Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P7/00—Preparation of oxygen-containing organic compounds
  • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
  • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
  • C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/0004—Oxidoreductases (1.)
  • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P7/00—Preparation of oxygen-containing organic compounds
  • C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
  • C12P7/26—Ketones
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P7/00—Preparation of oxygen-containing organic compounds
  • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
  • C12P7/56—Lactic acid

Definitions

• the present invention relates to a novel polypeptide having the enzymatic activity of conversion of methylglyoxal to lactic acid in a single step (known as glyoxalase III activity), a polynucleotide having a nucleotide sequence encoding such polypeptide and uses thereof.
• the invention relates to the modulation of the glyoxalase III activity in a microorganism by varying the expression level of the polynucleotide coding for such polypeptide.
• the present invention also relates to the production of commodity chemicals, especially
• D- or L-lactate can be formed depending on the organisms : D- lactate is formed in E. coli together with other products during mixed acid fermentation, whereas D- or L-lactate can be produced by fermentation of lactic acid bacteria.
• the production pathway is derived from the glycolysis pathway leading from glucose to pyruvate.
• Pyruvate can be reduced by a single reaction into lactate by a soluble lactate dehydrogenase dependent on reduced nicotinamide adenine dinucleotide (NADH) as co-factor.
• NADH nicotinamide adenine dinucleotide
• the lactate dehydrogenase coded by the ldhA gene is specific for D-lactate (Clark, 1997).
• lactate dehydrogenases specific for D- or L-lactate can be found (D-lactate for Lactobacillus delbrueckii, L-lactate for Lactobacillus helveticus, see for example Garvie, 1980).
• methylglyoxal bypass In several organisms, another pathway can be responsible for lactate production. This pathway is called methylglyoxal bypass as it could serve as an alternative to the downstream part of the glycolysis pathway converting the triose glyceraldehyde-3-phopshate (GA3P) into pyruvate (Cooper, 1984). Methylglyoxal bypass starts from the second triose phosphate produced by the cleavage of fructose- 1,6-bisphosphate, dihydroxyacetone phosphate (DHAP). DHAP is converted to methylglyoxal (MG) by methylglyoxal synthase.
• G3P triose glyceraldehyde-3-phopshate
• DHAP dihydroxyacetone phosphate
• D- or L-lactate dehydrogenases which are a toxic compound for the cell is then converted to D- or L-lactate by different systems and the lactate produced can be further transformed into pyruvate by D- or L-lactate dehydrogenases.
• D- and L-lactate dehydrogenases are flavin-linked membrane-bound proteins that are activated only under aerobic conditions (Garvie, 1980).
• D- and L-lactate dehydrogenases are coded respectively by the did and HdO (or lciD) genes in E. coli (Rule et al, 1985, Dong et al, 1993).
• the routes for catabolism of methylglyoxal have been investigated in bacteria (Ferguson et al, 1998) to understand the detoxification of this compounds but also for purposes of production of 1 ,2-propanediol.
• Three pathways that can lead to the production of lactate from methylglyoxal have been identified in E. coli : The first one is the gluthatione dependent glyoxalase I-II system (encoded by gloA and gloB genes) which converts methylglyoxal into D-lactate in two steps.
• the second is the glutathione independent glyoxalase III enzyme which catalyses the conversion of methylglyoxal into D-lactate in one step.
• the third system is the degradation of methylglyoxal by methylglyoxal reductases, resulting either in acetol or in D- or L-lactaldehyde.
• L-lactaldehyde can be further converted to L- lactate by the action of aldehyde dehydrogenases e.g. by the enzymes encoded by the aldA or aldB genes (Grabar et al, 2006).
• the glyoxalase III system has been less extensively studied than the glyoxalase I-II system.
• the enzyme glyoxalase III was first mentioned in E coli by Misra et al in 1995 and purified. This enzyme is significantly different from glyoxalase I as it has different properties and is able to catalyse the conversion of methylglyoxal in D-lactate in a single step, independently of gluthatione. This enzyme is later mentioned in several reports (MacLean et al, 1998, Okado-Matsumoto and Fridovich, 2000, Benov et al 2004) to have a higher activity than glyoxalase I or glyoxalase II in E. coli. Before this day, the amino-acid sequence of glyoxalase III had not been determined and the gene coding for this enzyme was unknown.
• propylene glycol a C3 dialcohol
• It is a component of unsaturated polyester resins, liquid detergents, coolants, anti-freeze and de-icing fluids for aircraft.
• Propylene glycol has been increasingly used since 1993-1994 as a replacement for ethylene derivatives, which are recognised as being more toxic than propylene derivatives.
• 1 ,2-propanediol is currently produced by chemical means using a propylene oxide hydration process that consumes large amounts of water.
• Propylene oxide can be produced by either of two processes, one using epichlorhydrin, and the other hydroperoxide. Both routes use highly toxic substances.
• the hydroperoxide route generates by-products such as tert- butanol and 1 -phenyl ethanol. For the production of propylene to be profitable, a use must be found for these by-products.
• the chemical route generally produces racemic 1 ,2-propanediol, whereas each of the two stereoisomers (R)l,2-propanediol and (5)l,2-propanediol are of interest for certain applications (e.g. chiral starting materials for specialty chemicals and pharmaceutical products).
• Acetol or hydroxyacetone (1 -hydroxy- 2-propanone) is a C3 keto alcohol. This product is used in vat dyeing process in the textile industry as a reducing agent. It can advantageously replace traditional sulphur containing reducing agents in order to reduce the sulphur content in wastewater, harmful for the environment.
• Acetol is also a starting material for the chemical industry, used for example to make polyols or heterocyclic molecules. It possesses also interesting chelating and solvent properties. Acetol is currently produced mainly by catalytic oxidation or dehydration of 1,2- propanediol. New processes starting from renewable feedstocks like glycerol are now proposed (see DE4128692 and WO 2005/095536).
• This route is used by natural producers of (R)-1, 2-propanediol, such as Clostridium sphenoides and Thermoanaerobacter thermosaccharolyticum.
• Clostridium sphenoides has been used to produce 1 ,2-propanediol at a titer of 1,58 g/1 under phosphate limited conditions (Tran Din and Gottschalk, 1985).
• Thermoanaerobacter thermosaccharolyticum has also been investigated for the production of 1 ,2-propanediol (Cameron and Cooney, 1986, Sanchez-Rivera et al, 1987).
