EP2245051A1

EP2245051A1 - Fusion polypeptides comprising a shbg dimerization component and uses thereof

Info

Publication number: EP2245051A1
Application number: EP08864595A
Authority: EP
Inventors: Nicholas Hunt; Tom Krietsch; Birgit Engeland; Monika Heibey
Original assignee: Altonabiotec AG
Current assignee: Altonabiotec AG
Priority date: 2007-12-21
Filing date: 2008-12-22
Publication date: 2010-11-03
Also published as: EP2072527A1; WO2009080816A1

Abstract

The present invention relates to fusion polypeptides comprising a physiologically active component and a dimerization component, wherein said dimerization component is derived from sex hormone-binding globuline (SHBG). The invention further relates to nucleic acid molecules encoding the fusion polypeptides and to use of these polypeptides for treatment of various diseases.

Description

FUSION POLYPEPTIDES COMPRISING A SHBG DIMERIZATION COMPONENT AND USES THEREOF

The present invention relates to fusion polypeptides comprising a physiologically active component and a dimerization component, wherein said dimerization component is derived from sex hormone-binding globulin (SHBG) . The invention further relates to nucleic acid molecules encoding said fusion polypeptides as well as methods of producing the fusion polypeptides. The fusion polypeptides of this invention are useful in the field of diagnostics and therapy.

BACKGROUND OF THE INVENTION

Physiologically active proteins or polypeptides can be useful for therapy and diagnosis of a large number of diseases and disorders. The efficiency of such physiologically active proteins depends on parameters like stability and half life of the biological molecule in biological fluids such as serum.

In many cases the physiological activity of the protein comprises binding to a particular target molecule. One example of such physiologically active proteins are soluble tumor necrosis factor (TNF) receptor proteins which can be used to reduce elevated TNF concentrations peculiar to several diseases like auto immune diseases (US-B-6440693; EP-A-0418014; WO-A-98/01555 ; WO-A-92/07076) . The relatively small mass of soluble TNF receptor proteins and associated fast clearance from blood circulation result in low total dose accumulation (Osborn et al, 2002) .

This problem can partly be solved by fusing the physiologically active polypeptide to a carrier polypeptide. Approaches using human serum albumin or a fragment of human serum albumin as a carrier protein demonstrated that the resulting physiologically active fusion protein has a prolonged shelf life, an increased plasma stability and is more stable in solution (see e.g. US-A-2007/0048282 ) . These molecules are monomers and may not show sufficiently strong binding to the target molecule due to the lack of avidity compared to multivalent or multimer fusion proteins, especially when binding to multimeric ligands and ligands with multiple binding sites, respectively.

Another approach uses recombinant antibody molecules having the physiologically active substance substituted for the variable domains of the immunoglobulin molecule heavy and light chains (see WO-A-94/06476) , WO-A-96/003141, EP-A-0939121, EP-A-0464533, and WO-A-91/008298) .

This approach provides a dimeric platform structure, but has the disadvantage of very complex recombinant fusion proteins, which are typically characterised by low yields in most expression systems, and usually require expression in mammalian cells.

A third approach uses fusion to other, mostly human proteins forming multimers: hcG / Share (WO-A-97/030161, WO-A-2007/047829 and WO-A-2007/062037, ) OPG (WO-A-98/049305, ) , collagen (WO-A-05/047850) , fibritin (WO-A-2008/025516, ) , and the homotrimeric protein tetranectin (WO-A-2004/039841) . Tetranectin is physiologically present in blood plasma, but also in the extracellular matrix during embryogenesis, tissue healing and cancer. The physiological role of this protein or its fragments is still not fully determined, as its distribution between tissue and blood stream. Hence the consequences of using tetranectin especially as a carrier for long-term applications are not predictable. WO-A-2006/053568 demonstrates experimentally the TNF binding function of the extracellular domain of the TNF receptor IB (TNFRSFlB, p75) comprising four cystein rich domains (CRD) I-IV fused to a trimerising domain derived from tetranectin. Furthermore several fusion variants between fragments of the extracellular domain of TNFRSFlB and the tetranectin derived trimerisation domain are diclosed, but not shown experimentally to be active .

Another approach uses a hybrid protein which includes two coexpressed amino acid sequences forming a dimer derived from a heterodimeric proteinaceous hormone such as hCG (WO-A-97/30161 WO-A-2007/047829, and WO-A-2007/062037) , but expression of these fusion proteins was only disclosed for mammalian cells. Furthermore, heterodimers are only advantageous if two different molecular entities need to be dimerized. In all other cases, homodimers are produced more easily.

To solve these problems, the disclosed SHBG fusion polypeptide can be produced in both, eukaryotic and procaryotic cells as monomeric polypeptide. Subsequent spontaneous dimerisation of the polypeptides constitutes dimeric ligands or soluble receptors to improve binding. This feature may also enable or simplify production in yeast or transgenic plants or animals.

Multimerising peptides are also used as a carrier for miniantibodies . Use of a multimeric platform can be advantageous in two ways. Firstly, physiologically active components consisting of two or more subunits can be applied in a multimeric form. Secondly, combinations of physiologically active components can be applied.

One approach uses peptides capable of dimerisation carrying a Fv-fragment of a recombinant antibody on at least one of the two monomeric fusion proteins (see EP-A-0654085) . These peptides are derived from proteins, which do not naturally occur in blood plasma (Pack et al . , 1995) .

Another approach uses at least the variable region of a heavy or a light chain fused to a non-Ig protein which is capable to dimerize. This fusion protein is coexpressed with the complementary light or heavy chain in a mammalian cell line to obtain a chimeric antibody. The dimerising polypeptide substitutes not only the Fc region but may display additional functional activity, too (EP-A-0194276) .

Another approach uses recombinant antibodies and engineered variants thereof as binders for target molecules. Antibodies and their engineered variants binding to human TNF and reducing elevated TNF levels are disclosed, for example, in US-A-6, 451, 983, WO-A-92/011383, US-A-6, 277 , 969, US-A-6,284,471, US-B-6, 790 , 444 , US-B-6, 835, 823, US-B-6, 991 , 791 and US-B-7, 138, 118, WO-A-97/029131, WO-A-2006/014477, WO-A- 06/ 131013.

Various methods to obtain antibodies specific for a particular target were developed. Immunization of mice or other animals leads to the generation of antibodies which can be isolated from their serum. Animal cells producing monoclonal antibodies can also be isolated by various methods. Kδhler and Milstein developed the Hybridoma Technology to generate an immortalized cell line producing these monoclonal antibodies.

Patients receiving long-term therapies using mouse monoclonal antibodies regularly react with the production of human anti mouse antibodies (HAMA) and hypersensitivity reactions which contraindicate further therapy with the antibody or antibody fragment (Saif et al 2008) .

Chimaeric, humanized or fully human recombinant antibodies may reduce or prevent hypersensitivity reactions, but they are also large macromolecules of complicated structure and need to be procuced in mammalian cells (Smith et al . , 2004) .

Several attempts were made to allow more easy production of antibody fragments in bacteria. One approach uses mono and multivalent single chain Fv antibodies formed by association of the immunoglobulin heavy and light chain variable domains, V_H and V_L, respectively, produced in E.coli (see e.g. WO-A-04/024771) .

Another approach uses variable domains of the heavy or the light chain of an immunoglobulin. These single domain antibodies can be mutated to improve the solubility of the ligand, to improve ligand binding ability or to increase the yields of expression (WO-A-90/05144) .

Heavy chain only or VHH single chain antibodies, produced by some species such as camels, llamas and other camelids, ratfish and wobbegongs are the smallest naturally occuring antibodies and are devoid of light chains. Due to the lack of the CHl region no cysteine residues for disulfide bonding of the light chains are present. These unusual antibodies are the basis for further approaches to solve problems which are associated with the production and application of 4-chain- antibodies consisting of four polypeptide chains.

Heavy chain only antibodies (HAbs) are generated by assembly of two Ig heavy chain molecules consisting of a VH domain, a CH2 domain and a CH3 domain. HAbs usually are bivalent and mono-specific having two identical VHs attached to the CH2 domain. Addition of two more of the VH domains to each CH3 domain results in tetravalent mono-specific antibodies, whereas attachment of a different VH domain to each CH3 domain results in tetravalent bi-specific antibodies. (WO-A-02/085945) . The production of VHH single chain antibodies in transgenic mammals are described in WO-A-02/085945 and WO-A-2007/096779.

Camelids produce likewise heavy chain only antibodies which lack a CHl domain and a hydrophobic patch in the variable region . Based on llama antibodies another approach uses soluble heavy chain antibodies which are derived from an expression library comprising nucleic acid sequences encoding variable domains of heavy chain antibodies from non-immunised llamas. The sequences of the complement determining regions (CDRs) may be diversified by point mutations or by novel combinations of the CDR repertoire (WO-A-00/43507 ; WO-A-94/004678.

Another approach uses polypeptides derived from single domain heavy chain antibodies (see WO-A-04/041862) . These domain antibodies consist of the variable region of heavy chain antibodies from camelids. They are the smallest antibody- derived binding molecules having only one tenth of the size of a conventional IgG. Due to their small size, domain antibodies are easy to produce, but are subjected to fast clearance from blood circulation (Osborn, 2002) . In addition, they are monomeric and do not benefit from the bivalent structure 4- chain-antibodies display.

Moreover, the non-antigen-binding region of the Fc portion has functional properties like receptor-mediated phagocytosis and complement activation which may or may not be desirable in particular fields of application (Mix et al 2006) .

SUMMARY OF THE INVENTION

The present invention provides an alternative way to obtain dimeric proteins and offers important advantages. The invention comprises the use of the dimerization domain of human Sex Hormone-Binding Globulin (SHBG) , which is a natural, non-immunoglobulin and constitutively expressed serum protein. It forms tightly bound, non-covalent homodimers displaying long-term stability. The main objective of the invention is therefor a fusion polypeptide comprising a physiologically active component, and a dimerization componant derived from SHBG, which is capable of forming homodimers. To solve problems listed above, according to the invention human or humanised antigen-binding Ig fragments may be fused to the disclosed SHBG fusion polypeptide.

Size

The size of a therapeutic molecule is associated with several properties .

Firstly, many of the physiologically active fusion polypeptides have a relatively high molecular mass which may lead to low yield of physiologically active fusion protein in cellular expression system. Secondly, the higher the molecular mass of a polypeptide, the slower it usually penetrates into the disease tissue.

On the other hand a molecular mass exceeding the average size exclusion of the renal filtration barrier is often desirable to keep the molecule in the blood circulation for a prolonged time of up to several weeks and to extend injection or infusion intervals of the therapeutic protein.

Avidity

Multimeric proteins show a significantly greater availability for ligand binding. This has been shown for antibodies which consist of two monomers. It has been shown that complete antibody molecules which are dimers (two monomers in complex) have 5-30-fold increases in avidity over monomer antibody fragments (e.g. Pack et al, 1995) .

Another example is the trimeric protein TNF alpha, which has three interaction sites for the binding to the trimeric TNF receptor. The inhibitory effect of soluble receptors targeting TNF alpha depends on the avidity of the binding molecule.

Differences in the molecular mass of the physiologically active component obviously change the mass of the therapeutic molecule. A platform system with broad variability in molecular mass of linker and multimerising platform has great advantages for adjustment of retention time and size.

Retention time and stability

Especially for the therapy of chronic diseases, a high stability and accompanied elongated retention time is desirable. The molecular mass is one determinative factor, another is the stability. A dimeric therapeutic protein needs to keep its dimeric state for a sufficient time to mediate its effects .

The stability of a complex can be characterised by its dissociation constant (Kd) . SHBG has a remarkable low Kd of 10^" ¹² to ICT¹¹ M, determined by a study of the interaction between [125I]SHBG and unlabeled SHBG immobilized on agarose (incorporated by reference: Strelchyonok and Avvakumov, 1990), which constitutes the high stability of the dimer. The low dissociation constant further suggests, that at physiological concentrations of around 10^"7 M (Westphal, 1986) SHBG exists almost exclusively as a dimer.

For comparison: The dissociation constant for the strong binding between biotin and avidin is 1 x 10^~15 M, dissociation constant for the binding of a transcription factor to DNA is in the range of 1 x 10^~10 M and SHBG binds the sex hormones testosterone, 5α-dihydrotestosterone and estradiol with dissociation constants of 3,6 x 10^~9, 1 x 10^~9 and 16,7 x 10^~9 M, respectively.

Antigenicity

Typically, the antigenicity of the construct is critical for two reasons. The non-physiological occurrence of the scaffold protein in the blood plasma and the non-physiological combination of the physiologically active polypeptide and the carrier molecule can lead to increased antigenicity of the construct .

In the case of mouse monoclonal or chimeric (mouse / human) antibodies occurrence of hypersensitivity reactions is a frequent consequence leading to immediate termination of the treatment .

The dimerisation domain of SHBG used according to the invention is constitutively present in human circulation. Its antigenicity is expected to be low even if being an element of a fusion protein. This expectation is supported by the fact that Etanercept, a fusion protein of a fragment of the human TNFRSFlB and the Fc part of a human IgG, provoques less immune reactions than other biologies targeting TNF.

Production

Protein expression can be performed in prokaryotic and eukaryotic host cells. A typical prokaryotic expession can be performed as follows. Competent B121 (DE3) cells are transformed with an appropriate expression vector, for example pET24a, containing the nucleic acid encoding the desired protein. Host cells are grown in LB medium with 50 mg/1 kanamycin sulfate at 37°C to an optical density at 600 nm wavelength (OD₆oo) of approximately 0,2. Protein expression isinduced with ImM IPTG (Isopropyl-β-D-thiogalactopyranosid) and cells are grown for another 4 hours to an OD₆oo of approximately 3,0. Cells are harvested by centrifugation and resuspended in an appropriate buffer. Cells are lysed by sonication and protein is denatured and renatured in appropriate buffer systems and harvested by centrifugation. The expressed protein is purified using an affinity column and subsequent elution of the bound protein.

A typical eukaryotic expression can be performed as follows. l,5*10⁶ CHO DG44 cells, dihydrofolate reductase deficient (dhfr ) derivates of Chinese Hamster Ovary (CHO) cells, were transfected with an appropriate expression vector, for example pcDNA3, containing the nucleic acid encoding the desired protein using the Lipofectamine / Optimem method. After cultivation of the cells for 20 days protein was enriched from the cell suspension by batch elution with Concanavalin A Sepharose 4B, Sigma-Aldrich. The expressed protein is purified using an affinity column and subsequent elution of the bound protein .

In all cellular systems (from prokaryotes to eukaryotes) , proteins that are destined for export into the extracellular space often exhibit multiple disulfide bonds with complex folding patterns. Having multiple disulfide bridges stabilizes the secondary and tertiary structures of these secreted proteins, conferring a stability advantage in the harsher microenvironment outside the intracellular compartment.

Native disulphide bond formation is a complex process. Disulphide bonds must not only be formed (oxidation) , but also incorrect bonds must be broken (reduction) or rearranged

(isomerization) (Lars Ellgaard & Lloyd W. Ruddock EMBO reports

(2005) 6, 28-32) .

Expression of proteins with disufide bonds in prokaryotic systems leads to insoluble recombinant protein in inclusion bodies, whereas the eukaryotic cells are strongly burdened with the production of these proteins (for a review, see Tu & Weissman, 2004) .

Thus, there is a need for physiologically active fusion polypeptides which do not exhibit the above drawbacks and which provide stable physiologically active fusion polypeptides .

These problems are solved by the nucleic acid molecules of the present invention and the fusion polypeptides encoded by them. Detailed description

According to one aspect of the present invention a nucleic acid molecule encoding a fusion polypeptide, except the nucleic acid molecule consisting of a nucleic acid encoding a peptide having at least parts of the sex hormone-binding globulin (SHBG) sequence, SEQ ID NO:1 and a nucleic acid encoding a peptide having at least parts of a glutathione-S- transferase sequence or androgen-binding protein (ABP) , which fusion polypeptide comprises the following fusion polypeptide components:

(a) a physiologically active polypeptide component; and

(b) a polypeptide dimerization component,

wherein the polypeptide dimerization component (b) forms dimers with the polypeptide dimerization component (b) comprised in another of said fusion polypeptides, wherein said polypeptide dimerization component is derived from Sex Hormone-Binding Globulin (SHBG) with the proviso that the polypeptide dimerization component exhibits a binding affinity to a human steroid hormone weaker than human SHBG, in particular a dissociation constant higher than 10^~8 M. The binding affinity can be determined for example as a ratio of the concentration of steroid competitor resulting in a 50% reduction in specific binding of [3H] dihydrotestosterone (DHT) to the concentration of DHT required to produce the same effect as incorporated by reference Grishkovskaya et al, 2002) .

The term "derived from" relates to polypeptides which may differ from the original polypeptide by the addition, deletion, substitution or insertion of amino acids, or by the linkage of other molecules to the encoded polypetide without losing the function of the original polypeptide. The sex hormone-binding globulin (SHGB) transports testosterone, 5α-dihydrotestosterone and estradiol in the blood. SHBG binds C19 androgen metabolites, 5CC-androstan- 3β,17β-diol, 5α-androstan-3β, 17α-diol and artificial steroids like levonorgestrel and methyl-dihydrotestosterones .

Human SHBG is a homodimeric plasma glycoprotein produced by hepatocytes under the control of various hormonal and metabolic regulators. SHBG contains the coding sequence for the secretion signal polypeptide and two contiguous laminin G- like (LG) domains. The amino-terminal LG domain contains the steroid-binding site, the dimer interface, and several cation- binding sites (Grishkovskaya et al, 2000; Avvakumov et al, 2002) . Cristallographic studies revealed that the dimer formation is mediated mainly by the hydrophobic patch including beta strands β7 (SEQ ID No.125), β8 (SEQ ID No:126), β9 (SEQ ID No:127)and βlO (SEQ ID No:128) and involves residues from Ala 85 to Arg 125, of SEQ ID NO:2. This minimal dimer interface may not have sufficient stability to generate a dimer with comparable low dissociation constant, as it has been determined for the complete SHBG. The side chains of the adjacent beta strands contribute approximately 25 % to the binding, so that a dimerisation component comprising strands β6 (SEQ ID No.124) to βll (SEQ ID No.129), including residues Arg 75 to Arg 154, of SEQ ID NO : 2 , may provide a much more stable dimer interface.

An even more comprehensive approach consists of residues Asp 59 to GIu 205 of SEQ ID NO : 2 and Asp 59 to Ser 263 of SEQ ID NO: 2, respectively and provides dimerisation subunits of advantageous size and stability. These two embodiments include beta strands 5 (SEQ ID No:123) to 14 (SEQ ID No:132) containing strands βl2 (SEQ ID No.130) and βl3 (SEQ ID No.131) .

Therefore in one embodiment of the invention the nucleic acid of the invention encodes for a polypeptide dimerization component in the fusion polypeptide of the invention comprising or consisting of a hydrophobic patch consisting of amino acids of strands β7, and βlO of human SHBG, preferably of β7, β8, β9 and βlO. Typically the β7 to βlO strands are linked consecutively.

In a further embodiment of the invention the nucleic acid of the invention encodes for a polypeptide dimerization component in the fusion polypeptide comprising strands β5 and/or β6, and/or strands βll and/or βl2 of human SHBG.

In another embodiment of the invention the nucleic acid of the invention encodes for a polypeptide dimerization component in the fusion polypeptide comprising a stretch of amino acids having amino acids Ala85 to Argl25 (SEQ ID NO: 133) of the human SHBG.

In another embodiment of the invention the nucleic acid of the invention encodes for a polypeptide dimerization component in the fusion polypeptide comprising a stretch of amino acids having amino acids Arg74 to ARG 154 (SEQ ID NO: 134) of the human SHBG.

The carboxy-terminal LG domain of SHBG normally contains two sites for N-glycosylation, one of which is invariably conserved in SHBG molecules across a wide range of mammalian species. A variant human SHBG, with a point mutation in exon 8 encoding an amino acid substitution (Asp327Asn) , which introduces an additional consensus site for N-glycosylation, shows a significantly higher biological half life than heterozygous or wild type human SHBG (Cousin et al . , 1998) . A site for O-glycosylation is present at the amino terminus.

A dimerization component which is derived from SHBG is advantageous compared to other dimerization components used in the state of the art since dimerization domains of SHBG interact spontaneously and very strongly and have a relatively low molecular weight. A "dimerization component derived from SHBG" as used herein means each polypeptide fragment of SHBG which comprises the amino acid sequence Ala 85 - Arg 125 of human mature SHBG (SEQ ID N0:2) and is able to form stable dimers as well as polypeptide fragments which have a sequence similarity of at least 50%, preferably at least 60%, preferred at least 70%, more preferred at least 80%, even more preferred at least 90% and most preferred at least 95% to the amino acid sequence Ala85 - Argl25 of human mature SHBG (SEQ ID NO: 2) .

A "dimerization component derived from SHBG" as used herein further means each polypeptide fragment of SHBG which comprises the amino acid sequence Ala 85 - Arg 125 of human mature SHBG (SEQ ID NO: 2) and is able to form stable dimers as well as glycosylated polypeptides and polypeptide fragments, variants with conservative amino acid substitutions (see table 1) which have a sequence similarity of at least 50%, preferably at least 60%, preferred at least 70%, more preferred at least 80%, even more preferred at least 90% and most preferred at least 95% to the amino acid sequence Ala85 - Argl25 of human mature SHBG (SEQ ID NO: 2) .

Table 1

In particular, the nucleic acid molecule of the invention encodes for a polypeptide wherein the physiologically active polypeptide component is a ligand-binding component, a substrate-binding component or a substrate component, carbohydrates, lipids, DNA, RNA, especially siRNA and, micro- RNA.

In another embodiment the fusion polypeptide encoded by the nucleic acid of the invention further comprises a linker peptide which is located between components (a) and (b) of the fusion polypeptide. In particular, the linker peptide has a length of at least 1 amino acids up to 125 amino acids, preferably 1-50 amino acids, more preferably 4-30 amino acids and is selected from the group consisting of antibody derived linker (WO-A-2008052679) , Fc hinge, Ig hinge, natural interdomain linkers in human proteins (EP-A-1816201) , natural interdomain linkers in human plasma proteins (EP-A-1816201), Glycine-linker, SHBG derived linker or fragments thereof. The linker peptide is for example encoded by the nucleic acid sequences shown in SEQ ID NO:21 and SEQ ID NO: 110.

A typical example of the nucleic acid molecule according to the invention is encoding the dimerization component derived from sex hormone-binding globulin (SHBG) and

a) comprises the nucleic acid sequence as shown in SEQ ID NO: 98; and/or

b) comprises a fragment of SEQ ID NO: 98 of at least 50 nucleotides; and/or

c) has a nucleotide acid sequence similarity of at least 80%, preferred 90% and most preferred 95% to SEQ ID NO:98. The and/or language means here and elsewhere that the following combinations are comprised: a) + b) + c) ; a) + b) ; a) + c) ; b) + c) .

Another typical example of the nucleic acid molecule according to the invention is encoding the dimerization component derived from sex hormone-binding globulin (SHBG) and

a) comprises the nucleic acid sequence as shown in SEQ ID NO: 100; and/or

b) comprises a fragment of SEQ ID NO: 100 of at least 50 nucleotides; and/or

c) has a nucleotide acid sequence similarity of at least 80%, preferred 90% and most preferred 95% to SEQ ID NO: 100.

The and/or language means here and elsewhere that the following combinations are comprised: a) + b) + c) ; a) + b) ; a) + c) ; b) + c) .

The polypeptide dimerization component of the fusion polypeptide of the invention encoded by the nucleic acid molecule according invention, derived from sex hormone-binding globulin (SHBG) is capable of forming dimers with a dissociation constant K_D of less than 10^~9, preferably less than 10^~10, more preferably less than 10^'11 and most preferred less than 10^"12.

In a further embodiment the nucleic acid molecule of the invention is encoding the polypeptide dimerization component derived from sex hormone-binding globulin (SHBG) which is a chimeric construct consisting of at least two parts of the dimerization domain which are naturally not adjacent to each other . In another embodiment the nucleic acid molecule of the invention is encoding the polypeptide dimerization component derived from sex hormone-binding globulin (SHBG) which is a chimeric construct consisting of at least two parts, one of which is derived from the polypeptide dimerization domain of SHBG, whereas the at least one further part is derived from another protein, in particular the at least one further part is derived from cortisol-binding globulin (CBG) (SEQ ID NO:135) .

In yet another embodiment of the invention the nucleic acid of the invention encodes as the physiologically active component at least one which is selected or derived from the group consisting of antibodies, antibody fragments, for example 4 chain antibodies, bivalent and tetravalent VHH antibodies, Fab, Fab', F(ab')2, scFv, (scFv)2, diabodies, triabodies, tetrabodies, TandAb and flexibodies, VH and VL single domain antibodies, individual CDRs or groups of CDRs consisting of 1,2,3,4,5,6 or more different CDRs, and scaffolds containing CDRs.

The "sequence similarity" can be determined by standard bioinformatic programs known by the person skilled in the art, e.g the BLAST, FASTA or ClustalW programs.

In a preferred embodiment of the invention the nucleic acid molecule encodes a dimerization component derived from SHBG wherein the nucleic acid encoding said dimerization component comprises the nucleic acid sequence as shown in SEQ ID NO: 133 and/or comprises a fragment of at least 50 nucleotides of SEQ ID NO: 133 and/or has a nucleic acid sequence similarity of at least 70%, preferably 80%, more preferred 90% and most preferred 95% to SEQ ID NO:133.

In a further preferred embodiment the nucleic acid molecule encodes a dimerization component derived from SHBG which is capable of forming dimers with a dissociation constant K_D of less than 10 ¹⁰, preferably less than 10 ^lλ and most less than preferred 10^"12.

The term "dissociation constant" as used herein describes the affinity between two dimerization components. The K_D value is influenced by non-covalent intermolecular interactions between the two molecules such as hydrogen bonding, electrostatic interactions, hydrophobic and Van der Waals forces and specifies how tightly these two molecules bind each other.

In general, the smaller the dissociation constant (represented in molar units (M) ) , the more tightly bound the molecules are, or the higher the affinity between the two molecules.

A "stable dimer" in the context of the present invention is a dimer having a dissociation constant K_D of less than 10^" as determined by a study of the interaction between [125I]SHBG and unlabeled SHBG immobilized on agarose (incorporated by reference: Strelchyonok and Avvakumov, 1990) .

In another preferred embodiment the nucleic acid molecule encodes a dimerization component derived from SHBG wherein the nucleic acid encoding said dimerization component consists of the nucleic acid sequence as shown in SEQ ID NO: 98. In another preferred embodiment the present invention is directed to the nucleic acid molecule of the invention wherein the dimerization component encoded by said nucleic acid is a chimeric construct comprising at least two parts of the dimerization domain of SHBG (nucleotide 127 - 1119 of SEQ ID NO:1 which are naturally not adjacent to each other. In a preferred embodiment the dimerization component is a chimeric construct consisting of at least two parts of the dimerization domain of SHBG which are naturally not adjacent to each other.

"Adjacent" as used herein means that the two parts are normally in close proximity to each other. This can be due to primary structure of a protein, i.e. the two parts are consecutive in the amino acid sequence and it can also be the result of the folding of the mature protein. In the folded protein, also referred to as tertiary structure, two parts of the protein may come into close proximity which are considerably separated on the primary structure level.

A further preferred embodiment relates to the nucleic acid molecule of the invention wherein the dimerization component derived from sex hormone-binding globulin (SHBG) is a chimeric construct consisting of at least two parts, one of which is derived from the dimerization domain of SHBG, whereas the at least one further part is derived from a domain of SHBG other than the dimerization domain, wherein the at least two parts are naturally not adjacent to each other.

Another preferred embodiment relates to the nucleic acid molecule of the invention wherein the dimerization component derived from sex hormone-binding globulin (SHBG) is a chimeric construct consisting of at least two parts, one of which is derived from the dimerization domain of SHBG, whereas the at least one further part is derived from another protein. According to a further embodiment the at least one further part is derived from the group of steroid hormone-binding proteins. In a preferred embodiment the at least one further part is derived from the nucleic acid molecule (SEQ ID NO: 135) coding for corticosteroid-binding globulin (CBG) .

The nucleic acid molecules of the present invention further encode a physiologically active component.

A "physiologically active component" according to this invention refers to proteins, polypeptides, antibodies, antibody fragments and antibody derived polypeptides. The physiologically active components possess at least one biological activity, e.g. the ability to bind specifically to a particular cell type and/or to function in signal transduction pathways. A physiologically active component does not include components useful just for the preparation of the fusion protein, such as hexa-His, biotin carboxyl carrier protein (BCCP) , c-myc-tag, flag-tag, Strep-tag, HA-tag, Softag, S-tag, HAT-tag, Calmodulin binding peptide (CBP) , Chitin binding peptide (ChBP) , Cellulose binding peptide, Maltose binding protein (MBP) , green fluorescent protein (GFP) , Thioredoxin, Nus-tag or fragments of androgen-binding protein (ABP) , which has an intrinsic functionality similar to SHBG.

