EP2215230A2 - Regulatory sequences derived from il-10 promoter and uses thereof in modulation of immune response - Google Patents

Abstract

The present invention relates to a nucleic acid sequence comprising a regulatory element derived from an anti-inflammatory cytokine promoter region. More particularly, the invention relates to novel repressor elements derived from the IL-10 promoter region. The invention further provides transcription factor repressor decoy molecules comprising the regulatory sequences of the invention, as well as immuno-modulatory compositions, methods and uses thereof for modulation of innate immunity and for the treatment of immune related disorders.

Description

REGULATORY SEQUENCES DERIVED FROM IL-IO PROMOTER AND USES THEREOF IN MODULATION OF IMMUNE RESPONSE

Field of the Invention

The present invention relates to a nucleic acid sequence comprising a regulatory element derived from an anti-inflammatory cytokine promoter region. More particularly, the invention relates to a novel repressor element derived from the IL-IO promoter region, as well as to methods and uses thereof for modulation of innate immunity.

Background of the Invention

All publications mentioned throughout this application are fully incorporated herein by reference, including all references cited therein.

The 65-kDa heat shock protein (HSP65) of the Mycobacterium Tuberculosis plays a significant role in the pathogenesis of autoimmune arthritis. Its effect is well exemplified in the experimental model of adjuvant arthritis (AA). AA can be induced in susceptible, inbred strains of rats such as Lewis or Wistar, by intracutaneous inoculation of heat killed mycobacteria suspended in Freunds adjuvant. AA can be passively transferred by a T-cell clone reactive to residues 180-188 of the HSP65 [Holoshitz, J. et al. Science 219:56-58 (1983)]. Furthermore, an association between T cell responses to HSP65 and early stages of joint inflammation has also been found in patients suffering from rheumatoid arthritis [Gaston, J. et al. J. Exp. Med. 171:831-841 (1990); Quayle, A. Eur. J. Immunol. 22:1315-1322 (1992); Henwood, J. et al. Eur. J. Immunol. 23:1256-1265 (1993)].

Resistance to adjuvant arthritis can be conferred by several factors: genetic background (e.g. Black-Norway or Fisher strains), old age, previous disease and pre-immunization of susceptible rats with mycobacterial HSP65. Evidence has been reported that protection from disease may be due to cellular responses to HSP65 [Hogervorst, E. et al. Eur. J. Immunol. 21:1289-1286 (1991); Thole, J. et al. Infect. Immun. 55:1466-1475 (1987); Lider, O. et al. Proc. Natl. Acad. Sci. 84:4577-4580 (1987); Billingham, M. et al. J. Exp. Med. 171:339-344 (1990); Moudgil, K. et al. J. Exp. Med. 185:1307-1316 (1997)] suggesting that this protein contains different epitopes which participate in both pathogenesis and acquisition of resistance. The present inventors have previously shown that resistance to AA can also be conferred by antibodies against HSP65 and can be passively transferred by intravenous infusion of immunoglobulins from arthritis-resistant strains to arthritis-susceptible rats [Ulmansky, R., and Y. Naparstek, Eur. J. Immunol. 25:952-957 (1995)]. Further analysis defined the epitope specificity of the anti-HSP protective antibodies to amino-acid residues 31-46, designated as peptide-6 [Ulmansky, R. and Y. Naparstek, J. Immunol. 168: 6463-6469 (2002)]. Vaccination of Lewis rats with this peptide resulted in the production of antibodies against the whole molecule as well as resistance to disease induction. Protective antibodies were absent in arthritis- susceptible, young Lewis rats but present resistant animals such as BN, old naϊve Lewis and young Lewis rats after recovery from AA [Ulmansky (2002) ibid.].

The cellular and molecular mechanisms by which anti-HSP65 antibodies exert their protective effects were further investigated as disclosed by the present invention. The inventors have previously shown that polyclonal antibodies against peptide-6, stimulate IL-10 production by peripheral blood mononuclear cells (PBMC) [Ulmansky (2002) ibid.]

IL-10 plays an important role in innate immunity mostly due to its inhibitory effects, which allow containment of inflammatory responses. Monoclonal anti- peptide 6 antibodies (AP6) were generated by the inventors and were shown to retain a protective effect [Ulmansky, in preparation, (2008)]. The present invention shows that these antibodies bind to PBMC and stimulate IL-IO secretion. Specific IL-IO mRNA levels rise four hours post-exposure but return almost to baseline levels after 24 hours. Detailed analysis of the enhancing effect of the AP6 antibody on the IL-IO promoter level, revealed the involvement of protein binding to the transcription-enhancing SpI site and cAMP responsive element (CRE) within the IL-IO promoter. It should be noted that these sites have been previously reported to participate in IL-IO gene expression [Platzer, C. et al. Eur. J. Immunol. 29:3098-3104 (1999); Ma, W. et al. J. Biol. Chem. 276:13664-13674 (2001)]. Interestingly, protein binding was also observed in a pair of novel repressor elements. These novel elements were shown by the present invention to be involved in subsequent gene silencing of IL-10, which was observed after 24 hr.

It is therefore an object of the invention to provide nucleic acid sequences comprising a regulatory sequence derived from an anti-inflammatory cytokine, preferably, IL-10 promoter region.

Another object of the invention is to provide a nucleic acid construct comprising the regulatory element of the invention, optionally, attached to a reporter gene.

Another object of the invention involves the use of the nucleic acid sequences of the invention as immuno modulatory decoy molecules for modulating antiinflammatory cytokine expression and thereby regulating the Thl/Th2 response.

In yet another object, of the invention provides the use of the regulatory element of the invention for screening of compounds which modulates innate immunity. These and other objects of the invention will become apparent as the description proceeds.

Summary of the Invention

In a first aspect, the invention relates to a nucleic acid sequence comprising a regulatory element derived from the IL-IO promoter region. According to a preferred embodiment, the novel regulatory element of the invention comprises the nucleic acid sequence as denoted by SEQ ID NO. 12, or any fragment, variant, derivative, homologue and mutant thereof.

In a second aspect, the invention relates to a nucleic acid construct comprising a regulatory element derived from IL-IO promoter region, wherein said regulatory element comprises the nucleic acid seqxience as denoted by SEQ ID NO. 12, or any fragment, variant, derivative, homologue and mutant thereof.

A third aspect of the invention relates to a transcription factor repressor decoy, in the form of an oligonucleotide or oligonucleotide analogue comprising the sequence of the regulatory elements of the invention. As shown by the invention, this element is derived from the IL-10 promoter region, and mediates the repression of IL-10 expression.

According to a further aspect, the invention relates to a screening method for an immuno-modulating compound which modulates the expression of an antiinflammatory Th2 cytokine and thereby modulates the Thl/Th2 cell balance. The screening method of the invention comprises the steps of: (a) obtaining a candidate compound which binds a nucleic acid sequence comprising a regulatory element derived from IL-10 promoter region. More specifically, the regulatory element of the invention comprises the nucleic acid sequence as denoted by SEQ ID NO. 12, or any fragment, variant, derivative, homologue and mutant thereof; (b) selecting from the candidate compounds obtained in step (a), a compound which regulates the expression of a reporter gene operably linked to the nucleic acid sequence of the invention which comprises a regulatory element derived from IL-IO promoter region; and (c) determining the effect of the compound selected in step (b), on modulation of an antiinflammatory cytokine expression. Whereby modulation of an anti- inflammatory cytokine expression by said candidate compound is indicative of the ability of said compound to modulate the Thl/Th2 balance.

Other aspects of the invention will become apparent by the hand of the following figures.

Brief Description of the Figures Figure 1: AP6 antibody bind to PBMC

Human PBMC were methanol-fixed to glass slides and incubated with either polyclonal naive Lewis rat immunoglobulins as a control or monoclonal anti peptide-6 antibodies (AP6). The slides were then treated with FITC-labeled goat anti-rat antibodies. Binding was detected by fluorescence microscopy.

