TRYPANOSOME MICROSOME SYSTEM AND USES THEREOF
CONTINUING APPLICATION DATA This application claims the benefit of U.S. Provisional Application Serial
No. 60/836,045, filed August 7, 2006, which is incorporated by reference herein.
GOVERNMENT FUNDING
The present invention was made with government support under Grant No. A153086, awarded by the National Institutes of Health. The Government has certain rights in this invention.
BACKGROUND Human African trypanosomiasis (HAT) occurs in 36 countries in Sub-Saharan Africa, threatening an estimated 60 million people with debilitating disease. No vaccines are available for prevention of infection by Trypanosoma brucei, which causes trypanosomiasis. Drugs in use are toxic, and drug resistance can be an issue (for review, see Docampo and Moreno, 2003, Parasitol Res; 90 Supp 1 :S10-3). As a result, new drugs are needed for the treatment of trypanosomiasis (Cowman and Crabb, 2003, Trends Parasitol; 19(1 1 ):538-43; Pink et al., 2005, Nat Rev Drug Discov; 4(9):727-40; and GeIb and HoI, 2003, Science; 297(5580):343-4). In addition, additional new drugs must be developed, in order to prepare for possible emergence of drug resistance in the parasites (de Koning, 2001 , Int J Parasitol; 31(5-6):512-22; Ouellette, 2001 , Trop Med Int Health; 6(1 1):874-82; and Sinyangwe et al., 2004, Vet Parasitol; 1 19(2-3): 12-35).
Unique to T. brucei is the expression of a variable surface glycoprotein (VSG) coat on the cell surface, which undergoes constant variation in order to evade the humoral immune system and host antibodies. It is thought that recombination from a repertoire of greater that 1,000 VSG genes is responsible
for the vast diversity of the parasite, and its effectiveness in immune evasion. This "antigenic variation" allows T. brucei to survive in the host blood stream by evading immune response. VSGs arrive at the plasma membrane after entering the secretory pathway at the endoplasmic reticulum (ER) (McConville et al., 2002, Microbiol MoI Biol Rev; 66(1): 122-54). The transferrin receptor and nucleobase/nucleoside transporters are other proteins that localize to the plasma membrane after signal peptide dependent import into the ER. Thus, movement of proteins into the ER is crucial for targeting of cell surface receptors and nutrient transporters, as well as for the biogenesis of the Golgi complex, lysosomes, endosomes and the inner nuclear membrane. From the perspective of eukaryotic pathogen control, small molecules that selectively interfere with translocation of proteins into the ER hold promise for treatment of disease because they could block delivery of many proteins to the plasma membrane and as a result compromise viability of parasites. There is a need for efficient, cost- effective assays for identifying drug targets that interfere with protein translocation in trypanosomes.
SUMMARY OF THE INVENTION
The present invention includes a cell free preparation of protozoan microsomes, wherein the cell free preparation of protozoan microsomes demonstrate the ability to translocate a plasma membrane polypeptide into the microsome.
The present invention includes a method of preparing a cell free preparation of protozoan microsomes, wherein the cell free preparation of protozoan microsomes demonstrate the ability to translocate a plasma membrane polypeptide into the microsome.
The present invention includes a method of endoplasmic reticulum (ER) translocation of a polypeptide using a cell free preparation of protozoan microsomes, wherein the cell free preparation of protozoan microsomes demonstrate the ability to translocate a plasma membrane polypeptide into the microsome. In some embodiments, the method further includes contacting the cell free preparation of protozoan microsomes with a cell free preparation of protozoan cytosol, wherein the cytosol demonstrates the ability to facilitate the
translocation of a plasma membrane polypeptide into a cell free preparation of protozoan microsomes.
The present invention includes a method of screening for an agent that modulates the ER translocation of a polypeptide in a protozoan, the method including contacting the cell free preparation of protozoan microsomes, wherein the microsomes demonstrate the ability to translocate a plasma membrane polypeptide into the microsome with an agent and monitoring ER translocation of a polypeptide. In some embodiments, the methods further includes contacting the cell free preparation of protozoan microsomes with a cell free preparation of protozoan cytosol, wherein the cytosol demonstrates the ability to facilitate the translocation of a plasma membrane polypeptide into a cell free preparation of protozoan microsomes.