In a preferred embodiment of the invention the physiologically active component is a ligand binding component, a substrate- binding component or a substrate-component, carbohydrates, lipids, DNA, RNA, especially siRNA and, micro-RNA.

According to the present invention "ligand binding" components are proteins or fragments thereof that specifically bind to target ligand molecules. Ligand binding components comprise receptors, carrier proteins, hormones, cellular adhesive proteins, i.e. proteins that direct or induce the adhesion of one cell to another, lectin binding molecules, growth factors and the like, carbohydrates or lipids, DNA, RNA, especially siRNA or micro-RNA.

According to the present invention "substrate binding components" are proteins or fragments thereof that specifically bind to a substrate, e.g. a substrate of a specific enzyme. Therefore, enzymes are preferred substrate binding components of the present invention.

According to the present invention "substrate components" are molecules that are acted upon by an enzyme. Preferred substrate components according to the invention are nucleotides, polynucleotides, peptides, proteins, carbohydrates or lipids, DNA, RNA, especially siRNA or micro- RNA. In another preferred embodiment the ligand binding component is derived from a cytokine, a growth factor, a regulatory peptide factor, a hormone, a receptor or a fragment of these.

In an especially preferred embodiment the physiologically active component, ligand binding component and/or substrate binding component and/or substrate component is selected or derived from the group consisting of IL-I, IL-IR, IL-2, IL-2R, IL-3, IL-3R, IL-4, IL-4R, IL-5, IL-5R, IL-6, IL-6R, IL-7, IL- 7R, IL-8, IL-9, IL-9R, IL-IO , IL-IOR, IL-Il , 11-1 IR, IL-12, IL- 12R, IL-13, IL-13R, IL-14, IL-14R IL-15, IL-15R, IL-16, IL-17, I1-17RA, I1-17RB, I1-17RC, IL-20, IL-20R, IL-22, IL-22R IL-23, IL-23R, IL-35, TNFSFl, TNFSF2, GM-CSF, GM-CSFR, G-CSF, G- CSFR, EPO, EPOR, TPO, mplR, M-CSF, M-CSFR, GHR, TNFRSFlA, TNFRSFlB, TNFRSF4, TNFRSF 13b, BAFF, BAFFR, TNFRSF 18, GITRL, RANKL, RANK, TGF, TGF-alpha, TGFR, IFN alpha, IFN beta, IFN kappa, IFN delta, IFN epsilon, IFN tau, IFN omega, IFN zeta, IFN alphaR, IFN gamma, IFN gammaR, IFN lambdal, IFN Iambda2, IFN Iambda3, IFN lambdaR, , cMpl, gpl30, Fas (Apo 1), CCRl, CXCRl-7, TrkA, TrkB, TrkC, Htk, REK7, Rse/Tyro-3, hepatocyte growth factor R, platelet-derived growth factor R, FIt-I, CD2, CD4, CD5, CD6, CD20, CD22, CD27, CD28, CD30, CD31, CD40, CD44, CDlOO, CD137, CD150, LAG-3, B7, B61, β-neurexin, CTLA-4, ICOS, B7RP1, ICAM-I, complement R-2 (CD21) IgER, lysosomal membrane gpl, CC2 microglobulin receptor related proteins and sodium- releasing peptide R, LIF, LT, FGF, VEGF, VEGFR, EGF, EGFR, PlGF, PlGFR, SCF, oncostatin M, Amphiregulin, Mullerian- inhibiting substance, BCGF, MIF, Endostatin and Angiostatin, Adiponectin, GLPl, GLP2, Exendin3, Exendin4, PACAP, VIP, , Secretin, glicentin, Oxyntomodulin, ANP, BNP, BDNF, NGF, GDNF, Somatostatin, Leptin, Apolipoprotein A-I, ApoA-I Milano, Endostatin, Angiostatin, P-glycoprotein6 (CD243) , enzymes from the group of hydrolases (including phosphatases, nucleases phosphodiesterases) , oxidoreductases, transferases (including phosphotransferases) , lyases, isomerases and ligases and substrates of these enzymes including nucleotides, proteins, carbohydrates and lipids, DNA, RNA, siRNA, micro- RNA, or physiologically active fragments, variants, mutants, analogs or derivatives thereof.

In another preferred embodiment the ligand binding component is derived from an antibody, for example a conventional antibody, a VHH antibody, antibody fragments, Fv fragments, and domain antibodies and multispecific molecules formed from antibodies, antibody fragments and Fv fragments.

In an especially preferred embodiment the ligand binding component is selected or derived from the group consisting of 4 chain antibodies, bivalent and tetravalent VHH antibodies, Fab, Fab', F(ab')2, scFv, (scFv)2, diabodies, triabodies, tetrabodies, TandAb and flexibodies, VH and VL single domain antibodies , individual CDRs or groups of CDRs consisting of 1,2,3,4,5,6 or more different CDRs, or scaffolds containing CDRs. These antibody fragments and combinations thereof are non-limiting examples and well known to a person skilled in the art, who would readily be able to combine fragments further. Multispecific molecules can be generated by fusion of one component of a heterodimeric protein to the dimerising component of the homodimeric SHBG peptide, and subsequent assembly of the other component of a heterodimeric protein. Resulting molecule consists of four polypeptide chains of which two polypeptide chains are each identical.

In a preferred embodiment the heterodimeric protein is a plasma protein or a fragment thereof consisting of two polypeptide chains dimerising to form a heterodimer (e.g. WO-A-2007/062037) .

In another preferred embodiment the heterodimeric protein is an antibody fragment consisting of two polypeptides each possessing a variable region to confer binding specificity and a constant region accounting for dimerisation of the heterodimeric protein. In another preferred embodiment the ligand binding component is derived from a scaffold which contains naturally occurring or synthetically designed peptides stretches capable of binding to the target, as published for example in Binz et al . 2005. Useful scaffolds for this embodiment comprise adnectins, avimers, transferrin, tetranectin, tenascin, protein A, ankyrin and ankyrin repeats, lipocalins, anticalins, ubiquitins, β-crystallin, uteroglobin, and fragments thereof capable of binding the target molecule. A non-limiting example for a synthetic peptide stretch for binding TNF-α and a corresponding scaffold is KRWSRYF integrated in a fragment of tetranectin, as disclosed in WO-A-06/053568.

In another preferred embodiment, multiple physiologically active components may be linked to the dimerization component. If ACl, AC2, etc. denote different active components, DCl, DC2, etc. denote different dimerization components, and Ll, L2, etc. denote different linkers, any combination of the type

(ACk) - (Ll) - ACl - (Ln) - DCl - (Lp) - (ACq) - (Lr) - (ACs) or

(ACk) - (Ll) - (ACm) - (Ln) - DCl - (Lp) - ACl - (Lr) - (ACs)

are contemplated in the context of the present invention, k, 1, m, n, p, q, r, s, t being integers 1,2,... independently of each other, and brackets () denoting optional components. The person skilled will know to extend this list by more optional components, including additional dimerization components DCt. Active components may add additional functionality, comprising components such as cell or tissue penetrating peptides, peptides providing additional disulphide bridges, tissue targeting components, toxins, and imaging moieties. In addition to these active components, further active components may comprise purification and isolation tags such as hexa- Histidine, which may be enzymatically cleavable. In a preferred embodiment, the least two active components ACl and AC2 are linked to the dimerization component, each of them comprising extracellular fragments of homodimeric or heterodimeric cell surface receptors. In an especially preferred embodiment, ACl comprises a fragment of gpl30 and AC2 comprises a fragment of an interleukin 6.

In a preferred embodiment, cell or tissue penetrating peptides include HIV, TAT, antennapedia homeobox peptide and the penetratin peptide derived thereof, or the translocation motif PLSSIFSRIGDP, aa41-52 of the Pre2S region of the hepatitis B virus (Malkowski et al (2003) or variants thereof, as disclosed in WO/04/022657.

In a preferred embodiment, tissue targeting components include CD13 targeting peptides such as NGR, integrin targeting peptides such as RGD, or tumor cell surface markers, or markers of infected cells.

In a preferred embodiment, toxins comprise anthrax or diphtheria toxins.

In an especially preferred embodiment, two active components are linked to the dimerization component in the following way:

ACl - (Ll) - DCl - (L2) - AC2 or ACl - (Ll) - AC2 - (L2) - DCl or DCl - (Ll) - ACl - (L2) - AC2

In the context of this invention, "active" fragments, variants, mutants, analogs or derivatives are defined as molecules that retain the specific ligand binding function to particular ligands of the molecule they are derived from.

The term "active fragment" means a fragment of a protein that has full or partial biological activity of the entire protein.

The term "variant" means any polypeptide having one or several structural modification (s) introduced therein, such as mutation (s), deletion (s), substitution (s) and/or addition (s) of one or several amino acid residues, the variant still exhibiting the biological activity.

With respect to proteins the term "mutant" means a modified version of the native protein. A protein may be modified by amino acid substitution, deletion, addition, permutation (e.g., circular permutation), etc. An "active" mutant retains a biological characteristic of the native protein (e.g., the capability of binding of a ligand) .

The term "analog" means any structurally or functionally related compound which mimicks the biological activity of the ligand binding components mentioned above. The skilled person is able to identify such analogs. A polypeptide of the invention can be modified e.g. by derivatisation of side chain (s) of the amino acid sequence and/or the C-terminal and/or the N-terminal end of the amino acid chain. Also glycosylation of the poly peptide is a derivatisation which can e.g. performed by expressing the nucleic acid of the invention in an eukaryotic expression system. The term derivatisation according to the invention means in a broad sense any post-translationally performed modification without excluding modifications which may occur during translation of the poly-nucleotide . Also chemical derivatisation can be performed, e.g. amidation, esterification, phosphorylation, alkylation, acylation, thiolation, aromatic substitution whenever a functional chemical group in the amino acid chain can be reacted. Of course the modification at least has to maintain the function of the polypeptide. Modifications of the C-terminal and/or N-terminal ent can be performed for improving formulation and administration of the polypeptide of the invention, e.g. by pegylation.

In a preferred embodiment of the invention is directed to a nucleic acid molecule encoding a fusion polypeptide, which fusion polypeptide comprises the following fusion polypeptide components :

(a) a ligand binding component; and

(b) a dimerization component,

wherein the nucleic acid encoding the ligand binding component comprises a soluble fragment of human TNF receptor super family, especially TNFRSFlA (p55) and TNFRSFlB (p75) .

In an especially preferred embodiment the nucleic acid molecule of the invention encodes a ligand binding component which comprises a truncated fragment of the TNF receptor IB (TNFRSFlB, p75) comprising residues Leul - Asp235, Leul Thrl79, Leul- Cysl63, Leul- Pro141, Leul - Ala 116, Leul - Proll7, Leul - Leullδ, Leul - Argll9, Leul - Lysl20, Leul - Cysl21, Leul - Argl22, Thrl7 - Leullδ, Cys32 - Cysll5 of SEQ ID NO: 97, or N- or C-terminally truncated fragments thereof, or sequences having a sequence similarity of at least 60%, preferably 70%, more preferred 80%, even more preferred 90% and most preferred 95% to Leul - Asp235, Leul - T179, Leul- Cysl63, Leul- Prol41, Leul - Ala 116, Leul - Proll7, Leul - Leullδ, Leul - Argll9, Leul - Lysl20, Leul - Cysl21, Leul - Argl22, Thrl7 - Leullδ, Cys 32 - Cysll5 of SEQ ID NO:97.

In another especially preferred embodiment, the nucleic acid encoding the ligand binding component comprises a soluble fragment of human TNF receptor IB (TNFRSFlB, p75) as shown in SEQ ID NO: 102 or a sequence having a sequence similarity of at least 70%, more preferred 80% and most preferred 95% to SEQ ID NO: 102 and wherein the polypeptide dimerization component is derived from sex hormone-binding globulin (SHBG) with the proviso that the polypeptide dimerization component exhibits a binding affinity to a human steroid hormone weaker than human SHBG, in particular having a KD higher than 10^" M. In a preferred embodiment the nucleic acid encoding the ligand binding component comprises a fragment of the human TNF receptor IB (TNFRSFlB, p75) selected from the list consisting of SEQ ID No:3, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO : 7 , SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20 and SEQ ID NO: 84..

In an especially preferred embodiment said dimerization component comprises the amino acid sequence Ala85 - Argl25 of the SHBG dimerization domain encoded by the nucleic acid sequence as shown in SEQ ID NO: 133.

In another especially preferred embodiment, the nucleic acid encoding the ligand binding component comprises a soluble fragment of human TNF receptor IA (TNFRSFlA, p55 selected from the list consisting of SEQ ID NO:31, SEQ ID NO:32 and SEQ ID NO:33, SEQ ID NO: 93, SEQ ID NO: 94 and SEQ ID NO: 95, and wherein the polypeptide dimerization component is derived from sex hormone-binding globulin (SHBG) with the proviso that the polypeptide dimerization component exhibits a weaker binding affinity to a human steroid hormone than human SHBG, in particular having a dissociation constant Kd higher than 10^"8 M.

In a preferred embodiment said dimerization component comprises the the amino acid sequence Ala85 - Argl25 of SHBG dimerization domain encoded by the nucleic acid sequence as shown in SEQ ID NO: 133.

Another embodiment of the invention is directed to a nucleic acid molecule encoding a fusion polypeptide, which fusion polypeptide comprises the following fusion polypeptide components :

(a) a ligand binding component; and (b) a dimerization component,

wherein the nucleic acid encoding the ligand binding component consists of 4 chain antibodies, bivalent and tetravalent VHH antibodies, Fab, Fab', F(ab')2, scFv, (scFv)2, diabodies, triabodies, tetrabodies, TandAb and flexibodies, VH and VL single domain antibodies, individual CDRs or groups of CDRs consisting of 1,2,3,4,5,6 or more different CDRs, or scaffolds containing CDRs, and wherein the dimerization component can be any polypeptide dimerization component is derived from sex hormone-binding globulin (SHBG) with the proviso that the polypeptide dimerization component exhibits a binding affinity to a human steroid hormone weaker than the human SHBG, in particular with a dissociation constant higher than 10^" M.

In a preferred embodiment the antibody or antibody fragment binds TNF, the antibody fragment being for example encoded by the nucleic acid of SEQ ID NO: 103.

The molecular weight of the dimerization domain of SHBG can be selected according to the desired parameters of the fusion protein. Two dimerization domains with different molecular weights were selected as non-limiting examples, a short domain containing the 147 aa stretch from Asp59 - Glu205 of SEQ ID No .2 and a long domain containing the 205 aa stretch from Asp59 to Ser263 of SEQ ID No .2. Both domains experimentally delivered functional fusion proteins with TNF receptor fragments .

In another embodiment of the invention the nucleic acid molecules encoding the fusion polypeptides further encode a linker peptide which is located between components (a) and (b) of the fusion polypeptides.

Suitable linker peptides will adopt a flexible extended conformation. Therefore, the linker peptide is preferably a flexible linker. The flexible molecular linkers are preferably inert, hydrophilic and non-cleavable by proteases. The flexible molecular linkers are also preferably designed to lack secondary structure under physiological conditions.

In another embodiment of the invention the polypeptide linker is a cleavable linker, which can be cleaved enzymatically .

In a preferred embodiment of the invention the linker peptide is flexible having a length of at least 1 amino acid up to 125 amino acids, preferably 1-50 amino acids, more preferably 4-30 amino acids and is selected from the group consisting of antibody derived linker (SEQ ID NO: 110) (WO-A-2008052679) , Fc hinge, Ig hinge, natural interdomain linkers in human proteins

(SEQ ID NO:113, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO: 117), natural interdomain linkers in human plasma proteins (SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO: 121) (EP-A-1816201) , Glycine-linker, SHBG derived linker

(SEQ ID NO: 122) or fragments thereof.

In another preferred embodiment of the invention the linker peptide is a linker consisting of four glycine residues and one serine residue (GIy GIy GIy GIy Ser) and concatameres thereof .

In an especially preferred embodiment the linker peptide is an Ig hinge encoded by a nucleic acid sequence as shown in SEQ ID NO: 21. The amino acid sequence of the linker peptide encoded by SEQ ID NO:21 is shown in SEQ ID NO:22.

In another especially preferred embodiment the linker peptide is an Ig hinge encoded by a nucleic acid sequence as shown in SEQ ID NO: 112. The amino acid sequence of the linker peptide encoded by SEQ ID NO: 112 is shown in SEQ ID NO:22.

In another especially preferred embodiment the linker peptide is an antibody-derived linker encoded by a nucleic acid sequence as shown in SEQ ID NO: 110. The amino acid sequence of the linker peptide encoded by SEQ ID NO: 110 is shown in SEQ ID NO: 111.

In a preferred embodiment the nucleic acids of the present invention are provided in isolated form.

The invention is further directed to a vector comprising the nucleic acid molecules of the invention. In a preferred embodiment the vector is an expression vector comprising a nucleic acid molecule of the invention, wherein the nucleic acid molecule is operatively linked to an expression control sequence. Expression control sequences which are suitable for the present invention are for example RSV control sequences, CMV control sequences, retroviral LTR sequences, SV-40 control sequences, p-actin control sequences, T7 control sequences and lac (bla) control sequences, mouse WAP promoter, cauliflower mosaic virus (CaMV) 35S promoter, nopaline synthase (nos) promoter, the Figwort mosaic virus 35S promoter, the sugarcane bacilliform virus promoter, the commelina yellow mottle virus promoter, the light-inducible promoter from the small subunit of the ribulose-1, 5-bis-phosphate carboxylase (ssRUBISCO) , the rice cytosolic triosephosphate isomerase (TPI) promoter, the adenine phosphoribosyltransferase (APRT) promoter of Arabidopsis, the rice actin 1 gene promoter, and the mannopine synthase, octopine synthase promoters.

The invention is further directed to a host cell, a host animal or a host plant, respectively, for production of the fusion polypeptides of the invention, wherein said host cell, host animal or host plant comprises the expression vector of the invention which has been introduced into the host cell, the host animal or the host plant.

In a preferred embodiment of the invention the host cell is a bacterial cell, a yeast cell, an insect cell or a mammalian cell. An especially preferred host cell is an E.coli cell, a Chinese Hamster ovary (CHO) cell, a 293 cell or a K562 cell.

In a preferred embodiment of the invention the host animal is a mammalian animal. An especially preferred host mammalian animal is a milk producing animal.

In a preferred embodiment of the invention the host plant is tobacco or Physcomitrella patens.

The present invention is also directed to a method of producing the fusion polypeptides of the invention. The method comprises growing the host cell of the invention comprising an expression vector of the invention, wherein said growing is carried out under conditions permitting production of the fusion polypeptides and wherein the fusion polypeptides, produced by the host cell, are recovered from the host cell and/or from the medium used for growing the host cell.

The present invention is also directed to another method of producing the fusion polypeptides of the invention. The method comprises expressing the fusion polypeptides in a cell free expression system using an expression vector comprising a nucleic acid molecule of the invention, wherein the nucleic acid molecule is operatively linked to an expression control sequence .

The invention is also directed to the fusion polypeptides encoded by the nucleic acid molecules of the invention. The fusion polypeptides can be in monomeric form. In a preferred embodiment of the invention the fusion polypeptides are present in dimeric form. The invention also comprises fusion polypeptides in multimeric form.

Another preferred embodiment of the invention is directed to a fusion polypeptide in monomeric or dimeric form obtained by the methods of the invention.

The monomers of a dimeric fusion polypeptide may comprise the same physiologically active component or different physiologically active components.

The invention is also directed to fusion polypeptides in dimeric form, wherein only one of the two monomers of the fusion polypeptide in dimeric form comprises a physiologically active component according to the invention.

A preferred fusion polypeptide comprises a fragment of human TNF receptor IA (TNFRSFlA, p55) or human TNF receptor IB (TNFRSFlB, p75) or an anti-TNF-antibody-fragment and the dimerization domain of SHBG. In an especially preferred embodiment the fusion polypeptide comprises a fragment of TNF receptor IB encoded by the sequence SEQ ID NO: 102 and a dimerization domain of SHBG. Also preferred are fusion polypeptides encoded by a nucleic acid comprising a sequence having a sequence similarity of at least 50%, preferred at least 60%, more preferred at least 70%, even more preferred at least 80% and most preferred 90% to SEQ ID NO: 102 and further comprising the dimerization domain of SHBG.

Further preferred fusion polypeptides comprise anyone of the fragments of human TNF receptor IB encoded by the sequences as set forth in SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO: 6, SEQ ID NO:7, SEQ ID NO : 8 , SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO : 19 or SEQ ID NO: 20, and SEQ ID NO: 84 o: fragments of human TNF receptor IA encoded by the sequences as set forth in J- " ¹I" Xv ^•- ^{^} 1.. ^O _^ ^"* ^lχ- " : .->^"" _^;^ :^ C ^">- Xv ; ^{" ^} and a dimerization domain of SHBG.

The present invention is also directed to the use of the fusion polypeptides as a medicament. In a preferred embodiment the fusion polypeptide comprising a human TNF receptor IA (TNFRSFlA, p55) or human TNF receptor IB (TNFRSFlB, p75) or an anti-TNF-antibody-fragment encoded by a sequence selected from the list consisting of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO : 8 , SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO : 19 or SEQ ID NO: 20, SEQ ID NO: 84 and SEQ ID NO: 102 or fragments of human TNF receptor IA encoded by the sequences as set forth in SEQ ID NO:31, SEQ ID NO:32 and SEQ ID NO:33 or a fusion polypeptide encoded by a nucleic acid comprising a sequence having a sequence similarity of at least 50%, preferred at least 60%, more preferred at least 70%, even more preferred at least 80% and most preferred 90% to a sequence selected from the list consisting of SEQ ID NO:102is used as a medicament. These fusion polypeptides preferably further comprise the dimerization domain of SHBG.

Another embodiment relates to fusion polypeptides of the invention for the treatment of diseases or disorders selected from the group consisting of autoimmune diseases, chronic inflammatory diseases, lymphoproliferative disorders, neurological and neuropsychiatry disorders.

In a preferred embodiment the fusion polypeptide comprising a fragment of human TNF receptor IA (TNFRSFlA, p55) or human TNF receptor IB (TNFRSFlB, p75) or an anti-TNF-antibody-fragment and a dimerization domain of SHBG is used for the treatment of above mentioned diseases.

In an especially preferred embodiment the fusion polypeptide comprises a fragment of TNF receptor IB encoded by the sequence SEQ ID NO: 102 and a dimerization domain of SHBG. Also preferred are fusion polypeptides encoded by a nucleic acid comprising a sequence having a sequence similarity of at least 50%, preferred at least 60%, more preferred at least 70%, even more preferred at least 80% and most preferred 90% to SEQ ID NO: 102 and further comprising the dimerization domain of SHBG.

In another preferred embodiment the disease is selected from the group consisting of acute disseminated encephalomyelitis, addison' s disease, alcohol withdrawal, Alzheimer's disease, amyotrophic lateral sclerosis (ALS) , ankylosing spondylitis, anorexia nervosa, autism, autoimmune hepatitis, autoimmune oophoritis, B-Cell-Non-Hodgkin-lymphoma, Creutzfeldt-Jacob Disease (CJD) , Variant CJD, Coeliac disease, Colitis Ulcerosa, Crohn's disease, depression, diabetes mellitus type 1, diabetic retinopathy, endometriosis, gestational pemphigoid, glaucoma, Goodpasture's syndrome, Graves disease, Guillain- Barre syndrome (GBS), Hashimoto's thyroiditis, Idiopathic Dementia, Idiopathic thrombocytopenic purpura (ITP), Kawasaki disease, Lewy Body Disease, Morbus Bechterew, Multiple Sclerosis, Muscular Dystrophies Myasthenia gravis, narcotic addiction, nicotine withdrawal, obsessive-compulsive disorder, Opsoclonus myoclonus syndrome (OMS) , Optic neuritis, Parkinson's Disease, pemphigus, pernicious anemia, Pick's Disease, Polyarthritis, post-herpetic neuralgia, Psoriasis, primary biliary cirrhosis, rheumatoid arthritis (RA), Reiter' s syndrome (reactive arthritis) , Schizoaffective Illness, Schizophrenia, sepsis, Sjδgrens syndrome, systemic lupus erythematodes (SLE), Takayasu's arteritis, Temporal arteritis, Unipolar and Bipolar Affective Disorders.

In a preferred embodiment the fusion polypeptide comprising a fragment of human TNF receptor IA (TNFRSFlA, p55) or human TNF receptor IB (TNFRSFlB, p75) or an anti-TNF-antibody-fragment and a dimerization domain of SHBG is used for the treatment of ankylosing spondylitis, Colitis Ulcerosa, Crohn's disease, systemic lupus erythematodes (SLE) , Morbus Bechterew, Polyarthritis, rheumatoid arthritis (RA) , Psoriasis, and/or Sjδgrens syndrome.

In a preferred embodiment the fusion polypeptide comprising a fragment of human TNF receptor IA (TNFRSFlA, p55) or human TNF receptor IB (TNFRSFlB, p75) or an anti-TNF-antibody-fragment and a dimerization domain of SHBG is used for the treatment of endometriosis. The amino-terminal domain of human SHBG interacts with fibulin-1 and fibulin-2, two matrix-associated proteins located in the endometrium, and therefore targets SHBG to the endometrium and epididymis.

The present invention is also directed to pharmaceutical compositions comprising a fusion poypeptide of the present invention in a pharmacologically acceptable liquid, solid or semi-solid carrier, linked to a carrier or targeting molecule and/or incorporated into liposomes, microcapsules or a controlled release preparation or as nanoparticles .

The pharmaceutical compositions of the invention can be administered as any pharmaceutical formulation known in the art. Such pharmaceutical formulations comprise, for example, formulations which are suitable for oral, rectal, nasal or parenteral (including subcutaneous, intramuscular, and intravenous) administration. Preferably, the compositions are formulated for parenteral injection. Normally, the pharmaceutical compositions of the present invention further comprise one or more pharmaceutical acceptable carriers that are physiologically compatible with the other substances comprised in the composition.

The compositions can be prepared according to standard methods which are well known in the art. See, e.g., Pharmaceutical Dosage Forms: Parenteral Medications Dekker, NY; Lieberman et al. (Hrsg.) (1990) Pharmaceutical Dosage Forms: Tablets Dekker, NY; und Lieberman et al . (Hrsg.) (1990) Pharmaceutical Dosage Forms: Disperse Systems Dekker, NY.

In particular, the pharmaceutical compositions of the present invention may contain a physiologically acceptable carrier together with the fusion polypeptides dissolved or dispersed therein as an active ingredient. As used herein, the term "pharmaceutically acceptable carrier" comprises, but is not limited to, water, saline, Ringer's Solutions, dextrose solution, and 5% human serum albumin. Liposome-based carriers and non-aqueous vehicles such as fixed oils may also be used. Further examples of suitable carriers for compositions comprising the fusion peptides are described in standard textbooks, for example, in "Remington's Pharmaceutical Sciences", Mack Pub. Co., New Jersey (1991) . In addition to the carrier, the composition may also contain further compounds, such as wetting agents, emulsifying agents, pH buffering agents, stabilizers, dyes and the like, insofar as these compounds do not interfere with the biological activity of the poly-OC 2,8-sialic acid mimetic peptides and the HNK-I mimetic peptides. A stable liquid formulation can be prepared with or without lyophylisation process.

Preferably, the pharmaceutical composition is formulated for parenteral administration, for example, for intravenous, intradermal, subcutaneous, topical, transmucosal, or rectal administration. Solutions or suspensions used for parenteral, intradermal or subcutaneous application usually comprise a sterile diluent such as water, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents. The solutions or suspensions may further comprise antibacterial agents such as benzyl alcohol or methyl parabens, antioxidants such as ascorbic acid or sodium bisulfite, chelating agents such as EDTA, buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with suitable acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injection normally include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The composition intended for injection must be sterile and should be fluid in order to allow a convenient handling in a syringe.

In one embodiment, the active compounds are prepared with carriers that will protect the fusion peptides against elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparing controlled release formulation are well-known in the art. Furthermore, sustained-release compositions can be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers, which matrices are in the form of shaped articles, e.g., films or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels, polylactides, copolymers of L- glutamic acid and ethyl-L-glutamate, non-degradable ethylene- vinyl acetate, degradable lactic acid-glycolic acid copolymers and the like.

The therapeutic composition of the present invention can include pharmaceutically acceptable salts of the components therein. As used herein, pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the polypeptide) that are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic acid or tartaric acid and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like. Particularly preferred are the salts of TFA and HCl, when used in the preparation of cyclic peptides.

Brief Description of the Figures:

Figure 1: The graph shows the result of a SEAP assay where only SHBG was used as a competitor. The competitor was used with increasing concentrations of 4nM, 2OnM, 4OnM and 20OnM;

Figure 2: The graph shows the results of SEAP assays where the Pro_TNFRSFlA_D41-L108_hinge_SHBG fusion polypeptide and Pro_TNFRSFlA_D41-L108 without SHBG was used as a competitor. Each competitor was used with increasing concentrations of 4nM, 2OnM, 4OnM and 20OnM;

Figure 3: The graph shows the results of SEAP assays where the Pro_TNFRSFlA_D41-T127_hinge_SHBG fusion polypeptide and Pro_TNFRSFlA_D41-T127 without SHBG was used as a competitor. Each competitor was used with increasing concentrations of 4nM, 2OnM, 4OnM and 20OnM. Figure 4: The graph shows the results of SEAP assays where the TNFRSFlB-L140_hinge_SHBG_short fusion polypeptide and TNFRSF1B-L140 without SHBG were used as competitors. Each competitor was used with increasing concentrations of 25nM, 5OnM, and 20OnM.