Abbreviations: cont. (control). v

Figure 2A-2B: AP6 antibodies are potent IL-IO inducers

Fig. 2A. IL-10 secretion: PBMC were split and incubated for 24 hours with one of three reagents: LPS-lipopolysaccharide; IgM- total polyclonal naϊve

Lewis IgM; AP6-anti peptide-6 monoclonal antibodies, compared to control untreated cells (UT-untreated cells). Following incubation, IL-10 was detected in supernatants by ELISA.

Fig. 2B. IL-10 transcription: Total RNA was extracted after 4 and 24 hours of incubation of PBMC with inducers as indicated. Reverse-transcriptase PCR was performed using primers for human IL-10 and human GAPDH (control), as shown. The PCR products were electrophoresed on a 2%, ethidium-bromide stained agarose gel. Figure 3A-3C: Enhancement of protein binding to IL-IO promoter- activating sites in response to stimulation by AP6

Fig. 3A. A schematic map of the human IL-IO promoter is shown, indicating the position of the SpI and CRE (cAMP Responsive Element) sites.

Fig. 3B. Radioactively labeled probes corresponding to the CRE element were incubated with nuclear protein extracted from PBMC after one hour incubation with either total polyclonal naϊve Lewis IgM or AP6. The incubation products were electrophoresed on a 4% polyacrilamide gel.

Fig. 3 C. Radioactively labeled probes corresponding to the SpI element were incubated with nuclear protein extracted from PBMC after one hour incubation with either total polyclonal naϊve Lewis IgM or AP6. The incubation products were electrophoresed on a 4% polyacrilamide gel.

Abbreviations: mut. (mutated).

Figure 4: Specific inhibition of the cAMP-dependent protein kinase by KT5720 abrogates IL-10 stimulation

PBMC were treated with increasing concentrations of KT5720 in DMSO, 15 minutes prior to the addition of the AP6 antibody, as indicated. Medium was collected 24hrs later and IL-10 levels were determined by ELISA. Abbreviations: pg/ml (Pico-gram/ milliliter), UT (untreated), Nm (nano-molar).

Figure 5A-5B: Enhancement of protein binding to a site within a repressor region in the 3' end of the IL-10 promoter

Fig. 5A. IL-10 promoter fragments were produced by PCR and cloned upstream to the luciferase reporter gene (left). The different constructs were transiently transfected into the IL-10 producing HuT-78 cell line. Luciferase activity was assayed and depicted as percent of the -1308-(-6) promoter (right). The 3' elongations define a putative repressor region, as indicated. A fragment from exon 1 (bp +40 to +112) was deleted and replaced by an exogenous sequence in the bottom construct (blue rectangle); Deleted sequence:

TCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCCAGCCC AGGCCAGGGCACCCAGTCTGAGA (SEQ ID NO. 5)

Exogenous insertion:

TAAGCCGAATTCTGCAGATATCCATCACACTGGCGGCC

GCTCGAAATCTAAGTAAGCTTGGCATTCCGGTACT (SEQ ID NO. 6).

Fig. 5B. Probes from the repressor region were tested for changes in binding following incubation with both total polyclonal naive Lewis IgM and to AP6 antibody. Probe 1 (SEQ ID NO. 7, bottom) showed enhancement of binding after treatment with AP6 (top).

Abbreviations: rep. (repressory), reg. (region), pr. (probe), act. (activity).

Figure 6A-6C: Characterization of the novel antibody-responsive site reveals a duplicated motif recognizing a 7OkDa protein which mediates IL-10 repression

The nucleotide sequence around the transcription start site is shown at the top (SEQ ID NO. 17). A nine base pair (bp.) motif present in the antibody- responsive probe 1 (Fig. 5B) is duplicated and indicated in boxed light characters.

Fig. 6A. Duplication of the binding site: EMSA experiments comparing the binding of probe 1 and probe 2 (SEQ ID NO. 7 and 9, respectively), show identical patterns with both probes. Probe 1 was used without cold competition (-) or with 100 fold excess of cold probe 2, probe 1 and mutated probe 1 (CT7JGCAAAA SEQ ID NO. 8^ CCCGCAAAA, SEQ ID. NO. 11). Probe 1 and 2 competed equally with the radio labeled oligonucleotide. Fig. 6B. The size of the binding protein: Southwestern blotting analysis was performed by electrophoresis of PBMC nuclear protein (see "Experimental procedures") and hybridization with either radio labeled probe 1 or mutated probe 1. The robust 70kd band is significantly decreased with the mutated probe.

Fig. 6C. The inhibitory function of the novel binding sites: Promoter fragments were cloned upstream to the luciferase reporter gene and transfected into Hut78 cells. The non- mutated promoter was designated 100% activity, and this was compared to constructs with mutations in the binding sites, (empty rectangle=non-mutated [CTTGCAAAA, SEQ ID NO. 8], rectangle with X= mutated [CCCGCAAAA, SEQ ID NO. H]).

Abbreviations: pr. (probe), act. (activity), mut. (mutated), rad. lab. (radio labeled), co. comp. (cold competition), pi. cons, (plasmid constructs).

Figure 7: A schematic representation of the proposed mechanism of action of AP6

The production of AP6 is triggered by antigenic stimulation following exposure of the immune system to an epitope within the mycobacterial HSP65, designated peptide-6 (indicated in green) (A).

This antibody is cross reactive with an antigen present the mononuclear cell, presumably on its surface (B).

Antibody-cell interaction elicits signaling to the nucleus, in which the cAMP- dependent pathway is a pivotal player (C). ^v

Consequently, transcription factors are bound to the SpI and CRE sites within the IL-10 promoter (D).

These changes are reflected by an increase in mRNA levels and IL-10 secretion from the cell (E).

Concomitantly, protein is also bound to a pair of repressor elements, which eventually silences the active promoter down to its background level (F).

Abbreviations: pat. (pathway), act. (activation), rep. (repressor), silen.

(silencing). Detailed Description of the invention

Adjuvant arthritis (AA) was the first animal model devised for the investigation of human rheumatoid arthritis (RA). Many investigators use AA to understand the human disease because of the similarities between the two entities. However, it is the difference between them that has attracted a great deal of attention during recent years. In contrast to the chronic course of RA, rats eventually recover spontaneously and become resistant to re-induction of the disease. The understanding of the role of HSP65 in convalescence and resistance to AA is especially intriguing because of its potential therapeutic implications.

Preceding research of the present inventors have shown that protection from AA is attributed to formation of antibodies against heat shock protein surface epitopes, for example, specific epitope within the mycobacterial HSP65 such as antibodies directed against peptide-6 (also denoted by SEQ ID NO.10), or against any of the peptides denoted by any one of SEQ ID O. 18, 19 and 20 (derived from rat HSP60). The inventors have also reported previously that protective polyclonal anti-peptide-6 antibodies enhance the secretion of the anti-inflammatory cytokine IL-IO [Ulmansky, R. et al. J. Immunol. 15;168(12):6463-9 (2002)] ^v

This finding prompted the inventors to further investigate the molecular mechanism underlying this effect. It should be noted that in the inventor's model for resistance to AA, they portray a mechanism which differs from the commonly accepted dogma. Usually, innate responses are thought to precede the acquired immune system. In contrast, the inventors have shown that specific (monoclonal) antibodies to a bacterial protein, that are clearly an acquired form of immunity, stimulate the production of an anti-inflammatory cytokine i.e. a component of the innate system. Without being bound by any theory, the results presented by the present invention suggest a sequence of events which account for the biological effects of a monoclonal anti peptide-6 (SEQ ID NO.10) antibody, designated AP6. As illustrated by Figure 7, the trigger for this cascade may be the exposure of the immune system to a foreign epitope within the mycobacterial heat shock protein (Fig. 7 (A). This interaction results in the production of antibodies, which are apparently cross-reactive with a putative ligand on the surface membrane of self-PBMC (Fig. 7 (B) thus providing a mechanism for remodeling of the immune response by bacteria. Even though AP6 actually binds to PBMC (Fig 1), the identity of its target antigen has yet to be characterized, although preliminary results indicate that it is a membrane protein (not shown). In this regard, it should be noted that a BLAST search revealed no significant homology between peptide-6 amino-acid sequence (SEQ ID NO. 10) and other known proteins.