• the group of Bennett obtained similar results in flask cultures under anaerobic conditions with a titer of 1.3 g/1 and a yield of 0.12 g/g whereas microaerobic cultures gave a titer of 1.4 g/1 with a yield of 0.13 g/g.
• Lactic acid or lactate and its derivatives have a wide range of applications in the food, pharmaceutical, leather and textile industries.
• polylactic acid (PLA) has been developed as a renewable, biodegradable and environmentally friendly plastic and therefore, the demand for lactate is expected to expand.
• Lactate can be produced either by a chemical synthesis or by a biological process.
• a biological process is able to produce the desired stereoisomer, D- or L-lactate with high optical purity, which is an important characteristic for many of its end uses.
• Physical properties and biodegradation rate of PLA can be controlled by manipulating the ratio of the chiral substrates, D- and L-lactate. Therefore, availability of biological processes for the production of optically pure D- and L-lactate is a prerequisite for high quality polymer synthesis.
• Lactic acid bacteria are natural producers of lactate and some can be found to be specific for the D- or L-form. These bacteria have been traditionally used for the production of lactate as specialty chemical (e.g. in US 2004/0005677). However, with the emergence of lactate as commodity chemical for PLA synthesis, more efficient and cost-effective processes are needed. Alternative biocatalysts able to growth in mineral salt medium and to use a range of different sugar substrates are investigated. Yeasts and E. coli combine these characteristics with the availability of a wide range of genetic tools for metabolic engineering. Use of these catalysts for the production of lactic acid has been described in WO 03102201, WO 03102152 and US 2005/0112737 for yeast strains and in EP 1760156 and WO 2005/033324 for E. coli strains.
• D- or L-lactate in microorganisms relies on the reduction of pyruvate produced by the catabolism of sugars by NADH-dependent lactate dehydrogenases. Conditions for efficient conversion are generally achieved under anaerobiosis where a large pool of NADH co- factor is available. Lactic acid bacteria can be selected for homofermentative metabolism yielding lactate as the only fermentation product. This is not the case with yeast or E. coli and other fermentation products like ethanol, acetate, formate or succinate have to be removed. This can be achieved by genetic engineering with deletion of the corresponding genes. In the recent years, metabolic engineering of E. coli for production of optically pure D- lactate has been investigated.
• the present invention concerns an isolated polypeptide having a glyoxalase III enzymatic activity comprising the sequence of SEQ ID NO 1 , a fragment or homologous sequence thereof
• the invention also provides a polynucleotide comprising a sequence coding for said polypeptide.
• Inventors report the identification of a gene from E. coli encoding a protein having a glyoxalase III activity. This gene was previously known as the yedU gene (also known as hchA) coding for Hsp31, a homodimeric protein (Sastry et al, 2002). This protein has been later purified, crystallized and its structure resolved by different groups (Lee et al, 2003, Quigley ey al, 2003 and Zhao et al, 2003).
• Hsp31 functions have been associated with Hsp31 : molecular chaperone active in the management of protein misfolding (Malki et al, 2003), aminopeptidase of broad specificity (Malki et al, 2005) and another potential function linked to the 2-His-l-carboxylate motif able to coordinate a metal ion and present in several dioxygenases and hydroxylases (Zhao et al, 2003). No association of Hsp31 with a glyoxalase III activity has never been reported in the literature.
• the invention is furthermore related to an expression cassette comprising said polynucleotide under the control of regulatory elements functional in a host cell and to a transformation vector comprising said cassette or said polynucleotide.
• This microorganism is able to convert glucose to 1 ,2-propanediol or acetol, with an improved yield and with a better selectivity (i.e. less by-products) compared to the already- known processes.
• microorganisms according to the invention with attenuated glyoxalase III activity are further modified to enhance the production of 1 ,2-propanediol and/or acetol.
• a method for preparing 1 ,2-propanediol and/or acetol wherein said microorgansims are grown in appropriate growth medium and 1 ,2-propanediol and/or acetol is recovered is provided.
• Overexpression of said gene coding for glyoxalase III provides a strain able to produce lactate under fully aerobic conditions, therefore increasing the productivity of the process.
• a method for preparing lactate wherein said microorgansims are grown in appropriate growth medium and lactate is recovered is provided.
• the invention is also related to a method for modulating the glyoxalase III enzymatic activity in a microorganism, wherein activity of the polypeptide of the invention is enhanced or attenuated in said microorganism.
• the present invention is related to an isolated polypeptide having a glyoxalase III enzymatic activity comprising the sequence of SEQ ID N°l, a fragment or homologous sequence thereof.
• a glyoxalase III enzymatic activity comprising the sequence of SEQ ID N°l, a fragment or homologous sequence thereof.
• polypeptide refers to peptide or protein which comprises a sequence of two or more amino-acids linked with peptide bonds.
• glycoxalase III refers to a polypeptide responsible for an enzyme activity that catalyzes the conversion in a single step of methylglyoxal into D-lactate. Such an enzyme activity was described in E. coli by Misra et al (1995) and methods to measure this enzyme activity were provided.
• enzyme activity and “enzymatic activity” are used interchangeably and refer to the ability of an enzyme to catalyse a specific chemical reaction, for example the conversion of methylglyoxal in D-lactate for glyoxalase III enzyme activity.
• the isolated polypeptide of the present invention can be obtained from microorganisms having glyoxalase III activity, for example by using the purification procedure as described in the following examples.
• Microorganisms that can be used to isolate the polypeptide include, but are not limited to, E. coli
• the term "comprising the sequence of SEQ ID N°l” means that the amino-acid sequence of the polypeptide may not be strictly limited to SEQ ID N°l but may contain additional amino- acids.
• a fragment of SEQ ID N°l means that the sequence of the polypeptide may include less amino-acid than SEQ ID N°l but still enough amino-acids to confer glyoxalase III activity.
• a polypeptide can be modified by substitution, insertion, deletion and/or addition of one or more amino-acids while retaining its enzymatic activity.
• substitutions of one amino-acid at a given position by a chemically equivalent amino-acid that do not affect the functional properties of a protein are common.
• substitutions are defined as exchanges within one of the following groups :
• the positions where the amino-acids are modified and the number of amino-acids subject to modification in the amino-acid sequence are not particularly limited.
• the man skilled in the art is able to recognize the modifications that can be introduced without affecting the activity of the protein.
• modifications in the N- or C-terminal portion of a protein would not be expected to alter the activity of a protein.
