EP2185731A2

EP2185731A2 - Oligonucleotides, use, method of detection and kit for diagnosing the presence of the e1 gene of the chikungunya virus

Info

Publication number: EP2185731A2
Application number: EP08835332A
Authority: EP
Inventors: Jean-Noël TELLES
Original assignee: Biomerieux SA
Current assignee: Biomerieux SA
Priority date: 2007-09-14
Filing date: 2008-09-11
Publication date: 2010-05-19
Also published as: US20100216117A1; WO2009044085A2; FR2921064A1; WO2009044085A3

Abstract

The present invention concerns oligonucleotides intended to enable the amplification and the detection of a target sequence located in the El gene of the Chikungunya virus. These oligonucleotides are between 10 and 50 nucleotides in length and comprise at least one fragment of 10 consecutive nucleotides derived from the following sequences: SEQ ID No. 1: 5'-CTCTTACCGGGTTTGTTGC-3' or SEQ ID No. 2: 5'-GCCTGGACACCTTTCGAC-3', or the sequence complementary thereto. The invention also concerns the oligonucleotide which enables detection of the amplicons, the use of these oligonucleotides, a method of detection and a kit for diagnosing the presence of the E1 gene of the Chikungunya virus. The invention has a preferred use in the diagnostics field.

Description

Oligonucleotides, use, detection method and kit for diagnosing the presence of the E1 gene of the human immunodeficiency virus

Chikungunya.

The present invention provides oligonucleotides for amplification and detection of a target sequence localized in the Chikungunya virus E1 gene. The invention also relates to the use of these oligonucleotides, a detection method and a kit for diagnosing the presence of the El gene of Chikungunya virus.

The Chikungunya virus is an alphavirus arbovirus that is transmitted by Aedes mosquitoes. It was isolated for the first time in 1953. Since then, Chikungunya epidemics have occurred in tropical Africa and Asia. An unprecedented epidemic has occurred in Reunion Island, which has 775,000 inhabitants and for which more than 244,000 cases were reported as of April 20, 2006.

At present, there is no routine diagnosis of Chikungunya infection and very few laboratories have the capacity to diagnose this virus. The techniques employed in these reference laboratories are as follows: serology by standard techniques (inhibition of haemagglutination, complement fixation, immunofluorescence, Elisa), amplification and detection by RT-PCR in real time.

Serology is based on the detection of IgM and IgG antibodies that appear at different times during infection. The IgM are detected in the serum on average 5 days after the onset of clinical signs and persist for several weeks at three month. IgG are identified by two samples (acute phase and convalescence), and persist for years. The sensitivity and specificity of these tests are not well established, including the possibility of false positives by cross-reactions with IgM dengue or other arboviruses.

In parallel real-time RT-PCR amplification tests have been developed. The interest of molecular biology in the diagnosis of infectious diseases is well known. It allows a rapid detection of the genome of the virus and this from the initial viremic phase which corresponds to the first seven days in the case of infection with the Chikungunya virus. Thus, Pastorino et al describe an RT-PCR assay for the real-time detection of Chikungunya virus using the TaqMan® method (Journal of Virological Methods, 124 (2005) 65-71). The amplification primers and the detection probe were selected in the region of the El structural protein gene. The sensitivity obtained is 1. 2.10 ^-2 Infectious Dose per reaction. In another publication, Parida et al describe the detection of Chikungunya virus by an alternative method to PCR called RT-LAMP for "reverse transcription loop-mediated isothermal amplification" (J. Clin Microbiol 2007 Feb; 45 (2): 351-7). The primers were selected from the El protein gene. A sensitivity of 20 transcript copies per reaction was determined. The disadvantage of this technique is that it requires 6 different primers to perform the amplification reaction. In addition, the detection is not carried out with a specific probe but by turbimetry. Thus, in the case where the reaction is not specific and another virus is amplified, a false positive will be detected.

