microalgal food compositions | |
| US20100297292A1 (en) | Reduced Pigmentation Microalgae Strains and Products Therefrom | |
| US20100297296A1 (en) | Healthier Baked Goods Containing Microalgae | |
| US20100297331A1 (en) | Reduced Fat Foods Containing High-Lipid Microalgae with Improved Sensory Properties | |
| US20100303990A1 (en) | High Protein and High Fiber Algal Food Materials | |
| US20100303957A1 (en) | Edible Oil and Processes for Its Production from Microalgae | |
| AU2015271929A1 (en) | Novel microalgal food compositions | |
| AU2015261580B2 (en) | Food compositions of microalgal biomass | |
| HK1164061B (en) | Food compositions of microalgal biomass | |
| HK1182595B (en) | Novel microalgal food compositions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20110415 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: AL BA RS |
|
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20150327 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A23D 7/005 20060101AFI20150323BHEP Ipc: A21D 2/16 20060101ALN20150323BHEP Ipc: A23K 1/00 20060101ALN20150323BHEP Ipc: A23K 1/16 20060101ALN20150323BHEP Ipc: A23D 7/00 20060101ALN20150323BHEP |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: TERRAVIA HOLDINGS, INC. |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: CORBION BIOTECH, INC. |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: BALIU, ENRIQUE Inventor name: AVILA, JEFF Inventor name: DECKER, STEPHEN, M. Inventor name: RAKITSKY, WALTER Inventor name: FRANKLIN, SCOTT Inventor name: BROOKS, GEOFFREY Inventor name: PIECHOCKI, JOHN Inventor name: ZDANIS, DANA |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 17Q | First examination report despatched |
Effective date: 20210730 |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R079 Ref document number: 602009064613 Country of ref document: DE Free format text: PREVIOUS MAIN CLASS: A23D0007005000 Ipc: A23D0007000000 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A21D 2/16 20060101ALI20220205BHEP Ipc: A23K 20/158 20160101ALI20220205BHEP Ipc: A23K 10/16 20160101ALI20220205BHEP Ipc: A23D 7/00 20060101AFI20220205BHEP |
|
| GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: GRANT OF PATENT IS INTENDED |
|
| INTG | Intention to grant announced |
Effective date: 20220404 |
|
| GRAS | Grant fee paid |
Free format text: ORIGINAL CODE: EPIDOSNIGR3 |
|
| GRAA | (expected) grant |
Free format text: ORIGINAL CODE: 0009210 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE PATENT HAS BEEN GRANTED |
|
| AK | Designated contracting states |
Kind code of ref document: B1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR |
|
| REG | Reference to a national code |
Ref country code: GB Ref legal event code: FG4D |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: EP |
|
| REG | Reference to a national code |
Ref country code: IE Ref legal event code: FG4D |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R096 Ref document number: 602009064613 Country of ref document: DE |
|
| REG | Reference to a national code |
Ref country code: AT Ref legal event code: REF Ref document number: 1519508 Country of ref document: AT Kind code of ref document: T Effective date: 20221015 |
|
| REG | Reference to a national code |
Ref country code: DK Ref legal event code: T3 Effective date: 20221028 |
|
| REG | Reference to a national code |
Ref country code: SE Ref legal event code: TRGR |
|
| REG | Reference to a national code |
Ref country code: NL Ref legal event code: FP |
|
| REG | Reference to a national code |
Ref country code: PT Ref legal event code: SC4A Ref document number: 2339925 Country of ref document: PT Date of ref document: 20221230 Kind code of ref document: T Free format text: AVAILABILITY OF NATIONAL TRANSLATION Effective date: 20221221 |
|
| REG | Reference to a national code |
Ref country code: LT Ref legal event code: MG9D |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: NO Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20221221 Ref country code: LV Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 Ref country code: LT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 Ref country code: FI Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 |
|
| REG | Reference to a national code |
Ref country code: AT Ref legal event code: MK05 Ref document number: 1519508 Country of ref document: AT Kind code of ref document: T Effective date: 20220921 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: HR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 Ref country code: GR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20221222 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: SM Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 Ref country code: RO Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 Ref country code: ES Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 Ref country code: CZ Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 Ref country code: AT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: SK Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 Ref country code: PL Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 Ref country code: IS Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20230121 Ref country code: EE Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R097 Ref document number: 602009064613 Country of ref document: DE |
|
| REG | Reference to a national code |
Ref country code: BE Ref legal event code: MM Effective date: 20221031 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: MC Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 Ref country code: LU Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20221014 |
|
| PLBE | No opposition filed within time limit |
Free format text: ORIGINAL CODE: 0009261 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT |
|
| 26N | No opposition filed |
Effective date: 20230622 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: SI Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: BE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20221031 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: IE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20221014 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: HU Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO Effective date: 20091014 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: CY Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: MK Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 Ref country code: IT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: BG Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: MT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: PT Payment date: 20250923 Year of fee payment: 17 |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: U11 Free format text: ST27 STATUS EVENT CODE: U-0-0-U10-U11 (AS PROVIDED BY THE NATIONAL OFFICE) Effective date: 20251101 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: NL Payment date: 20251026 Year of fee payment: 17 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: TR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20220921 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: DE Payment date: 20251029 Year of fee payment: 17 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: GB Payment date: 20251027 Year of fee payment: 17 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: DK Payment date: 20251027 Year of fee payment: 17 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: FR Payment date: 20251027 Year of fee payment: 17 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: CH Payment date: 20251101 Year of fee payment: 17 Ref country code: SE Payment date: 20251027 Year of fee payment: 17 |






