• homologous refers to polypeptides submitted to modifications such as defined above while still retaining the original enzymatic activity.
• polypeptide of the present invention have at least 70% identity with the sequence of SEQ ID N°l, preferentially at least 80% identity and more preferentially at least 90% identity.
• Methods for determination of the percentage of identity between two protein sequences are known from the man skilled in the art. For example, it can be made after alignment of the sequences by using the software CLUSTALW available on the website http://www.ebi.ac.uk/clustalw/ with the default parameters indicated on the website. From the alignment, calculation of the percentage of identity can be made easily by recording the number of identical residues at the same position compared to the total number of residues. Alternatively, automatic calculation can be made by using for example the BLAST programs available on the website http://www.ncbi.nlm.nih. gov/BLAST/ with the default parameters indicated on the website.
• the polypeptide comprises at least 100 contiguous amino-acids from the sequence of SEQ ID N°l, preferentially at least 150, at least 200, at least 250 or more preferentially at least 280 contiguous amino-acids of the sequence shown in
• polypeptide has a polypeptidic sequence strictly identical to the sequence of SEQ ID N°l .
• the present invention is also related to a polynucleotide comprising a sequence coding for the polypeptide of the invention.
• polynucleotide refer to a polymer of ribonucleotides (or RNA) or to a polymer of deoxyribonucleotides (or DNA), that is single or double-stranded, optionally containing synthetic, non-natural, or altered nucleotide bases.
• An isolated polynucleotide in the form of DNA may contain one or more segments of synthetic DNA, genomic DNA or cDNA.
• the origin of the polynucleotide is not necessarily the organism where the enzymatic activity is originally measured.
• Hybridization under different conditions of stringency with a probe that comprises the nucleotide sequence of SEQ ID N°2 can be used to screen a gene library for such polynucleotides by the man skilled in the art. Detailled protocols for hybridization are disclosed in Sambrook et al (1989).
• sequences of such polynucleotides can be extracted from the databases using for example the BLAST programs defined above and searching for homology with the nucleotide sequence of SEQ ID N°2.
• Preferred polynucleotides of the present invention are polynucleotides that are at least 80% identical to the nucleotide sequence of SEQ ID N°2. More preferred polynucleotides of the present invention are polynucleotides that are at least 90% identical to the nucleotide sequence of SEQ ID N°2. Even more preferred polynucleotides of the present invention are polynucleotides that are at least 95% identical to the nucleotide sequence of SEQ ID N°2.
• polynucleotide that comprises the nucleotide sequence of SEQ ID N°2 is included in the invention.
• encoding or "coding” refer to the process by which a polynucleotide, through the mechanisms of transcription and translation, produces an amino-acid sequence.
• This process is allowed by the genetic code, which is the relation between the sequence of bases in DNA and the sequence of amino-acids in proteins.
• One major feature of the genetic code is to be degenerate, meaning that one amino-acid can be coded by more than one triplet of bases (one "codon"). The direct consequence is that the same amino-acid sequence can be encoded by different polynucleotides.
• polynucleotide sequences derived from SEQ ID N°2 by degeneracy of the genetic code can also code for the polypeptide sequence of SEQ ID N°l and are therefore contemplated by the present invention. It is well known from the man skilled in the art that the use of codons can vary according to the organisms. Among the codons coding for the same amino-acid, some can be used preferentially by a given microorganism. It can thus be of interest to design a polynucleotide adapted to the codon usage of a particular microorganism in order to optimize the expression of the corresponding protein in this organism.
• the present invention is also related to an expression cassette comprising the polynucleotide of the invention under the control of regulatory elements functional in a host microorganism.
• expression refers to the transcription and translation of a gene sequence leading to the generation of the corresponding protein, product of the gene.
• expression cassette refers to a polynucleotide preferably linked with regulatory elements, such as promoters, enhancers, ribosome binding site or terminator allowing the expression of the gene contained in the polynucleotide inside a suitable host organism.
• regulatory elements can be the own regulatory elements of the gene, but also modified or synthetic elements, to allow a stronger expression of the gene. For example, stronger expression can be obtained by replacing the native promoter of the gene by stronger promoters.
• these promoters are for example : lac promoter, tac promoter, trc promoter and lambda cl promoter.
• the skilled artisan may be able to choose the more adapted promoter.
• host microorganism refers to a microorganism able to receive foreign or heterologous genes or extra copies of its own genes and able to express those genes to produce an active protein product.
• the present invention provides for a transformation vector comprising the polynucleotide or the cassette according to the invention.
• transformation refers to the introduction of new genes or extra copies of existing genes into a host organism.
• the acquired genes may be incorporated into chromosomal DNA or introduced as extra-chromosomal elements.
• electroporation a method for transferring DNA into a host organism is electroporation.
• transformation vector refers to any vehicle used to introduce a polynucleotide in a host organism.
• vehicle can be for example a plasmid, a phage or other elements known from the expert in the art according to the organism used.
• the transformation vector usually contains in addition to the polynucleotide or the expression cassette other elements to facilitate the transformation of a particular host cell.
• An expression vector comprises an expression cassette allowing the suitable expression of the gene borne by the cassette and additional elements allowing the replication of the vector into the host organism.
• An expression vector can be present at a single copy in the host organism or at multiple copies.
• the present invention also provides for a modified microorganism having modulated glyoxalase III activity, wherein activity of the polypeptide of the invention is attenuated or enhanced.
• an "increased enzymatic activity” or an “enhanced enzymatic activity” means that the activity is superior to the original activity measured in the same microorganism before any modification.
• the corresponding non-modified microorganism is a microorganism having the same characteristics of the modified microorganism except for the enzyme activity under consideration.
• the enzyme activity is increased by at least 50 %, preferably by at least 100%, compared to the native activity of the corresponding non-modified microorganism.
• a method for measuring glyoxalase III activity is given in Example 1 below.
• the microorganism according to the invention is selected among the group consisting of bacteria, yeast and fungi.
• the bacterium is selected among the group consisting of
• the bacterium is selected among the group consisting of Escherichia coli, Bacillus subtilis, Clostridium acetobutylicum and Corynebacterium glutamicum.
• Attenuation of the expression of a gene denotes the partial or complete suppression of the expression of a gene, which is then said to be “attenuated”.
• This suppression of expression can be either an inhibition of the expression of the gene, a deletion of all or part of the promoter region necessary for the gene expression, or a deletion in the coding region of the gene.