Thus, a fast, specific and highly sensitive Chikungunya virus identification test is still awaited. The present invention therefore relates to a pair of oligonucleotides for amplifying a target sequence located in the El gene of the Chikungunya virus genome, the oligonucleotide pair consisting of: a first oligonucleotide of a length between 10 and 50 nucleotides and comprising at least one fragment of 10 consecutive nucleotides derived from:

SEQ ID No. 1: 5 '-CTCTTACCGGGTTTGTTGC-3', or its complementary sequence, and a second oligonucleotide of a length of between 10 and 50 nucleotides and comprising at least one fragment of 10 consecutive nucleotides derived from:

SEQ ID No. 2: 5'-GCCTGGACACCTTTCGAC-3 ', or its complementary sequence.

In a particular embodiment of the invention, the first oligonucleotide additionally comprises a promoter sequence that can be recognized by a DNA-dependent RNA polymerase enzyme. Preferably, the promoter sequence which can be recognized by a DNA dependent RNA polymerase enzyme is a T7 polymerase.

Thus, when this oligonucleotide, to which the promoter sequence is added, allows the amplification of the target sequence located in the E1 gene, it essentially consists of the following sequence: SEQ ID No. 3: 5'-

ΛΓΓCΓΛΛΓΛCGΛCΓCΛCΓΛΓΛGGGGCTCTTACCGGGTTTGTTGC-3 '. The part of the sequence in italic corresponds to the T7 promoter sequence. The underlined sequence corresponds to a sequence creating a so-called linker between the promoter sequence and the oligonucleotide of sequence SEQ ID No. 1.

The invention also relates to an oligonucleotide to be used as a detection probe for a target sequence located in the E1 gene of the Chikungunya virus genome, the detection probe being between 10 and 50 nucleotides in length and comprising at least one fragment of 10 consecutive nucleotides derived from from:

SEQ ID No. 4: 5'-CTCTCAGGCACCATCTGGC-S ', or its complementary sequence, said sequence comprising at least one labeling means.

In an advantageous embodiment of the invention, the oligonucleotide used as a detection probe enables real-time detection and is flanked by two arms, one at the 5 'position and the other at the 3' position of said oligonucleotide, each arm having a length of between 5 and 15 nucleotides, preferably between 6 and 10 nucleotides and these arms being complementary to one another in order to present the oligonucleotide in the form of a loop in the absence of the sequence localized target in the El gene of the Chikungunya virus genome.

In an even more advantageous mode, the detection probe has a fluorescent marker at the free end of one of the arms and a fluorescence absorber at the free end of the other arm. Preferably, the detection probe is constituted by a "molecular beacon", subsequently called molecular beacon. Molecular beacons are detection probes in the form of single-stranded oligonucleotides, which have a rod-and-loop structure well known to those skilled in the art. The loop contains a probe sequence complementary to the target sequence (amplicon in general), and the stem is formed by the hybridization of two sequences forming arms, which are each located at each end of the probe. A fluorophore is covalently bound to the end of one of the two arms and an absorber of fluorescence (quencher) is covalently bound to the end of the other arm. Molecular beacons do not fluoresce when free in solution, the structure now closes the fluorophore and absorber in close proximity to one another, resulting in the transfer of fluorescence from the fluorophore to the absorber. The fluorescence absorber is a non-fluorescent chromophore that dissipates the energy received from the fluorophore in heat. However, in the presence of complementary amplicons, when they hybridize to these targets, they undergo a conformational change that allows them to fluoresce. In this case, a probe-target hybrid is formed which is longer and more stable than the hybrid created by the two arms of the stem. The rigidity and length of the hybrid-probe hybrid prevent the simultaneous existence of the stem hybrid. As a result, the molecular beacon undergoes a spontaneous conformational reorganization that forces the stem hybrid to dissociate and the fluorophore and absorber to move away from each other, thereby restoring fluorescence.

More precisely, the detection probe consists of a molecular beacon preferably consisting of: SEQ ID No. 5: 5 '- [6-FAM] -CGAGCGACTCTCAGGCACCATCTGGCrCGCrCG- [DabSyl] -3', or its complementary sequence. The sequence in italic corresponds to the arms mentioned above, constituting the stem.

