EP2281064A1 - Method for labelling a product using a plurality of polynucleotides, method for identifying the labelling and labelled product - Google Patents

Abstract

The present invention relates to a method for labelling a product, to a method for identifying the labelling and to a product labelled by means of the method of the invention. The labelling used in the present invention is based on single-stranded nucleic acids. The labelling method of the present invention comprises a step of addition of a plurality of single-stranded polynucleotides onto or into said product, said plurality of polynucleotides comprising: at least one target polynucleotide comprising a single-stranded polynucleotide of predetermined length and sequence, and decoy polynucleotides which have identical or different predetermined lengths and identical or different predetermined sequences, said decoy polynucleotides having a length or lengths identical to or different from and sequences different from the sequence of said, at least one, target polynucleotide, in which each of the target polynucleotide(s) and decoy polynucleotides does not hybridize with any of the other polynucleotides of said plurality of polynucleotides. The method of the invention makes it possible, for example, to label fragrances, cosmetics, hygiene products, food products, flavourings, extracts of a plant or plants, tobacco, beverages, textiles, leathers, medicaments, powders, varnishes, inks, hydrocarbons, papers, paints, and chemical products and compounds.

Description

 PROCESS FOR MARKING A PRODUCT USING A PLURALITY OF POLYNUCLEOTIDES, METHOD FOR IDENTIFYING THE MARKING AND PRODUCT

MARK

DESCRIPTION

Technical area

The present invention relates to a method of marking a product, a method of identifying the marking and a product labeled by the method of the invention. The labeling used in the present invention is based on single-stranded nucleic acids.

The present invention makes it possible to distinguish an authentic product from a counterfeit. In particular, it makes it possible to mark the authentic product so that it can be traced and identified.

The counterfeiting or illegal reproduction of objects, especially high value-added products, or luxury goods, entails serious financial consequences for companies, but also in terms of jobs, health security or even social life. This is why manufacturers are working to combat this scourge by developing new marking and authentication techniques for their products in order to track and destroy counterfeit products.

References in brackets ([x]) refer to the list of references at the end of the examples.

STATE OF THE ART One of the methods often used to detect and identify an authentic product is the marking of said product "in the mass", by incorporating into this product a body or chemical compound that can be identified unilaterally.

This type of marking must have particular properties: the marking must be done in a transparent manner vis-à-vis the end user of the product, it must not alter the physical properties. product and should not present a hazard to the end user of the product. It must also be, as far as possible, undetrable and / or tamper-proof to avoid being falsified at the same time as the product. There is no reliable technique today, stable over time, in particular for the very many chemical substances known to be aggressive for markers, such as perfumes, cosmetic creams or on materials such as leather, fabric, etc. To date, there are no tagging techniques that actually have great difficulty decrypting for counterfeiters.

There is therefore a real need for a marking and a marking process overcoming these defects, disadvantages and obstacles of the prior art and to fight effectively against counterfeits, including luxury goods.

Presentation of the invention

The present invention is specifically intended to provide a marking solution that meets this need and solving the problems of the prior art. The present invention relates in particular to a method of labeling a product, said method comprising a step of adding to or on said product a plurality of single-stranded polynucleotides, said plurality of polynucleotides comprises:

at least one target polynucleotide consisting of a single-stranded polynucleotide of defined length and sequence, and

decoy polynucleotides which are of identical or different determined lengths and of identical or different determined sequences, said decoy polynucleotides being of identical length (s) or different (s) and of different sequences of the sequence of said at least one target polynucleotide wherein each of the target polynucleotides and lures does not hybridize with any of the other polynucleotides of said plurality of polynucleotides.

In a particular embodiment of the method of the present invention, said plurality of polynucleotides further comprises at least one recognition polynucleotide consisting of a single-stranded polynucleotide of defined length and sequence of nature identification and the sequence of the at least one target polynucleotide, wherein each recognition polynucleotide does not hybridize with any of the other polynucleotides of said plurality of polynucleotides.

The following description is to be considered for the method of the invention as defined above and for the particular embodiment of the method of the invention.

The marking of the present invention therefore consists of said plurality of polynucleotides as defined in the present description. These polynucleotides are single-stranded polynucleotides. In the present description, this polynucleotide is also designated by the term "marker".

The present invention also relates to a labeled product that can be obtained by the method of the invention and to a method for detecting the marking of this product.

The present invention relates in particular to the determination of the marker used to implement the process of the invention, the manufacture of these markers, the marking of the products, as well as the techniques for detecting markers in the marked products. The present invention makes it possible to distinguish a counterfeit from an authentic product or to identify diversions of distribution circuits or unauthorized parallel circuits. The polynucleotides of said plurality of polynucleotides may be of several types: they may be single-stranded ribonucleotide or ribonucleic acid (RNA) polymers or deoxyribonucleotides or single-stranded deoxyribonucleic acid (DNA) or a mixture thereof.

By "plurality of polynucleotides" is meant herein the set formed polynucleotide (s) target (s), lures, and, if appropriate, recognition. Preferably, according to the present invention, several target polynucleotides, several decoy polynucleotides and, where appropriate, several recognition polynucleotides are used. For example, without this example being limiting, it is possible to use from 1 to 100 target polynucleotide (s), for example from 1 to 50, for example from 5 to 50. For example also, without this example being limiting from 2 to 100 polynucleotides, for example from 2 to 50, can be used. For example, if appropriate, without this example being limiting, it is possible to use from 1 to 100 recognition polynucleotides, for example from 1 to 50. The choice of the number of polynucleotides depends on the desired complexity of the marking according to the present invention.

By "target polynucleotide" is meant herein a polynucleotide whose sequence has been determined and constructed to constitute a reference sequence for labeling the product according to the present invention, then to be specifically sought in this product to authenticate it. Preferably, according to the invention, the marker comprises several identical or different target polynucleotides, preferably different. The target polynucleotides are referenced in a confidential target / product database that establishes the link between the target polynucleotide (s) and the labeled product.

By "confidential database" is meant a database to which only the manufacturer of the marking according to the present invention for a given product and / or only the manufacturer / creator of said product has (have) access (the one and / or or the other is hereinafter referred to as "the one who puts implement the present invention "). This is a correspondence base in which, for each product or each product family is assigned a particular signature determined according to the present invention. In the case where only target polynucleotides and decoys are used for the signature of the products, this database or correspondence may be called "confidential target / product base" or "target / product base". Thus, if it is desired to authenticate a product according to the present invention, the target / product base is first searched for the target sequence (s) assigned to said product, and then it is sought if the or the target sequence (s) is (are) actually present in said product, for example using one of the methods described below. If the target sequence (s) is (are) actually present, the product is declared authentic. On the other hand, if the target sequence (s) is (are) not present, the product is declared to be counterfeit. Of course, this only works if all authentic products are marked according to the present invention. The correspondence database may be constructed by the signature manufacturer of the present invention and / or by the manufacturer / creator from a list of signatures according to the present invention, for example by matching each signature to a particular product. In this case, the authentication is direct.

By "decoy polynucleotide" is meant herein a polynucleotide whose sequence has been chosen and constructed to be different from the target sequence (s). The decoy sequences are intended to scramble the marking according to the present invention, but not to be searched in the product to authenticate it. The decoy sequences are there to complicate the work of a counterfeiter to attempt to reproduce the signature of the present invention. Indeed, only one who implements the present invention knows the target sequence (s). The distinction of one or more particular sequence (s), in this case from sequences (s) target (s) for reproduction, among a mixture of target sequences (s) and lures, for reproduction, is made all the more difficult or impossible that, according to the invention, the Decoy sequences are present, which target (s) and decoys are short, single stranded sequences and do not hybridize with each other. The greater the number of decoys, the more difficult the reproduction of the signature as a whole and, statistically, the less chance there is of randomly determining the sequence (s) of the target polynucleotide (s). The sequences of these decoy polynucleotides are also known to those who practice the present invention, but these polynucleotides are not in a database to be assigned to a product.

The term "recognition polynucleotide" is used herein to mean a polynucleotide of a sequence and of a determined length which allows the identification of the target polynucleotide (s). These may have a nature or be present in concentrations facilitating quick search and identification, which can serve as a first test of authentication: their absence is a first sign of counterfeiting. This is one or more polynucleotide (s) whose sequence (s) has (have) been chosen and constructed to constitute a code used in a confidential database of identification of the target polynucleotide (s) or "target identification base" to provide information on the number, nature, sequence and length of the target polynucleotide (s). When there are several recognition polynucleotides, we can speak of "a set of recognition polynucleotides". In this case, in the target identification base, for each recognition polynucleotide or recognition polynucleotide set, is assigned a target polynucleotide or a set of target polynucleotides according to the present invention. The sequences of the recognition polynucleotides are known only to those who implement the present invention. The presence of polynucleotide (s) of recognition in the signature of the The present invention is optional, it corresponds to a particular embodiment of the method of the invention. If one or more recognition polynucleotide (s) is (are) used in the signature according to the invention of a product, a confidential target identification base is created by the one who implements the present invention. This base makes it possible to identify the target polynucleotide (s) present in a product to be authenticated from the recognition polynucleotide (s). In this case, the authentication of a product is indirect. Indeed, if it is desired to authenticate a product intended to include a signature according to the invention, the recognition polynucleotide (s) is identified according to one of the methods described below of the present invention, it is then sought in the database. target identification (s) target (s) assigned (s) to said product, and then it is sought if the target sequence (s) is (are) actually present (s) in said produced, for example using one of the methods described below. If the target sequence (s) is (are) actually present, the product is declared authentic. On the other hand, if the target sequence (s) is (are) not present, the product is declared to be counterfeit. Note in this embodiment of the present invention that there are two steps of identifying polynucleotides before being able to authenticate a product, which complicates the task of any counterfeiters. Of course, this only works if the authentic products are marked according to the present invention. According to the invention, the sequence of the recognition polynucleotides may contain a sub-sequence bearing the code which enables the user of the invention to find which are the target polynucleotides, and which are the polynucleotides luring from a base of target recognition. Thus, during the authentication process of a product, these recognition polynucleotides are extracted from the product to be authenticated, or directly identified in or on the product. Once the nature of recognition polynucleotides is revealed - for example, without this For example, the identification of the target polynucleotides can be done by reading the sequence of a recognition polynucleotide, or by identifying a set of recognition polynucleotides present among a plurality of putative coding polynucleotides. The user of the present invention will refer in a correspondence table (database of recognition of target polynucleotides), and read therein the nature of the target polynucleotides theoretically present in the product to be authenticated. This table can for example, and without this example being limiting, be stored in a secure database and computerized (to ensure confidentiality), which database was created when marking the product, and in which couples ("read recognition polynucleotide code" - "target polynucleotides to be searched for"). Thus, after referring to this table, the user of the invention can deduce the exact nature of the target markers that should be present in the product to be authenticated. The target polynucleotides are then extracted and identified. If the detected target polynucleotides exactly match the theoretical code read in the table, then the product is authenticated. If other target polynucleotides are present, the user of the invention may suspect a mixture of labeled products. If the target polynucleotides detected are totally different from those expected, it may be a counterfeit. If there is no recognition polynucleotide used in a signature according to the invention, only a target / product database is useful. In the present invention, the polynucleotides of the plurality of polynucleotides can be designed for example by methods known to those skilled in the art, for example using a software implementing an algorithm as presented below, such that, for a given polynucleotide, selected from the plurality of polynucleotides constituting the labeling, no other polynucleotide of this plurality, nor any complementary polynucleotide inverted thereof. polynucleotides consists of a nucleotide sequence complementary to this given polynucleotide. Thus, no double-stranded complex, for example a nucleic acid double helix, such as for example a DNA double helix, nor any hybridization between the polynucleotides of the signature of the present invention can be formed even at the temperature and in the molecular environment of product conditioning, and at the temperature and molecular environment of polynucleotide discovery.

By "formation of a double-stranded complex" is meant a pairing of complementary, energetically stable nucleotides, including under the conditions mentioned above.

By "inverse complementary polynucleotide" of a given polynucleotide is meant a new polynucleotide, existing or theoretical, where each nucleotide of the given polynucleotide is replaced by a complementary nucleotide that can be paired with the first, such as, for example, adenine replacing a thymine. , or a thymine replacing an adenine, or a cytosine replacing a guanine, or a guanine replacing a cytosine in the case of a deoxyribonucleic acid polynucleotide. By "hybridization" is meant the association by non-covalent bonds of two complementary single-stranded polynucleotides. This hybridization can be perfect, ie the sequences are totally complementary, or imperfect, that is to say that the sequences are not totally complementary but sufficiently complementary to hybridize with each other and form a double structure. -strand.

