EP2163652A1 - Preparing crude biological extracts using protease, suitable for preparing cDNA - Google Patents

Preparing crude biological extracts using protease, suitable for preparing cDNA Download PDF

Info

Publication number
EP2163652A1
EP2163652A1 EP09180993A EP09180993A EP2163652A1 EP 2163652 A1 EP2163652 A1 EP 2163652A1 EP 09180993 A EP09180993 A EP 09180993A EP 09180993 A EP09180993 A EP 09180993A EP 2163652 A1 EP2163652 A1 EP 2163652A1
Authority
EP
European Patent Office
Prior art keywords
cells
definition
method
cell
protease
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
EP09180993A
Other languages
German (de)
French (fr)
Other versions
EP2163652B1 (en
Inventor
Brittan L. Pasloske
Hoang Quoc
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Life Technologies Corp
Original Assignee
Ambion Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
Priority to US35240202P priority Critical
Application filed by Ambion Inc filed Critical Ambion Inc
Priority to EP03710760A priority patent/EP1476573B1/en
Publication of EP2163652A1 publication Critical patent/EP2163652A1/en
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27663090&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=EP2163652(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application granted granted Critical
Publication of EP2163652B1 publication Critical patent/EP2163652B1/en
Application status is Active legal-status Critical
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1096Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Abstract

The invention relates to methods for the detection of a specific sequence of RNA in a cell or tissue sample. The invention also relates to methods to enzymatically manipulate the RNA in a crude cell lysate in a number of applications.