The inventors further showed that cAMP is necessary as a secondary messenger (Fig 7(C) and that AP6 increases protein binding to CRE within the IL-10 promoter (Fig, 7(D). Without being bound by any theory, the results presented in the present invention allow an estimation of a timetable of the intracellular cascade elicited by the AP6 antibody: protein binding to the activating elements CRE and SpI in the IL-10 promoter is detected within one hour, increase in mRNA levels after 4 hours (Fig 7 (E), and secretion of IL-10 into the medium was observed at 24 hours (Fig 7 (E).

The inventors were intrigued by the fact that the stimulation of transcription by AP6 was eventually blunted at 24 hours although the antibody was not removed. This finding is somewhat expected, since the antibody, which is persistently present in the serum of resistant animals, does not stimulate cytokine secretion constantly. The fact that the AP6 antibody enhances binding of an unknown 70Kda protein to the repressor elements defined by the invention, should therefore, not be regarded surprising, and may therefore indicate that this antibody participate in the late silencing of IL-IO expression. It seems that the importance of silencing elements is often overlooked. A recent report suggested that the -571bp human IL-IO promoter polymorphism, which is associated with inflammatory diseases, represents disruption of a repressor promoter elements [Steinke, J. W. et al. J. Immunol. 173:3215-3222 (2004)]. The inventors conclude that the anti- inflammatory effect of IL-10 depends on a burst of expression within a limited time-frame and that this pattern of production is obtained by exposure of PBMC to the AP6 antibody.

Finally, the results presented in this work indicate that the effect of the AP6 antibody on PBMC is evident by intracellular changes which lead to a transient and well controlled increase in the expression and secretion of the anti-inflammatory cytokine IL-10.

Thus, in a first aspect, the invention relates to a nucleic acid sequence comprising a regulatory element derived from the IL-10 promoter region. According to a preferred embodiment, the novel regulatory element of the invention comprises the nucleic acid sequence as denoted by SEQ ID NO. 12 or any fragment, variant, derivative, homologue and mutant thereof. More specifically, the regulatory element of the invention comprises nucleotide sequence located from nucleotide base at position -14 to nucleotide base at position +232 (SEQ ID NO. 12). It should be appreciated that the location of the nucleotide bases is referred to the transcription start site. It should be further noted that the IL-10 promoter region may be also referred to as having GenBank Accession Number AF418271.

According to one embodiment, the regulatory element of the invention may comprise a fragment of sequence ID NO. 12. One preferred fragment according to this embodiment may be a fragment having the nucleic acid sequence as denoted by SEQ ID NO. 5. As shown by Figure 5A, this sequence comprises a repressor element, since replacement thereof, significantly reduced, repression of the reporter gene expression. It should be noted that this sequence is located from nucleotide base at position +40 to nucleotide base at position +112.

According to another embodiment, the regulatory element of the invention may comprise a fragment of sequence ID NO. 12, which may be the fragment as denoted by SEQ ID NO. 16. This nucleotide sequence is located from nucleotide base at position -5 to nucleotide base at position+112 (SEQ ID NO. 16).

According to another embodiment, the regulatory element of the invention may comprise a fragment of sequence ID NO. 12 which may be the fragment as denoted by SEQ ID NO. 13. This nucleotide sequence is located from nucleotide base at position +73 to nucleotide base at position+112 (SEQ ID NO. 13).

In yet another embodiment, the regulatory element of the invention comprises the nucleic acid sequence as denoted by SEQ ID NO. 7 which is a fragment of SEQ ID NO. 12. It should be noted that SEQ ID NO. 7, is also referred by the present invention as probe 1.

According to another embodiment, the regulatory element of the invention comprises the nucleic acid sequence as denoted by SEQ ID NO. 9, which is a fragment of SEQ ID NO. 12. It should be noted that SEQ ID NO. 9, is also referred by the present invention as probe 2.

According to another embodiment, the regulatory element of the invention may comprise a fragment of sequence ID NO. 12 which may be the fragment, as denoted by SEQ ID NO. 14. This nucleotide sequence is located from nucleotide base at position -5 to nucleotide base at position+39 (SEQ ID NO. 14).

According to another embodiment, the regulatory element of the invention may comprise a fragment of sequence ID NO. 12, which may be the fragment as denoted by SEQ ID NO. 15. This nucleotide sequence is located from nucleotide base at position -5 to nucleotide base at position+72 (SEQ ID NO. 15).

In a specifically preferred embodiment, the regulatory sequence comprised within the nucleic acid sequence of the invention comprises at least one repeat of the nucleic acid sequence CTTGCAAAA as denoted by SEQ ID NO. 8, or any mutant, homologue variant or derivative thereof.

According to a specific embodiment, a mutant of the CTTGCAAA sequence may carry mutation in at least one of any of the bases T, specifically, in both, more preferably mutation of both T to C. Alternatively, the mutated SEQ ID NO. 8 may carry a mutation in at least one of any of the bases, except T. Ann example for such mutated binding site is the sequence denoted by SEQ ID NO. 11.

In another specifically preferred embodiment, the novel regulatory element of the invention may be a repressor element comprising DNA-binding sites for one or more specific transcription repressor factor, whereby binding of said transcription repressor factor to said site leads to repression of gene transcription.

It should be emphasized that as clearly exemplified by the present invention, binding of a transcription repressor factor to this site leads to significant reduction in IL-IO expression. It should be appreciated that wherein indicated repression it is meant, reduction, suppression, inhibition, attenuation or weakening of the expression of IL-IO or of any other attached coding region, in about 10-100%, as compared to control. More specifically, the invention encompasses reduction of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of the expression of a coding sequence attached t the repressor elements of the invention, preferably, IL-10 expression.

In a second aspect, the invention relates to a nucleic acid construct comprising a regulatory element derived from IL-10 promoter region. Such regulatory element comprises the nucleic acid sequence as denoted by SEQ ID NO. 12, or any fragment, variant, derivative, homologue and mutant thereof.

According to one preferred embodiment, a fragment of the nucleic acid sequence, comprised within the construct of the invention, may be any fragment of SEQ ID NO. 12, for example, any sequence as denoted by any one of SEQ ID NO. 5, 13, 14, 15, 16, 7, 8, 17 and 9.

According to a specifically preferred embodiment, the constructs of the invention may comprise at least one repeat of any of the fragments of the invention or any combination thereof. Thus, according to one embodiment, the nucleic acid construct of the invention may comprise at least one repeat of the nucleic acid sequence CTTGCAAAA as denoted by SEQ ID NO. 8, or any mutant, homologue variant or derivative thereof.

In yet another specifically preferred embodiment, the nucleic acid construct of the invention further comprises operably linked reporter gene. As non-limiting example, such reporter genes may be selected from the group consisting of luciferase, green fluorescent protein (GFP), secreted alkaline phosphatase (SEAP) and β-galactosidase (β-gal).

It should be appreciated that the invention relates to any of nucleic acid constructs or plasmids described herein. It should be further noted that the invention further encompasses any host cells (Eukaryotic as well as prokaryotic) transformed or transfected with any of the constructs of the invention. Still further, the invention also relates to any recombinant protein expressed by said host cells.

The novel regulatory element of the invention provides a powerful tool for controlling the expression of genes harboring said sequence in their regulatory regions. More particularly, this repressor element enables modulation of the expression of anti-inflammatory cytokines, specifically, IL-IO. One possible way of interfering with the repressor activity mediated by the regulatory element of the invention, is to use oligonucleotides (ODNs) comprising the nucleic acid sequences of this element as competitors of the endogenous sequence within the IL-IO promoter, for binding to the repressor factor. It should be noted that experiments using cold probe as shown in Figure 6 of the specification, demonstrate the feasibility of such strategy, cis DNA elements (decoys) are short double stranded DNA oligonucleotides, able to bind their target DNA binding proteins. The decoys according to the present invention are replicas of IL-IO genomic transcription repressor factor binding elements. Like the natural elements, the decoys are able to bind the corresponding transcription repressor factors. Therefore, when these elements are in surplus they will decoy the transcription repressor factors away from natural genomic elements. When regulatory factors, repressors in particular, are prevented from binding their target sequences, their regulatory effects on gene expression are generally impeded. The decoy strategy aims at providing an intracellular surplus of artificial DNA-binding sites for one or more specific transcription repressor factors, thus sequestering the repressor/s from their natural site(s). In this way, transcription repression from the natural sites is prevented.