• the attenuation of a gene is essentially the complete deletion of that gene, which gene can be replaced by a selection marker gene that facilitates the identification, isolation and purification of the strains according to the invention.
• a gene is inactivated preferentially by the technique of homologous recombination (Datsenko, K. A. & Wanner, B. L.,
• the microorganism with attenuated glyoxalase III activity is further modified to enhance production of 1 ,2-propanediol and/or acetol from a source of carbon.
• some enzyme activities involved either in bypass pathways or by-product formation pathways are attenuated in order to increase the yield of 1 ,2-propanediol and/or acetol production from a source of carbon :
• the Entner-Doudoroff pathway provides an alternative way to degrade glucose to glyceraldehyde-3 -phosphate and pyruvate besides glycolysis.
• the attenuation of the Entner-Doudoroff pathway assures that most or at best all glucose is degraded via glycolysis and is utilized for the production of 1 ,2-propanediol.
• lactate dehydrogenase encoded by the gene idhA, catalysing the synthesis of lactate from pyruvate, alcohol-aldehyde dehydrogenase, encoded by the gene adhE, catalysing the synthesis of ethanol from acetyl-CoA and pyruvate formate lyase, encoded by the genes pflA and pflB, catalysing the synthesis of acetyl-CoA and formate from pyruvate.
• at least one of these genes is attenuated.
• the triose phosphate isomerase activity is attenuated. Preferentially, this result is achieved by attenuating the expression of the tpiA gene. More preferentially, the tpiA gene is deleted.
• the tpiA gene encodes the enzyme 'triose phosphate isomerase', which catalyses the conversion of DHAP into glyceraldehyde 3-phosphate. The attenuation of the expression of this gene ensures that half of the glucose metabolized is converted to 1 ,2-propanediol and/or acetol.
• the glyceraldehyde 3 phosphate dehydrogenase activity is attenuated.
• the glyceraldehyde 3-phosphate dehydrogenase also called GAPDH, is one of the key enzymes involved in the glycolytic conversion of glucose to pyruvic acid.
• the attenuation of the enzyme resulted in the redirection of part of the GA3P toward the synthesis of 1 ,2-propanediol and/or acetol.
• the yield of 1 ,2-propanediol over glucose can then be greater than 1 mole / mole.
• the activity of the glyceraldehyde 3-phosphate dehydrogenase is about less than 30% of the usual activity of a wild-type GADPH, more preferably less than 10%.
• the expression of the gapA gene coding for GAPDH is attenuated.
• the efficiency of the sugar import is increased.
• a strong attenuation of the expression of the gapA gene resulting in a decrease of the carbon flux in the GAPDH reaction by more than 50% result in the synthesis of less than 1 mole of PEP per mole of glucose imported.
• PEP is required by the sugar-phosphotransferase system (PTS) normally used for the import of simple sugars into the cell, since import is coupled to a phospho-transfer from PEP to glucose yieding glucose-6-phosphate. Thus reducing the amount of PEP will negatively impact on sugar import.
• PTS sugar-phosphotransferase system
• the sugar might be imported into the microorganism by a sugar import system independent of phosphoenolpyruvate.
• the galactase- proton symporter encoded by the gene gal? that does not involve phosphorylation can be utilized.
• the imported glucose has to be phosphorylated by the glucose kinase activity encoded by the glk gene.
• the expression of at least one gene selected among gaIP and glk is increased.
• the PTS becomes dispensable, it can be eliminated by attenuating at least one gene selected among ptsG, ptsH, ptsl or err.
• Enzyme II codes for the HPr protein
• ptsl codes for the Enzyme I
• err codes for the subunit A of the Enzyme II.
• the efficiency of the sugar- phosphotransferase system is increased by increasing the availability of the metabolite phosphoenopyruvate. Due to the attenuation of the gapA activity and of the lower carbon flux toward pyruvate, the amount of PEP in the modified strain of the invention could be limited, leading to a lower amount of glucose transported into the cell.
• a mean is to attenuate the reaction PEP ⁇ pyruvate.
• at least one gene selected among pykA an ⁇ pykF, coding for the pyruvate kinase enzyme is attenuated in said strain to obtain this result.
• Another way to increase the availability of PEP is to favour the reaction pyruvate ⁇ PEP, catalysed by the phosphoenolpyruvate synthase by increasing the activity of this enzyme.
• This enzyme is encoded by the ppsA gene. Therefore, preferentially in the microorganism, the expression of the pps A gene is preferentially increased. Both modifications can be present in the microorganism simultaneously.
• the synthesis of the by-product acetate is prevented by attenuating at least one enzyme involved in its synthesis It is preferable to avoid such acetate synthesis to optimize the production of 1 ,2-propanediol.
• At least one gene selected among ⁇ ckA,pt ⁇ an ⁇ poxB is attenuated. These genes all encode enzymes involved in the different acetate biosynthesis pathways.
• the enzyme activities are increased by at least 50 %, preferably by at least 100%, compared to the native activity of the corresponding non-modified microorganism.
• the genes coding for these activities are preferentially overexpressed : the mgsA gene, coding for methylglyoxal synthase, yqhD, yq/B, ydfiF, ycdW, yqfiE, yeaE, yghZ, yajO, tas, ydjG, and ydbC, all coding for methylglyoxal reductases, gldA orfucO, coding for 1 ,2-propanediol dehydrogenase.
• Another way to obtain an increased enzymatic activity is to introduce into the gene of interest a specific mutation allowing the translation of a gene product presenting a higher activity than the native protein.
• NADH for the reduction of the precursors into 1 ,2-propanediol is advantageously increased. This is obtained by alleviating the repression on the tricarboxylic acid cycle mediated by the global regulator ArcA (encoded by the arcA gene). NADH concentration in the cell can also be increased by inactivating the NADH dehydrogenase II encoded by the gene ndh. Therefore, preferably, at least one gene selected among arc A and ndh is attenuated.
• the pyruvate dehydrogenase complex (PDC), converting pyruvate into acetyl-coA has low sensitivity to inhibition by NADH.
• Lower sensitivity is defined with reference to the sensitivity of the wild-type enzyme.
• Such characteristic can be obtained by a specific mutation in the lpd gene (coding for the sub-unit lipoamide dehydrogenase of the PDC) resulting in the replacement of alanine 55 in the protein sequence of the enzyme by the residue valine.