Description

    BACKGROUND OF THE INVENTION 1. Field of the Invention
  • The present invention relates generally to the field of RNA analysis, more specifically it teaches a more direct method for the detection of a specific sequence of RNA in a biological unit, for example a virus, cell or tissue sample. More generally, the invention may be used to enzymatically manipulate and protect the RNA in a crude cell lysate for a number of applications.
  • 2. Description of Related Art
  • Reverse transcription followed by the polymerase chain reaction (RT-PCR) is one of the main methods used for measuring mRNA levels from a small number of cells. As well, reverse transcription is the first step in several strategies towards amplifying a small quantity of total or poly (A) RNA ( U.S. Patent 5,554,516 ; U. S. Patent 5,891,636; Phillips, 1996 ). The amplified RNA can be used to probe arrays for monitoring the expression of multiple genes ( Lockhart, 1996; U.S. Patent 6,316,608 ). Prior to performing any of these methods, the substrate RNA is isolated from a biological sample, in most cases. Current procedures for RNA isolation involve numerous steps and are not very amenable to high throughout analysis.
  • In general, the techniques used for RNA isolation involve phenol-chloroform extraction (Mesink, 1998) or guanidinium lysis followed by adsorbing the RNA to a glass fiber filter (Su, 1997). By streamlining the RNA isolation step, the analysis of a large number of samples involving reverse transcription or some other enzymatic manipulation becomes much faster, simpler, and less expensive. Klebe et al. (1996) developed a strategy of creating a crude cell lysate by freeze-thawing cells at a concentration of 10 cells/µl in the presence of placental RNase inhibitor. The crude lysate, containing no more than 250 cells, was then used for reverse transcription to produce cDNA. This technology serves as the basis for the "cDNA Direct from Cells" kit sold by PCG (Cat. #62-613100). As pointed out by Klebe (1996), this method is limited in that the RNase inhibitor is only specific for RNase A. There are many other types of RNases in a cell that may contribute to RNA degradation and would not be inhibited by a single specific RNase inhibitor. Another problem is that some types of cells have a much higher concentration of RNase activity thereby making it more difficult to maintain the intactness of the RNA in a crude lysate (O'Leary, 1999). A similar protocol was used by Yan. (2002) to detect an mRNA from one cell by RT-PCR. However, it differed in that it also included a DNase treatment to remove genomic DNA and only 1 to 3 cells were used in the reactions.
  • Busche (2000) used a procedure similar to Klebe (1996) to reverse transcribe RNA from a few cells. Ten myocyte section profiles from various samples were selected by laser-assisted picking, transferred into 10 µl of first strand buffer containing 4% ribonuclease inhibitor, cooled on ice for 5 minutes and snap frozen. The samples were incubated 70°C for 10 minutes and cooled on ice for 5 minutes. Reverse transcription was performed in a total of 17.5 µl using 5 µl of the sample and an MMLV-RT, and incubated 20°C for 10 minutes followed by 433°C for 60 minutes. The cDNA was subsequently used for PCR.
  • Brady (1993) generated cDNA from a few cells for creating cDNA banks using lysed cells. One to 40 cells in less than 0.5 µl volume are added to 4 µl of first-strand buffer and stored on ice for less than one hour before reverse transcription. The first strand buffer contains 0.5% Nonidet P-40 (NP-40) to lyse the cellular membrane and an RNase inhibitor to protect the RNA from degradation. The NP-40 does not lyse the nuclear membrane and therefore, the nucleus can be pelted by centrifugation (e.g., centrifugation at 12,000 x g, 4°C, for 50 seconds), to deplete the cell lysate of genomic DNA if desired. The cytoplasmic RNA is used for reverse transcription. The cell lysate in the first strand buffer is incubated at 65°C for 1 minute to unfold the mRNA. The reaction is cooled to room temperature for 3 minutes to anneal the oligo (dT) primer. One µl of a 1:1 mix of MMLV-RT and AMV-RT is added to the reaction and incubated 15 minutes at 37°C. The reaction was stopped by heating to 65°C for 10 minutes. This procedure does not involve any protease treatment, any DNase treatment and is only recommended for no more than 40 cells.
  • A kit called ExpressDirect™ (Pierce Chemical Company, Cat. #20146), isolates poly(A) RNA directly from a cell lysate. The wells of a 96-well plate have oligo dT immobilized to them. Cells are lysed in the wells and the poly(A) RNA hybridizes to the oligo dT, After hybridization, the cell lysates are removed and the wells washed to remove cell debris. The poly(A) RNA may then be eluted from the well and then reverse transcribed. Alternatively, the poly(A) RNA could be reverse transcribed directly in the 96-well plate. The immobilized oligo dT serves as the primer.
  • Protocols exist for the detection of bacterial DNA sequences from tissue culture in order to assay for Mycoplasma contamination ( US Patent 5,693,467 ; and Tang, 2000). This procedure involves incubating the cells from tissue culture with proteinase K. However, there is no mention of using this procedure to synthesize cDNA. In the Mycoplasma Detection kit from the American Type Culture Collection (Cat. #90-1001K) cells to be tested for Mycoplasma from tissue culture can be subjected directly to PCR if the Mycoplasma contamination is suspected to be severe. However, to achieve maximum sensitivity the cells are incubated in a lysis buffer (1x PCR buffer, 0.5% NP-40, 0.5% Tween 20) with proteinase K (18 µg/ml) at 60°C for one hour. The lysate is then incubated at 95°C for 10 minutes to inactivate the proteinase K. The manual states that the DNA extract may be used directly as the template for PCR without further purification. However, it cautions that the completion of the secondary DNA extraction procedure facilitates removal of all possible PCR inhibitors. The secondary extraction protocol involves adding 500 µl water, mixing well, adding 600 µl isopropanol and 1 µl glycogen (20 mg/ml), mixing well, incubating at -20°C for at least 30 minutes, centrifuging to pellet the DNA and then removing the supernatant. The DNA pellet is washed with 75% ethanol, centrifuged again and the supernatant removed. No mention is made in that this procedure can be used to prepare RNA for reverse transcription.
  • Fink (200a; 2000b) used a proteinase K treatment to increase the efficiency of RT-PCR from cells isolated by laser-assisted cell picking. Between 15 and 20 frozen or fixed cells were selected by laser-assisted cell picking, harvested by a syringe needle, added to 10 µl of first-strand-buffer and frozen in liquid nitrogen. After thawing the cells, proteinase K was added to the sample to 100 µg/ml, the sample was incubated at 53°C for 30 minutes and then heated at 99°C for 7 minutes to denature the proteinase K and RNA. Reverse transcription was performed directly on the sample using murine maloney leukemia virus - reverse transcriptase (MMLV-RT), at 20°C for 10 minutes and 43°C for 60 minutes. The cDNA from this reaction was used for PCR. In both of these publications, the fixed cells were frozen before the proteinase K treatment, the concentration of cells was no more than 2 cells/µl and no DNase treatment was used to remove genomic DNA.
  • Cells to cDNA™ (Ambion, Inc., #1712 & 1713; US Patent applications serial numbers 09/160,284 and 09/815,577 , the entire disclosures of which are incorporated herein by reference) is a kit where there is no RNA isolation step. A crude cell lysate is prepared containing total RNA. Cells from tissue culture are washed once in PBS and then resuspended in Cell Lysis Buffer. The cells are incubated at 75°C for 5 minutes, having two important effects. First, the cell membranes are lysed, thereby releasing the RNA into the Cell Lysis Buffer. As well, the heating step inactivates the endogenous RNases, thus protecting the RNA from degradation. A key component in the Cell Lysis Buffer is a reducing agent such as dithiothreitol (DTT). It was discovered that RNases can be inactivated by heating them in the presence of reducing agents ( US patent applications serial number 09/160,284 and 09/815,577 ). Following cell lysis, the crude cell lysate is incubated with DNase I to degrade the genomic DNA. After the DNase I is inactivated by a heating step, the cell lysate is ready for reverse transcription and then PCR. The Cells-ta-cDNA™ kit (Ambion, Inc. Cat. #1712 & 1713) is adapted for use with samples having low cell concentrations. If higher cell concentrations are used, then RNA quantification can cease to be linear and in some cases, the signal can be completely inhibited. It appears that the reverse transcriptase can be inhibited by the higher cell concentrations. In general, the maximum optimal cell concentration the Cells-to-cDNA™ kits is 100 to 200 cells per µl in the Cell Lysis Buffer.
  • A procedure that enables the direct use of a cell lysate at a higher cell concentration would have many more applications and provide a greater dynamic range for quantification, thereby complimenting the technology in Cells-to-cDNA. Also, because of the issue of higher cell concentrations, Cells-to-cDNA is most useful in the context of cells from tissue culture. As well, methods that are more useful in the direct use of a tissue in a reverse transcription reaction would decrease the time and the amount of handling required to prepare a sample for reverse transcription or other enzymatic applications.
  • SUMMARY OF THE INVENTION
  • The above-described deficiencies in the art are overcome by the present invention.
  • Broadly, the present invention relates to methods comprising: obtaining at least one biological unit containing RNA; obtaining at least one catabolic enzyme; preparing an admixture of the biological unit and the catabolic enzyme; and incubating the admixture under conditions where the catabolic enzyme is active.
  • The term "biological unit" is defined to mean any cell or virus that contains genetic material. In most aspects of the invention, the genetic material of the biological unit will include RNA. In some embodiments, the biological unit is a prokaryotic or eukaryotic cell, for example a bacterial, fungal, plant, protist, animal, invertebrate, vertebrate, mammalian, rodent, mouse, rat, hamster, primate, or human cell. Such cells may be obtained from any source possible, as will be understood by those of skill in the art. For example, a prokaryotic or eukaryotic cell culture. The biological unit may also be obtained from a sample from a subject or the environment. The subj ect may be an animal, including a human. The biological unit may also be from a tissue sample or body fluid, e.g., whole blood, plasma, serum, urine or cerebral spinal fluid.
  • The catabolic enzyme can be any catabolic enzyme known to those of skill in the art as of the filing of this specification or at anytime thereafter. In some preferred embodiments, the catabolic enzyme is a protease, for example, proteinase K. In other embodiments, the catabolic enzyme degrades carbohydrates, for example, amylase or cellulase. In some embodiments, the catabolic enzyme degrades lipids, such as lipase. In other embodiments the catabolic enzyme degrades DNA, such as, for example, bovine pancreatic DNase I. Of course, the various embodiments of the invention may comprise the use of one, two, three, four, five, six, seven, or more different catabolic enzymes, in order to achieve the desired goals of a given method. In some embodiments, any enzymes that digest DNA, lipids, fats, carbohydrates, connective tissue or any other molecules, proteins, or biological compounds that inhibit enzymatic reactions, specifically reverse transcription or PCR are contemplated. In certain embodiments, a catabolic enzyme may or may not be included in the Cell Lysis Buffer and in some case may be introduced before, after or simultaneously with the Cell Lysis Buffer. For example, it is entirely possible, in RT-PCR embodiments of the invention, to use both proteinase K to destroy RNase in a cellular extract in combination with one or more other catabolic enzymes to degrade other portions of the cellular extract to the benefit of the reaction. Of course, in such cases, it may be necessary to balance the concentrations and/or timing of the addition of the various catabolic enzymes, in order to prevent, for example, the degradation of a cellulase by a proteinase. However, such balancing will be well within the skill of one of skill in the art, in view of this specification. Proteases that may be used in the methods of the invention include, but are not limited to, Serine proteases that include but are not limited to Trypsin, Chymotrypsin, Elastase, Subtilisin, Streptogrisin, Thermitase, Aqualysin, and carboxypeptidase A, D, C, or Y; cysteine proteases that include but are not limited to Papain and Clostripain; acid proteases that include but are not limited to Pepsin, Chymosin, and Cathepsin; metalloproteases that include but are not limited to Pronase, Thermolysin, Collagenase, Dispase; and various aminopeptidases and Carboxypeptidase A, B, E/H, M, T, or U. In some embodiments of the invention, these proteases could be used in place of proteinase K. It is possible that a mixture of proteases could be used instead of a single protease to generate a cell lysate compatible with reverse transcription and PCR.
  • In certain embodiments, a protease and a DNase enzyme may be administered simultaneously or in the same reactions. This simultaneous treatment using proteases and DNase enzymes is an unexpected and novel finding, as described below. In some embodiments, 1, 2, 3, 4, 5, 6, 7, or more catabolic enzymes may be included in a protease/DNase composition or reaction. For example, multiple proteases or co-proteases may be included with lipases, collagenases, nucleases, and virtually any other enzyme that may be used to remove inhibitors of a reaction, e.g., polymerization reactions.
  • In some aspects of the invention, preparing an admixture of the biological unit and the catabolic enzyme is further defined as comprising preparing an extract of the biological unit and preparing an admixture of the extract of the biological unit and the catabolic enzyme. Further, preparing an admixture of the extract of the biological unit and the catabolic enzyme may comprise: first preparing the extract; and then mixing the extract with the catabolic enzyme. Alternatively, preparing an admixture of the extract of the biological unit and the catabolic enzyme could comprise: first mixing the biological unit and the catabolic enzyme; and then preparing the extract from the biological unit in the presence of the catabolic enzyme.
  • In some preferred embodiments, the invention relates to methods for producing cDNA from one or more biological units, possibly different types of biological units. In some embodiments, any enzyme that can utilize a nucleic acid or in particular RNA as template or substrate is contemplated. In certain embodiments, an admixture may be incubated with a nucleic acid polymerase. In some embodiments, the nucleic acid polymerase is a ribonucleotide polymerase, e.g., bacterial or viral RNA polymerase. Preferred embodiments may further comprise incubating the admixture with reverse transcriptase under conditions to allow reverse transcription. Typically, the methods will further comprise amplifying the products of the reverse transcription, and these methods may further comprise incubating said admixture with a deoxyribonuclease prior to the reverse transcription reaction. In some preferred embodiments the catabolic enzyme is a protease that is capable of inactivating ribonucleases in the admixture. For example, the protease may be proteinase K.
  • These embodiments have certain benefits in the context of RT-PCR, with regard to the issues described above. In such methods, a freezing step is not required. Further, the admixture may contain 1, 5, 10, 100, 200, 300, 400,. 500, 1,000, 2,000, 3,000, 4,000, 5,000, 10,000, or 15,000 or more cells/µl, as well as any concentration of cells between any two of these concentrations. Note that these concentration are for typical eukaryotic cells. Since prokaryotic cells are typically a thousand times smaller these concentration may be adjusted accordingly. Typically, it is the reverse transcriptase enzyme that is inhibited by the higher cell concentrations of cell lysate. In certain embodiments, the upper limit of cell concentration may be increased by either using other catabolic enzymes or other methods or compositions to destroy the inhibitors of the RT or by using RTs that are less inhibited by the lysates. In addition, DNase I treatment can be included although this is not necessary in all embodiments, for example, if the PCR primers are designed properly and the gene structure is amenable. In view of these improvements, the methods of the invention are well-suited to the analysis of a large number of differentially treated samples grown in tissue culture. For example, the regulation of an mRNA may be followed as cells are treated with increasing concentrations of a particular chemical (Sumida, 1999). Alternatively, cells may be treated with a panel of different drugs to screen for candidates that have the desired effect on a particular mRNA or a time course may be followed (Su, 1997).
  • Some embodiments of the invention further comprise adding an RNase inhibitor to the admixture, in addition to any proteinase that inhibits or degrades RNase. For example, the RNase inhibitor is a non-proteinaceous RNase inhibitor, such as ADP or a vanadyl complex. Proteinaceous inhibitors could also be used such as placental ribonuclease inhibitor or antibodies that inactivate specific ribonucleases.
  • In some embodiments, the final concentration of the catabolic enzyme added is between about 0.00001, 0.0001, 0.001, 0.01, 0.1, 1, 2, 3, 4, 5, 10, 15, 20, or 25 mg/ml, as well as any concentration between any two of these concentrations. In some embodiments, the final concentration of the catabolic enzyme added is between about 0.00001, 0.0001, 0.001, 0.01, 0.1, 1, 2, 3, 4, 5, 10,15, 20, or 25 mg/ml, as well as any concentration between any two of these concentrations in the admixture, more preferably, between 0.001 and 2 mg/ml, and even more preferably, between 0.025 and 1 mg/ml.
  • Typically, the catabolic enzyme is comprised in a buffer composition prior to admixing.
  • In some preferred embodiments, the admixture is incubated at between 0°C and 75°C. However, this temperature may vary during the course of the procedure. In certain embodiments, the admixture may be incubated at between 0°C and 100°C. Further, it is entirely possible to raise the temperature to a point where the catabolic enzyme is ultimately inactivated. For example, proteinase K tends to be inactivated at around 75°C. The inventors frequently place proteinase K containing reactions in a water bath at 75°C, knowing that when the reaction reaches this temperature, the enzyme activity will be destroyed, but that the benefit of the enzyme in destroying RNase will be achieved by that point.
  • In preferred embodiments, the invention is related to methods for producing cDNA from one or more biological units comprising: obtaining at least one biological unit; obtaining at least one catabolic enzyme; preparing an admixture of the biological unit and the catabolic enzyme; incubating the admixture at a temperature where the catabolic enzyme is active; and incubating with reverse transcriptase under conditions to allow reverse transcription. The components of this reaction can be any of the components described above.
  • Other embodiments of the invention relate to kits for producing cDNA from a biological unit, comprising, in a suitable container: a buffer; and a catabolic enzyme. In some such kits, the buffer and the catabolic enzyme are comprised in the same container. The kits may further comprise a reverse transcription buffer, a reverse transcriptase, and dNTP mix. The kits may additionally contain a deoxyribonuclease. In some preferred embodiments, the catabolic enzyme is proteinase K. The kits may further comprise an RNase inhibitor.
  • In some preferred embodiments, the kits for producing cDNA from a biological unit comprises, in one or more suitable container(s): a biological unit lysis buffer; a deoxyribonuclease; an RNase inhibitor; a reverse transcription buffer; reverse transcriptase; dNTPs; and an Armored RNA® control. "Armored RNA" is a an Ambion trademark for ribonuclease resistant RNA particles produced according to the methods disclosed in U.S. Patents 6,399,307 ; 6,214.982 ; 5,939,262 ; 5,919,625 ; and 5,677124 , the entire contents of which are incorporated herein by reference. These kits may further comprise a protease inhibitor, such as phenylmethylsulfonyl fluoride (PMSF), and/or a thermostable DNA polymerase.
  • Kits suitable for the practice of the methods described herein are sold by Ambion under the trademark Cells-to-cDNA II™.
  • In other aspects of the invention, a Cell Lysis Buffer comprising a catabolic enzyme, 1 mM CaCl2, 3 mM MgCl2, 1 mM EDTA, 1% Triton X100, and 10 mM Tris pH 7.5 is contemplated. In certain embodiments, the catabolic enzyme is Proteinase K. In some embodiments, Proteinase K may is present at a concentration of about 0.2 mg/ml.
  • In preferred embodiments the present invention is defined as follows:
    • Definition 1. A method comprising:
      • obtaining at least one biological unit containing RNA;
      • obtaining at least one catabolic enzyme;
      • preparing an admixture of the biological unit and the catabolic enzyme; and
      • incubating the admixture under conditions where the catabolic enzyme is active.
    • Definition 2. The method of definition 1, further comprising obtaining at least two catabolic enzymes.
    • Definition 3. The method of definition 2, wherein the at least two catabolic enzymes are a protease and a nuclease.