Figure 5: The graph shows the results of SEAP assays where the sd-anti-TNF hinge SHBG short fusion polypeptide was used as competitor. Competitor was used with increasing concentrations of 2,5nM, 12,5nM, and 5OnM.

Figure 6: The graph shows the results of SEAP assays where the sd-anti-TNF_ polypeptide was used as competitor. Competitor was used with increasing concentrations of 5nM, 12,5nM, and 5OnM.

Figure 7: The graph shows the results of SEAP assays where the hinge SHBG_short polypeptide was used as control competitor. Control was used with increasing concentrations of 25nM, and 5OnM.70

The present invention will now be described in greater detail with reference to the following examples. The following examples are for illustrative purposes and are not intended to limit the scope of the invention.

EXAMPLES

Example 1

Preparation of SHBG-TNF alpha receptor constructs

a) Isolation of human SHBG cDNA clones and expression of SHBG peptides

A 1209 bp human SHBG cDNA was purchased from GeneCopoeia, Germantown, USA and used as a template to amplify a 615 bp SHBG cDNA fragment (SEQ ID NO:1) with the oligonucleotide primers SHBG 1205 Fl (5'-AACCCATATGGATACCAACC-S' ; SEQ ID NO:23) and SHBG 1205 Rl (5'-GGTTGGATCCTCACGACCCAGAA-S' ; SEQ ID NO: 24) . The Ndel recognition sequence (CATATG) and the BamHI recognition sequence (GGATCC) are shown in bold letters.

The reaction contained 0,2 mM of each dNTP, 75 μM of each primer, lOμg template, and 2,5 Units Pfu Turbo, Stratagene.

The PCR was carried out as a "Touch down PCR", i.e. the annealing temperature was lowered incrementally from 60⁰C to 50⁰C with 0,5 °C/Cycle, followed by 30 cycles at 50⁰C. PCR products were cloned blunt using the Zero Blunt TopoII PCR cloning kit, Invitrogen and TOP 10 competent cells, Invitrogen .

The 615 bp SHBG cDNA fragment was inserted in pET15b, Novagen, using BamHI and Ndel restriction enzymes, Fermentas GmbH, Germany, and ligase, Fermentas (method in Sambrook, E. F. Fritsch, T. Maniatis 2nd ed., New York: Cold Spring Harbour Laboratory Press, 1989) .

For protein expression, BL21 (DE3) cells, Invitrogen, were transformed with the SHBG pET15b construct according Invitrogens user manual for One shot BL21 (DE3) competent cells and grown at 37°C to an optical density at 600 nm wavelength (OD600) of approximately 0,2. Protein expression was induced with ImM IPTG ( Isopropyl-β-D-thiogalactopyranosid) and grown for 4 hours to an ODεoo of approximately 2,5.

Bacteria were pelletised, resuspended to an OD₆oo of 0,02, denatured and applied to an 4-12% Bis/Tris gel for expression control. Expression of a 22,5 kDa protein was visible. b) Isolation of human tumor necrosis factor α receptors TNFRSFlA (p55) and TNFRSFlB (p75) cDNAs The sequences of human TNFRSFlA (GenBank ACC-No. NM_00106) and TNFRSFlB (GenBank ACC-No. NM_001066) were used to design the following synthetic oligonucleotide primers:

TNFRSFlA Fl: δ'-CCAAATGGGGGAGTGAGAGG-S' (SEQ ID NO: 25)

TNFRSFlA Rl: 5'-TATGTACATCGAGGGGTTAGCA-S' (SEQ ID NO: 26)

TNFRSFlB Fl: 5'-GAGGGCAGGGGGCAACC-S' (SEQ ID NO: 27)

TNFRSFlB Rl: 5'-GGCGGGGCAGGTCACAGA-S' (SEQ ID NO: 28)

The oligonucleotides TNFRSFlA Fl and TNFRSFlA Rl were used to amplify a 1544 bp TNFRSFlA cDNA fragment (SEQ ID NO: 29) from a human spleen cDNA. A touch down PCR with incremental lowering of the annealing temperature by 0,5°C/cycle from 60⁰C to 50⁰C and subsequent 30 cycles at 50⁰C was performed. PCR conditions: 0,2 mM each dNTP, 75 μM each primer, 10μg template, 2,5 Units Pfu Turbo, Stratagene.

PCR products were cloned blunt using the Zero Blunt TopoII PCR cloning kit, Invitrogen and TOP 10 competent cells, Invitrogen .

The oligonucleotides TNFRSFlB Fl and TNFRSFlB Rl were used to amplify a 1718 bp TNFRSFlB fragment (SEQ ID NO: 30) using a human spleen cDNA as template. A touch down PCR with incremental lowering of the annealing temperature by 0,5°C/cycle from 60°C to 50°C and subsequent 30 cycles at 50⁰C was performed. PCR conditions: 0,2 mM each dNTP, 75 μM each primer, lOμg template, 2,5 Units Pfu Turbo, Stratagene.

c) Preparation of TNFRαRla- and TNFRαRlb-Ig_hinge-SHBG- constructs I. In a first step, the nucleotide sequences TNFRαRla D41- L108 (SEQ ID NO: 31), TNFRSFlA D41-T127 (SEQ ID NO:32), TNFRSFlA D41-N161 (SEQ ID NO:33), TNFRSFlB M1-C185 (SEQ ID NO:34), TNFRSFlB P24-C185 (SEQ ID NO:84), TNFRαRla M1-L108 (SEQ ID NO: 93), TNFRSFlA M1-T127 (SEQ ID NO: 94), TNFRSFlA Ml- N161 (SEQ ID NO: 95) and TNFRSFlB S71-C126 (SEQ ID NO:3) were amplified from the TNFRSFlA and TNFRSFlB cDNAs using oligonucleotide primers designed for insertion in appropriate vectors for prokaryotic and eukaryotic expression, respectively. A touch down PCR with incremental lowering of the annealing temperature by 0,5°C/cycle from 60⁰C to 50⁰C and subsequent 30 cycles at 50⁰C was performed. PCR conditions: 0,2 mM each dNTP, 75 μM each primer, lOμg template, 2,5 Units Pfu Turbo, Stratagene.

The following oligonucleotide primers were used for the TNFRSFlA constructs:

pZB Pro L108:

Pro nde Fl : 5' -AACCCATATGGATAGTGTGTGTCCCC-S' (SEQ ID NO: 35)

Pro_L108_Rl: 5'-GGTTGGATCCTCAGAGGCTGCAATTGAAGC-S' (SEQ ID NO: 36) pZB Pro T127

Pro nde Fl : 5' -AACCCATATGGATAGTGTGTGTCCCC-S' (SEQ ID NO: 35)

Pro_T127_Rl: 5'-GGTTGGATCCTCAGGTGCACACGGTGTTC-S' (SEQ ID NO:37)

pZB Pro N161

Pro nde Fl : 5' -AACCCATATGGATAGTGTGTGTCCCC-S' (SEQ ID NO: 35)

Pro_N161_Rl 5'-GGTTGGATCCTCAATTCTCAATCTGGGGTAG-S' (SEQ ID NO: 38) pZB Euk L108R1

Euk_Hind Fl: 5' -AACCAAGCTTCCACCATGGGCCTCTCCACC-S' (SEQ ID NO: 39)

Euk_L108_Rl 5'-GGTTGGATCCTCAGAGGCTGCAATTGAAGC-S' (SEQ ID NO: 40) pZB Euk T127R1

Euk_Hind Fl: 5' -AACCAAGCTTCCACCATGGGCCTCTCCACC-S' (SEQ ID NO: 39)

Euk_T127_Rl δ'-GGTTGGATCCTCAGGTGCACACGGTGTTC-S' (SEQ ID NO: 41)

pZB Euk Nl 61Rl

Euk_Hind Fl: 5' -AACCAAGCTTCCACCATGGGCCTCTCCACC-S' (SEQ ID NO: 39)

Euk_N161_Rl 5'-GGTTGGATCCTCAATTCTCAATCTGGGGTAG-S' (SEQ ID NO:42)

The following oligonucleotide primers were used for the TNFRSFlB constructs:

pZB Pro TNFRSF1B_P24_C185:

P75proFl 5' -AACATATGCCCGCCCAGG-3' (SEQ ID NO: 68)

P75proRl 5'-TTGGATCCTTAACAGATCTGGTGG-S' (SEQ ID NO: 83)

pZB Euk TNFRSF1B_M1-C185:

P75F1 5' -AACTCGAGGCCGCCACCATGGCGCCCGTCGC-S' (SEQ ID

NO: 43)

P75R1 5' -TTGCGGCCGCTTAACAGATCTGGTGG-S' (SEQ ID NO: 44)

pZB Pro S71 C126: P75pro_S71_F: 5'-AACCCATATGTCGGACACCGTGTGTG-S' (SEQ ID NO: 45)

p75pro_C126_R: 5' -GGTTGGATCCTCAgcagtaccagccgggcc -3' (SEQ ID NO: 46)

pZB Euk S71_C126: p75Euk_S71_F: 5' -AACTCGAGGCCGCCACCATGGCGCCCGTCGCCGTCTGGGC CGCGCTGGCCGTCGGACTGGAGCTCTGGGCTGCGGCGCACGCCTCGGACACCGTGTGTG-3'

(SEQ ID NO:47)

p75Euk_C126_R: 5' -TTGCGGCCGCTCAgcagtaccagccgggcc-3' (SEQ ID NO: 48)

For prokaryotic expression TNFRSFlA fragments were inserted in pET24a, Novagen using the Ndel (CATATG) and BamHI (GGATCC) restriction sites in the oligonucletides .

Resulting constructs were:

pET24a_Pro_D41-L108 pET24a_Pro_D41-T127

pET24a_Pro_D41-N161

TNFRSF1B_P24-C185 and TNFRSFlB S71-C126 fragments were inserted in pETlla, Novagen using the Ndel (CATATG) and BamHI (GGATCC) restriction sites in the oligonucletides.

Resulting construct were:

pETlla_Pro_TNFRSFlB_P24-C185

pETlla TNFRSFlB S71-C126 For eukaryotic expression TNFRSFlA fragments were inserted in pcDNA3.1(+), Invitrogen using the BamHI (GGATCC) and HindIII (AAGCTT) restriction sites in the oligonucletides .

Resulting constructs were:

pcDNA3.1(+) Euk M1-L108

pcDNA3.1(+) Euk M1-T127

pcDNA3.1(+) Euk M1-N161

For preparation of TNFRSFlB S71_C126 for eukaryotic expression, TNFRSFlB S71 C126 construct was inserted in in pcDNA3.1(+), Invitrogen using the Xhol (CTCGAG) and Notl (GCGGCCGC) restriction sites in the oligonucleotides.

Resulting construct was: pcDNA3.1 (+)_TNFRSF1B S71-C126

II. In a second step, an Ig hinge 87 nucleotide sequence (SEQ ID NO: 21) was attached to the 3' end of the TNFRSFlA and TNFRSFlB cDNA fragments using chimeric oligonucleotide primers in an overlap PCR (Higuchi et al, 1988 Nucleic Acids Res 16 (15) : 7351-67) .

TNFRSFlA D41-L108, TNFRSFlA D41-T127, TNFRSFlA D41-N161 fragments were amplified using a "Touch down" PCR with incremental lowering of the annealing temperature by 0,5°C/cycle from 60⁰C to 50⁰C and subsequent 30 cycles at 50°C was performed. PCR conditions: 0,2 mM each dNTP, 75 μM each primer, lOμg template, 2,5 Units Pfu Turbo, Stratagene, with following oligonucleotides:

Pro_nde_Fl (SEQ ID NO:35) and Euk_Hind Fl (SEQ ID NO:39), respectively combined with L108 HingeRl (5'- GGGTCTTGTCGCAGAGGCTGCAATTGAAGC-3' (SEQ ID NO:49)), T127 HingeRl (5'-GGGTCTTGTCGCAGGTGCACACGGTG-S' (SEQ ID NO: 50)) and N161_HingeRl (5'-GGGTCTTGTCGCAATTCTCAATCTGGGG-S' (SEQ ID NO:51)), respectively.

The resulting constructs are chimeras of TNFRSFlA L108 and Ig hinge partial sequence, TNFRSFlA T127 and Ig hinge partial sequence and TNFRSFlA N161 and Ig hinge partial sequence carrying Ndel or HindIII restriction sites at the 5' -end.

The resulting constructs were used together with a double- stranded Ig hinge sequence (SEQ ID N0:21) of 87 bp in an overlap PCR (5 cycles with annealing temperature of 50⁰C, followed by a touch down PCR with incremental lowering of the annealing temperature by 0,5°C/cycle from 60⁰C to 50⁰C and subsequent 30 cycles at 50⁰C), in which both fragments anneal and are combined by PCR with the both outer primers.

Outer primers were as follows:

Pro_nde_Fl (SEQ ID NO: 35)

Euk_Hind Fl(SEQ ID NO:39)

Hinge_SHBGRl: 5'-CTTAGGGTTGGTATCCTTGGGCTTGGG-S' (SEQ ID NO: 52)

III. In the next step, the SHBG fragment ((from a); see above) was fused to the 3' end of the TNFRSFlA hinge constructs (from the second step of c) using overlap PCR (PCR conditions as described above) .

PCR templates I: Pro_L108-Hinge

Pro_T127-Hinge

Pro_N161-Hinge

Euk_L108-Hinge

Euk_T127-Hinge

Euk N161-Hinge PCR template II Hinge-SHBG

Hinge-SHBG was amplified in a touch down PCR (Touch down PCR with incremental lowering of the annealing temperature by 0,5°C/cycle from 60⁰C to 50⁰C and subsequent 30 cycles at 50°C was performed. PCR conditions: 0,2 mM each dNTP, 75 μM each primer, lOμg template, 2,5 Units Pfu Turbo, Stratagene) with primers: Hinge_SHBG Fl and SHBG_BamHI Rl:

Hinge_SHBGFl 5'-CCCAAGCCCAAGGATACCAACCCTAAG-S' (SEQ ID NO: 53)

SHBG_BamHI Rl 5' -GGTTGGATCCTCACGACCCAGAAGACAACAC-S' (SEQ ID NO:54)

Each of the PCR templates I were combined with PCR template II

resulting in an overlap PCR (PCR conditions as above) .

Outer primers were Pro_nde_Fl (SEQ ID NO:35), Euk_Hind_Fl (SEQ ID NO:39) and SHBG_BamHI Rl (SEQ ID NO:54) .

PCR products (= TNFRSFlA_hinge_SHBG constructs) were cloned blunt using the Zero Blunt TopoII PCR cloning kit, Invitrogen, and TOP 10 competent cells, Invitrogen.

TNFRSFlA hinge SHBG pZB

Resulting products contain a TNFRSFlA fragment, a Ig hinge and a SHBG dimerization domain.

Prokaryotic expression constructs:

Pro_TNFRSFlA D41-L108_hinge_SHBG (SEQ ID NO: 55)

Pro_TNFRSFlA D41-T127_hinge_SHBG (SEQ ID NO: 57)

Pro_TNFRSFlA D41-N161_hinge_SHBG (SEQ ID NO: 59)

The fusion proteins encoded by these constructs were: Pro_TNFRSFlA D41-L108_hinge_SHBG prot (SEQ ID NO: 56)

Pro_TNFRSFlA D41-T127_hinge_SHBG prot (SEQ ID NO: 58)

Pro_TNFRSFlA D41-N161_hinge_SHBG prot (SEQ ID NO: 60)

Eukaryotic expression constructs:

Euk_TNFRSFlA Ml-L108_hinge_SHBG (SEQ ID NO: 61)

Euk_TNFRSFlA Ml-T127_hinge_SHBG (SEQ ID NO: 63)

Euk_TNFRSFlA Ml-Nl 61_hinge_SHBG (SEQ ID NO: 65)

The fusion proteins encoded by these constructs were: Euk_TNFRSFlA Ml-L108_hinge_SHBG prot (SEQ ID NO: 62)

Euk_TNFRSFlA Ml-T127_hinge_SHBG prot (SEQ ID NO: 64)

Euk_TNFRSFlA Ml-Nl 61_hinge_SHBG prot (SEQ ID NO: 66)

TNFRSFlB hinge SHBG expression constructs

For preparation of TNFRSFlB_hinge_SHBG expression constructs, the the pETlla and pcDNA3.1 (+) TNFRSFlB constructs were combined with an Ig-hinge-SHBG-sequence in overlap PCRs as described above.

Template I: pETlla_Pro_TNFRSFlB_P24-C185 pETlla_TNFRSFlB S71-C126

pcDNA3.1 (+)_TNFRSF1B S71-C126

Template II: Ig hinge SHBG (SEQ ID NO: 67)

TNFRSFlB P24 C185 hinge SHBG:

Outer primer for pro_TNFRSFlB P24_C185_hinge_SHBG

P75proFl 5'-AACATATGCCCGCCCAGG-S' (SEQ ID NO: 68) SHBG_BamHI Rl 5' -GGTTGGATCCTCACGACCCAGAAGACAACAC-S' (SEQ ID NO:54)

Overlap primer for TNFRSFlB P24_C185_hinge_SHBG

P75ENHSF1 5' -CCCACCAGATCTGTTGCGACAAGACCCACAC-S' (SEQ ID NO: 85)

P75ENHSR1 δ'-GTGTGGGTCTTGTCGCAACAGATCTGGTGGG-S' (SEQ ID NO: 86)

The resulting construct was:

Pro_TNFRSFlB P24_C185_hinge_SHBG (SEQ ID NO: 87)

The fusion protein encoded by this construct was:

Pro_TNFRSFlB P24_C185_hinge_SHBG prot (SEQ ID NO: 88)

TNFRSFlB S71-C126 hinge SHBG:

Outer primer for pro_TNFRSFlB S71-C126_hinge_SHBG

P75proFl 5' -AACATATGCCCGCCCAGG-3' (SEQ ID NO: 68)

SHBG_BamHI Rl (SEQ ID NO: 54)

Outer primer for euk_TNFRSFlB S71-C126_hinge_SHBG

p75Euk_S71_F (SEQ ID NO:47)

SHBG_BamHI Rl (SEQ ID NO: 54)

Overlap primer

TNFRSF1B_C126_hinge_F 5 ^s -CCCGGCTGGTACTGCTGCGACAAGACCCACACC- 3^s (SEQ ID NO:69 )

TNFRSF1B_C126_hinge_R 5 ^s -GGTGTGGGTCTTGTCGCAGCAGTACCAGCCGGG- 3^s (SEQ ID NO:70) The resulting constructs were:

Pro_TNFRSFlB S71-C126_hinge_SHBG (SEQ ID NO: 89)

euk_TNFRSFlB S71-C126_hinge_SHBG (SEQ ID NO: 91)

The fusion proteins encoded by these constructs were:

Pro_TNFRSFlB S71-C126_hinge_SHBG prot (SEQ ID NO: 90) euk_TNFRSFlB S71-C126_hinge_SHBG prot (SEQ ID NO: 92)

TNFRSFlB hinge SHBG constructs for prokyaryotic and eukaryotic expression: TNFRSFlB S71-A127, TNFRSFlB S71-L128, TNFRSFlB S71-S129, TNFRSFlB S71-K130, TNFRSFlB S71-Q131, TNFRSFlB S71- E132, TNFRSFlB S71-G133, TNFRSFlB S71-C134, TNFRSFlB S71-R135, TNFRSFlB S71-L136, TNFRSFlB S71-C137, TNFRSFlB S71-A138, TNFRSFlB S71-P139, TNFRSFlB S71-L140, TNFRSFlB S71-R141, TNFRSFlB S71-K142 were constructed in an analogous manner.

d) Construction of an eukaryotic expression vector for expression of Euk_TNFRSFlB_Ml-C185 in mammalian cell lines.

pcDL-SRa296 vector (Takebe et al, 1988, MCB 8: 466-472) was used for construction of an expression vector containing DHFR as selection marker for transfection of CHO DHFR-cells.

Construction of pcDL-Sralpha296_II_IRES_DHFR:

An IRES (Internal ribosomal entry site) sequence and a mouse DHFR (Dihydrofolate reductase) sequence were amplified and combined in an overlap PCR using overlap oligonucleotides:

IRDHFR2 5' -GTTCAATGGTCGAACCATTTATCATCGTGTTTTTC-S' (SEQ ID NO: 71)

IRDHFRl 5'-GAAAAACACGATGATAAATGGTTCGACCATTGAAC-S' (SEQ ID NO:72)

And outer oligonucleotides: IRNPTl 5' -GCTAGCCGCCCCTCTCCCTC-S' (SEQ ID NO: 73)

IRDHFR3 5' -GGATCCTTAGTCTTTCTTCT-S' (SEQ ID NO: 74)

Resulting sequence was IRES mouse DHFR (SEQ ID NO: 75) which was cloned Nhel / BamHI in pcDL SR alpha 296 MCSII (SEQ ID NO: 76) .

This vector was used for subcloning of eukaryotic TNFRSFlB constructs, e.g., TNFRSFlB M1-C185 was cloned Xhol / Notl in pCDSRalpha 296 MCSII IRES mouse DHFR.

Example 2

Expression of TNFRSFlA_Ig_hinge_SHBG constructs

a) Expression of TNFRSFlA_Ig_hinge_SHBG in a prokaryotic expression system

The TNFRSFlA_hinge_SHBG-inserts from clones: Pro_TNFRSFlA D41- L108_hinge_SHBG_pZB, Pro_TNFRSFlA D41-T127_hinge_SHBG_pZB and Pro_TNFRSFlA D41-N161_hinge_SHBG_pZB were cloned in pET24, Novagen, (a brand of EMD Chemicals Inc., an Affiliate of Merck KGaA, Darmstadt, Germany) using BamHI and Ndel restriction enzymes, Fermentas and ligase, Fermentas (Method in Sambrook, E. F. Fritsch, T. Maniatis 2nd ed., New York : Cold Spring Harbour Laboratory Press, 1989) .

For protein expression, BL21 (DE3) cells, Invitrogen, were transformed with the resulting constructs Pro_TNFRSFlA D41- L108_hinge_SHBGpET24a, Pro_TNFRSFlA D41-T127_hinge_SHBGpET24a and Pro_TNFRSFlA D41-N161_hinge_SHBGpET24a according Invitrogens User Manual for One shot BL21 (DE3) competent cells and grown in LB medium with 50 mg/1 kanamycin sulfate at 37⁰C to an optical density at 600 nm wavelength (OD₆oo) of approximately 0,2. Protein expression was induced with ImM IPTG (Isopropyl-β-D-thiogalactopyranosid) and cells were grown for another 4 hours to an OD₆oo of approximately 3,0. Cells were harvested by centrifugation (10 minutes, 4600 rpm, 4°C) and resuspended in Tris/EDTA-buffer (5OmM Tris/HCl pH 8,5, 5mM EDTA) to an OD₆₀₀ of 0,02, denatured and applied to an 4-12% Bis/Tris gel for expression control. Gel was blotted to a Polyvinylidene Difluoride (PVDF) membrane. Protein expression was confirmed with Western Blot Analysis (Towbin et al. 1979, United State Patent 4840714) using anti-TNFαR antibody, Santa Cruz Biotechnology, INC according to manufacturers instructions.

Cell lysis was achieved by sonication (constant duty cycle, output control 3.5, eight times 20 seconds) and addition of 1% DOC (desoxycholate) .

Protein was harvested by centrifugation (20 minutes, 15000 rpm, 4°C) . Protein was denatured in denaturing buffer (100 mM Tris / NaOH, pH 13,0, 2M Urea) and renatured in renaturing buffer (Tris 5OmM pH8,5; 0,5 mM EDTA; 2 M Urea; 10% Glycerine; 1 mM PMSF) .

Purification of renatured protein using DEAE 5ml FF column and subsequent concentration using Centricon Plus-20 MWCo 10000, Millipore. Concentrated protein was applied to a size exclusion column Superdex 200 10/30 HR, AmershamPharmacia Biotech and eluted with Tris/HCl/Glycerol buffer pH 8,5 and Tris/HCl/NaCL/Glycerol buffer pH8,5.

b) Expression of TNFRSFlA_Ig_hinge_SHBG in a eukaryotic expression system

The TNFRSFlA_hinge_SHBG-inserts from clones: Euk_TNFRSFlA D41- L108_hinge_SHBGpZB, Euk_TNFRSFlA D41-T127_hinge_SHBGpZB, Euk_TNFRSFlA D41-N161_hinge_SHBGpZB were cloned in pcDNA3.1 (Invitrogen) using BamHI and HindIII restriction enzymes, Fermentas and ligase, Fermentas . The resulting constructs were : Euk_TNFRSFlA_D41 -Ll 08_hinge_SHBGpcDNA3

Euk_TNFRSFlA_D41-T127_hinge_SHBGpcDNA3

Euk_TNFRSFlA_D41-N161_hinge_SHBGpcDNA3

l,5*10⁶ CHO DG44 cells, dihydrofolate reductase deficient (dhfr ) derivates of Chinese Hamster Ovary (CHO) cells, were transfected with above pcDNA3 constructs (1,5 μg DNA) using Lipofectamine, Invitrogen and Optimem medium, Invitrogen according manufacturers instructions. After cultivation of the cells for 20 days protein expression was controlled by Western Blot Analysis of 1 ml cell suspension.

TNFRSFlA_hinge_SHBG protein was enriched from the cell suspension by batch elution with Concanavalin A Sepharose 4B, Sigma-Aldrich.

Enriched protein was applied to an 4-12% Bis/Tris gel. Gel was blotted to a Polyvinylidene Difluoride (PVDF) membrane. Protein expression was confirmed with Western Blot Analysis (Towbin et al . 1979, Proc Natl Acad ScI U S A, Sep;76 (9) :4350-4; and US Patent No: 4840714) using anti-TNFαR antibody, Santa Cruz Biotechnology, INC according to manufacturers instructions.

For protein purification, TNFRSFlA hinge SHBG protein was enriched from transiently or stably transfected cells by batch elution with Concanavalin A Sepharose 4B, Sigma-Aldrich (Vinogradova et al . , 2000) . Protein was applied to HiTrap DEAE 5ml FF column, eluted with 50 mM Tris-HCl pH 8,5, 5 mM EDTA, 1 M NaCl and subsequently concentrated using Centricon Plus-20 MWCo 10000, Millipore. Concentrated protein was applied to a Superdex 200 HR 10/30 column, GE Healthcare and eluted with 50 mM Tris-HCl pH 8,5, 5 mM EDTA.

Example 4 Expression of TNFRSF1B-L140 expression constructs.

The cDNAs for TNFRSF1B-L140 (SEQ ID NO: 102)

TNFRSFlB-L140_hinge_SHBG (SEQ ID NO: 136) TNFRSFlB-L140_hinge_SHBG_short (SEQ ID NO: 104) Hinge-SHBG_short (SEQ ID NO: 100) were synthesised (Geneart, Regensburg, Germany) and inserted in pET24a, Novagen, an Affiliate of Merck KgaA, Darmstadt, Germany, using Nde and BamHI restriction enzymes, biolabs, Ipswich, USA.

For protein expression, BL21 (DE3) cells, Invitrogen were transformed with the TNFRSFlB constructs according Invitrogens user manual for One shot BL21 (DE3) competent cells and grown at 37°C to an optical density at 600 nm (OD₆oo) of approximately 0,2. Protein expression was induced with ImM IPTG (Isopropyl- β-D-thiogalactopyranosid) and cells were grown for another 4 hours at 37°C, 125 rpm to an OD₆oo of approximately 2,0 Cells were harvested by centrifugation (15 minutes, 4600 rpm, 4⁰C) and resuspended in BugBuster Master Mix, Novagen, an Affiliate of Merck KgaA, Darmstadt, Germany, to an OD600 of 0,02 and applied to an 4-12% Bis/Tris gel for expression control .

Proteins were expressed in 2 litre culture volumes as described above. Cells were harvested by centrifugation (15 minutes, 4600 rpm, 4°C) and resuspended in 100 ml Tris/EDTA- buffer (50 mM Tris/HCl pH 8,5, 5 mM EDTA) . Cell lysis was achieved by 3 freeze (liquid nitrogen) /thaw (37°C waterbath) cycles and subsequent sonication (8 x 20 sec duty cycle, output control 4 in ice water) . Protein was harvested by centrifugation (20 min, 4°C, 10000 rpm) . Protein was resuspended in 100 ml Tris/DOC (desoxycholate) buffer (50 mM Tris pH 8,5, 1% DOC) and sonicated (8 x 20 sec duty cycle, output control 4 in ice water) .