According to the present invention, the two oligonucleotides for use as amplification primers, and the oligonucleotide for use as a detection probe, each have a length of between 10 and 50 nucleotides and comprise at least one fragment of 10 nucleotides consecutive sequences SEQ ID No. 2 and 4 respectively. Preferably, each oligonucleotide is of a length of between 12 and 30 nucleotides and comprises at least one fragment of 10 or 12 consecutive nucleotides, and even more preferably, each oligonucleotide has a length of between 15 and 26 nucleotides and comprises at least one fragment of 10, 12 or 15 nucleotides.

The present invention also provides the use of the pair of oligonucleotides or probe as described above, in a nucleic acid amplification reaction of the Chikungunya virus genome that may be present in a biological sample.

The invention further relates to a method for detecting nucleic acids of Chikungunya virus that may be present in a sample, wherein the sample is subjected to a nucleic acid amplification reaction using an oligonucleotide pair, as described above, in the presence of the amplification reagents necessary for such amplification and where the presence of amplicons of interest is detected.

This detection method can be based on an RT-PCR amplification reaction.

Alternatively, this detection method may be based on a transcriptional amplification technique. Preferably this technique is the NASBA technique. The NASBA technique is a method of isothermal amplification of nucleic acids involving several enzymatic activities, which allows rapid detection of the Chikungunya virus. The amplification of nucleic acids by this route is well suited to RNA genomes, thanks to the presence of a reverse transcription step directly in the amplification reaction.

Thus, the invention also relates to a method method of amplifying the Chikungunya virus El gene that may be present in a sample, comprising the steps of: incubating the sample in amplification buffer in the presence of two amplification primers, each having a length of between 10 and 50 nucleotides, one additionally comprising a promoter sequence, the other of opposite polarity to the primer associated with the promoter sequence, for hybridizing respectively upstream and downstream of an area of interest located in the gene El Chikungunya virus, add the following reagents in the sample:

An enzyme having an RNA activity dependent DNA polymerase, an enzyme having a DNA-dependent DNA polymerase activity,

An enzyme having an RNase H activity,

An enzyme having an RNA polymerase-dependent DNA activity, and maintaining the reaction mixture thus created under appropriate conditions and for a period of time sufficient for amplification to take place.

The enzymes listed above are four in number but it is quite possible to use an enzyme having two or three of the above mentioned activities, in this case the use of three or two enzymes remains possible and covered. by the invention. In addition, other elements are necessary to establish an amplification such as nucleotides or buffer solutions. These buffer solutions can be optimized depending on the amplification technique used or the oligonucleotides present in the reaction. In a reaction transcriptional amplification, such as a NASBA reaction, these buffer solutions may contain, for example, DMSO which enhances the amplification reaction (as described in PCT / US90 / 04733). In addition, it is also possible to add to the amplification reaction an internal control, to avoid the presence of false negative due to the failure of the amplification process. The use of an internal control in a transcriptional amplification reaction is described in PCT / EP93 / 02248. Such internal control is selected such that it does not compete with the target nucleic acid in the amplification reaction. All these elements are well known to those skilled in the art.

Finally, the invention provides a kit for detecting the El gene of the Chikungunya virus that may be present in a sample, containing at least one pair of oligonucleotides as described above to carry out the amplification of the El gene, - at least one labeled or labeled oligonucleotide, as described above, and having a nucleic acid sequence substantially complementary to at least a portion of the amplified nucleic acid sequence, - reagents necessary for carrying out an amplification reaction .

Preferably, the reagents necessary for carrying out an amplification reaction are reagents allowing NASBA amplification.

