EP2297311A1

EP2297311A1 - Compounds reducing or inhibiting the expression of pkd1 for diagnosis and therapy of brain tumors

Info

Publication number: EP2297311A1
Application number: EP09757627A
Authority: EP
Inventors: Eva Bernhart; Hans Eder; Manuel Mrfka; Wolfgang Sattler; Andreas Zimmer; Daniela Reischl
Original assignee: JSW Life Sciences GmbH; Medizinische Universitaet Graz; Karl-Franzens-Universitaet Graz
Current assignee: JSW LIFE SCIENCES GmbH; Medizinische Universitaet Graz; Karl-Franzens-Universitaet Graz
Priority date: 2008-06-06
Filing date: 2009-06-05
Publication date: 2011-03-23
Also published as: WO2009147246A1

Abstract

The present invention relates inter alia to a role of PKD1 in the progression of malignancy in brain tumors. The invention provides compounds suitable for reducing or inhibiting the expression of PKD1. The invention further relates to the use of said compounds for the diagnosis and therapy of cancer, in particular brain cancer.

Description

COMPOUNDS REDUCING OR INHIBITING THE EXPRESSION OF PKDl FOR DIAGNOSIS AND THERAPY OF BRAIN TUMORS

FIELD OF THE INVENTION

The present invention relates inter alia to a role of PKDl in the progression of malignancy in brain tumors. The invention provides compounds suitable for reducing or inhibiting the expression of PKDl. The invention further relates to the use of said compounds for the diagnosis and therapy of cancer, in particular brain cancer.

BACKGROUND OF THE INVENTION

Gliomas, a type of primary central nervous system tumors arising from glial cells, are the most common primary brain tumors in humans and occur at an incidence of almost 12 per 100,000 people with a male predominance. Astrocytomas, which are derived from astrocytes, are the most common type of gliomas.

The World Health Organization (WHO) has graded gliomas into 4 grades according to histopathology. Malignant gliomas refer to WHO grade III (anaplastic astrocytoma) and IV (glioblastoma multiforme). (Reardon, DA et al. (2006), J. Clin. Oncol. 24, 1253-1265) These high grade gliomas carry a poor prognosis, causing death within a few weeks if left untreated. Symptoms depend on which part of the brain is affected by the tumor and include headaches, nausea, vomiting, disturbed vision, convulsions and muscle spasms.

The current standard of care for malignant gliomas consists of surgery, radiotherapy and conventional chemotherapies. The oral alkylating agent temozolomide has become a standard chemotherapy drug for the treatment of malignant gliomas.

However, despite this multi-modality treatment the median survival time of patients diagnosed with glioblastoma is only about 12 months, mostly due to the highly invasive nature of the tumor and the poor responsiveness to therapeutic drugs. To date, no single glioblastoma patient has been cured. A major problem in the treatment of brain tumors is to overcome the difficulty of delivering therapeutic agents to specific regions of the brain as drug delivery to the brain is severely hampered by the exceptionally low permeability of the blood brain barrier. The effectiveness of chemotherapy is also hindered by multi-drug resistance of brain tumor cells.

The development of novel therapies to combat malignant gliomas therefore remains an essential task. New cellular targets are needed, as well as therapeutic molecules which can efficiently impinge on these targets.

Objective and summary of the invention

It is therefore one objective of the present invention to provide molecules that can be used for the treatment of tumors, in particular malignant gliomas. It is a further objective of the present invention to provide methods for treating tumors, in particular malignant gliomas. Another objective of the present invention is to provide diagnostic methods that can be used for tumor detection and methods that can be used for identifying molecules capable of modulating cell proliferation, preferably tumor cell proliferation.

These and other objectives as they will become apparent from the ensuing description and claims are attained by the subject matter of the independent claims. Some of the preferred embodiments are defined by the dependent claims.

Protein kinase D 1 (PKDl, also known as PRKDl or PKC μ) is a phospholipid/diacylglycerol- stimulated serine/threonine protein kinase, that has been implicated in diverse cellular functions, such as for example Golgi organization and plasma membrane transport.

The inventors of the present invention have surprisingly found that RNAi mediated knockdown of Protein kinase Dl leads to growth inhibition of brain tumors, in particular of astrocytoma grade III and IV. These findings can be used for a multitude of different applications as will be set out hereinafter.

The present invention thus relates inter alia to a role of PKDl (also known as PRKDl) in the progression of malignancy in brain tumors and to the use of an anti- PKDl therapeutic approach to combat tumors in general, and malignant gliomas in particular.

The present therapeutic approach is in particular based on the use of anti-PKDl tools relating to RNA interference- (RNAi), antisense-, expression vector- , or any other related approaches aiming to reduce or inhibit the expression or activity of PKDl in tumor cells, in particular in malignant glioma cells, including reducing or inhibiting the expression or activity of PKDl by means of aptameres, specific inhibitory peptides or specific antibodies directed against PKDl.

In a first aspect the present invention relates to a compound suitable for reducing or inhibiting the expression or activity of a polypeptide according to SEQ ID NO: 3 or a homologue thereof.

In a further aspect the present invention provides an isolated polynucleotide, comprising (a) a first polynucleotide sequence comprising SEQ ID NO: 4 or a fragment or derivative thereof and a second polynucleotide sequence comprising SEQ ID NO: 1 or a fragment or derivative thereof; or

(b) a first polynucleotide sequence comprising SEQ ID NO: 5 or a fragment or derivative thereof and a second polynucleotide sequence comprising

SEQ ID NO: 2 or a fragment or derivative thereof.

In another aspect the invention further provides an expression vector comprising an isolated polynucleotide according to the invention.

The present invention also relates to a host cell comprising an expression vector according to the invention.

In a further aspect the present invention relates to a carrier particle comprising at least one compound according to the invention that is suitable for reducing or inhibiting the expression or activity of a polypeptide according to SEQ ID NO: 3 or a homologue thereof and/or an expression vector or host cell according to the invention.

In yet another aspect the present invention relates to a pharmaceutical composition for the treatment of cancer comprising at least one compound according to the invention that is suitable for reducing or inhibiting the expression or activity of a polypeptide according to SEQ ID NO: 3 or a homologue thereof and/or an expression vector, host cell or carrier particle according to the invention.

The present invention in a further aspect also relates to a transgenic animal containing an expression vector capable of expressing a polypeptide which is identical to or a homologue of the polypeptide according to SEQ ID NO: 3 and wherein the polypeptide has the molecular function of the polypeptide according to SEQ ID NO: 3.

In another aspect the present invention relates to a method of detecting the presence of a tumor in a biological sample from a subject comprising at least the steps of:

(a) providing a biological sample from the subject; and

(b) determining in the sample the level of expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof

(c) comparing the expression level in (b) to a level of expression in a control, wherein a higher level of expression of the polypeptide according to SEQ ID

NO: 3 or the homologue thereof in comparison to the control indicates the presence of a tumor in the subject.

The present invention also relates to a method for identifying a molecule capable of modulating cell proliferation comprising at least the following steps:

(a) providing cells from a tissue or from a cell line;

(b) contacting said cells according to (a) with a test compound;

(c) determining the activity or the expression level of a polypeptide according to SEQ ID NO: 3 or a homologue thereof in said cells, (d) comparing the activity or the expression level in (c) to the activity or expression level in a control, wherein a higher or lower activity or expression level of the polypeptide according to SEQ ID NO: 3 in comparison to the control indicates that the test compound is capable of modulating cell proliferation. FIGURE LEGENDS:

Fig.l: PKDl protein content correlates with tumor grading.

Proteins from A 172 cells and tumor specimens of the indicated WHO grading were extracted, separated by SDS-PAGE, electrob lotted and detected using a anti PKDl- antiserum. ECL was used to visualize immunoreactive bands. The number of samples is indicated, results are expressed as % of band intensity observed in Al 72 cells.

Fig. 2: Immunohistochemial characterization of PKDl expression in a glioblastoma sample.

Cryosections of the tumor sample were thawed, fixed in acetone and rehydrated in PBS. After blocking, the sections were incubated with rabbit anti-PKDl, HLA-DR, and GFAP IgG, followed by the corresponding secondary antibodies. Samples were mounted with Moviol and analyzed on a confocal laser-scanning microscope. The x/y dimension of the scanned field is 47.23 μm.

Fig. 3: PMA-induced translocation of PKDl-GFP.

A PKDl-GFP construct was transiently over-expressed in A 172 cells. The images show cells before (A) and after incubation with PMA (100 nM) for up to 30 min (B- H, 5 min intervals). PKDl trafficking is observed to the plasma membrane where it is mainly located in cellular pseudopodia/invadopodia Fig. 4: PDGF-induced translocation of PKDl.

A PKDl-GFP construct was transiently overexpressed in Al 72 cells. Cells were stimulated with PDGF (30 ng/ml) and cells were visualized after 2(A), 5 (B), 10 (C), 15 (D), and 20 (E) min. Arrows indicate sites of PKDl accumulation in response to PDGF.

Fig. 5: Lysophosphatidic acid (LPA) affects A 172 cell growth. Cells (50,000 per well) were seeded in 1 ml culture medium (5 % serum) in the absence or presence of the indicated LPA concentrations. LPA addition was repeated after 25 h. Cells were counted manually using a hemacytometer. Results are mean±SD (n=3).

Fig. 6: LPA-dependent activation of PKDl in A 172 and primary glioblastoma (GBM) cells.

Cells were incubated for 30 min in the presence of the indicated LPA concentrations and analyzed by Western blotting using an antibody against the S916 phosphorylated form of PKDl (arrows).

Fig. 7: Silencing of PKDl in Al 72 cells

Cells were electroporated with siRNA (1, 3, 5 μg) (GAA CCA ACU UGC ACA GAG A dTdT (SEQ ID NO: 15); UUG GCG AAG UGA CCA UUA A dTdT (SEQ ID NO: 16)) constructs from the suppliers mentioned in the text. At the time points indicated, cellular PKDl levels were assessed by Western blotting. C=control, M=mock, S=scrambled, D=Dharmacon, Q=Qiagen, B=Biospring. Fig. 8: Silencing of PKDl efficiently reduces tumor cell growth A 172 cells were trans fected with the indicated concentrations of siRNA of the different suppliers. Cells (20.000 per well) were seeded in 6-well trays. At the indicated time points cells were trypsinized and manually counted. Results represent mean values from triplicates.

Fig. 9: A 172 glioblastoma cells express all members of the PKD family.

The following primer pairs were used: PKDl: F: ATT CCT TCT CTC CTC CTC CT, (SEQ ID NO: 8), R: ATA CTG AGG

GCA CAC CAG GCA (582 bp); (SEQ ID NO: 9)

PKD2: F: ATC CTC TTC CTC CCT CTT CTG (SEQ ID NO: 10), R: CAC AAG

GCT GAA GTT CTG G (667 bp); (SEQ ID NO: 11)

PKD3: F: AGT CAC ATG TCC ACC AGG AA (SEQ ID NO: 12), R: TGA GGA GTA ACA GGC ATG AG (895 bp); (SEQ ID NO: 13)

PCR products were detected at the expected sizes (582, 667, and 895 bp, respectively). Identity was confirmed by sequencing.