    • Definition 4. The method of definition 3, wherein the protease is Proteinase K and the nuclease is DNase I.
    • Definition 5. The method of definition 1, wherein the biological unit is a cell.
    • Definition 6. The method of definition 5, wherein the admixture contains a concentration of cells from about 5 to about 50,000 cells/µl.
    • Definition 7. The method of definition 6, wherein the concentration of cells is about 10,000 cells/µl.
    • Definition 8. The method of definition 5, wherein the cell is in obtained from a cell culture.
    • Definition 9. The method of definition 5, wherein the cell is a prokaryotic cell.
    • Definition 10. The method of definition 5, wherein the cell is a fungal cell.
    • Definition 11. The method of definition 5, wherein the cell is a eukaryotic cell.
    • Definition 12. The method of definition 11, wherein the cell is a human cell.
    • Definition 13. The method of definition 5, wherein the biological unit is obtained from a subject.
    • Definition 14. The method of definition 5, wherein the biological unit is obtained from a sample of body fluid.
    • Definition 15. The method of definition 14, wherein the body fluid is whole blood, plasma, serum, cerebral spinal fluid or urine.
    • Definition 16. The method of definition 13, wherein the biological unit is in a tissue sample.
    • Definition 17. The method of definition 1, wherein the biological unit is a virus.
    • Definition 18. The method of definition 1, wherein the catabolic enzyme is a protease.
    • Definition 19. The method of definition 18, further defined as a method of inactivating ribonucleases in the admixture.
    • Definition 20. The method of definition 18, wherein the protease is proteinase K.
    • Definition 21. The method of definition 1, wherein the catabolic enzyme degrades carbohydrates.
    • Definition 22. The method of definition 21, wherein the catabolic enzyme is amylase or cellulase.
    • Definition 23. The method of definition 1, wherein the catabolic enzyme degrades lipids.
    • Definition 24. The method of definition 23, wherein the catabolic enzyme is lipase.
    • Definition 25. The method of definition 1, wherein the catabolic enzyme degrades DNA.
    • Definition 26. The method of definition 1, wherein the catabolic enzyme is bovine pancreatic DNase I.
    • Definition 27. The method of definition 1, further comprising adding an RNase inhibitor to the admixture.
    • Definition 28. The method of definition 27, wherein the RNase inhibitor is a non-proteinaceous RNase inhibitor.
    • Definition 29. The method of definition 28, wherein the RNase inhibitor is ADP or a vanadyl complex.
    • Definition 30. The method of definition 27, wherein in the RNase inhibitor is a proteinaceous inhibitor.
    • Definition 31. The method of definition 30, wherein the proteinaceous inhibitor is placental ribonuclease inhibitor or an anti-RNase antibody.
    • Definition 32. The method of definition 1, wherein preparing an admixture of the biological unit and the catabolic enzyme is further defined as comprising preparing an extract of the biological unit and preparing an admixture of the extract of the biological unit and the catabolic enzyme.
    • Definition 33. The method of definition 32, wherein preparing an admixture of the extract of the biological unit and the catabolic enzyme comprises:
      • first preparing the extract; and
      • then mixing the extract with the catabolic enzyme.
    • Definition 34. The method of definition 32, wherein preparing an admixture of the extract of the biological unit and the catabolic enzyme comprises:
      • first mixing the biological unit and the catabolic enzyme; and
      • then preparing the extract from the biological unit in the presence of the catabolic enzyme.
    • Definition 35. The method of definition 1, further defined as a method for producing cDNA from one or more biological units and further comprising incubating the admixture with reverse transcriptase under conditions to promote reverse transcription.
    • Definition 36. The method of definition 35, further comprising amplifying the products of the reverse transcription.
    • Definition 37. The method of definition 35, further comprising incubating said admixture with a deoxyribonuclease prior to the reverse transcription reaction.
    • Definition 38. The method of definition 35, wherein the catabolic enzyme is proteinase K and the final concentration of the proteinase K between 0.0001 and 5 mg/ml in the admixture.
    • Definition 39. The method of definition 1, wherein the catabolic enzyme is comprised in a buffer composition prior to admixing.
    • Definition 40. The method of definition 1, wherein the admixture is incubated at between 0° C and 100° C.
    • Definition 41. A method for producing cDNA from one or more biological units comprising:
      • obtaining at least one biological unit;
      • obtaining at least one catabolic enzyme;
      • preparing an admixture of the biological unit and the catabolic enzyme;
      • and incubating the admixture at a temperature where the catabolic enzyme is active and with reverse transcriptase under conditions to allow reverse transcription.
    • Definition 42. The method of definition 41, further comprising obtaining at least two catabolic enzymes.
    • Definition 43. The method of definition 42, wherein the at least two catabolic enzymes are a protease and a nuclease.
    • Definition 44. The method of definition 43, wherein the protease is Proteinase K and the nuclease is DNase I.
    • Definition 45. The method of definition 41, wherein the reverse transcriptase is added to the admixture after a time sufficient to allow the catabolic enzyme to function.
    • Definition 46. The method of definition 41, wherein the biological unit is a cell.
    • Definition 47. The method of definition 41, wherein the biological unit is a virus.
    • Definition 48. The method of definition 41, wherein the catabolic enzyme is a protease.
    • Definition 49. The method of definition 48, wherein the protease is proteinase K.
    • Definition 50. The method of definition 41, wherein the catabolic enzyme degrades carbohydrates.
    • Definition 51. The method of definition 41, wherein the catabolic enzyme degrades lipids.
    • Definition 52. The method of definition 41, wherein the catabolic enzyme degrades DNA.
    • Definition 53. The method of definition 41, wherein preparing an admixture of the biological unit and the catabolic enzyme is further defined as comprising preparing an extract of the biological unit and preparing an admixture of the extract of the biological unit and the catabolic enzyme.
    • Definition 54. The method of definition 53, wherein preparing an admixture of the extract of the biological unit and the catabolic enzyme comprises:
      • first preparing the extract; and
      • then mixing the extract with the catabolic enzyme.
    • Definition 55. The method of definition 53, wherein preparing an admixture of the extract of the biological unit and the catabolic enzyme comprises:
      • first mixing the biological unit and the catabolic enzyme; and
      • then preparing the extract from the biological unit in the presence of the catabolic enzyme.
    • Definition 56. The method of definition 41, further comprising amplifying the products of the reverse transcription.
    • Definition 57. The method of definition 41, further comprising incubating said admixture with a deoxyribonuclease prior to the reverse transcription reaction.
    • Definition 58. A kit for producing cDNA from a biological unit, comprising, in a suitable container:
      • a buffer; and
      • a catabolic enzyme.
    • Definition 59. The kit of definition 58, wherein the buffer and the catabolic enzyme are comprised in the same container.
    • Definition 60. The kit of definition 58, further comprising, in one or more container (s):
      • a reverse transcription buffer
      • a reverse transcriptase; and
      • a dNTP mix.
    • Definition 61. The kit of definition 58, further comprising a deoxyribonuclease.
    • Definition 62. The kit of definition 58, wherein said catabolic enzyme is proteinase K.
    • Definition 63. The kit of definition 58, further comprising an RNase inhibitor.
    • Definition 64. A kit for producing cDNA from a biological unit comprising, in one or more suitable container(s):
      • a biological unit lysis buffer;
      • a deoxyribonuclease;
      • an RNase inhibitor;
      • a reverse transcription buffer;
      • reverse transcriptase;
      • dNTPs; and
      • an Armored RNA® control.
    • Definition 65. The kit of definition 64, further comprising a protease inhibitor.
    • Definition 66. The kit of definition 65, wherein the protease inhibitor is PMSF.
    • Definition 67. The kit of definition 64, further comprising a thermostable DNA polymerase.
    • Definition 68. A Cell Lysis Buffer comprising a catabolic enzyme, 1 mM CaCl2, 3 mM MgCl2, 1 mM EDTA, 1% Triton X100, and 10 mM Tris pH 7.5.
    • Definition 69. The Cell Lysis Buffer of definition 68, wherein the catabolic enzyme is Proteinase K.
    • Definition 70. The Cell Lysis Buffer of definition 69, wherein Proteinase K is at a concentration of about 0.2 mg/ml.
    BRIEF DESCRIPTION OF THE DRAWINGS
  • The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
    • FIG. 1. Illustrates an example of measuring the levels of GAPDH mRNA and the enterovirus Armored RNA® by real-time RT-PCR in the ABI 7700 in different concentrations of HeLa cells. The cells were processed using the methods of the invention.
    • FIG. 2. Illustrates an example of measuring the levels of GAPDH mRNA by real-time RT-PCR in the ABI 7700 in different concentrations of HeLa cells that were unfixed or fixed with 1% formalin for 1 hour. The cells were processed using the methods of the invention.
    • FIG. 3. Illustrates an example of measuring the levels of 18S rRNA and tPA mRNA in HeLa cells that were incubated with different concentrations of PMA by one-step, real-time RT-PCR in the ABI 7700. The cells were processed in 96-well plates using the methods of the invention.
    • FIG. 4. Illustrates an example of analyzing Gene Silencing by siRNA using Cells-to-cDNA II™ Automated Protocol. HeLa cells were transfected with gene specific siRNAs against CDC-2, c-jun, survivin, and GAPDH or a negative control (NCl). After 48 hours, cells were processed according to the Cells-to-cDNA II™ automated protocol, and analyzed by real-time one-step RT-PCR for the indicated genes and normalized to 18S rRNA.
    DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
  • The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
  • EXAMPLE I A Basic Procedure for Cells Derived from Tissue Culture
  • HeLa cells are used as an exemplary cell type of cells that are suitable for treatment using the compositions and methods described herein. However, the invention is in no way limited to the exemplary cell type. It is expected that the compositions and methods apply to all cell types. One of ordinary skill would, in light of the disclosure, expect all other cells types to be amenable to the methods of the present invention.
  • To demonstrate the basic methods for cells derived from tissue culture, HeLa cells were grown in Dulbecco's Modified Eagle Medium with 10% fetal bovine serum in a tissue culture flask to 50 to 75% confluency. The medium was removed and then the cells were incubated with trypsin (0.05% trypsin, 0.53mM EDTA) for 10 minutes at 37°C. Trypsin was inactivated by re-suspending the cells in medium with 10% fetal bovine serum. Cell concentration was determined with a hemacytometer and then the volume, calculated to contain 6 million cells, was centrifuged at 3,000 rpm for 5 minutes. The medium was removed and the cells were washed once with 1 ml of cold phosphate buffered saline (PBS). The cells were resuspended in 30 µl of PBS and dilutions were made in PBS using the stock solution of 200,000; 100,000; 50,000; 25,000; 10,000; 2,000; 400; 80; and 20 cells/µl. Five µl of each dilution were added to 95 µl of Cell Lysis Buffer [0.2 mg/ml proteinase K (Ambion, Inc., #2546), 1 mM CaCl2, 3 mM MgCl2, 1 mM EDTA, 1% Triton X100, 10 mM Tris pH 7.5] such that the final cell concentrations were 10,000; 5,000; 2,500; 1,250; 500; 100; 20; 4 and 1 cells/µl. Two µl of the enterovirus Armored RNA® control (Ambion RNA Diagnostics, #42050; Pasloske, 1998) may be included in the Cell Lysis Buffer as a positive control to a final concentration of ∼40,000 copies/µl. The EV Armored RNA® Primer and probe sequences were as follows: Forward 5'-GATTGTCACCATAAGCAGC-3' (SEQ ID NO.1); Reverse 5'-CCCCTGAATGCGGCTAATC-3' (SEQ ID NO. 2); TaqMan Probe: 5'-(FAM)-CGGAACCGACTACTTTGGGTGTCCGT-(TAMRA)-3' (SEQ ID NO. 3). The samples were incubated at 75°C for 10 minutes and then cooled to 37°C. DNase I (Ambion, Inc., #2222) was added to the cell lysate to a concentration of 0.02 to 0.04 U/µl, incubated at 37°C for 15 to 30 minutes and then incubated at 75°C for 5 minutes to inactivate the DNase I. The cell lysate is now compatible for reverse transcription and PCR.
  • Reverse transcription followed by PCR
  • Five µl of the cell lysate from above was added to 2 µl of random primers, 4 µl dNTP mix (2.5 mM each) and 5 µl of RNase-free water (Ambion, Inc., #9932). The mixture was incubated at 75°C for 3 minutes and cooled to room temperature. Two µl 10x RT buffer (500 mM Tris pH 8.3, 750 mM KCl, 30 mM MgCl2, 50 mM DTT), 1 µl (10 U/µl) of placental RNase Inhibitor (#2687, Ambion, Inc.), and 1 µl of MMLV-RT (25 U/µl) were added and the reaction was incubated at 42°C from 15 minutes to 60 minutes to synthesize cDNA. Negative control reactions were included that do not include MMLV-RT to assess the level of genomic DNA contamination. Reactions that do not include MMLV-RT should not generate any detectable signal during PCR. The reverse transcription reaction was incubated at 92°C for 10 minutes to inactivate the MMLV-RT.
  • For PCR, 5 µl of the cDNA were combined with 1 unit of SuperTaq Polymerase (Ambion, Inc.), 2.5 µl 10x PCR buffer (100 mM Tris-Cl pH 8.3, 500 mM KCl, 8% glycerol, 0.1% Tween 20), 2 µl dNTP mix (2.5 mM each), 3 µl 25 mM MgCl2, 1 µl of the primer pair (10 µM mixture of the forward and reverse primers) and 1 µl of the TaqMan® probe (2 µM), 0.5 µl 50x ROX Standard, 8.8 µl RNase-free water (Ambion, Inc.). Human GAPDH Primer and probe sequences were employed as follows: Forward: 5'-GAAGGTGAAGGTCGGAGT-3' (SEQ ID NO. 4); Reverse: 5'-GAAGATGGTGATGGGATTTC-3' (SEQ ID NO. 5); TaqMan Probe: 5'-(FAM)-CAAGCTTCCCGTTCTCAGCC-(TAMRA)-3' (SEQ ID NO. 6). The reactions were placed in an ABI 7700 Prism thermocycler and ran using following profile: 94°C, 2 minutes; [94°C, 20 seconds; 60°C, 20 seconds] x 40 cycles..
  • GAPDH was detectable in all samples that included HeLa cells. A plot of the threshold cycle (Ct value) against cell concentration was linear up to 2,500 cells/µl. GAPDH signal was readily detected at cell concentrations greater than 2,500 cells/µl but a slight inhibition of the reactions was observed. FIG. 1. In addition, the Ct value for the enterovirus Armored RNA® was unchanged in all of the cell concentrations up to 2,500 cells/µl indicating that there was no inhibition of the reverse transcriptase or PCR up to 2,500 cells/µl, which was in agreement with the GAPDH data. FIG. 1.
  • The cDNA synthesis reactions that did not include MMLV-RT (MMLV-RT minus control) did not generate any signal in the amplification reaction, demonstrating that genomic DNA was degraded to undetectable levels and that signals produced by RT-PCR were attributable solely to the amplification of the cDNA.
  • EXAMPLE II The Invention Functions with Multiple Cell Lines
  • In order to show the applicability of the invention across cell types HeLa S3, MCF-7, COS-7, CHO-K1, and J558 cells were grown to 50-75% confluency in appropriate growth media. The cells were harvested by trypsin, re-suspended in growth medium and counted with a hemacytometer. Two million of each cell type were collected and the cells were pelleted by centrifugation (3,000 rpm for 5 minutes). The cells were washed with 1x PBS (Ambion, Inc.) and pelleted again by centrifugation (3,000 rpm for 5 minutes). The cells were resuspended in 40 µl 1x PBS and four 1:5 dilutions were made in PBS. Five µl of each cell suspension was added to 95 µl Cell Lysis Buffer for final cell concentrations of 2,500; 500; 100; 20; and 4 cells/µl in the Cell Lysis Buffer. The cells were lysed, DNase I treated, and reverse transcribed followed by PCR as in EXAMPLE I.
  • In each cell line, β-actin mRNA was detected by real-time PCR at each cell concentration. β-actin primer and probe sequences were employed as follows: Forward: 5'-TCACCCACACTGTGCCCATCTACGA-3' (SEQ ID NO. 7); Reverse: 5'-CAGCGGAACCGCTCATTGCCAATGG-3' (SEQ ID NO. 8); TaqMan Probe: 5'-(FAM)-ATGCCC-X(TAMRA)-CCCCCATGCCATCCTGCGTp-3' (SEQ ID NO. 9) where X indicates a linker-arm nucleotide, and p indicates phosphorylation. The cDNA synthesis reactions that did not include MMLV-RT (MMLV-RT minus control) did not generate any signal in the amplification reaction proving that the genomic DNA was degraded to undetectable levels and that signals produced by RT-PCR were attributable solely to the amplification of the cDNA in each cell line.
  • EXAMPLE III Use of Methods on Fixed Cells from Tissue Culture
  • To demonstrate the methods of the invention on fixed cells from tissue culture, HeLa S3 cells were grown to 75% confluency in Dulbecco's Modified Eagle Medium with 10% fetal bovine serum. The cells were harvested as described in EXAMPLE I. Approximately 6 million cells were collected and pelted (3,000 rpm for 5 minutes). The cells were re-suspended in 0.5 ml of 1 x PBS. A volume of 0.5 ml of a solution containing 2% formalin in PBS was added to make a final concentration of 1% formalin. The cells were vortexed and placed at 4°C for 1 hour. Subsequently, the cells were formalin fixed.
  • The cells were pelleted to remove the formalin. The cells were resuspended in PBS and washed again to remove trace amounts of formalin. The cells were re-suspended in 120 µl PBS and four 1:5 dilutions were made. Five µl of each cell suspension was added to 95 µl cells lysis buffer for a final cell concentration of 2,500; 500; 100; 20 and 4 cells/µl. The same procedure was performed for cells that were not formalin fixed. The cells were lysed, DNase I treated, reverse transcribed and followed by PCR as in EXAMPLE I.
  • GAPDH was detected in both the fixed and unfixed cells. A plot of the threshold cycle (Ct value) against cell concentration was linear up to 2,500 cells/µl for both the fixed and unfixed cells FIG. 2. The Ct values for both sets were nearly identical for both sets.
  • The cDNA synthesis reactions that did not include MMLV-RT (MMLV-RT minus control) did not generate any signal in the amplification reaction proving that the genomic DNA was degraded to undetectable levels and that signals produced by RT-PCR were attributable solely to the amplification of the cDNA.
  • The effect of fixing the cells up to 24 hours with a formalin concentration as high as 4% was tested. There was about a 1 Ct value shift between the fixed cells and the cells that were not fixed. This was most likely due to loss of cells from washing the cells twice more with I x PBS to remove the formalin.
  • Those of skill would, based on this study, expect that this same procedure to function equally well with other types of common fixatives such as glutaraldehyde, acetic acid/ethanol (3:1), Carnoy's fixative, Bouin's fixative, and Osmium tetroxide fixative.
  • EXAMPLE IV Use of Methods on Fixed Cells Selected by Laser Capture Microdissection
  • To demonstrate the methods of the invention on fixed cells selected by laser capture microdissection, frozen sections of mouse kidney embedded with OCT media (Tissue-Tek), were fixed and stained with Hematoxylin-Eosin. Sections of 5 to 10 µm were produced with a cryostat. Areas of 0.04, 0.25, 0.6 and 1.0 mm2 of tissue were captured by laser capture microdissection using an Arcturus PixCell II™ system, each on a different cap. The thin layer of plastic containing the tissue samples was removed and placed into an 0.5 ml centrifuge tube containing 100 µl Cell Lysis Buffer and 2 µl of the Armored RNA® control. The tubes were incubated at 75°C for 10 minutes. The lysates were then subjected to DNase I treatment, reverse transcription, and PCR as described in EXAMPLE I. Primers and probes to detect a cyclophilin sequence as well as the Armored RNA® control were used in the PCR. Cyclophilin Primer and Probe sequences that may be employed were as follows: Forward: 5'-CCATCGTGTCATCAAGGACTTCAT-3' (SEQ ID NO. 10); Reverse: 5'-CTT GCC ATC CAG CCA GGA GGT CTT-3' (SEQ ID NO. 11); TaqMan Probe: 5'(FAM)TGGCACAGGAGGAAAGAGCATCTATG-(TAMRA)-3' (SEQ ID NO. 12). A Cyclophilin signal was detected in all samples. The Armored RNA® control ran alongside the cyclophilin reactions indicated that there was no inhibition from the tissue samples.
  • EXAMPLE V Multi-Well Format for Gene Expression Analysis
  • To demonstrate the methods of the invention in a multi-well format for gene expression analysis, cells were grown overnight in 0.2 ml DME media with 10% FBS with equal number of cells in each well in a 96 well culture plate (Falcon). The media was removed and the wells were washed with 0.2 ml 1 x PBS, and the PBS was removed. One hundred µl of Cell Lysis Buffer was added to each well. The plate was then moved to a heating tile set to 75°C and let stand for 10 minutes. To fully inactivate the proteinase K in the lysis, 2 µl of 0.1 M PMSF in DMSO was added to each sample and incubated at room temperature for two minutes. Two µl DNase I was added to each sample and the plate was incubated at 37°C for 15 minutes while shaking. The plate was then moved again to the 75°C heating tile for 5 minutes to inactivate the DNase I. One-step RT-PCR was performed on each lysate in a 96-well PCR plate as described in EXAMPLE IX.