Therefore, as a third aspect, the invention relates to a transcription factor repressor decoy, in the form of an oligonucleotide or oligonucleotide analogue comprising the sequence of a repressor element of the invention. This element is derived from the IL-IO promoter region, and thereby regulates the repression of IL-IO expression. As shown by the invention, the repressor element comprises the nucleic acid sequence as denoted by SEQ ID NO. 12, or any fragment, variant, derivative, homologue and mutant thereof.

It should be noted that the repressor element of the invention comprises DNA- binding site/s for one or more specific transcription repressor factor. Subsequently, binding of said transcription repressor factor to their specific site/s may lead to repression of gene transcription. More particularly, as exemplified by the present invention, such repressor may be a 70Kd protein, which upon binding to said repressor element within the IL-IO promoter region, leads to significant decrease in IL-10 expression and secretion. More preferably, reduction of between about 10% to 100%, specifically, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of the expression.

According to one preferred embodiment, the decoy molecule of the invention comprises at least one repeat of the nucleic acid sequence as denoted by any one of SEQ ID NO. 5, 13, 14, 15, 16, 7, 8, 17 and 9. v

According' to a specifically preferred embodiment, the transcription factor repressor decoy of the invention comprises at least one repeat of the nucleic acid sequence CTTGCAAAA as denoted by SEQ ID NO. 8, or any mutant, homologue variant or derivative thereof.

According to another preferred embodiment, the oligonucleotide or oligonucleotide analogue comprised within the decoy of the invention may be selected from the group consisting of DNA, RNA, LNA, PNA, INA and mixtures thereof and hybrids thereof, as well as phosphorous atom modifications thereof. When used in the present context, the terms "locked nucleic acid monomer", "locked nucleic acid residue", "LNA monomer" or "LNA residue" refer to a bicyclic nucleotide analogue. LNA monomers are described in inter alia WO 99/14226, WO 00/56746, WO 00/56748, WO 01/25248, WO 02/28875, WO 03/006475 and WO 03/095467. By INA is meant an intercalating nucleic acid in accordance with the teaching of WO 03/051901, WO 03/052132, WO 03/052133 and WO 03/052134 incorporated herein by reference. An INA is an oligonucleotide or oligonucleotide analogue comprising one or more intercalator pseudonucleotide (IPN) molecules.

The invention further provides a composition comprising as an active ingredient a transcription factor repressor decoy in the form of an oligonucleotide or oligonucleotide analogue comprising the sequence of a repressor element derived from the IL-IO promoter region. More specifically, the repressor element of the invention comprises the nucleic acid sequence as denoted by SEQ ID NO. 12 or any fragment, variant, derivative, homologue and mutant thereof. Such fragment may comprise the nucleic acid sequence as denoted by any one of SEQ ID NO. 5, 13, 14, 15, 16, 7, 8, 17 and 9. Thus, the composition of the invention may comprise as an active ingredient any of the decoy molecules described by the invention. ^v

According to a specifically preferred embodiment, the composition of the invention is specifically applicable in inhibiting repression of antiinflammatory cytokine expression, thereby leading to increase in the expression of such cytokine. Such anti-inflammatory cytokine may be any one of IL-IO, IL-4 and IL-6. More specifically, such increase may be an increase of between about 10% to 100% of the expression of such cytokines. Particularly, an increase of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of the expression. According to another embodiment, the composition of the invention may be used for modulating the balance between Thl/Th2 towards the Th2 antiinflammatory reaction in a subject in need thereof.

Therefore, use of the composition of the invention for the treatment of an immune-related disorder in a subject in need thereof, is further provided.

More specifically, the invention provides a composition for the treatment of immune disorders related to an imbalance in the Thl-Th2 response. An immune-related disorder may be for example, an autoimmune disease, (for example, Arthritis, multiple sclerosis (MS), Type-1 diabetes, lupus, Graves disease and thyroiditis, IBD), graft rejection pathology and graft versus host disease, inflammatory disorders and disorders induced by supper antigens, such as toxic shock, septic shock and severe sepsis.

It should be noted that the pharmaceutical composition of the invention may comprise the active compound in free form and be administered directly to the subject to be treated. Alternatively, depending on the size of the active molecule, it may be desirable to conjugate it to a carrier prior to administration. Therapeutic formulations may be administered in any conventional dosage formulation. Formulations typically comprise at least one active ingredient, as defined above, together with one or more acceptable carriers thereof.

Each carrier should be both pharmaceutically and physiologically acceptable in the sense of being compatible with the other ingredients and not injurious to the patient. Formulations include those suitable for oral, rectal, nasal, or parenteral (including subcutaneous, intramuscular, intraperitoneal (IP), intravenous (IV) and intradermal) administration. The pharmaceutical forms suitable for injection use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.

In the case of sterile powders for the preparation of the sterile injectable solutions, the preferred method of preparation are vacuum-drying and freeze drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The pharmaceutical compositions of the invention generally comprise a buffering agent, an agent who adjusts the osmolarity thereof, and optionally, one or more pharmaceutically acceptable carriers, excipients and/or additives as known in the art. Supplementary active ingredients can also be incorporated into the compositions. The carrier can be solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.

As used herein "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic composition is contemplated.

Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.

Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. The pharmaceutical compositions of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers. The pharmaceutical compositions of the present invention also include, but are not limited to, emulsions and liposome-containing formulations. v

The nature_/ availability and sources, and the administration of all such compounds including the effective amounts necessary to produce desirable effects in a subject are well known in the art and need not be further described herein. The preparation of pharmaceutical compositions is well known to the skilled man of the art and has been described in many articles and textbooks, see e.g., Remington's Pharmaceutical Sciences, Gennaro A. R. ed., Mack Publishing Co., Easton, PA, 1990, and especially pp. 1521-1712 therein.

In yet another aspect, the invention provides a method for the treatment of an immune-related disorder in a subject in need thereof. The method of the invention comprises the step of administering to said subject a therapeutically effective amount of any of the decoy molecules of the invention or any composition thereof as described by the invention.

It should be noted that the administration of the decoy molecules of the invention, may preferably inhibit the repression of IL-IO expression, and thereby modulate the Thl/Th2 balance towards the Th2 anti-inflammatory response. This may be useful in conditions where modulation of the Thl/Th2 balance towards an anti-inflammatory reaction is desired. For example, in the treatment of immune-related disorders such as an autoimmune disease, (for example, Arthritis, multiple sclerosis (MS), Type-1 diabetes, lupus, Graves disease and thyroiditis, IBD), graft rejection pathology and graft versus host disease, and disorders induced by supper antigens, such as toxic shock, septic shock and severe sepsis.

By "patient" or "subject in need" it is meant any mammal who may be affected by the above-mentioned conditions, and to whom the treatment methods herein described is desired, including human, bovine, equine, canine, murine and feline subjects. Preferably said patient is a human. Administering of the drug combination to the patient includes both self-administration and administration to the patient by another person. ^v

According to another specific embodiment, the active ingredients used by the invention or composition comprising the same or combination thereof, may be administered via any mode of administration. For example, oral, intravenous, intramuscular, subcutaneous, intraperitoneal, parenteral, transdermal, intravaginal, intranasal, mucosal, sublingual, topical, rectal or subcutaneous administration, or any combination thereof.

The term "therapeutically effective amount" is intended to mean that amount of a drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, a system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician.

The novel transcription regulatory (repressor) element defined by the present invention enables the use of such regulatory element as a target molecule for searching for novel molecules having regulatory effect on repression of the expression of anti-inflammatory cytokines. Such modulatory compounds may potentially affect the Thl/Th2 balance and therefore may be used as immuno- modulating agent, specifically, for treating immuno-related disorders. The present invention therefore provides a high throughput screening methods for compounds which modulate innate immunity through regulation of gene expression of different cytokine genes, preferably, anti-inflammatory cytokines, most preferably, IL-IO, IL-4, and IL-6.