• the microorganism designed to produce mainly 1 ,2-propanediol is selected among bacteria, yeasts or fungi. More preferentially, the microorganism is selected among Enterobacteriaceae, Bacillaceae, Clostridiaceae, Streptomycetaceae and Corynebacteriaceae. Even more preferentially, the microorganism is either Escherichia coli or Clostridium acetobutylicum.
• methylglyoxal synthase and methylglyoxal reductase it may be advantageous to increase the specific enzyme activities leading to the formation of this compound : methylglyoxal synthase and methylglyoxal reductase.
• the enzyme activities are increased by at least 50 %, preferably by at least 100%, compared to the native activity of the corresponding non-modified microorganism.
• the genes coding for these activities are preferentially overexpressed : the mgsA gene, coding for methylglyoxal synthase, yqhD, yq/B, ydfiF, ycdW, yqfiE, yeaE, yghZ, yajO, tas, ydjG, and ydbC, all coding for methylglyoxal reductases.
• the combination of the overexpression of the mgsA and yqhD genes is preferentially used.
• acetol for the production of acetol, it is advantageous to prevent the formation of 1 ,2- propanediol from acetol.
• This result can be achieved by attenuating the activity of at least one enzyme involved in the conversion of acetol into 1 ,2-propanediol.
• the expression of the gldA gene is attenuated, more preferentially, the gldA gene is deleted.
• genes whose expression may advantageously be attenuated are the following : pts G, ptsH, ptsl, err, edd, ed ⁇ , gloA, ⁇ ldA, ⁇ ldB, idhA, pflA, pflB, ⁇ dhE, tpiA, gap A, pykA, pykF, ackA, pta,poxB.
• genes whose expression may advantageously be enhanced are the following : galP, glk, ppsA.
• the microorganism designed to produce mainly acetol is selected among bacteria, yeast or fungi. More preferentially, the microorganism is selected among Enterobacteriaceae, Bacillaceae, Streptomycetaceae and Corynebacteriaceae. Even more preferentially, the microorganism is either Escherichia coli or Klebsiella pneumoniae.
• the overexpression is obtained by transforming the organism with the vector of the invention or by integrating the polynucleotide or the cassette of the invention into the chromosome of the organism.
• One single copy or multiple copies of the gene borne by expression vectors or integrated into the chromosome can be introduced in order to modulate the overexpression.
• different kind of promoters inducing different level of expression of the gene can be used.
• the adequate position on the chromosome for the insertion of the new gene can be selected by the expert in the art. This position (or locus) should not affect the essential functions of the host organism.
• This is preferentially obtained by introducing a strong promoter upstream the coding sequence of the native gene.
• other regulatory elements of the gene can be modified. For example, suitable mutations that can be selected by the expert in the field in the upstream region of the gene (start codon, ribosome binding site) can results in increased expression.
• an inducible promoter can be introduced in order to turn on/off the expression of the gene when desired.
• a strong promoter is present upstream to the coding sequence of the native gene coding for the polypeptide according to the invention.
• the present invention is also related to a microorganism with enhanced glyoxalase III activity, which is further modified to enhance production of lactate.
• lactate designates D-lactate and L-lactate and mixtures thereof, including mixtures in different proportions such as 50/50 (racemic mixture), 75/25, 90/10 and 100/0.
• modifications are introduced into the microorganism such as described previously, to enhance specifically the production of lactate.
• the methylglyoxal synthase activity is increased.
• the preferred method is the overexpression of the mgsA gene.
• one or several mutation can be introduced in the mgsA gene in order to increase the methylglyoxal synthase activity under the culture conditions used.
• genes whose expression may advantageously be enhanced are the following : galP, glk, ppsA.
• galP galP
• glk glk
• ppsA ppsA
• Doudoroff pathway encoded by the genes edd and eda is attenuated. Preferentially, at least one of the genes edd or eda is attenuated.
• the Entner-Doudoroff pathway can function as an unwanted bypass of the glycolysis pathway.
• the re-direction of the carbon flux toward the methylglyoxal bypass is advantageous. Therefore, the attenuation of the GAPDH and the features associated (engineering of sugar import or engineering of PEP recycling) are preferentially introduced.
• the phosphotransacetylase and acetate kinase activities responsible for the synthesis of acetate in two steps from acetyl-CoA, encoded respectively by the genes pt ⁇ and ⁇ ckK.
• the pyruvate oxidase activity responsible for the synthesis of acetate in one step from pyruvate, encoded by the genepoxB.
• the attenuation of activity is obtained by the attenuation of at least one of these genes.
• Other potential by-products originating from the methylglyoxal bypass are acetol, lactaldehyde and 1 ,2-propanediol.
• at least one methylglyoxal reductase activity is attenuated.
• a methylglyoxal reductase activity chosen among : yql ⁇ D, yq/B, yqhE, ydhF, ycdW, yeaE, yghZ, yajO, tas, ydjG, ydbC and gldA.
• a methylglyoxal reductase activity chosen among : yql ⁇ D, yq/B, yqhE, ydhF, ycdW,
• the expression or activity at least one enzyme utilizing L-lactate is attenuated. More preferentially, the HdD gene is attenuated.
• genes whose expression may advantageously be attenuated to favour the production of lactate are the following : pts G, pts ⁇ i, ptsl, err, gloA, aldA, aldB, gapA, pykA, pykF ' , tpiA.
• the microorganism designed to produce lactate is selected among bacteria, yeasts or fungi. More preferentially, the microorganism is selected among Enterobacteriaceae, Bacillaceae, Streptomycetaceae and Corynebacteriaceae. Even more preferentially, the microorganism is either from the species Escherichia coli, Bacillus subtilis or Corynebacterium glutamicum.
• the present invention provides for a method for modulating the glyoxalase III enzymatic activity in a microorganism, wherein activity of the polypeptide of the invention is enhanced or attenuated in said microorganism.
• the glyoxalase III enzymatic activity is enhanced by overexpressing the polynucleotide of the invention.
• the glyoxalase III enzymatic activity is attenuated by attenuating the expression of the polynucleotide of the invention.
• the invention is also related to a method for preparing 1 ,2-propanediol and/or acetol, wherein a microorganism according to the invention is grown in an appropriate culture medium comprising a source of carbon, and the produced 1 ,2-propanediol and/or acetol is recovered.
• the production of 1 ,2-propanediol is performed under aerobic, microaerobic or anaerobic conditions.
• the production of acetol is performed under aerobic or microaerobic conditions, preferentially under aerobic conditions.