In the present invention, "non-hybridization" means the non-association by non-covalent bonds of two single-stranded polynucleotides because they are not complementary and / or because the complementarity is insufficient for the formation of a double strand. It is interesting to note that the plurality of polynucleotides of the tag of the present invention to be incorporated in a product or a substance of interest are not all assigned in a database to directly or indirectly authenticate a product. It is thus possible to use only a small number of target polynucleotides, these target polynucleotides being those which are sought during an authentication of the product, and to incorporate them into the product at the same time as a large number of decoys. and, where appropriate, recognition polynucleotides whose sequences do not correspond to those of the target polynucleotides. Thus, the target polynucleotide (s) can be "embedded" in a mass of decoy polynucleotides that are extraordinarily scrambling the tracks in case of attempted malicious decoding of the target polynucleotides in order to reproduce the signature. In addition, according to the particular embodiment of the present invention, in which recognition polynucleotides are used, only reading and decryption of the code carried by the recognition polynucleotides can incriminate, among a mixture of target polynucleotides and polynucleotides lures. , which actually correspond to the target sequences, and by elimination which are only decoys intended to deceive the counterfeiter.

The labeling method of the present invention can be carried out using markers which are deoxy and / or ribonucleic acids. The said polynucleotides of the plurality of polynucleotides may thus be single-stranded deoxyribonucleic acid or single-stranded ribonucleic acid sequences or a mixture of deoxyribonucleic acid and ribonucleic acid sequences. A marker according to the present invention can therefore be composed of common bases, called "natural bases", for example those present in DNA: adenine, guanine, thymine, cytosine, or in RNA: adenine, guanine, uracil, cytosine (see, for example, Molecular Cloning, Maniatis, Spring-Harbor CoId, 2nd Edition, pp C3-C14 [1]). A marker according to the The present invention may also include less frequent natural or synthetic compounds, referred to as "modified bases", such as, for example, dihydrouridine (DHU), inosine, or pseudouracil resulting from modifications, for example deamination, carried out on the previously presented bases. The nitrogenous bases can be made from natural isotopes and / or from stable isotopes of different atomic mass and / or be modified to establish a number of hydrogen bonds different from normal during the hybridization processes. According to a particular embodiment of the invention, the deoxyribonucleic acid sequences may comprise, in their sequence, the same proportion of the four bases A, C, G and T, natural or modified. According to another particular embodiment of the present invention, the ribonucleic acid sequences may contain, in their sequence, the same proportion of the four bases A, C, G and U, natural or modified. According to another embodiment of the invention further, including or not the two previous embodiments, the set of polynucleotides comprising the marking have the same number of nucleotides, and the same molecular weight. This particular embodiment of the invention advantageously makes it even more difficult or impossible to separate and identify the polymers by a possible counterfeiter. For example, separation and identification as a function of size and / or molecular weight by techniques such as electrophoresis, for example on agarose or polyacrylamide gel and / or mass spectrometry is impossible to realize on a signature according to these last embodiments, in particular the last.

For example, in the labeling of the present invention, a single-stranded (or oligomeric) polynucleotide of 20 nucleotides, each of the nucleotides being selected from 4 possible bases makes it possible to make 420 different sequences, ie about 1, 1 × 10 12 combinations, that is, to say a thousand billion combinations. The probability of extracting a target marker, according to the invention, at random for example a plurality of polynucleotides of size 20 in a marking according to the present invention, and that this marker is the one that has been assigned to the product in a base of target / product data is therefore almost zero. In addition, the labeling of the present invention is composed of several target molecules of determined sequences and length, of several decoys, and, if appropriate, of several recognition polynucleotides, which ensures both a very high safety and an inviolability. outstanding marking.

By their nature, the polynucleotides used may therefore comprise, for example, an oriented combination of 4 nitrogenous bases, the nature of which is to be defined by the one who implements the present invention. This combination, which is at the origin of the specificity of each polynucleotide of the marker of the present invention, and which can bear the information relating to the labeled product, can be calculated in a computerized manner, according to the needs (complexity of the code, type information that the markers bear) and the physico-chemical properties of these markers (hybridization properties, molecular weight, fragment size, composition of nitrogenous bases).

Depending on the product to be labeled and the detection technique of the intended labeling, one or more target polynucleotide (s) may be used. The invention therefore allows a considerable number of signature or marking variants. As non-limiting examples for the target polynucleotides of the first set, there may be mentioned the following different forms: one or more target single-stranded polynucleotide (s) of large size (s), that is to say comprising for example 500 to 5000 nucleotides or bases; one or more target single-stranded polynucleotide (s) of small size (s), ie for example comprising from 5 to 200 nucleotides or bases, for example from 15 to 200, for example from 20 to 200, for example from 5 to 50; one or more target single-stranded polynucleotide (s) of average size (s), ie comprising, for example, from 201 to 499 nucleotides or bases; one or more target single-stranded polynucleotide (s) having a constant-sequence end and a variable-sequence end, one or more target single-stranded (or determined) single-stranded polynucleotide (s) in larger polynucleotides, these inserted target polynucleotides thus forming a portion of larger polynucleotides, one or more circular single-stranded polynucleotides, or a combination of these different forms.

According to the invention, at least two target polynucleotides can be used, one being a circular polynucleotide and the other a linear polynucleotide. A plurality of circular or linear target polynucleotides or a mixture thereof may be used, depending on the chosen complexity of the labeling by the one implementing the present invention.

According to a particular embodiment of the present invention, when some or all of the single-stranded polynucleotides are linear, they may comprise a variable end of one polynucleotide to another and a constant end of one polynucleotide to another . By "constant end" is meant a part of the polynucleotide sequence including one of the two ends of said sequence and having a determined and constant sequence, that is to say identical for part of the target sequences or for all the target sequences of the the present invention. By "variable end" is meant a part of the polynucleotide sequence including the other two ends of said sequence and having a variable sequence variable from one target sequence to another in the marker of the present invention. This presents a particular advantage for the target polynucleotides. Indeed, to detect or decrypt the labeling for the purpose of identifying an authentic product, as described below, a solid support for decryption can be used, on which support polynucleotides complementary to the variable ends of the target polynucleotides are fixed, as for a DNA chip. The constant ends can be used to highlight the hybridization of target polynucleotides on the solid support, for example by means of biotin / streptavidin. This detection mode is described below.

The number and nature of the target polynucleotides, combined with their size, makes it possible to define the complexity of the marking, and in a combinatorial manner, the number of possible combinations. The number of possible combinations increases exponentially with the size of these polynucleotides. By choosing a signature composed of one or more polynucleotides among all the polynucleotides of the same size, a large number of combinations is possible. The probability of reproducing a signature among all those that are possible, at random, is almost nil.

According to the invention, the labeling information may consist of: target polynucleotide sequences, each assigned in a target / product-to-product database, and / or one or more combination (s) of target polynucleotide sequences, said (said) combination (s) being assigned in a target / product database to a product. Thus, it is possible to use several target polynucleotides of determined sequences. One can also choose for example a group or "pool" of 20 polynucleotide sequences of all different and determined sequences, and choose, for marking a series of given products, a combination of, for example, 10 of these 20 sequences for each product. To these target sequences are added decoy polynucleotide sequences to form the label according to the present invention. According to the invention, the decoy polynucleotides do not hybridize with the target polynucleotides and their role is to make it even more difficult for a counterfeiter to decrypt the marking of the present invention in order to copy it. These decoy polynucleotides may be in linear or circular form or a mixture of circular polynucleotides and circular polynucleotides as indicated above for the target polynucleotides. The number of lure polynucleotides added to the marker depends on the desired interference. Preferably this number is greater than the number of target polynucleotides. Examples are given above. The decoy polynucleotides are of the same or different length (s) from one another, preferably of identical length to the one, to the one or to the target sequence (s) present in the the present invention, for example, as indicated above for the target polynucleotides, from 15 to 5000 bases, for example from 15 to 200, for example from 20 to 200, for example from 201 to 499, for example from 500 to 5000. bases, or a mixture of these lengths.

To these target sequences and decoys can be added recognition polynucleotides, allowing, by means of a database, to discriminate the target polynucleotides of the decoy polynucleotides as indicated above. The number of recognition polynucleotides depends in particular on the complexity of the desired marking. The recognition polynucleotides may be circular or linear. They may be of the same or different length (s) and of identical or different length (s) from those of the target polynucleotides and decoys, for example, as indicated above. for target polynucleotides of 5 to 5000 bases, for example from 15 to 200, for example from 20 to 200, for example from 201 to 499, for example from 500 to 5000 bases, or a mixture of these lengths.

Thus, in the labeling of the present invention, said polynucleotides of the plurality of polynucleotides may be circular, linear, or a mixture of circular and linear polynucleotides, for example with a free 3'OH end and a free 5 'phosphate end.

Preferably, the length of the polynucleotides of the labeling of the present invention is from 5 to 5000 nucleotides, for example from 5 to 100 nucleotides, for example from 5 to 50 nucleotides, for example from 20 to 50 nucleotides.

According to the invention, said polynucleotides of the plurality of polynucleotides are single-stranded polynucleotides. Indeed, one of the peculiarities of the present invention is that the use of single strands makes it more difficult to decrypt the marking of the present invention.

The marking method of the present invention thus makes it possible to manufacture a very large number of markers. Each marker comprises a code consisting of the target polynucleotide (s) and, if appropriate, recognition polynucleotides.

The sequences of the polynucleotides of the marker of the present invention can be created empirically or, preferably, especially for a matter of speed, by appropriate software that can be generated for this purpose. In the latter case, it is a computer design or "Design In Silico" marker of the present invention.

For the determination of the sequences of the target polynucleotides and decoys, and, if appropriate, of recognition of the marker of the present invention, the following algorithms may for example be used:

- (0) Creation of a set E which contains all the polynucleotides generated for the marking. - (1) Random generation of a first polynucleotide p, whose size and the number of nucleotides can be defined by the user, p not already belonging to E.

(2) Calculation of the hybridization score according to the Smith and Waterman algorithm [2] between: the polynucleotide resulting from the concatenation of two polynucleotides p, on the one hand, and each polynucleotide resulting from the concatenation of two selected polynucleotides in the set of polynucleotides of E as well as their inverse complement on the other hand.

- (3) If the set of scores does not exceed a threshold given by the user, add p in E. Return to step (1) as long as E is not of a desired size. This threshold is a minimum alignment score above which two sequences are considered sufficiently identical to hybridize with each other.

Once the sequences of the target polynucleotides and decoys determined, these target polynucleotides and decoys can be manufactured by any existing method known to those skilled in the art. One or more protocols may be used depending on the nature of the polynucleotides manufactured and according to the chosen marking: synthesis of ribonucleic and / or deoxyribonucleic acids, single-stranded, circular and / or linear, of a size may vary for example from 5 bases to 5000 bases. Examples of protocols that can be used to implement the present invention are those making it possible to synthesize single-strand circular polynucleotides [3] or the protocols for in silico synthesis of polynucleotides [4]. When sequences of the recognition polynucleotides are desired for labeling, their respective sequences can be determined empirically, or using an algorithm as described above, so that the recognition polynucleotides do not hybridize with each other or with each other. with the target polynucleotides, or with the decoy polynucleotides.

The labeling of a solution or a compound using markers of ribonucleic acid or deoxyribonucleic acid according to the process of the invention can be done in different ways depending on the desired labeling complexity. Each target polynucleotide carries specific information, inherent to its sequence. Each target polynucleotide or target polynucleotide combination can be used uniquely. The first possible level of coding may be that of using one or more target polynucleotides. Several batches of labeled products can then be traced by one or more polynucleotide (s) of defined size (s), and of sequence (s) determined (s) but different from each other. The second possible level of coding is the use of several target polynucleotides, chosen from an initial pool of target polynucleotides. The code then no longer comes from each target polynucleotide sequence but from the combination of the target polynucleotides found in a product. Thus, according to the invention, a labeled product can be labeled with n target polynucleotides selected from a possibility of N different polynucleotides, n being in the range [0; NOT].

In all cases, the tag of the present invention may be supplemented by a third level of coding, consisting of using recognition polynucleotides, then indicating, by means of a target recognition base, which markers among the polynucleotides. The targets which may be used by the manufacturer and which may be different in nature and concentration, are present if the product is authentic and marked with the process of the present invention.

According to the invention, each step of the product marking process can be subject to specific traceability. This traceability can be ensured by introducing specific data at each stage into one or more confidential databases.

Thus, according to the invention, each batch of markers or combination of markers may for example be identified by an alphanumeric identifier. This identifier may appear on the product or by any other mode of optical representation: for example barcode, datamatrix, etc., for example on the container of the batch of markers. This identifier can also serve as an index in a first database where the information on the batch of markers is stored, for example: sequence of each of the markers composing the batch, respective proportions of the quantities of each marker, date of manufacture, etc. .

Each marker batch container, followed by means of its identifier, can be attached in a database for example to the reference of a customer's order and to the delivery references of this container to said customer. A confirmation of receipt from the customer can also be entered into this database.

Nucleic acids do not alter the physicochemical properties of marked products. In addition, the nucleic acids have no effect on their container, i.e., the labeled product. Finally, the nucleic acids have proved very stable in the numerous tests carried out by the inventors. This property of stability is demonstrated in the examples presented below.