Protein was harvested by centrifugation (20 min, 4°C, 10000 rpm) . Protein was resuspended in 100 ml 1% DOC and incubated at 37 ⁰C for 1 hour. Protein was sonicated again (8 x 20 sec duty cycle, output control 4 in ice water) and harvested by centrifugation (20 min, 4°C, 10000 rpm) . Protein was resuspended in 100 ml Tris/Urea buffer (50 mM Tris/HCl pH8,5, 2M Urea) and incubated (20⁰C, 30 min) . Inclusion bodies were harvested by centrifugation (20 min, 4°C, 10000 rpm), resuspended in solubilisation buffer (6 M GuHCl, 100 mM Tris/HCl pH8,5, 4 mM PMSF (phenylmethylsulphonyl fluoride)), and incubated for 1 h at 20⁰C. IM DTT was added to a final concentration of 20 mM and proteins were incubated for another 30 min at RT.

Protein suspension was cleared by centrifugation 20 min, 4°C, 10000 rpm) and the supernatant was added to 500 ml refolding buffer (50 mM Tris/HCl pH 10,7) .

Refolded protein was cleared by centrifugation 45 min, 4°C, 10000 rpm) and the supernatant was added to a His Trap FF column, GE Healthcare Europe, Freiburg. Protein was eluted using elution buffer (50 mM Tris/HCl, pH 8.0, 300 mM Na cl, 0.2 M urea, 400 mM imidazole) . Protein purification using a His Trap FF column, GE Healthcare Europe, Freiburg, was repeated once. Protein was subsequently concentrated using Amicon Ultra MWCo 10000. Protein recovery and concentration was determined using 4-12% Bis/Tris gel electrophoresis and Bradford Assay. Proteins were stored at -80⁰C and used for activity analysis in the SEAP Assay. Expression of hinge-SHBG short

Protein was expressed as described above. Cells were harvested by centrifugation (15 minutes, 4600 rpm, 4°C) and resuspended in 100 ml Tris/EDTA-buffer (50 mM Tris/HCl pH 8,5, 5 mM EDTA) .Cell lysis was achieved by sonication (8 x 20 sec duty cycle, output control 7 in ice water) . Protein was harvested by centrifugation (20 min, 4°C, 10000 rpm) . Protein was resuspended in 100 ml Tris/EDTA-buffer (50 mM Tris/HCl pH 8,5, 5 mM EDTA) and subsequently sonicated (8 x 20 sec duty cycle, output control 7 in ice water) . Protein was harvested by centrifugation (20 min, 4°C, 10000 rpm) and resuspended in 100 ml Tris/DOC (desoxycholate) buffer (50 mM Tris pH 8,5, 1% DOC) . After another centrifugation protein was resuspended in 1% DOC + 10 μl Benzonase and incubated for 30 min at RT. Protein was cleared by centrifugation (15 minutes, 10000 rpm, 4°C) . Protein expression was confirmed with Western Blot analysis .

The supernatant was added to a His Trap FF column, GE Healthcare Europe, Freiburg. Protein was eluted using elution buffer (50 mM Tris/HCl, pH 8.0, 300 mM Na cl, 0.2 M urea, 400 mM imidazole) .

Protein was subsequently concentrated using Centricon Ultra 15 MWCo 10000, Millipore, Billerica, USA. Protein concentration was determined and proteins were stored at -80⁰C for use in the SEAP Assay.

Example 5

Expression of new TNFRSF1A-T127 expression constructs. The cDNA for TNFRSFlA-T127_hinge_SHBG_short (SEQ ID NO: 108) was synthesised (Geneart, Regensburg, Germany) and inserted in pET24a, Novagen, an Affiliate of Merck KgaA, Darmstadt, Germany, using Nde and BamHI restriction enzymes, biolabs, Ipswich, USA.

Protein was expressed as described above. Cells were harvested by centrifugation (15 minutes, 4600 rpm, 4°C) and resuspended in 340 ml BugBuster Master Mix, stirred for 10 min at RT. Protein expression was confirmed using Western Blot analysis using an anti SHBG antibody (anti SHBG rabbit polyclonal IgG, Santa Cruz Biotechnology, Santa Cruz, USA) . After centrifugation (20 min, 4°C, 10000 rpm) pellets were resuspended in 100 mM Tris/NaOH pH 13, 2M Urea and homogenised with a Polytron PT1200CL, Kinematica (2 x 6 sec, maximal power) . Proteins were cleared by centrifugation (20 min, 4°C, 10000 rpm) and refolded in refolding buffer (5OmM Tris/HCl pH8,5, 2M Urea, 10% glycerine) o.N. at 4°C.

The refolding reaction was added to a His Trap FF column, GE Healthcare Europe, Freiburg. Protein was eluted using elution buffer (50 mM Tris/HCl, pH 8.0, 300 mM Na cl, 0.2 M urea, 10 % glycerol, 400 mM imidazole) .

Protein was subsequently concentrated using Amicon Ultra MWCo 10000. Protein concentration was determined and proteins were stored at 4°C for use in the SEAP Assay.

Example 6

Expression of new sd-anti-TNFCC expression constructs. The cDNA for sd-anti-TNFCC_L2_SHBG_short (SEQ ID NO: 106) was synthesised (Geneart, Regensburg, Germany) and inserted in pET24a, Novagen, an Affiliate of Merck KgaA, Darmstadt, Germany, using Nde and BamHI restriction enzymes, biolabs, Ipswich, USA.

Protein was expressed as described above. Cells were harvested by centrifugation (15 minutes, 4600 rpm, 4°C) and resuspended in 100 ml Tris/EDTA-buffer (50 mM Tris/HCl pH 8,5, 5 mM EDTA) . Cell lysis was achieved as described above. Protein was harvested by centrifugation (20 min, 4°C, 10000 rpm) . Protein was resuspended in 100 ml Tris/DOC (desoxycholate) buffer (50 mM Tris pH 8,5, 1% DOC) and sonicated (8 x 20 sec duty cycle, output control 4 in ice water) .

Protein was harvested by centrifugation (20 min, 4°C, 10000 rpm) . Protein was resuspended in 100 ml 1% DOC and incubated at 37 ⁰C for 1 hour. Protein was sonicated again (8 x 20 sec duty cycle, output control 4 in ice water) and harvested by centrifugation (20 min, 4°C, 10000 rpm) .

Protein was resuspended in 50 mM Tris/HCl pH8,5 and incubated for 30 min at 20⁰C, centrifuged as described above and resuspended in 100 mM Tris/NaOH pH 13, 2M Urea. After centrifugation the supernatant was added to 80 ml refolding buffer (50 mM Tris/HCl pH 8,5, 2M Urea, 10% glycerine) and incubated over night at 4⁰C.

Refolded protein was cleared by centrifugation 45 min, 4°C, 10000 rpm) and the supernatant was added to a His Trap FF column, GE Healthcare Europe, Freiburg. Protein was eluted using elution buffer (50 mM Tris/HCl, pH 8.0, 300 mM Na cl, 0.2 M urea, 400 mM imidazole) .

Protein suspension was cleared by centrifugation (5 min, RT, 10000 rpm) and applied to size exclusion chromatography column Superdex 75 10/300 GL, GE Healthcare Europe, Freiburg and eluted with elution buffer (50 mM Tris/HCl pH 8,0, 150 mM NaCl, 0,2 M Urea, 10 % glycerol) . Protein was subsequently concentrated using Amicon Ultra MWCo 30000. Protein concentration was determined and proteins were stored at -80⁰C for use in the SEAP Assay.

Example 6

Construction of HEK 293T cell line stably expressing SEAP NfkappaB

l,2*10⁵ HEK 293T cells were transfected with 0,8 μg DNA of PSEAP2basicNFkBNeo containing the SEAP (secreted alkaline phosphatase) cDNA under the control of the NF-κB promotor using Lipofectamine, Invitrogen and Optimem medium, Invitrogen according to manufacturers instructions. HEK cells were transfected and plated to a 24 well micro plate. After 24 hours medium was changed. After another 24 hours cells were stimulated with 1000 Units/well TNF alpha ligand (100,000 Units/μl), JenaBioscience and TNF alpha ligand V77-L234. Response to TNF alpha activation of TNF receptor was measured in the supernatant using the Great EscAPe SEAP (secreted form of human placental alkaline phosphatase) assay (Clontech) . Responding pools were subjected to a G418 (neomycin) selection and cultivated in DMEM, PAA Laboratories containing 1000 μg G418, PAA Laboratories / ml medium.

Cloning of TNF alpha ligand V77-L234

PCR The sequence of human TNF ligand superfamily member 2 (TNF SF2, Acc.No.NM_000594) was used to design synthetic oligonucleotides :

hTNFaFl 5' ATCCCCTGACAAGCTGCCAGGCAGGTTCTC 3' (SEQ ID NO: 77)

hTNFalphRl 5' AGGGGAGGCGTTTGGGAAGGTTGGATGTTC 3' (SEQ ID NO: 78)

A 823 bp TNF ligand superfamily member 2 fragment (SEQ ID NO: 79) was amplified with oligonucleotides hTNFaFl and hTNFalphRl using a human spleen cDNA as template and cloned into the pHβexβ vector.

A 474 bp TNF ligand superfamily member 2 fragment (SEQ ID

NO: 80) was amplified with oligonucleotides TNF V77 Fl and TNF

V77 Rl using the TNF ligand pHβexβ DNA and cloned into the pET 11a vector (Novagen) .

TNF V77 Fl 5'-AACCATATGGTCAGATCATCTTCTCGAAC-SMSEQ ID NO: 81)

TNF V77 Rl 5' -GGTTGGATCCTCACAGGGCAATG-S' (SEQ ID NO: 82)

A touch down PCR with incremental lowering of the annealing temperature by 0,5°C/cycle from 60⁰C to 50⁰C and subsequent 30 cycles at 50⁰C was performed. PCR conditions: 0,2 mM each dNTP, 75 μM each primer, 10μg template, 2,5 Units Pfu Turbo, Stratagene .

PCR products were cloned blunt using the Zero Blunt TopoII PCR cloning kit, Invitrogen, and TOP 10 competent cells, Invitrogen: TNF_alpha_ligand_pZB

Expression of TNF alpha ligand V77-L234 in a prokaryotic expression system:

The TNF alpha ligand V77-L234-inserts from TNF alpha ligand pZB were cloned in pETlla, Novagen, using BamHI and Ndel restriction enzymes, Fermentas and ligase, Fermentas .

For protein expression, BL21 (DE3) cells, Invitrogen were transformed with the resulting construct TNF alpha ligand pETlla according Invitrogens User Manual for One shot BL21 (DE3) competent cells and grown in LB medium with 100 mg/1 ampicillin at 37°C to an optical density at 600 nm wavelength (OD₆oo) of approximately 0,8. Protein expression was induced with ImM IPTG (Isopropyl-β-D-thiogalactopyranosid) and cells were grown for another 3,5 hours to an OD₆oo of approximately 3,0.

Cells were harvested by centrifugation (15 minutes, 4600 rpm, 4°C) and resuspended in Sodium phosphate buffer (5OmM Sodium Phosphate pH7,4, ImM EDTA, ImM PMSF, 5% glycerol) . Cell lysis was achieved by 4 sonication procedures (duty cycle 50%, output control 3.5, eight times 20 seconds) .

The sample was clarified by centrifugation at 27,000 x g for 20 min at 4° C, then ammonium sulphate-precipitated at a saturation of 30%. The precipitate was dissolved in a small volume of 0.05 M sodium phosphate, pH 7.2, then re- precipitated with ammonium sulphate to a saturation of 50%. This second precipitate was dissolved in as small a volume as possible of 0.05 M sodium phosphate, pH 7.2, sterile filtered, then fractionated on a Superdex 200 prep grade HiLoad 16/60 column in 50 mM Tris-HCl, pH 8.0, 10% glycerol. Peak fractions were analysed by SDS-PAGE and Western blotting. TNF-alpha containing fractions were pooled.

Protein fractions were applied to HiTrap QFF column, eluted with 50 mM Tris-HCl pH 8,0, 10% glycerol, 0.5 M NaCl and subsequently concentrated using Centricon Plus-20 MWCo 10000, Millipore .

Example 7 SEAP assay Stimulation of TNF receptors with TNF ligand leads to translocation of NF-κB to the nucleus, where it binds to a promotor sequence leading to transcription of SEAP (secreted alkaline phosphatase) cDNA. (Berger et al . , Gene, 1988, 66:1-

10) . TNFRSFlA constructs were tested for their ability to inhibit the induction of NF-κB nuclear translocation and therefore inhibit secretion of AP using the Great EscAPe SEAP

(secreted form of human placental alkaline phosphatase) assay

(Clontech) according to manufacturers instructions. (Great

EscAPe SEAP Reporter System 2. Clontechniques XI (4) : 6-7

(1996) ; New Fluorescent Great EscAPe SEAP Assay.

Clontechniques XII(I) :18-19 (1997)) .

Fluorescence was measured using a Tecan SafireII Fluorescence reader .

Example 8 Reactivation of inactive protein

After refolding and affinity purification TNFRSFlA- T127_hinge_SHBG_short and TNFRSFlB-L140_hinge_SHBG_short protein was refolded by adding oxidized Glutathione to an endconcentration of 0,5 mM and reduced Glutathione to an endconcentration of 5 mM. Reactivation mixture was incubated at 4°C for 72 h. Protein suspension was cleared by centrifugation (5 min, 13000 rpm, 20⁰C) . Protein concentration was determined and proteins were stored at -80⁰C for use in the SEAP Assay.

Description of the figures a) In a first experiment the dimerization domain of SHBG was used as a competitor in an SEAP assay. The results are shown in Figure 1. Column 1 shows the fluorescence of the cells when stimulated with BSA as control. The stimulation with TNF ligand (column 2) led to a much higher fluorescence which is the result of the stimulation of the cells by TNFalpha. The addition of SHBG as a competitor in increasing concentrations (4nm, col. 3; 20nm, col.4; 4OnM, col. 5; and 200nm, col. 6, respectively) had no influence on the stimulation of the cells by TNFalpha.

b) In a second experiment the Pro_TNFRSFlA_D41-L108_hinge_SHBG fusion polypeptide was used as a competitor (Fig. 2a) and Pro_TNFRSFlA_D41-L108 without SHBG was used as a control (Fig. 2b) in a SEAP assay. As can be clearly seen from Fig. 2a the Pro_TNFRSFlA_D41-L108_hinge_SHBG fusion polypeptide led to a considerable decrease in the fluorescence of the cells (columns 3-6 compared with col. 2) , which means that it inhibited the induction of NF-κB nuclear translocation and therefore the action of TNFalpha. Pro_TNFRSFlA_D41-L108 without SHBG had no influence on the stimulation of the cells (Fig. 2b) .

c) In a third experiment the Pro_TNFRSFlA_D41-T127_hinge_SHBG fusion polypeptide was used as a competitor (Fig. 3a) and Pro_TNFRSFlA_D41-T127 without SHBG was used as a control (Fig. 3b) in a SEAP assay. Similar to the results of the second experiment (item b) , the fusion polypeptide including the SHBG dimerization domain led to a considerable decrease in the fluorescence while the polypeptide without SHBG had no effect.

d) In another experiment the TNFRSFlB-L140_hinge_SHBG_short fusion polypeptide and TNFRSF1B-L140 without SHBG were used as competitors (Fig. 4) in a SEAP assay. TNF was added to an end concentration of 0,5 nM. TNFRSF1B_L140 with and without SHBG was added to an end concentration of 25 nM

(5Ox) , 50 nM (10Ox) and 200 nM (40Ox) . TNFRSFlB- L140_hinge_SHBG was able to displace TNFalpha to basal levels (BSA), whereas TNFRSF1B-L140 without SHBG did not show this potential under the same experimental conditions (400 fold excess) .

In another experiment the sd-anti-TNF_hinge_SHBG_short fusion polypeptide (Fig. 5) and sd-anti-TNF without SHBG (obtained by the Institute of Biochemistry, Kiel, Germany) (Fig. 6) were used as a competitor, the hinge SHBG_short was used as a control (Fig 7) in a SEAP assay. TNF was added to an end concentration of 0,5 nM. sd-anti-TNF with and without SHBG was added to an end concentration of 2,5 nM (5x), 5 nM (1Ox), 12,5 nM (25x) and 50 nM (10Ox) . SHBG short was added to an end concentration of 25 nM (5Ox) and 50 nM (10Ox) . The sd-anti-TNF_hinge_SHBG_short fusion polypeptide and the sd-anti-TNF without hinge SHBG short showed a comparable inhibition potential. The hinge SHBG short alone did not show any effect and serves as a control for the set of experiments with the short form of SHBG.

SEQUENCE LISTING SEQ ID NO:1 ctgagacctg ttctccccac ccagagtgcc cacgaccctc cggctgtcca cctcagcaat 60 ggcccaggac aagagcctat cgctgtcatg acctttgacc tcaccaagat cacaaaaacc 120 tcctcctcct ttgaggttcg aacctgggac ccagagggag tgatttttta tggggatacc 180 aaccctaagg atgactggtt tatgctggga cttcgagacg gcaggcctga gatccaactg 240 cacaatcact gggcccagct tacggtgggt gctggaccac ggctggatga tgggagatgg 300 caccaggtgg aagtcaagat ggagggggac tctgtgctgc tggaggtgga tggggaggag 360 gtgctgcgcc tgagacaggt ctctgggccc ctgaccagca aacgccatcc catcatgagg 420 attgcgcttg gggggctgct cttccccgct tccaaccttc ggttgccgct ggttcctgcc 480 ctggatggct gcctgcgccg ggattcctgg ctggacaaac aggccgagat ctcagcatct 540 gcccccacta gcctcagaag ctgtgatgta gaatcaaatc ccgggatatt tctccctcca 600 gggactcagg cagaattcaa tctccgagac attccccagc ctcatgcaga gccctgggcc 660 ttctctttgg acctgggact caagcaggca gcaggctcag gccacctcct tgctcttggg 720 acaccagaga acccatcttg gctcagtctc cacctccaag atcaaaaggt ggtgttgtct 780 tctgggtcgg ggccagggct ggatctgccc ctggtcttgg gactccctct tcagctgaag 840 ctgagtatgt ccagggtggt cttgagccaa gggtcgaaga tgaaggccct tgccctgcct 900 cccttaggcc tggctcccct ccttaacctc tgggccaagc ctcaagggcg tctcttcctg 960 ggggctttac caggagaaga ctcttccacc tctttttgcc tgaatggcct ttgggcacaa 1020 ggtcagaggc tggatgtgga ccaggccctg aacagaagcc atgagatctg gactcacagc 1080 tgcccccaga gcccaggcaa tggcactgac gcttcccat 1119

SEQ ID NO: 2

Leu Arg Pro VaI Leu Pro Thr GIn Ser Ala His Asp Pro Pro Ala VaI

1 5 10 15

His Leu Ser Asn GIy Pro GIy GIn GIu Pro lie Ala VaI Met Thr Phe

20 25 30

Asp Leu Thr Lys lie Thr Lys Thr Ser Ser Ser Phe GIu VaI Arg Thr

35 40 45

Trp Asp Pro GIu GIy VaI lie Phe Tyr GIy Asp Thr Asn Pro Lys Asp

50 55 60

Asp Trp Phe Met Leu GIy Leu Arg Asp GIy Arg Pro GIu lie GIn Leu 65 70 75 80

His Asn His Trp Ala GIn Leu Thr VaI GIy Ala GIy Pro Arg Leu Asp

85 90 95

Asp GIy Arg Trp His GIn VaI GIu VaI Lys Met GIu GIy Asp Ser VaI

100 105 110

Leu Leu GIu VaI Asp GIy GIu GIu VaI Leu Arg Leu Arg GIn VaI Ser

115 120 125

GIy Pro Leu Thr Ser Lys Arg His Pro lie Met Arg lie Ala Leu GIy

130 135 140

GIy Leu Leu Phe Pro Ala Ser Asn Leu Arg Leu Pro Leu VaI Pro Ala 145 150 155 160

Leu Asp GIy Cys Leu Arg Arg Asp Ser Trp Leu Asp Lys GIn Ala GIu

165 170 175 lie Ser Ala Ser Ala Pro Thr Ser Leu Arg Ser Cys Asp VaI GIu Ser

180 185 190

Asn Pro GIy lie Phe Leu Pro Pro GIy Thr GIn Ala GIu Phe Asn Leu

195 200 205

Arg Asp lie Pro GIn Pro His Ala GIu Pro Trp Ala Phe Ser Leu Asp

210 215 220

Leu GIy Leu Lys GIn Ala Ala GIy Ser GIy His Leu Leu Ala Leu GIy 225 230 235 240

Thr Pro GIu Asn Pro Ser Trp Leu Ser Leu His Leu GIn Asp GIn Lys

245 250 255

VaI VaI Leu Ser Ser GIy Ser GIy Pro GIy Leu Asp Leu Pro Leu VaI 260 265 270

Leu GIy Leu Pro Leu GIn Leu Lys Leu Ser Met Ser Arg VaI VaI Leu

275 280 285

Ser GIn GIy Ser Lys Met Lys Ala Leu Ala Leu Pro Pro Leu GIy Leu

290 295 300

Ala Pro Leu Leu Asn Leu Trp Ala Lys Pro GIn GIy Arg Leu Phe Leu 305 310 315 320

GIy Ala Leu Pro GIy GIu Asp Ser Ser Thr Ser Phe Cys Leu Asn GIy

325 330 335

Leu Trp Ala GIn GIy GIn Arg Leu Asp VaI Asp GIn Ala Leu Asn Arg

340 345 350

Ser His GIu lie Trp Thr His Ser Cys Pro GIn Ser Pro GIy Asn GIy

355 360 365

Thr Asp Ala Ser His 370

SEQ ID NO: 3 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgc 168

SEQ ID NO: 4

Ser Asp Thr VaI Cys Asp Ser Cys GIu Asp Ser Thr Tyr Thr GIn Leu

1 5 10 15

Trp Asn Trp VaI Pro GIu Cys Leu Ser Cys GIy Ser Arg Cys Ser Ser

20 25 30

Asp GIn VaI GIu Thr GIn Ala Cys Thr Arg GIu GIn Asn Arg lie Cys

35 40 45

Thr Cys Arg Pro GIy Trp Tyr Cys 50 55

SEQ ID NO: 5 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc g 171

SEQ ID NO: 6 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctg 174

SEQ ID NO: 7 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagc 177

SEQ ID NO: 8 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180

SEQ ID NO: 9 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180 cag 183 SEQ I D NO : 1 0 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180 caggag 186

SEQ ID NO: 11 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180 caggagggg 189

SEQ ID NO: 12 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180 caggaggggt gc 192

SEQ ID NO: 13 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180 caggaggggt gccgg 195

SEQ ID NO: 14 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180 caggaggggt gccggctg 198

SEQ ID NO: 15 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180 caggaggggt gccggctgtg c 201

SEQ ID NO: 16 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180 caggaggggt gccggctgtg cgcg 204

SEQ ID NO: 17 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180 caggaggggt gccggctgtg cgcgccg 207

SEQ ID NO:18 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180 caggaggggt gccggctgtg cgcgccgctg 210

SEQ ID NO: 19 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180 caggaggggt gccggctgtg cgcgccgctg cgc 213

SEQ ID NO:20 tcggacaccg tgtgtgactc ctgtgaggac agcacataca cccagctctg gaactgggtt 60 cccgagtgct tgagctgtgg ctcccgctgt agctctgacc aggtggaaac tcaagcctgc 120 actcgggaac agaaccgcat ctgcacctgc aggcccggct ggtactgcgc gctgagcaag 180 caggaggggt gccggctgtg cgcgccgctg cgcaag 216

SEQ ID NO:21 tgcgacaaga cccacacctg ccccccctgc cccgcccccg agctgctggg cggcccctcc 60 gtgttcctgt tcccccccaa gcccaag 87

SEQ ID NO: 22

Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro GIu Leu Leu 1 5 10 15

GIy GIy Pro Ser VaI Phe Leu Phe Pro Pro Lys Pro Lys 20 25

SEQ ID NO: 23 aacccatatg gataccaacc 20

SEQ ID NO: 24 ggttggatcc tcacgaccca gaa 23

SEQ ID NO: 25 ccaaatgggg gagtgagagg 20

SEQ ID NO:26 tatgtacatc gaggggttag ca 22

SEQ ID NO: 27 gagggcaggg ggcaacc 17

SEQ ID NO:28 ggcggggcag gtcacaga 18

SEQ ID NO: 29 ccaaatgggg gagtgagagg ccatagctgt ctggcatggg cctctccacc gtgcctgacc 60 tgctgctgcc actggtgctc ctggagctgt tggtgggaat atacccctca ggggttattg 120 gactggtccc tcacctaggg gacagggaga agagagatag tgtgtgtccc caaggaaaat 180 atatccaccc tcaaaataat tcgatttgct gtaccaagtg ccacaaagga acctacttgt 240 acaatgactg tccaggcccg gggcaggata cggactgcag ggagtgtgag agcggctcct 300 tcaccgcttc agaaaaccac ctcagacact gcctcagctg ctccaaatgc cgaaaggaaa 360 tgggtcaggt ggagatctct tcttgcacag tggaccggga caccgtgtgt ggctgcagga 420 agaaccagta ccggcattat tggagtgaaa accttttcca gtgcttcaat tgcagcctct 480 gcctcaatgg gaccgtgcac ctctcctgcc aggagaaaca gaacaccgtg tgcacctgcc 540 atgcaggttt ctttctaaga gaaaacgagt gtgtctcctg tagtaactgt aagaaaagcc 600 tggagtgcac gaagttgtgc ctaccccaga ttgagaatgt taagggcact gaggactcag 660 gcaccacagt gctgttgccc ctggtcattt tctttggtct ttgcctttta tccctcctct 720 tcattggttt aatgtatcgc taccaacggt ggaagtccaa gctctactcc attgtttgtg 780 ggaaatcgac acctgaaaaa gagggggagc ttgaaggaac tactactaag cccctggccc 840 caaacccaag cttcagtccc actccaggct tcacccccac cctgggcttc agtcccgtgc 900 ccagttccac cttcacctcc agctccacct atacccccgg tgactgtccc aactttgcgg 960 ctccccgcag agaggtggca ccaccctatc agggggctga ccccatcctt gcgacagccc 1020 tcgcctccga ccccatcccc aacccccttc agaagtggga ggacagcgcc cacaagccac 1080 agagcctaga cactgatgac cccgcgacgc tgtacgccgt ggtggagaac gtgcccccgt 1140 tgcgctggaa ggaattcgtg cggcgcctag ggctgagcga ccacgagatc gatcggctgg 1200 agctgcagaa cgggcgctgc ctgcgcgagg cgcaatacag catgctggcg acctggaggc 1260 ggcgcacgcc gcggcgcgag gccacgctgg agctgctggg acgcgtgctc cgcgacatgg 1320 acctgctggg ctgcctggag gacatcgagg aggcgctttg cggccccgcc gccctcccgc 1380 ccgcgcccag tcttctcaga tgaggctgcg cccctgcggg cagctctaag gaccgtcctg 1440 cgagatcgcc ttccaacccc acttttttct ggaaaggagg ggtcctgcag gggcaagcag 1500 gagctagcag ccgcctactt ggtgctaacc cctcgatgta cata 1544

SEQ ID NO: 30 gagggcaggg ggcaaccgga ccccgcccgc acccatggcg cccgtcgccg tctgggccgc 60 gctggccgtc ggactggagc tctgggctgc ggcgcacgcc ttgcccgccc aggtggcatt 120 tacaccctac gccccggagc ccgggagcac atgccggctc agagaatact atgaccagac 180 agctcagatg tgctgcagca aatgctcgcc gggccaacat gcaaaagtct tctgtaccaa 240 gacctcggac accgtgtgtg actcctgtga ggacagcaca tacacccagc tctggaactg 300 ggttcccgag tgcttgagct gtggctcccg ctgtagctct gaccaggtgg aaactcaagc 360 ctgcactcgg gaacagaacc gcatctgcac ctgcaggccc ggctggtact gcgcgctgag 420 caagcaggag gggtgccggc tgtgcgcgcc gctgcgcaag tgccgcccgg gcttcggcgt 480 ggccagacca ggaactgaaa catcagacgt ggtgtgcaag ccctgtgccc cggggacgtt 540 ctccaacacg acttcatcca cggatatttg caggccccac cagatctgta acgtggtggc 600 catccctggg aatgcaagca tggatgcagt ctgcacgtcc acgtccccca cccggagtat 660 ggccccaggg gcagtacact taccccagcc agtgtccaca cgatcccaac acacgcagcc 720 aactccagaa cccagcactg ctccaagcac ctccttcctg ctcccaatgg gccccagccc 780 cccagctgaa gggagcactg gcgacttcgc tcttccagtt ggactgattg tgggtgtgac 840 agccttgggt ctactaataa taggagtggt gaactgtgtc atcatgaccc aggtgaaaaa 900 gaagcccttg tgcctgcaga gagaagccaa ggtgcctcac ttgcctgccg ataaggcccg 960 gggtacacag ggccccgagc agcagcacct gctgatcaca gcgccgagct ccagcagcag 1020 ctccctggag agctcggcca gtgcgttgga cagaagggcg cccactcgga accagccaca 1080 ggcaccaggc gtggaggcca gtggggccgg ggaggcccgg gccagcaccg ggagctcaga 1140 ttcttcccct ggtggccatg ggacccaggt caatgtcacc tgcatcgtga acgtctgtag 1200 cagctctgac cacagctcac agtgctcctc ccaagccagc tccacaatgg gagacacaga 1260 ttccagcccc tcggagtccc cgaaggacga gcaggtcccc ttctccaagg aggaatgtgc 1320 ctttcggtca cagctggaga cgccagagac cctgctgggg agcaccgaag agaagcccct 1380 gccccttgga gtgcctgatg ctgggatgaa gcccagttaa ccaggccggt gtgggctgtg 1440 tcgtagccaa ggtgggctga gccctggcag gatgaccctg cgaaggggcc ctggtccttc 1500 caggccccca ccactaggac tctgaggctc tttctgggcc aagttcctct agtgccctcc 1560 acagccgcag cctccctctg acctgcaggc caagagcaga ggcagcgagt tgtggaaagc 1620 ctctgctgcc atggcgtgtc cctctcggaa ggctggctgg gcatggacgt tcggggcatg 1680 ctggggcaag tccctgactc tctgtgacct gccccgcc 1718