• carbon substrate or “source of carbon” means any carbon source capable of being metabolized by a microorganism wherein the substrate contains at least one carbon atom.
• Authors refer particularly to renewable, inexpensive and fermentable carbon source such as monosaccharides, oligosaccharides, polysaccharides, single-carbon substrates, and polyols such as glycerol. Saccharides of the formula (CH 2 O) n are also called oses or "simple sugars"; monosaccharides include fructose, glucose, galactose and mannose. Other carbon sources are disaccharides, trisaccharides, oligosaccharides and polysaccharides. Disaccharides include saccharose (sucrose), lactose and maltose. Starch and hemicellulose are polysaccharides, also known as "complex sugars”.
• the recovered 1 ,2-propanediol and/or acetol is furthermore purified.
• the invention is also related to a method for preparing lactate, wherein a microorganism according to the invention is grown in an appropriate growth medium containing a carbon source, and the lactate is recovered.
• the production of lactate is performed under aerobic, microaerobic or anaerobic conditions, preferentially under aerobic conditions.
• the recovered lactate is furthermore purified.
• bacteria are fermented at temperatures between 20 0 C and 55°C, preferably between 25°C and 40 0 C, and preferably at about 35°C for C. acetobutylicum and at about 37°C for E. coli and K. pneumoniae.
• This process can be carried out either in a batch process, in a fed-batch process or in a continuous process.
• Under aerobic conditions means that oxygen is provided to the culture by dissolving the gas into the liquid phase. This could be obtained by (1) sparging oxygen containing gas (e.g. air) into the liquid phase or (2) shaking the vessel containing the culture medium in order to transfer the oxygen contained in the head space into the liquid phase.
• oxygen containing gas e.g. air
• Advantage of the fermentation under aerobic conditions instead of anaerobic conditions is that the presence of oxygen as an electron acceptor improves the capacity of the strain to produce more energy in form of ATP for cellular processes. Therefore the strain has its general metabolism improved.
• Micro-aerobic conditions are defined as culture conditions wherein low percentages of oxygen (e.g. using a mixture of gas containing between 0.1 and 10% of oxygen, completed to 100% with nitrogen), is dissolved into the liquid phase.
• Anaerobic conditions are defined as culture conditions wherein no oxygen is provided to the culture medium. Strictly anaerobic conditions are obtained by sparging an inert gas like nitrogen into the culture medium to remove traces of other gas. Nitrate can be used as an electron acceptor to improve ATP production by the strain and improve its metabolism.
• appropriate growth medium denotes a medium of known molecular composition adapted to the growth of the micro-organism.
• a mineral culture medium of known set composition adapted to the bacteria used containing at least one carbon source.
• the mineral growth medium for E. coli or K. pneumoniae can thus be of identical or similar composition to M9 medium (Anderson, 1946, Proc. Natl. Acad. ScL USA 32:120-128), M63 medium (Miller, 1992; A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York) or a medium such as that defined by Schaefer et al. (1999, Anal. Biochem. 270: 88-96).
• the carbon source used for the culture of E. coli or K. pneumoniae is preferentially a simple carbon source and can be arabinose, fructose, galactose, glucose, lactose, maltose sucrose or xylose.
• An especially preferred simple carbon source is glucose.
• the invention is described above, below and in the Examples with respect to E. coli.
• the genes that can be attenuated, deleted or over-expressed for the initial and evolved strains according to the invention are defined mainly using the denomination of the genes from E. coli.
• this designation has a more general meaning according to the invention, and covers the corresponding genes in other micro-organisms.
• GenBank references of the genes from E. coli those skilled in the art can determine equivalent genes in other organisms than E. coli.
• the means of identification of the homologous sequences and their percentage homologies are well-known to those skilled in the art, and include in particular the BLAST programmes that can be used on the website http://www.ncbi.nlm.nih. gov/BLAST/ with the default parameters indicated on that website.
• the sequences obtained can be exploited (aligned) using for example the programmes CLUSTALW (http://www.ebi.ac.uk/clustalw/), with the default parameters indicated on these websites.
• the PFAM database protein families database of alignments and hidden Markov models http://www.sanger.ac.uk/Software/Pfam/) is a large collection of alignments of protein sequences. Each PFAM makes it possible to visualise multiple alignments, view protein domains, evaluate distributions among organisms, gain access to other databases and visualise known protein structures.
• COGs clusters of orthologous groups of proteins http://www.ncbi.nlm.nih.gov/COG/
• COGs are obtained by comparing protein sequences derived from 66 fully sequenced unicellular genomes representing 14 major phylogenetic lines.
• Each COG is defined from at least three lines, making it possible to identify ancient conserved domains.
• Altaras NE and Cameron DC (1999), Appl. Environ. Microbiol. 65 : 1180-1185 17.
• Altaras NE and Cameron DC (2000), Biotechnol. Prog. 16 : 940-946
• Zhao Y Liu D, Kaluarachchi WD, Bellamy HD, White MA, Fox RO (2003) Protein Science 12 : 2303-2311 28.
• Malki A Kern R, Abdallah J, Richarme G (2003), Biochem. Biophys. Res. Com. 301 : 430-436
• Lane 1 Fraction of Gel filtration column containing the glyoxalase activity
• Lane 2 Molecular weight marker
• EXAMPLE 1 Purification of glyoxalase III activity in E. coli PG0016 and identification of the encoding gene
• Protocol 1 Elimination of resistance cassettes (FRT system)
• the chloramphenicol and/or kanamycin resistance cassettes were eliminated according to the following technique.
• the plasmid pCP20 carrying the FLP recombinase acting at the FRT sites of the chloramphenicol and/or kanamycin resistance cassettes was introduced into the strain by electroporation. After serial culture at 42°C, the loss of the antibiotic resistance cassettes was checked by PCR analysis with the oligonucleotides given in Table 1.
• the strain obtained was named E. coli MGl 655 Ipd*, AtpiA, ApflAB, AadhE, ldhA::Km, AgIoA, AaIdA, AaIdB, Aedd Table 1 : Oligonucleotides used for checking the insertion of a resistance cassette or the loss of a resistance cassette
• the chloramphenicol resistance cassette was inserted into the ldhA gene deleting most of the gene concerned according to Protocol 2.
• Protocol 2 Introduction of a PCR product for recombination and selection of the recombinants (FRT system).
• the oligonucleotides chosen and given in Table 2 for replacement of a gene or an intergenic region were used to amplify either the chloramphenicol resistance cassette from the plasmid pKD3 or the kanamycin resistance cassette from the plasmid pKD4 (Datsenko, K.A. & Wanner, B.L. (2000)).