In a non-exhaustive manner, the single-stranded DNA and RNA markers included in the present invention can be included in a very wide range of products and substances that are likely to be victims of illegal reproduction (counterfeiting), abusive, trafficked on a parallel market and / or where it is necessary to follow the track (tracing of products).

The process of the invention is applicable to the marking of any industrial or consumer product, liquid, semi-liquid or solid. For example, without this list being limited: perfumes, cosmetics, hygiene products, foodstuffs, flavorings, plant extracts, tobacco, beverages, textiles, leathers, drugs, powders, varnishes, inks, paints, chemical products and compounds, and more generally all goods and products that may be counterfeited.

The invention can be applied to a whole range of products in the luxury and cosmetics industry: perfumes, perfume waters, toilet waters, essential oils, creams, masks, ointments, etc. In the fields of industrial and consumer products, the invention can also be used to trace various substances such as inks, resins, varnishes, paints, dyes, additives, flavors, glues, powders.

In the food field, the present invention finds application to luxury products that may be targets of counterfeiting or cheating (mixtures), such as liqueurs, spirits, wines, or any product that is important to ensure authenticity for security reasons for example.

Markers can also be used in the pharmaceutical industry to mark and trace drugs and other drugs.

The invention can also be used in tracing biological samples in a hospital context. This may involve, for example, implementing a traceability protocol for blood samples in a biochemistry laboratory, tumor samples in an anatomopathology laboratory, or in order to constitute a a bank of directly authenticated human material that can be stored and traced for many years in a biological resource center.

In general, the products can be marked either as such or as a component of a product. For example, a paper document can be marked through the ink used which has been previously marked.

According to the invention, the step of adding the marker of the present invention may be carried out by any suitable means for adding to the product to be labeled the polynucleotides constituting the marker of the present invention. The products or substances to be marked can be marked in the mass, by incorporating the markers whose final concentration is studied and planned or on the surface of the product. The markers are polymers of ribo or deoxyribonucleic acids having the physicochemical properties deriving from their nature: they are hydrophilic and negatively charged molecules. Depending on the nature of the product to be labeled, they may be pre-diluted or added directly into the product. They can also be encapsulated. They can still be deposited or incorporated on the surface of the product. This addition of the marker of the present invention to the product can be carried out by adding said plurality of polynucleotides in said product during its manufacture and / or in or on (ie on the surface) the finished product. The present invention thus also relates to a labeled product that can be obtained by the marking method according to the invention.

According to the invention, when the addition of the marker is carried out on the surface of the product to be marked, it may be carried out for example by soaking the finished product in a solution comprising the said marker or by spraying or spraying such a solution on the final product. Preferably, the solution is a protic solvent such as ethanol, methanol or diethylene glycol, or a polar aprotic solvent such as acetone or tetrahydrofuran. This mode of addition is suitable for example for solid products after manufacture such as fabrics, leather, wood, paper, cardboard, tobacco, cigarettes, cigars, etc.

The addition can also be carried out during the manufacture of the product, by mixing said marker with the compounds or components constituting the product. This introduction of the plurality of polynucleotides can be carried out on or in a component of said product. This type of addition is suitable for any product or substance whose manufacture passes through a liquid or semi-liquid phase in which the markers may be incorporated. This may be the case for example for the marking in the mass of a cosmetic product or a drug.

According to a particular embodiment of the present invention, a step of encapsulation of said plurality of polynucleotides in lipid vectors can be carried out prior to the addition step. This encapsulation step makes it possible to maintain the polynucleotides in a favorable medium, or to facilitate their future extraction. For example, a product chosen from the group comprising a vector of cationic lipid nature, such as dioleoxyloxypropyltrimethylammonium bromide (DOTMA) and dioleoylphosphatidylethanolamine (DOPE), or polynucleotide complexes may be used as an encapsulation product. with molecules like polylysine, protamine, or polyethyleneimine (PEI) called polyplexes. For example, the technique described in Bioch can be used for this purpose. Biophys. Acta 1280: 1. [5], J. Biol. Chem. 269: 2550 [6] or AAPS PharmSci. 2001; 3 (3): E21 [7].

According to another embodiment of the invention, a step of encapsulating and / or protecting said plurality of polynucleotides in lipid vectors or the like may be carried out prior to the addition step. This step also makes it possible to ensure stability and / or facilitate its recovery. The term "protection" herein refers to the protection of the polynucleotides of the present invention, in particular any physicochemical attack originating from the medium in which the signature of the present invention (perfume, food) is found, for example in charged polymers or carbon nanotubes.

Whatever the mode of addition chosen, the marker of the present invention is preferably added to the product for its labeling at very small concentrations ranging from micro-molar to femto-molar. According to the envisaged detection technique, existing or future, and the size of the markers, they are added to a variable final concentration, the respective concentrations of each target polynucleotide of the first set may be different and compose a coding subset. According to the invention, the concentration of the plurality of polynucleotides after its addition in said product can be, but is not limited to, 10 ^-6 moles to 10 ^-18 moles / dm- ³ . For a liquid, this corresponds to the amount of markers mixed with the product per unit volume.For a solid, this corresponds to the amount of markers mixed in the product per unit volume or deposited on the surface of the product. reduced to the product surface, this amount can also be defined per unit area, or 10 ^"6 moles to ^{10" 18} moles / dm ^2. These concentrations can be obtained by dilution of a more concentrated solution. the solution may be as defined above.

The present invention also relates to a method for detecting the labeling of a product that can be obtained by the labeling method of the invention, said method comprising a step of analyzing the plurality of polynucleotides making it possible to specifically detect the at least one target polynucleotide. The invention further provides several methods for detecting markers of the present invention. The detection can be carried out laboratory or laboratory, for example by means of a portable system, for example by means of a DNA chip specially designed for the detection of target polynucleotides of the marker of the present invention.

According to the invention, the analysis step can be carried out for example by immunodetection. According to the invention, the analysis step may comprise, for example, a step of sequencing the coding polynucleotides. According to the invention, the analysis step may comprise, for example, a retro-transcription of the ribonucleic acid into deoxyribonucleic acid, in particular when the target polynucleotides are ribonucleic acid. According to the invention the analysis step can comprise a colorimetric or luminescent detection, or fluorimetric, coupled to a specific hybridization. In other words, the analysis step may use a specific means for detecting the target polynucleotides. According to the invention, the analysis technique used can implement the physico-chemical properties, the code and the specificity of the marker. This may be, for example, a sandwich assay technique, a detection technique using microarrays, or any other technique known to those skilled in the art to reveal the presence of polynucleotides and / or identify them.

In a particular embodiment of the invention, target polynucleotides and decoys can be polynucleotides of small size, that is to say 8 to 30 nucleotides / nucleosides and single strands. According to this embodiment and advantageously, these polynucleotides by their nature can not be used as a template strand to be amplified and detected by exponential amplification techniques such as chain polymerization reactions (" PCR ", Polymerase Chain Reaction). Thus, their detection by PCR amplification is impossible. In this embodiment, the detection of the polynucleotides can be carried out by hybridization methods and direct revelation without amplification is achievable only by the user who knows the signature used. Also the counterfeiter who would try to extract, amplify and reproduce the plurality of polynucleotides present in the labeled product will be held in check. Moreover and advantageously, the revelation methods comprising only hybridization and revelation stages of this hybridization can be implemented much more rapidly (a chain polymerization reaction takes several hours, whereas simple hybridization polynucleotides is almost instantaneously) insofar as the detection is specific to the polynucleotides to be revealed.

According to the invention, the analysis technique used can be based on the physicochemical properties, the code and the specificity of the marker. It can include amplification of the target polynucleotides, exponentially or linearly, any other technique can be used to reveal the presence of the markers. In other words, the analysis step may comprise a step of linear extension of the target polynucleotides.

The method of the invention may further comprise the following steps, prior to the analysis step: (a) taking a sample of the product; and

(b) extracting the plurality of polynucleotides from said sample.

This is a means of implementing the tag detection of the present invention by taking a sample of the product. After being extracted, the presence of the markers can be analyzed as indicated above.

According to the invention, the extraction step (b) can be carried out by any technique known to those skilled in the art to extract the polynucleotides from a sample. The polynucleotides can be extracted according to a protocol depending on the nature of the labeled product. Any type of ribonucleic or deoxyribonucleic acid extraction technique existing or future, can be used to extract the polynucleotides from the mass of the labeled product. It may be for example a phenol chloroform extraction. Extraction techniques that can be used in the present invention are for example described in Molecular Cloning.Maniatis, CoId Spring-Harbor, 2nd edition, pp E3 to E4 [8].

The methods of analysis of the labeled products can therefore consist in extracting the polynucleotides of these products, in detecting the code carried by the recognition polynucleotides, in referring to the database of recognition of the target polynucleotides, in thus decrypting the code carried. by the recognition polynucleotides, then exploiting this information in order to find the target polynucleotides among the plurality of target polynucleotides, including the decoy polynucleotides, and then to detect the presence of the target polynucleotides, which is characteristic of the labeled product (in case of detection of the marking) or to conclude that a counterfeit product (in the absence of the target polynucleotides, or of non-conforming marking to the target / product database).

According to a particular embodiment of the present invention, the specific detection of the analysis step can comprise for example the following successive steps:

(I) contacting the plurality of polynucleotides with a solid support on which probe sequences are fixed, these probe sequences being complementary to one of the ends of said at least one target polynucleotide of the plurality of polynucleotides of the product marking, the bringing into contact allowing the target polynucleotides to bind to the support by hybridization with the complementary probe sequences fixed on the support;

(ii) removing non-hybridized polynucleotides by step (i); and (iii) detecting the presence on the support of the target polynucleotides. In the present invention, the detection carried out in step (iii) may be carried out by a suitable specific means, for example it may be for example it may be a detection using a fluorescent molecule, or a detection using a luminescent molecule, or detection using an enzyme whose reaction product may be colored, or detection using an enzyme whose catalyzed reaction is exothermic, or detection using an enzyme whose catalyzed reaction releases light, or detection using a specific protein target polynucleotides, such as an antibody, an enzyme.

According to one particular embodiment, the specific detection may furthermore comprise, between steps (i) and (ii), a step of capturing the plurality of polynucleotides on a support, by at least one specific capture system of the polynucleotide (s). (s) target (s), system on which binds, the at least one, polynucleotide target of the plurality of polynucleotides of the product marking.

When the marking according to the invention comprises recognition polynucleotides, the method of this particular embodiment may further comprise, before step (i), a step (x) for identifying these recognition polynucleotides and a step (y) of choice of a solid support, according to the identified recognition polynucleotides, solid support chosen because it comprises the complementary probe sequences of the target sequences identified by the recognition polynucleotides. This detection method may advantageously be used with a marker according to the invention which comprises target polynucleotides having a constant end and a variable end. These target polynucleotides are defined above. According to the invention, the polynucleotides complementary to the target polynucleotides, called probe sequences, can be fixed on the solid support by any means known to those skilled in the art. These techniques of detection on support and the types of supports that can be used in the present invention are, for example, those described in Molecular Cloning, Maniatis, CoId Spring Harbor, 2nd Edition, pp. 9.47 to 9.57 [9]. For example, the fixing of the probe sequences on the support can be carried out by means of a biotin / streptavidin binding, the probe being coupled to a biotin molecule and the support having streptavidin molecules. For example, the attachment of the probe sequences can also be accomplished by covalent bonding to a charged nylon membrane, said membrane forming the solid support. These techniques, usable in the present invention, are for example those described in publications [10], [11] and [12]. In other words, the polynucleotides complementary to the target polynucleotides are examples of specific capture systems for the desired target polynucleotide (s). According to the invention, the target polynucleotides fixed on the support by hybridization to the probe sequences can be detected by any appropriate means known to those skilled in the art. It may be, for example, a detection by means of polynucleotides labeled with a labeling agent and complementary at the other end of the target polynucleotides, the labeling agent being able to be chosen from the group comprising a fluorochrome, a d colloidal gold and an enzyme.

This solid support mode of detection allows easy, reproducible and immediate detection of the marker of the present invention. It can advantageously be used in the present invention. The detection method of the invention may furthermore comprise a step of comparing the results of the step of analysis of the target polynucleotides with the content of a database which makes it possible to identify the target polynucleotides, and of analysis target polynucleotides which makes it possible to identify and authenticate said product, and which can also make it possible to determine the origin of said product. In other words, the database and the decryption of the code carried by the Coding polynucleotides can identify a counterfeit of an original product.

It is by finding by the analysis technique used the target polynucleotides contained in a labeled product that the information relating to this product can be found. The absence of the target polynucleotides that should be present in a tested product indicates a possible counterfeit of the product. The revelation of several different markers according to the invention or recognition polynucleotides in the same product may indicate that it is the result of an initial abnormal mixture.