Fig. 10: Silencing of PKDl in primary glioblastoma cells Primary cells were electroporated with siRNA (3 μg) from Biospring. At the indicated time points cells were lysed and cellular PKDl levels were assessed by Western blotting in duplicates

Fig. 11: Panther classification of induced and repressed genes in PKDl silenced cells The genes were grouped on the basis of the PANTHER classification system according to their involvement in particular biological processes. It is of importance that in the list of upregulated genes p21 was found that could be responsible for repressed growth in silenced A 172 cells. In the list of downregulated genes it is obvious that some representatives that contribute to proteolysis (a process thought to favor invasiveness of tumor cells) was downregulated in PKDl silenced cells.

Fig. 12: 2D-DIGE analysis of untreated and scrambled or PKDl-siRNA transfected Al 72 cells.

Cells were cultured in the presence of PDGF (20 ng). After 48 h cells were lysed, lysates (50 μg protein) were labeled with Cy-2, Cy-3 and Cy-5, mixed with 500 μg of unlabeled protein and separated in the first (pH3-10) and second (12 % SDS- PAGE) dimension. Spot intensity was analyzed on a Typhoon imager using the DeCyder software

Fig. 13: Characterization of siRNA binding capacity of ternary siRNA/protamine/HSA nanoparticles on agarose gels l=positive control, 2 = negative control, 3-8 = 1 :0.1 :5, 1 :1:5, 1:2:5, 1 :3:5, 1 :4:5, and 1 :5:5 siRNA/protamine/HS A, respectively.

Fig. 14: pH-dependent size of ternary nanoparticles

Diameter of ternary nanoparticles at pH 12 (white bars) and pH6.5 (black bars) was analyzed on a Zetasizer in a time dependent manner. Results shown are mean±SD from triplicate measurements.

Fig. 15: Effects of desalted siRNA on nanoparticle diameter:

Ternary nanoparticles were assembled with either non-desalted or desalted (RNA*, Biospring) siRNA (GAA CCA ACU UGC ACA GAG A dTdT(SEQ ID NO: 15); UUG GCG AAG UGA CCA UUA A dTdT(SEQ ID NO : 16)) from the suppliers indicated. Particle diameter was measured using a Zeta-sizer. Results are mean±SD from triplicate determinations. Fig. 16: PKDl silencing in Al 72 cells with electroporated protamine/siRNA nanoparticles

Analysis of PKDl expression in Al 72 cells 48h and 72h after transfection (electroporation) with ternary (a, HSA, Prot, siRNA) and binary (b) nanoparticles containing siRNA GAA CCA ACU UGC ACA GAG A dTdT (SEQ ID NO: 15);UUG GCG AAG UGA CCA UUA A dTdT (SEQ ID NO: 16) directed against PKDl. siRNA concentration: 9 μg/ml, C: control cells

Fig. 17: PKDl silencing in U87MG cells uing a lentiviral system expressiong 5 different shRNAs against PKD 1

Cells were transduced (12 well trays) with lentiviral constructs at multiplicity of infection (MOI) 2. Five days after transduction RNA was isolated and quantitative real time PCR (SybrGreen) was performed (A). PKDl mRNA content was normalized to GAPDH. Controls were set at 1. In a second experimental series cells were lysed and analyzed by Western blotting (B). Films were densitoetrically evaluated. Cl = no addition, C2 = detergent used for transduction, 1 - 5 are lentiviral constructs expressing shRNAs mentioned in the Results section.

Fig. 18: Sequence listing SEQ ID NO: 1,2,4,5 and sequences of Homo sapiens protein kinase Dl (PKDl) (SEQ ID NO: 3), Homo sapiens protein kinase Dl (PKDl) mRNA (NM 002742; SEQ ID NO: 6) and reverse complement sequence of Homo sapiens protein kinase Dl (PKDl) mRNA (SEQ ID NO: 7). DETAILED DESCRIPTION OF THE INVENTION

Before the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

The following definitions are introduced.

As used in this specification and in the intended claims, the singular forms of "a" and "an" also include the respective plurals unless the context clearly dictates otherwise.

As used herein the term "hybridize" or "hybridizes" refers to the hybridization of a first to a second polynucleotide. To determine, if two polynucleotides hybridize to each other, the skilled person will preferably conduct hybridization experiments in vitro under moderate or stringent hybridization conditions. Hybridization assays and conditions are known to those skilled in the art and can be found, for example, in Current Protocols in Molecular Biology, John Wiley & Sons, N. Y., 6.3.1-6.3.6, 1991. Moderate hybridization conditions are defined as equivalent to hybridization in 2X sodium chloride/sodium citrate (SSC) at 3OC, followed by a wash in 1 X SSC, 0.1% SDS at 50⁰C.

For example under the aforementioned conditions 10 μg RNA might be separated by 1 % agarose gel electrophoresis and transferred to a nylon membrane. For detection a [32P]dCTP-labeled probe might be used. Band intensities might be determined using a Storm phosphoimaging system. GAPDH might be used as internal control.

Highly stringent conditions are defined as equivalent to hybridization in 6X sodium chloride/sodium citrate (SSC) at 45°C, followed by a wash in 0.2 X SSC, 0.1 % SDS at 65°C.

It is to be understood that the term "comprise", and variations such as "comprises" and "comprising" is not limiting. For the purpose of the present invention the term "consisting of is considered to be a preferred embodiment of the term "comprising". If hereinafter a group is defined to comprise at least a certain number of embodiments, this is meant to also encompass a group which preferably consists of these embodiments only.

The term "RNA interference" or "RNAi" refers to an RNA induced block of gene expression in a specific and post-transcriptional manner by degradation of a specific target mRNA. This process can involve the action of the RNA- induced silencing complex (RISC).

The term "siRNA" refers to small interfering RNA and is used herein according to its conventional and well known meaning in the art.

The determination of percent identity between two sequences is preferably accomplished using the mathematical algorithm of Karlin and Altschul (1993) Proc. Natl. Acad. Sci USA 90: 5873-5877. Such an algorithm is incorporated into the BLASTn and BLASTp programs of Altschul et al. (1990) J. MoI. Biol. 215: 403-410 available at NCBI (http://www.ncbi.nlm.nih.gov/blast/Blast.cge). The determination of percent identity is performed with the standard parameters of the BLASTn and BLASTp programs.

BLAST polynucleotide searches are performed with the BLASTn program. For the general parameters, the "Max Target Sequences" box may be set to 100, the "Short queries" box may be ticked, the "Expect threshold" box may be set to 10 and the "Word Size" box may be set to 28. For the scoring parameters the "Match/mismatch Scores" may be set to 1,-2 and the "Gap Costs" box may be set to linear. For the Filters and Masking parameters, the "Low complexity regions" box may not be ticked, the "Species-specific repeats" box may not be ticked, the "Mask for lookup table only" box may be ticked, the "Mask lower case letters" box may not be ticked.

BLAST protein searches are performed with the BLASTp program. For the general parameters, the "Max Target Sequences" box may be set to 100, the "Short queries" box may be ticked, the "Expect threshold" box may be set to 10 and the "Word Size" box may be set to "3". For the scoring parameters the "Matrix" box may be set to "BLOSUM62", the "Gap Costs" Box may be set to "Existence: 11 Extension: 1", the "Compositional adjustments" box may be set to "Conditional compositional score matrix adjustment". For the Filters and Masking parameters the "Low complexity regions" box may not be ticked, the "Mask for lookup table only" box may not be ticked and the "Mask lower case letters" box may not be ticked.

The term "polypeptide" as used herein refers to a polymer of amino acids and does in general not refer to a specific length of the product; thus, peptides, oligopeptides, and proteins are included within the definition of polypeptide. Polypeptides according to the definition may be post-translationally modified for example by glycosylations, acetylations, phosphorylations and the like. Included within the definition are, for example, polypeptides containing one or more analogues of an amino acid (including, for example, unnatural amino acids, etc.), polypeptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring.

The term "subject" in the context of the present invention preferably refers to a human. However, veterinary applications are also in the scope of the present invention. The term "subject" can therefore also refer to an animal, preferably a mammal.

The terms "cancer" or "tumor" as used herein are considered to include different types of cancers such as colorectal, lung and breast cancer and cancers of the brain, such as glioblastoma. Other cancers or tumors may include non-Hodgkin lymphoma, head and neck cancer, non-small cell lung cancer, ovarian cancer or urinary bladder cancer.

The term "expression vector" as used herein refers to a vector that contains a desired coding sequence and appropriate DNA sequences necessary for the expression of the operably linked coding sequence and is capable of inducing protein expression in a particular host organism (e.g., bacteria, yeast, plant, insect, or mammal) or in in vitro expression systems. Expression vectors may comprise functional elements such as e.g., a promoter that is operatively linked to the nucleic acid sequence to be transcribed, a termination sequence that allows proper termination of transcription and a selectable marker. The person skilled in the art will be aware that the nature of the promoter will depend on whether the vector is going to be used in a prokaryotic or eukaryotic host cell. To obtain stable expression for an extended period of time the expression vector may further comprise an origin of replication (ORI). Suitable expression vectors are known to the person skilled in the art. Depending on whether expression is to be achieved in a prokaryotic or eukaryotic host cell or in in vitro expression systems, the vectors may be prokaryotic and/or eukaryotic expression vectors such as plasmids, cosmids, minichromosomes, bacterial phages, retroviral vectors etc. The skilled person will be familiar with how to select an appropriate vector according to the specific need.

Protein kinase D 1 (PKD 1 , also known as PRKD 1 or PKC μ) is a phospholipid /diacylglycerol- stimulated serine/threonine protein kinase, that has been implicated in diverse cellular functions, such as for example Golgi organization and plasma membrane transport.

The inventors of the present invention have surprisingly found that the expression level of protein kinase D 1 (PKDl, also called PRKDl or PKCμ) in astrocytoma cells correlates with grading and severity of the astrocytoma. For example, the inventors found that WHO grade IV astrocytoma cells exhibit higher PKDl expression levels than WHO grade III astrocytoma cells (see figure 1 in the Example section).

PKDl therefore constitutes a new target for tumor therapy, in particular brain tumor therapy.

Thus, in a first aspect the invention refers to a compound suitable for reducing or inhibiting the expression or activity of a polypeptide according to SEQ ID NO: 3 or a homologue thereof.

In a preferred embodiment said compound is an isolated polynucleotide, an aptamere, an antibody or an inhibitory peptide.

The term "aptamer" as used herein refers to a polynucleotide that specifically binds to one or more molecular target molecules, A preferred target in the context of the present invention is a polypeptide according to SEQ ID NO: 3 or a homologue thereof. However the aptamer might also bind to and interfere with the activity of any polypeptide that is involved in the intracellular expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof, such as for example a polypeptide that is part of the intracellular transcription or translation machinery.