• the PCR product obtained was then introduced by electroporation into the recipient strain bearing the plasmid pKD46 in which the system ⁇ Red ( ⁇ , ⁇ ,.exo) expressed greatly favours homologous recombination.
• the antibiotic-resistant transformants were then selected and the insertion of the resistance cassette was checked by PCR analysis with the appropriate oligonucleotides given in Table 1.
• the resulting strain was named E. coli MGl 655 Ipd*, AldhAwCm, AtpiA, ApflAB, AadhE, AgIoA, AaIdA, AaIdB, ⁇ e ⁇ / or PG0016.
• the glyoxalase III enzyme activity was determined in vitro in E. coli cell-free extracts. Biomass harvested by centrifugation was resuspended in 100 mM Potassium Phosphate buffer pH 7.6, 10% sucrose, ImM DTT, O.lmM PLP, ImM EDTA, and a protease inhibitor cocktail (Roche) and sonicated on ice (Branson sonif ⁇ er, 70W) during four cycles of 30 sec with 30 sec intervals. After centrifugation, the supernatant corresponding to the crude extract was desalted using an Econo-Pac 10 DG column (BioRad). Protein concentration in the desalted supernatant was measured by a Bradford colorimetric assay (Bradford, 1976).
• One hundred ⁇ L of desalted extract were incubated during either 5 or 30 minutes at 37°C in a reaction mix containing 50 mM Potassium phosphate pH 8 and 5 mM methylglyoxal in a total volume of 250 ⁇ L. After the incubation time, ImI of -20 0 C acetone was then added as well as 100 ⁇ L of the internal standard L-Serine[l-13C] at a concentration of 1.5 M in a total volume of 1.5 mL. The reaction mix were incubated at -20 0 C for 30 min and centrifugated for 5 min at 1000Og.
• the supernatants were frozen at -80 0 C and lyophilized overnight.
• the dried samples were silylated by the addition of 0.5 ml hydroxylamine 20% (diluted in pyridine) and incubated for lh30 at 30 0 C followed by the addition of 0.5 ml tert- butyldimethylsilyltrifluoroacetamide (TBDMSTFA) and 0.5ml of pyridine and incubation for lhour at 60 0 C.
• the samples were analyzed by GC-MS (Agilent GC6890-MS5973, column Varian
• DB5MS DB5MS
• the quantity of lactate produced by the Glyoxalase III enzyme after 5 min and 30 min was measured by using a standard curve of lactate (0 to 33 ⁇ M).
• the total activity (nmoles/min) in the crude extract was calculated using the quantity of lactate produced between 5 and 30 min.
• the protein concentration was used to determine the specific activity in nmoles/min/mg (mUI/mg).
• the strain PGOO 16 was cultivated in a 21 batch fermenter with a 1.4 1 working volume.
• the culture medium was based on a minimal medium with 10 g/1 glucose supplemented with yeast extract.
• the temperature of the culture was maintained constant at 37 0 C and the pH was permanently adjusted to 6.8 using an NH 4 OH solution.
• the agitation rate was adjusted according to the oxygen demand.
• the concentration of dissolved oxygen is maintained at values between 30 and 40% saturation by using a gas controller.
• the optical density reached a value of 2
• the culture was stopped and the biomass was recovered by centrifugation. All chromatographic columns were run at room temperature. Fractions were stored at -
• Step 1 Preparation of cell-free extracts
• PGOO 16 E. coli biomass were resuspended in 48 ml of 100 mM Potassium Phosphate buffer pH 7.6, 10% sucrose, ImM DTT, 0.ImM PLP, ImM EDTA, and a protease inhibitor cocktail.
• Cells were sonicated on ice (Branson sonifier, 70W) during four cycles of 30 sec with 30 sec intervals.
• the suspension was treated with DNase I (100U/ml) and ImM MgCl 2 for 30 min at room temperature under stirring. Cell debris were removed by centrifugation at 1200Og for 30 min.
• the crude extract was desalted using an Econo-Pac 10 DG column (BioRad).
• the dialysed pool was applied to a 1ml Resource Q column (GE Healthcare) equilibrated with 20 mM Tris buffer pH8, ImM DTT, 10% sucrose. The column was then washed with 10 column volumes of the same buffer. Proteins were eluted with a linear gradient from 0 M to 0.5 NaCl of 20 column volumes. The column was washed with 10 column volumes of 20 mM Tris pH8, ImM DTT, 10% sucrose IM NaCl. The flow rate of the column was 1 ml/min and 0.5 ml fractions were collected. Fractions from Resource Q column were assayed for glyoxalase III activity. The protein was eluted with 190 mM NaCl. The most active fraction was concentrated for gel filtration. The glyoxalase III specific activity of this fraction was 1594 mUI/mg.
• Step 5 Gel filtration The concentrated fraction from the Resource Q column was loaded onto a Superdex 200
• the region of the gel corresponding to the protein at 3OkDa was cut off using a sterile pipette tip. This gel plug was then used for identification of proteins by mass spectroscopy. The sample was subjected to trypsin digestion and analyzed by nano LC/MS/MS on a
• EXAMPLE 2 Modulation of glyoxalase III activity in E. coli
• the resulting strain E. coli MGl 655 Ipd*, AtpiA, ApflAB, AadhE, AldhA AgIoA, AaIdA, AaIdB, Aedd was named PG0021.
• the deletion of the chosen gene by replacement of the gene by a resistance cassette (kanamycin or chloramphenicol) in the recipient E. coli strain was performed by the technique of transduction with phage Pl.
• the protocol was in two steps, (i) the preparation of the phage lysate on the strain MGl 655 with a single gene deleted and (ii) the transduction of the recipient strain by this phage lysate.
• Tube test 100 ⁇ l of cells + 100 ⁇ l phages Pl of strain MG1655 with a single gene deleted. Incubation for 30 min at 30 0 C without shaking. Addition of 100 ⁇ l sodium citrate 1 M in each tube, and vortexing. Addition of 1 ml of LB. - Incubation for 1 hour at 37°C with shaking
• the antibiotic-resistant transformants were then selected and the insertion of the deletion was checked by a PCR analysis with the appropriate oligonucleotides given in Table 1.