By "substantially complementary" it is meant that hybridization is performed between a labeled or labeled oligonucleotide, otherwise known as an amplification primer. or detection probe, and at least a portion of the amplicon target or amplified nucleic acid sequence, this hybridization being specific and selective to allow amplification or detection of the amplicon of interest. By "detectable marker" is meant at least one marker capable of directly generating a detectable signal. For example, the presence of biotin is considered direct labeling because it is detectable, although it can be subsequently associated with labeled streptavidin. A nonlimiting list of these markers follows:

Enzymes that produce a detectable signal, for example by colorimetry, fluorescence, luminescence, such as horseradish peroxidase, alkaline phosphatase, β-galactosidase, glucose-6-phosphate dehydrogenase, chromophores such as fluorescent, luminescent compounds, colorants,

Electron density groups detectable by electron microscopy or by their electrical property such as conductivity, amperometry, voltammetry, impedance,

Detectable groups, for example whose molecules are of sufficient size to induce detectable changes in their physical and / or chemical characteristics, this detection can be carried out by optical methods such as diffraction, surface plasmon resonance, surface, the variation of contact angle or physical methods such as atomic force spectroscopy, the tunnel effect,

• radioactive molecules such as ³² P, ³⁵ S or ¹²⁵ I.

In a particular embodiment of the present invention the marker is electrochemically detectable, and in particular the marker is a derivative of an iron complex, such as a ferrocene.

The term "nucleic acid" means a sequence of at least two deoxyribonucleotides or ribonucleotides optionally comprising at least one modified nucleotide, for example at least one nucleotide comprising a modified base, such as inosine, methyl-5-deoxycytidine, dimethylamino-5-deoxyuridine, deoxyuridine, diamino-2,6-purine, bromo-5-deoxyuridine or any other modified base for hybridization. This polynucleotide can also be modified at the level of the internucleotide linkage, for example phosphorothioates, H-phosphonates or alkylphosphonates, at the level of the backbone such as, for example, alpha-oligonucleotides (FR 2 607 507) or PNAs (M Egholm et al., J. Am Chem Soc, 114, 1895-1897, 1992 or the 2 'O-alkyl ribose and LNA (BW, Sun et al., Biochemistry, 4160-4169, 43, 2004). The nucleic acid may be natural or synthetic, an oligonucleotide, a polynucleotide, a nucleic acid fragment, a ribosomal RNA, a messenger RNA, a transfer RNA, a nucleic acid obtained by an enzymatic amplification technique such as :

PCR (Polymerase Chain Reaction), described in US-A-4,683,195, US-A-4,683,202 and US-A-4,800,159, and its derivative RT-PCR (Reverse Transcription PCR), especially in a one-step format, as described in patent EP-BO569242,

LCR (Ligase Chain Reaction), for example disclosed in patent application EP-A-0201.184,

RCR (Repair Chain Reaction), described in the patent application WO-A-90/01069,

3SR (Self Sustained Sequence Replication) with the patent application WO-A-90/06995, NASBA (Nucleic Acid Sequence-Based Amplification) with Patent Application WO-A-91/02818,

• TMA (Transcription Mediated Amplification) with US-A-5,399,491, and • RCA (Rolling Circle Amplification (US-6, 576, 448).

We then speak of amplicons to designate the nucleic acids generated by an enzymatic amplification technique. Each of these modifications can be taken in combination.

The amplification and detection steps described above may be preceded by a purification step. By "purification step" is meant in particular the separation between the nucleic acids of the microorganisms and the cellular constituents released in the lysis step which precedes the purification of the nucleic acids. These lysis steps are well known by way of indicative example, the lysis methods as described in the patent applications can be used:

WO-A-00/60049 on lysis by sonication, WO-A-00/05338 on mixed magnetic and mechanical lysis,

WO-A-99/53304 on electrical lysis, and

WO-A-99/15621 on mechanical lysis.

Those skilled in the art may use other well-known lysis methods such as thermal or osmotic shocks or treatments with chaotropic agents, such as guanidium salts (US-A-5, 234, 809).