SEQ ID NO: 31 gatagtgtgt gtccccaagg aaaatatatc caccctcaaa ataattcgat ttgctgtacc 60 aagtgccaca aaggaaccta cttgtacaat gactgtccag gcccggggca ggatacggac 120 tgcagggagt gtgagagcgg ctccttcacc gcttcagaaa accacctcag acactgcctc 180 agctgctcca aatgccgaaa ggaaatgggt caggtggaga tctcttcttg cacagtggac 240 cgggacaccg tgtgtggctg caggaagaac cagtaccggc attattggag tgaaaacctt 300 ttccagtgct tcaattgcag cctc 324

SEQ ID NO: 32 gatagtgtgt gtccccaagg aaaatatatc caccctcaaa ataattcgat ttgctgtacc 60 aagtgccaca aaggaaccta cttgtacaat gactgtccag gcccggggca ggatacggac 120 tgcagggagt gtgagagcgg ctccttcacc gcttcagaaa accacctcag acactgcctc 180 agctgctcca aatgccgaaa ggaaatgggt caggtggaga tctcttcttg cacagtggac 240 cgggacaccg tgtgtggctg caggaagaac cagtaccggc attattggag tgaaaacctt 300 ttccagtgct tcaattgcag cctctgcctc aatgggaccg tgcacctctc ctgccaggag 360 aaacagaaca ccgtgtgcac c 381

SEQ ID NO: 33 gatagtgtgt gtccccaagg aaaatatatc caccctcaaa ataattcgat ttgctgtacc 60 aagtgccaca aaggaaccta cttgtacaat gactgtccag gcccggggca ggatacggac 120 tgcagggagt gtgagagcgg ctccttcacc gcttcagaaa accacctcag acactgcctc 180 agctgctcca aatgccgaaa ggaaatgggt caggtggaga tctcttcttg cacagtggac 240 cgggacaccg tgtgtggctg caggaagaac cagtaccggc attattggag tgaaaacctt 300 ttccagtgct tcaattgcag cctctgcctc aatgggaccg tgcacctctc ctgccaggag 360 aaacagaaca ccgtgtgcac ctgccatgca ggtttctttc taagagaaaa cgagtgtgtc 420 tcctgtagta actgtaagaa aagcctggag tgcacgaagt tgtgcctacc ccagattgag 480 aat 483

SEQ ID NO: 34 atggcgcccg tcgccgtctg ggccgcgctg gccgtcggac tggagctctg ggctgcggcg 60 cacgccttgc ccgcccaggt ggcatttaca ccctacgccc cggagcccgg gagcacatgc 120 cggctcagag aatactatga ccagacagct cagatgtgct gcagcaaatg ctcgccgggc 180 caacatgcaa aagtcttctg taccaagacc tcggacaccg tgtgtgactc ctgtgaggac 240 agcacataca cccagctctg gaactgggtt cccgagtgct tgagctgtgg ctcccgctgt 300 agctctgacc aggtggaaac tcaagcctgc actcgggaac agaaccgcat ctgcacctgc 360 aggcccggct ggtactgcgc gctgagcaag caggaggggt gccggctgtg cgcgccgctg 420 cgcaagtgcc gcccgggctt cggcgtggcc agaccaggaa ctgaaacatc agacgtggtg 480 tgcaagccct gtgccccggg gacgttctcc aacacgactt catccacgga tatttgcagg 540 ccccaccaga tctgttaa 558

SEQ ID NO: 35 aacccatatg gatagtgtgt gtcccc 26

SEQ ID NO: 36 ggttggatcc tcagaggctg caattgaagc 30

SEQ ID NO: 37 ggttggatcc tcaggtgcac acggtgttc 29

SEQ ID NO: 38 ggttggatcc tcaattctca atctggggta g 31

SEQ ID NO:39 aaccaagctt ccaccatggg cctctccacc 30

SEQ ID NO:40 ggttggatcc tcagaggctg caattgaagc 30

SEQ ID NO:41 ggttggatcc tcaggtgcac acggtgttc 29

SEQ ID NO: 42 ggttggatcc tcaattctca atctggggta g 31

SEQ ID NO: 43 aactcgaggc cgccaccatg gcgcccgtcg c 31

SEQ ID NO: 44 ttgcggccgc ttaacagatc tggtgg 26 SEQ ID NO : 45 aacccatatg tcggacaccg tgtgtg 26

SEQ ID NO:46 ggttggatcc tcagcagtac cagccgggcc 30

SEQ ID NO: 47 aactcgaggc cgccaccatg gcgcccgtcg ccgtctgggc cgcgctggcc gtcggactgg 60 agctctgggc tgcggcgcac gcctcggaca ccgtgtgtg 99

SEQ ID NO:48 ttgcggccgc tcagcagtac cagccgggcc 30

SEQ ID NO: 49 gggtcttgtc gcagaggctg caattgaagc 30

SEQ ID NO: 50 gggtcttgtc gcaggtgcac acggtg 26

SEQ ID NO: 51 gggtcttgtc gcaattctca atctgggg 28

SEQ ID NO: 52 cttagggttg gtatccttgg gcttggg 27

SEQ ID NO: 53 cccaagccca aggataccaa ccctaag 27

SEQ ID NO: 54 ggttggatcc tcacgaccca gaagacaaca c 31

SEQ ID NO: 55 atggatagtg tgtgtcccca aggaaaatat atccaccctc aaaataattc gatttgctgt 60 accaagtgcc acaaaggaac ctacttgtac aatgactgtc caggcccggg gcaggatacg 120 gactgcaggg agtgtgagag cggctccttc accgcttcag aaaaccacct cagacactgc 180 ctcagctgct ccaaatgccg aaaggaaatg ggtcaggtgg agatctcttc ttgcacagtg 240 gaccgggaca ccgtgtgtgg ctgcaggaag aaccagtacc ggcattattg gagtgaaaac 300 cttttccagt gcttcaattg cagcctctgc gacaagaccc acacctgccc cccctgcccc 360 gcccccgagc tgctgggcgg cccctccgtg ttcctgttcc cccccaagcc caaggatacc 420 aaccctaagg atgactggtt tatgctggga cttcgagacg gcaggcctga gatccaactg 480 cacaatcact gggcccagct tacggtgggt gctggaccac ggctggatga tgggagatgg 540 caccaggtgg aagtcaagat ggagggggac tctgtgctgc tggaggtgga tggggaggag 600 gtgctgcgcc tgagacaggt ctctgggccc ctgaccagca aacgccatcc catcatgagg 660 attgcgcttg gggggctgct cttccccgct tccaaccttc ggttgccgct ggttcctgcc 720 ctggatggct gcctgcgccg ggattcctgg ctggacaaac aggccgagat ctcagcatct 780 gcccccacta gcctcagaag ctgtgatgta gaatcaaatc ccgggatatt tctccctcca 840 gggactcagg cagaattcaa tctccgagac attccccagc ctcatgcaga gccctgggcc 900 ttctctttgg acctgggact caagcaggca gcaggctcag gccacctcct tgctcttggg 960 acaccagaga acccatcttg gctcagtctc cacctccaag atcaaaaggt ggtgttgtct 1020 tctgggtcgt ga 1032

SEQ ID NO: 56

Met Asp Ser VaI Cys Pro GIn GIy Lys Tyr lie His Pro GIn Asn Asn 1 5 10 15

Ser lie Cys Cys Thr Lys Cys His Lys GIy Thr Tyr Leu Tyr Asn Asp 20 25 30 Cys Pro GIy Pro GIy GIn Asp Thr Asp Cys Arg GIu Cys GIu Ser GIy

35 40 45

Ser Phe Thr Ala Ser GIu Asn His Leu Arg His Cys Leu Ser Cys Ser

50 55 60

Lys Cys Arg Lys GIu Met GIy GIn VaI GIu He Ser Ser Cys Thr VaI 65 70 75 80

Asp Arg Asp Thr VaI Cys GIy Cys Arg Lys Asn GIn Tyr Arg His Tyr

85 90 95

Trp Ser GIu Asn Leu Phe GIn Cys Phe Asn Cys Ser Leu Cys Asp Lys

100 105 HO

Thr His Thr Cys Pro Pro Cys Pro Ala Pro GIu Leu Leu GIy GIy Pro

115 120 125

Ser VaI Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Asn Pro Lys Asp

130 135 140

Asp Trp Phe Met Leu GIy Leu Arg Asp GIy Arg Pro GIu He GIn Leu 145 150 155 160

His Asn His Trp Ala GIn Leu Thr VaI GIy Ala GIy Pro Arg Leu Asp

165 170 175

Asp GIy Arg Trp His GIn VaI GIu VaI Lys Met GIu GIy Asp Ser VaI

180 185 190

Leu Leu GIu VaI Asp GIy GIu GIu VaI Leu Arg Leu Arg GIn VaI Ser

195 200 205

GIy Pro Leu Thr Ser Lys Arg His Pro He Met Arg He Ala Leu GIy

210 215 220

GIy Leu Leu Phe Pro Ala Ser Asn Leu Arg Leu Pro Leu VaI Pro Ala 225 230 235 240

Leu Asp GIy Cys Leu Arg Arg Asp Ser Trp Leu Asp Lys GIn Ala GIu

245 250 255

He Ser Ala Ser Ala Pro Thr Ser Leu Arg Ser Cys Asp VaI GIu Ser

260 265 270

Asn Pro GIy He Phe Leu Pro Pro GIy Thr GIn Ala GIu Phe Asn Leu

275 280 285

Arg Asp He Pro GIn Pro His Ala GIu Pro Trp Ala Phe Ser Leu Asp

290 295 300

Leu GIy Leu Lys GIn Ala Ala GIy Ser GIy His Leu Leu Ala Leu GIy 305 310 315 320

Thr Pro GIu Asn Pro Ser Trp Leu Ser Leu His Leu GIn Asp GIn Lys

325 330 335

VaI VaI Leu Ser Ser GIy Ser 340

SEQ ID NO: 57 atggatagtg tgtgtcccca aggaaaatat atccaccctc aaaataattc gatttgctgt 60 accaagtgcc acaaaggaac ctacttgtac aatgactgtc caggcccggg gcaggatacg 120 gactgcaggg agtgtgagag cggctccttc accgcttcag aaaaccacct cagacactgc 180 ctcagctgct ccaaatgccg aaaggaaatg ggtcaggtgg agatctcttc ttgcacagtg 240 gaccgggaca ccgtgtgtgg ctgcaggaag aaccagtacc ggcattattg gagtgaaaac 300 cttttccagt gcttcaattg cagcctctgc ctcaatggga ccgtgcacct ctcctgccag 360 gagaaacaga acaccgtgtg cacctgcgac aagacccaca cctgcccccc ctgccccgcc 420 cccgagctgc tgggcggccc ctccgtgttc ctgttccccc ccaagcccaa ggataccaac 480 cctaaggatg actggtttat gctgggactt cgagacggca ggcctgagat ccaactgcac 540 aatcactggg cccagcttac ggtgggtgct ggaccacggc tggatgatgg gagatggcac 600 caggtggaag tcaagatgga gggggactct gtgctgctgg aggtggatgg ggaggaggtg 660 ctgcgcctga gacaggtctc tgggcccctg accagcaaac gccatcccat catgaggatt 720 gcgcttgggg ggctgctctt ccccgcttcc aaccttcggt tgccgctggt tcctgccctg 780 gatggctgcc tgcgccggga ttcctggctg gacaaacagg ccgagatctc agcatctgcc 840 cccactagcc tcagaagctg tgatgtagaa tcaaatcccg ggatatttct ccctccaggg 900 actcaggcag aattcaatct ccgagacatt ccccagcctc atgcagagcc ctgggccttc 960 tctttggacc tgggactcaa gcaggcagca ggctcaggcc acctccttgc tcttgggaca 1020 ccagagaacc catcttggct cagtctccac ctccaagatc aaaaggtggt gttgtcttct 1080 gggtcgtga 1089

SEQ ID NO: 58

Met Asp Ser VaI Cys Pro GIn GIy Lys Tyr lie His Pro GIn Asn Asn

1 5 10 15

Ser lie Cys Cys Thr Lys Cys His Lys GIy Thr Tyr Leu Tyr Asn Asp

20 25 30

Cys Pro GIy Pro GIy GIn Asp Thr Asp Cys Arg GIu Cys GIu Ser GIy

35 40 45

Ser Phe Thr Ala Ser GIu Asn His Leu Arg His Cys Leu Ser Cys Ser

50 55 60

Lys Cys Arg Lys GIu Met GIy GIn VaI GIu lie Ser Ser Cys Thr VaI 65 70 75 80

Asp Arg Asp Thr VaI Cys GIy Cys Arg Lys Asn GIn Tyr Arg His Tyr

85 90 95

Trp Ser GIu Asn Leu Phe GIn Cys Phe Asn Cys Ser Leu Cys Leu Asn

100 105 110

GIy Thr VaI His Leu Ser Cys GIn GIu Lys GIn Asn Thr VaI Cys Thr

115 120 125

Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro GIu Leu Leu

130 135 140

GIy GIy Pro Ser VaI Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Asn 145 150 155 160

Pro Lys Asp Asp Trp Phe Met Leu GIy Leu Arg Asp GIy Arg Pro GIu

165 170 175 lie GIn Leu His Asn His Trp Ala GIn Leu Thr VaI GIy Ala GIy Pro

180 185 190

Arg Leu Asp Asp GIy Arg Trp His GIn VaI GIu VaI Lys Met GIu GIy

195 200 205

Asp Ser VaI Leu Leu GIu VaI Asp GIy GIu GIu VaI Leu Arg Leu Arg

210 215 220

GIn VaI Ser GIy Pro Leu Thr Ser Lys Arg His Pro lie Met Arg lie 225 230 235 240

Ala Leu GIy GIy Leu Leu Phe Pro Ala Ser Asn Leu Arg Leu Pro Leu

245 250 255

VaI Pro Ala Leu Asp GIy Cys Leu Arg Arg Asp Ser Trp Leu Asp Lys

260 265 270

GIn Ala GIu lie Ser Ala Ser Ala Pro Thr Ser Leu Arg Ser Cys Asp

275 280 285

VaI GIu Ser Asn Pro GIy lie Phe Leu Pro Pro GIy Thr GIn Ala GIu

290 295 300

Phe Asn Leu Arg Asp lie Pro GIn Pro His Ala GIu Pro Trp Ala Phe 305 310 315 320

Ser Leu Asp Leu GIy Leu Lys GIn Ala Ala GIy Ser GIy His Leu Leu

325 330 335

Ala Leu GIy Thr Pro GIu Asn Pro Ser Trp Leu Ser Leu His Leu GIn

340 345 350

Asp GIn Lys VaI VaI Leu Ser Ser GIy Ser 355 360

SEQ ID NO:59 atggatagtg tgtgtcccca aggaaaatat atccaccctc aaaataattc gatttgctgt 60 accaagtgcc acaaaggaac ctacttgtac aatgactgtc caggcccggg gcaggatacg 120 gactgcaggg agtgtgagag cggctccttc accgcttcag aaaaccacct cagacactgc 180 ctcagctgct ccaaatgccg aaaggaaatg ggtcaggtgg agatctcttc ttgcacagtg 240 gaccgggaca ccgtgtgtgg ctgcaggaag aaccagtacc ggcattattg gagtgaaaac 300 cttttccagt gcttcaattg cagcctctgc ctcaatggga ccgtgcacct ctcctgccag 360 gagaaacaga acaccgtgtg cacctgccat gcaggtttct ttctaagaga aaacgagtgt 420 gtctcctgta gtaactgtaa gaaaagcctg gagtgcacga agttgtgcct accccagatt 480 gagaattgcg acaagaccca cacctgcccc ccctgccccg cccccgagct gctgggcggc 540 ccctccgtgt tcctgttccc ccccaagccc aaggatacca accctaagga tgactggttt 600 atgctgggac ttcgagacgg caggcctgag atccaactgc acaatcactg ggcccagctt 660 acggtgggtg ctggaccacg gctggatgat gggagatggc accaggtgga agtcaagatg 720 gagggggact ctgtgctgct ggaggtggat ggggaggagg tgctgcgcct gagacaggtc 780 tctgggcccc tgaccagcaa acgccatccc atcatgagga ttgcgcttgg ggggctgctc 840 ttccccgctt ccaaccttcg gttgccgctg gttcctgccc tggatggctg cctgcgccgg 900 gattcctggc tggacaaaca ggccgagatc tcagcatctg cccccactag cctcagaagc 960 tgtgatgtag aatcaaatcc cgggatattt ctccctccag ggactcaggc agaattcaat 1020 ctccgagaca ttccccagcc tcatgcagag ccctgggcct tctctttgga cctgggactc 1080 aagcaggcag caggctcagg ccacctcctt gctcttggga caccagagaa cccatcttgg 1140 ctcagtctcc acctccaaga tcaaaaggtg gtgttgtctt ctgggtcgtg a 1191

SEQ ID NO: 60

Met Asp Ser VaI Cys Pro GIn GIy Lys Tyr lie His Pro GIn Asn Asn

1 5 10 15

Ser lie Cys Cys Thr Lys Cys His Lys GIy Thr Tyr Leu Tyr Asn Asp

20 25 30

Cys Pro GIy Pro GIy GIn Asp Thr Asp Cys Arg GIu Cys GIu Ser GIy

35 40 45

Ser Phe Thr Ala Ser GIu Asn His Leu Arg His Cys Leu Ser Cys Ser

50 55 60

Lys Cys Arg Lys GIu Met GIy GIn VaI GIu He Ser Ser Cys Thr VaI 65 70 75 80

Asp Arg Asp Thr VaI Cys GIy Cys Arg Lys Asn GIn Tyr Arg His Tyr

85 90 95

Trp Ser GIu Asn Leu Phe GIn Cys Phe Asn Cys Ser Leu Cys Leu Asn

100 105 HO

GIy Thr VaI His Leu Ser Cys GIn GIu Lys GIn Asn Thr VaI Cys Thr

115 120 125

Cys His Ala GIy Phe Phe Leu Arg GIu Asn GIu Cys VaI Ser Cys Ser

130 135 140

Asn Cys Lys Lys Ser Leu GIu Cys Thr Lys Leu Cys Leu Pro GIn He 145 150 155 160

GIu Asn Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro GIu

165 170 175

Leu Leu GIy GIy Pro Ser VaI Phe Leu Phe Pro Pro Lys Pro Lys Asp

180 185 190

Thr Asn Pro Lys Asp Asp Trp Phe Met Leu GIy Leu Arg Asp GIy Arg

195 200 205

Pro GIu He GIn Leu His Asn His Trp Ala GIn Leu Thr VaI GIy Ala

210 215 220

GIy Pro Arg Leu Asp Asp GIy Arg Trp His GIn VaI GIu VaI Lys Met 225 230 235 240

GIu GIy Asp Ser VaI Leu Leu GIu VaI Asp GIy GIu GIu VaI Leu Arg

245 250 255

Leu Arg GIn VaI Ser GIy Pro Leu Thr Ser Lys Arg His Pro He Met

260 265 270

Arg He Ala Leu GIy GIy Leu Leu Phe Pro Ala Ser Asn Leu Arg Leu 275 280 285

Pro Leu VaI Pro Ala Leu Asp GIy Cys Leu Arg Arg Asp Ser Trp Leu

290 295 300

Asp Lys GIn Ala GIu He Ser Ala Ser Ala Pro Thr Ser Leu Arg Ser

305 310 315 320

Cys Asp VaI GIu Ser Asn Pro GIy He Phe Leu Pro Pro GIy Thr GIn

325 330 335

Ala GIu Phe Asn Leu Arg Asp He Pro GIn Pro His Ala GIu Pro Trp

340 345 350

Ala Phe Ser Leu Asp Leu GIy Leu Lys GIn Ala Ala GIy Ser GIy His

355 360 365

Leu Leu Ala Leu GIy Thr Pro GIu Asn Pro Ser Trp Leu Ser Leu His

370 375 380

Leu GIn Asp GIn Lys VaI VaI Leu Ser Ser GIy Ser

385 390 395

SEQ ID NO: 61 atgggcctct ccaccgtgcc tgacctgctg ctgccactgg tgctcctgga gctgttggtg 60 ggaatatacc cctcaggggt tattggactg gtccctcacc taggggacag ggagaagaga 120 gatagtgtgt gtccccaagg aaaatatatc caccctcaaa ataattcgat ttgctgtacc 180 aagtgccaca aaggaaccta cttgtacaat gactgtccag gcccggggca ggatacggac 240 tgcagggagt gtgagagcgg ctccttcacc gcttcagaaa accacctcag acactgcctc 300 agctgctcca aatgccgaaa ggaaatgggt caggtggaga tctcttcttg cacagtggac 360 cgggacaccg tgtgtggctg caggaagaac cagtaccggc attattggag tgaaaacctt 420 ttccagtgct tcaattgcag cctctgcgac aagacccaca cctgcccccc ctgccccgcc 480 cccgagctgc tgggcggccc ctccgtgttc ctgttccccc ccaagcccaa ggataccaac 540 cctaaggatg actggtttat gctgggactt cgagacggca ggcctgagat ccaactgcac 600 aatcactggg cccagcttac ggtgggtgct ggaccacggc tggatgatgg gagatggcac 660 caggtggaag tcaagatgga gggggactct gtgctgctgg aggtggatgg ggaggaggtg 720 ctgcgcctga gacaggtctc tgggcccctg accagcaaac gccatcccat catgaggatt 780 gcgcttgggg ggctgctctt ccccgcttcc aaccttcggt tgccgctggt tcctgccctg 840 gatggctgcc tgcgccggga ttcctggctg gacaaacagg ccgagatctc agcatctgcc 900 cccactagcc tcagaagctg tgatgtagaa tcaaatcccg ggatatttct ccctccaggg 960 actcaggcag aattcaatct ccgagacatt ccccagcctc atgcagagcc ctgggccttc 1020 tctttggacc tgggactcaa gcaggcagca ggctcaggcc acctccttgc tcttgggaca 1080 ccagagaacc catcttggct cagtctccac ctccaagatc aaaaggtggt gttgtcttct 1140 gggtcgtga 1149

SEQ ID NO: 62

Met GIy Leu Ser Thr VaI Pro Asp Leu Leu Leu Pro Leu VaI Leu Leu

1 5 10 15

GIu Leu Leu VaI GIy He Tyr Pro Ser GIy VaI He GIy Leu VaI Pro

20 25 30

His Leu GIy Asp Arg GIu Lys Arg Asp Ser VaI Cys Pro GIn GIy Lys

35 40 45

Tyr lie His Pro GIn Asn Asn Ser He Cys Cys Thr Lys Cys His Lys

50 55 60

GIy Thr Tyr Leu Tyr Asn Asp Cys Pro GIy Pro GIy GIn Asp Thr Asp

65 70 75 80

Cys Arg GIu Cys GIu Ser GIy Ser Phe Thr Ala Ser GIu Asn His Leu

85 90 95

Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys GIu Met GIy GIn VaI

100 105 HO

GIu He Ser Ser Cys Thr VaI Asp Arg Asp Thr VaI Cys GIy Cys Arg

115 120 125

Lys Asn GIn Tyr Arg His Tyr Trp Ser GIu Asn Leu Phe GIn Cys Phe 130 135 140

Asn Cys Ser Leu Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 145 150 155 160

Pro GIu Leu Leu GIy GIy Pro Ser VaI Phe Leu Phe Pro Pro Lys Pro

165 170 175

Lys Asp Thr Asn Pro Lys Asp Asp Trp Phe Met Leu GIy Leu Arg Asp

180 185 190

GIy Arg Pro GIu lie GIn Leu His Asn His Trp Ala GIn Leu Thr VaI

195 200 205

GIy Ala GIy Pro Arg Leu Asp Asp GIy Arg Trp His GIn VaI GIu VaI

210 215 220

Lys Met GIu GIy Asp Ser VaI Leu Leu GIu VaI Asp GIy GIu GIu VaI 225 230 235 240

Leu Arg Leu Arg GIn VaI Ser GIy Pro Leu Thr Ser Lys Arg His Pro

245 250 255 lie Met Arg lie Ala Leu GIy GIy Leu Leu Phe Pro Ala Ser Asn Leu

260 265 270

Arg Leu Pro Leu VaI Pro Ala Leu Asp GIy Cys Leu Arg Arg Asp Ser

275 280 285

Trp Leu Asp Lys GIn Ala GIu lie Ser Ala Ser Ala Pro Thr Ser Leu

290 295 300

Arg Ser Cys Asp VaI GIu Ser Asn Pro GIy lie Phe Leu Pro Pro GIy 305 310 315 320

Thr GIn Ala GIu Phe Asn Leu Arg Asp lie Pro GIn Pro His Ala GIu

325 330 335

Pro Trp Ala Phe Ser Leu Asp Leu GIy Leu Lys GIn Ala Ala GIy Ser

340 345 350

GIy His Leu Leu Ala Leu GIy Thr Pro GIu Asn Pro Ser Trp Leu Ser

355 360 365

Leu His Leu GIn Asp GIn Lys VaI VaI Leu Ser Ser GIy Ser 370 375 380

SEQ ID NO: 63 atgggcctct ccaccgtgcc tgacctgctg ctgccactgg tgctcctgga gctgttggtg 60 ggaatatacc cctcaggggt tattggactg gtccctcacc taggggacag ggagaagaga 120 gatagtgtgt gtccccaagg aaaatatatc caccctcaaa ataattcgat ttgctgtacc 180 aagtgccaca aaggaaccta cttgtacaat gactgtccag gcccggggca ggatacggac 240 tgcagggagt gtgagagcgg ctccttcacc gcttcagaaa accacctcag acactgcctc 300 agctgctcca aatgccgaaa ggaaatgggt caggtggaga tctcttcttg cacagtggac 360 cgggacaccg tgtgtggctg caggaagaac cagtaccggc attattggag tgaaaacctt 420 ttccagtgct tcaattgcag cctctgcctc aatgggaccg tgcacctctc ctgccaggag 480 aaacagaaca ccgtgtgcac ctgcgacaag acccacacct gccccccctg ccccgccccc 540 gagctgctgg gcggcccctc cgtgttcctg ttccccccca agcccaagga taccaaccct 600 aaggatgact ggtttatgct gggacttcga gacggcaggc ctgagatcca actgcacaat 660 cactgggccc agcttacggt gggtgctgga ccacggctgg atgatgggag atggcaccag 720 gtggaagtca agatggaggg ggactctgtg ctgctggagg tggatgggga ggaggtgctg 780 cgcctgagac aggtctctgg gcccctgacc agcaaacgcc atcccatcat gaggattgcg 840 cttggggggc tgctcttccc cgcttccaac cttcggttgc cgctggttcc tgccctggat 900 ggctgcctgc gccgggattc ctggctggac aaacaggccg agatctcagc atctgccccc 960 actagcctca gaagctgtga tgtagaatca aatcccggga tatttctccc tccagggact 1020 caggcagaat tcaatctccg agacattccc cagcctcatg cagagccctg ggccttctct 1080 ttggacctgg gactcaagca ggcagcaggc tcaggccacc tccttgctct tgggacacca 1140 gagaacccat cttggctcag tctccacctc caagatcaaa aggtggtgtt gtcttctggg 1200 tcgtga 1206