In this context, "target-specific" means that the aptamer binds to the target molecule with a much higher degree of affinity than it binds to contaminating materials. The specificity of the binding is preferably defined in terms of the comparative dissociation constants (Kd) of the aptamer for its ligand as compared to the dissociation constant of the aptamer for other materials in the enviromnent or unrelated molecules in general. Preferably, the Kd for the aptamer with respect to its ligand will be at least about 10-fold less than the Kd for the aptamer with unrelated material or accompanying material in the environment. Even more preferably, the Kd will be at least about 50-fold less, more preferably at least about 100-fold less, and most preferably at least about 200-fold less.

An aptamer will preferably be between about 10 to about 300 nucleotides in length. Preferably an aptamer will be between about 30 to about 100 nucleotides in length. Most preferably an aptamer will be between about 10 to 60 nucleotides in length.

Aptamers may be prepared by any known method, including synthetic, recombinant, and purification methods, and may be used alone or in combination with other aptamers specific for the same target.The term "aptamer" also includes peptide aptamers.

The term "antibody" includes both polyclonal and monoclonal antibodies, as well as variants or fragments thereof, such as Fv, Fab and F(ab)2 fragments that are capable of binding a polypeptide according to SEQ ID NO: 3 or a homologue thereof. The term "antibody" also includes single-chain antibodies. An antibody according to the invention preferably binds to a polypeptide according to SEQ ID NO: 3 or a homologue thereof. However the antibody might also bind to and interfere with the activity of any polypeptide that is involved in the intracellular expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof, such as for example a polypeptide that is part of the intracellular transcription or translation machinery.

An inhibitory peptide according to the invention is a polypeptide that is capable of specifically binding to and reducing or inhibiting the activity of a polypeptide according to SEQ ID NO: 3 or a homologue thereof.

The activity of a polypeptide according to SEQ ID NO: 3 can for example be determined by analysing the serine phosphorylation status in the trans-and/or autophosphorylation domain using phosphosite specific antibodies and western blotting. Alternatively in vitro phosphorylation assays using (γ³²P) ATP as e.g. described in Jaggi et al. Cancer Res. 2005 Jan 15;65(2):483-92 can be used.

An inhibitory peptide according to the invention may also be a polypeptide that specifically binds to and reduces the activity of any polypeptide that is involved in the intracellular expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof, such as for example a polypeptide that is part of the intracellular transcription or translation machinery.

The inventors of the present invention have found that reduction or inhibition of the expression of PKDl protein (SEQ ID NO: 3) by RNA interference or antisense approaches efficiently reduces glioblastoma cell proliferation. Unexpectedly, isolated polynucleotides comprising or consisting of either SEQ ID NO: 1, 2, 15 or 16, which are capable of hybridizing to human PKDl mRNA, turned out to be particularly efficient for this process. Thus, in another aspect, the invention provides an isolated polynucleotide comprising or consisting of either SEQ ID NO: 1, 2, 15 or 16 or a fragment or derivative thereof, wherein said polynucleotide is suitable for reducing or inhibiting the expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof.

In one preferred embodiment the isolated polynucleotide according to the invention is suitable for the induction of RNA interference in a cell, preferably a tumor cell.

In another preferred embodiment the isolated polynucleotide according to the invention can be used in an antisense approach to inhibit translation of PKDl mRNA in a cell, preferably a tumor cell.

To induce RNA interference, the isolated polynucleotide of the invention preferably has a length of between 10 and 100, between 12 and 80, between 14 and 60, between 16 and 50, between 17 and 40, more preferably between 18 and 30 nucleotides and most preferably between 18 and 22 nucleotides.

To inhibit translation, the isolated polynucleotide of the invention typically has a length of about 10 to about 500 nucleotides, of about 11 to about 200 nucleotides, of about 12 to about 100 nucleotides, about 13 to about 75 nucleotides or of about 14 to about 50 nucleotides, of about 15 to about 40 nucleotides, of about 16 to about 30 nucleotides or of about 17 to about 25 nucleotides.

The isolated polynucleotides according to the invention are also applicable in any other antisense technique suitable for reducing or inhibiting gene-expression known to the skilled person. The term "isolated" in the context of the present invention indicates that a polynucleotide has been removed from its natural environment and/or is presented in a form in which it is not found in nature.

As used herein, the term "fragment" generally refers to a polynucleotide of between 10 and 20 nucleotides in length. A fragment may be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides in length. A fragment is typically a portion of the polynucleotide it refers to.

As used herein the term "derivative" refers to a polynucleotide sequences that may differ from the polynucleotide sequence it refers to in that one or more nucleotides of the original sequence are substituted by other nucleotides and/or (chemically) modified by methods known to the skilled person, provided that the polynucleotide is still capable of fulfilling its respective function.

The terms "derivative" also includes polynucleotides having linkages between nucleotides that differ from typical linkages. Examples of such polynucleotides specifically include 2 '-O-methyl-ribo nucleotide, a polynucleotide derivative in which a phosphodiester bond in a polynucleotide is converted to a phosphorothioate bond, a polynucleotides derivative in which a phosphodiester bond in a polynucleotide is converted to a N3'-P5' phosphoroamidate bond, a polynucleotide derivative in which a ribose and a phosphodiester bond are converted to a pep-tide- nucleic acid bond, a polynucleotide derivative in which uracil is substituted with C-5 propynyl uracil, a polynucleotide derivative in which uracil is substituted with C-5 thiazole uracil, a polynucleotide derivative in which cytosine is substituted with C-5 propynyl-cytosine, a polynucleotide derivative in which cytosine is substituted with phenoxazine-modified cytosine, a polynucleotide derivative in which ribose is substituted with 2'-O-propyl ribose, and a polynucleotide derivative in which ribose is substituted with 2'-methoxyethoxy ribose.

The term "derivative" may further refer to polynucleotides according to the invention which are covalently linked to or admixed with one or more lipid moieties. In one embodiment a "derivative" may for example be a lipid modified siRNA according to the invention. Preferably said lipid moieties, which may be for example cholesterol, lithocholic acid or lauric acid, are covalently linked to the 3' or 5 '-end of the siRNA, most preferably to the 5 '-end.

A "derivative" may show at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97% or at least 98% and most preferably at least 99% sequence identity to the polynucleotide sequence it refers to.

The term "reducing or inhibiting" as used herein refers to a reduction in expression or activity of a polypeptide in a cell preferably by more than 30%, more preferably by more than 40%, more preferably by more than 50%, more preferably by more than 55%, more preferably by more than 60%, more preferably by more than 65%, more preferably by more than 70%, more preferably by more than 75%, more preferably by more than 80% , more preferably by more than 85%, more preferably by more than 90%, even more preferably by more than 91%, more than 92%, more than 93%, more than 94%, more than 95%, more than 96%, more than 97%, and most preferably by more than 98% in comparison to the expression or activity of said polypeptide in a control cell. The skilled person knows how to select a suitable control cell. A control cell can e.g. be a cell that has not been treated with any of the inventive compounds. Comparison is preferably performed under similar experimental conditions.

As used herein, the term "homologue" refers to the level of sequence identity between two proteins or polypeptides. Whether or not two proteins or polypeptides are "homologues" is determined by direct comparison of their amino acid sequences. When the sequences of two proteins or polypeptides are directly compared with each other, these proteins or polypeptides are "homologues" if they are at least 40%, preferably at least 50%, preferably at least 60%, more preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and most preferably at least 99% identical with each other. Preferably, said level of sequence identity is determined as described above using the BLASTp programme.

A "homologue" may for example be a protein or polypeptide in which amino acids have been deleted (e.g., a truncated version of the protein or polypeptide), inserted, inverted, substituted and/or derivatized (e.g., by glycosylation, phosphorylation, acetylation, myristoylation, prenylation, palmitation, amidation and/or addition of glycosylphosphatidyl inositol) in comparison to the polypeptide according to SEQ ID NO: 3. A homologue of a polypeptide according to SEQ ID NO: 3has preferably the same biological function as the polypeptide according to SEQ ID NO: 3. Preferably, a homologue does not comprise more than 10, 20, 30, 40, 50 or 100 deleted, inserted, inverted, substituted and/or derivatized amino acids. A homologue preferably has at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the biological activity in vitro and/or in vivo as the polypeptide according to SEQ ID NO: 3.

Preferably, an isolated polynucleotide according to the invention is a double stranded RNA or a double stranded DNA molecule. In one preferred embodiment the isolated polynucleotide according to the invention is a double stranded siRNA molecule. In another embodiment, an isolated polynucleotide according to the invention is a shRNAs, miRNAs, esiRNA or a dicer-substrate 27-mer duplex.

A double stranded DNA molecule according to the invention can for example be used for the expression of an RNA molecule capable of reducing or inhibiting the expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof.

The double stranded DNA molecule according to the invention is preferably inserted into an expression vector.

In another preferred embodiment an isolated polynucleotide according to the invention, is a single stranded RNA molecule or a single stranded DNA molecule. In a further embodiment the isolated polynucleotide according to the invention may be a single stranded siRNA molecule.

siRNA molcules used to induce RNA interference frequently carry a dTdT overhang linked to their 3 'end for increased stability. Therefore in cases where the isolated polynucleotide according to the invention is used as single stranded siRNA molecule or forms part of a double stranded siRNA molecule, the isolated polynucleotide according to the invention preferably consists of SEQ ID NO: 15 or 16. The isolated polynucleotide according to the invention may also be a morpholino molecule.

Morpholino molecules may for example be used in cases where increased stability of the antisense molecule against cellular nucleases is particularly desirable. In a preferred embodiment morpholino molecules are used as single-stranded polynucleotides. In another embodiment, heteroduplexes of a Morpholino strand and a complementary polynucleotide strand may be used.

The person skilled in the art will be familiar with the concept of morpholino antisense technology and will know how to synthesize and use suitable morpholino molecules. For example, cells might be scrape-loaded with morpholino oligonucleotides used at concentrations between 1 and 20 μM. Alternatively, ethoxylated polyethyleneimine complexed morpholino oligonucleotides might be used for cellular delivery. In this setting the concentrations might be approx. 1 μM. Reference can also be made to: Summerton J, Weller D, Antisense Nucleic Acid Drug Dev.1997 Jun; 7(3): 187-95.

The effect of RNA interference, i.e. the reduction or inhibition of the expression of a target gene is typically only transient when the antisense molecules are directly applied to cells. In order to achieve a stable production of siRNA within the cell, it can be advantageous to use an expression vector. Such an expression vector must include a polynucleotide sequence that encodes a siRNA molecule or siRNA-like transcript. A particularly efficient method is to express a single stranded RNA that forms a hairpin with a loop. When expressed in a cell, the hairpin siRNA is processed to form a functional siRNA. For cloning into a siRNA expression vector, hairpin siRNA inserts have the advantage that only a single pair of oligonucleotides are needed. Complementary oligonucleotides may be designed that encode hairpin sequences specific to the mRNA target, a loop sequence seperating the two complementary domains and a polythymidine tract to terminate transcription.

The present invention in one aspect therefore refers to an isolated polynucleotide, comprising (a) a first polynucleotide sequence comprising SEQ ID NO: 4 or a fragment or derivative thereof and a second polynucleotide sequence comprising SEQ ID NO: 1 or a fragment or derivative thereof; or

SEQ ID NO: 2 or a fragment or derivative thereof.