This step generally makes it possible to concentrate the nucleic acids. By way of example, solid supports, such as magnetic particles (see US-A-4, 672, 040 and US-A-5, 750, 338), can be used to purify nucleic acids, which are attached to these magnetic particles, by a washing step. This nucleic acid purification step is particularly interesting if one wishes to subsequently amplify said nucleic acids. A particularly interesting embodiment of these magnetic particles is described in patent applications WO-A-97/45202 and WO-A-99/35500. The term "solid support" as used herein includes all materials to which a nucleic acid may be attached. Synthetic materials or natural materials, possibly chemically modified, can be used as solid support, in particular polysaccharides, such as cellulose-based materials, for example paper, cellulose derivatives, such as cellulose acetate and nitrocellulose, or dextran; polymers, copolymers, especially based on styrene-type monomers, natural fibers such as cotton, and synthetic fibers, such as nylon; inorganic materials, such as silica, quartz, glasses, ceramics; latexes; magnetic particles; metal derivatives, gels, etc. The solid support may be in the form of a microtiter plate, a membrane, a particle or a substantially planar plate of glass or silicon or derivatives.

The entire protocol (from the sample taken at the detection of amplicons) can be carried out in a single container or tube, processed manually or in a PLC.

The accompanying figures and example show a particular embodiment and can not be considered as limiting the scope of the present invention. Figures 1 to 8: Detection of Chikungunya virus at different concentrations in relative fluorescence unit (RFU ordinate) per unit of time (T on the abscissa). The dotted curve corresponds to the signal emitted by the complementary probe according to the invention of a sequence of the Chikungunya and the solid line corresponds to the internal control, which is a synthetic transcript of about 1000 bases encompassing the amplified region of the NASBA primers; It will therefore be co-amplified with the wild-type sequence present in the sample. However, this internal control has been modified to replace the region where the detection probe normally attaches to a sequence that does not correspond to Chikungunya. This modified region is recognized by the internal control detection probe. Figure 1 negative plasma. Figure 2 positive plasma, 4.18 copies / ml Figure 3 positive plasma, 41.8 copies / ml Figure 4 positive plasma, 418 copies / ml Figure 5 positive plasma, 4180 copies / ml Figure 6 positive plasma, 41800 copies / ml Figure 7 positive plasma, 418000 copies / ml Figure 8 positive plasma, 4180000 copies / ml

EXAMPLE 1 Experience of Evaluation of Primers and Probe for the Detection of Chikungunya Virus on RNA from a Clinical Sample of Reunion:

The sequences of the oligonucleotide pair (P1 and P2) and the detection probe (MB) present in the form of molecular beacon are indicated below:

Sequences of the primers and probes used: Pl, SEQ ID NO.3:

5'- AAΓΓCΓAAΓACGACΓCACΓAΓAGGGGCTCTTACCGGGTTTGTTGC -3 'P2, SEQ ID NO.2: 5'- GCCTGGACACCTTTCGAC -3'

MB, SEQ ID NO.5: 5 '-CGAGCGACTCTCAGGCACCATCTGGCTCGCTCG-3'

The sequence indicated in bold and in italics corresponds to the T7 promoter sequence, recognized by the T7 RNA polymerase and is found in the oligonucleotides Pl for the implementation of the NASBA technique. The underlined sequence corresponds to a sequence creating a gap, called a linker, between the promoter sequence and the oligonucleotide of sequence SEQ ID No. 1. The doubly underlined sequences correspond to the sequences forming the rod of the molecular beacon.

Operating procedure :

- Source of Chikungunya virus:

Dilution of plasma from infected and quantified patients, from the Sud St Denis Reunion Hospital Center.

- Nucleic acid extraction: Nucleic acids were extracted using the easyMAG System (bioMérieux BV, Boxtel, Holland) with NucliSENS Magnetic Extraction Reagents reagents (bioMérieux BV, Boxtel, Holland, NucliSENS EasyMAG Extraction Buffer 1 # 280130, NucliSENS EasyMAG Extraction Buffer 2 # 280131, NucliSENS EasyMAG Extraction Buffer 3 # 280132, NucliSENS EasyMAG Magnetic Silica # 280133, NucliSENS EasyMAG Buffer Lysis # 280134). The extractions were carried out on 200 μl of each of the plasma dilutions. The dilutions correspond to concentrations of 41 copies / ml, 418 copies / ml, 4180 copies / ml, 41800 copies / ml, 418000 copies / ml, 4180000 copies / ml.