During its manufacturing steps of the product to be marked, the user manufacturer of a marker according to the present invention can associate with the identifier of the marker batch container references relating for example to a production lot labeled with the help from this lot of markers. This association can be done for example in a database identical or separate from previous databases. The information inserted in this database and relating to the production batch is preferably sufficient, depending on the information system implemented at this user, to allow to trace this lot unequivocally.

When a product sample suspected of counterfeiting is analyzed, the revelation of the identified polynucleotide sequences can be compared with the data entered into the databases during the production and delivery of markers. Counterfeiting is for example characterized if no marker is identified. Counterfeiting can also be demonstrated if at least one marker in the marker set that has been partly revealed and whose precise composition has been obtained by querying the database is missing. Counterfeiting can still be characterized if all the markers are present the batch of markers, but that the goods tested do not come from the manufacturer who took delivery of the batch of markers which has just been revealed.

In the case of misappropriation of distribution channels or parallelism, the products are authentic and the batches of markers revealed actually correspond to batches of markers delivered to the manufacturer of the tested product. The method of the invention makes it possible to obtain, by query in the manufacturing database, markers of the identifier of the batch of markers. As far as its traceability system allows, this identifier advantageously allows the manufacturer to compare the theoretical allocation of the marked production batch to one of his customers with the actual allocation found during the taking of a product sample suspected of parallelism. If the theoretical assignment of the products does not correspond to the actual allocation, there may be diversion of the distribution channel.

Other advantages may still appear to those skilled in the art on reading the examples below, illustrated by the appended figures, given for illustrative purposes.

Brief description of the figures

- Figure 1 attached represents a NbBpuiOI cleavage site.

FIG. 2 represents an addressing of the probes on the chip.

FIG. 3 represents emission and absorption spectra of Cy5.

FIG. 4 appended represents a method for detecting the markers according to the present invention on a support: The markers M1 and M2 are present in a mixture. They make "bridge" between the probe attached to the chip, and the Universal probes: the signal (Cy5 fluorescence) is then detected. - The appended FIG. 5 reveals a revelation of the markers with the NanoChip station (registered trademark) (Nanogen Inc.).

- Figure 6 attached shows a principle of coupled marking.

- Figure 8 attached represents a detection scheme of a marking according to the invention and authentication of a labeled product according to the invention.

EXAMPLES

EXAMPLE 1 Manufacture of a Marking According to the Process of the Invention and Marking of a Product

In this example, the target polynucleotides and decoys used are single-stranded sequences of deoxyribonucleic acid with a size of 28 nucleotides. The encoding polynucleotide is a circularized DNA sequence, 4.3 kilobase (kb) in size.

The marked product is a perfumed solution: J'Adore perfume (registered trademark, Parfums Christian Dior).

Three markings are made, illustrating three possible scenarios during the authentication process: an example where the product is authenticated, as well as two examples where the product is not authenticated.

THE. Development of target markers and polynucleotides lures

1. a.1 Principle

Ten single-stranded deoxyribonucleic acid polynucleotides are generated as follows: The ten 5 'nucleotides are all identical, defined by the user. This is the sequence GCAACTCCAG. The eighteen nucleotides at 3 'are then generated using the algorithm presented in the "Presentation of the invention" section, using the following parameters: a length of words equal to 18 nucleotides, five nucleotides G, five nucleotides C, four nucleotides A and four nucleotides T.

Each new polynucleotide is then generated in a random manner, so that it contains this determined number of each of the bases. An alignment score between this new polynucleotide and the set of polynucleotides already validated, as well as the polynucleotides resulting from the concatenation of each of the two by two polynucleotides of this set, this step not having any place if it is is the first polynucleotide.is calculated according to the Smith and Waterman algorithm, with the following parameters:

- Score of a match AT: 1

- Score of a GC match: 1, 5

- Mismatch penalty: -3 - Gap penalty: -2

The minimum score selected is 3, which means that if the new polynucleotide aligns with a polynucleotide of the set, or a concatenation of two polynucleotides of the set with a score greater than 3, it is discarded. Otherwise, it is validated and then added to all the polynucleotides. This step is repeated until ten polynucleotides are obtained.

Table 1.1 lists these markers.

Table 1.1: Marker Sequences

Primer- 1: 5 ¹ -GCAACTCCAGGCACTCCATGAGTCATGG-3 ^I (SEQ ID NO :: 1)

Primer-2: 5'-GCAACTCCAGGTGGCGACTCATACGTCA-3 ¹ (SEQ ID NO: 2) Primer-3: 5 ^I -GCAACTCCAGCTCAGGGGGACTCTATCA-3 ¹

(SEQ ID NO: 3)

Primer-4: 5 ^I -GCAACTCCAGGCTCTAGGGCAAGTCTCA-3 ^I

(SEQ ID NO: 4)

Primer-5: 5'-GCAACTCCAGGCAGACTCTGGATCTCAG-3 ¹

(SEQ ID NO: 5)

Primer-6: 5 ¹ -GCAACTCCAGGCAGCATGAGGTCTCATC-3 ^I

(SEQ ID NO: 6)

Primer-7: 5 ^I -GCAACTCCAGGCAGCAGGAGTCTCATTC-3 ¹

(SEQ ID NO: 7)

Primer-8: 5 ¹ -GCAACTCCAGGGTGGCTCAGCAATACTC-3 ¹

(SEQ ID NO: 8)

Primer-9: 5 ^I -GCAACTCCAGCTCAGGGCAGTGATCTCA-3 ^I

(SEQ ID NO: 9)

Primer-10: 5'-GCAACTCCAGGGGGGCACACATTCTATC-3 ^I

(SEQ ID NO: 10)

The first five polynucleotides (Primer-1 to Primer-5) are considered as target polynucleotides. The last five (Primer-6 to

Primer-10) are considered lure polynucleotides. These markers are then injected at a final concentration of 10-12 moles per dm ³ into the perfume, along with the coding marker.

1.a.2 Materials

Synthetic Polynucleotides (Eurofins MWG GmbH), 100 pmoles / μL-H ₂ O deionized, nuclease-free

1.a.3 Methods The ten polynucleotides are mixed in three pre-labeling solutions, diluted in deionized water, without nuclease, to a final concentration of 10 ^-9 moles of markers per liter, per label (ie 5.10 ⁹ mol / l of total markers). . For each solution, each label is pre-diluted twice to 1/100 in water without nuclease (1 .mu.l using a P10 pipette, in 99 .mu.l using a P100 pipette) or an intermediate dilution at 1/10000. Then, 10 μL of each intermediate solution are added to a 1.5 ml tube (Eppendorf, registered trademark), and the mixture is then added to 100 μL by addition of 50 μL of water (using a pipette P100). Table 1.2 shows the three pre-labeling solutions (A, B, C) each containing a combination of five target polynucleotides selected from ten possible, target or decoys.

Table 1.2: Combinations of markers

I. B. Development of coding polynucleotides

1. b.1 Principle The encoding polynucleotide is a circular single-stranded nucleic acid sequence of 4.3 kilobases (kb) in length. It is, for the example, synthesized from a plasmid pBR322. This polynucleotide contains within it a specific sequence following nucleotides (A, T, G, C), known to the user of the invention. It constitutes a unique code, which subsequently allows the user to know which combination of target markers is in theory present in the marked product.

In this example, the coding sequence is a portion of 20 nucleotides located exactly 50 bases upstream (5 'side) of a known and universal sequence which remains constant regardless of the coding sequence, and whose sequence is: 5' -CTGTAAGCGGATGCC-3 '(SEQ ID NO: 11). The user has an associative table that allows him to link the coding polynucleotide coding sequence, and the target polynucleotide combination expected in the labeled product.

The plasmid is first digested with the restriction enzyme Nb.BpuiOI, which cuts a single strand of the DNA molecule, recognizing the restriction site shown in Figure 1: NbBpuiOI cleavage site.

The polynucleotide is then digested a second time with exonuclease III, releasing the nucleotides from the free 3 'hydroxyl end of the cut strand by Nb.BpuiOI. The strand which has not been digested with Nb.BpuiOI is then spared, because circular. 1. b.2 Materials

Plasmid pBR322, Invitrogen (registered trademark)

- Nb.BpuiOI (20 U) reference: Fermentas, # ER1681

Buffer R 10 X (buffer Nb.BpuiOI) reference # BR5, (Fermentas) - Exonuclease III (1200 U) reference # EN0191, (Fermentas)

- Reaction Buffer for Exonuclease III; reference # EN0191, (Fermentas)

- Phenol UltraPure (Trademark) Buffer-Saturated Phenol,

Invitrogen. - Chloroform / isoamyl alcohol (24: 1)

- Sodium acetate 3M

- Ethanol iced 95%, 75%

- Deionized water, without nucleases.

1. b.3 Methods

• Digestion

In a 1.5 ml tube (Eppendorf, registered trademark), add the plasmid (5 μg or 20 μl), the reaction buffer ten times concentrated (40 μl) using a pipette P100 (Gilson Pipetman, registered trademark) water (339 μl) using a P1000 pipette (Gilson Pipetman, registered trademark) and the enzyme (1 μl) using a P10 pipette (Gilson Pipetman, registered trademark ).

Table 1.3: digestion of pBR322

Vortex using a vortex VTX-400 (Modern Lab) and incubate the tube for 1 hour at 37 ^° C. Extract the phenol chloroform DNA according to the following protocol:

- Add to the tube ^Λ A volume of phenol (200 μl_) and ^Λ A volume of chloroform (200 μl_) using a pipette P200 (Gilson

Pipetman, registered trademark), then vortex for 10 seconds. Centrifuge for 5 minutes at 10,000 rcf (in a centrifuge tube 1, 5 ml Centrifuge 5415 R, Eppendorf, registered trademark). Transfer the aqueous phase to a new tube of 1.5 ml

(Eppendorf, registered trademark), and add 1 volume (400 μl) of chloroform. Vortex and centrifuge for 5 minutes at 10,000 rcf. Repeat this step 5 times.

Transfer the aqueous phase into a new tube of 1.5 ml, then add 1/10 volume of 3M sodium acetate (40 μl, using a P20) and 2.5 volumes (1000 μl). using a P1000) frozen ethanol. Mix and incubate for 1 hour at -20 ^° C. - Centrifuge for 10 minutes at 10,000 rcf. Discard the supernatant and gently wash the pellet with 200 μl of 75% iced ethanol. Then dry the pellet in the open air. Take it back into 50 μL (using a pipette P100) of deionized water without nucleases.

• Exonuclease treatment In a 1.5 mL tube (Eppendorf) containing the 50 μL extract, add the reagents according to Table 1 using pipettes P100, P20 and P200.

Table 1.4: Linearization of pBR322

- Mix the tube, then incubate for 10 minutes at 30 ^° C. Stop the reaction by heating for 10 minutes at 70 ^° C.

Extract the phenol chloroform DNA as described in step 1.b.3, precipitate the DNA as described in step 1.b.3 and then recover the polynucleotides in 20 μl of demineralized water without nuclease.

The markers taken up in 20 μL are assayed using a Nanodrop spectrophotometer (registered trademark). The concentration is then reduced to 10-9 mol / L by adding a suitable volume of demineralized water without nuclease using a P10.

I. C. Marking solutions

Three fragrance solutions J'Adore (registered trademark, Parfums Christian Dior) are then marked. The polynucleotides are injected into the mass of the products, at a final concentration of 10 ^-12 M for the target polynucleotides and decoys, and 10 ^-12 M for the coding polynucleotides.

The first solution is labeled with the pre-labeling solution A, containing the target polynucleotides 1 and 2 as well as the decoy polynucleotides 8, 9, 10 and the encoding polynucleotide. This solution corresponds to normal labeling, where the encoding polynucleotide is present, and where the combination of the target polynucleotides present actually correspond to the information carried by the encoding polynucleotide.

The second solution is labeled with the pre-labeling solution B, containing the target polynucleotides 3, 4 and 5, as well as the decoy polynucleotides 6 and 7 and the encoding polynucleotide. This solution is an example of incoherent labeling: although the coding polynucleotide is present, the combination of target polynucleotides does not correspond to the information it contains. The third solution is labeled with the pre-labeling solution C, containing the target polynucleotides 1, 2, 3, 4 and 5, no decoy polynucleotide, and no coding polynucleotide. This solution is also an example of incoherent labeling: on the one hand it does not comprise coding polynucleotides, and on the other hand, although it has the target polynucleotides 1 and 2 of the normal labeling, it contains other unexpected polynucleotides.

After labeling, the solutions are stored at room temperature or at 4 ° C.

I. D. Extraction of polynucleotides

Before starting the identification of the polynucleotides coding and targets, it is advisable to extract the markers of the alcoholic medium that is the labeled product (perfume).

1. d.1 Principle

The markers are extracted from their alcoholic medium (perfume) and then recovered in an aqueous medium in order to then be able to use molecular identification techniques. The extraction should preferably not only have a good yield (recover a maximum of markers, ideally: 100% yield), but it should also preferably rid the markers of any "polluting" substances that can interfere with the detection techniques .