The present invention includes a method of screening for an agent for the treatment and/or prevention of a protozoan infection, the method including contacting a cell free preparation of protozoan microsomes, wherein the microsomes demonstrate the ability to translocate a plasma membrane polypeptide into the microsome, with an agent; and monitoring ER translocation of a polypeptide, wherein a modulation in the ER translocation of the polypeptide indicates the agent is a candidate for the treatment of a protozoan infection. In some embodiments, modulation is a decrease or inhibition in the ER translocation of the polypeptide. In some embodiments, the methods further includes further contacting the cell free preparation of protozoan microsomes with a cell free preparation of protozoan cytosol, wherein the cytosol demonstrates the ability to facilitate the translocation of a plasma membrane polypeptide into a cell free preparation of protozoan microsomes.
The present invention includes a method of screening for an agent that kills, inhibits the growth, and/or inhibits the reproduction of a protozoan, the method including contacting the cell free preparation of protozoan microsomes, wherein the microsomes demonstrate the ability to translocate a plasma membrane polypeptide into the microsome, with an agent and monitoring ER translocation of a polypeptide, wherein a modulation in the ER translocation of the polypeptide indicates the agent is a candidate agent that kills, inhibits the growth, and/or inhibits the reproduction of a protozoan. In some embodiments,
modulation is a decrease or inhibition in the ER translocation of the polypeptide. In some embodiments, the method further includes contacting the cell free preparation of protozoan microsomes with a cell free preparation of protozoan cytosol, wherein the cytosol demonstrates the ability to facilitate the translocation of a plasma membrane polypeptide into a cell free preparation of protozoan microsomes.
The present invention includes agents and derivatives thereof, identified by the methods of the present invention. The present invention includes compositions including these agents and/or derivatives thereof. The present invention includes a method of treating or preventing a protozoan infection in a subject, the method including administering to the subject an effective amount of an agent that modulates the ER translocation of a polypeptide in the cell free preparation of protozoan microsomes.
The present invention includes a method of treating or preventing a protozoan infection in a subject, the method including administering to the subject an effective amount of an agent or composition that modulates the ER translocation of a polypeptide in the cell free preparation of protozoan microsomes.
The present invention includes a method of killing, inhibiting the growth and/or inhibiting the reproduction of a protozoan, the method including contacting the protozoan with an agent or composition that modulates the ER translocation of a polypeptide in the cell free preparation of protozoan microsomes.
The present invention includes a method of killing, inhibiting the growth and/or inhibiting the reproduction of a protozoan, the method including contacting the protozoan with an agent that modulates the ER translocation of a polypeptide in the cell free preparation of protozoan microsomes, wherein the microsomes demonstrate the ability to translocate a plasma membrane polypeptide into the microsome. In some embodiments, the methods further includes further contacting the cell free preparation of protozoan microsomes with a cell free preparation of protozoan cytosot, wherein the cytosol demonstrates the ability to facilitate the translocation of a plasma membrane polypeptide into a cell free preparation of protozoan microsomes.
In some embodiments of the methods, cell free preparations, agents, and compositions of the present invention, the protozoan is of the genus Trypanosoma. In some embodiments of the methods, cell free preparations, agents, and compositions of the present invention, the protozoan is T. cruzi, T. brucei, T.b. gambiense, or T.b. rhodesiense. In some embodiments of the methods, cell free preparations, agents, and compositions of the present invention, the protozoan is of the genus Leishmania.
The present invention includes a cell free preparation of protozoan cytosol, wherein the cell free preparation of cytosol demonstrates the ability to facilitate the translocation of a plasma membrane polypeptide into a cell free preparation of protozoan microsomes.
The present invention includes a method of preparing a cell free preparation of protozoan cytosol, wherein the cell free preparation of protozoan cytosol demonstrates the ability to facilitate the translocation of a plasma membrane polypeptide into a cell free preparation of protozoan microsomes. The terms "comprises" and variations thereof do not have a limiting meaning where these terms appear in the description and claims.
Unless otherwise specified, "a," "an," "the," and "at least one" are used interchangeably and mean one or more than one.