  • In each sample GAPDH was detected by real-time PCR. An analysis of the Ct values for each sample gives a mean of 17.28 with a standard deviation of 0.524. This gives a CV of 3.03% with a high of 18.88 and a low of 15.90.
  • If one is using a heating tile that can be set to a higher temperature such, as 95°C, then it is possible to incubate the cells on these heating tiles to inactivate the proteinase K instead of adding PMSF. It is important that the samples themselves actually reach 75°C when using proteinase K as the protease (other proteases may be inactivated at lower temperatures). If not, then some of the protease may remain active to digest the reverse transcriptase when the sample was incubated for cDNA synthesis. Such an event would lessen or completely diminish a signal from the sample.
  • EXAMPLE VI Use of Other Reverse Transcriptases in Context of Methods
  • MMLV-RT is one of the most commonly used reverse transcriptases by molecular biologists. However, there are other reverse transcriptases that function in the invention. For example, Avian Myelogenous Virus reverse transcriptase (AMV-RT; Retzel, 1980) and the Tth DNA polymerase, which also has reverse transcriptase activity, can each synthesize cDNA. Further, the DNA polymerase has reverse transcriptase activity if Mn+2 is provided in the buffer (Myers, 1991) and can be used to generate cDNA from a cell lysate following the protocol of the invention. Those of skill in the art will understand that the above-described nucleic acid polymerases and any other nucleic acid polymerases having reverse transcriptase activity may be adaptable to the protocols of the invention.
  • EXAMPLE VII Different Concentrations of Proteinase K and Proteases other than Proteinase K Function in Context of Methods of the Invention
  • Using the procedure listed in EXAMPLE I, proteinase K has been used at concentrations of 25 and 500 µg/ml. The results have been essentially the same as using the 200 µg/ml concentration that was used in the standard protocol.
  • Proteases are classified into several groups based on the mechanism of catalysis. Serine proteases include but are not limited to Trypsin, Chymotrypsin, Elastase, Subtilisin, Streptogrisin, Thermitase, Aqualysin, and carboxypeptidase A, D, C, or Y. Cysteine proteases include but are not limited to Papain and Clostripain. Acid Proteases include but are not limited to Pepsin, Chymosin, and Cathepsin. Metalloproteases include but are not limited to Pronase, Thermolysin, Collagenase, Dispase, various aminopeptidases, and Carboxypeptidase A, B, E/H, M, T, or U. In some embodiments of the invention, these proteases or combination thereof could be used in place of or in addition to proteinase K. It is possible that a mixture of proteases could be used instead of a single protease to generate a cell lysate compatible with reverse transcription and PCR. In certain embodiments a protease or protease mixture may be used simultaneously with a nuclease, e.g., a DNase such as DNas I, or any other catabolic enzyme.
  • EXAMPLE VIII Tissue Samples
  • Another type of sample that may be used in regard to the invention is a piece of tissue consisting of cells ranging from hundreds to thousands. One such tissue or organ may be leech ganglia. Another sample type may be a patient needle biopsy that often consists of thousands of cells. A biopsy could be processed by the inventive methods and PCR amplified to make a diagnosis or prognosis by measuring the expression of certain genes. Another sample may be leukocytes or lymphocytes isolated from a blood sample. Plasma fractionated from a blood sample may be used in this invention to detect a virus such as HIV or HCV. Another sample may be whole blood itself.
  • EXAMPLE IX Coupling of invention with One-step RT-PCR
  • Methods of the invention can be used in a one-step RT-PCR reaction where the MMLV-RT and Taq polymerase were combined in a one tube, one buffer system. For example, HeLa S3 cells were grown, harvested, lysed, and DNase treated as in EXAMPLE I. Cell lysate concentrations of 1, 4, 20, 100, 500, 1,250, 2,500, 5,000, and 10,000 cells/µl were made and DNase treated as in EXAMPLE I. Five µl of each lysate was added to 2.5 µl 10 x RT buffer (500 mM Tris pH 8.3, 750 mM KCl, 30 mM MgCl2, 50 mM DTT), 1 µl (10 U/µl) of placental RNase Inhibitor (cat. # 2687, Ambion, Inc.), 1 µl of MMLV-RT (25 U/µl), 4 µl dNTP mix (2.5 mM each), 0.5 µl 50 x ROX standard (Ambion, Inc.), 1 µl PCR primer mix (10 µM mix of forward and reverse primers 1 µl TaqMan probe (2 mM), 0.2 µl SuperTaq (Ambion, Inc.), and 8.8 µl RNase-free water (Ambion, Inc.). The reactions were placed in an ABI 7700 Prism thermocycler and the following profile was ran: 42°C, 15 minutes; 94°C, 2 minutes; [94°C, 20 seconds; 60°C, 20 seconds] x 40 cycles.
  • GAPDH was detected in all samples that included HeLa cells. A plot of the threshold cycle (Ct value) against cell concentration was linear up to 2,500 cells/µl GAPDH signal was detected at higher cell concentrations but inhibition of the reactions by higher cell concentrations was indicated by Ct values increasing at the higher cell concentrations compared to the lower concentrations.
  • The cDNA synthesis reactions that did not include MMLV-RT (MMLV-RT minus control) did not generate any signal in the amplification reaction proving that the genomic DNA was degraded to undetectable levels and that signals produced by RT-PCR are attributable solely to the amplification of the cDNA.
  • EXAMPLE X Use of Invention without the DNase treatment
  • The DNase I step in some aspects of the invention is not necessary if the PCR primers used will not amplify genomic sequences. This can be done by designing primers that span an intron within the gene of interest. This greatly reduces the total time it takes to complete the procedure of the invention because the DNase I treatment can be eliminated.
  • For example, HeLa S3 cells were grown, harvested and lysed as described in EXAMPLE I. Reverse transcription followed by PCR was performed, again as in EXAMPLE I. A one-step RT-PCR procedure on the same lysates was performed as described in EXAMPLE IX using primers and probe for DDPK. DDPK Primer and Probe sequences, can be, for example: Forward: 5'-CTGGCCGGTCATCAACTGA-3' (SEQ ID NO. 13); Reverse: 5'-ACAAGCAAACCGAAATCTCTGG-3' (SEQ ID NO. 14); TaqMan Probe: 5'(FAM)-AATGCGT-(TAMRA)-CCTGAGCAGCAGCCCp-3' (SEQ ID NO. 15). DDPK was detected by real time PCR, and the reverse transcriptase minus reactions were negative.
  • EXAMPLE XI DNA Amplification
  • There are many cases where researchers have a limited amount of sample and the RNA isolated from the sample is not enough to perform their desired assay. The technique that this applies to most often is producing a labeled nucleic acid from the isolated RNA and then hybridizing the labeled nucleic acid to a microarray. The signals produced at each of the addresses of the microarray indicate the level of expression for each of the genes on the array. Thus, a snapshot is taken of the abundance for each of the genes probed by the array.
  • Typically, the starting material for amplifying RNA is a minimum of ∼10 ng of total RNA from the sample. Next, the RNA is reverse transcribed in the presence of an oligonucleotide primer that encodes an RNA polymerase promoter such as a T7 phage promoter. In the procedure by Kacian (US patent 5,554,516 ), the material is now transcribed by T7 RNA polymerase to synthesize RNA. In the procedure by Phillips (1996), a second strand of cDNA is produced and then the double-stranded DNA is transcribed by a phage polymerase. Ambion, Inc. produces the MessageAmp kit (Cat. #1750) based on the procedure of Phillips (1996). Purified total RNA or poly(A)RNA is the recommended substrate for the MessageAmp kit.
  • Cell lysates generated by the Cells-to-cDNA II™ procedure were demonstrated to be suitable substrate for the MessageAmp kit. For example, K562 cells at concentrations of 200, 600 and 2,000 cells/µl were incubated at 75°C for 10 minutes in a Cell Lysis Buffer comprised of 50 mM Tris pH 8.3, 75 mM KCl, 5 mM DTT, 1 mM EDTA, 1% TX-100. and 200 µg/ml protease K. No DNase I treatment was performed because it is not needed in this application. Five µl of each cell lysate concentration was used as the template in the MessageAmp procedure. RNA was amplified from 860 to 3,000 fold with this procedure (TABLE 1). TABLE 1. Fold-Amplification of RNA from a Cell Lysate Generated by the Cells-to-cDNA II™ method using the MessageAmp kit.
    Number of Cells Added to MessageAmp Reaction as Lysate *Quantity of RNA in the Reaction (ng) Quantity of RNA After MessageAmp Amplification (µg) Fold-Amplification of Cellular RNA
    1,000 5 15 3,000
    3,000 15 25 1,667
    10,000 50 43 860
    *Assume 5 pg of total RNA per cell
  • EXAMPLE XII Automation and Monitoring the Effects of Drug Treatment
  • Cells were grown overnight in 0.2 ml DME media with 10% FBS with equal number of cells in each well of a 96-well plate. After an overnight incubation, phorbol myristate acetate (PMA) is added to final concentrations of 100, 10, 1, 0.1, and 0 nM in the growth medium in replicates of eight. The cells were incubated at 37°C for 24 hours. The 96-well plate and lid were placed on the Packard MultiPROBE® II HT Liquid Handling System from PerlcinElmer Life Sciences on the proper deck positions. All proceeding steps were entered into the WinPrep for automation. The growth medium was removed and the cells washed with 1 x PBS. A volume of 0.1 ml Cell Lysis Buffer is added to each well. The plate was moved to a heating tile, for example, a tile at 75°, and incubated for 10 minutes. The plate was then moved to a shaker platform and 2 µl 100 mM PMSF in DMSO was added to each well to inactivate the proteinase K. PMSF is a serine protease inhibitor that does not inhibit reverse transcriptase or Taq polymerase. The plate was shaken for 2 minutes. PMSF can be used when the heating tile cannot heat the sample to 75°C to inactivate the proteinase K. Two µl DNase I (2 U/µl) was added to each well and the plate was moved to a 37°C heating tile. The plate was incubated for 15 minutes while shaking. The plate was then moved to a heating tile, for example, a tile at 75°C, and incubated for 5 minutes to inactivate the DNase I. The protocol for one step RT-PCR found in EXAMPLE IX was followed so that 20 µl aliquots of the master mix were added to a 96-well PCR plate. Five µl of lysate was added to each well. The plate was ready for one-step RT-PCR.
  • The one-step RT-PCR was run with primers and TaqMan probes for both tissue plasminogen activator (t-PA) and 18S ribosomal RNA with a standard curve ran for each set. tPA Primer and Probe sequences were: Forward: 5'-GGCGCAGTGCTTCTCTACAG-3' (SEQ ID NO. 16); Reverse: 5'-TAGGGTCTCGTCCCGCTTC-3' (SEQ ID NO. 17); TaqMan Probe: 5'-(FAM)-TTCTCCAGACCCACCACACCGC-(TAMRA)-3' (SEQ ID NO. 18); 18S Primer and Probe sequences: Forward: 5'TCAAGAACGAAAGTCGGAGG3' (SEQ ID NO. 19); Reverse: 5'GGACATCTAAGGGCATCACA3' (SEQ ID NO. 20); TaqMan Probe: 5'-(FAM)-TGGCTGAACGCCACTTGTCCCTCTAA-(TAMRA)-3' (SEQ ID NO. 21). The real-time PCR data shows there was about a 29-fold stimulation of t-PA with concentrations of 100 and 10 nM when the values were normalized to the levels of 18S rRNA which is assumed to be constant during different experimental conditions. FIG. 3.
  • In a similar type of experiment, cells were treated with short interfering (si)RNA to down regulate specific genes (Elbashir, 2002). Three thousand HeLa cells grown in a 96-well dish were transfected with chemically synthesized, 125 nM gene-specific siRNAs against CDC-2, c-jun, survivin, and GAPDH or a negative control (NC1) 24 hours after plating using Oligofectamine transfection reagent (Invitrogen). After 48 hours, cells were processed according to the Cells-to-cDNA II™ automated protocol, and analyzed by real-time one-step RT-PCR on an ABI 7900 for the indicated genes and normalized to 18S rRNA. Gene expression was calculated as a percentage of gene expression compared with the negative control siRNA. Experiments were performed in replicates of eight. Using the cell lysate produced by the Cells-to-cDNA II™ procedure and one-tube RT-PCR, gene expression for each of the target genes was determined to be reduced by more than 70% (FIG. 4).
  • EXAMPLE XIII Multiple Enzymes Used to Produce the Cell Lysate
  • In addition to proteases, other types of enzymes may be included in the Cell Lysis Buffer, such as enzymes to digest nucleic acids, sugars, fats, connective tissue (collagen and elastin) and DNA. These enzymes may be more important with regard to EXAMPLE VIII where the system may be used for small quantities of tissue. A combination of enzymes may enhance the digestion process and also destroy the macromolecules that inhibit enzymatic reactions.
  • For example, the initial lysis step containing proteinase K was combined with the DNase treatment, and the cellular DNA was digested to substantially reduce the signal generated in the reverse transcriptase minus reactions. This result was unexpected since it was thought that the proteinase K would digest the DNase I before the DNase could fully digest the cellular DNA. By combining these two enzymatic reactions, the Cells-to-cDNA II™ process is further streamlined and only a single incubation event is required to produce a cell lysate compatible with reverse transcription or one-step RT-PCR.
  • The Cell Lysis Buffer was made with proteinase K concentrations of 20 to 200 µg/ml and placed on ice. DNase I was added to the Cell Lysis Buffers at 0.1 U/µl and then the Cell Lysis Buffers were kept on ice while the cells were harvested. Cells were added to the different Cell Lysis Buffers at concentrations of 4 to 2,500 cells/µl. The samples were heated in a thermocycler at 60°C for 10 minutes to give the DNase time to digest the cellular DNA before inactivating the proteinase K and DNase enzymes at 75°C for 10 minutes. The same cells were also treated using the sequential method of EXAMPLE I. One-step real-time RT-PCR for GAPDH (as in EXAMPLE IX) was performed on these lysates. The difference between the RT minus and RT plus reactions were 18 Ct (∼20,000x) indicating that the DNase I was active in the combined format and that the proteinase K did not digest the DNase until it had degraded nearly all of the cellular DNA (TABLE 2). TABLE 2. Comparison of the signal obtained for GAPDH by real-time RT-PCR and PCR (RT-) using a combined or sequential proteinase K and DNase I treatments of HeLa S3 cells.
    Combined (Ct) Sequential (Ct)
    Cell Concentration
    (cells/µl) RT(+) RT(-) RT(+) RT(-)
    4 21.3 40 21.4 40
    20 17.6 40 18.1 40
    100 16.9 31.9 15.7 33.5
    500 14.6 33.3 14.1 36.7
    2,500 12.9 31.5 12.7 31.7
  • EXAMPLE XIV Addition of Cell Lysis Buffer Directly to Tissue Culture Medium
  • Typically, the Cells-to-cDNA II™ procedure involves washing the cells grown in tissue culture with phosphate buffered saline (PBS), primarily to remove the serum from the sample that was in the growth medium. The serum can inhibit downstream enzymatic reactions like reverse transcription and PCR.
  • If the cells can be grown in scrum-free medium, then the cell-washing step may be bypassed entirely. As such, the processing time will be decreased. Also, this procedure makes the handling of cells grown in suspension much easier because centrifugation is no longer required for washing. Drosophila cells are commonly grown in serum-free medium and therefore, the efficiency of the Cells-to-cDNA II™ procedure on these cells, if the cell washing step were omitted, was tested.
  • Schneider L2 Drosophila cells were grown to confluency in Drosophila-SFM (serum free medium). The cells were harvested in SFM and diluted to concentrations of 6,500; 1,300; 260; 52; and 10.4 cells/µl in SFM. Eighty µl of each cell concentration was added to a 0.5 ml tube to which two volumes (160 µl) of Cell Lysis Buffer was added. These samples were then taken through the Cells-to-cDNA II™ protocol including the DNase I digestion. The cell lysates were then used in one-step, real-time RT-PCR to detect Ubiquitin (accession #M22428) and analyzed using the ABI PRISM® 7900 HT Sequence Detection System Forward Primer; 5'-CACGCATCTTGTTTTCCCAAT-3' (SEQ ID NO:22); Reverse Primer: 5'-CTCGAGTGCGTTCGTGATTTC-3' (SEQ ID NO:23); TaqMan Probe: 5'-AATTGGCATCAAAACGCAAACAAATC-3' (SEQ ID NO:24). Lysate volumes of 5 µl were used in each of the 20 µl reactions.
  • It was found that all cell concentrations generated a PCR signal and that they were in the linear range. In addition, no signal was detected in the RT minus reactions indicating that the DNase treatment was effective in the presence of the SFM medium.
  • EXAMPLE XV Use of an Exemplary Kit for Producing cDNA from Mammalian Cells in Culture
  • Components of an exemplary kit for the preparation of cDNA from mammalian cells in culture may include one or more of the following reagents: 1 X PBS (pH 7.4); Cell Lysis II Buffer (10 mM Tris pH 7.5, 3 mM MgCl2, 1 mM CaCl2, 1 mM EDTA pH 8.0, 1% Tx-100 and 200 ug/ml Proteinase K); DNase 1 (2 U/µl); 10x RT Buffer (500 mM Tris pH 8.3, 750 mM KCl, 30 mM MgCl2, 50mM DTT); M-MLV Reverse Transcriptase; RNase Inhibitor (10 U/µl); dNTP Mix (2,5 mM each dNTP); Random Decamers (50 µM); Oligo(dT)18 Primers (50 µM); Nuclease-free water; RNA control, e.g., Armored RNA control; control RNA primer pair, e.g., Armored RNA primer pair (10 µM each); and an endogenous Primer Pair (5 µM each). The kit components are supplied in suitable containers under suitable conditions for shipping or storage. The parameters for use of the kit components are described herein and may be used to produce cDNA from mammalian cells in culture without the isolation of mRNA. In certain embodiments, the cDNA produced may be used in a variety of assays or procedures including, but not limited to PCR amplification or automated PCR amplification and analysis in multiwell formats and RNA amplification.
  • All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preened embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
  • REFERENCES
  • The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
    • Brady G, Iscove NN. Construction of cDNA libraries from single cells. Methods Enzymol. 225: 611-623,1993.
    • Busche S, Gallinat S, Bohle R-M, Reinecke A, Seebeck J, Franke F, Fink L, Zhu M, Sumners C, Unger T. Expression of angiotensin AT1 and AT2 receptors in adult rat cardiomyocytes after myocardial infarction: a single-cell reverse transcriptase-polymerase chain reaction study. J. Am. Pathol. 157: 605-611, 2000.
    • Elbashir SM, Harborth J, Weber K, Tuschl T. Analysis of gene function in somatic mammalian cells using small interferingRNAs. Methods 26: 199-213, 2002.
    • Fink L, Kinfe T, Seeger W, Ermert L, Kummer W, Bohle RM. Immunostaining for cell picking and real-time mRNA quantitation. Am. J. Pathol. 157: 1459-1466,2000a.
    • Fink L, Kinfe T, Stein MM, Ermet L, Hanze J, Kummer W, Seeger W, Bohle RM. Immunostaining and laser-assisted cell picking for mRNA analysis. Laboratory Invest. 80; 327-333, 2000b.
    • Klebe RJ, Grant GM, Grant AM, Garcia MA, Giambernardi TA, Taylor GP. RT-PCR without RNA isolation. BioTechniques 21: 1094-1100, 1996.
    • Lockhart DJ, Dong H, Byrne MC, et al. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat. Biotechnol. 14: 1675-1680, 1996.
    • Mesink E, van de Locht A, Schattenberg A, Liners E, Schaap N, Geurts van Kessel A, de Witte T. Quantitation of minimal residual disease in Philadelphia chromosome positive chronic myeloid leukemia patients using real-time quantitative RT-PCR. Br. J. Haematol. 102: 768-774,1998.
    • Myers TW, Gelfand DH. Reverse transcription and DNA amplification by a Thermus thermophilus DNA polymerase. Biochemistry 30:7661-7666,1991.
    • O'Leary TJ. Reducing the impact of endogenous ribonucleases on reverse transcription-PCR assay systems. Clin. Chem. 45: 449-450, 1999.
    • Pasloske BL, WallrerPeach CR, Obermoeller RD, Winkler M, DuBois DB. Armored RNA technology for the production of ribonuclease resistant viral RNA controls and standards. J. Clin. Microbiol. 36: 3590-3594, 998.
    • Phillips J, Eberwine JH. Antisense RNA amplification: a linear amplification method for analyzing the mRNA population from single living cells. Methods 10: 283-288, 1996.
    • Retzel EF, Collett MS, Faras AJ. Enzymatic synthesis of deoxyribonucleic acid by the avian retrovirus reverse transcriptase in vitro: optimum conditions required for transcription of large ribonucleic acid templates. Biochemistry 19: 513-518, 980.
    • Sumida A, Yamamoto I, Zhou Q, Morisaki T, Azuma J. Evaluation of induction of CYP3A mRNA using the HepG2 cell line and reverse transcription-PCR. Biol. Pharm. Bull. 22: 61-65,1999.
    • Su S, Vivier RG, Dickson MC, Thomas N, Kendrick MK, Williamson NM, Anson JG, Houston JG, Craig FF. High-throughput RT-PCT analysis of multiple transcripts using a microplate RNA isolation procedure. BioTechniques 22: 1107-1113,1997.
    • Tang J, Hu M, Lee S, Roblin R. A polymerase chain reaction based method for detecting; Mycoplasma/Acholeplasma contaminants in cell culture. J. Microbiol. Methods 39: 121-126, 2000.
    • Yan L, Kaczorowski G, Kohler M. One-tube protocol for single-cell reverse transcriptase-polymerase chain reaction. Anal. Biochem. 304: 267-270, 2002.
    • Roblin III RO, Hu M, Tang JS, Sunmin L. Mycoplasma polymerase chain reaction testing system using a set of mixed and single sequence primers. US Patent 5,693,467 .
    • Van Gelder RN, von Zastrow ME, Barchas JD, Eberwine JH. Processes for genetic manipulations using promoters. US patent 5,8991,636 .
    • Kacian DL, McAllister DL, McDonough SH, Dattagupta N. Nucleic acid sequence amplification method, composition and kit. US patent 5,554,516 .
    • Reynolds MA, Ruvolo M, Arnold Jr. LJ. Combined polynucleotide sequence as discrete assay endpoints. US patent 6,316,608 .
      Figure imgb0001
      Figure imgb0002
      Figure imgb0003
      Figure imgb0004
      Figure imgb0005