In a preferred embodiment the aforementioned isolated polynucleotide according to (a) or (b) is integrated into an expression vector that directs intracellular synthesis of a siRNA molecules or siRNA-like transcript.

The polynucleotide sequences comprising SEQ ID NO: 4 or SEQ ID NO: 5 are reverse and complement to the polynucleotide sequences comprising SEQ ID NO: 1 or SEQ ID NO: 2 respectively.

In a preferred embodiment the first polynucleotide sequence is located upstream of the second polynucleotide sequence, i.e. SEQ ID NO: 4 or a fragment or derivative thereof is located upstream of SEQ ID NO: 1 or a fragment or derivative thereof or SEQ ID NO: 5 or a fragment or derivative thereof is located upstream of SEQ ID NO: 2 or a fragment or derivative thereof within the same polynucleotide strand.

Preferably the first and/or second polynucleotide sequence has a length of between 10 and 100, between 12 and 80, between 14 and 60, between 16 and 50, between 17 and 40, between 18 and 30 nucleotides, more preferably between 18 and 22 nucleotides. Most preferably the first and/or second polynucleotide sequence hast a length of 19 nucleotides. The terms "upstream" and "downstream" are used herein according to their conventional and well known meaning in the art.

In another preferred embodiment a linker polynucleotide is located downstream of the first polynucleotide sequence and upstream of the second polynucleotide sequence, i.e. a linker polynucleotide is located downstream of SEQ ID NO: 4 or a fragment or derivative thereof and upstream of SEQ ID NO: 1 or a fragment or derivative thereof or downstream of SEQ ID NO: 5 or a fragment or derivative thereof and upstream of SEQ ID NO: 2 or a fragment or derivative thereof.

The term "linker polynucleotide" as used herein refers to a polynucleotide sequence that acts as a molecular bridge to operably link two different polynucleotides sequences, wherein one portion of the linker is operably linked to a first polynucleotide sequence, and wherein another portion of the linker is operably linked to a second polynucleotides sequence.

In a preferred embodiment the linker polynucleotide is a DNA sequence. The length of the linker polynucleotide can vary. The linker is preferably 5 to 15 nucleotides in length, more preferably the linker is 6 to 12 nucleotides in length and most preferably it is 6 or 9 nucleotides in length. The linker can in general comprise any suitable nucleotide sequence. Preferably the linker comprises the sequence 5"-ttcaagaga-3" or 5"-ctcgag-3\

The aforementioned isolated polynucleotide according to (a) or (b) can be single stranded or double stranded. In a preferred embodiment the isolated polynucleotide according to (a) or (b) is double stranded. In order to direct intracellular synthesis of siRNA molecules or siRNA-like transcripts the invention in a further aspect provides an expression vector comprising the aforementioned isolated polynucleotide.

In a preferred embodiment the vector allows for the production of double stranded RNA (dsRNA). The expression vector may be a prokaryotic or eukaryotic expression vector such as a plasmid, a minichromosome, a cosmid, a bacterial phage, a retroviral vector, such as e.g. a lentiviral expression vector, or any other vector known to the skilled person. The skilled person will be familiar with how to select an appropriate vector according to the specific need.

An example of a particulary suited expression vector which allows for the production of dsRNA directly in the target cell is the so-called pSUPER (available from OligoEngine, Inc., Seattle, Washington, United States of America). The vector itself and the mechanism how the dsRNA is produced by using said vector is described in Brummelkamp et al., 2002, Science, Vol. 296, pages 550-553. Another example of such a vector named pSilencer (available from Ambion) was developed by Sui et al., 2002, Proc. Natl. Acad. Sci. Vol. 99, pages 5515-5520. Further preferred expression vectors are lentiviral expression vectors. An example of a lentiviral expression vector is the pLKO.l puro vector (Stewart,S.A., et al.,

Lentivirus-delivered stable gene silencing by RNAi in primary cells, RNA, 9,493- 501 (2003);vector available from Sigma-Aldrich).

In a preferred embodiment the expression vector according to the invention might therefore be pSUPER or a lentiviral expression vector.

The present invention in another aspect refers to a host cell comprising an expression vector according to the invention. Depending on the area of applications, the host cell may be a prokaryotic or eukaryotic host cell. Typical prokaryotic host cells include bacterial cells such as e.g. Escherichia coli (E. coli) or Klebsiella species. Typical eukaryotic host cells include yeast cells such as Saccharomyces cerevisiae, insect cells such as SF9 cells, plant cells and mammalian cells such as COS, CHO and HeLa cells. In one preferred embodiment the eukaryotic host cells are glioblastoma cells.

In order to exert the desired function, i.e. reducing or inhibiting the expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof, the antisense molecules according to the present invention need to be delivered into target cells, preferably into tumor cells.

There are several well-known methods of introducing polynucleotides into cells, any of which may be used in the present invention and which depend on the host. Typical hosts include mammalian species, such as e.g. humans, non-human primates, dogs, cats, cattle, horses, sheep, and the like. A preferred host is human. At the simplest, the polynucleotide can be directly injected into the target cell / target tissue. Other methods include fusion of the recipient cell with bacterial protoplasts containing the nucleic acid, the use of compositions like calcium chloride, rubidium chloride, lithium chloride, calcium phosphate, DEAE dextran, cationic lipids or liposomes or methods like receptor-mediated uptake (e.g. apoA-I-containing nanoparticles might be added to target cells/target tissue where they bind to scavenger receptor class B, type I and deliver oligonucleotides via 'selective uptake' which does not involve endocytosis of the remaining particle) biolistic particle bombardment ("gene gun" method; e.g. oligonucleotides might be coated on gold particles and delivered in vitro, in situ, or in vivo via a 100 - 600 psi helium pulse into the target cells/tissues), infection with viral vectors, electroporation (e.g. via nucleofection where 2x10⁶ cells might be resuspended in 100 μl transfection reagent. Then, 3 μg of suitable oligonucleotides might be electroporated under suitable conditions) and the like. The person skilled in the art will be familiar with these methods.

In one embodiment the polynucleotide according to the invention may be complexed to high densitiy lipoproteins for delivery into the cell.

Preferably, the antisense molecules or any other compound according to the present invention suitable for reducing or inhibiting the expression or activity of a polypeptide according to SEQ ID NO: 3 are delivered to the cell using carrier particles.

The present invention in one aspect therefore refers to a carrier particle comprising at least one compound according to the invention that is suitable for reducing or inhibiting the expression or activity of a polypeptide according to SEQ ID NO: 3 or a homologue thereof and/or an expression vector or host cell according to the invention.

Preferably, said carrier particle is a liposome, a micelle, a dendrimer or a nanoparticle.

Depending on the nature of the carrier particle, the average diameter of said carrier particle is between 10 nm to 10 μm.

The terms "liposome" and "micelle" are used herein according to their conventional and well known meaning in the art.

Dendrimers in the context of the present invention may be any dendrimers known to the skilled person that are suitable for delivery of biological or pharmaceutical material or compounds. One example for such dendrimers are polypropylenimine dendrimers.

In a preferred embodiment the carrier particle according to the invention is a nanoparticle.

In a particularly preferred embodiment said carrier particle is a nanoparticle comprising at least one molecule selected from the group of

(a) an isolated polynucleotide which (aa) hybridizes over its entire length to SEQ ID NO: 6, and/or

(ab) is at least 70% identical over its entire length to SEQ ID NO: 7; wherein said isolated polynucleotide is capable of reducing or inhibiting the expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof; (b) a double stranded siRNA molecule capable of reducing or inhibiting the expression of a polypeptide according to SEQ ID No: 3 or a homologue thereof;

(c) an isolated polynucleotide according to the invention comprising or consisting of either SEQ ID NO: 1, 2, 15 or 16, or a fragment or derivative thereof or an isolated polynucleotide according to the invention comprising

(a) a first polynucleotide sequence comprising SEQ ID NO: 4 or a fragment or derivative thereof and a second polynucleotide sequence comprising SEQ ID NO: 1 or a fragment or derivative thereof; or (b) a first polynucleotide sequence comprising SEQ ID NO: 5 or a fragment or derivative thereof and a second polynucleotide sequence comprising SEQ ID NO: 2 or a fragment or derivative thereof; and/or

(d) an expression vector as described herein. It is to be understood that the term "over its entire length" as used herein refers to the isolated polynucleotide according to the invention.

In a preferred embodiment the aforementioned isolated polynucleotide according to (a) is a single stranded RNA or a single stranded DNA molecule that is capable of hybridizing to human PKDl mRNA (SEQ ID NO: 6), thereby inducing RNA interference or any other intracellular antisense mechanism that results in reduction or inhibition of the expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof. The isolated polynucleotide according to (a) is preferably at least 50%, preferably at least 60%, preferably at least 70%, more preferably at least 75%, more preferably at least 80 %, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% and most preferably at least 99% identical over its entire length to the reverse complement sequence of human PKDl mRNA (SEQ ID NO: 7).

To induce RNA interference, the isolated polynucleotide according to (a) preferably has a length of between 10 and 100, between 12 and 80, between 14 and 60, between 16 and 50, between 17 and 40, more preferably between 18 and 30 nucleotides and most preferably between 18 and 22 nucleotides.

To inhibit translation in an antisense approach, the isolated polynucleotide according to (a) typically has a length of about 10 to about 500 nucleotides, of about 11 to about 200 nucleotides, of about 12 to about 100 nucleotides, about 13 to about 75 nucleotides or of about 14 to about 50 nucleotides, of about 15 to about 40 nucleotides, of about 16 to about 30 nucleotides or of about 17 to about 25 nucleotides. The aforementioned double stranded siRNA molecule according to (b) can be of any sequence that allows the siRNA molecule to induce RNA interference resulting in reduction or inhibition of the expression of a polypeptide according to SEQ ID No: 3 or a homologue thereof.

Preferably, the aforementioned double stranded siRNA molecule according to (b) has a length of between 10 and 100, between 12 and 80, between 14 and 60, between 16 and 50, between 17 and 40, more preferably between 18 and 30 nucleotides and most preferably between 18 and 22 nucleotides.

Nanoparticles according to the invention include e.g. solid lipid nanoparticles, metallic nanoparticles, semiconductor nanoparticles, polymeric and biopolymeric nanoparticles. The nanoparticle according to the invention may comprise one or more materials selected from the group consisting of silica, gold, heavy metals, iron oxide, polymers, biocompatible and biodegradable polymers such as e.g. poly(D,L-lactide- co-glycolide), poly (ε-caprolactone) and poly (β-amino esters), proteins, nucleic acids, lipids,(proteo) liposomes, (reconstituted) lipoproteins, combinations thereof or any other suitable material known to the skilled person. The person skilled in the art will know how to select an appropriate material for a given application.

The nanoparticles may comprise a metallic core or shell to exploit for optical imaging or Magnetic Resonance Imaging in tumor diagnostics, guided hyperthermia therapy and guided radiation therapy.