BRIEF DESCRIPTION OF THE FIGURES
Figures IA and IB demonstrate cell-free protein import into T, brucei endoplasmic reticulum (ER) membranes. Fig. IA is a flowchart of protocol for post-translational import of VSG_ 1175ϋϋ Depicted are the various steps and temperatures at which reactions took place. The translation product for VSG_1 17500 is presented along with [14C] methylated protein markers (Amersham). Fig. 1 B shows the import of VSG_117500 into T. brucei microsomes (TbRM). VSG_1 17g6 mRNA was translated in rabbit reticulocyte lysate for 15 minutes and then treated with cycloheximide (50 μg/ml, final concentration). Reaction mixtures were incubated with TbRM (one equivalent) for 45 minutes at 37°C, followed by proteinase K digestion (300 μg/ml, final concentration) for 60 minutes on ice. Proteins were resolved by SDS-PAGE and
detected by phosphorimaging. Lane 1 is untreated VSG_117S00; lane 2 is VSG_117S00 treated with proteinase K; lane 3 is VSG_117500 translocated in presence of TbRM; lane 4 is VSG_1 17500 translocated in presence of TbRM but treated with proteinase K; and lane 5 is VSG_1 17500 translocated in presence of TbRM and then permeabilized with 2% NP40 during proteinase K digestion. Rectangular brackets underneath sets of bars denote those data points that were directly compared for quantitation, and the asterisks denote instances where no proteins were detected.
Figure 2 A and 2B show the effect of protein translocation inhibitors on TbRM. Fig. 2A presents the protocol used for import of VSG_117500. In Fig. 2B, SG_1 17500 mRNA was translated in rabbit reticulocyte lysate with 1.5 equivalents T. brucei cytosol (pretreated with MAL3-101 (0.3 μM), MAL3-51 (1 μM), CJ21 ,058 (20 μM) or equisetin (50 μM)) for 60 minutes. The reaction mixtures were treated with cycloheximide (50 μg/ml, final concentration) and incubated with TbRM (one equivalent). The mixture was incubated for 60 minutes at 37°C and digested with proteinase K digestion (30 μg/ml, final concentration) for 60 minutes on ice. Proteins were resolved by SDS-PAGE and detected by phosphorimaging. In lanes 1 and 2, TbRM were pretreated with DMSO. Lane 1 is untreated VSG__117500 with TbRM; lane 2 is VSG_117500 incubated with TbRM and treated with proteinase K. In lanes 3 and 4 TbRM were pretreated with MAL3-101. Lane 3 is VSG_1 17500 incubated with TbRM; lane 4 is VSG_1 175OO incubated with TbRM and then treated with proteinase K. In lanes 5 and 6 TbRM pretreated with MAL3-51. Lane 5 is VSG_1 17500 incubated with TbRM; lane 6 is VSG_1 17500 incubated with TbRM and then treated with proteinase K. In lanes 7 and 8 TbRM were pretreated with CJ- 21 ,058). Lane 7 is VSG_1 17500 incubated with TbRM; lane 8 is VSG_117500 incubated with TbRM and then treated with proteinase K. In lanes 9 and 10 TbRM were pretreated with equisetin). Lane 9 is VSG_1 17500 incubated with TbRM; lane 10 is VSG_1 17S00 incubated with TbRM and then treated with proteinase K.
Figures 3 A to 3D demonstrate the trypanocidal effect of protein translocation blockers (PTBs). Blood stream form T. brucei CA427 were grown in HMI-9 media to the cell density of 106. The cells were then transferred to 96
well plates with the addition of different concentrations of MAL3-101 , MAL3- 51, CJ-21,058 or equisetin. In controls, DMSO was added. Cell density was calculated at the end of 24 hours, and the graph was plotted. Fig. 3 A demonstrates the trypanocidal effect of MAL3-101. Fig. 3B demonstrates the trypanocidal effect of MAL3-51. Fig. 3C demonstrates the trypanocidal effect of CJ-21 ,058. Fig. 3D demonstrates the trypanocidal effect of equisetin.
Figures 4 A and 4B demonstrate the effect of anti-trypanosome compounds on a human HeLa Cells. HeLa cells, treated with DMSO, MAL3- 101, MAL3-51 , CJ-21,058 or equisetin, were subject to a propidium iodide viability assay and analyzed by flow cytometry.