Thus, according to a further aspect, the invention relates to a screening method for an immuno-modulating compound which modulates the expression of an anti-inflammatory Th2 cytokine (T helper) and thereby modulates the Thl/Th2 cell balance. The screening method of the invention comprises the steps of. (a) obtaining a candidate compound which binds a nucleic acid sequence comprising a regulatory element derived from IL-IO promoter region. More specifically, the regulatory element of the invention comprises the nucleic acid sequence as denoted by SEQ ID NO. 12, or any fragment, variant, derivative, homologue and mutant thereof; (b) selecting from the candidate compounds obtained in step (a), a compound which regulates the expression of a reporter gene operably linked to the nucleic acid sequence of the invention which comprises a regulatory element derived from IL-IO promoter region; and (c) determining the effect of the compound selected in step (b), on modulation of an anti-inflammatory cytokine expression. Whereby modulation of an anti-inflammatory cytokine expression by said candidate compound is indicative of the ability ^of said compound to modulate the Thl/Th2 balance. According to one preferred embodiment, the first stage of screening method of the invention involves the identification of a compound which specifically binds to the regulatory element of the invention. As indicated above, identification of such compound involves the use of the regulatory repressor element of the invention as a target. Therefore, the candidate modulating compound may be obtained by the steps of:

(a) providing a mixture comprising a nucleic acid sequence of a regulatory element derived from IL-IO promoter region, wherein said regulatory element comprises the nucleic acid sequence as denoted by SEQ ID NO. 12, or any fragment, variant, derivative, homologue and mutant thereof; (b) contacting said mixture with a candidate compound under suitable conditions for said binding; and (c)determining the effect of said candidate compound on an end- point indication. It should be noted that modulation of the end point should indicates the binding of the nucleic acid sequence of the invention to the tested candidate compound.

According to one specific embodiment, the end point indication may be the binding of the nucleic acid sequence of the invention to a tested candidate compound, which leads to a visually detectable signal. It should be noted that preferably, said nucleic acid sequence or any fragments thereof may be labeled. In such case binding may be determined using gel retardation assay. Alternatively, the candidate compounds may be immobilized to a solid support, a plate or membrane for example, and binding of the labeled sequence may be detected by a suitable means (radioactive labeling, avidin- biotin, Enzymatic reaction leading to a visual signal). In yet another alternative, specifically where the candidate compound is a protein compound, binding may be examined using affinity chromatography, ELISA, Western blots South- Western etc.

According to another specifically preferred embodiment, the second stage of the screening method of the invention involves functional examination of the candidate compounds. Therefore, this stage involves the selection of a candidate compound which in addition to its binding to the regulatory element derived from the IL-IO promoter region, also and thereby regulates the expression of a reporter gene operably linked thereto. According to a preferred embodiment, the selection may be performed by the steps of: (a) providing a mixture comprising a reporter gene operably linked to a nucleic acid sequence comprising a regulatory element derived from IL-IO promoter region, wherein said regulatory element comprises the nucleic acid sequence as denoted by SEQ ID NO. 12 or any fragment, variant, derivative, homologue and mutant thereof; (b) contacting the mixture with the tested candidate compound under suitable conditions for expression of the reporter gene; and (c) determining the effect of the candidate compound on an end-point indication. Modulation of such end point is indicative of the ability of said compound to modulate gene expression of said reporter gene via said regulatory element.

According to another embodiment, it should be noted that modulation of expression of the reporter gene may be either increasing or decreasing the expression of the gene as compared to a control. A control may be for example, the expression of the reporter gene in the presence of the regulatory element of the invention and in the absence of the candidate compound. ^v

According to another embodiment, the mixture used for the selection stage of the screening method of the invention may be a cell mixture. More particularly, such cell mixture may be a transfected cell culture transfected with the DNA construct as defined by the invention.

It should be appreciated that the transfected cells may further contain endogenously expressed and optionally exogenously added molecules essential for the modulation of expression of said reporter gene, mediated by said regulatory element. A non-limiting example of an exogenously added molecules essential for regulation of gene expression mediated by the regulatory element of the invention, may be the addition of an anti-peptide 6 (SEQ ID NO. 10) antibody (AP-6 for example), or antibodies directed against any of the peptides of SEQ ID NO. 18, 19 or 20.

According to another specifically preferred embodiment, the third stage of the screening method of the invention involves further evaluation of the feasibility of the selected candidate compounds to actually modulate the expression of anti-inflammatory cytokines and thereby, their ability to modulate innate immunity. Therefore, the selected candidate compounds are next evaluated for their ability to modulate an anti-inflammatory cytokine expression. This evaluation stag involves the steps of: (a)providing a test system comprising an anti-inflammatory cytokine or any fragments thereof; (b) contacting the test system with a tested candidate compound obtained and selected by the previous stages of the screening method of the invention, under conditions suitable for expression of the anti-inflammatory cytokine; and (c) determining the effect of said candidate compound on an end-point indication as compared to a control, wherein said effect is indicative of the ability of said candidate to modulate the expression of said anti-inflammatory cytokine.

According to one specifically preferred embodiment, the test system may be any one of in-υitrol ex-υiυo cell culture, and in-υiυo animal model.

It should be noted that the test system used by the invention optionally further comprises endogenous and/or exogenous compounds which provide suitable conditions for anti-inflammatory cytokine expression and for the detection of an end-point indication for determining the immunomodulatory effect of the candidate compound. It should be appreciated that in some cases exogenously added molecules may be essential for regulation of gene expression mediated by the regulatory element of the invention. Such molecules may be for example, an anti-peptide 6 antibody (AP-6 for example), or antibodies directed against the peptides of any one of SEQ ID NO. 18, 19 or 20.

In another preferred embodiment, the modulation of expression of the antiinflammatory cytokine may be any one of increasing or decreasing the expression of said cytokine as compared to a control.

It should be noted that the screening method of the invention is directed for identification of compounds modulating the expression of any antiinflammatory cytokine for example, IL-IO, IL-4, and IL-6.

According to another preferred embodiment, the candidate compound examined by the screening method of the invention may be selected from the group consisting of: protein based, nucleic acid based, carbohydrates based, lipid based, small molecule, natural organic based, synthetically derived v organic based, inorganic based, and peptidomimetics based compounds.

According to a specifically preferred embodiment, the compound may be a product of small molecule libraries.

The invention further provides a method of making a compound which modulates the innate immunity in a subject in need thereof, which method comprises the steps of: (a) identifying a compound which modulates the expression of a Th2 anti-inflammatory cytokine, by specifically binding to a regulatory element within an intron and/or an exon of a nucleic acid molecule encoding said cytokine, preferably, by the screening method of the invention; and (b) synthesizing said compound by suitable chemical synthesis means.

It should be noted that the regulatory element used by the method of the invention is comprised within the nucleic acid sequence as defined by the invention.

Still further, the invention provides a method of preparing a therapeutic composition for the treatment of an immune-related disorder in a mammalian subject. The method of the invention comprises the steps of: (a.) identifying, by the screening method of the invention, an immunomodulatory compound which modulates the expression of a Th2 anti-inflammatory cytokine, by specifically binding to a regulatory element comprised within the nucleic acid sequence according to the invention. It should be noted that such element may be harbored within an intron and/or an exon of a nucleic acid molecule encoding inflammatory cytokines, preferably, Th2 anti-inflammatory cytokine; and (b) admixing said compound with at least one of a pharmaceutically acceptable carrier, diluent, excipient and/or additive.

The invention further provides an immuno-modulating compound which modulates the expression of an anti-inflammatory Th2 cytokine and thereby modulates the Thl/Th2 cell balance. According to a specifically preferred embodiment, such compound may be obtained by the screening method of the invention.

According to one embodiment, the compound obtained by the screening method of the invention may be for use in modulating the innate immunity of a subject in need thereof. It should be noted that as used herein, "modulation" of the anti-inflammatory cytokine expression by the compounds obtained by the method of the invention is meant either enhancement or inhibition.