Claims (13)

  1. A method for producing cDNA from one or more biological units comprising:
    incubating an admixture comprising a cell lysis buffer composition, at least one biological unit and at least one protease, to produce a lysate under conditions where the at least one protease is active;
    inactivating the protease by one or more of heating the lysate or contacting the lysate with an inhibitor of the protease; and
    contacting at least one reverse transcriptase directly to all or a part of the lysate to form a reverse transcription reaction to produce cDNA..
  2. The method of claim 1, wherein the admixture further comprises a second catabolic enzyme.
  3. The method of claim 2, wherein the second catabolic enzyme comprises a deoxyribonuclease.
  4. The method of claim 3 wherein the protease comprises Proteinase K and the deoxyribonuclease comprises DnaseI.
  5. The method of any one of claims 1 to 4, wherein the biological unit is a eukaryotic cell.
  6. The method of claim 5 wherein the eukaryotic cell is a human cell.
  7. The method of claim 5, wherein the cell is obtained from a cell culture.
  8. The method of claim 5, wherein the biological unit is obtained from a subject, preferably from a tissue sample.
  9. The method of claim 5, wherein the biological unit is obtained from a sample of body fluid.
  10. The method of any one of claims 1 to 9, wherein the method does not involve isolation of RNA prior to production of cDMA.
  11. A kit for producing cDNA from a biological unit comprising, in one or more suitable container(s):
    a biological unit lysis buffer;
    a protease;
    a deaxyribonuclease;
    a protease inhibitor;
    an RNase inhibitor;
    a reverse transcription buffer;
    a reverse transcriptase; and
    dNTPs.
  12. The kit of claim 11, wherein the protease inhibitor is PMSF.
  13. The kit of claim 11, further comprising a thermostable DNA polymerase.
EP09180993.9A 2002-01-28 2003-01-28 Preparing crude biological extracts using protease, suitable for preparing cDNA Active EP2163652B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US35240202P true 2002-01-28 2002-01-28
EP03710760A EP1476573B1 (en) 2002-01-28 2003-01-28 Crude biological derivatives competent for nucleic acid detection