In order to enhance targeting efficiency of the nanoparticle and/or to confer advantageous properties to the nanoparticle such as increased solubility and biocompatibility useful in crossing biophysical barriers such as for example the blood brain barrier, the surface of the nanoparticle may be modified.

The surface of the nanoparticle may be modified, e.g. by coating/linking with folate, antibodies, adjuvants, ligands, antigens, proteins, enzymes, pH sensitive agents or any other suitable material or compound known to the skilled person.

In a preferred embodiment a carrier particle according to the invention in addition to the at least one molecule selected from the group of (a) to (d) or any other compound according to the invention that is suitable for reducing or inhibiting the expression or activity of a polypeptide according to SEQ ID NO: 3 or a homologue thereof comprises at least one compound selected from the group of protamine, serum albumin and Interleukin 13 or combinations thereof.

In a particularly preferred embodiment a nanoparticle according to the invention is assembled from protamine, human serum albumin and at least one of the molecules according to (a)-(d).

Such a nanoparticle is referred to as ternary nanoparticle.

In one embodiment the mass ratio of the at least one molecule according to (a)-(d), protamine and human serum albumin is 1 :3:5.

Preferably, the mass ratio of the at least one molecule according to (a)-(d), protamine and human serum albumin is 1 :4:5. In another particularly preferred embodiment a nanoparticle according to the invention is assembled from protamine and at least one of the molecules according to (a)-(d) in a mass ratio of 4:1.

Such a nanoparticle is referred to as binary nanoparticle.

In one embodiment nanoparticles according to the invention may comprise Inter leukin-13.

Interleukin-13 receptor is constitutively overexpressed on a variety of tumor cells, including malignant glioma cells. Interleukin-13 may therefore be coupled to nanoparticles according to the invention in order to improve the efficacy of targeting said nanoparticles to tumor cells. Interleukin 13 may in particular be coupled to the inventive nanoparticles for improving the efficacy of targeting said nanoparticles to malignant glioma cells.

Preferably, the average diameter of ternary nanoparticle is between 80-500 nm at pH 6.5.

Preferably, the average diameter of binary nanoparticles is between 50-250 nm, at pH 6.5.

In a further aspect the present invention relates to pharmaceutical composition for the treatment of cancer comprising at least one compound according to the invention that is suitable for reducing or inhibiting the expression or activity of a polypeptide according to SEQ ID NO: 3 or a homologue thereof and/or an expression vector, host cell or carrier particle according to the invention. In a particularly preferred embodiment said pharmaceutical composition comprises at least one compound selected from the group of (a) an isolated polynucleotide which

(aa) hybridizes over its entire length to SEQ ID NO: 6, and/or (ab) is at least 70% identical over its entire length to SEQ ID NO: 7; wherein said isolated polynucleotide is suitable for reducing or inhibiting the expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof;

(b) a double stranded siRNA molecule capable of reducing or inhibiting the expression of a polypeptide according to SEQ ID No 3 or a homologue thereof;

(a) a first polynucleotide sequence comprising SEQ ID NO: 4 or a fragment or derivative thereof and a second polynucleotide sequence comprising SEQ ID NO: 1 or a fragment or derivative thereof; or

(b) a first polynucleotide sequence comprising SEQ ID NO: 5 or a fragment or derivative thereof and a second polynucleotide sequence comprising SEQ ID NO: 2 or a fragment or derivative thereof;

(d) an expression vector as described herein;

(e) a host cell as described herein; or

(f) a carrier particle as described herein; and/or combinations thereof and optionally a pharmaceutically acceptable excipient.

The aforementioned pharmaceutical composition according to the invention comprises at least one compound selected from the group of (a)-(f). However, the aforementioned pharmaceutical composition according to the invention may also comprise combinations of the compounds according to (a)-(f).

To inhibit translation in an antisense approach, the isolated polynucleotide according to (a) typically has a length of about 10 to about 500 nucleotides, of about 11 to about 200 nucleotides, of about 12 to about 100 nucleotides, about 13 to about 75 nucleotides or of about 14 to about 50 nucleotides, of about 15 to about 40 nucleotides, of about 16 to about 30 nucleotides or of about 17 to about 25 nucleotides. The aforementioned double stranded siRNA molecule according to (b) can be of any sequence that allows the siRNA molecule to induce RNA interference resulting in reduction or inhibition of the expression of a polypeptide according to SEQ ID No: 3 or a homologue thereof;

A pharmaceutical dosage form according to the invention can be administered orally, for example in the form of pills, tablets, lacquered tablets, sugar-coated tablets, granules, hard and soft gelatin capsules, aqueous, alcoholic or oily solutions, syrups, emulsions or suspensions, or rectally, for example in the form of suppositories. Administration can also be carried out parenterally, for example subcutaneously, intramuscularly or intravenously in the form of solutions for injection or infusion. Other suitable administration forms are, for example, percutaneous or topical administration, for example in the form of ointments, tinctures, sprays or transdermal therapeutic systems, or the inhalative administration in the form of nasal sprays or aerosol mixtures.

For the production of pills, tablets, sugar-coated tablets and hard gelatin capsules it is possible to use, for example, lactose, starch, for example maize starch, or starch derivatives, talc, stearic acid or its salts, etc. Carriers for soft gelatin capsules and suppositories are, for example, fats, waxes, semisolid and liquid polyols, natural or hardened oils, etc. Suitable carriers for the preparation of solutions, for example of solutions for injection, or of emulsions or syrups are, for example, water, physiological sodium chloride solution, alcohols such as ethanol, glycerol, polyols, sucrose, invert sugar, glucose, mannitol, vegetable oils, etc.

The pharmaceutical preparations can also contain additives, for example fillers, disintegrants, binders, lubricants, wetting agents, stabilizers, emulsifiers, dispersants, preservatives, sweeteners, colorants, flavorings, aromatizers, thickeners, diluents, buffer substances, solvents, solubilizers, agents for achieving a depot effect, salts for altering the osmotic pressure, coating agents or antioxidants.

Examples of suitable excipients for the various different forms of pharmaceutical compositions described herein may be found in the "Handbook of Pharmaceutical Excipients", 2nd Edition, (1994), Edited by A Wade and PJ Weller.

Pharmaceutical dosage forms in accordance with the invention may preferably be implants that constantly release the inhibitory nucleic acid molecules in accordance with the invention. In one preferred embodiment a pharmaceutical dosage form according to the invention may be administred intravenously, intracranially, adsorbed to slow release wafers, incorporated in gels, via microperfusion, or by convection-enhanced delivery.

In one aspect the present invention relates to the use of a pharmaceutical composition according to the invention for the manufacture of a medicament for the treatment of cancer.

In a further aspect the present invention relates to the use of a compound according to the invention that is suitable for reducing or inhibiting the expression or activity of a polypeptide according to SEQ ID NO: 3 or a homologue thereof and/or an expression vector, host cell or carrier particle according to the invention for the manufacture of a medicament for the treatment of cancer. Said cancer may be a colorectal, lung or breast cancer or cancer of the brain, such as glioblastoma. Said cancer may further be non-Hodgkin lymphoma, head and neck cancer, non-small cell lung cancer, ovarian cancer or urinary bladder cancer.

Preferably said cancer is a glioma.

In a preferred embodiment, the pharmaceutical composition according to the invention further comprises an active compound suitable for the treatment of cancer.

In a preferred embodiment the active compound is a chemotherapeutic agent.

Examples of chemotherapeutic agents are temozolomide, adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids, e. g., paclitaxel (Taxol, BristolMyers Squibb Oncology, Princeton, NJ), toxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carminomycin, aminopterin, dactinomycin,mitomycins, melphalan andotherrelated nitrogen mustards and hormonal agents that act to regulate or inhibit hormone action on tumors such as tamoxifen and onapristone.

In a preferred embodiment the chemotherapeutic agent is temozolomide.

A preferred embodiment further relates to a pharmaceutical composition according to the invention, wherein said cancer is a brain tumor.

In a further preferred embodiment said brain tumor is a glioma or a meningioma. Preferably said glioma is a malignant glioma of WHO grade III or IV. Said meningioma can be benign or malignant.

In yet a preferred embodiment said glioma is an astrocytoma.

In a further object the present invention relates to a transgenic animal containing an expression vector capable of expressing a polypeptide which is identical to or a homologue of the polypeptide according to SEQ ID NO: 3 and wherein the polypeptide has the molecular function of the polypeptide according to SEQ ID NO: 3.

Such transgenic animals can e.g. be used as model organisms for research purposes. For example, it might be used to study the effects of different expression levels of the polypeptide according to SEQ ID NO: 3 or a homologue thereof on tumor progression in vivo or to identify a modulator of tumor progression in vivo.

The person skilled in the art is familiar with how to produce such transgenic animals. Typically preferred species for such transgenic animals are rodents such as mice and rats. The expression vector may be integrated into the genome of the transgenic animal. Appropriate expression vectors are well known to those of skill in the art.

In one embodiment transgenic animals according to the invention may contain selected systems that allow for regulated expression of the polypeptide according to SEQ ID NO: 3 or a homologue thereof. One example of such a system is the cre/loxP recombinase system of bacteriophage Pl. For a description of the cre/loxP recombinase system, see, e.g., Lakso et al. PNAS 89:6232-6236 (1992). Another example of a recombinase system is the FLP recombinase system of S. cerevisiae (O'Gorman et al. Science 251 :1351-1355 (1991).

Transgenic animal are preferably rodents with mice and rats being partcilularly preferred.

In order to determine whether a polypeptide has the molecular function of the polypeptide according to SEQ ID NO: 3 analysis of protein expression and/or analysis of the serine phosphorylation status in the trans-and/or autophosphorylation domain using phosphosite specific antibodies and western blotting can be performed. Alternatively in vitro phosphorylation assays using (γ³²P) ATP as e.g. described in Jaggi et al. Cancer Res. 2005 Jan 15;65(2):483-92 can be used.

In a further aspect the present invention relates to a method of detecting the presence of a tumor in a biological sample from a subject comprising at least the steps of:

(a) providing a biological sample from the subject; and

The person skilled in the art will know how to determine the level of expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof in a sample. The level of expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof can for example be determined by Western Blot using an anti-PKDl antibody and subsequent quantitaion of expression levels using densitometric evaluation of the bands of interest and comparing their intensities to those of a house keeping protein like GAPDH or actin. The level of expression of a polypeptide according to SEQ ID NO: 3 in a tumor cell may be approximately 1.3 to 4 fold higher than in a control cell. Suitable control cells would e.g. be primary brain cells (e.g. astrocytes) isolated from brain samples obtained during surgery performed on epilepsy, bipolar disorder or schizophrenia patients.

In a preferred embodiment said tumor is a brain tumor.

In a further preferred embodiment said brain tumor is a glioma or a meningioma.

Preferably said glioma is a malignant glioma of WHO grade III or IV. Said meningioma can be benign or malignant.

In yet a preferred embodiment said glioma is an astrocytoma.

In a preferred embodiment the relative level of expression of the polypeptide according to SEQ ID NO: 3 or the homologue thereof in the sample in (b) as compared to the control correlates with tumor grading (see figure 1 for reference).