1. d.2 Materials

- Phenol: UltraPure (Trademark) Buffer-Saturated Phenol,

Invitrogen.

- chloroform / isoamyl alcohol (24: 1) - 3M sodium acetate

- 95% frozen ethanol (Carlo Erba Rectapur), 75% - deionized water, without nucleases

1. d.3 Methods

The technique used is that of phenol chloroform extraction. For the example, the markers are extracted from 500 μL of labeled perfume.

To the 500 μl of labeled perfume in a 2 ml tube (Eppendorf, registered trademark), add V ₂ volumes of phenol, ie 250 μl, using a pipette P1000 (Gilson Pipetman, registered trademark), then ^1/4 volumes of chloroform, ie 250 μl with the aid of a P 1000

(Gilson Pipetman, registered trademark), and Vi volume of water is 250 μl using a P1000 (Gilson Pipetman, registered trademark) and then vortex for 10 seconds. Centrifuge for 5 minutes at 10,000 rcf (in Centrifuge 5415 R centrifuge, Eppendorf, registered trademark).

- Transfer the aqueous phase to a new 2mL tube

(Eppendorf, registered trademark), and add 1 volume of chloroform. Vortex and centrifuge for 5 minutes at 10,000 rcf. Repeat this step 5 times. Transfer the aqueous phase (above) to a new tube, then add 1/10 volume of 3M sodium acetate (ie 50 μl using a P100 pipette) and 2.5 volumes of ice-cold ethanol. (ie 1250 μL, added twice using a P1000). Mix and incubate for 1 hour at -20 ^° C. - Centrifuge for 10 minutes at 10,000 rcf. Discard the supernatant and gently wash the pellet with 200 μl of 75% iced ethanol. Then dry the pellet. Take it up in 20 μL of deionized water, without nuclease, using a P20 pipette.

Detection of coding polynucleotides 1. e.1 Principle

The information carried by the polynucleotides coding, relative to the target polynucleotides, is read in the nucleotide sequence of these first (by a sequencing technique). It then allows the user of the invention to know the exact nature of the target polynucleotides carrying the product authentication information by referring to the associative table presented in 1.b.1.

1. e.2 Materials

Universal sense primer (Eurofins MWG GmbH), 100 pmol / μL)

5'-GGCATCCGCTTACAG-3 '(SEQ ID NO: 13)

BigDye (registered trademark) Terminator V3.1 (Applied)

Biosystems)

Matrix: extracted polynucleotide solution.

H ₂ O deionized without nucleases.

1. e.3 Methods

The sequence reaction is carried out from the solution of markers extracted in a 200 μL tube (Eppendorf, registered trademark), according to the protocol set forth in Table 1.5.

Table 1.5: Sequence Reaction

The reactions are then launched on a GeneAmp PCR System 9700 device (Applied Biosystem) by respecting the following cycles:

- 96 ⁰ C r

- 96 ⁰ C 10 "I

- 50 ⁰ C 5 "I => 25 cycles

- 60 ⁰ C 4 'I

After purification on a column (Qiagen, registered trademark), the reactions are then sequenced on an ABI3100 capillary sequencer 16 (Applied Biosystem). Analysis of the results then enables the user of the invention to read the nucleotide sequences of interest, and to correlate the read sequences with the target polynucleotides theoretically present in the labeled product.

LF Detection of target polynucleotides.

1. f.1 Principles A support (or DNA chip) is used to detect the presence of target polynucleotides. This support has a battery of several probes, fixed in a covalent manner, and complementary complementary inverse 3 'variable regions of the markers. The appended FIG. 2 represents the addressing of the probes on the chip. When the extracted solution, containing the putative markers, is brought into contact with this support, the present markers hybridize with their inverse complementary on the chip. After washing, the support is then brought into contact with a solution containing probes (polynucleotides) coupled to a fluorophore (Cy5), thus the sequence is the exact complementary inverse of the 5 'universal region of the markers. The appended FIG. 3 represents the emission (667 nm) and excitation (650 nm) spectra of the Cy5.

These probes are fixed there, and are detected thereafter. Their presence makes it possible to reveal the presence of the corresponding target polynucleotides in the initial solution. The appended FIG. 4 represents the principle of detection of the markers.

1. f.2 Materials

Inverse complementary probes of marker-specific regions, (Eurofins MWG GmbH), supplemented in 5 'with a 20-base arm and biotinylated.

Anti-1 probe (SEQ ID NO: 14)

5 '(B) -TGGATCCCGCACACGACTGACCATGACTCATGGAGTGC 3' Anti-2 Probe (SEQ ID NO: 15)

5 '(B) -TGGATCCCGCACACGACTGATGACGTATGAGTCGCCAC 3'

Anti-3 probe (SEQ ID NO: 16)

5 '(B) -TGGATCCCGCACACGACTGATGATAGAGTCCCCCTGAG 3'

Anti-4 probe (SEQ ID NO: 17)

5 '(B) -TGGATCCCGCACACGACTGATGAGACTTGCCCTAGAGC 3'

Anti-5 probe (SEQ ID NO: 18) 5 '(B) -TGGATCCCGCACACGACTGACTGAGATCCAGAGTCTGC 3'

Anti-6 probe (SEQ ID NO: 19)

5 '(B) -TGGATCCCGCACACGACTGAGATGAGACCTCATGCTGC 3' Anti-7 probe (SEQ ID NO: 20)

5 '(B) -TGGATCCCGCACACGACTGAGAATGAGACTCCTGCTGC 3'

Anti-8 probe (SEQ ID NO: 21)

5 '(B) -TGGATCCCGCACACGACTGAGAGTATTGCTGAGCCACC 3 " Anti-9 probe (SEQ ID NO: 22)

5 '(B) -TGGATCCCGCACACGACTGATGAGATCACTGCCCTGAG 3'

AntMO probe (SEQ ID NO: 23)

5 '(B) -TGGATCCCGCACACGACTGAGATAGAATGTGTGCCCCC 3'

Complementary complementary polynucleotides of the 5 'universal region of the markers, coupled to a 3' fluorophore (Cy5) (Eurofins MWG GmbH):

UnivFluo 5 'CTGGAGTTGC- (CY5 ^* ) 3' (SEQ ID NO: 24)

- Solution of extracted markers

- Chip and Cartridge for Nanogen (trademark) automaton spotted with the complementary of the variable regions of the probes

(NanoChip (registered trademark) Electronic Microarray, 100-Site NanoChip (Trademark) Cartridge)

Nanochip processing station (registered trademark) Molecular biology Workstation (Nanochip (registered trademark) Reader, Nanochip (registered trademark) Loader)

L-histidine (Invitrogen, reference: 0955061 IX)

Multiscreen Filtration System (Millipore (registered trademark))

High salinity buffer (500 mM sodium phosphate, 500 mM sodium chloride, Nanogen ™) - Low salinity buffer (50 mM sodium phosphate, Nanogen®)

- 0.1M NaOH

1. f.3 Methods

Preparation of the cartridge The probes complementary to the specific regions of the markers are purified on the Multiscreen filtration system (from Millipore (registered trademark)) and then taken up in 60 μl of 50 mM L-histidine buffer. They are then transferred to the cartridge. Each of them is then addressed to a specific site of the cartridge for a period of 120 seconds (protocol managed by the workstation). The 5 'biotin binds to the streptavidin of the support.

Table 1.6: Probe Placement Plan

Hybridization of markers

Rinse the cartridge twice with high salinity buffer (75 μL). Prepare a mixture containing 5 μL of extract (markers), as well as the fluorescent probes at a final concentration of 0.5 μM in high salinity buffer (q.s.p. 100 μL). Take 75 μL of this mixture into the cartridge and incubate for three minutes at room temperature. Empty the cartridge and rinse twice with 75 μL of high salinity buffer. Add 75 μL of high salinity buffer at the end of the operation. Then start the device using the standard Nanogen Workstation (registered trademark) protocol. Regenerate the cartridge that can be reused.

LG Exploitation of results and interpretation

The analysis of the three products marked in this first example (see Figure 5) makes it possible to simulate three possible configurations (among others) during the product authentication steps. In the first and second labeled products, the user was able to detect the presence of the encoding polynucleotide. The mere presence of this polynucleotide indicates that the product is likely to be authentic. As regards the third product, the total absence of detection of the coding polynucleotide indicates that the product is not labeled: it is therefore not authenticated.

After reading the information carried by the encoding polynucleotide present in the first and the second product, the user refers to the associative table indicating that the code of the encoding polynucleotide corresponds to the presence of the target polynucleotides 1 and 2 (no matter the lure polynucleotides present). These polynucleotides are well detected in the first labeled solution, and only these two polynucleotides: the first solution can be authenticated. As for the second solution, the unexpected presence of the target polynucleotides 3, 4 and 5 does not make it possible to authenticate the product.

EXAMPLE 2 Marking According to the Process of the Invention of a Cosmetic Product

This example illustrates a labeling using several single-stranded deoxyribonucleic acid polynucleotides, injected into a skin cream, and detected according to the technique presented in Example 1.

HE HAS. Injection of polynucleotides into the cream

2.a.1 Principle

The markers are first prepared nuclease-free distilled water and then incorporated the cream, to a final concentration of ^10-12 moles per tablet of dm ³ cream for target markers and decoys, and at a concentration of 10 ^{" 14} moles per dm ³ of cream for the coding markers. 2.a.2 Materials

Synthetic Polynucleotides (Eurofins MWG GmbH), 100 pmol / μL

- Circular single-stranded deoxyribonucleic acid (coding markers) - deionized H ₂ O, nuclease-free

- Thermal Fix 2 cream (registered trademark), Laboratoires VICHY

2 .a.3 Methods

A preliminary mixture of target, coding and decoy polynucleotides is injected using a P10 pipette (Gilson Pipetman, registered trademark) into 1 cm ³ samples of Thermal Fix (registered trademark) creams, leading to a final concentration of ^10-12 moles of marker per dm ³ for target markers and decoys, and a final concentration of ^10-14 moles per dm3 for the encoding polynucleotides, the samples are then stored for identification.

11. B. Extraction and detection of markers

The markers are detected in the same way as in Example 1, except for the extraction step of the polynucleotides.

2.b.1 Principle of extraction

The markers are extracted from the cream by breaking the emulsion and recovering the aqueous phase. A high temperature (above 80 ^° C.) is sufficient to reduce the emulsion constituting the cream and thus separate the aqueous and lipid phases. The markers, very polar, are found in the aqueous phase from which they are extracted.

2.b.2 Material - Thermal Cream Fix (registered trademark) (Vichy) Marked - Heating block or water bath. Demineralized H20 without nucleases.

2.b.3 Method

The labeled cream is heated for 15 minutes at a temperature of 95 ^° C. and then centrifuged for 5 minutes at 10,000 rcf. The aqueous phase is recovered, and is used for the detection of markers. The polynucleotides can then be detected according to the method described in Example 1.

Example 3 Labeling According to the Process of the Invention of a Spirits

This example illustrates a technique for labeling a spirit with a mixture of target, coding and decoy polynucleotides. The first type of marker (target polynucleotides) consists of a pool of 20 single-stranded deoxyribonucleic acids of a size of 20 bases. The second marker is a single-stranded circular nucleic acid, 1000 bases in size, whose sequence contains the target marker search instructions. Thus, this sequence makes it possible to know which target markers, among the 20, are significant for the coding of the spirits, the other markers being lures added in a semi-random manner.

Ul. A. Development of markers and markings

3.a.1 Detailed principle of the marking technique

Twenty markers of single-stranded deoxyribonucleic acid are generated by means of the algorithm presented in the description of the invention. These markers differ from each other, do not self-hybridize, and do not are not likely to hybridize each other. They constitute the target polynucleotides.

The polynucleotide encoding is a 1000 base deoxyribonucleic acid, circular. The sequence of this nucleic acid contains, at a given location, a cassette containing the combination of target polynucleotides to be searched in the product.

The attached FIG. 6 shows the principle of coupled labeling: the coding marker, in circular form, contains a general information site, as well as a site allowing to know which of the target markers, also present in the mixture, carry the information. code (the others are only decoys).

Thus, only the combination of the target markers designated by the coding marker is significant for the authentication, the other markers being only decoys. The sequence of the coding marker therefore contains a coding box whose position is hidden. Reading this sequence allows the user to know which markers are to be searched in the target marker pool via cross-referencing in a lookup table. The combination of the target markers makes it possible to identify the product unitarily: only one possible combination for a possible product. In the coding marker, downstream of the coding cassette for the combination of target markers to be searched, a second sequence codes for general product information, such as the batch, year of production, etc.

These markers are then injected into the spirits to be marked. The detection then takes place in two phases. The first is to detect the specific sequences of the coding marker. The first information that comes out of it is: • Product authentication. In case of coarse counterfeiting, no coding marker is present • Product information: Batch number, date of manufacture, ...