Compounds which modulate the expression of the anti-inflammatory cytokine may therefore increase the expression of such cytokine, IL-IO for example. The enhancement may be mediated by inhibiting the interaction of a cellular transcription repressor factor, specific for the regulatory element of the invention to said repressor element. It should be noted that according to a specifically preferred embodiment the repressor element of the invention (comprises nucleic acid sequence of SEQ ID NO. 12, or any fragment thereof)- When regulatory factors, repressors in particular, are prevented from binding their target sequences, their inhibitory effects on gene expression are generally impeded. This leads to expression of said cytokine which modulates the Thl/Th2 balance towards the Th2 anti-inflammatory response. Such compounds may be useful in conditions where modulation of the Thl/Th2 balance towards an anti-inflammatory reaction is desired. For example, in the treatment of immune-related disorders such as an autoimmune disease, (for example, Arthritis, multiple sclerosis (MS), Type-1 diabetes, lupus, Graves disease and thyroiditis, IBD), graft rejection pathology and graft versus host disease, and disorders induced by supper antigens, such as toxic shock, septic shock and severe sepsis.

More particularly, in general, the composition as well as the methods of the present invention may be used in the treatment of any autoimmune disease such as for example, but not limited to, Eaton-Lambert syndrome, Goodpasture's syndrome, Greave's disease, Guillain-Barr syndrome, autoimmune hemolytic anemia (AIHA), hepatitis, insulin-dependent diabetes mellitus (IDDM), systemic lupus erythematosus (SLE), multiple sclerosis (MS), myasthenia gravis, plexus disorders e.g. acute brachial neuritis, polyglandular deficiency syndrome, primary biliary cirrhosis, rheumatoid arthritis, scleroderma, thrombocytopenia, thyroiditis e.g. Hashimoto's disease, Sjogren's syndrome, allergic purpura, psoriasis, mixed connective tissue disease, polymyositis, dermato myositis, vasculitis, polyarteritis nodosa, polymyalgia rheumatica, Wegener's granulomatosis, Reiter's syndrome, Behget's syndrome, ankylosing spondylitis, pemphigus, bullous pemphigoid, dermatitis herpetiformis, insulin dependent diabetes, inflammatory bowel disease, ulcerative colitis and Crohn's disease.

Alternatively, the compounds identified by the screening method of the invention may enhance the repressing activity of the repressor factor specific for the repressor element of the invention, and thereby may enhance the decrease of anti-inflammatory cytokines expression. This may shift the Thl/Th2 balance towards the ThI pro-inflammatory reaction. Compounds modulating the immune-reaction towards a pro-inflammatory reaction may be useful for treating immune-related disorders such as proliferative pathologic conditions.

More specifically, such proliferative condition may be a malignant disorder. According to a specific embodiment, the malignant proliferative disorder may be any one of solid and non-solid tumor selected from the group consisting^v of carcinoma, sarcoma, melanoma, leukemia and lymphoma. More particularly, the malignant disorder may be melanoma, hepaotcellular carcinoma, colon cancer, myeloma, acute or chronic leukemia.

As used herein to describe the present invention, the terms "malignant proliferative disorder", "cancer", "tumor" and "malignancy" all relate equivalently to a hyperplasia of a tissue or organ. If the tissue is a part of the lymphatic or immune systems, malignant cells may include non-solid tumors of circulating cells. Malignancies of other tissues or organs may produce solid tumors. In general, the composition as well as the methods of the present invention may be used in the treatment of non- solid and solid tumors, for example, carcinoma, melanoma, leukemia, and lymphoma.

Therefore, according to a preferred embodiment, the methods and compositions of the invention can be used for the treatment or inhibition of non-solid cancers, e.g. hematopoietic malignancies such as all types of leukemia, e.g. acute lymphocytic leukemia (ALL), acute myelogenous leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), myelodysplastic syndrome (MDS), mast cell leukemia, hairy cell leukemia, Hodgkin's disease, non-Hodgkin's lymphomas, Burkitt's lymphoma and multiple myeloma, as well as for the treatment or inhibition of solid tumors such as tumors in lip and oral cavity, pharynx, larynx, paranasal sinuses, major salivary glands, thyroid gland, esophagus, stomach, small intestine, colon, colorectum, anal canal, liver, gallbladder, extraliepatic bile ducts, ampulla of Vater, exocrine pancreas, lung, pleural mesothelioma, bone, soft tissue sarcoma, carcinoma and malignant melanoma of the skin, breast, vulva, vagina, cervix uteri, corpus uteri, ovary, fallopian tube, gestational trophoblastic tumors, penis, prostate, testis, kidney, renal pelvis, ureter, urinary bladder, urethra, carcinoma of the eyelid, carcinoma of the conjunctiva, malignant melanoma of the conjunctiva, malignant melanoma^vof the uvea, retinoblastoma, carcinoma of the lacrimal gland, sarcoma of the orbit, brain, spinal cord, vascular system, hemangiosarcoma and Kaposi's sarcoma.

Disclosed and described, it is to be understood that this invention is not limited to the particular examples, methods steps, and compositions disclosed herein as such methods steps and compositions may vary somewhat. It is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only and not intended to be limiting since the scope of the present invention will be limited only by the appended claims and equivalents thereof. It must be noted that, as used in this specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the content clearly dictates otherwise.

Throughout this specification and the Examples and claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. Thus, use of the term "comprising" indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present. By "consisting of is meant including, and limited to, whatever follows the phrase "consisting of. Thus, the phrase "consisting of indicates that the listed elements are required or mandatory, and that no other elements may be present. By "consisting essentially of is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase "consisting essentially of indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.

The following examples are representative of techniques employed by the inventors in carrying out aspects of the present invention. It should be appreciated that while these techniques are exemplary of preferred embodiments for the practice of the invention, those of skill in the art, in light of the present disclosure, will recognize that numerous modifications can be made without departing from the spirit and intended scope of the invention. 1154

33

Examples

Experimental procedures

Generation of rat anti-peptide 6-producing hybridomas

Six- weeks-old female Lewis rats were injected subcutaneously with lOOμg peptide-6 (as denoted by SEQ ID NO. 10) suspended in complete Freund's adjuvant. Rats were injected 2 more times with the peptide in incomplete Freund's adjuvant at 3 weeks intervals. Sera were collected for measurement of anti-peptide antibody levels by ELISA and rats with the highest levels were treated with 2 consecutive intraperitoneal injections of 50 μg peptide in PBS. On the following day spleens were fused with the BALB/c Ig-nonsecreting myeloma NSO.

The presence of antibodies specifically recognizing peptide-6 was detected in the supernatants by specific ELISA, and positive clones were expanded. For this study, a clone designated R24B was used, which produced antibodies of the IgM type. These monoclonal antibodies are referred to as AP6.

Purification of monoclonal AP6 (R24B) and polyclonal rat IgM Polyclonal rat IgM was purified from the sera of six-weeks-old naϊve female Lewis rats, confirmed by ELISA to be devoid of antibodies to peptide-6 (SEQ ID NO. 10). AP6 (also designated as R24B) was purified from the supernatants of hybridoma cells. Purification was performed by thioadsorption followed by protein G chromatography (Adar Biotech, Israel). The purity of antibodies was confirmed by SDS-PAGE.

Preparation of human peripheral blood monocytes

Human PBMC were prepared from 15ml buffy coat diluted with 10ml phosphate buffered saline (PBS), followed by addition of 10ml Lymphoprep (Axis Shield PoC AS, Norway). Cells were centrifuged at 1800rpm for 30 minutes at room temperature. The mononuclear band was extracted and re- suspended in PBS to a final volume of 40ml, and centrifuged at 1200rpm for 10 minutes. The pellet was suspended in RPMI supplemented with 2% human serum, 2 mM glutamine, lOOμg/ml streptomycin, 100 U/ml penicillin (all reagents from Beit-Haemek, Israel) and split to a concentration of 4xlO⁵ cells/ml for adhesion to 10ml plates. After l.δhrs of incubation (37⁰C, 7%CO2) non-adherent cells were washed out 4 times with PBS. The remaining adherents PBMC were incubated overnight in serum-free medium.