In a further aspect the present invention provides a method for identifying a molecule capable of modulating cell proliferation comprising at least the following steps:

(a) providing cells from a tissue or from a cell line; (b) contacting said cells according to (a) with a test compound;

(c) determining the activity or the expression level of a polypeptide according to SEQ ID NO: 3 or a homologue thereof in said cells, (d) comparing the activity or the expression level in (c) to the activity or expression level in a control, wherein a higher or lower activity or expression level of the polypeptide according to SEQ ID NO: 3 in comparison to the control indicates that the test compound is capable of modulating cell proliferation.

In a preferred embodiment the cells from the cell line according to (a) are mammalian cells, such as for example CHO cells, COS cells, HeLa cells, fibroblasts or any other suitable mammalian cells known to the skilled person .

In a preferred embodiment, the tissue in (a) is from a tumor and the cell line in (a) is a tumor cell line. A suitable tumor cell line may be for example a primary tumor cell line or any immortalized cell line known to the skilled person, such as for example HeLa cells or Jurkat cells. In a preferred embodiment the cell line in (a) is a genetically modified cell line overexpressing a polypeptide according to SEQ ID NO: 3 or a homologue thereof. As used herein the term "overexpressing" means that a genetically modified cell expresses a higher amount of a polypeptide according to SEQ ID NO: 3 or a homologue thereof than a non-modified control cell under similar experimental conditions.

A higher level of expression can for example be achieved by expressing one or more exogenous copies of a polypeptide according to SEQ ID NO: 3 or a homologue thereof in a cell using an expression vector. A higher level of expression can also be achieved by expressing a polypeptide according to SEQ ID NO: 3 or a homologue thereof from an expression cassette integrated into the genome of the cell, wherein, preferably, a strong promoter such as for example a viral promoter, e.g. a VSV or SV40 promoter, drives the expression of the polynucleotide according to SEQ ID NO: 3 or a homologue thereof.

Test compounds according to (b) may for example be compounds from libraries such as small compound libraries, nucleic acid libraries, antibody libraries or peptide libraries.

The activity or the expression level in (c) might e.g. differ from the activity or expression level in a control by approximately l%-80 %.

A suitable control would be, e.g., a cell obtained in (a) that has not been contacted with a test compound.

In a preferred embodiment said tumor is a brain tumor.

In a further preferred embodiment said brain tumor is a glioma or a meningioma.

In yet a preferred embodiment said glioma is an astrocytoma.

The present invention will now be described with respect to some of its specific examples. These examples are however not to be construed in a limiting way. EXAMPLES

Material and Methods

Cell culture of A172 cells

The human GBM cell line A 172 (obtained from American Type Culture Collection, Rockville, MD, USA) was maintained in Dulbeccos Modified Eagle Medium (DMEM) "high glucose" supplemented with 10% fetal calf serum, lOOU/ml penicillin and lOOμg/ml streptomycin. Cells were incubated in a humidified 37°C / 5% CO₂ incubator. Cells were splitted every 4-7 days and used in experiments for no more than 20 additional passages.

siRNA transfection of A172 cells

Non-specific RNA (UAA GGC UAU GAA GAG AUA C (SEQ ID NO: 14); at least 4 mismatches to any human, mouse or rat gene; microarray tested) or PKDl siRNA (target sequence: NM_002742 (SEQ ID NO: 6), human PRKCM, Start: 1893: 5' - GAA CCA AC UU GC ACA GAG A dTdT- 3' (SEQ ID NO: 15) and Start 1197: UUG GCG AAG UGA CCA UUA A dTdT) (SEQ ID NO: 16) was transfected into Al 72 cells by electroporation using Nucleofector technology from Amaxa. Cells were cultured in 75 cm² culture flasks supplemented with medium. Before transfection, cells were washed twice with Ix phosphate-buffered saline (PBS), detached with trypsin and centrifuged (900 rpm, 4 min). The supernatant was removed and according to the manufacturer's instructions about 2x10⁶ cells were resuspended in 100 μl transfection reagent (mouse astrocyte nucleofector solution from Amaxa) at room temperature. Then, 11 μl (3 μg) siRNA or 11 μl (3 μg) scramble RNA were added. The samples were mixed by pipetting and then transferred into Amaxa certified cuvettes. After electroporation with the program T- 24, cells were immediately resuspended in medium and cultured for 3 days into 6 cm dishes (for cell lysis for Western Blots), 10 cm Petri dishes (for RNA isolation) or 4 well Permanox Chamber Slides (for Immunocytochemistry). Silencing of PKDl was examined by Western Blot Analysis.

Cell proliferation

Control, mock or silenced A172 or U87MG cells (50,000) were seeded on 6-well cluster plates and cultured in DMEM/10% FCS. At the indicated time points, cells were trypsinized, harvested, and counted manually by a hemacytometer in triplicates.

Isolation and culture of primary glioma tumor cells

Tumor tissue specimens were obtained from patients during open surgical resection of astrocytic gliomas. The WHO grade was diagnosed according to perioperative diagnosis on cryostat sections by a neuropathologist. After removal the biopsies were transferred immediately to liquid nitrogen (for protein expression patterns experiments and immunohistochemical characterization) or prewarmed DMEM ,,high glucose" supplemented with 100 U/mL penicillin and 100 μg/mL streptomycin (for isolation and culture) and transported to the laboratory within 20 minutes. To investigate protein expression patterns, the biopsy material was homogenized in liquid nitrogen, resuspended in PJPA-buffer (Tris-HCl, 50 mM; pH 7.4; NP-40, 1%; Na-deoxycholate, 0.25%; NaCI, 150 mM; EDTA, 1 mM; PMSF, 1 mM; aprotinin, leupeptin, pepstatin, 1 μg/ml each; Na₃VO₄, 1 mM; NaF, 1 mM), sonicated, and centrifuged to remove debris and insoluble proteins. The supernatant was removed, the protein content analyzed using the Bradford method and equal amounts of protein was separated on SDS-PAGE gels prior to immunoblotting. For primary tumor cell isolation and subsequent cell culture, the human biopsy samples (after transportation) were washed in DMEM and blood vessels were removed as best as possible. Then the samples were mechanically homogenized by staggered roller blades, the homogenized material was rinsed with PBS again and plated in medium on 25 cm² flasks. After two days in culture the non-adherent material was removed and adherent cells were further cultured. When the cells were confluent, they were trypsinized and transferred to new flasks for further amplification.

Immunohistochemical characterization

Tumor tissue specimens were obtained from patients during open surgical resection as described above. Thereafter the tissue samples were embedded in Tissue Tec OCT and serial cryosections (5 μm) in a cryostat (Microm HM 500 OM; Microm, Walldorf, Germany) were made. Cryosections were collected on glass slides and air dried for 2 h at 22°C. Before staining, the samples were thawed, fixed once more in acetone for 5 min. at 22°C, rehydrated in PBS for 5 min. and blocked with protein block for 15 min. The sections were incubated with monoclonal rat anti- human glial fibrillary acid protein (GFAP) (1:10), followed by incubation with a Cy-2 labeled goat anti-human antibody (1 : 100). Afterwards the sections were incubated with rabbit anti-PKDl antibody (sc-935, D-20, 1 :50), followed by incubation with Cy-3 labeled goat anti-rabbit antibody (1 :400). Sections were mounted with Moviol and analysed on a confocal laser scanning microscope (Leica TCS NT, Leica Lasertechnik GmbH, Heidelberg, Germany) equipped with an argon-krypton laser. Preparation of Nanoparticles

For 1 ml of ternary nanoparticle preparation, 72 μl (360 μg) of protamine free base

(Sigma AG, Steinheim, Germany) stock solution (containing 5,0 mg/ml protamine in distilled water) were diluted with distilled water to a volume of 333,3 μl. Then 90 μl

(450 μg) of human serum albumin (Sigma AG, Steinheim, Germany) stock solution

(containing 5 mg/ml hsa in distilled water) were diluted with distilled water to a volume of 333,3 μl and afterwords both solutions were mixed and stirred for 5 s.

Subsequent 67,4 μl of siRNA (Biospring, Frankfurt, Germany) stock solution (100 μM, 1336 μg) were diluted (H₂O) to a final volume of 333,3 μl and then, after 10 minutes of incubation mixed with the primary protamine/HSA complex and stirred three times for 1 s.

For 1 ml of binary nanoparticle preparation, 54 μl (270 μg) of protamine free base

(Sigma AG, Steinheim, Germany) stock solution (containing 5,0 mg/ml protamine in H₂O) were diluted with distilled water to a volume of 500 μl. Then 67,4 μl of siRNA

(Biospring, Frankfurt, Germany) stock solution (100 μM, 1336 μg/ml) were diluted with distilled water to a volume of 500 μl and afterwards both solutions were mixed and stirred three times for 1 s.

For the cellular uptake studies Cy-3 conjugated siRNAs were used. After 15 min of incubation, physicochemical measurements and cell culture experiments were performed. For physical characterization the mixtures were analyzed as described.

For cell culture experiments the preparations were diluted with the corresponding cell culture medium.

Preparation of siRNA complexed to high density lipoproteins

siRNA can be complexed to reconstituted high density lipoproteins (rHDL) which are prepared by the sodium cholate dialysis method [Bergt et al. Biochem. J. (2000) 346 (345-354)] and are used as delivery vehicle to induce RNAi. DPPC, siRNA apo A-I are used at molar ratios of 90/10/1. Aliquots of DPPC and siRNA are dried under nitrogen, followed by the addition of Na-cholate. Tubes are vortexed on ice until the solution is optically clear. To the clear solution apoA-I in endotoxin- free buffer is added. rHDL are incubated over night at 37 ⁰C for 16 h. Dialysis with exhaustive changes of buffer is performed at ambient temperature for 3 days. siRNA- containing rHDL are reisolated by density-gradient ultracentrifugation [Sattler, W., Mohr, D. and Stacker, R. (1994) Methods Enzymol. 233, 469-489].

Results

PKDl protein content correlates with tumor grading

It was tested in surgical material obtained from patients (written consent obtained) suffering from astrocytomas of different WHO grading (grade 2-4) whether the expression level of protein kinase Dl (PKDl) correlates with the severity of brain tumor aggressiveness. Due to the lower incidence of low-grade astrocytomas the number of available patient samples is limited. However, it was found that total protein expression levels of PKDl correlate with astrocytoma grading and severity

(Fig- 1)

PKDl is expressed in GFAP-positive cells (astrocytes) and in HLA-DR-positive cells

Cellular expression patterns of PKDl were tested by immunohistochemistry in glioblastoma samples. Expression of PKDl was found in GFAP-positive cells (astrocytes) and in HLA-DR-positive cells (microglia; Fig. 2). PMA induces translocation of PKDl-GFP

To get a more detailed insight into the activation mechanism and subcellular trafficking of PKDl in glioblastoma samples a GFP-tagged PKDl construct was transiently overexpressed in A 172 cells. Cells were then stimulated with the phorbolester PMA (which is a known activator of PKDl) and subcellular trafficking of PKDl in response to PMA was followed by laser scanning microscopy in 5 min intervals (Fig. 3). These results show that PKDl recruitment occurs from perinuclear sites to the plasma membranes and is concentrated in cellular tips that probably resemble invadopodia.