SEQ ID NO: 64 Met GIy Leu Ser Thr VaI Pro Asp Leu Leu Leu Pro Leu VaI Leu Leu

1 5 10 15

GIu Leu Leu VaI GIy He Tyr Pro Ser GIy VaI He GIy Leu VaI Pro

20 25 30

His Leu GIy Asp Arg GIu Lys Arg Asp Ser VaI Cys Pro GIn GIy Lys

35 40 45

Tyr He His Pro GIn Asn Asn Ser He Cys Cys Thr Lys Cys His Lys

50 55 60

GIy Thr Tyr Leu Tyr Asn Asp Cys Pro GIy Pro GIy GIn Asp Thr Asp

65 70 75 80

Cys Arg GIu Cys GIu Ser GIy Ser Phe Thr Ala Ser GIu Asn His Leu

85 90 95

Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys GIu Met GIy GIn VaI

100 105 HO

GIu He Ser Ser Cys Thr VaI Asp Arg Asp Thr VaI Cys GIy Cys Arg

115 120 125

Lys Asn GIn Tyr Arg His Tyr Trp Ser GIu Asn Leu Phe GIn Cys Phe

130 135 140

Asn Cys Ser Leu Cys Leu Asn GIy Thr VaI His Leu Ser Cys GIn GIu

145 150 155 160

Lys GIn Asn Thr VaI Cys Thr Cys Asp Lys Thr His Thr Cys Pro Pro

165 170 175

Cys Pro Ala Pro GIu Leu Leu GIy GIy Pro Ser VaI Phe Leu Phe Pro

180 185 190

Pro Lys Pro Lys Asp Thr Asn Pro Lys Asp Asp Trp Phe Met Leu GIy

195 200 205

Leu Arg Asp GIy Arg Pro GIu He GIn Leu His Asn His Trp Ala GIn

210 215 220

Leu Thr VaI GIy Ala GIy Pro Arg Leu Asp Asp GIy Arg Trp His GIn

225 230 235 240

VaI GIu VaI Lys Met GIu GIy Asp Ser VaI Leu Leu GIu VaI Asp GIy

245 250 255

GIu GIu VaI Leu Arg Leu Arg GIn VaI Ser GIy Pro Leu Thr Ser Lys

260 265 270

Arg His Pro He Met Arg He Ala Leu GIy GIy Leu Leu Phe Pro Ala

275 280 285

Ser Asn Leu Arg Leu Pro Leu VaI Pro Ala Leu Asp GIy Cys Leu Arg

290 295 300

Arg Asp Ser Trp Leu Asp Lys GIn Ala GIu He Ser Ala Ser Ala Pro

305 310 315 320

Thr Ser Leu Arg Ser Cys Asp VaI GIu Ser Asn Pro GIy He Phe Leu

325 330 335

Pro Pro GIy Thr GIn Ala GIu Phe Asn Leu Arg Asp He Pro GIn Pro

340 345 350

His Ala GIu Pro Trp Ala Phe Ser Leu Asp Leu GIy Leu Lys GIn Ala

355 360 365

Ala GIy Ser GIy His Leu Leu Ala Leu GIy Thr Pro GIu Asn Pro Ser

370 375 380

Trp Leu Ser Leu His Leu GIn Asp GIn Lys VaI VaI Leu Ser Ser GIy

385 390 395 400

Ser

SEQ ID NO : 65 atgggcctct ccaccgtgcc tgacctgctg ctgccactgg tgctcctgga gctgttggtg 60 ggaatatacc cctcaggggt tattggactg gtccctcacc taggggacag ggagaagaga 120 gatagtgtgt gtccccaagg aaaatatatc caccctcaaa ataattcgat ttgctgtacc 180 aagtgccaca aaggaaccta cttgtacaat gactgtccag gcccggggca ggatacggac 240 tgcagggagt gtgagagcgg ctccttcacc gcttcagaaa accacctcag acactgcctc 300 agctgctcca aatgccgaaa ggaaatgggt caggtggaga tctcttcttg cacagtggac 360 cgggacaccg tgtgtggctg caggaagaac cagtaccggc attattggag tgaaaacctt 420 ttccagtgct tcaattgcag cctctgcctc aatgggaccg tgcacctctc ctgccaggag 480 aaacagaaca ccgtgtgcac ctgccatgca ggtttctttc taagagaaaa cgagtgtgtc 540 tcctgtagta actgtaagaa aagcctggag tgcacgaagt tgtgcctacc ccagattgag 600 aattgcgaca agacccacac ctgccccccc tgccccgccc ccgagctgct gggcggcccc 660 tccgtgttcc tgttcccccc caagcccaag gataccaacc ctaaggatga ctggtttatg 720 ctgggacttc gagacggcag gcctgagatc caactgcaca atcactgggc ccagcttacg 780 gtgggtgctg gaccacggct ggatgatggg agatggcacc aggtggaagt caagatggag 840 ggggactctg tgctgctgga ggtggatggg gaggaggtgc tgcgcctgag acaggtctct 900 gggcccctga ccagcaaacg ccatcccatc atgaggattg cgcttggggg gctgctcttc 960 cccgcttcca accttcggtt gccgctggtt cctgccctgg atggctgcct gcgccgggat 1020 tcctggctgg acaaacaggc cgagatctca gcatctgccc ccactagcct cagaagctgt 1080 gatgtagaat caaatcccgg gatatttctc cctccaggga ctcaggcaga attcaatctc 1140 cgagacattc cccagcctca tgcagagccc tgggccttct ctttggacct gggactcaag 1200 caggcagcag gctcaggcca cctccttgct cttgggacac cagagaaccc atcttggctc 1260 agtctccacc tccaagatca aaaggtggtg ttgtcttctg ggtcgtga 1308

SEQ ID NO: 66

Met GIy Leu Ser Thr VaI Pro Asp Leu Leu Leu Pro Leu VaI Leu Leu

1 5 10 15

GIu Leu Leu VaI GIy He Tyr Pro Ser GIy VaI He GIy Leu VaI Pro

20 25 30

His Leu GIy Asp Arg GIu Lys Arg Asp Ser VaI Cys Pro GIn GIy Lys

35 40 45

Tyr lie His Pro GIn Asn Asn Ser He Cys Cys Thr Lys Cys His Lys

50 55 60

GIy Thr Tyr Leu Tyr Asn Asp Cys Pro GIy Pro GIy GIn Asp Thr Asp

65 70 75 80

Cys Arg GIu Cys GIu Ser GIy Ser Phe Thr Ala Ser GIu Asn His Leu

85 90 95

Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys GIu Met GIy GIn VaI

100 105 HO

GIu He Ser Ser Cys Thr VaI Asp Arg Asp Thr VaI Cys GIy Cys Arg

115 120 125

Lys Asn GIn Tyr Arg His Tyr Trp Ser GIu Asn Leu Phe GIn Cys Phe

130 135 140

Asn Cys Ser Leu Cys Leu Asn GIy Thr VaI His Leu Ser Cys GIn GIu

145 150 155 160

Lys GIn Asn Thr VaI Cys Thr Cys His Ala GIy Phe Phe Leu Arg GIu

165 170 175

Asn GIu Cys VaI Ser Cys Ser Asn Cys Lys Lys Ser Leu GIu Cys Thr

180 185 190

Lys Leu Cys Leu Pro GIn He GIu Asn Cys Asp Lys Thr His Thr Cys

195 200 205

Pro Pro Cys Pro Ala Pro GIu Leu Leu GIy GIy Pro Ser VaI Phe Leu

210 215 220

Phe Pro Pro Lys Pro Lys Asp Thr Asn Pro Lys Asp Asp Trp Phe Met

225 230 235 240

Leu GIy Leu Arg Asp GIy Arg Pro GIu He GIn Leu His Asn His Trp

245 250 255

Ala GIn Leu Thr VaI GIy Ala GIy Pro Arg Leu Asp Asp GIy Arg Trp

260 265 270 His GIn VaI GIu VaI Lys Met GIu GIy Asp Ser VaI Leu Leu GIu VaI

275 280 285

Asp GIy GIu GIu VaI Leu Arg Leu Arg GIn VaI Ser GIy Pro Leu Thr

290 295 300

Ser Lys Arg His Pro lie Met Arg lie Ala Leu GIy GIy Leu Leu Phe 305 310 315 320

Pro Ala Ser Asn Leu Arg Leu Pro Leu VaI Pro Ala Leu Asp GIy Cys

325 330 335

Leu Arg Arg Asp Ser Trp Leu Asp Lys GIn Ala GIu lie Ser Ala Ser

340 345 350

Ala Pro Thr Ser Leu Arg Ser Cys Asp VaI GIu Ser Asn Pro GIy lie

355 360 365

Phe Leu Pro Pro GIy Thr GIn Ala GIu Phe Asn Leu Arg Asp lie Pro

370 375 380

GIn Pro His Ala GIu Pro Trp Ala Phe Ser Leu Asp Leu GIy Leu Lys 385 390 395 400

GIn Ala Ala GIy Ser GIy His Leu Leu Ala Leu GIy Thr Pro GIu Asn

405 410 415

Pro Ser Trp Leu Ser Leu His Leu GIn Asp GIn Lys VaI VaI Leu Ser

420 425 430

Ser GIy Ser 435

SEQ ID NO: 67 atgtgcgaca agacccacac ctgccccccc tgccccgccc ccgagctgct gggcggcccc 60 tccgtgttcc tgttcccccc caagcccaag gataccaacc ctaaggatga ctggtttatg 120 ctgggacttc gagacggcag gcctgagatc caactgcaca atcactgggc ccagcttacg 180 gtgggtgctg gaccacggct ggatgatggg agatggcacc aggtggaagt caagatggag 240 ggggactctg tgctgctgga ggtggatggg gaggaggtgc tgcgcctgag acaggtctct 300 gggcccctga ccagcaaacg ccatcccatc atgaggattg cgcttggggg gctgctcttc 360 cccgcttcca accttcggtt gccgctggtt cctgccctgg atggctgcct gcgccgggat 420 tcctggctgg acaaacaggc cgagatctca gcatctgccc ccactagcct cagaagctgt 480 gatgtagaat caaatcccgg gatatttctc cctccaggga ctcaggcaga attcaatctc 540 cgagacattc cccagcctca tgcagagccc tgggccttct ctttggacct gggactcaag 600 caggcagcag gctcaggcca cctccttgct cttgggacac cagagaaccc atcttggctc 660 agtctccacc tccaagatca aaaggtggtg ttgtcttctg ggtcgtgagg atccaa 716

SEQ ID NO: 68 aacatatgcc cgcccagg 18

SEQ ID NO: 69 cccggctggt actgctgcga caagacccac ace 33

SEQ ID NO:70 ggtgtgggtc ttgtcgcagc agtaccagcc ggg 33

SEQ ID NO:71 gttcaatggt cgaaccattt atcatcgtgt ttttc 35

SEQ ID NO: 72 gaaaaacacg atgataaatg gttcgaccat tgaac 35

SEQ ID NO: 73 gctagccgcc cctctccctc 20

SEQ ID NO: 74 ggatccttag tctttcttct 20

SEQ ID NO: 75 gctagccgcc cctctccctc ccccccccct aacgttactg gccgaagccg cttggaataa 60 ggccggtgtg cgtttgtcta tatgttattt tccaccatat tgccgtcttt tggcaatgtg 120 agggcccgga aacctggccc tgtcttcttg acgagcattc ctaggggtct ttcccctctc 180 gccaaaggaa tgcaaggtct gttgaatgtc gtgaaggaag cagttcctct ggaagcttct 240 tgaagacaaa caacgtctgt agcgaccctt tgcaggcagc ggaacccccc acctggcgac 300 aggtgcctct gcggccaaaa gccacgtgta taagatacac ctgcaaaggc ggcacaaccc 360 cagtgccacg ttgtgagttg gatagttgtg gaaagagtca aatggctctc ctcaagcgta 420 ttcaacaagg ggctgaagga tgcccagaag gtaccccatt gtatgggatc tgatctgggg 480 cctcggtgca catgctttac atgtgtttag tcgaggttaa aaaaacgtct aggccccccg 540 aaccacgggg acgtggtttt cctttgaaaa acacgatgat aaatggttcg accattgaac 600 tgcatcgtcg ccgtgtccca aaatatgggg attggcaaga acggagacct accctggcct 660 ccgctcagga acgagttcaa gtacttccaa agaatgacca caacctcttc agtggaaggt 720 aaacagaatc tggtgattat gggtaggaaa acctggttct ccattcctga gaagaatcga 780 cctttaaagg acagaattaa tatagttctc agtagagaac tcaaagaacc accacgagga 840 gctcattttc ttgccaaaag tttggatgat gccttaagac ttattgaaca accggaattg 900 gcaagtaaag tagacatggt ttggatagtc ggaggcagtt ctgtttacca ggaagccatg 960 aatcaaccag gccacctcag actctttgtg acaaggatca tgcaggaatt tgaaagtgac 1020 acgtttttcc cagaaattga tttggggaaa tataaacttc tcccagaata cccaggcgtc 1080 ctctctgagg tccaggagga aaaaggcatc aagtataagt ttgaagtcta cgagaagaaa 1140 gactaaggat cc 1152

SEQ ID NO: 76 gtcgacctca tgtttgacag cttatcatcg ataagcttct gtggaatgtg tgtcagttag 60 ggtgtggaaa gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt 120 agtcagcaac caggtgtgga aagtccccag gctccccagc aggcagaagt atgcaaagca 180 tgcatctcaa ttagtcagca accatagtcc cgcccctaac tccgcccatc ccgcccctaa 240 ctccgcccag ttccgcccat tctccgcccc atggctgact aatttttttt atttatgcag 300 aggccgaggc cgcctcggcc tctgagctat tccagaagta gtgaggaggc ttttttggag 360 gcctaggctt ttgcaaaaag ctcctccgat cgaggggctc gcatctctcc ttcacgcgcc 420 cgccgcccta cctgaggccg ccatccacgc cggttgagtc gcgttctgcc gcctcccgcc 480 tgtggtgcct cctgaactgc gtccgccgtc taggtaagtt taaagctcag gtcgagaccg 540 ggcctttgtc cggcgctccc ttggagccta cctagactca gcccggctct ccacgctttg 600 cctgaccctg cttgctcaac tctacgtctt tgtttcgttt ttgttctgcg ccgttacaga 660 tccaagctgc ctcgaggaac tgaaaaacca gaaagttaac tggtaagttt agtctttttg 720 tcttttattt caggtcccgg atctggtacc gagctcacta gtacgcgtga attctgcaga 780 tatccagctg gcggccgcgc tagcgggccc ggatccagac atgataagat acattgatga 840 gtttggacaa accacaacta gaatgcagtg aaaaaaatgc tttatttgtg aaatttgtga 900 tgctattgct ttatttgtaa ccattataag ctgcaataaa caagttaaca acaacaattg 960 cattcatttt atgtttcagg ttcaggggga ggtgtgggag gttttttaaa gcaagtaaaa 1020 cctctacaaa tgtggtatgg ctgattatga tcctgcctcg cgcgtttcgg tgatgacggt 1080 gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc 1140 gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc 1200 atgacccagt cacgtagcga tagcggagtg tatactggct taactatgcg gcatcagagc 1260 agattgtact gagagtgcac catatgcggt gtgaaatacc gcacagatgc gtaaggagaa 1320 aataccgcat caggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc 1380 ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag 1440 gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa 1500 aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc 1560 gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc 1620 ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg 1680 cctttctccc ttcgggaagc gtggcgcttt ctcaatgctc acgctgtagg tatctcagtt 1740 cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc 1800 gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc 1860 cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag 1920 agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg 1980 ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa 2040 ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag 2100 gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact 2160 cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa 2220 attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt 2280 accaatgctt aatcagtgag gcacctatct cagcgatgtg tctatttcgt tcatccatag 2340 ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca 2400 gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc 2460 agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt 2520 ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg 2580 ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca 2640 gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg 2700 ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca 2760 tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaca tgcttttctg 2820 tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct 2880 cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca 2940 tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca 3000 gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg 3060 tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac 3120 ggaaatgttg aatactactc ttcctttttc aatattattg aagcatttat cagggttatt 3180 gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata ggggttccgc 3240 gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac cattattatc atgacattaa 3300 cctataaaaa taggcgtatc acgaggccct ttcgtcttca ag 3342

SEQ ID NO: 77 atcccctgac aagctgccag gcaggttctc 30

SEQ ID NO:78 aggggaggcg tttgggaagg ttggatgttc 30

SEQ ID NO: 79 atcccctgac aagctgccag gcaggttctc ttcctctcac atactgaccc acggctccac 60 cctctctccc ctggaaagga caccatgagc actgaaagca tgatccggga cgtggagctg 120 gccgaggagg cgctccccaa gaagacaggg gggccccagg gctccaggcg gtgcttgttc 180 ctcagcctct tctccttcct gatcgtggca ggcgccacca cgctcttctg cctgctgcac 240 tttggagtga tcggccccca gagggaagag ttccccaggg acctctctct aatcagccct 300 ctggcccagg cagtcagatc atcttctcga accccgagtg acaagcctgt agcccatgtt 360 gtagcaaacc ctcaagctga ggggcagctc cagtggctga accgccgggc caatgccctc 420 ctggccaatg gcgtggagct gagagataac cagctggtgg tgccatcaga gggcctgtac 480 ctcatctact cccaggtcct cttcaagggc caaggctgcc cctccaccca tgtgctcctc 540 acccacacca tcagccgcat cgccgtctcc taccagacca aggtcaacct cctctctgcc 600 atcaagagcc cctgccagag ggagacccca gagggggctg aggccaagcc ctggtatgag 660 cccatctatc tgggaggggt cttccagctg gagaagggtg accgactcag cgctgagatc 720 aatcggcccg actatctcga ctttgccgag tctgggcagg tctactttgg gatcattgcc 780 ctgtgaggag gacgaacatc caaccttccc aaacgcctcc cct 823

SEQ ID NO: 80 gtcagatcat cttctcgaac cccgagtgac aagcctgtag cccatgttgt agcaaaccct 60 caagctgagg ggcagctcca gtggctgaac cgccgggcca atgccctcct ggccaatggc 120 gtggagctga gagataacca gctggtggtg ccatcagagg gcctgtacct catctactcc 180 caggtcctct tcaagggcca aggctgcccc tccacccatg tgctcctcac ccacaccatc 240 agccgcatcg ccgtctccta ccagaccaag gtcaacctcc tctctgccat caagagcccc 300 tgccagaggg agaccccaga gggggctgag gccaagccct ggtatgagcc catctatctg 360 ggaggggtct tccagctgga gaagggtgac cgactcagcg ctgagatcaa tcggcccgac 420 tatctcgact ttgccgagtc tgggcaggtc tactttggga tcattgccct gtga 474

SEQ ID NO: 81 aaccatatgg tcagatcatc ttctcgaac 29

SEQ ID NO: 82 ggttggatcc tcacagggca atg 23

SEQ ID NO: 83 ttggatcctt aacagatctg gtgg 24

SEQ ID NO: 84 atgcccgccc aggtggcatt tacaccctac gccccggagc ccgggagcac atgccggctc 60 agagaatact atgaccagac agctcagatg tgctgcagca aatgctcgcc gggccaacat 120 gcaaaagtct tctgtaccaa gacctcggac accgtgtgtg actcctgtga ggacagcaca 180 tacacccagc tctggaactg ggttcccgag tgcttgagct gtggctcccg ctgtagctct 240 gaccaggtgg aaactcaagc ctgcactcgg gaacagaacc gcatctgcac ctgcaggccc 300 ggctggtact gcgcgctgag caagcaggag gggtgccggc tgtgcgcgcc gctgcgcaag 360 tgccgcccgg gcttcggcgt ggccagacca ggaactgaaa catcagacgt ggtgtgcaag 420 ccctgtgccc cggggacgtt ctccaacacg acttcatcca cggatatttg caggccccac 480 cagatctgtt aa 492

SEQ ID NO: 85 cccaccagat ctgttgcgac aagacccaca c 31

SEQ ID NO: 86 gtgtgggtct tgtcgcaaca gatctggtgg g 31

SEQ ID NO: 87 atgcccgccc aggtggcatt tacaccctac gccccggagc ccgggagcac atgccggctc 60 agagaatact atgaccagac agctcagatg tgctgcagca aatgctcgcc gggccaacat 120 gcaaaagtct tctgtaccaa gacctcggac accgtgtgtg actcctgtga ggacagcaca 180 tacacccagc tctggaactg ggttcccgag tgcttgagct gtggctcccg ctgtagctct 240 gaccaggtgg aaactcaagc ctgcactcgg gaacagaacc gcatctgcac ctgcaggccc 300 ggctggtact gcgcgctgag caagcaggag gggtgccggc tgtgcgcgcc gctgcgcaag 360 tgccgcccgg gcttcggcgt ggccagacca ggaactgaaa catcagacgt ggtgtgcaag 420 ccctgtgccc cggggacgtt ctccaacacg acttcatcca cggatatttg caggccccac 480 cagatctgtt gcgacaagac ccacacctgc cccccctgcc ccgcccccga gctgctgggc 540 ggcccctccg tgttcctgtt cccccccaag cccaaggata ccaaccctaa ggatgactgg 600 tttatgctgg gacttcgaga cggcaggcct gagatccaac tgcacaatca ctgggcccag 660 cttacggtgg gtgctggacc acggctggat gatgggagat ggcaccaggt ggaagtcaag 720 atggaggggg actctgtgct gctggaggtg gatggggagg aggtgctgcg cctgagacag 780 gtctctgggc ccctgaccag caaacgccat cccatcatga ggattgcgct tggggggctg 840 ctcttccccg cttccaacct tcggttgccg ctggttcctg ccctggatgg ctgcctgcgc 900 cgggattcct ggctggacaa acaggccgag atctcagcat ctgcccccac tagcctcaga 960 agctgtgatg tagaatcaaa tcccgggata tttctccctc cagggactca ggcagaattc 1020 aatctccgag acattcccca gcctcatgca gagccctggg ccttctcttt ggacctggga 1080 ctcaagcagg cagcaggctc aggccacctc cttgctcttg ggacaccaga gaacccatct 1140 tggctcagtc tccacctcca agatcaaaag gtggtgttgt cttctgggtc gtga 1194

SEQ ID NO: 88

Met Pro Ala GIn VaI Ala Phe Thr Pro Tyr Ala Pro GIu Pro GIy Ser

1 5 10 15

Thr Cys Arg Leu Arg GIu Tyr Tyr Asp GIn Thr Ala GIn Met Cys Cys

20 25 30

Ser Lys Cys Ser Pro GIy GIn His Ala Lys VaI Phe Cys Thr Lys Thr 35 40 45

Ser Asp Thr VaI Cys Asp Ser Cys GIu Asp Ser Thr Tyr Thr GIn Leu

50 55 60

Trp Asn Trp VaI Pro GIu Cys Leu Ser Cys GIy Ser Arg Cys Ser Ser 65 70 75 80

Asp GIn VaI GIu Thr GIn Ala Cys Thr Arg GIu GIn Asn Arg lie Cys

85 90 95

Thr Cys Arg Pro GIy Trp Tyr Cys Ala Leu Ser Lys GIn GIu GIy Cys

100 105 110

Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg Pro GIy Phe GIy VaI Ala

115 120 125

Arg Pro GIy Thr GIu Thr Ser Asp VaI VaI Cys Lys Pro Cys Ala Pro

130 135 140

GIy Thr Phe Ser Asn Thr Thr Ser Ser Thr Asp lie Cys Arg Pro His 145 150 155 160

GIn lie Cys Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro

165 170 175

GIu Leu Leu GIy GIy Pro Ser VaI Phe Leu Phe Pro Pro Lys Pro Lys

180 185 190

Asp Thr Asn Pro Lys Asp Asp Trp Phe Met Leu GIy Leu Arg Asp GIy

195 200 205

Arg Pro GIu lie GIn Leu His Asn His Trp Ala GIn Leu Thr VaI GIy

210 215 220

Ala GIy Pro Arg Leu Asp Asp GIy Arg Trp His GIn VaI GIu VaI Lys 225 230 235 240

Met GIu GIy Asp Ser VaI Leu Leu GIu VaI Asp GIy GIu GIu VaI Leu

245 250 255

Arg Leu Arg GIn VaI Ser GIy Pro Leu Thr Ser Lys Arg His Pro lie

260 265 270

Met Arg lie Ala Leu GIy GIy Leu Leu Phe Pro Ala Ser Asn Leu Arg

275 280 285

Leu Pro Leu VaI Pro Ala Leu Asp GIy Cys Leu Arg Arg Asp Ser Trp

290 295 300

Leu Asp Lys GIn Ala GIu lie Ser Ala Ser Ala Pro Thr Ser Leu Arg 305 310 315 320

Ser Cys Asp VaI GIu Ser Asn Pro GIy lie Phe Leu Pro Pro GIy Thr

325 330 335

GIn Ala GIu Phe Asn Leu Arg Asp lie Pro GIn Pro His Ala GIu Pro

340 345 350

Trp Ala Phe Ser Leu Asp Leu GIy Leu Lys GIn Ala Ala GIy Ser GIy

355 360 365

His Leu Leu Ala Leu GIy Thr Pro GIu Asn Pro Ser Trp Leu Ser Leu

370 375 380

His Leu GIn Asp GIn Lys VaI VaI Leu Ser Ser GIy Ser 385 390 395

SEQ ID NO:89 atgtcggaca ccgtgtgtga ctcctgtgag gacagcacat acacccagct ctggaactgg 60 gttcccgagt gcttgagctg tggctcccgc tgtagctctg accaggtgga aactcaagcc 120 tgcactcggg aacagaaccg catctgcacc tgcaggcccg gctggtactg ctgcgacaag 180 acccacacct gccccccctg ccccgccccc gagctgctgg gcggcccctc cgtgttcctg 240 ttccccccca agcccaagga taccaaccct aaggatgact ggtttatgct gggacttcga 300 gacggcaggc ctgagatcca actgcacaat cactgggccc agcttacggt gggtgctgga 360 ccacggctgg atgatgggag atggcaccag gtggaagtca agatggaggg ggactctgtg 420 ctgctggagg tggatgggga ggaggtgctg cgcctgagac aggtctctgg gcccctgacc 480 agcaaacgcc atcccatcat gaggattgcg cttggggggc tgctcttccc cgcttccaac 540 cttcggttgc cgctggttcc tgccctggat ggctgcctgc gccgggattc ctggctggac 600 aaacaggccg agatctcagc atctgccccc actagcctca gaagctgtga tgtagaatca 660 aatcccggga tatttctccc tccagggact caggcagaat tcaatctccg agacattccc 720 cagcctcatg cagagccctg ggccttctct ttggacctgg gactcaagca ggcagcaggc 780 tcaggccacc tccttgctct tgggacacca gagaacccat cttggctcag tctccacctc 840 caagatcaaa aggtggtgtt gtcttctggg tcgtgaa 877

SEQ ID NO: 90

Met Ser Asp Thr VaI Cys Asp Ser Cys GIu Asp Ser Thr Tyr Thr GIn

1 5 10 15

Leu Trp Asn Trp VaI Pro GIu Cys Leu Ser Cys GIy Ser Arg Cys Ser

20 25 30

Ser Asp GIn VaI GIu Thr GIn Ala Cys Thr Arg GIu GIn Asn Arg lie

35 40 45

Cys Thr Cys Arg Pro GIy Trp Tyr Cys Cys Asp Lys Thr His Thr Cys

50 55 60

Pro Pro Cys Pro Ala Pro GIu Leu Leu GIy GIy Pro Ser VaI Phe Leu 65 70 75 80

Phe Pro Pro Lys Pro Lys Asp Thr Asn Pro Lys Asp Asp Trp Phe Met

85 90 95

Leu GIy Leu Arg Asp GIy Arg Pro GIu lie GIn Leu His Asn His Trp

100 105 110

Ala GIn Leu Thr VaI GIy Ala GIy Pro Arg Leu Asp Asp GIy Arg Trp

115 120 125

His GIn VaI GIu VaI Lys Met GIu GIy Asp Ser VaI Leu Leu GIu VaI

130 135 140

Asp GIy GIu GIu VaI Leu Arg Leu Arg GIn VaI Ser GIy Pro Leu Thr 145 150 155 160

Ser Lys Arg His Pro lie Met Arg lie Ala Leu GIy GIy Leu Leu Phe

165 170 175

Pro Ala Ser Asn Leu Arg Leu Pro Leu VaI Pro Ala Leu Asp GIy Cys

180 185 190

Leu Arg Arg Asp Ser Trp Leu Asp Lys GIn Ala GIu lie Ser Ala Ser

195 200 205

Ala Pro Thr Ser Leu Arg Ser Cys Asp VaI GIu Ser Asn Pro GIy lie

210 215 220

Phe Leu Pro Pro GIy Thr GIn Ala GIu Phe Asn Leu Arg Asp lie Pro 225 230 235 240

GIn Pro His Ala GIu Pro Trp Ala Phe Ser Leu Asp Leu GIy Leu Lys

245 250 255

GIn Ala Ala GIy Ser GIy His Leu Leu Ala Leu GIy Thr Pro GIu Asn

260 265 270

Pro Ser Trp Leu Ser Leu His Leu GIn Asp GIn Lys VaI VaI Leu Ser

275 280 285

Ser GIy Ser 290

SEQ ID NO: 91 atggcgcccg tcgccgtctg ggccgcgctg gccgtcggac tggagctctg ggctgcggcg 60 cacgcctcgg acaccgtgtg tgactcctgt gaggacagca catacaccca gctctggaac 120 tgggttcccg agtgcttgag ctgtggctcc cgctgtagct ctgaccaggt ggaaactcaa 180 gcctgcactc gggaacagaa ccgcatctgc acctgcaggc ccggctggta ctgctgcgac 240 aagacccaca cctgcccccc ctgccccgcc cccgagctgc tgggcggccc ctccgtgttc 300 ctgttccccc ccaagcccaa ggataccaac cctaaggatg actggtttat gctgggactt 360 cgagacggca ggcctgagat ccaactgcac aatcactggg cccagcttac ggtgggtgct 420 ggaccacggc tggatgatgg gagatggcac caggtggaag tcaagatgga gggggactct 480 gtgctgctgg aggtggatgg ggaggaggtg ctgcgcctga gacaggtctc tgggcccctg 540 accagcaaac gccatcccat catgaggatt gcgcttgggg ggctgctctt ccccgcttcc 600 aaccttcggt tgccgctggt tcctgccctg gatggctgcc tgcgccggga ttcctggctg 660 gacaaacagg ccgagatctc agcatctgcc cccactagcc tcagaagctg tgatgtagaa 720 tcaaatcccg ggatatttct ccctccaggg actcaggcag aattcaatct ccgagacatt 780 ccccagcctc atgcagagcc ctgggccttc tctttggacc tgggactcaa gcaggcagca 840 ggctcaggcc acctccttgc tcttgggaca ccagagaacc catcttggct cagtctccac 900 ctccaagatc aaaaggtggt gttgtcttct gggtcgtga 939