Binding of antibodies to fixed human PBMC

Human PBMC were fixed to glass slides by cold methanol. The glass slides were incubated with either 1 μg/50 μl anti-peptide 6 or naϊve Lewis rat polyclonal immunoglobulins followed by incubation with FITC-conjugated goat anti-rat immunoglobulins. The binding intensity was detected by fluorescence microscopy.

Stimulation of PBMC

PBMC were washed 4 times with PBS and covered with medium supplemented with 10% human serum and one of the following: 10ng/ml LPS, 20μg/ml naϊve Lewis rat polyclonal IgM, 20μg/ml AP6.

Human IL-10 ELISA

The levels of IL-10 in cell-culture media of PBMC were determined by ELISA

(Quintikine Immunoassay Human IL-10 kit, R&D Systems, USA).

Reverse-transcription polymerase chain reaction (H PCR)

Total RNA was extracted by SV Total RNA Isolation System (Promega, USA) and cDNA was prepared with Reverse Transcription System (Promega, USA).

The resulting cDNA was amplified by PCR with the following primers:

IL-10: upstream - 5' AC C AAG AC C C AG AC AT C AAG 3', (also denoted by

SEQ ID NO. 1); downstream - 5'GAGGTACAATAAGGTTTCTCAAG 3', also denoted by SEQ ID NO. 2);

GAPDH: upstream - 5' CCCATCACCATCTTCCAGGAGCG 3' also denoted by SEQ ID NO. 3);

Downstream - 5' CATGCCAGTGAGCTTCCCGTTCA 3' also denoted by SEQ ID NO. 4).

The primers yielded products of 46lbp and 476bp for the IL-IO and GAPDH mRNAs, respectively.

Electro mobility -shift assay (EMSA)

Nuclear extracts were prepared as previously described [Lee, K. et al. Gene. Anal. Technol. 5:22-31 (1988)]. Oligonucleotides were labeled in a 20μl reaction mixture containing 20ng of double stranded oligonucleotide, lμl Klenow DNA polymerase and 5μl of lOμC/μL [α-³²P] dCTP (Amersham, UK). In a final volume of 20μl, 200pg of labeled oligonucleotides were incubated at 30⁰C for 40 min, with the nuclear extracts (lOμg protein) in a buffer containing 12mM HEPES pH 7.2, 6OmM KCl, 0.6 mM Na₂EDTA, 0.6 mM DTT, 5mM MgCb and 1 μg poly d(I-C). The reaction mixtures were electrophoresed on 4% polyacrylamide gels in 0.5 TBE buffer, 200V for 90 min.

South-Western blot analysis

PBMC were washed twice with phosphate buffered saline (PBS), suspended in ice cold PBS and centrifuged for 45 seconds in 4⁰C. Cells were resuspended in PBS, vortexed, boiled for 5 minutes and vortexed again. An amount of 15μg protein was separated on 9% polyacrylamide gel and transferred to a nitrocellulose filter at 25OmA for 2hrs in a transfer buffer containing: 15.6mM Tris and 12OmM glycine and 20% methanol. The filter was rinsed in PBS and subjected to hybridization with a double stranded, radiolabeled DNA probe (1.5 x 10⁶cpm) in 20ml of lOmMTris HCl pH7.8, ImM EDTA, 5OmM NaCl (TEN) and ImM dithiotreitol at room temperature for 2 hrs. After three 10- minute rinses with TEN buffer the filter was exposed to film at -80⁰C. Preparation of plasmid constructs

Various fragments of the human IL-IO promoter DNA were amplified by PCR using primers linked to the recognition sites of the restriction enzymes Kpnl (upstream primer) and Xhol (downstream primer). The PCR products and the promoterless-enhancerless pGL2-basic luciferase vector (Promega, USA) were digested by these enzymes prior to cloning with Rapid DNA Ligation Kit (Roche, Germany).

Cell-culture

Human T-cell line Hut78 cells were grown in RPMI supplemented by 10% heat-inactivated foetal calf serum, 2 mM glutamine, 10 mM HEPES buffer, ImM sodium pyruvate, 4.5g/l glucose, lOOμg/ml streptomycin, 100 U/ml penicillin and 0.05 mM 2-mercaptoethanol (all reagents from Beit-Haemek, Israel). Cells were split one day prior to transfection to a concentration 1.5 X 10⁵ cells/ml.

Transfections to HuT- 78 cells and luciferase assay

Transfections to HuT-78 were performed by electroporation with the Nucleofactor system (Amaxa, Germany) according to the manufacturer's instructions, using Solution V and program V-Ol. Each sample of 4 X 10⁶ cells was transfected with 5μg of a pGL2-IL-10 construct and lOOng of the phRL- TK plasmid (Promega, USA) expressing Renilla luciferase as an internal control. Cells were harvested 48 hrs after transfection and tested with firefly and Renilla Luciferase Systems (Promega, USA). Example 1 AP6 binds to methanol-fixated human PBMC

Without being bound by the theory, the initial hypothesis of the present inventors was that AP6 binds to PBMC and that this interaction elicits intracellular processes which eventually trigger transcriptional changes. In order to address this assumption, slides with methanol-fixed PBMC were prepared and incubated with either AP6 antibody or naive Lewis-rat immunoglobulins as control. The cells were then exposed to FITC-conjugated goat anti-rat antibodies. As clearly shown by Figure 1, fluorescence microscopy revealed intense staining only of cells treated with the AP6 antibody. This experiment clearly demonstrates specific interaction of AP6 with a cellular target.

Example 2

AP6 stimulates IL-IO secretion in macrophages and induces transient up-regulation of IL-10-specific mRNA

The inventors have previously reported that the protective effect of polyclonal anti-peptide 6 antibodies from adjuvant arthritis was associated with stimulation of the anti-inflammatory cytokine IL-IO. Monoclonal antibodies which were prepared and used by the present invention retain this protective capacity [data not shown, Ulmansky, in preparation, (2008)] and were therefore also tested for their ability to stimulate IL-IO secretion from PBMC. As shown by Figure 2A, the AP6 antibody stimulated IL-10 secretion in levels comparable with lipopolysaccharide (LPS). In contrast, incubation of PBMC with Lewis rat IgM control did not show an effect exceeding untreated (UT) cells.

Having shown that the monoclonal antibodies enhance IL-10 secretion from PBMC, their effect on specific mRNA levels was next tested. The cells were harvested 4 hours and 24 hours following exposure of PBMC to LPS, total naϊve Lewis IgM control or AP6. The extracted RNA was tested by reverse transcription-PCR for IL-10-specific mRNA. As shown by Figure 2B, both LPS and the AP6 antibody, induced an increase at four hours post-exposure, compared to the untreated and naϊve Lewis IgM-treated cells, thus corresponding to the secretion of IL-IO as detected by ELISA (Fig 2A). However, as clearly shown by Figure 2B, at twenty-four hours, the expression levels seemed to remain high for LPS-treated cells and significantly lower in cells exposed to AP6. These findings led the inventors to conclude that induction of IL-IO expression by the monoclonal antibodies involves up- regulation of expression followed by subsequent silencing.

Example 3

AP6 enhances protein binding to stimulatory sites within the IL-10 promoter

In search for a possible explanation for enhancement of gene expression upon activation of PBMC, changes in protein binding to the IL-10 promoter region were next examined. For this purpose, representative sites previously reported to enhance IL-10 transcription, namely the SpI [Ma, W. et al. J. Biol. Chem. 276:13664-13674 (2001)] and cAMP responsive element (CRE) [Platzer, O et al. Eur. J. Immunol. 29:3098-3104 (1999)] binding motifs were used. Radioactively labeled oligonucleotide probes harboring these known motifs were incubated with nuclear protein extracted from PBMC exposed to either total Lewis rat IgM or the AP6 antibody. As demonstrated by Figure 3B and 3C, respectively, exposure of cells to AP6 resulted in significant binding of SPl and CRE-binding protein (CREB) to their corresponding motifs derived from the IL-10 promoter, compared to treatment with total Lewis IgM which showed only negligible protein binding. Introduction of nucleotide changes into these binding sites (mutated CRE and SpI) abolished protein binding to both sites almost completely. These results clearly indicate that exposure of PBMC to the AP6 antibody, facilitates the binding of transcription factors to the CRE and SpI motifs of the IL-IO gene promoter.