PDGF induces translocation of PKDl-GFP

To test a physiologically more relevant agonist of PKDl a PKDl-GFP construct was overexpressed in A 172 cells, which were then challenged by the addition of PDGF. Also these experiments indicate recruitment of PKDl to the plasma membrane in a time-dependent manner (Fig. 4).

Lysophosphatidic acid (LPA) affects Al 72 cell growth

The effects of lysophosphatidic acid (LPA) on proliferation of glioblastoma cells were explored. The first series of experiments were performed with Al 72 glioblastoma cells to investigate feasible concentrations that affect growth rates. During these experiments (Fig. 5) cells were seeded and cultured under standard conditions in the absence or presence of increasing concentrations of LPA. Results revealed a statistically significant 1.3-fold increase in cell numbers when cultured in the presence of 1 μM LPA for 48 h (170,000 vs. 220,000 cells, respectively). Thus LPA is a bio active lysophospho lipid that contributes to glioblastoma cell growth.

LPA activates PKDl in Al 72 and primary glioblastoma (GBM) cells

LPA was also found to be a potent activator of PKDl . The Western blots shown in Fig. 6 demonstrate that a 30 min incubation of A 172 and primary glioblastoma cells led to dose-dependent autophosphorylation of S916 in PKDl.

Silencing of PKDl in A172 cells

siRNA constructs (target sequence: NM_002742 (SEQ ID NO:6), human PRKCM, Start: 1893: 5' -GAA CCA AC UU GC ACA GAG A dTdT- 3' (SEQ ID NO: 15) and Start 1197: UUG GCG AAG UGA CCA UUA A dTdT) (SEQ ID NO: 16)) were ordered from three different commercial suppliers (Dharmacon, D; Qiagen, Q;

Biospring, B) at three different concentrations (1, 3 and 5 μg). The efficacy of PKDl silencing was analyzed by Western blotting (total PKDl levels; Fig. 7). These results (shown for the 5' -GAA CCA AC UU GC ACA GAG A dTdT- 3' construct) indicate that siRNA obtained from all three commercial suppliers are approximately equally effective in inducing RNAi o f PKD 1.

Silencing of PKDl efficiently reduces tumor cell growth

The outcome of RNAi on glioblastoma cell growth was assessed in proliferation assays (Fig. 8). These results revealed that siRNAs obtained from all three suppliers efficiently silence PKDl up to four days and significantly impair glioblastoma cell growth by 75, 83, and 95 %, respectively (D, Q, B) when used at 3 μg/ml. PKD2 and PKD3 expression levels are not affected by PKDl knockdown

To test the specificity of PKDl silencing in Al 72 cells real time RT-PCR analyses were performed. Primers were designed against human PKDl, PKD2 and PKD3 and semi-quantitative PCR was performed (Fig. 9). Results from microarray analysis revealed that neither PKD2 nor PKD3 expression levels were affected by PKDl knockdown.

Silencing of PKDl in primary glioblastoma cells

PKDl knockdown by RNA interference was also established in primary glioblastoma cells by RNA interference. Results of these preparatory experiments clearly indicate that PKDl in primary glioblastoma cells is accessible to RNAi and is significantly downregulated over a time period of at least four days (Fig. 10). Scrambled siRNA was without effect on PKDl expression levels (Fig. 9, lower panel).

Genomic studies

To get an indication about the outcome of PKDl silencing on the genomic level ABI 1700 microarray (29098 human genes spotted) analysis was performed. These experiments were performed with A 172 glioblastoma cells that were treated with two siRNA constructs (target sequence: NM_002742 (SEQ ID NO: 6), human PRKCM, Start: 1893: 5' -GAA CCA AC UU GC ACA GAG A dTdT- 3'(SEQ ID NO: 15) and Start 1197: UUG GCG AAG UGA CCA UUA A dTdT) (SEQ ID NO: 16)) in the presence of PDGF. The gene clusters that were regulated by both constructs in a similar manner were combined. This clustering method resulted in 66 differently regulated genes out of which 27 were repressed and 39 were induced. These genes were further classified in functional groups according to their involvement in different biological processes using the Panther classification system. For reasons of clarity only the number of genes regulated in functionally related families are shown in Fig. 11. With regards to the physiological outcome of PKDl silencing in Al 72 cells (i.e. impaired growth), one promising candidate strongly upregulated in silenced cells is p21. P21 is a cyclin-dependent kinase 1 inhibitor and a potent suppressor of cell growth. Also sestrin 1 is a potential suppressor of cell growth. A family clustering of differentially regulated genes (using Panther classification) revealed that major gene clusters involved in signaling and regulation of cell proliferation were up or downregulated in PKDl silenced glioblastoma cells. Details regarding the regulation of individual genes in response to PKDl silencing are given in Tables II and III.

Proteomic studies

To reveal changes on the protein levels that are induced in response to PKDl silencing proteome studies were performed. During these studies untreated or siRNA treated cells (target sequence: NM 002742 (SEQ ID NO: 6), human PRKCM, Start: 1893: 5' -GAA CCA AC UU GC ACA GAG A dTdT- 3' (SEQ ID NO: 15) and Start 1197: UUG GCG AAG UGA CCA UUA A dTdT (SEQ ID NO: 16)) were incubated in the presence of PDGF and were analyzed by two dimensional difference gel analysis (2D-DIGE) (Fig. 12). Wild type, scrambled- and PKDl-siRNA treated cells were cultured until 80 % confluency (on 75 cm² flasks) and incubated in the absence or presence of PDGF (20 ng). After an overnight incubation cells were washed and lysed. Aliquots (50 μg protein) of the three lysates were labeled with Cy-2 (wild- type), Cy-3 (scrambled) and Cy-5 (silenced), respectively, and mixed with 500 μg of the unlabeled protein populations. These samples were separated in the first dimension on an IPG strip (pH 3-10) and in the second on 12 % gels. Protein spots were visualized on a Typhoon imager, and analyzed using the DeCyder software. In the gel shown in Fig. 12 approximately 1100 spots were resolved and among these 72 (6.7 %) were downregulated >2-fold and 158 (14.8 %) were upregulated > 2-fold which were picked and tryptically digested. Results for 5' -GAA CCA AC UU GC ACA GAG A dTdT- 3' RNAi (SEQ ID NO: 15) are shown.

Characterization of siRNA binding capacity of ternary siRNA/protamine/HAS nanoparticles

For the preparatation of nanoparticles different protamine/siRN A/albumin-ratios and their capability to effectively bind siRNA were tested. Using different mass ratios the binding capacity for siRNA was established on ethidiumbromide-containing agarose gels.

As evident from Fig. 13 siRNA was assembled with nanoparticles of a mass ratio 1 :3:5 almost quantitatively. However, to introduce a weak positive electrical charge via the positively charged protein protamine, a mass ratio of 1 :4:5 was chosen for future experiments.

Size of ternary nanoparticles is pH-dependent

The next set of experiments established the particle size (by dynamic light scattering) in a pH-dependent manner (Fig. 14). Data of these experiments revealed that the mean diameter of ternary nanoparticles (1 :4:5) ranged between 250 and 400 nm at pH 6.5, while it was considerably higher at pH 12. Therefore, during nanoparticle assembly the pH was kept at 6.5. Effects of desalted siRNA on nanoparticle diameter

Concomitantly the suitability of commercially available and desalted siRNA for nanoparticle assembly and the effects on nanoparticle size was established. These experiments revealed that ternary nanoparticles (1 :4:5) that were synthesized with desalted siRNA preparations (containing Na+ as the sole counter-ion) have a significantly lower particle diameter (Fig. 15; 60 vs. 250 nm). Comparable results were obtained for binary nanoparticle preparations

PKDl silencing in Al 72 cells with electroporated protamine/siRNA nanoparticles

These nanoparticles were electroporated into A 172 cells (Fig. 16) and the effects on PKDl silencing were analyzed by Western blotting. It was demonstrated for the first time that nanoparticles can be transfected by electroporation followed by siRNA release as evident by induction of RNAi.

PKDl silencing in U87MG glioblastoma cells using lentiviral constructs expressing different shRNAs

Lentiviral constructs (Sigma) expressing 5 different stem-loop constructs encoding hairpin RNAs directed against the mRNA of human PKDl were used to induce RNAi. The following sequences were used:

TRCN0000002124 (Clone ID: NM 002742.x-672slcl: coding sequence) CCGGCCCACGCTCTCTTTGTTCATTCTCGAGAATGAACAAAGAGAGCGTG GGTTTTT (SEQ ID NO: 17) TRCN0000002125 (Clone ID: NM 002742.x-2498slcl: coding sequence) CCGGCTAAGGAACAAGGGCTACAATCTCGAGATTGTAGCCCTTGTTCCTT AGTTTTT (SEQ ID NO: 18)

TRCN0000002126 (Clone ID: NM 002742.x-2978slcl: 3'-UTR) CCGGCCATCTCCTATAATCTGTCAACTCGAGTTGACAGATTATAGGAGAT GGTTTTT (SEQ ID NO: 19)

TRCN0000002127 (Clone ID: NM 002742.x-1556slcl: coding sequence) CCGGCGGCACTATTGGAGATTGGATCTCGAGATCCAATCTCCAATAGTGC CGTTTTT (SEQ ID NO: 20) TRCN0000002128 (Clone ID: NM 002742.x-2270slcl: coding sequence)

CCGGCCAGAGCACATAACGAAGTTTCTCGAGAAACTTCGTTATGTGCTCT GGTTTTT (SEQ ID NO: 21)

Expression of PKDl was analyzed on niRNA (quantitative real time PCR; Fig. 17A) and protein level (Western blot experiments; Fig. 17B). Results indicate that this experimental approach is useful to silence PKDl expression on mRNA and protein level. Densitometric evaluation of the western blot and the corresponding relative optical density (ROD) of PKDl is shown in the bar graph in B.

The invention has been described with respect to some specific examples. However, these examples are not be understood as limiting the invention in any way.