- Amplification / Detection:

According to the instructions of the NucliSENS EasyQ Kit Basic Kit V2 (bioMérieux BV, Boxtel, Holland), a unique reaction mixture allowing the simultaneous detection of the Chikungunya El gene and the internal control is prepared. Briefly, to 64 μl of diluent were added 11 μl of water, 13 μl of 1.2 M KCl, 4 μl of each oligonucletide at 10 μM, and 0.8 μl of each of the molecular beacons at 20 μM (1 specific molecular beacon of Chikungunya and a probe specific to the internal control). A volume of 10 μl of the mixture was then added to 5 μl of the solutions of the RNAs previously extracted.

Results: The results are visible in Figures 1 to 8 and show that the test works and detects a positive Chikungunya plasma up to the 4180 copies / ml concentration (equivalent to about 150 copies of Chikugunya RNA / NASBA reaction). It is observed that the higher the number of Chikungunya RNA copies, the greater the amplitude of the curve.

The results also show that the internal control is correctly detected and plays its role of validating the test. The internal control signal decreases in proportion to the number of Chikungunya RNA copies. The signal from the internal control is at its peak in the negative plasma, and is minimal in the presence of a large number of Chikungunya RNA copies. Indeed, since it is a co-amplification, the amount of internal control has been calculated so that the internal control does not compete too much with the wild-type virus sequence. Thus, the internal control is normally amplified when it is alone (negative sample), but as soon as a wild Chikungunya sequence is present, it is the amplification of this sequence which takes place until complete amplification inhibition. internal control when the wild-type sequence is present in high concentration. So for the test to be validated, there must always be a signal: if the sample is negative we have positive internal control, if the sample is positive we have a positive signal with or without a signal for internal control (depending on whether the sample is strongly positive or not).

Example 2 Comparison of the Efficacy of the Amplification Primer and the Chikunqunya Virus Detection Probe Against the Primers and the RT-PCR Reference Technique Probe

The primers and probe of the present invention and the reference technique were compared in NASBA and PCR, on a quantized qig of quantified chikunqunya RNA. The primers / probes of the reference technique have been adapted in NASBA and those of the present invention to the reference technique.

Operating procedure :

- Source of Chikunqunya RNA:

The experiments were carried out on a number of dilutions of purified RNAs of a strain of Chikunqunya from IMTSSA (Institute of Tropical Medicine of the Army Health Service).

- Amplification / Detection: • NASBA:

According to the instructions of the NucliSENS EasyQ Basic Kit V2 kit (bioMérieux BV, Boxtel, Holland, lot 010712.), a unique reaction mixture allowing the amplification and detection of Chikunqunya virus E1 E1 is prepared. Briefly, to 64 μl of diluent were added 11 μl of water, 13 μl of 1.2 M KCl, 4 μl of each of the 10 μM oliqonucletides, and 0.8 μl of the 20 μM molecular probe. A volume of 10 μl of the melanqe was then added to 5 μl of the solutions of the RNAs previously extracted. After incubation for 2 min at 65 ^° C. and then for 2 min at 41 ^° C., 5 μl of the enzyme mixture is added. Real-time signal amplification and detection is carried out using the NucliSENS EasyQ Analyzer system (bioMérieux, Boxtel, Holland, reference 285060) for 90 min at 41 ^° C. The results are analyzed using the software NucliSENS EasyQ Director 2.0 software.

RT-PCR: The one-step RT-PCR was carried out in a final volume of 20 μl containing 2.5 μl of extracted Ckikungunya RNA, and 10 μl of 2 × Thermoscript Reaction Mix Buffer (Invitrogen, Lot 1207045, Germany). , 2 pmol of Taqman probe, 9 pmol of each of the amplification primers, 25 mM MgSO4, 0.4 μl of the One Step RT-PCR enzyme mixture (Invitrogen, Lot 271375, Germany). The amplifications were carried out in a LightCycler instrument (Roche, Molecular Biochemicals, Germany) using the following parameters: 50 ^° C. for 20 min, 95 ^° C. at 2 min and 45 cycles at 95 ^° C. for 5 sec, and 60 ^° C. C for 1 min.