• Unique combination of target markers to search for a

It is a well-known practice.

If this first authentication is not considered sufficient, a second is performed on the target markers. This second authentication makes it possible to deduce the following information:

• Coarse counterfeit in the absence of target markers or incorrect combination. • Product from a mixture if other markers are detected in addition to those provided by the coding marker.

• Product authentication accurately through cross-checking with a database.

3. a.2. materials

Synthetic Polynucleotides (Eurofins MWG GmbH), 100 pmol / μL (target markers)

- Champagne Moët and Chandon (registered trademark), Brut Impérial

- Single-stranded deoxyribonucleic acid (coding markers)

- Deionized water, without nucleases.

3. a.3 Method a. Target markers The target markers consist of 20 different polynucleotides, obtained by chemical synthesis (Eurofins MWG GmbH). This example is realized with the marking of 5 different products. In each of these products, the markers can be used:

Primer-1: 5 ¹ -AGTCGAGAGCCGATTCCGCT-3 ¹ (SEQ ID NO: 25)

Primer-2: δ'-GTCCGAGCAAAGGCTTCCGT-S ¹ (SEQ ID NO: 26) Primer-3: 5 ^I -AGACCCGTGGGCTCCATTAG ^3-1 (SEQ ID NO: 27) primer-4: 5 ^I -CCACCCAGAGGGCTTAGGTTτ3 ¹ (SEQ ID NO: 28) primer-5: 5 ^I -ATCCCACGAGGGTGATCTCG ^3-1 (SEQ ID NO: 29) Primer-6: 5 ^I -GGAATCCGACCGTGCATGTC ^3-1 (SEQ ID NO: 30) Primer-7: 5 ^I -CAGAGACGTGACCCGCTGTT ^3-1 (SEQ ID NO: 31) Primer-8: 5 -GACCCAGGGGTACATTCTCG ^{I-3 I} ( SEQ ID NO: 32) Primer-9: 5 ^I -AAACGAGCCCGTTCCGTGTG-3 ¹ (SEQ ID NO: 33) Primer- ^I -GGGAGCCCCAGCATTATCGT-3 ¹ (SEQ ID NO: 34) Primer-11 5 ^I -GGACGTGAACGCATCCGTCT-3 ^I (SEQ ID NO: 35) Primer 12 5'-GGCTGAAGGCCACTACTCTG-3 '(SEQ ID NO: 36) 13 January ⁵ Primer- -GTAGGTAGCACACCGTCGCT ^3-l (SEQ ID NO: 37) Primer-14 January ⁵ -CAGCCAGGAGATGTCCGTCT- 3 ¹ (SEQ ID NO: 38) Primer 15 ^{5'-GTCCCCAGGTGAGATCATCG-3-1} (SEQ ID NO: 39) Primer-16-May ¹ -CGAGGGACCAGCTTCCGTAT 3 ^I (SEQ ID NO: 40) Primer-17 January ⁵ -GCCAGTCGCAGGCATGATTC -3 ¹ (SEQ ID NO: 41) 18 5'-Primer- CGCCAGGGTCTCAGTCGTAA-3 ¹ (SEQ ID NO: 42) Primer- 19 -GAGCATAGCCGACGTCTTCG 5 ^{I-3 1} (SEQ ID NO: 43) Primer-20 5 ^I - GTAGAGTGACACGTCGCTCC-3 ^I (S EQ ID NO: 44)

Of these 20 target markers, only 10 are actually injected into the products. Of these 10 markers, 5 are decoys, and 5 constitute the actual marking of the product. Only the sequence of the coding marker can find what are the coding markers, and what are the decoys. In addition, the products 1 to 4 are samples of Moët et Chandon Champagne, cuvée Impériale 2005 (registered trademark), the product number 5 is a sample of Moët et Chandon Champagne, vintage Imperiale 2002 (registered trademark).

Table 3.1: Marking Products 1-5 with Target Markers

1 to 20

Table 3.1 illustrates the marking of the 5 products. The dash indicates that the marker is not injected. The letter M indicates that the marker is injected, and that it serves in the signature of the marking. The letter L means that the marker is injected, but acts as a decoy. Thus, products 1 and 2, even if they contain different lures, contain the same markers. They present the same signature. Conversely, products 3 and 4 have the same decoys, but the markers are different. They have a different signature. The product 5 has the same signature as the product 1. Only the coding marker makes the difference between the two products.

Prediluted at a concentration of 10 ⁷ mol / L in the product to be labeled (1 .mu.l of initial 10-4 mol / L solution diluted in 999 .mu.l of product to be labeled, then 10 .mu.l of this intermediate solution in 990 .mu.l of product. to mark), the markers are injected at the rate of 100 μL (using a Pipette P100) so as to obtain a final concentration of

10 ^{~ 9} moles / L in each in products 1 to 5, the final volume is, for example, 10 ml_. The product thus contains 10 ^-8 moles of labels per liter, ie a total of 10 ^-10 moles of labels in 10 ml.

β. Coding marker

Synthesized according to the protocol of Example 1, the coding markers are single-stranded deoxyribonucleic acids with a total length of 1000 bases. Their sequence is as follows (SEQ ID NO: 45):

5 'CAGAAGAATGCACGCTCTTTAACGCTTCGCCCTAAAATGGGCCATG ACTATTGAGAATACGATACCTTCCCGCGTTAGCATCCCTTCCCTGATG CTGGTAGATCTACACCATCTGTACGGGAGATAAGGCTGGCTGTGCGC TTAGACGGGAACTTGGACCGGAAGAATGCGTACAGCCTTACGCGCAT CCGAGTCGTCACCTACCACACGCTCATGCGCACTTTACGGGTAAAAA GTGTTAATCGTAACAGTGTCGGGACCACTCCTATGCTAATACCAGCGT GGTCCAGTGACG I I I I LACATAGTAGGTGCTCTAATCTTGCAAACCAC CGTTTCATTATCTGTTATTCTCCCTTGCTAATGGCCCGCTCAGCACCG GGTGTTCCCAGAGGAGAGCTCCCAGCCACGTTGCAGCGAGCGGGCT

GTCGAAAGTATAAAGTTCTTAC [mark uagel] ACATTCTATGCGTATCAT

TTCTCCTACGGATCTGGAGCTAATCCGGTACGCAGCTTACGCACAAT GGCATAAGCTGTGACGTGGGATAGATAGTACTCTCTACAAACGTACA GAGCAGTGTTATCGATACCCCCCGCAGCCAATTACTCATAAATCCGA CACAGCAACGCCCATTTTCAGTTTTCGGTATACGTGCGGGCTCCTCAT ATGTATTAACGTTGAGTGACTCTGCAGTCCGATTGGATGTTGGTTCCA TCCGCTATCGTAGAGTCCTATC [tag2] GAAATCCACAAATCTGT

GCGATTTGACGTACATTTCGTATCGGCGGTAGTTACGCAAGCTAGCA CTACCATAGTAGTATCGTTATTCGGGCTTGACAACCTCGAAGGCGTG GGGAAGAAGCGTCAGTATCTTCGCAAGAAATGAGGAAGAGGTACCAA TAAGCGAATGGGCCCGAAACTACGTCCTCGCAGAGGGCGATCGATC GGCGATTAGAGTCTGGGGGGTAGTTCAGCACA 3 ¹

Mark 1 codes for the combination of target markers to look for in the product. The mark 2 codes for a generic information such as the vintage from which the samples originate. Below (Table 3.2), the legend of type 1 marks.

Table 3.2: Coding of the target markers according to the variable sites of the coding markers

Table 3.3: Coding of the product type according to the secondary information of coding markers

In the products is then injected a specific coding marker, which indicates which are the target authentication markers coding for the information, and which indicates, in our example, the vintage from which the sample originates, at a final concentration. 10 ^{~ 11} mol / L according to the technique described in Example 1. They contain the following variable sequences:

Table 3.4: Summary of product markings 1 to

M = marking PM = marked product

III. B. Extraction of markers

The detection is done in two steps. The first is to detect coding markers. It allows a first authentication of products, thanks to the second mark. Reading the first mark then makes it possible to know the combination of target markers to be searched.

3. b.1 Principle of extraction

The markers are extracted from their environment (here, a Champagne wine), then recovered in an aqueous medium in order to then be able to use molecular identification techniques.

The extraction should preferably not only have a good performance

(get a maximum of markers, ideally: 100 yield

%), but it must also rid the markers of any "polluting" substances that may interfere with detection techniques. In addition, it should preferably be effective for both types of markers.

3. b.2 Material - Phenol UltraPure (Trademark) Buffer-Saturated Phenol, Invitrogen.

- chloroform / isoamyl alcohol (24: 1)

- 3M sodium acetate

- 95% frozen ethanol (Carlo Erba Rectapur), 75% - UltraPure Glycogen, Invitrogen (trademark) 20 μg / μmol

- Deionized water, without nucleases.

3. b.3 Method

The technique used is that of phenol chloroform extraction. For the example, the markers are extracted from 500 μl_ of product (Champagne). - In a 2 mL tube (Eppendorf, registered trademark) containing 500 μl_ labeled product, add ^Λ A phenol volumes (250 μl_), ^Λ A volume of chloroform (250 μl_) with the aid of a P1000 pipette, then vortex for 10 seconds. Centrifuge for 5 minutes at 10000 rcf.

- Transfer the aqueous phase to a new 2 mL tube

(Eppendorf, registered trademark), and add 1 volume (500 μl) of chloroform. Vortex and centrifuge for 5 minutes at 10000 rcf. Repeat this step 5 times.

Transfer the aqueous phase into a new tube, then add 3 μl of glycogen, 1/10 volume (50 μl) of 3M sodium acetate and 2.5 volumes (1250 μl) of ice-cold ethanol. Mix and incubate 1 hour at -20 ⁰ C

- Centrifuge 10 minutes at 10,000 rcf. Discard the supernatant and gently wash the pellet with 200 μl of 75% iced ethanol. Then dry the pellet. Take it back into 20 μL of deionized water, without nucleases.

III. C. Detection of the coding marker

3. c.1 Principles The coding marker is detected by a chain polymerization technique. Two primers are needed to do this. A first type of primer is complementary to a region located 5 'of the variable sequence 1. This primer is called universal because it does not depend on the variability of the target markers (it recognizes a site common to all these markers). The second primer is in turn complementary to the variable sites 2. Thus, we use as many pairs of primers as variable sequence types 2 (here, two pairs).

The attached FIG. 7 represents the detection of the primary labeling of the coding markers by PCR. This figure shows the two types of primers, the matrix as well as the complementary strand that is generated during the first PCR cycle.

For each type of variable sequence 2, a chain polymerization reaction is carried out on the markers extracted from the products. The specific amplification of the marker coding for a primer pair reveals the presence of a type 2 sequence. The absence of amplification is indicative of an unlabeled product, which is therefore probably counterfeited. An amplification of the marker with the wrong pair of primer, or with several pairs of primers reveals a cheating on the product (cheating on the vintage, mixtures, ...)

3.C.2. Equipment

- Taq Polymerase (Applied Biosystems) AmpliTaq GoId

- Buffon X PCR Buffer II (Applied Biosystems) - MgCb Solution (25 mM) (Applied Biosystems)

- Universal sense primer (Eurofins MWG GmbH), 100 pmol / μL) 5 'ACGTTGCAGCGAGCG 3' (SEQ ID NO: 56)

- antisense primer (see variable sequences V2: the antisense primers are their reverse counterparts) (Eurofins MWG GmbH), 100 pmol / μL)

- dNTP (2 mM) - Agarose gel (Agarose Electrophoresis Grade, Invitrogen, reference: 15510-027)

- Tris Borate EDTA buffer (TBE) 0.5 X

- Ethidium bromide

3. c.3 Methods

In a 200 μl tube (Eppendorf, registered trademark), add the reagents using a pipette P2, P10 and P100, according to Table 3.5.

Table 3.5: Chain Polymerization Reaction

The chain polymerization reactions are then launched on a GeneAmp PCR System 9700 device (Applied Biosystem) by respecting the following cycles:

- 94 ⁰ C 5 '

- 94 ⁰ C 30 "I

- 55 ⁰ C 30 "ι-> 40 cycles - 72 ⁰ C 30 "I

- 72 ⁰ CT

The polymerase chain reaction products are then deposited on a 0.5% agarose gel prepared in 0.5X TBE and migrated in 0.5 X TBE buffer at 10 V.cm- ¹ . migration is carried out, the gel is put in a bath containing BET, rinsed and then revealed with UV.For each product, the absence of band reveals that the marker was not detected, or that the sequence 2 does not correspond to the type of primer used A band (358 bp in size) corresponds to an amplification, thus to the detection of a specific sequence of the coding marker.

For each positive revelation, the amplicons are conserved for possible detection of target markers.