Tables

Table I: Differentially expressed proteins in Al 72 cells (wt vs. silenced)

* number of identified peptides/percent sequence coverage Table II: List of induced genes in PKDl -silenced Al 72 cells (Microarray analysis)

Gene Name Fold Change Common Genbank Gene_Name

154424 7,745 KIAA1912 AB067499 1 null

155724 6,904 KRTHB1 NM_002284 2 keratin, hair, basic, 1

193383 5,854 KRTHB1 NM_002281 2 keratin, hair, basic, 1 cychn-dependent kinase inhibitor 1A (p21 ,

137292 5, 15 CDKN1A NM_000389 2 Cιp1 )

115924 4,871 SESN1 NM_014454 1 sestrin 1

109792 4,583 FDXR NM_024417 1 ferredoxin reductase

121071 4,483 FLJ20489 N M_017842 1 null

166176 3,997 null null

702747 3,664 UCA1 BC017567 1 null

218530 3,483 JPH1 NM_020647 1 junctophihn 1

161567 3,339 PAPOLG NM_022894 2 poly(A) polymerase gamma

CD68 antιgen|eukaryotιc translation initiation

203170 3,218 CD68|EIF4A1 NM_001251 1 factor 4A, isoform 1

182417 2,843 DUSP1 NM_004417 2 dual specificity phosphatase 1

215284 2,733 BDNF NMJ 70734 2 brain-derived neurotrophic factor

146324 2,713 SPANXC NM_022661 2 SPANX family, member C

201217 2,707 SMG1 NM_015092 2 null

103357 2,663 BTBD14A BC045702 1 BTB (POZ) domain containing 14A

139725 2,651 NRXN3 NMJ38970 2 neurexin 3

G protein-coupled receptor, family C, group 5,

180293 2,599 GPRC5A NM_003979 2 member A

122331 2,532 DIO2 AF007144 1 deiodmase, iodothyronine, type Il

223108 2,448 NRG1 N M_013962 1 neureguhn 1

148634 2,426 PPCS NM_024664 1 phosphopantothenoylcysteine synthetase mitogen-activated protein kinase-activated

135157 2,399 MAPKAPK3 NM_004635 3 protein kinase 3

NIMA (never in mitosis gene a)-related kinase

223768 2,395 NEK7 AB062450 1 7 inhibitor of DNA binding 1 , dominant negative

204743 2,31 ID1 NM_002165 2 helix-loop-hehx protein

118944 2,306 NRG1 NM_013962 1 neureguhn 1

121269 2,236 null BC015429 1 null

166587 2,209 DIRAS3 NM_004675 1 DIRAS family, GTP-binding RAS-like 3

157574 2,203 LHB NM_000894 2 luteinizing hormone beta polypeptide

202674 2,198 ZNF295 AP001745 1_CDS_3 zinc finger protein 295

171398 2,166 SEC23B AL121893 21_CDS_7 Sec23 homolog B (S cerevisiae)

1481 16 2,153 PLXNA3 NM_017514 1 plexin A3

227404 2,148 NRG1 N M_013957 1 neureguhn 1

140272 2,086 C19orf33 NM_033520 1 chromosome 19 open reading frame 33 235051 2,071 null null

148299 2,058 WDR25 NM_024515 2 WD repeat domain 25 ras-related C3 botulinum toxin substrate 2 (rho

164911 2,029 RAC2 NM_002872 3 family)

146510 2,017 BAX NMJ38765 2 BCL2-assocιated X protein

141908 2.013 PECI NM 206836 1 peroxisomal D3,D2-enoyl-CoA isomerase

Table III: List of repressed genes in PKDl -silenced A 172 cells (Microarray analysis).

Gene Name Fold Change Common Genbank Gene_Name

169984 0,374 SEPP1 NM_005410 1 selenoprotein P, plasma, 1

119769 0,48 LTBP1 NM_000627 2 latent transforming growth factor beta binding protein 1

178884 0,275 PCSK5 NM_006200 2 proprotein convertase subtilisin/kexin type 5

222577 0,38 RGS5 BC030059 1 regulator of G-protein signalling 5

108301 0,481 PDGFD NM_033135 2 platelet derived growth factor D

173025 0,405 RGS 16 U 70426 1 regulator of G-protein signalling 16

110557 0,339 FXYD6 NM_022003 1 FXYD domain containing ion transport regulator 6

159901 0,413 CCL2 NM_002982 2 chemokine (C-C motif) hgand 2

192935 0,397 RGS5 BC030059 1 regulator of G-protein signalling 5

11 1908 0,178 PRKD1 NM_002742 1 protein kinase D1

107328 0,158 HSD17B6 NM_003725 2 hydroxysteroid (17-beta) dehydrogenase 6 transmembrane and tetratricopeptide repeat containing

206456 0,275 TMTC1 NMJ94311 1 1

190274 0,386 CRYAB NMJ)01885 1 crystallin, alpha B

228853 0,342 null AK056283 1 null

228921 0,441 LOC400764 null

113714 0,34 C18orf1 NMJ81481 1 chromosome 18 open reading frame 1

128315 0,481 TM4SF1 NM_014220 1 transmembrane 4 L six family member 1

137034 0,43 BEX1 NM_018476 2 brain expressed, X-linked 1

229693 0,497 null null serpin peptidase inhibitor, clade I (neuroserpin), member

134551 0,288 SERPINI1 NM_005025 1 1

208672 0,356 PLAU NM_002658 1 plasminogen activator, urokinase

TIMP metallopeptidase inhibitor 3 (Sorsby fundus

179538 0,394 TIMP3 NM_000362 3 dystrophy, pseudoinflammatory)

135420 0,394 MMP1 1 NM_002784 2 matrix metallopeptidase 1 1 (stromelysin 3) membrane metallo-endopeptidase (neutral

197353 0,289 MME NM_007289 1 endopeptidase, enkephahnase, CALLA, CD10)

149612 0,393 HIST1 H1 E NM_005321 2 histone 1 , H1 e

1151 14 0,468 DNAJC15 NM_013238 1 DnaJ (Hsp40) homolog, subfamily C, member 15

108880 0,438 GPR124 NM 032777 6 G protein-coupled receptor 124

Claims

1. A compound suitable for reducing or inhibiting the expression or activity of a polypeptide according to SEQ ID NO: 3 or a homologue thereof.

2. A compound according to claim 1, wherein said compound is an isolated polynucleotide, an aptamere, an antibody or an inhibitory peptide.

3. A compound according to any of claims 1 or 2, wherein said compound is an isolated polynucleotide comprising or consisting of either SEQ ID NO: 1, 2, 15 or 16, or a fragment or derivative thereof.

4. An isolated polynucleotide according to claim 3, wherein said polynucleotide is a double stranded RNA or a double stranded DNA molecule.

5. An isolated polynucleotideaccording to any of claims 3 or 4, wherein said polynucleotide is a double stranded siRNA molecule.

6. An isolated polynucleotide according to claim 3, wherein said isolated polynucleotide is a single stranded RNA molecule or a single stranded DNA molecule.

7. An isolated polynucleotide, comprising (a) a first polynucleotide sequence comprising SEQ ID NO: 4 or a fragment or derivative thereof and a second polynucleotide sequence comprising SEQ ID NO: 1 or a fragment or derivative thereof; or (b) a first polynucleotide sequence comprising SEQ ID NO: 5 or a fragment or derivative thereof and a second polynucleotide sequence comprising SEQ ID NO: 2 or a fragment or derivative thereof.

8. An isolated polynucleotide according to claim 7, wherein the first polynucleotide sequence is located upstream of the second polynucleotide sequence.

9. The isolated polynucleotide according to claim 8, wherein a linker polynucleotide is located downstream of the first polynucleotide sequence and upstream of the second polynucleotide sequence.

10. The isolated polynucleotide according to any of claims 7 to 9, wherein the isolated polynucleotide is double stranded.

11. An expression vector comprising an isolated polynucleotide according to any of claims 7 to 10.

12. An expression vector according to claim 11, wherein said expression vector is pSUPER or a lentiviral expression vector.

13. A host cell comprising an expression vector according to any of claims 11 or 12.

14. A carrier particle comprising at least one compound according to any of claims 1 to 13.

15. A carrier particle according to claim 14, wherein said carrier particle is a liposome, a micelle, a dendrimer or a nanoparticle.

16. A carrier particle according to claim 15, wherein said carrier particle is a nanoparticle comprising at least one molecule selected from the group of

(a) an isolated polynucleotide which

(aa) hybridizes over its entire length to SEQ ID NO: 6 and/or (ab) is at least 70% identical over its entire length to SEQ ID NO: 7;

wherein said isolated polynucleotide is capable of reducing or inhibiting the expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof;

(b) a double stranded siRNA molecule capable of reducing or inhibiting the expression of a polypeptide according to SEQ ID No: 3 or a homologue thereof;

(c) an isolated polynucleotide according to any of claims 3 to 10 and/or

(d) the expression vector according to any of claims 11 or 12.

17. A carrier particle according to any of claims 14 to 16 additionally comprising at least one compound selected from the group of protamine, serum albumin and Interleukin 13 or combinations thereof.

18. A pharmaceutical composition for the treatment of cancer comprising at least one compound according to any of claims 1 to 17.

19. A pharmaceutical composition according to claim 18, comprising at least one compound selected from the group of

(ab) is at least 70% identical over its entire length to SEQ ID NO: 7; wherein said isolated polynucleotide is suitable for reducing or inhibiting the expression of a polypeptide according to SEQ ID NO: 3 or a homologue thereof;

(b) a double stranded siRNA molecule capable of reducing or inhibiting the expression of a polypeptide according to SEQ ID No 3 or a homologue thereof; (c) an isolated polynucleotide according to any of claims 3 to 10;

(d) an expression vector according to any of claims 11 or 12;

(e) a host cell according to claim 13; or

(f) a carrier particle according to any of claims 14 to 17 ; and/or combinations thereof and optionally a pharmaceutically acceptable excipient.

20. A pharmaceutical composition according to any of claims 18 or 19, further comprising an active compound suitable for the treatment of cancer.

21. A pharmaceutical composition according to claim 20, wherein the active compound is a chemotherapeutic agent.

22. A pharmaceutical composition according to any of claims 18 to 21, wherein said cancer is a brain tumor.

23. A pharmaceutical composition according to claim 22, wherein said brain tumor is a glioma or a meningioma.

24. A pharmaceutical composition according to claim 23, wherein said glioma is an astrocytoma.

25. A transgenic animal containing an expression vector capable of expressing a polypeptide which is identical to or a homologue of the polypeptide according to SEQ ID NO: 3 and wherein the polypeptide has the molecular function of the polypeptide according to SEQ ID NO: 3.

26. A method of detecting the presence of a tumor in a biological sample from a subject comprising at least the steps of:

(a) providing a biological sample from the subject; and

27. A method according to claim 26, wherein the relative level of expression of the polypeptide according to SEQ ID NO: 3 or the homologue thereof in the sample in

(b) as compared to the control correlates with tumor grading.

28. A method for identifying a molecule capable of modulating cell proliferation comprising at least the following steps: (a) providing cells from a tissue or from a cell line

(b) contacting said cells according to (a) with a test compound;

(c) determining the activity or the expression level of a polypeptide according to SEQ ID NO: 3 or a homologue thereof in said cells,

(d) comparing the activity or the expression level in (c) to the activity or expression level in a control, wherein a higher or lower activity or expression level of the polypeptide according to SEQ ID NO: 3 in comparison to the control indicates that the test compound is capable of modulating cell proliferation.

29. A method according to claim 28, wherein the tissue in (a) is from a tumor and wherein the cell line in (a) is a tumor cell line.

30. A method according to any of claims 28 or 29, wherein the cell line in (a) is a genetically modified cell line overexpressing a polypeptide according to SEQ ID NO: 3 or a homologue thereof.

31. A method according to any of claims 26, 27, 29 or 30, wherein said tumor is a brain tumor.

32. A method according to claim 31, wherein said brain tumor is a glioma or a meningioma.

33. A method according to claim 32, wherein said glioma is an astrocytoma.