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP14197615.9A EP2902501A1 (en) 2002-01-28 2003-01-28 Preparing crude biological extracts using protease, suitable for preparing cDNA
EP10182642A EP2290098A1 (en) 2002-01-28 2003-01-28 Preparing crude biological extracts using protease, suitable for preparing cDNA

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
EP03710760.4 Division 2003-01-28
EP03710760A Division EP1476573B1 (en) 2002-01-28 2003-01-28 Crude biological derivatives competent for nucleic acid detection

Related Child Applications (2)

Application Number Title Priority Date Filing Date
EP14197615.9A Division EP2902501A1 (en) 2002-01-28 2003-01-28 Preparing crude biological extracts using protease, suitable for preparing cDNA
EP10182642A Division-Into EP2290098A1 (en) 2002-01-28 2003-01-28 Preparing crude biological extracts using protease, suitable for preparing cDNA

Publications (2)

Publication Number Publication Date
EP2163652A1 true EP2163652A1 (en) 2010-03-17
EP2163652B1 EP2163652B1 (en) 2014-12-24

Family

ID=27663090

Family Applications (4)

Application Number Title Priority Date Filing Date
EP09180993.9A Active EP2163652B1 (en) 2002-01-28 2003-01-28 Preparing crude biological extracts using protease, suitable for preparing cDNA
EP14197615.9A Pending EP2902501A1 (en) 2002-01-28 2003-01-28 Preparing crude biological extracts using protease, suitable for preparing cDNA
EP10182642A Withdrawn EP2290098A1 (en) 2002-01-28 2003-01-28 Preparing crude biological extracts using protease, suitable for preparing cDNA
EP03710760A Revoked EP1476573B1 (en) 2002-01-28 2003-01-28 Crude biological derivatives competent for nucleic acid detection

Family Applications After (3)

Application Number Title Priority Date Filing Date
EP14197615.9A Pending EP2902501A1 (en) 2002-01-28 2003-01-28 Preparing crude biological extracts using protease, suitable for preparing cDNA
EP10182642A Withdrawn EP2290098A1 (en) 2002-01-28 2003-01-28 Preparing crude biological extracts using protease, suitable for preparing cDNA
EP03710760A Revoked EP1476573B1 (en) 2002-01-28 2003-01-28 Crude biological derivatives competent for nucleic acid detection

Country Status (6)

Country Link
US (5) US20030170617A1 (en)
EP (4) EP2163652B1 (en)
AT (1) AT454469T (en)
DE (1) DE60330842D1 (en)
HK (1) HK1210627A1 (en)
WO (1) WO2003064605A2 (en)