Primers and probes used:

1) Primers and probe of the present invention adapted to the

NASBA:

## STR2 ##

5'Fam-CGAGCGACTCTCAGGCACCATCTGGCTCGCTCG-Dabsyl 3 '.

2) Primers and probe of the invention adapted to RT-PCR: Pl-CHIK-without T7: SEQ ID NO. 6: 5 '-GCTCTTACCGGGTTTGTTGC-3' P2: SEQ ID NO.7: 5'-GCCTGGACACCTTTCGAC -3 ' BEAC-CHIK-SANS-ROD: SEQ ID NO.8: 5'Fam-ACTCTCAGGCACCATCTGGCT-Tamra3

3) Primers and probe from the publication of Pastorino et al. (Journal Journal of Virological Methods, 124 (2005) 65-71) for RT-PCR:

R-CHIK: SEQ ID NO.9: 5 '-CCAAATTGTCCYGGTCTTCCT-3'

F-CHIK: SEQ ID NO.10: 5 '-AAGCTYCGCGTCCTTTACCAAG-3'

P-CHIK: SEQ ID NO.11: 5 'Fam-CCAATGTCYTCMGCCTGGACACCT-Tamra

3 '(the letter corresponding to it either at the base C or at the base

T and the letter M corresponds either to the base C or to the base

AT) .

4) Primers and probe from the publication of Pastorino et al. (Journal Journal of Virological Methods, 124 (2005) 65-71) adapted to a NASBA:

NASP1-PASTO-NAS: SEQ ID NO.12:

5 '-ΛΛΓΓCΛCGΛCΓCΛCΎΛΓΛGGGGCCCAAATTGTCCYGGTCTTCCT-3' F-CHIK: SEQ ID NO.13: 5'-AAGCTYCGCGTCCTTTACCAAG-3 'BEAK-PASTO-NAS: SEQ ID NO.14: 5' Fam-CGAGCGACCCAATGTCYTCMGCCTGGACACCTCGCTCG-Dabsyl 3 '

Results:

The results are summarized in the table below

* The NASBA test is positive when the fluorescence signal obtained exceeds the negative control signal by 20%. ** The RT-PCR test is positive when a measurable Ct is obtained (the Ct is the number of cycles for which the signal becomes positive).

The results show that over the dilution range of chikungunya RNAs, the primers and probe of the present invention used in NASBA have a better sensitivity than the primers and probe of the publication by Pastorino et al. used in the RT-PCR reference test. Indeed, NASBA detects ICT ⁷ dilution, whereas RT-PCR detects only until ICT ⁵ dilution.

On the other hand, although in NASBA, the different primers and probe have identical sensitivity, the primers and probe of the present invention can be used in RT-PCR and increase by two logarithm the sensitivity compared to the sequences of Pastorino and al. in the reference method.

Claims

A pair of oligonucleotides for amplification of a target sequence localized in the El gene of the Chikungunya virus genome, the oligonucleotide pair consisting of: a first oligonucleotide of a length of between 10 and 50 nucleotides and comprising at least one fragment of 10 consecutive nucleotides derived from: SEQ ID No. 1: 5 '-CTCTTACCGGGTTTGTTGC-3', or its complementary sequence and, a second oligonucleotide of a length of between 10 and 50 nucleotides and comprising at least a fragment of 10 consecutive nucleotides derived from: SEQ ID No. 2: 5 '-GCCTGGACACCTTTCGAC-3', or its complementary sequence.

2. Pair of oligonucleotides according to claim 1, characterized in that the first oligonucleotide additionally comprises a promoter sequence which can be recognized by a DNA-dependent RNA polymerase enzyme.