SEQ ID NO: 92

Thr Met Ala Pro VaI Ala VaI Trp Ala Ala Leu Ala VaI GIy Leu GIu

1 5 10 15

Leu Trp Ala Ala Ala His Ala Ser Asp Thr VaI Cys Asp Ser Cys GIu

20 25 30

Asp Ser Thr Tyr Thr GIn Leu Trp Asn Trp VaI Pro GIu Cys Leu Ser

35 40 45

Cys GIy Ser Arg Cys Ser Ser Asp GIn VaI GIu Thr GIn Ala Cys Thr

50 55 60

Arg GIu GIn Asn Arg lie Cys Thr Cys Arg Pro GIy Trp Tyr Cys Cys 65 70 75 80

Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro GIu Leu Leu GIy

85 90 95

GIy Pro Ser VaI Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Asn Pro

100 105 110

Lys Asp Asp Trp Phe Met Leu GIy Leu Arg Asp GIy Arg Pro GIu lie

115 120 125

GIn Leu His Asn His Trp Ala GIn Leu Thr VaI GIy Ala GIy Pro Arg

130 135 140

Leu Asp Asp GIy Arg Trp His GIn VaI GIu VaI Lys Met GIu GIy Asp 145 150 155 160

Ser VaI Leu Leu GIu VaI Asp GIy GIu GIu VaI Leu Arg Leu Arg GIn

165 170 175

VaI Ser GIy Pro Leu Thr Ser Lys Arg His Pro lie Met Arg lie Ala

180 185 190

Leu GIy GIy Leu Leu Phe Pro Ala Ser Asn Leu Arg Leu Pro Leu VaI

195 200 205

Pro Ala Leu Asp GIy Cys Leu Arg Arg Asp Ser Trp Leu Asp Lys GIn

210 215 220

Ala GIu lie Ser Ala Ser Ala Pro Thr Ser Leu Arg Ser Cys Asp VaI 225 230 235 240

GIu Ser Asn Pro GIy lie Phe Leu Pro Pro GIy Thr GIn Ala GIu Phe

245 250 255

Asn Leu Arg Asp lie Pro GIn Pro His Ala GIu Pro Trp Ala Phe Ser

260 265 270

Leu Asp Leu GIy Leu Lys GIn Ala Ala GIy Ser GIy His Leu Leu Ala

275 280 285

Leu GIy Thr Pro GIu Asn Pro Ser Trp Leu Ser Leu His Leu GIn Asp

290 295 300

GIn Lys VaI VaI Leu Ser Ser GIy Ser 305 310

SEQ ID NO: 93 atgggcctct ccaccgtgcc tgacctgctg ctgccactgg tgctcctgga gctgttggtg 60 ggaatatacc cctcaggggt tattggactg gtccctcacc taggggacag ggagaagaga 120 gatagtgtgt gtccccaagg aaaatatatc caccctcaaa ataattcgat ttgctgtacc 180 aagtgccaca aaggaaccta cttgtacaat gactgtccag gcccggggca ggatacggac 240 tgcagggagt gtgagagcgg ctccttcacc gcttcagaaa accacctcag acactgcctc 300 agctgctcca aatgccgaaa ggaaatgggt caggtggaga tctcttcttg cacagtggac 360 cgggacaccg tgtgtggctg caggaagaac cagtaccggc attattggag tgaaaacctt 420 ttccagtgct tcaattgcag cctc 444

SEQ ID NO: 94 atgggcctct ccaccgtgcc tgacctgctg ctgccactgg tgctcctgga gctgttggtg 60 ggaatatacc cctcaggggt tattggactg gtccctcacc taggggacag ggagaagaga 120 gatagtgtgt gtccccaagg aaaatatatc caccctcaaa ataattcgat ttgctgtacc 180 aagtgccaca aaggaaccta cttgtacaat gactgtccag gcccggggca ggatacggac 240 tgcagggagt gtgagagcgg ctccttcacc gcttcagaaa accacctcag acactgcctc 300 agctgctcca aatgccgaaa ggaaatgggt caggtggaga tctcttcttg cacagtggac 360 cgggacaccg tgtgtggctg caggaagaac cagtaccggc attattggag tgaaaacctt 420 ttccagtgct tcaattgcag cctctgcctc aatgggaccg tgcacctctc ctgccaggag 480 aaacagaaca ccgtgtgcac c 501

SEQ ID NO: 95 atgggcctct ccaccgtgcc tgacctgctg ctgccactgg tgctcctgga gctgttggtg 60 ggaatatacc cctcaggggt tattggactg gtccctcacc taggggacag ggagaagaga 120 gatagtgtgt gtccccaagg aaaatatatc caccctcaaa ataattcgat ttgctgtacc 180 aagtgccaca aaggaaccta cttgtacaat gactgtccag gcccggggca ggatacggac 240 tgcagggagt gtgagagcgg ctccttcacc gcttcagaaa accacctcag acactgcctc 300 agctgctcca aatgccgaaa ggaaatgggt caggtggaga tctcttcttg cacagtggac 360 cgggacaccg tgtgtggctg caggaagaac cagtaccggc attattggag tgaaaacctt 420 ttccagtgct tcaattgcag cctctgcctc aatgggaccg tgcacctctc ctgccaggag 480 aaacagaaca ccgtgtgcac ctgccatgca ggtttctttc taagagaaaa cgagtgtgtc 540 tcctgtagta actgtaagaa aagcctggag tgcacgaagt tgtgcctacc ccagattgag 600 aat 603

SEQ ID NO: 96 lie Tyr Pro Ser GIy VaI He GIy Leu VaI Pro His Leu GIy Asp Arg

1 5 10 15

GIu Lys Arg Asp Ser VaI Cys Pro GIn GIy Lys Tyr He His Pro GIn

20 25 30

Asn Asn Ser He Cys Cys Thr Lys Cys His Lys GIy Thr Tyr Leu Tyr

35 40 45

Asn Asp Cys Pro GIy Pro GIy GIn Asp Thr Asp Cys Arg GIu Cys GIu

50 55 60

Ser GIy Ser Phe Thr Ala Ser GIu Asn His Leu Arg His Cys Leu Ser

65 70 75 80

Cys Ser Lys Cys Arg Lys GIu Met GIy GIn VaI GIu He Ser Ser Cys

85 90 95

Thr VaI Asp Arg Asp Thr VaI Cys GIy Cys Arg Lys Asn GIn Tyr Arg

100 105 HO

His Tyr Trp Ser GIu Asn Leu Phe GIn Cys Phe Asn Cys Ser Leu Cys

115 120 125

Leu Asn GIy Thr VaI His Leu Ser Cys GIn GIu Lys GIn Asn Thr VaI

130 135 140

Cys Thr Cys His Ala GIy Phe Phe Leu Arg GIu Asn GIu Cys VaI Ser

145 150 155 160

Cys Ser Asn Cys Lys Lys Ser Leu GIu Cys Thr Lys Leu Cys Leu Pro

165 170 175

GIn lie GIu Asn VaI Lys GIy Thr GIu Asp Ser GIy Thr Thr VaI Leu

180 185 190

Leu Pro Leu VaI He Phe Phe GIy Leu Cys Leu Leu Ser Leu Leu Phe

195 200 205 lie GIy Leu Met Tyr Arg Tyr GIn Arg Trp Lys Ser Lys Leu Tyr Ser

210 215 220

He VaI Cys GIy Lys Ser Thr Pro GIu Lys GIu GIy GIu Leu GIu GIy

225 230 235 240

Thr Thr Thr Lys Pro Leu Ala Pro Asn Pro Ser Phe Ser Pro Thr Pro

245 250 255

GIy Phe Thr Pro Thr Leu GIy Phe Ser Pro VaI Pro Ser Ser Thr Phe

260 265 270

Thr Ser Ser Ser Thr Tyr Thr Pro GIy Asp Cys Pro Asn Phe Ala Ala

275 280 285

Pro Arg Arg GIu VaI Ala Pro Pro Tyr GIn GIy Ala Asp Pro He Leu

290 295 300

Ala Thr Ala Leu Ala Ser Asp Pro He Pro Asn Pro Leu GIn Lys Trp

305 310 315 320

GIu Asp Ser Ala His Lys Pro GIn Ser Leu Asp Thr Asp Asp Pro Ala

325 330 335

Thr Leu Tyr Ala VaI VaI GIu Asn VaI Pro Pro Leu Arg Trp Lys GIu

340 345 350

Phe VaI Arg Arg Leu GIy Leu Ser Asp His GIu He Asp Arg Leu GIu

355 360 365

Leu GIn Asn GIy Arg Cys Leu Arg GIu Ala GIn Tyr Ser Met Leu Ala

370 375 380

Thr Trp Arg Arg Arg Thr Pro Arg Arg GIu Ala Thr Leu GIu Leu Leu

385 390 395 400

GIy Arg VaI Leu Arg Asp Met Asp Leu Leu GIy Cys Leu GIu Asp He

405 410 415

GIu GIu Ala Leu Cys GIy Pro Ala Ala Leu Pro Pro Ala Pro Ser Leu

420 425 430

Leu Arg

434

SEQ ID NO: 97

Leu Pro Ala GIn VaI Ala Phe Thr Pro Tyr Ala Pro GIu Pro GIy Ser

1 5 10 15

Thr Cys Arg Leu Arg GIu Tyr Tyr Asp GIn Thr Ala GIn Met Cys Cys

20 25 30

Ser Lys Cys Ser Pro GIy GIn His Ala Lys VaI Phe Cys Thr Lys Thr

35 40 45

Ser Asp Thr VaI Cys Asp Ser Cys GIu Asp Ser Thr Tyr Thr GIn Leu

50 55 60

Trp Asn Trp VaI Pro GIu Cys Leu Ser Cys GIy Ser Arg Cys Ser Ser

65 70 75 80

Asp GIn VaI GIu Thr GIn Ala Cys Thr Arg GIu GIn Asn Arg He Cys

85 90 95

Thr Cys Arg Pro GIy Trp Tyr Cys Ala Leu Ser Lys GIn GIu GIy Cys

100 105 HO

Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg Pro GIy Phe GIy VaI Ala

115 120 125

Arg Pro GIy Thr GIu Thr Ser Asp VaI VaI Cys Lys Pro Cys Ala Pro

130 135 140

GIy Thr Phe Ser Asn Thr Thr Ser Ser Thr Asp He Cys Arg Pro His

145 150 155 160

GIn He Cys Asn VaI VaI Ala He Pro GIy Asn Ala Ser Met Asp Ala

165 170 175

VaI Cys Thr Ser Thr Ser Pro Thr Arg Ser Met Ala Pro GIy Ala VaI

180 185 190 His Leu Pro GIn Pro VaI Ser Thr Arg Ser GIn His Thr GIn Pro Thr

195 200 205

Pro GIu Pro Ser Thr Ala Pro Ser Thr Ser Phe Leu Leu Pro Met GIy

210 215 220

Pro Ser Pro Pro Ala GIu GIy Ser Thr GIy Asp Phe Ala Leu Pro VaI 225 230 235 240

GIy Leu He VaI GIy VaI Thr Ala Leu GIy Leu Leu He He GIy VaI

245 250 255

VaI Asn Cys VaI He Met Thr GIn VaI Lys Lys Lys Pro Leu Cys Leu

260 265 270

GIn Arg GIu Ala Lys VaI Pro His Leu Pro Ala Asp Lys Ala Arg GIy

275 280 285

Thr GIn GIy Pro GIu GIn GIn His Leu Leu He Thr Ala Pro Ser Ser

290 295 300

Ser Ser Ser Ser Leu GIu Ser Ser Ala Ser Ala Leu Asp Arg Arg Ala 305 310 315 320

Pro Thr Arg Asn GIn Pro GIn Ala Pro GIy VaI GIu Ala Ser GIy Ala

325 330 335

GIy GIu Ala Arg Ala Ser Thr GIy Ser Ser Asp Ser Ser Pro GIy GIy

340 345 350

His GIy Thr GIn VaI Asn VaI Thr Cys He VaI Asn VaI Cys Ser Ser

355 360 365

Ser Asp His Ser Ser GIn Cys Ser Ser GIn Ala Ser Ser Thr Met GIy

370 375 380

Asp Thr Asp Ser Ser Pro Ser GIu Ser Pro Lys Asp GIu GIn VaI Pro 385 390 395 400

Phe Ser Lys GIu GIu Cys Ala Phe Arg Ser GIn Leu GIu Thr Pro GIu

405 410 415

Thr Leu Leu GIy Ser Thr GIu GIu Lys Pro Leu Pro Leu GIy VaI Pro

420 425 430

Asp Ala GIy Met Lys Pro Ser 435

SEQ ID NO: 98 gataccaacc ctaaggatga ctggtttatg ctgggacttc gagacggcag gcctgagatc 60 caactgcaca atcactgggc ccagcttacg gtgggtgctg gaccacggct ggatgatggg 120 agatggcacc aggtggaagt caagatggag ggggactctg tgctgctgga ggtggatggg 180 gaggaggtgc tgcgcctgag acaggtctct gggcccctga ccagcaaacg ccatcccatc 240 atgaggattg cgcttggggg gctgctcttc cccgcttcca accttcggtt gccgctggtt 300 cctgccctgg atggctgcct gcgccgggat tcctggctgg acaaacaggc cgagatctca 360 gcatctgccc ccactagcct cagaagctgt gatgtagaat caaatcccgg gatatttctc 420 cctccaggga ctcaggcaga attcaatctc cgagacattc cccagcctca tgcagagccc 480 tgggccttct ctttggacct gggactcaag caggcagcag gctcaggcca cctccttgct 540 cttgggacac cagagaaccc atcttggctc agtctccacc tccaagatca aaaggtggtg 600 ttgtcttctg ggtcg 615

SEQ ID NO: 99

Asp Thr Asn Pro Lys Asp Asp Trp Phe Met Leu GIy Leu Arg Asp GIy

1 5 10 15

Arg Pro GIu He GIn Leu His Asn His Trp Ala GIn Leu Thr VaI GIy

20 25 30

Ala GIy Pro Arg Leu Asp Asp GIy Arg Trp His GIn VaI GIu VaI Lys

35 40 45

Met GIu GIy Asp Ser VaI Leu Leu GIu VaI Asp GIy GIu GIu VaI Leu

50 55 60

Arg Leu Arg GIn VaI Ser GIy Pro Leu Thr Ser Lys Arg His Pro He 65 70 75 80

Met Arg lie Ala Leu GIy GIy Leu Leu Phe Pro Ala Ser Asn Leu Arg

85 90 95

Leu Pro Leu VaI Pro Ala Leu Asp GIy Cys Leu Arg Arg Asp Ser Trp

100 105 110

Leu Asp Lys GIn Ala GIu lie Ser Ala Ser Ala Pro Thr Ser Leu Arg

115 120 125

Ser Cys Asp VaI GIu Ser Asn Pro GIy lie Phe Leu Pro Pro GIy Thr

130 135 140

GIn Ala GIu Phe Asn Leu Arg Asp lie Pro GIn Pro His Ala GIu Pro 145 150 155 160

Trp Ala Phe Ser Leu Asp Leu GIy Leu Lys GIn Ala Ala GIy Ser GIy

165 170 175

His Leu Leu Ala Leu GIy Thr Pro GIu Asn Pro Ser Trp Leu Ser Leu

180 185 190

His Leu GIn Asp GIn Lys VaI VaI Leu Ser Ser GIy Ser 195 200 205

SEQ ID NO:100 atgtgcgata aaacccatac ctgcccgccg tgtccggcac cggaactgct gggtggcccg 60 agcgtgtttc tgtttccgcc gaaaccgaaa gataccaatc cgaaagatga ttggtttatg 120 ctgggcctgc gtgatggccg tccggaaatt cagctgcata accattgggc gcagctgacc 180 gttggtgcgg gtccgcgtct ggatgatggc cgttggcatc aggtggaagt gaaaatggaa 240 ggcgatagcg tgctgctgga agtggatggc gaagaagtgc tgcgtctgcg tcaggttagc 300 ggtccgctga ccagcaaacg tcatccgatt atgcgtattg cgctgggcgg cctgctgttt 360 ccggcgagca acctgcgtct gccgctggtt ccggcgctgg atggttgcct gcgtcgtgat 420 agctggctgg ataaacaggc ggaaattagc gcgagcgcgc cgaccagcct gcgtagctgt 480 gatgtggaaa gcaatccggg catttttctg ccgccgggta cgcaggcgga a 531

SEQ ID NO:101

Met Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro GIu Leu

1 5 10 15

Leu GIy GIy Pro Ser VaI Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr

20 25 30

Asn Pro Lys Asp Asp Trp Phe Met Leu GIy Leu Arg Asp GIy Arg Pro

35 40 45

GIu lie GIn Leu His Asn His Trp Ala GIn Leu Thr VaI GIy Ala GIy

50 55 60

Pro Arg Leu Asp Asp GIy Arg Trp His GIn VaI GIu VaI Lys Met GIu 65 70 75 80

GIy Asp Ser VaI Leu Leu GIu VaI Asp GIy GIu GIu VaI Leu Arg Leu

85 90 95

Arg GIn VaI Ser GIy Pro Leu Thr Ser Lys Arg His Pro lie Met Arg

100 105 110 lie Ala Leu GIy GIy Leu Leu Phe Pro Ala Ser Asn Leu Arg Leu Pro

115 120 125

Leu VaI Pro Ala Leu Asp GIy Cys Leu Arg Arg Asp Ser Trp Leu Asp

130 135 140

Lys GIn Ala GIu lie Ser Ala Ser Ala Pro Thr Ser Leu Arg Ser Cys 145 150 155 160

Asp VaI GIu Ser Asn Pro GIy lie Phe Leu Pro Pro GIy Thr GIn Ala

165 170 175

GIu 177

SEQ ID NO: 102 atgacctgcc gtctgcgtga atattacgac cagaccgcgc agatgtgctg cagcaaatgc 60 agcccgggtc agcatgcgaa agtgttctgc accaaaacca gcgataccgt gtgcgatagc 120 tgcgaagata gcacctatac ccagctgtgg aactgggtgc cggaatgcct gagctgcggc 180 agccgttgca gcagcgatca ggtggaaacc caggcgtgca cccgtgaaca gaaccgtatt 240 tgcacctgcc gtccgggctg gtattgcgcc ctgagcaaac aagagggctg ccgtctgtgc 300 gcgccgctg 339

SEQ ID NO: 103 atgcaggtgc agctgcagga atctggcgga ggtctggttc agccaggtgg cagcctgcgt 60 ctgagctgtg cagcgtctgg tcgtaccttt agcgatcata gcggctatac ctataccatt 120 ggctggtttc gtcaggcacc gggtaaagaa cgtgaatttg ttgcgcgtat ttattggagc 180 agcggcaaca cctattatgc ggatagcgtg aaaggccgtt ttgcgattag ccgtgatatt 240 gcgaaaaaca ccgtggatct gaccatgaac aacctggaac cggaagatac cgcagtgtat 300 tattgtgcag cgcgtgatgg cattccgacc agccgtagcg tggaaagcta taactattgg 360 ggtcagggca cccaggtgac cgtgagcagc 390

SEQ ID NO:104 atgacctgcc gtctgcgtga atattacgac cagaccgcgc agatgtgctg cagcaaatgc 60 agcccgggtc agcatgcgaa agtgttctgc accaaaacca gcgataccgt gtgcgatagc 120 tgcgaagata gcacctatac ccagctgtgg aactgggtgc cggaatgcct gagctgcggc 180 agccgttgca gcagcgatca ggtggaaacc caggcgtgca cccgtgaaca gaaccgtatt 240 tgcacctgcc gtccgggctg gtattgcgcc ctgagcaaac aagagggctg ccgtctgtgc 300 gcgccgctgt gcgataaaac ccatacctgc ccgccgtgtc cggcaccgga actgctgggt 360 ggcccgagcg tgtttctgtt tccgccgaaa ccgaaagata ccaatccgaa agatgattgg 420 tttatgctgg gcctgcgtga tggccgtccg gaaattcagc tgcataacca ttgggcgcag 480 ctgaccgttg gtgcgggtcc gcgtctggat gatggccgtt ggcatcaggt ggaagtgaaa 540 atggaaggcg atagcgtgct gctggaagtg gatggcgaag aagtgctgcg tctgcgtcag 600 gttagcggtc cgctgaccag caaacgtcat ccgattatgc gtattgcgct gggcggcctg 660 ctgtttccgg cgagcaacct gcgtctgccg ctggttccgg cgctggatgg ttgcctgcgt 720 cgtgatagct ggctggataa acaggcggaa attagcgcga gcgcgccgac cagcctgcgt 780 agctgtgatg tggaaagcaa tccgggcatt tttctgccgc cgggtacgca ggcggaa 837

SEQ ID NO: 105

Met Thr Cys Arg Leu Arg GIu Tyr Tyr Asp GIn Thr Ala GIn Met Cys

1 5 10 15

Cys Ser Lys Cys Ser Pro GIy GIn His Ala Lys VaI Phe Cys Thr Lys

20 25 30

Thr Ser Asp Thr VaI Cys Asp Ser Cys GIu Asp Ser Thr Tyr Thr GIn

35 40 45

Leu Trp Asn Trp VaI Pro GIu Cys Leu Ser Cys GIy Ser Arg Cys Ser

50 55 60

Ser Asp GIn VaI GIu Thr GIn Ala Cys Thr Arg GIu GIn Asn Arg lie

65 70 75 80 Cys Thr Cys Arg Pro GIy Trp Tyr Cys Ala Leu Ser Lys GIn GIu GIy

85 90 95

Cys Arg Leu Cys Ala Pro Leu Cys Asp Lys Thr His Thr Cys Pro Pro

100 105 110

Cys Pro Ala Pro GIu Leu Leu GIy GIy Pro Ser VaI Phe Leu Phe Pro

115 120 125

Pro Lys Pro Lys Asp Thr Asn Pro Lys Asp Asp Trp Phe Met Leu GIy

130 135 140

Leu Arg Asp GIy Arg Pro GIu lie GIn Leu His Asn His Trp Ala GIn 145 150 155 160

Leu Thr VaI GIy Ala GIy Pro Arg Leu Asp Asp GIy Arg Trp His GIn

165 170 175

VaI GIu VaI Lys Met GIu GIy Asp Ser VaI Leu Leu GIu VaI Asp GIy

180 185 190

GIu GIu VaI Leu Arg Leu Arg GIn VaI Ser GIy Pro Leu Thr Ser Lys

195 200 205

Arg His Pro lie Met Arg lie Ala Leu GIy GIy Leu Leu Phe Pro Ala

210 215 220

Ser Asn Leu Arg Leu Pro Leu VaI Pro Ala Leu Asp GIy Cys Leu Arg 225 230 235 240

Arg Asp Ser Trp Leu Asp Lys GIn Ala GIu lie Ser Ala Ser Ala Pro

245 250 255

Thr Ser Leu Arg Ser Cys Asp VaI GIu Ser Asn Pro GIy lie Phe Leu

260 265 270

Pro Pro GIy Thr GIn Ala GIu 275

SEQ ID NO: 106 atgcaggtgc agctgcagga atctggcgga ggtctggttc agccaggtgg cagcctgcgt 60 ctgagctgtg cagcgtctgg tcgtaccttt agcgatcata gcggctatac ctataccatt 120 ggctggtttc gtcaggcacc gggtaaagaa cgtgaatttg ttgcgcgtat ttattggagc 180 agcggcaaca cctattatgc ggatagcgtg aaaggccgtt ttgcgattag ccgtgatatt 240 gcgaaaaaca ccgtggatct gaccatgaac aacctggaac cggaagatac cgcagtgtat 300 tattgtgcag cgcgtgatgg cattccgacc agccgtagcg tggaaagcta taactattgg 360 ggtcagggca cccaggtgac cgtgagcagc ggtgatggca gctctggtgg ctctggcggt 420 gcgagcgata ccaatccgaa agatgattgg tttatgctgg gcctgcgtga tggccgtccg 480 gaaattcagc tgcataacca ttgggcacag ctgaccgttg gtgcgggtcc gcgtctggat 540 gatggccgtt ggcatcaggt ggaagtgaaa atggaaggcg atagcgtgct gctggaagtg 600 gatggcgaag aagtgctgcg tctgcgtcag gtttctggtc cactgacgag caaacgtcat 660 ccgattatgc gtattgcgct gggtggcctg ctgtttccgg caagcaacct gcgtctgccg 720 ctggttccgg cactggatgg ttgcctgcgt cgtgatagct ggctggataa acaggcggaa 780 attagcgcga gcgcaccaac ttctctgcgc agctgtgatg tggaaagcaa tccgggtatt 840 tttctgccac cgggtacgca ggcggaa 867

SEQ ID NO:107

Met GIn VaI GIn Leu GIn GIu Ser GIy GIy GIy Leu VaI GIn Pro GIy

1 5 10 15

GIy Ser Leu Arg Leu Ser Cys Ala Ala Ser GIy Arg Thr Phe Ser Asp

20 25 30

His Ser GIy Tyr Thr Tyr Thr lie GIy Trp Phe Arg GIn Ala Pro GIy

35 40 45

Lys GIu Arg GIu Phe VaI Ala Arg lie Tyr Trp Ser Ser GIy Asn Thr

50 55 60

Tyr Tyr Ala Asp Ser VaI Lys GIy Arg Phe Ala lie Ser Arg Asp lie 65 70 75 80

Ala Lys Asn Thr VaI Asp Leu Thr Met Asn Asn Leu GIu Pro GIu Asp 85 90 95

Thr Ala VaI Tyr Tyr Cys Ala Ala Arg Asp GIy lie Pro Thr Ser Arg

100 105 110

Ser VaI GIu Ser Tyr Asn Tyr Trp GIy GIn GIy Thr GIn VaI Thr VaI

115 120 125

Ser Ser GIy Asp GIy Ser Ser GIy GIy Ser GIy GIy Ala Ser Asp Thr

130 135 140

Asn Pro Lys Asp Asp Trp Phe Met Leu GIy Leu Arg Asp GIy Arg Pro 145 150 155 160

GIu lie GIn Leu His Asn His Trp Ala GIn Leu Thr VaI GIy Ala GIy

165 170 175

Pro Arg Leu Asp Asp GIy Arg Trp His GIn VaI GIu VaI Lys Met GIu

180 185 190

GIy Asp Ser VaI Leu Leu GIu VaI Asp GIy GIu GIu VaI Leu Arg Leu

195 200 205

Arg GIn VaI Ser GIy Pro Leu Thr Ser Lys Arg His Pro lie Met Arg

210 215 220 lie Ala Leu GIy GIy Leu Leu Phe Pro Ala Ser Asn Leu Arg Leu Pro 225 230 235 240