Example 4

The cAMP-dependent protein kinase (PKA) is necessary for AP6- induced IL-10 activation

The finding that AP6 strengthens protein binding to CRE prompted the inventors to further examine the role of cAMP in IL-10 expression. The following analysis took advantage of the fact that the effects of cAMP are mediated by the modification of the cAMP- dependent protein kinase (PKA). The agent KT5720, a selective PKA-inhibitor [Kase, H. et al. Bioch. Biophys. Res. Com. 142:436-440 (1987)], was added to the cells 15 minutes prior to the AP6 antibody. As clearly shown by Figure 4, this intervention resulted in abrogation of IL-10 stimulation, proving that cAMP is necessary for IL-10 expression under these conditions.

Example 5

AP6 enhances protein binding to repressor elements within the^κ 3' region of the IL-10 promoter

The observation that IL-10 mRNA levels decreased 24 hours after initial stimulation with the AP6 antibody (Fig. 2B) prompted the inventors to next examine whether this antibody may also affect other, possibly inhibitory, sites within the IL-10 promoter. Subsequent transfection experiments performed by the present invention, using plasmids containing fragments of the IL-10 promoter cloned upstream to the luciferase reporter gene, revealed the existence of a novel repressor region. More particularly, as demonstrated by Figure 5A, these different constructs were transfected into Hut78 cells which constitutively express IL-10. Evidently, as shown by the Figure, consecutive elongations of the 3' end of the promoter, from -5bp to +112bp relative to the transcription start site, resulted in corresponding significant decreases in luciferase expression. In order to examine whether this effect was due to the presence of a putative repressor element/s or merely due to the length of the promoter, part of the -5bp to +112bp region (+40 to +112, also denoted by SEQ ID NO. 5) was replaced with an exogenous DNA fragment (also denoted by SEQ ID NO. 6). As clearly shown by Figure 5A, this replacement caused a significantly alleviated repression of the reporter gene, indicating that silencing was sequence-specific. The entire repressor region, which spans from -5 to +112bp (SEQ ID NO. 16) and comprises the 5¹ untranslated region (5¹UTR) and exon 1, was further analyzed for differential protein binding with nuclear protein extracts obtained from PBMC treated with either total rat IgM as control, or the AP6 antibody. As a result, an oligonucleotide probe was identified (probe 1, also denoted by SEQ ID NO. 7), which bound significantly protein from cells treated with AP6 (Fig. 5B). This putative binding site is within the 5' untranslated region of the IL-10 gene, adjacent to the transcription initiation site. As illustrated by Figure 6 (top), further characterization of this binding site, revealed several findings. First, the oligonucleotide probe harbors a nine bp element (CTTGCAAAA, also denoted by SEQ ID NO. 8) which is duplicated upstream to the transcription start site (Fig 6 top). As demonstrated by Figure 6A, two non-overlapping probes (prcfoe 1 and probe 2, also denoted by SEQ ID. NO. 7 and 9, respectively) which contain this element exhibit an identical binding pattern, and compete for the same protein factor. Second, a South-Western blot analysis presented in Figure 6B, disclosed a 7OkDa protein which is recognized the novel binding element. Third, transfection experiments demonstrated by Figure 6C clearly show that introduction of mutations into both binding motifs increases promoter activity by twofold. It is therefore concluded that AP6 enhances the binding of a 7OkDa factor to a pair of repressor elements around the transcription initiation site.

Claims

Claims:

1. A nucleic acid sequence comprising a regulatory element derived from the IL-IO (interleukin 10) promoter region, wherein said regulatory element comprises the nucleic acid sequence as denoted by SEQ ID NO. 12 or any fragment, variant, derivative, homologue and mutant thereof.

2. The nucleic acid sequence according to claim 1, wherein a fragment of said sequences comprises the nucleic acid sequence as denoted by any one of SEQ ID NO. 5, 7, 8, 9, 13, 14, 15 16 and 17.

3. The nucleic acid sequence according to claim 2, wherein a fragment of said sequences comprises the nucleic acid sequence as denoted by SEQ ID NO. 5.

4. The nucleic acid sequence according to claim 1, wherein a fragment of said sequence comprises at least one repeat of the nucleic acid sequence CTTGCAAAA as denoted by SEQ ID NO. 8, or any mutant, homologue variant or derivative thereof.

5. The nucleic acid sequence according to claim 1, wherein said regulatory element is a repressor element comprising DNA-binding sites for one or more specific transcription repressor factor, whereby binding of said transcription repressor factor to said site leads to repression of gene transcription.

6. A nucleic acid construct comprising a regulatory element derived from IL-10 promoter region, wherein said regulatory element comprises the nucleic acid sequence as denoted by SEQ ID NO. 12 or any fragment, variant, derivative, homologue and mutant thereof.

7. The nucleic acid construct according to claim 6, wherein a fragment of said sequence comprises the nucleic acid sequence as denoted by any one of SEQ ID NO. 5, 7, 8, 9, 13, 14, 15 16 and 17.

8. A transcription factor repressor decoy in the form of an oligonucleotide or oligonucleotide analogue comprising the sequence of a regulatory element derived from the IL-IO promoter region, wherein said regulatory element comprises the nucleic acid sequence as denoted by SEQ ID NO. 12 or any fragment, variant, derivative, homologue and mutant thereof.

9. The decoy according to claim 8, wherein a fragment of said sequence comprises at least one repeat of the nucleic acid sequence as denoted by any one of SEQ ID NO. 5, 7, 8, 9, 13, 14, 15 16 and 17, or any combinations thereof.

10. The decoy according to claim 9, wherein a fragment of said sequence comprises at least one repeat of the nucleic acid sequence CTTGCAAAA as denoted by SEQ ID NO. 8, or any mutant, homologue variant or derivative thereof. ^{v v}

11. The decoy according to claim 10, wherein the oligonucleotide or oligonucleotide analogue is selected from the group consisting of DNA, RNA, LNA, PNA, INA and mixtures thereof and hybrids thereof, as well as phosphorous atom modifications thereof.

12. A composition comprising as an active ingredient a transcription factor repressor decoy in the form of an oligonucleotide or oligonucleotide analogue comprising the sequence of a repressor element derived from the IL-10 promoter region, wherein said repressor element comprises the nucleic acid sequence as denoted by SEQ ID NO. 12, or any fragment, variant, derivative, homologue and mutant thereof.

13. The composition according to claim 12, wherein said decoy is as defined in any one of claims 8 to 11.

14. The composition according to claim 12, for inhibiting repression of antiinflammatory cytokine expression, thereby increasing the expression of said cytokine.

15. The composition according to claim 14, for modulating the balance between Thl/Th2 towards the Th2 anti-inflammatory reaction in a subject in need thereof.

16. The composition according to claim 15, for the treatment of an immune- related disorder in a subject in need thereof.

17. A method for the treatment of an immune-related disorder in a subject in need thereof comprising the step of administering to said subject a therapeutically effective amount of the decoy according to any one^vof claims 8 to 11 or any composition thereof according to any one of claims 12 to 16.

18. A screening method for an immuno-modulating compound which modulates the expression of an anti-inflammatory Th2 cytokine (T helper) and thereby modulates the Thl/Th2 cell balance, which method comprises the steps of: a) obtaining a candidate compound which binds a nucleic acid sequence comprising a regulatory element derived from IL-IO promoter region, wherein said regulatory element comprises the nucleic acid sequence as denoted by SEQ ID NO. 12, or any fragment, variant, derivative, homologue and mutant thereof; b) selecting from the candidate compounds obtained in step (a), a compound which regulates the expression of a reporter gene operably linked to a nucleic acid sequence comprising a regulatory element derived from IL-IO promoter region, wherein said regulatory element comprises the nucleic acid sequence as denoted by SEQ ID NO. 12, or any fragment, variant, derivative, homologue and mutant thereof; and c) determining the effect of the compound selected in step (b), on modulation of an anti-inflammatory cytokine expression.

Whereby modulation of an anti-inflammatory cytokine expression by said candidate compound is indicative of the ability of said compound to modulate the Thl/Th2 balance.