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NZ511680A (en) 2001-05-14 2004-07-30 Univ Waikato Method for preparing nucleic acid or DNA samples and a DNA extraction process using thermophilic proteases
EP2163652B1 (en) 2002-01-28 2014-12-24 Life Technologies Corporation Preparing crude biological extracts using protease, suitable for preparing cDNA
CA2518569C (en) * 2003-03-10 2011-11-15 Expression Pathology, Inc. Liquid tissue preparation from histopathologically processed biological samples, tissues and cells
CN1580283A (en) * 2003-08-13 2005-02-16 清华大学 Method for detecting nucleic acid molecule
US20050208501A1 (en) 2004-03-16 2005-09-22 Ambion, Inc. Process and reagents for extraction of RNA from fractionated blood leukocytes
US20050239055A1 (en) * 2004-04-22 2005-10-27 Mariani Brian D Enterovirus primers and probes
US7575864B2 (en) * 2004-05-27 2009-08-18 E.I. Du Pont De Nemours And Company Method for the direct detection of diagnostic RNA
US20050277121A1 (en) * 2004-06-11 2005-12-15 Ambion, Inc. Crude biological derivatives competent for nucleic acid detection
AU2005253903B2 (en) * 2004-06-17 2010-07-01 Zygem Corporation Limited Purification methods and uses thereof
US20060188892A1 (en) * 2005-02-18 2006-08-24 Ambion, Inc. Enzymatic digestion of tissue
EP2049688B1 (en) * 2006-08-01 2018-01-24 Applied Biosystems, LLC Detection of analytes and nucleic acids
EP2147119B1 (en) * 2007-05-03 2011-05-25 Roche Diagnostics GmbH SINGLE-CELL mRNA QUANTIFICATION WITH REAL-TIME RT-PCR
US7964350B1 (en) 2007-05-18 2011-06-21 Applied Biosystems, Llc Sample preparation for in situ nucleic acid analysis
JP5367078B2 (en) 2008-08-01 2013-12-11 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft Improved dissolution and reverse transcription for mRNA quantitation
EP2367954B1 (en) 2008-12-19 2015-02-18 Life Technologies Corporation Proteinase k inhibitors, methods and compositions therefor
US10273470B2 (en) 2010-02-26 2019-04-30 Qiagen Gmbh Method for isolating RNA from a RNA and DNA containing sample
EP2559764A1 (en) 2011-08-17 2013-02-20 Qiagen GmbH Composition and methods for RT-PCR comprising an anionic polymer
WO2015168097A1 (en) * 2014-04-28 2015-11-05 Quest Diagnostics Investments Incorporated Molecular detection of enterovirus and parechovirus
US20170166956A1 (en) * 2015-12-11 2017-06-15 Shoreline Biome, Llc Methods for DNA Preparation for Multiplex High Throughput Targeted Sequencing

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000228A1 (en) * 1994-06-23 1996-01-04 Dade International Inc. Method for the rapid isolation of nucleic acid
US5554516A (en) 1992-05-06 1996-09-10 Gen-Probe Incorporated Nucleic acid sequence amplification method, composition and kit
US5677124A (en) 1996-07-03 1997-10-14 Ambion, Inc. Ribonuclease resistant viral RNA standards
US5693467A (en) 1995-05-19 1997-12-02 The American Type Culture Collection Mycoplasma polymerase chain reaction testing system using a set of mixed and single sequence primers
US5726021A (en) * 1994-06-16 1998-03-10 Becton Dickinson And Company Rapid and sensitive detection of antibiotic-resistant mycobacteria using oligonucleotide probes specific for ribosomal RNA precursors
US5891636A (en) 1989-09-22 1999-04-06 Board Of Trustees Of Leland Stanford University Processes for genetic manipulations using promoters
US5939262A (en) 1996-07-03 1999-08-17 Ambion, Inc. Ribonuclease resistant RNA preparation and utilization
WO2000017320A2 (en) * 1998-09-24 2000-03-30 Ambion, Inc. Methods and reagents for inactivating ribonucleases
EP1044984A2 (en) * 1999-04-13 2000-10-18 GSF-Forschungszentrum für Umwelt und Gesundheit, GmbH Kit for recovering RNA
WO2001021830A1 (en) * 1999-09-24 2001-03-29 Ambion, Inc. Nuclease inhibitor cocktail
US6218531B1 (en) * 1997-06-25 2001-04-17 Promega Corporation Method of isolating RNA
US6265165B1 (en) * 1998-11-12 2001-07-24 The Regents Of The University Of California Methods for EST-specific full length cDNA cloning
US6316608B1 (en) 2000-03-20 2001-11-13 Incyte Genomics, Inc. Combined polynucleotide sequence as discrete assay endpoints
US6329179B1 (en) * 1996-03-26 2001-12-11 Oncomedx, Inc. Method enabling use of extracellular RNA extracted from plasma or serum to detect, monitor or evaluate cancer

Family Cites Families (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3481913D1 (en) 1983-04-27 1990-05-17 Ici America Inc Proline derivatives.
US5194588A (en) 1985-01-22 1993-03-16 Ici Americas Inc. Aminoalcohol intermediates for peptide derivatives
GB8600263D0 (en) 1985-01-22 1986-02-12 Ici America Inc Peptide derivatives
US5055450A (en) 1985-01-22 1991-10-08 Ici Americas Inc. Peptide derivatives
US4900677A (en) * 1986-09-26 1990-02-13 E. I. Du Pont De Nemours And Company Process for rapid isolation of high molecular weight DNA
CA1317860C (en) 1987-04-01 1993-05-18 Daniel Louis Kacian Techniques for preparing specimens for bacterial assays
US5008245A (en) 1988-10-27 1991-04-16 University Of Kentucky Research Foundation Novel peptidyl carbamate inhibitors of the enzyme elastase
NO177716C (en) 1989-06-09 1995-11-08 Zeneca Ltd A process for the preparation of therapeutically active polypeptides, DNA sequencing, expression and antibody
CA2021660A1 (en) 1989-07-26 1991-01-27 Philippe Bey Peptidase inhibitors
US4997932A (en) * 1989-11-13 1991-03-05 Boehringer Mannheim Corporation Method and kit for purifying nucleic acids
US5284940A (en) 1990-11-14 1994-02-08 Hri Research, Inc. Preparation for nucleic acid samples
US5284829A (en) 1991-11-26 1994-02-08 The Regents Of The University Of California Synthetic tetrapeptides for the prevention of schistosome parasite infection
EP0675965A4 (en) 1992-01-29 1999-01-20 Hitachi Chemical Co Ltd Polynucleotide immobilized support.
US5386024A (en) * 1993-02-10 1995-01-31 Gen-Probe Incorporated Method to prepare nucleic acids from a biological sample using low pH and acid protease
JPH08510004A (en) 1993-05-06 1996-10-22 アボツト・ラボラトリーズ Detection of Direct lysis buffer and hiv-1 plasma viremia
JPH09511492A (en) 1994-02-03 1997-11-18 ザ ピコワー インスティテュート フォア メディカル リサーチ Compositions and methods for forward glycosylation endproducts mediated modulation of amyloidosis
KR100238833B1 (en) * 1994-03-10 2000-03-02 다니엘 엘. 캐시앙 Method for suppressing inhibition of enzyme-mediated reactions by ionic detergents
US6218105B1 (en) * 1996-07-19 2001-04-17 Kathleen S. Hall High throughput papilloma virus in vitro infectivity assay
US5871628A (en) 1996-08-22 1999-02-16 The University Of Texas System Automatic sequencer/genotyper having extended spectral response
AU6451798A (en) * 1997-03-07 1998-09-22 Reprogen, Inc. Prostate cancer-specific marker
US6111096A (en) * 1997-10-31 2000-08-29 Bbi Bioseq, Inc. Nucleic acid isolation and purification
WO1999025815A2 (en) 1997-11-18 1999-05-27 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Nucleic acids involved in the responder phenotype and applications thereof
BR9907112A (en) 1998-01-26 2000-10-24 Basf Ag A compound, a drug, and the use of a compound
US6583301B1 (en) 1998-04-08 2003-06-24 Celltech R & D Limited Lipids
US6204375B1 (en) 1998-07-31 2001-03-20 Ambion, Inc. Methods and reagents for preserving RNA in cell and tissue samples
DE69900949T2 (en) 1998-09-18 2002-10-02 Micromet Ag Dns amplification from single cells
AU2354800A (en) 1998-12-10 2000-06-26 Genetic Vectors, Inc. Method of protein removal
NZ516641A (en) 1999-07-23 2003-07-25 Genentech Inc Method for RNase- and organic solvent-free plasmid DNA purification using tangential flow filtration
US7264932B2 (en) 1999-09-24 2007-09-04 Applera Corporation Nuclease inhibitor cocktail
US7186507B2 (en) 1999-12-09 2007-03-06 Indiana University Research And Technology Corporation Fluorescent in situ RT-PCR
US7001724B1 (en) 2000-11-28 2006-02-21 Applera Corporation Compositions, methods, and kits for isolating nucleic acids using surfactants and proteases
JP2004523229A (en) 2001-01-16 2004-08-05 インヴィトロジェン コーポレーション Reagents for Rna Isolation
US20020172972A1 (en) 2001-05-15 2002-11-21 President And Fellows Of Harvard College Use of a selectively inactivatable enzyme to digest contaminating nucleic acid
DK1421175T3 (en) 2001-06-28 2009-03-23 Mountain View Pharmaceuticals Polymer Stabilized proteinases
EP2163652B1 (en) 2002-01-28 2014-12-24 Life Technologies Corporation Preparing crude biological extracts using protease, suitable for preparing cDNA
US20040038213A1 (en) 2002-08-06 2004-02-26 Kwon Jai W. Genotyping by in situ PCR amplification of a polynucleotide in a tissue biopsy
US7214484B2 (en) 2002-12-17 2007-05-08 Sigma-Aldrich Co. Compositions and methods for nucleic acid extraction from biological samples
US20070032418A1 (en) 2003-02-25 2007-02-08 Ambion, Inc Small-molecule inhibitors of angiogenin and rnases and in vivo and in vitro methods of using same
US7067298B2 (en) 2003-03-31 2006-06-27 Ambion, Inc. Compositions and methods of using a synthetic Dnase I
SG161106A1 (en) 2003-04-04 2010-05-27 Univ Lausanne Inhibitor proteins of a protease and use thereof
US20050069953A1 (en) 2003-09-30 2005-03-31 Ye Fang Assay solution compositions and methods for GPCR arrays
US20050277121A1 (en) 2004-06-11 2005-12-15 Ambion, Inc. Crude biological derivatives competent for nucleic acid detection
US20060088870A1 (en) 2004-10-22 2006-04-27 Finkelstein Sydney D Topographic genotyping for determining the diagnosis, malignant potential, and biologic behavior of pancreatic cysts and related conditions
US20060188892A1 (en) 2005-02-18 2006-08-24 Ambion, Inc. Enzymatic digestion of tissue
US7964350B1 (en) 2007-05-18 2011-06-21 Applied Biosystems, Llc Sample preparation for in situ nucleic acid analysis
EP2367954B1 (en) 2008-12-19 2015-02-18 Life Technologies Corporation Proteinase k inhibitors, methods and compositions therefor