I I I. D Detection of target markers

3. d.1 Principle Target markers are searched in the product for further detection of the mark. Only the reading of the coding marker makes it possible to detect the target markers. This detection is done on the amplicons obtained previously by polymerization chain reaction. The first step is to read the information contained on the coding markers, and thus on the amplicons. This information (sequences 1) makes it possible to know, thanks to a correlation table, which are the target markers present in the product whose presence carries the information of the marking. Knowing this, a detection of the total target markers is performed, using a DNA chip. After revealing this detection, the user is able to know which target markers are present or not in the product, and can compare these results to theoretically expected results obtained by reading the information on the coding markers.

3. d.2 Materials

- Universal sense primer (Eurofins MWG GmbH), 100 pmol / μL) 5 'ACGTTGCAGCGAGCG 3' (SEQ ID NO: 56)

- BigDye (registered trademark) Terminator V3.1 (Applied Biosystems)

- Matrix: coding marker amplicon

Deionized H2O without nucleases.

3. d.3 Methods

The sequence reaction is carried out on each of the amplicons, in a 200 μl tube (Eppendorf, registered trademark), according to the protocol set out in Table 3.6.

Table 3.6: Sequence Reaction

The reactions are then launched on a GeneAmp PCR System 9700 device (Applied Biosystem) by respecting the following cycles:

96 ⁰ C r

.96 _ ° c 10 "I

50 ⁰ C 5 "I -> 25 cycles

60 ⁰ C 4 'I After purification on a column (Qiagen, registered trademark), the reactions are then sequenced on an ABI3100 capillary sequencer 16 (Applied Biosystem).

From the result of these sequences are extracted the variable sequences 1 (or Marques 1). These sequences make it possible to find which target markers must be present in the mixture, by cross-referencing in the following table (Table 3.7):

Table 3.7: Coding of target markers according to variable sites of coding markers

The target markers are then detected according to the technique described in Example 1. This detection reveals, of course, the ten or so markers present in each product, but it is by comparing with the coding markers that it is possible to remove the relevant information. .

Example 4 Labeling According to the Process of the Invention of a Medicament This example shows how to label drugs in the form of tablets such as those used for many drug formulations, according to the labeling method of the present invention. The protocol of Example 1 is used.

IV. A. Injection of polynucleotides into capsules

4.a.1 Principle

The markers are first put in an ethanolic solution (80%) and then incorporated during the tableting process, to a final concentration of 10-12 moles per 400 mg tablet for the target markers and lures, and at a concentration of 10-14 moles per tablet for the coding markers. For this example, the tablets do not contain any active ingredient.

4.a.2 Materials - Synthetic Polynucleotides (Eurofins MWG GmbH), 100 pmol / μL

- Circular single-stranded deoxyribonucleic acid (coding markers)

Deionized H2O, nuclease-free

- Beta Lactose, Sigma Aldrich (Trade Mark) # L3750-500G

- Corn starch, Sigma Aldrich (Trade Mark) # S4180-500G - Calcium dihydrogenphosphate, Sigma Aldrich (Trademark) # 307645

- Sugar Syrup

- Stearic Magnesium, Sigma Aldrich (Trade Mark) # 26454-1 KG

4a.3 Methods at. Preparation of the marker solution

The markers are prepared in the same manner as in Example 1.

Preliminary mixing is however carried out in an 80% ethanolic solution for the incorporation of the polynucleotides into the tablets.

b. Preparation of tablets

The tablets are prepared from 300 g of grains. The different powders composing the grains are first weighed and then mixed ("Lodigge" type swirling and blasting mixer), according to the following formula:

- Beta-Lactose: 120g - Corn starch: 60g

- Calcium dihydrogenphosphate: 120g

The wetting solution is then prepared from 100 g of sugar syrup and 750 μl of the marker solution. Gradually add this wetting solution to the powder mixture until a moist mass is obtained which looks like a coarse semolina, then granulate the preceding mixture to obtain a grain having the appearance of a moist vermiculate ( using an oscillating Granulator).

The grain is then dried at a temperature of 60 ^° C. until a hygrometry of 4 to 6% is obtained and then sieved on a sieve column to remove the fine particles. After lubrication with 1% magnesium stearate, the grains are pressed and compressed in press.

IV. B. Extraction and detection of markers The markers are detected in the same way as in Example 1, except for the extraction step of the polynucleotides.

4.b.1 Principle of extraction The markers are extracted by grinding the tablets and then recovering the polynucleotides in the aqueous phase.

4.b.2 Hardware

- Marked tablets. - Heating block or bain-marie.

Demineralized H20 without nucleases.

4.b.3 Method

The tablets are crushed using a mortar and pestle, so as to obtain a very fine powder. This powder is then mixed with

1 mL of distilled water, in a 1.5 mL tube (Eppendorf, registered trademark). After heating for 15 minutes at 70 ^° C., the tube is centrifuged for 5 minutes at 5000 rcf in order to remove the solid particles. The aqueous phase is then taken up in a new tube for the polynucleotide authentication step. The polynucleotides can then be detected according to the method described in Example 1.

Example 5 Labeling According to the Process of the Invention of a Food Product

This example shows how to mark and extract markers in a food product, such as pizza dough. The markers are injected into the fresh dough and being prepared. They can be detected later in the finished product, ready for consumption, cooked or not. VA Marking the dough

5.a.1 Principles

The markers are pre-diluted in deionized water. Mixtures of target, coding and decoy polynucleotides are used, as shown in Example 1. They are then incorporated into a pizza dough recipe, which is then cooked.

5.a.2 Materials - Synthetic Polynucleotides (Eurofins MWG GmbH), 100 pmol / μL

- Circular single-stranded deoxyribonucleic acid (coding markers)

Deionized H2O, nuclease-free

- Ingredients for pizza dough: T45 flour «All-purpose wheat flour for gourmet preparations» Francine (registered trademark), olive oil «Extra virgin olive oil extracted with cold» Carapelli (registered trademark), yeast «Bakery yeast Breads »Francine (Registered Trade Mark), Sugar" White Sugar Powder "Daddy (Registered Trade Mark), Salt" Iodized White Salt Natural Essential "Cereals (Trade Mark.)

5.a.3 Methods

A preliminary solution of target markers, coders and decoys is added, prepared as described in Example 1, is added using a P200 pipette (Gilson Pipetman, registered trademark) to the pizza dough during its manufacture, in sufficient quantity to obtain a final marker concentration of 1 ^E- 10 mol / kg (for each non-decoying marker, ie at 2 ^E- 9 mol / kg of polynucleotides). The following table (Table 5.1) shows the different amounts of ingredients to obtain 828 grams of raw pizza dough.

Table 5.1: Manufacture of marked pizza dough

The dough is then baked for 15 minutes at an average temperature of 240 ° C.

V. B Extraction of markers

The markers are extracted by dissolving a cooked portion of dough in demineralized water: 1 gram of cooked dough is reduced to powder and then taken up in 10 ml of water. The whole is then mixed vigorously and then heated for 15 minutes at 94 ^° C. After centrifugation for 5 minutes at 10,000 rcf, the aqueous phase recovered and stored at 4 ^° C. for the detection of the markers. These markers were detected according to the technique presented in Example 1.

Example 6: Marking according to the process of the present invention of tobacco

This example shows how to mark tobacco. It is labeled with polynucleotides as presented in Example 1 by direct adsorption on tobacco.

Vl. A Tobacco marking 6.a.1 Principle

The marking is on one of the cigarettes of cigarettes called "blondes". On this sample is adsorbed a mixture of target polynucleotides, coding polynucleotides and decoy polynucleotides as described in Example 1.

6.a.2 Materials

Synthetic Polynucleotides (Eurofins MWG GmbH), 100 pmol / μL

- Circular single-stranded deoxyribonucleic acid (coding markers)

- Ethanol (Ethanol anhydrous, denatured, Sigma-Aldrich # 676829)

- Deionized H ₂ O, nuclease-free

Marlboro (Trade Mark) Cigarettes, Philip Morris Products S.A. 15

6.a.3 Methods

The tobacco is labeled with the solution of polynucleotides prepared according to the method described in Example 1.

One gram of tobacco extracted from cigarettes is labeled so as to obtain, in the end, 10 ^-12 moles of label per gram of tobacco: a sufficient quantity of pre-marking solution is injected using a P200 pipette ( Gilson Pipetman, registered trademark) directly on the tobacco, then the whole is mixed vigorously, at a temperature of 37 ° C for 15 minutes.

The tobacco thus labeled is then stored at a temperature of 160 ^° C. and 70% hygrometry.

VLB Extraction and identification of markers

The markers are extracted by soaking marked tobacco

30 in demineralized water: one gram of tobacco is soaked in

10 mL of deionized distilled water and then heated for 15 minutes at 94 ° C. After centrifugation for 5 minutes at 10,000 rcf, the aqueous phase recovered and stored at 4 ° C. for the detection of the markers. These markers can be detected according to the technique presented in Example 1.

Example 7 Marking According to the Process of the Invention of a Hydrocarbon

This example shows how to mark a hydrocarbon (crude oil) and what technique can be used to extract the markers and reveal the marking.

VII.A Marking of hydrocarbon

7.a.1 Principles

In this example, a crude oil sample is labeled with polynucleotides previously prepared in a polar organic solvent. The labeling is composed of target polynucleotides, coding polynucleotides and decoy polynucleotides as described in Example 1.

7.a.2 Materials

Synthetic Polynucleotides (Eurofins MWG GmbH), 100 pmol / μL

- Circular single-stranded deoxyribonucleic acid (coding markers)

- Deionized H ₂ O, without nucleases

- Dimethylsulfoxide (DMSO), Euromedex Ref UD8050-A - Crude oil (IFP) 7.a.3 Methods

A solution of target, coding and decoy single-stranded polynucleotides are prepared as described in Example 1.

A second preliminary mixture is then carried out in DMSO before inserting the markers into the oil.

The second preliminary solution of markers is then mixed with the oil, using a precision pipette (Gilson Pipetman, registered trademark) in sufficient quantity to obtain a final marker concentration of 10 ^-10 mol / l. The labeled oil is then stored at room temperature for the purpose of identifying the markers.

VII. B Extraction and detection of markers

7.b.1 Principle

The markers are extracted from their apolar medium and then recovered in an aqueous medium in order to then be able to use an identification technique.

7.b.2 Materials

- Phenol UltraPure (Trademark) Buffer-Saturated Phenol, Invitrogen.

- chloroform / isoamyl alcohol (24: 1) - 3M sodium acetate

- 95% frozen ethanol (Carlo Erba Rectapur), 75%

- Deionized water, without nucleases.

- Hexane (Sigma, ref H9379-1 L)

7.b.3 Methods The technique used is that of phenol chloroform extraction. For the example, the markers are extracted from 500 μl of crude oil.

- Add 2 volumes of Hexane. - Add 1/2 volume of phenol (250 μl), 1/2 volumes of chloroform

(250 μl) and 1/2 volume of water (250 μl) mix vigorously for 30 seconds. Centrifuge 30 minutes at 10,000 rcf.

- Transfer the aqueous phase into a new tube, and add 1 volume of chloroform. Stir vigorously and centrifuge for 20 minutes at 10,000 rcf. Repeat this step 5 times.

- Transfer the aqueous phase into a new tube, then add 1/10 volume of 3M sodium acetate and 2.5 volumes of ice-cold ethanol. Mix and incubate for 1 hour at -20 ^° C. - Centrifuge for 10 minutes at 10,000 rcf. Discard the supernatant and gently wash the pellet with 200 μl of 75% iced ethanol. Then dry the pellet. Take it back into 100 μL of deionized water, without nucleases.

These markers can be detected according to the technique presented in Example 1.

Example 8: Labeling according to the method of the invention of a fresh food product In this example, a fresh food product is labeled with a polynucleotide mixture. The product is a dairy product: a yoghurt.

VIII .A Marking of yoghurt

8.a.1 Principles The markers are pre-diluted in deionized water. The labeling is composed of target polynucleotides, coding polynucleotides and decoy polynucleotides as described in Example 1.

8.a.1 Materials

Synthetic Polynucleotides (Eurofins MWG GmbH), 100 pmol / μL

- Circular single-stranded deoxyribonucleic acid (coding markers)

- Deionized H ₂ O, without nucleases

- Activia Yogurt (Trademark) of Danone (Trademark)

8. a.2 Methods

A preliminary solution of target, coding and decoy polynucleotides is added to the yogurt, in the mass, in an amount sufficient to obtain a final marker concentration of 1 ^E- 10 mol / kg (for each non-decoying marker, ie at 2 ^E- 9 moles / kilogram of polynucleotides) using a P10 pipette (Gilson Pipetman, registered trademark), 2 μL of preliminary solution are then injected into the mass of the product. Everything is well homogenized using a sterile spatula. The marked yogurt is then stored at 4 ° C pending identification of the markers.