Figures 5A to 5C presents the chemical structures of MAL3-101, CJ- 21,058 and Equisetin. Fig. 5A is MAL3-101 ; Fig. 5B is MAL3-51 ; Fig. 5C is equisetin.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS OF THE
INVENTION
The present invention provides cell free preparations of protozoan microsomes, wherein the cell free preparation of protozoan microsomes demonstrate the ability to translocate a protozoan polypeptide into the microsome, methods of preparing cell free preparations of protozoan microsomes, and methods of using cell free prepai-ations of protozoan microsomes. As used herein, a microsome is a small vesicle that is derived from fragmented endoplasmic reticulum (ER) produced when protozoan cells are mechanically broken (homogenized) and purified and isolated from other components, such as, for example, unbroken cells, other cellular organelles, nuclei, mitochondria, soluble enzymes, and other soluble proteins of the cellular cytosol.
The protozoan microsomes of the present invention may be prepared from any of a variety of protozoa, including, for example, kinetoplastid protozoa, such as for example, protozoa of the Blastocrithidia, Crithidia, Endotrypanum, Herpetomonas, Leishmania, Leptotnonas, Phytomonas, Trypanosoma, and Wallaceina genera. In preferred embodiments, the protozoan is of the genus Trypanosoma, including, but not limited to, T. cruzi, T. bnicei, T.b. gambiense,
and T.b. rhodesiense. In some embodiments, the protozoan is of the genus Leiskmania, including, for example, Leishmania major. Notable trypanosomal diseases include trypanosomiasis (African Sleeping Sickness and South American Chagas Disease, caused by species of Trypanosoma) and leishmaniasis (caused by species of Leishmania).
The purified and isolated microsomes of the present invention demonstrate the capability of translocating polypeptides across the endoplasmic reticulum (ER). In preferred embodiments, this polypeptide is a polypeptide of protozoan origin or is a polypeptide with a translocation signal sequence of protozoan origin. Such cell free microsomes are prepared by obtaining protozoan cells and treating the protozoan cells in a manner to mechanically break the protozoan cells, for example, by homogenization, enzymatic digestion, and/or detergent treatment. Microsomes can be concentrated and separated from other cellular organelles by differential centrifugation to sediment out unbroken cells, nuclei, mitochondria, and'other cellular organelles, whereas soluble cytosolic proteins and fragmented ER remain in the supernatant. Microsomes can then be separated from soluble cytosolic proteins by differential centrifugation to sediment out the microsomes formed by fragments of ER membrane, whereas the soluble cytosolic proteins remain in the supernatant. In some embodiments, the present invention also includes this supernatant which includes purified soluble cytosolic proteins.
The present invention also includes methods of preparing cell free protozoan microsomes that demonstrate the capability of translocating polypeptides across the ER membrane of the microsome. Such cell free microsomes may be prepared by obtaining protozoan cells; treating the protozoan cells in a manner to mechanically break the protozoan cells; concentrating and separating the microsomes from other cellular organelles by centrifugation to sediment out unbroken cells, nuclei, mitochondria, and other cellular organelles, whereas soluble cytosolic proteins and fragmented ER remain in supernatant; and separating microsomes from soluble cytosolic proteins by centrifugation to sediment the microsomes, whereas the soluble cytosolic proteins remain in the supernatant. The present invention includes microsomes made by this method, including microsomes prepared by any of the methods described in the Examples
included herewith.