• the other modifications of the strain were checked with the oligonucleotides given in
• the resulting strain was named E. coli MGl 655 Ipd*, AldhA, AtpiA, ApflAB, AadhE, AgIoA, AaIdA, AaIdB, Aedd, AyedUwcm (PG0021 AyedUwcm)
• the glyoxalase III activity of the parent strain PG0021 was 24 mUI/mg whereas the glyoxalase III activity of the strain PG0021 AyedU was 4 mUI/mg.
• the deletion of the yedU gene almost abolished the glyoxalase III activity of strain PG0021.
• the plasmid pMElOl was constructed as follows.
• the plasmid pCL1920 (Lerner & Inouye, 1990, NAR 18, 15 p 4631 - GenBank AX085428) was PCR amplified using the oligonucleotides PMElOlF and PMElOlR and the BstZllI-Xmnl fragment from the vector pTrc99A (Amersham Pharmacia Biotech, Piscataway, NJ) harboring the lad gene and the trc promoter was inserted into the amplified vector.
• PMElOlF (SEQ ID N 0 29): ccgacagtaagacgggtaagcctg
• yedU was PCR amplified from genomic DNA of E. coli MGl 655 using the following oligonucleotides: yedUF2, consisting of 34 bases (SEQ ID N° 31): catgtcatgactgttcaaacaagtaaaatccgc with: - a region (underlined letters) homologous to the sequence (2033857-2033884) of the gene yedU, and
• restriction site BspHl (bold face letters) yedUR2, consisting of 28 bases (SEQ ID N°32): CTAcccgggCATAGGGCTTCAGTACGCC with:
• the PCR amplified fragment was cut with the restriction enzymes BspHl and Smal and cloned into the Ncol I Smal sites of the vector pMElOl.
• the resulting plasmid was named pMElOl- yedU.
• the plasmid pME101-yedU was introduced by electroporation into the strain E. coli MG1655.
• the strain obtained was named E. coli MG1655 ( ⁇ MElQl -yedU).
• the E. coli strain MG1655 (pME101-je ⁇ J) and the control strain E. coli MG1655 were cultivated at 37°C under aerobic conditions in 500 ml baffled Erlenmeyer flasks in minimal medium with 10 g/1 glucose and buffered with MOPS. The pH was adjusted at 6.8 and 100 ⁇ M IPTG was added at the beginning of the cultures. The flasks were agitated at 200 rpm on an orbital shaker. The biomass was harvested by centrifugation when the cultures reached an optical density measured at 550 nm above 7 units. Cell-free extracts were prepared and glyoxalase III activity assays were carried out as described previously.
• the glyoxalase III activity of the MGl 655 strain was 8 mUI/mg whereas the glyoxalase III activity of the MGl 655 strain overexpressing yedU was 142 mUI/mg.
• the glyoxalase III activity was increased 18 fold by overexpression of the yedU gene.
• the PCR amplified fragment was cloned into the commercial vector pETTOPO (Invitrogen).
• the resulting plasmid was named pETTOPO-yedU.
• the plasmid pETTOPO-jei ⁇ J was introduced by electroporation into the commercial strain E. coli BL21 star (Invitrogen), optimized for protein overexpression.
• the strain obtained was named E. coli BL21 star pETTOPO- yedU.
• the E. coli strain BL21 star PETTOPO-jei ⁇ J and the control strain E. coli BL21 star were cultivated at 37 0 C under aerobic conditions in 500 ml baffled Erlenmeyer flasks with 50 ml LB medium with 2.5 g/1 glucose. The flasks were agitated at 200 rpm on an orbital shaker. The temperature was decreased at 25°C when the optical density (OD, measured at 550 nm) of the culture reached 0.8 OD units. The cultures were induced with 500 ⁇ M IPTG when the OD reached 2.4 units. The biomass was harvested by centrifugation when the cultures reached an OD above 3.5 units.
• the strains built previously with a deletion in the yedU gene (AyedU strain) and without a deletion (Control strain) were cultivated for 25 hours under microaerobic conditions (70 ml closed Erlenmeyer flask filled with 21 ml of medium) in the medium given below with glucose as carbon source. The flasks were agitated at 200 rpm on an orbital shaker.
• n is the number of repetitions of the same experiment.
• EXAMPLE 4 Production of lactate under microaerobic conditions in an E. coli strain overexpressing the yedV gene.
• the plasmid pME101-VB01 was built according to the description given in patent application WO 2008/116848.
• the gene yedU was PCR amplified from genomic DNA of E. coli MGl 655 using the following oligonucleotides: yedUF3 , consisting of 34 bases (SEQ ID N° 35): catgtcatgactgttcaaacaagtaaaatccgc with: - a region (underlined letters) homologous to the sequence (2033857-2033884) of the gene yedU, and
• strain obtained were named respectively E. coli MGl 655 Ipd* AtpiA ApflAB AadhE AldhA AgIoA AaIdA AaIdB Aedd AyqhDy.Km pMElOl-VBOl-yedU (Strain 1) or E. coli MG1655 Ipd* AtpiA ApflAB AadhE AldhA AgIoA AaIdA AaIdB Aedd AyqhDy.Km pME101->>e ⁇ i£/(Strain 2).
• strains built previously with overexpression of the yedU gene (Strain 1 and Strain 2) and without overexpression (Control strain) were cultivated for 46 h under microaerobic conditions (70 ml closed Erlenmeyer flask filled with 21 ml of medium) in the medium PGOl MC VOl (see Example 3) with glucose as carbon source.
• the flasks were agitated at 200 rpm on an orbital shaker.
• the culture was carried out at 37°C and the pH was maintained by buffering the culture medium with MOPS.
• the cultures of strain 1 and strain 2 were induced with 100 ⁇ M IPTG at the beginning of the culture in order to induce the expression of the yedU gene.
• lactate and residual glucose in the fermentation broth were analysed by HPLC and the yields of lactate over glucose were calculated. The results are given in the table below.
• n is the number of repetitions of the same experiment.

Landscapes

• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• General Engineering & Computer Science (AREA)
• Microbiology (AREA)
• Biotechnology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Medicinal Chemistry (AREA)
• Molecular Biology (AREA)
• Biomedical Technology (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Priority Applications (1)

Applications Claiming Priority (3)

Publications (1)

Family

ID=43234226

Family Applications (1)

Country Status (1)

• 2009
  • 2009-03-16 EP EP09723245A patent/EP2265716A1/de not_active Withdrawn

Non-Patent Citations (1)

Similar Documents

Legal Events