3. Pair of oligonucleotides according to claim 2, characterized in that the promoter sequence which can be recognized by a DNA dependent RNA polymerase enzyme is a Tl polymerase.

4. First oligonucleotide according to any one of claims 2 or 3, characterized in that it consists essentially of the following sequence: SEQ ID No. 3:

5 '-ΛΛΓΓCΓΛΛΓΛCGΛCΓCΛCΓΛΓΛGGGGCTCTTACCGGGTTTGTTGC-3'.

An oligonucleotide for use as a probe for detecting a target sequence located in the El gene of the Chikungunya virus genome, the detection probe being between 10 and 50 nucleotides in length and comprising at least one fragment of 10 consecutive nucleotides from:

6. The oligonucleotide according to claim 5, intended to enable real-time detection, characterized in that the oligonucleotide is flanked by two arms, one at the 5 'position and the other at the 3' position of said oligonucleotide, each arm having a length of between 5 and 15 nucleotides, preferably between 6 and 10 nucleotides and these arms being complementary to one another in order to present the oligonucleotide in the form of a loop in the absence of the sequence localized target in the El gene of the Chikungunya virus genome.

7. The oligonucleotide according to claim 6, the free end of one of the arms comprises a fluorescent marker and the free end of the other arm comprises a fluorescence absorber.

8. Oligonucleotide according to any one of claims 6 and 7, characterized in that it consists essentially of the following sequence: SEQ ID No. 5: 5 '- [6-FAM1 -CGAGCGACTCTCAGGCACCATCTGGCTCGCTCG- [DabSyl] -3 ', or its complementary sequence.

9. The oligonucleotide according to any one of claims 1 or 5, characterized in that each oligonucleotide is of a length of between 12 and 30 nucleotides and comprising at least one fragment of 10 or 12 consecutive nucleotides, and preferably of a length of between 15 and 26 nucleotides and comprising at least one fragment of 10, 12 or 15 nucleotides .

Use of an oligonucleotide pair according to any one of claims 1 to 4 or 9 in a nucleic acid amplification reaction or as a detection probe according to any one of claims 5 to 9. , of the genome of the Chikungunya virus likely to be present in a biological sample.

11. A method for detecting nucleic acids of Chikungunya virus that may be present in a sample, wherein the sample is subjected to a nucleic acid amplification reaction using an oligonucleotide pair, according to one of any of claims 1 to 4 or 9, in the presence of the amplification reagents necessary for such amplification and the presence of amplicons of interest is detected.

12. Method according to claim 11, characterized in that the amplification reaction used is RT-PCR.

13. Method according to claim 11, characterized in that the amplification reaction used is a transcriptional amplification technique.

14. Method according to claim 13, characterized in that the amplification reaction used is the NASBA technique.

15. El amplification method of the E1 gene of the Chikungunya likely to be present in a sample, comprising the following steps:

incubate the sample in amplification buffer in the presence of two amplification primers, each having a length of between 10 and 50 nucleotides, one additionally comprising a promoter sequence, the other of opposite polarity to the primer associated with the promoter sequence, for hybridizing respectively upstream and downstream of an area of interest localized in the El gene of the Chikungunya virus,

- add the following reagents in the sample:

An enzyme having an RNA activity dependent DNA polymerase,

An enzyme with a DNA-dependent DNA polymerase activity,

An enzyme having an RNase H activity,

An enzyme having an RNA polymerase-dependent DNA activity, and

- maintain the reaction mixture thus created under appropriate conditions and for a period of time sufficient for amplification takes place.

16. Kit for detecting the El gene of the Chikungunya virus that may be present in a sample, containing: at least one pair of oligonucleotides according to claims 1 to 4 or 9, at least one labeled or labeled oligonucleotide, according to any one of claims 5 to 9, and having a nucleic acid sequence substantially complementary to at least a portion of the amplified nucleic acid sequence, reagents necessary for carrying out an amplification reaction.

17. The kit of claim 16, wherein the reagents necessary for performing an amplification reaction are reagents for amplification NASBA.