Leu VaI Pro Ala Leu Asp GIy Cys Leu Arg Arg Asp Ser Trp Leu Asp

245 250 255

Lys GIn Ala GIu lie Ser Ala Ser Ala Pro Thr Ser Leu Arg Ser Cys

260 265 270

Asp VaI GIu Ser Asn Pro GIy lie Phe Leu Pro Pro GIy Thr GIn Ala

275 280 285

GIu 289

SEQ ID NO:108 atggatagcg tttgtccgca gggcaaatat atccatccgc agaataatag catttgctgc 60 acgaaatgcc ataaaggcac ctatctgtat aatgattgtc cgggtccggg tcaggatacc 120 gattgtcgtg aatgtgaaag cggtagcttt accgcaagcg aaaatcatct gcgtcattgt 180 ctgagctgta gcaaatgccg taaagaaatg ggtcaggtgg aaattagcag ctgtaccgtt 240 gatcgcgata ccgtttgtgg ttgccgcaaa aatcagtatc gccattattg gagcgaaaac 300 ctgtttcagt gctttaattg tagcctgtgt ctgaatggca ccgttcatct gagctgtcag 360 gaaaaacaga ataccgtttg tacctgcgat aaaacccata cctgtcctcc gtgtccggca 420 ccggaactgc tgggtggtcc gagcgttttt ctgtttccgc cgaaaccgaa agataccaat 480 ccgaaagatg attggtttat gctgggtctg cgtgatggtc gtccggaaat tcagctgcat 540 aatcattggg cacagctgac cgttggtgca ggtccgcgtc tggatgatgg tcgttggcat 600 caggttgaag tgaaaatgga aggtgatagc gttctgctgg aagttgatgg tgaagaagtt 660 ctgcgtctgc gtcaggttag cggtccgctg accagcaaac gtcatccgat tatgcgtatt 720 gcactgggtg gtctgctgtt tccggcaagc aatctgcgtc tgccgctggt tccggcactg 780 gatggttgtc tgcgtcgtga tagctggctg gataaacagg cagaaattag cgcaagcgca 840 ccgaccagcc tgcgtagctg tgatgtggaa agcaatccgg gtatttttct gcctccgggc 900 acccaggcag aa 912

SEQ ID NO:109

Met Asp Ser VaI Cys Pro GIn GIy Lys Tyr lie His Pro GIn Asn Asn

1 5 10 15

Ser lie Cys Cys Thr Lys Cys His Lys GIy Thr Tyr Leu Tyr Asn Asp

20 25 30

Cys Pro GIy Pro GIy GIn Asp Thr Asp Cys Arg GIu Cys GIu Ser GIy

35 40 45

Ser Phe Thr Ala Ser GIu Asn His Leu Arg His Cys Leu Ser Cys Ser

50 55 60

Lys Cys Arg Lys GIu Met GIy GIn VaI GIu lie Ser Ser Cys Thr VaI 65 70 75 80

Asp Arg Asp Thr VaI Cys GIy Cys Arg Lys Asn GIn Tyr Arg His Tyr

85 90 95

Trp Ser GIu Asn Leu Phe GIn Cys Phe Asn Cys Ser Leu Cys Leu Asn

100 105 110

GIy Thr VaI His Leu Ser Cys GIn GIu Lys GIn Asn Thr VaI Cys Thr

115 120 125

Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro GIu Leu Leu

130 135 140

GIy GIy Pro Ser VaI Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Asn 145 150 155 160

Pro Lys Asp Asp Trp Phe Met Leu GIy Leu Arg Asp GIy Arg Pro GIu

165 170 175 lie GIn Leu His Asn His Trp Ala GIn Leu Thr VaI GIy Ala GIy Pro

180 185 190

Arg Leu Asp Asp GIy Arg Trp His GIn VaI GIu VaI Lys Met GIu GIy

195 200 205

Asp Ser VaI Leu Leu GIu VaI Asp GIy GIu GIu VaI Leu Arg Leu Arg

210 215 220

GIn VaI Ser GIy Pro Leu Thr Ser Lys Arg His Pro lie Met Arg lie 225 230 235 240

Ala Leu GIy GIy Leu Leu Phe Pro Ala Ser Asn Leu Arg Leu Pro Leu

245 250 255

VaI Pro Ala Leu Asp GIy Cys Leu Arg Arg Asp Ser Trp Leu Asp Lys

260 265 270

GIn Ala GIu lie Ser Ala Ser Ala Pro Thr Ser Leu Arg Ser Cys Asp

275 280 285

VaI GIu Ser Asn Pro GIy lie Phe Leu Pro Pro GIy Thr GIn Ala GIu 290 295 300

SEQ ID NO: 110 ggtgatggca gctctggtgg ctctggcggt gcgagc 36

SEQ ID NO:111

GIy Asp GIy Ser Ser GIy GIy Ser GIy GIy Ala Ser

1 5 10

SEQ ID NO: 112 tgcgataaaa cccatacctg cccgccgtgt ccggcaccgg aactgctggg tggcccgagc 60 gtgtttctgt ttccgccgaa accgaaa 87

SEQ ID NO:113

GIu Pro GIn GIy GIy GIy GIy Ser GIy GIy GIy GIy Ser GIy GIu

1 5 10 15

SEQ ID NO: 114

GIy GIy VaI GIy GIy GIy GIy GIy GIy Ala GIy

1 5 10

SEQ I D NO : 115

Pro Ala Arg GIy GIy GIy GIy GIy GIy Lys Ala Arg

1 5 10

SEQ I D NO : 116

GIy GIy Pro GIy GIy GIy GIy GIy GIy GIy Pro GIy GIy

1 5 10 SEQ I D NO : 117

Thr Ser Arg GIy GIy GIy GIy Ser GIy GIy GIy GIu Pro Pro

1 5 10

SEQ ID NO: 118

Met Tyr Ala GIy Ala Lys Lys Pro Leu Asn Thr GIu GIy VaI Met Lys

1 5 10 15

Ser Arg Ser

20

SEQ ID NO : 119

Arg GIy GIu VaI Lys Tyr Pro Leu cys Thr Arg Lys GIu Ser Lys

10 15

SEQ ID NO: 120

GIu Ser GIy GIy Pro Leu Ser Leu Ser

1 5

SEQ ID NO:121

Ala Pro GIu Ala Pro Pro Pro Thr Leu Pro Pro

1 5 10

SEQ ID NO: 122

Ser Ser GIy Ser GIy Pro GIy Leu Asp Leu Pro

1 5 10

SEQ ID NO: 123

Asp Trp Phe Met Leu GIy Leu Arg

1 5

SEQ ID NO:124

Arg Pro GIu lie GIn Leu His Asn

1 5

SEQ ID NO: 125

Ala GIn Leu Thr VaI GIy Ala

1 5

SEQ ID NO:126

Arg Trp His GIn VaI GIu VaI Lys Met GIu

1 5 10

SEQ ID NO : 127

Ser VaI Leu Leu GIu VaI

1 5

SEQ ID NO: 128 Leu Arg Leu Arg 1

SEQ ID NO:129 lie Met Arg lie Ala Leu

1 5

SEQ ID NO: 130 Asp GIy Cys Leu Arg 1 5

SEQ ID NO:131 Ser Ala Ser Ala 1

SEQ ID NO: 132 Leu Arg Ser Cys 1

SEQ ID NO:133 gcccagctta cggtgggtgc tggaccacgg ctggatgatg ggagatggca ccaggtggaa 60 gtcaagatgg agggggactc tgtgctgctg gaggtggatg gggaggaggt gctgcgcctg 120 aga 123

SEQ ID NO:134 aggcctgaga tccaactgca caatcactgg gcccagctta cggtgggtgc tggaccacgg 60 ctggatgatg ggagatggca ccaggtggaa gtcaagatgg agggggactc tgtgctgctg 120 gaggtggatg gggaggaggt gctgcgcctg agacaggtct ctgggcccct gaccagcaaa 180 cgccatccca tcatgaggat tgcgcttggg gggctgctct tccccgcttc caaccttcgg 240

SEQ ID NO: 135 atggatccta acgctgctta tgtgaacatg agtaaccatc accggggcct ggcttcagcc 60 aacgttgact ttgccttcag cctgtataag cacctagtgg ccttgagtcc caaaaagaac 120 attttcatct cccctgtgag catctccatg gccttagcta tgctgtccct gggcacctgt 180 ggccacacac gggcccagct tctccagggc ctgggtttca acctcactga gaggtctgag 240 actgagatcc accagggttt ccagcacctg caccaactct ttgcaaagtc agacaccagc 300 ttagaaatga ccatgggcaa tgccttgttt cttgatggca gcctggagtt gctggagtca 360 ttctcagcag acatcaagca ctactatgag tcagaggtct tggctatgaa tttccaggac 420 tgggcaacag ccagcagaca gatcaacagc tatgtcaaga ataagacaca ggggaaaatt 480 gtcgacttgt tttcagggct ggatagccca gccatcctcg tcctggtcaa ctatatcttc 540 ttcaaaggca catggacaca gccctttgac ctggcaagca ccagggagga gaacttctat 600 gtggacgaga caactgtggt gaaggtgccc atgatgttgc agtcgagcac catcagttac 660 cttcatgacg cggagctccc ctgccagctg gtgcagatga actacgtggg caatgggact 720 gtcttcttca tccttccgga caaggggaag atgaacacag tcatcgctgc actgagccgg 780 gacacgatta acaggtggtc cgcaggcctg accagcagcc aggtggacct gtacattcca 840 aaggtcacca tctctggagt ctatgacctc ggagatgtgc tggaggaaat gggcattgcg 900 acttgttcac caaccaggca aatttctcac gcatcaccca ggacgcccag ctgaagtcat 960 caaaggtggt ccataaagct gtgctgcaac tcaatgagga gggtgtggac acagctggct 1020 ccactggggt caccctaaac ctgacgtcca agcctatcat cttgcgtttc aaccagccct 1080 tcatcatcat gatcttcgac cacttcacct ggagcagcct tttcctggcg agggttatga 1140 acccagtg 1148

SEQ ID NO: 136 atgacctgcc gtctgcgtga atattacgac cagaccgcgc agatgtgctg cagcaaatgc 60 agcccgggtc agcatgcgaa agtgttctgc accaaaacca gcgataccgt gtgcgatagc 120 tgcgaagata gcacctatac ccagctgtgg aactgggtgc cggaatgcct gagctgcggc 180 agccgttgca gcagcgatca ggtggaaacc caggcgtgca cccgtgaaca gaaccgtatt 240 tgcacctgcc gtccgggctg gtattgcgcc ctgagcaaac aagagggctg ccgtctgtgc 300 gcgccgctgt gcgataaaac ccatacctgc ccgccgtgtc cggcaccgga actgctgggt 360 ggcccgagcg tgtttctgtt tccgccgaaa ccgaaagata ccaaccctaa ggatgactgg 420 tttatgctgg gacttcgaga cggcaggcct gagatccaac tgcacaatca ctgggcccag 480 cttacggtgg gtgctggacc acggctggat gatgggagat ggcaccaggt ggaagtcaag 540 atggaggggg actctgtgct gctggaggtg gatggggagg aggtgctgcg cctgagacag 600 gtctctgggc ccctgaccag caaacgccat cccatcatga ggattgcgct tggggggctg 660 ctcttccccg cttccaacct tcggttgccg ctggttcctg ccctggatgg ctgcctgcgc 720 cgggattcct ggctggacaa acaggccgag atctcagcat ctgcccccac tagcctcaga 780 agctgtgatg tagaatcaaa tcccgggata tttctccctc cagggactca ggcagaattc 840 aatctccgag acattcccca gcctcatgca gagccctggg ccttctcttt ggacctggga 900 ctcaagcagg cagcaggctc aggccacctc cttgctcttg ggacaccaga gaacccatct 960 tggctcagtc tccacctcca agatcaaaag gtggtgttgt cttctgggtc g 1011

SEQ ID NO: 137

Met Thr Cys Arg Leu Arg GIu Tyr Tyr Asp GIn Thr Ala GIn Met Cys

1 5 10 15

Cys Ser Lys Cys Ser Pro GIy GIn His Ala Lys VaI Phe Cys Thr Lys

20 25 30

Thr Ser Asp Thr VaI Cys Asp Ser Cys GIu Asp Ser Thr Tyr Thr GIn

35 40 45

Leu Trp Asn Trp VaI Pro GIu Cys Leu Ser Cys GIy Ser Arg Cys Ser

50 55 60

Ser Asp GIn VaI GIu Thr GIn Ala Cys Thr Arg GIu GIn Asn Arg lie 65 70 75 80

Cys Thr Cys Arg Pro GIy Trp Tyr Cys Ala Leu Ser Lys GIn GIu GIy

85 90 95

Cys Arg Leu Cys Ala Pro Leu Cys Asp Lys Thr His Thr Cys Pro Pro

100 105 110

Cys Pro Ala Pro GIu Leu Leu GIy GIy Pro Ser VaI Phe Leu Phe Pro

115 120 125

Pro Lys Pro Lys Asp Thr Asn Pro Lys Asp Asp Trp Phe Met Leu GIy

130 135 140

Leu Arg Asp GIy Arg Pro GIu lie GIn Leu His Asn His Trp Ala GIn 145 150 155 160

Leu Thr VaI GIy Ala GIy Pro Arg Leu Asp Asp GIy Arg Trp His GIn

165 170 175

VaI GIu VaI Lys Met GIu GIy Asp Ser VaI Leu Leu GIu VaI Asp GIy

180 185 190

GIu GIu VaI Leu Arg Leu Arg GIn VaI Ser GIy Pro Leu Thr Ser Lys

195 200 205

Arg His Pro lie Met Arg lie Ala Leu GIy GIy Leu Leu Phe Pro Ala

210 215 220

Ser Asn Leu Arg Leu Pro Leu VaI Pro Ala Leu Asp GIy Cys Leu Arg 225 230 235 240

Arg Asp Ser Trp Leu Asp Lys GIn Ala GIu lie Ser Ala Ser Ala Pro

245 250 255

Thr Ser Leu Arg Ser Cys Asp VaI GIu Ser Asn Pro GIy lie Phe Leu

260 265 270

Pro Pro GIy Thr GIn Ala GIu Phe Asn Leu Arg Asp lie Pro GIn Pro

275 280 285

His Ala GIu Pro Trp Ala Phe Ser Leu Asp Leu GIy Leu Lys GIn Ala

290 295 300

Ala GIy Ser GIy His Leu Leu Ala Leu GIy Thr Pro GIu Asn Pro Ser 305 310 315 320

Trp Leu Ser Leu His Leu GIn Asp GIn Lys VaI VaI Leu Ser Ser GIy

325 330 335

Ser

340

SEQ ID NO:138

Met Thr Cys Arg Leu Arg GIu Tyr Tyr Asp GIn Thr Ala GIn Met Cys

1 5 10 15 Cys Ser Lys Cys Ser Pro GIy GIn His Ala Lys VaI Phe Cys Thr Lys

20 25 30

Thr Ser Asp Thr VaI Cys Asp Ser Cys GIu Asp Ser Thr Tyr Thr GIn

35 40 45

Leu Trp Asn Trp VaI Pro GIu Cys Leu Ser Cys GIy Ser Arg Cys Ser

50 55 60

Ser Asp GIn VaI GIu Thr GIn Ala Cys Thr Arg GIu GIn Asn Arg lie 65 70 75 80

Cys Thr Cys Arg Pro GIy Trp Tyr Cys Ala Leu Ser Lys GIn GIu GIy

85 90 95

Cys Arg Leu Cys Ala 100

Literature

Avvakumov et al . , 2002

Crystal structure of human sex hormone-binding globulin in complex with 2-methoxyestradiol reveals the molecular basis for high affinity interactions with C-2 derivatives of estradiol." J Biol Chem 277(47) : 45219-25.

Cousin et al . , 1998

Human variant sex hormone-binding globulin (SHBG) with an additional carbohydrate chain has a reduced clearance rate in rabbit." J Clin Endocrinol Metab 83(1) : 235-40.

Ellgaard and Ruddock, EMBO reports (2005) 6, 28-32

Grishkovskaya et al . , 2000

Crystal structure of human sex hormone-binding globulin: steroid transport by a laminin G-like domain." Embo J 19(4) :

504-12.

Grishkovskaya, Irina., George V Avvakumov, Geoffrey L.

Hammond, Maria G. Catalano and Yves A. Muller, 2002.

Steroid ligands bind human Sex Hormone-Binding Globulin in specific orientations and produce distinct changes in protein conformation. JBC 277 (35) : 32086-32093.

Higuchi, R., B. Krummel, et al . (1988) . "A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions." Nucleic

Acids Res 16(15) : 7351-67.

Kδhler and Milstein (1975)

Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256 (5517) : 495-497

Beate Malkowski

,,Charakterisierung funktioneller und struktureller

Vorraussetzungen der Hepatitis-B-Virus-Replikation"

Dissertation Humboldt Universitat zu Berlin 2003

Mix, Eilhard, Robert Gortsches and Uwe K. Zettl (2006)

Immunoglobulins - Basic considerations

Jounal of Neurology (2006) 253 (Suppl 5) :V/9-V/17

Blaire L. Osborn, Henrik S. Olsen, Bernardetta Nardelli, James

H. Murray, Joe X. H. Zhou, Andrew Garcia, Gordon Moody, Liubov

S. Zaritskaya, and Cynthia Sung (2002) .

Pharmacokinetic and Pharmacodynamic Studies of a Human Serum

Albumin-Interferon-α Fusion Protein in Cynomolgus Monkeys

J Pharmacol Exp Ther 2002 303: 540-548.

Peter Pack, Kristian Muller, Ralph Zahn and Andreas Pluckthun

(1995)

Tetravalent miniantibodies with high avidity assembling in

Escherichia coli Journal of Molecular Biology (1995) 246, 28-34

MW Saif, J Peccerillo and V Potter (2008)

Successful re-challenge with panitumumab in patients who developed hypersensitivity reactions to cetuximab: report of three cases and review of literature

Cancer Chemother Pharmacol. 2008 Sep 10. [Epub ahead of print]

KA Smith, PN Nelson, P Warren, SJ Astley, PG Murray and J

Greenman (2004)

Demystified... recombinant antibodies

J Clin Pathol 2004; 57:912-917.

Olga A. Strelchyonik and George V. Avvakumov (1990)

Specific steroid binding glycoproteins of human blood plasma: novel data on their structure and function

Journal of steroid biochemistry (1990) 35 (5) : 519-34.

Towbin, H., T. Staehelin, et al . (1979) . "Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications." Proc

Natl Acad Sci U S A 76(9) : 4350-4.

Tu and Weissman, 2004

Oxidative protein folding in eukaryotes: mechanisms and consequences." J Cell Biol 164(3) : 341-6.

Books

Pharmaceutical Dosage Forms: Parenteral Medications, Dekker NY Pharmaceutical Dosage Forms: Tablets, Dekker NY Pharmaceutical Dosage Forms:: Disperse Systems, Dekker NY Remingtons Pharmaceutical Sciences, Mack Pub. Co., New Jersey (1991)

Sambrook et al . , New Yoork, Cold Spring Harbour Laboratory Press

Westphal, U. Steroid-Protein Interactions. Parti I, Springer- Verlag, New York (1986) .

Claims

1. A nucleic acid molecule encoding a fusion polypeptide, except the nucleic acid molecule consisting of both, a nucleic acid encoding a peptide having at least parts of the sex hormone-binding globulin (SHBG) sequence and a nucleic acid encoding a peptide having at least parts of a sequence glutathione-S-transferase, or androgen binding protein (ABP) which fusion polypeptide comprises the following fusion polypeptide components:

(a) a physiologically active polypeptide component; and

(b) a polypeptide dimerization component,

wherein the polypeptide dimerization component (b) forms dimers with the polypeptide dimerization component (b) comprised in another of said fusion polypeptides, wherein said polypeptide dimerization component is derived from sex hormone-binding globulin (SHBG) with the proviso that the polypeptide dimerization component exhibits a binding affinity to a human steroid hormone weaker than human SHBG, in particular with a dissociation constant higher than 10^"8 M.

2. The nucleic acid of claim 1 wherein the nucleic acid encodes for a polypeptide dimerzation component in the fusion polypeptide comprising a hydrophobic patch of amino acids including strands β7 and βlO of human SHBG, preferably comprising strands β7, β8, β9 and βlO of human SHBG.

3. The nucleic acid of claim 1 and/or 2 wherein the nucleic acid encodes for a polypeptide dimerzation component in the fusion polypeptide comprising loops β5 and β6, and/or loops βll and βl2 of human SHBG.

4. The nucleic acid of any of the claims 1 to 3 wherein the nucleic acid encodes for a polypeptide dimerization component in the fusion polypeptide comprising a stretch of amino acids having amino acids Arg74 to Arg 154 of human SHBG (SEQ ID NO : 2 ) .

5. The nucleic acid molecule according to any of the claims 1 to 4, wherein the physiologically active polypeptide component is a ligand-binding component, a substrate- binding component or a substrate component.

6. The nucleic acid molecule according to any of the claims 1 to 5, wherein the encoded fusion polypeptide further comprises a linker peptide which is located between components (a) and (b) of the fusion polypeptide.

7. The nucleic acid molecule according to claim 6, wherein the linker peptide has a length of at least 1 amino acids up to 125 amino acids, preferably 1-50, more preferably 4-30 and is for example selected from the group consisting of antibody derived linker, Fc hinge, Ig hinge, natural interdomain linkers in human proteins, natural interdomain linkers in human plasma proteins, Glycine-linker, Glycine-Serin-linker, SHBG derived linker or fragments thereof.

8. The nucleic acid molecule according to claim 6 or 7, wherein the linker peptide is encoded by one of the nucleic acid sequences shown in SEQ ID NO:21, SEQ ID NO: 110 and SEQ ID NO: 112.

9. The nucleic acid molecule according to any one of claims 1 to 7, wherein the nucleic acid encoding the dimerization component derived from sex hormone-binding globulin (SHBG)

a) comprises the nucleic acid sequence as shown in SEQ ID NO: 98; and/or SEQ ID NO: 100.

b) comprises a fragment of SEQ ID NO: 98 and/or SEQ ID NO: 100 of at least 50 nucleotides;

c) has a nucleotide acid sequence similarity of at least 80%, preferred 90% and most preferred 95% to SEQ ID NO:1 and/or SEQ ID NO:100.

10. The nucleic acid molecule according to any one of claims 1 to 9, wherein the dimerization component derived from sex hormone-binding globulin (SHBG) is capable of forming dimers with a dissociation constant K_D of less than 10^~9, preferably less than 10^~10, more preferably less than 10^"11 and most preferred less than 10^~12.

11. The nucleic acid molecule according to any one of claims 1 to 10, wherein the dimerization component derived from sex hormone-binding globulin (SHBG) is a chimeric construct consisting of at least two parts of the dimerization domain which are naturally not adjacent to each other.

12. The nucleic acid molecule according to any one of claims 1 to 11, wherein the dimerization component derived from sex hormone-binding globulin (SHBG) is a chimeric construct consisting of at least two parts, one of which is derived from the dimerization domain of SHBG, whereas the at least one further part is derived from another protein .

13. The nucleic acid molecule according to claim 12, wherein the at least one further part is derived from cortisol- binding globulin (CBG) .

14. The nucleic acid according to any one of claims 1 to 13, wherein the physiologically active component is selected or derived from the group consisting of antibodies, antibody fragments, for example 4 chain antibodies, bivalent and tetravalent VHH antibodies, Fab, Fab' , F(ab')2/ scFv, (scFv)2, diabodies, triabodies, tetrabodies, TandAb and flexibodies, VH and VL single domain antibodies, individual CDRs or groups of CDRs consisting of 1,2,3,4,5,6 or more different CDRs, and scaffolds containing CDRs.

15. The nucleic acid molecule according to any one of claims 1 to 14, wherein the physiologically active component is selected or derived from the group consisting of IL-I, IL-IR, IL-2, IL-2R, IL-3, IL-3R, IL-4, IL-4R, IL-5, IL- 5R, IL-6, IL-6R, IL-7, IL-7R, IL-8, IL-9, IL-9R, IL-IO, IL-Il, IL-12, IL-13, IL-13R, IL-14, IL-15, IL-15R, IL- 16, IL-17, TNF, TGF, TGF-CC, IFN, GM-CSF, GM-CSFR, G-CSF, G-CSFR, EPO, EPOR, TPO, M-CSF, GHR, TNFR, TGFR, IFNR, interferon-α R, interferon-β R, interferon-γ R, cMpl, gpl30, Fas (Apo 1), CCRl, CXCRl-4, TrkA, TrkB, TrkC, Htk, REK7, Rse/Tyro-3, hepatocyte growth factor R, platelet-derived growth factor R, FIt-I, CD2, CD4, CD5, CD6, CD22, CD27, CD28, CD30, CD31, CD40, CD44, CDlOO, CD137, CD150, LAG-3, B7, B61, β-neurexin, CTLA-4, ICOS, ICAM-I, complement R-2 (CD21) IgER, lysosomal mebrane gpl, CC2 microglobulin receptor related proteins and sodium-releasing peptide R, LIF, LT, FGF, VEGF, EGF, SCF, oncostatin M, Amphiregulin, Mullerian-inhibiting substance, BCGF, MIF, Endostatin and Angiostatin, GLP, GLP2, PACAP, VIP, CD4 cluster of differentiation, Secretin, glicentin, Oxyntomodulin, ANP, BNP, Interferone, BDNF, NGF, GDNF, Somatostatin, enzymes from the group of hydrolases (including phosphatases, nucleases phosphodiesterases) , oxidoreductases, transferases (including phosphotransferases), lyases, isomerases and ligases and substrates of these enzymes including nucleotides, proteins, carbohydrates and lipids, DNA, RNA, siRNA, micro-RNA, or physiologically active fragments, variants, mutants, analogs or derivatives thereof.

16. The nucleic acid molecule according to any one of claims 1 to 15, wherein the physiologically active component is selected or derived from the group consisting of soluble fragments of TNFRSFlA and TNFRSFlB, especially preferred selected or derived from the group of SEQ ID NO: 3, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO : 11 , SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO: 84, SEQ ID NO: 102 and a nucleic acid encoding for amino acid 1-235 of SEQ ID NO: 97 and SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33.

17. The nucleic acid molecule according to any one of claims 1 to 16, wherein the physiologically active component comprises SEQ ID NO: 102 or SEQ ID NO:31 or at least 80%, preferred 90% and most preferred 95% homologues thereof .

18. The nucleic acid according to any one of claims 1 to 17, to which additional nucleic acids coding for active fragments, further linkers, and further dimerization components are fused, especially gpl30 and/or hCG.

19. An expression vector comprising the nucleic acid molecule of any one of claims 1 to 18.

20. A host cell comprising the expression vector of claim 18.

21. The host cell of claim 20, wherein the host cell is a bacterial cell, yeast cell, insect cell, or mammalian cell.

22. The host cell of claim 21, wherein the host cell is E. coli, a CHO cell, a 293 cell, or a K562 cell.

23. A fusion polypeptide encoded by the nucleic acid molecule according to any one of claims 1 to 18.

24. The fusion polypeptide of claim 23 chemically modified and/or containing chemically modified amino acids and/or having polymer moieties attached to it, especially polyethylene glycol.

25. Analogs to the fusion polypeptide of claim 23.

26. The fusion polypeptide of any one of the claims 23 to 25 attached to solid carriers, incorporated into liposomes, microcapsules, or formulated as microcrystals .

27. A fusion polypeptide in dimeric form comprising two fusion polypeptides according to claim 23.

28. A method of producing the fusion polypeptide of claim 23 to 27 which comprises growing the host cell of claims 20 to 22 under conditions permitting production of the fusion polypeptides and recovering the fusion polypeptides so produced.

29. A monomeric or dimeric fusion polypeptide obtained by the method of claim 28.

30. A pharmaceutical composition comprising the fusion polypeptide of claims 23 to 27 and/or 29 in a pharmacologically acceptable liquid, solid or semi-solid carrier, linked to a carrier or targeting molecule and/or incorporated into liposomes, microcapsules or a controlled release preparation or as nanoparticles .

31. The fusion polypeptide according to any one of claims 23 to 27 and/or 29 for use as a medicament.

32. The fusion polypeptide according to any of claims 23 to 27 and/or 29 for the treatment of diseases or disorders selected from the group consisting of autoimmune diseases, chronic inflammatory diseases, lymphoproliferative disorders, neurological and neuropsychiatric disorders, and cancer.

33. A fusion polypeptide according to claim 23 to 27 and/or 29, wherein the disease is selected from the group consisting of acute disseminated encephalomyelitis, addison' s disease, alcohol withdrawal, Alzheimer's disease, amyotrophic lateral sclerosis (ALS) , ankylosing spondylitis, anorexia nervosa, autism, autoimmune hepatitis, autoimmune oophoritis, B-Cell-Non-Hodgkin- lymphoma, Creutzfeldt-Jacob Disease (CJD) , Variant CJD, Coeliac disease, Colitis Ulcerosa, Crohn's disease, depression, diabetes mellitus type 1, diabetic retinopathy, endometriosis, gestational pemphigoid, glaucoma, Goodpasture's syndrome, Graves disease, Guillain-Barre syndrome (GBS), Hashimoto's thyroiditis, Idiopathic Dementia, Idiopathic thrombocytopenic purpura (ITP), Kawasaki disease, Lewy Body Disease, Morbus Bechterew, Multiple Sclerosis, Muscular Dystrophies Myasthenia gravis, narcotic addiction, nicotine withdrawal, obsessive-compulsive disorder, Opsoclonus myoclonus syndrome (OMS), Optic neuritis, Parkinson's Disease, pemphigus, pernicious anemia, Pick's Disease, Polyarthritis, post-herpetic neuralgia, Psoriasis, primary biliary cirrhosis, rheumatoid arthritis (RA) , Reiter' s syndrome (reactive arthritis), Schizoaffective Illness, Schizophrenia, sepsis, Sjδgrens syndrome, systemic lupus erythematodes (SLE), Takayasu's arteritis, Temporal arteritis, Unipolar and Bipolar Affective Disorders.