Patent Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5891636A (en) 1989-09-22 1999-04-06 Board Of Trustees Of Leland Stanford University Processes for genetic manipulations using promoters
US5554516A (en) 1992-05-06 1996-09-10 Gen-Probe Incorporated Nucleic acid sequence amplification method, composition and kit
US5726021A (en) * 1994-06-16 1998-03-10 Becton Dickinson And Company Rapid and sensitive detection of antibiotic-resistant mycobacteria using oligonucleotide probes specific for ribosomal RNA precursors
WO1996000228A1 (en) * 1994-06-23 1996-01-04 Dade International Inc. Method for the rapid isolation of nucleic acid
US5693467A (en) 1995-05-19 1997-12-02 The American Type Culture Collection Mycoplasma polymerase chain reaction testing system using a set of mixed and single sequence primers
US6329179B1 (en) * 1996-03-26 2001-12-11 Oncomedx, Inc. Method enabling use of extracellular RNA extracted from plasma or serum to detect, monitor or evaluate cancer
US6214982B1 (en) 1996-07-03 2001-04-10 Ambion Inc Ribonuclease resistant RNA preparation and utilization
US5919625A (en) 1996-07-03 1999-07-06 Ambion, Inc. Ribonuclease resistant viral RNA standards
US5939262A (en) 1996-07-03 1999-08-17 Ambion, Inc. Ribonuclease resistant RNA preparation and utilization
US5677124A (en) 1996-07-03 1997-10-14 Ambion, Inc. Ribonuclease resistant viral RNA standards
US6399307B1 (en) 1996-07-03 2002-06-04 Ambion, Inc. Methods of quantifying viral load in an animal with a ribonuclease resistant RNA preparation
US6218531B1 (en) * 1997-06-25 2001-04-17 Promega Corporation Method of isolating RNA
WO2000017320A2 (en) * 1998-09-24 2000-03-30 Ambion, Inc. Methods and reagents for inactivating ribonucleases
US6265165B1 (en) * 1998-11-12 2001-07-24 The Regents Of The University Of California Methods for EST-specific full length cDNA cloning
EP1044984A2 (en) * 1999-04-13 2000-10-18 GSF-Forschungszentrum für Umwelt und Gesundheit, GmbH Kit for recovering RNA
WO2001021830A1 (en) * 1999-09-24 2001-03-29 Ambion, Inc. Nuclease inhibitor cocktail
US6316608B1 (en) 2000-03-20 2001-11-13 Incyte Genomics, Inc. Combined polynucleotide sequence as discrete assay endpoints

Non-Patent Citations (17)

* Cited by examiner, † Cited by third party
Title
BRADY G; ISCOVE NN: "Construction of cDNA libraries from single cells", METHODS BNZYMOL., vol. 225, 1993, pages 611 - 623
BUSCHE S; GALLINAT S; BOHLE R-M; REINECKE A; SEEBECK J; FRANKE F; FINK L; ZHU M; SUMMERS C; UNGER T.: "Expression of angiotensin AT1 and AT2 receptors in adult rat cardiomyocytes after myocardial infarction: a single-cell reverse transcriptase-polymerase chain reaction study", J. AM. PATHO, vol. 157, 2000, pages 605 - 611
ELBASHIR SM; HARBORTH J; WEBER K; TUSCHL T.: "Analysis of gene function in somatic mammalian cells using small interferingRNAs", METHODS, vol. 26, 2002, pages 199 - 213
FINK L; KINFE T; SEEGER W; ERMERT L; KUMMER W; BOHLE RM.: "Immunostaining for cell picking and real-time mRNA quantitation", AM. J. PATHOL., vol. 157, 2000, pages 1459 - 1466
FINK L; KINFE T; STEIN MM; ERMET L; FRANZE J; KUMMER W; SEEGER W; BOHLE RM.: "Immunostaining and laser-assisted cell picking for mRNA analysis", LABORATORY INVEST., vol. 80, 2000, pages 327 - 333
KLEBE RJ; GRANT GM; GRANT AM; GARCIA MA; GIAMBERNARDI TA; TAYLOR GP.: "RT-PCR without RNA isolation", BIOTECHNIQUES, vol. 21, 1996, pages 1094 - 1100
LOCKHART DJ; DONG H; BYRNE MC ET AL.: "Expression monitoring by hybridization to high-density oligonucleotide arrays", NAT. BIOTECHNOL., vol. 14, 1996, pages 1675 - 1680
MESINK E; VAN DE LOCHT A; SCHATTENBERG A; LINDERS E; SCHAAP N; GEURTS VAN KESSEL A; DE WITTE T.: "Quantitation of minimal residual disease in Philadelphia chromosome positive chronic myeloid leukemia patients using real-time quantitative RT-PCR", BR. J. HAEMATOL., vol. 102, 1998, pages 768 - 774
MYERS TW; GELFAND DH.: "Reverse transcription and DNA amplification by a Thermus thermophilus DNA polymerase", BIOCHEMISTRY, vol. 30, 1991, pages 7661 - 7666
O'LEARY TJ.: "Reducing the impact of endogenous ribonucleases on reverse transcnption-PCR assay systems", CLIN. CHEM., vol. 45, 1999, pages 449 - 450
PASLOSKE BL; WALKERPEACH CR; OBENNOELLER RD; WINKLER M; DUBOIS DB.: "Armored RNA teclmology for the production of ribonuclease resistant viral RNA controls and standards", J. CLIN. MICROBIOL., vol. 36, 1998, pages 3590 - 3594
PHILLIPS J; EBERWINE JH.: "Antisense RNA amplification: a linear amplification method for analyzing the mRNA population from single living cells", METHODS, vol. 10, 1996, pages 283 - 288
RETZEL EF; COLLETT MS; FARAS AJ.: "Enzymatic synthesis of deoxyribonucleic acid by the avian retrovirus reverse transcriptase in vitro: optimum conditions required for transcription of large ribonucleic acid templates", BIOCHEMISTRY, vol. 19, 1980, pages 513 - 518
SNMIDA A; YAMAMOTO J; ZHOU Q; MORISALD T; AZUMA J.: "Evaluation of induction of CYP3A mRNA using the HepG2 cell line and reverse transcription-PCR", BIOL. PHARM BULL., vol. 22, 1999, pages 61 - 65
SU S; VIVIER RG; DICKSON MC; THOMAS N; KENDRICK MK; WILLIAMSON NM, ANSON JG; HOUSTON JG; CRAIG FF.: "High-throughput RT-PCT analysis of multiple transcripts using a microplate RNA isolation procedure", BIOTECHNIQUES, vol. 22, 1997, pages 1107 - 1113
TANG J; HU M; LEE S; ROBLIN R.: "A polymerase chain reaction based method for detecting Mycoplasma/Acholeplasma contaminants in cell culture", J. MICROBIOL. METHODS, vol. 39, 2000, pages 121 - 126
YAN L; KACZOROWSKI G; KOHLER M.: "One-tube protocol for single-cell reverse transcriptase-polymerase chain reaction", ANAL. BIOCHEM., vol. 304, 2002, pages 267 - 270

Also Published As

Publication number Publication date
EP1476573A4 (en) 2005-12-14
US10233444B2 (en) 2019-03-19
US20130143275A1 (en) 2013-06-06
HK1210627A1 (en) 2016-04-29
WO2003064605A3 (en) 2004-02-19
EP2163652B1 (en) 2014-12-24
AT454469T (en) 2010-01-15
US20180340175A1 (en) 2018-11-29
US10011831B2 (en) 2018-07-03
EP2902501A1 (en) 2015-08-05
EP1476573B1 (en) 2010-01-06
US20030170617A1 (en) 2003-09-11
DE60330842D1 (en) 2010-02-25
US20120322112A1 (en) 2012-12-20
US9611497B2 (en) 2017-04-04
EP1476573A2 (en) 2004-11-17
EP2290098A1 (en) 2011-03-02
WO2003064605A2 (en) 2003-08-07
US20170218359A1 (en) 2017-08-03

Similar Documents

Publication Publication Date Title
Kwak et al. The N domain of Argonaute drives duplex unwinding during RISC assembly
EP2374900B1 (en) Polynucleotides for the amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process
US5763239A (en) Production and use of normalized DNA libraries
JP4542312B2 (en) Methods and compositions for the amplification of Rna sequence
US6713285B2 (en) Circular site-directed mutagenesis
JP4651386B2 (en) Using primers encoding the single strand of the duplex promoter
EP1167524B1 (en) Method for amplifying a nucleic acid sequence employing a chimeric primer
Fairbrother et al. Human genomic sequences that inhibit splicing
Bakin et al. Four newly located pseudouridylate residues in Escherichia coli 23S ribosomal RNA are all at the peptidyltransferase center: analysis by the application of a new sequencing technique
AU2006202986B2 (en) Quantitative measurement of gene expression based on isolation of RNA from fixed paraffin-embedded tissue specimens
US5322770A (en) Reverse transcription with thermostable DNA polymerases - high temperature reverse transcription
EP1924704B1 (en) Compositions and methods for processing and amplification of dna, including using multiple enzymes in a single reaction
US5824517A (en) Method for amplifying nucleic acid sequences by strand displacement using DNA/RNA chimeric primers
Lisitsky et al. Addition of destabilizing poly (A)-rich sequences to endonuclease cleavage sites during the degradation of chloroplast mRNA
Karrer et al. In situ isolation of mRNA from individual plant cells: creation of cell-specific cDNA libraries.
US9873901B2 (en) Compositions and methods for reverse transcriptase-polymerase chain reaction (RT-PCR)
EP0506889B1 (en) High temperature reverse transcriptases
EP2714938B1 (en) Methods of amplifying whole genome of a single cell
Eder et al. Substrate specificity of human RNase H1 and its role in excision repair of ribose residues misincorporated in DNA
JP2843675B2 (en) Identification of messenger rna, isolated and cloned
Van Dijk et al. Library preparation methods for next-generation sequencing: tone down the bias
US7094536B2 (en) Methods and compositions for amplification of RNA sequences
CA2195209C (en) Use of rna polymerase to improve nucleic acid amplification process
EP2058405A1 (en) Device and method for high-throughput quantification of mRNA from whole blood
US20030186237A1 (en) Methods and compositions of amplifying RNA

Legal Events

Date Code Title Description
AC Divisional application: reference to earlier application

Ref document number: 1476573

Country of ref document: EP

Kind code of ref document: P

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT SE SI SK TR

17P Request for examination filed

Effective date: 20100812

17Q First examination report despatched

Effective date: 20110125

RAP1 Rights of an application transferred

Owner name: LIFE TECHNOLOGIES CORPORATION

INTG Intention to grant announced

Effective date: 20140730

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT SE SI SK TR

AC Divisional application: reference to earlier application

Ref document number: 1476573

Country of ref document: EP

Kind code of ref document: P

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: AT

Ref legal event code: REF

Ref document number: 703166

Country of ref document: AT

Kind code of ref document: T

Effective date: 20150115

REG Reference to a national code

Ref country code: CH

Ref legal event code: NV

Representative=s name: BOVARD AG, CH

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 60347156

Country of ref document: DE

Effective date: 20150219

RIN2 Information on inventor provided after grant (corrected)

Inventor name: PASLOSKE, BRITTAN L.

Inventor name: HOANG, QUOC

REG Reference to a national code

Ref country code: NL

Ref legal event code: VDEP

Effective date: 20141224

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20150325

Ref country code: SE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

REG Reference to a national code

Ref country code: AT

Ref legal event code: MK05

Ref document number: 703166

Country of ref document: AT

Kind code of ref document: T

Effective date: 20141224

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: NL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20150128

Ref country code: AT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

REG Reference to a national code

Ref country code: DE

Ref legal event code: R026

Ref document number: 60347156

Country of ref document: DE

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: DK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

26 Opposition filed

Opponent name: QIAGEN GMBH

Effective date: 20150924

REG Reference to a national code

Ref country code: IE

Ref legal event code: MM4A

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 14

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: IE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20150128

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: BE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

RAP2 Rights of a patent transferred

Owner name: LIFE TECHNOLOGIES CORPORATION

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 15

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO

Effective date: 20030128

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20150424

PG25 Lapsed in a contracting state [announced from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20141224

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 16

PGFP Annual fee paid to national office [announced from national office to epo]

Ref country code: FR

Payment date: 20181213

Year of fee payment: 17

PGFP Annual fee paid to national office [announced from national office to epo]

Ref country code: DE

Payment date: 20190115

Year of fee payment: 17

Ref country code: CH

Payment date: 20190115

Year of fee payment: 17

Ref country code: GB

Payment date: 20190123

Year of fee payment: 17