VIII. B Extraction of markers

The markers are extracted by dissolving a portion of yoghurt in demineralised water: 1 gram of yoghurt is taken up in 10 ml of water. The whole is then mixed vigorously and then allowed to warm 15 minutes at 94 ^C C. After centrifugation for 5 minutes at 10,000 rcf, the aqueous phase recovered and stored at 4 ° C for the revelation of the markers. These markers can be detected according to the technique presented in Example 1. Example 9 Labeling According to the Process of the Invention of a Beverage

A non-alcoholic soft drink is labeled with polynucleotides as described in Example 1: Orangina (registered trademark), Schweppes International Limited.

IX. A marking of the drink

9.a.1 Principles

Target, coding and decoy markers are pre-diluted in demineralized water. They are then mixed directly into the drink.

9.a.2 Materials

Synthetic Polynucleotides (Eurofins MWG GmbH), 100 pmol / μL

- Circular single-stranded deoxyribonucleic acid (coding markers)

- Deionized, nuclease-free H ₂ O - Orangina (registered trademark), Schweppes International Limited

9.a.3 Methods

Preliminary mixing is performed in deionized water before inserting the markers into the beverage. The preliminary solution of markers is mixed with the beverage, in an amount sufficient to obtain a final marker concentration of 1 ^E- 10 mol / L (for each non-decoying marker, ie at 2 ^E- 9 mol / l of polynucleotides).

The labeled beverage is then stored at 4 ° C in an airtight container. IX. B Extraction of markers

The labels are extracted using the phenol-chloroform technique presented in Example 1.

These markers can be detected according to the technique presented in Example 1.

Example 10 Marking According to the Process of the Invention of a Paper Support

This example shows how to mark and extract markers in a paper form. The markers are directly adsorbed on the paper. They are subsequently detected by dissolving the marked paper.

X. A Marking paper

10. a.1 Principles The target, coding and decoy polynucleotides as described in Example 1 are pre-diluted in demineralized water. A drop is then adsorbed on the surface of a sheet of paper.

10. a.2 Materials - Synthetic Polynucleotides (Eurofins MWG GmbH), 100 pmol / μL

- Circular single-stranded deoxyribonucleic acid (coding markers)

- Deionized H ₂ O, without nuclease.

- "1 QUALITATIVE Filter Paper" paper disc, Whatman (registered trademark). 10. a.3 Methods

Preliminary mixing as set forth in Example 1 is carried out in deionized water prior to deposition on the paper sheet.

The preliminary solution of markers is then deposited on the paper, so that 1 E-12 moles of labels are deposited. 1 μl of preliminary solution is deposited using a precision pipette

P10 (Gilson Pipetman, Trademark), which leads into the formation of a 5mm diameter disc.

The paper is then dried in the open air and then stored for the detection of markers.

X.B Extraction of markers

The markers are extracted by dissolving a section of paper in demineralized water: 1 cm ² of paper containing the marker disk is cut into very small pieces, and then immersed in 10 ml of water. Everything is then heated to 15 minutes at 94 ^° C.

The paper pulp is mixed very vigorously, then homogenized by suction-discharge using a pipette.

After centrifugation for 5 minutes at 2000 rcf, the aqueous phase recovered and stored at 4 ° C. for revealing the markers. These markers can be detected according to the technique presented in Example 1.

Example 11 Olfactory and Aging Tests on a Labeled Product According to the Process of the Invention

Stability and aging tests were carried out jointly with a cosmetics manufacturer. Olfactory tests have made it possible to verify that the addition of target polynucleotides, coding agents and decoys by carrying out a marking according to the present invention does not in any way alter the physicochemical and olfactory properties of the perfumes. These tests were carried out in parallel on several perfumes, and according to several conditions: a month at 5 ° C which served as a reference, a month at 50 ^c C, which simulated an accelerated aging of the perfume, as well as a month exposed to the light of day.

After aging, tests have shown that the solutions containing polynucleotides keep the same physicochemical and olfactory properties as the solutions containing no polynucleotide, whatever the method of aging. In addition, for each vial, the markers were extracted and then identified successfully.

Example 12 Olfactory and aging tests on a product labeled according to the process of the invention

The attached FIG. 8 represents a detection scheme of a marking according to the invention and of authentication of a labeled product according to the invention.

In this figure:

1- The coding markers are identified. The first level of authentication of the product lies in their presence. If the product does not contain a coding marker, the product is counterfeit.

2- The decoy and target markers are then identified in the product. In this figure, the product has been labeled with a set of target genes or putative lures.

Thus, it contains between 1 and 20 markers selected in this lot. At this stage of the process, the target markers and decoys are not differentiated (it is impossible to say that a polynucleotide is a target polynucleotide or a decoy polynucleotide). The nature of the coding polynucleotide detected during the first step (here the polynucleotide A) is then sent to the supplier of the marking. With this information, the tagging provider retrieves from a database the tag decryption key, which will define, in the series of polynucleotides lures and targets, which are decoys and which are target. - Using the decryption key, the user is interested in target polynucleotides only. It can then read the code that makes up the presence or absence of target polynucleotides (in this example, the code is -, -, + and -). - Reading the code then allows the user to check, using a secure database, if the identification code corresponds to the product of interest. Otherwise, it may be illegal reproduction, mixing or misappropriation of the product.

List of references

[1] Molecular Cloning, Maniatis, CoId Spring-Harbor, 2nd Edition, pp C3 to C14.

[2] Smith TF, Waterman MS (1981). Identification of a common, organic, sequence, J Mol Biol 1981 Mar 25; 147 (1): 195-7.

[3] Xin W, Zhang YM, Xiao JH, Huang DW (2003). Construction of linear functional expression elements with DNA fragments created by site-specific DNA nickase, N.BpulO I, and exonuclease III, Biotechnol Lett. 2003 Nov; 25 (22): 1913-6.

[4] Caruthers MH, Beaucage SL, Efcavitch JW, EF Fisher, Matteucci MD, Y Stabinsky, (1980). 1980 (7): 215-23.

[5] Wheeler, C.J., L Sukhu, G. Yang, Y. Tsai, C. Bustamente, Felgner P., J. Norman, Manthorpe M. (1996). Converting an alcohol to an amino in a cationic lipid dramatically alters the co-lipid requirement, cellular transfection activity and the ultrastructure of DNA-cytofectin complexes. Bioch. Biophys. Acta 1280: 1.

[6] Felgner, JH, R. Kumar, CN Sridhar, CJ Wheeler, YS Tsai, R. Border, P. Ramsey, M. Martin, PL Felgner. (1994). Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations. J. Biol. Chem. 269: 2550 [7] Ogris M, Steinlein P, Carotta S, Brunner S, Wagner E (2001) NA / polyethylenimine transfection particles: influence of ligands, polymer size, and PEGylation on internalization and gene expression, AAPS PharmSci. 2001; 3 (3): E21.

[8] Molecular Cloning.Maniatis, CoId Spring-Harbor, 2nd Edition, pp E3 to E4.

[9] Molecular Cloning, Maniatis, CoId Spring-Harbor, 2nd Edition pp 9.47 to 9.57.

[10] Kabilov MR, Pyshnyi DV, Dymshits GM, Gashnikova NM, Pokrovskii AG, Zarytova VF, Ivanova EM (2002). A new approach to detect a particular DNA sequence by UV-immobilization of its hybridization complex with a highly specific oligonucleotide solution in oligonucleotides, Mol Biol (Mosk). 2002 May-Jun; 36 (3): 424-31.

[11] Ramsay G (1998). DNA chips: state-of-the-art. Nat Biotechnol. 1998 Jan; 16 (1): 40-4.

[12] Ivanovskaia MG, Kozlov IA, Lebedeva IV, Shabarova ZA (1994). A new method of covalent immobilization of oligodeoxyribonucleotides on nylon membranes for hybridization with nucleic acids, Mol Biol (Mosk). 1994 Sep-Oct; 28 (5): 1176-82.

Claims

A method of labeling a product, said method comprising a step of adding to or within said product a plurality of single-stranded polynucleotides, said plurality of polynucleotides comprising: at least one target polynucleotide consisting of a single-stranded polynucleotide of defined length and sequence, and decoy polynucleotides which are of identical or different determined lengths and of identical or different determined sequences, said decoy polynucleotides being of identical or different length (s) and of different sequences of the sequence of said at least one target polynucleotide, wherein each of the target polynucleotides and lures does not hybridize with any of the other polynucleotides of said plurality of polynucleotides, and wherein the polynucleotides of the plurality of polynucleotides are sequences of deoxyribonucleic acid or ribonucleic acid, respectively comprising the m equal proportion of the four bases A, C, G and T, or A, C, G and U, natural or modified.

The method according to claim 1, wherein said plurality of polynucleotides further comprises at least one recognition polynucleotide consisting of a single-stranded polynucleotide of defined length and sequence of nature identification and the sequence of at least one target polynucleotide, wherein each recognition polynucleotide does not hybridize with any of the other polynucleotides of said plurality of polynucleotides,

The labeling method according to claim 1, wherein said polynucleotides of the plurality of polynucleotides are circular or linear.

The labeling method according to claim 1, wherein at least two target polynucleotides are used, one being a circular polynucleotide and the other a linear polynucleotide.

The labeling method according to claim 3 or 4, wherein the linear polynucleotides comprise a variable end of one polynucleotide to another and a constant end of one polynucleotide to another.

The labeling method according to any one of the preceding claims, wherein the at least one target polynucleotide of the plurality of polynucleotides is 5 to 50 nucleotides in length.

The tagging method of any of the preceding claims, wherein said polynucleotides of the plurality of polynucleotides are from 5 to 5000 nucleotides in length.

The labeling method according to any one of the preceding claims, wherein the adding step is performed by adding said plurality of polynucleotides in said product during its manufacture or in or on the finished product.

The labeling method according to any one of claims 1 to 8, wherein the adding step is performed by adding said plurality of polynucleotides to the surface of said product.

10. The method of marking according to any one of the preceding claims, wherein a step of encapsulation of said plurality of polynucleotides in lipid vectors is carried out prior to the addition step.

The marking method according to any one of the preceding claims, wherein the introduction of said plurality of polynucleotides is performed on or in a component of said product.

12. A marking method according to any preceding claim, wherein the concentration of the plurality of polynucleotides after its addition in said product is from 10 ^-6 mol to 10 ^"18 moles / dm3.

13. Labeled product obtainable by a process according to any one of claims 1 to 12.

14. Labeled product according to claim 13, said marked product being chosen from the group comprising perfumes, cosmetics, hygiene products, food products, flavorings, plant extracts, tobacco, beverages, textiles, hides, medicines, powders, varnishes, inks, foodstuffs, hydrocarbons, papers, paints, chemical products and compounds.

The method for detecting the labeling of a product according to claim 13, said method comprising a step of analyzing the plurality of polynucleotides for specifically detecting the at least one target polynucleotide, comprising the following successive steps: (I) contacting the plurality of polynucleotides with a solid support on which probe sequences are fixed, these probe sequences being complementary to one of the ends of said at least one target polynucleotide of the plurality of polynucleotides of the product marking, the bringing into contact allowing the target polynucleotides to bind to the support by hybridization with the complementary probe sequences fixed on the support;

(ii) removing non-hybridized polynucleotides by step (i); (iii) detecting the presence on the support of the target polynucleotides; and

(iv) comparing the results of step (iii) with the contents of a database which makes it possible to identify and authenticate said product.

The method of claim 15, further comprising the following steps, prior to the analyzing step:

(a) taking a sample of the product; and

(b) extracting the plurality of polynucleotides from said sample, the analyzing step being performed on the plurality of polynucleotides extracted from said sample.

The detection method of claim 15 or 16 wherein the analyzing step comprises a polymerase chain reaction of the target polynucleotides.

18. The detection method according to any one of claims 15 to 17 wherein the analysis step is carried out by immunodetection.

The method of detecting the label of claim 15, wherein the polynucleotides complementary to the target polynucleotides are attached to the solid support by means of a biotin / streptavidin linkage.

The method of detecting the tag of claim 15, wherein the polynucleotides complementary to the target polynucleotides are attached to the support by covalent bonding to a charged nylon membrane, said membrane forming the solid support.

A method of detecting tagging according to any one of claims 15 to 20, wherein the target polynucleotides attached to the support are detected using polynucleotides labeled with a labeling agent and complementary to the other end of the target polynucleotides, the marking agent being selected from the group consisting of a fluorochrome, a colloidal gold particle and an enzyme.

The tag detection method according to claim 15, wherein the database makes it possible to determine the origin of said product.

The method of detecting the marking of claim 15 to 22, wherein the database identifies a counterfeit of an original product.

24. A method of detecting tagging according to any one of claims 15 to 23, wherein the extraction as defined in step (b) is a phenol chloroform extraction.

The detection method according to any of claims 15 to 24, wherein the analyzing step comprises reverse transcribing the ribonucleic acid to deoxyribonucleic acid when the target polynucleotides are ribonucleic acid.

The detection method according to any of claims 15 to 24, wherein the analyzing step comprises a step of sequencing the target polynucleotides.