For example, T. brucei microsomes, also referred to herein as "TbRM," may be prepared by obtaining blood stream trypanosomes from the blood of infected rats. Blood stream trypanosomes may be purified by DE-52 chromatography. Trypanosomes may be mechanically broken by homogenization, for example, with a dounce homogenizer. A homogenization buffer of about 250 mM Sucrose, about 50 mM HEPES-KOH5 about 50 mM KOAc, about 6 mM Mg(OAc)2, about 1 mM EDTA, about 1 mM DTT, about 1 μg/ml TLCK, about 5 μg/ml leupeptin, and about 0.5 mM PMSF (final concentrations) may be used. The homogenized trypanosome lysate may be centrifuged in a low speed spin, for example, at about 2,000 rpm in microfuge tubes, to remove unbroken cells, nuclei, mitochondria, and other cellular organelles. The supernatant of the low speed spin, containing the protozoan microsomes may then be centrifuged at a higher speed, for example, about 12,000 rpm in a microfuge, to pellet the microsomes. Microsomes may be resuspended in, for example, rough microsome buffer (RMB) of about 250 mM Sucrose, about 50 mM HEPES-KOH, about 50 mM KOAc, about 6 mM Mg(OAc)2, about ImM DTT, about 0.5 μg/ml TLCK, and about 2.5 μg/ml leupeptin. Microsome concentration may be determined, for example, by measuring absorbance at 260 nm. Concentration of microsomes may be adjusted (with, for example, RMB) to OD260 nanometers (nm) of 50. In some aspects, one equivalent of TbRM has an OD260 of 50 nm.
The present invention also includes a purified cytosol preparation of the supernatant from which microsomes have been removed. This cytosol preparation may be subject to additional centrifugation and/or purification procedures. For example, the supernatant obtained during the preparation of TbRM described above may be centrifuged at about 65,000 x g (for example, for 60 minutes in a Beckman TLA 100.3 rotor). The resulting supernatant may be further concentrated by ultrafiltration, for example, with a Centricon-10 filter (Amicon). Or, the supernatant obtained during the preparation of TbRM described above may be centrifuged at about 186,000-x g to obtain an 186,00Og-RM. This 186,00Og-RM preparation may further be filtered and concentrated, for example, by ultrafiltration with a Microcon-10 tube, molecular
weight cut-off, 10 kDa (Amicon). The tube may be centrifuged (at about 3,000-x g), producing a retentate, the cytosol preparation. Concentration of the cytosol preparation may be adjusted (with 0.1% SDS) to OD280 nanometers (tun) of 50. In some aspects, one equivalent of cytosol has an OD28O of 50 nm. The cytosol preparation may be quick-frozen in liquid nitrogen, and stored at -8O0C.
Such purified cytosol preparations may be added to a cell free microsome preparation to increase, improve or facilitate the translocation of polypeptides. The translocation of larger polypeptides may, in particular, be enhanced by the addition of such a cytosol preparation. Signal peptides for translocation across the endoplasmic reticulum are essential for protein traffic through the secretory system in eukaryotes, including protozoans. In addition, lumenal proteins of the ER, Golgi complex, lysosomes and plasma membrane proteins with exoplasmic domains depend on signal peptides for correct intracellular targeting. Parasite surface proteins are critical for the uptake of nutrients, such as, for example, iron, signal transduction, and cell viability. Therefore, an understanding of how proteins arrive at the plasma membrane of a protozoan is important for understanding viability and virulence in these organisms.
In T. brucei, an eukaryote that causes human African trypanosomiasis, the defining features of signal peptides are not known and the ER protein translocation machinery has not been fully characterized. Signal peptides of T. brucei are not compatible with the canine microsomal protein import system (Al-Qahtani et al., 1998, Biochem J; 331 :521-529 and Ramirez et al., 1999, J Eukaryot Microbiol; 46(6):557-65) that is widely used to study translocation of proteins into eukaryote ER (Connolly et al., 1989, J Cell Biol; 108(2): 299-307). For example, in a canine microsomal system, signal peptides from T. brucei, namely VSG_1 17, VSG_221, VSG_MVAT7 and BiP, fail to direct ER import of proteins. In control experiments, pp MF and E. coli β-lactamase were imported into the canine microsomes. Replacement of the signal sequence of VSG_1 17 with a signal sequence from pp MF led to import of the T. brucei protein by canine microsomes. Thus, the trypanosome signal peptide is incompatible with the canine ER protein import machinery. Further, trypanosomatid proteins expressed in human and insect cells are mistargeted. Attempts to secrete
recombinant I,, major gp63 from insect Sf9 cells failed. When the trypanosomatid signal sequence was replaced with a baculovirus signal peptide, gp63 was secreted. When gρ82 from T. cruzi was expressed in murine Vero cells the protein was not targeted to the plasma membrane where it is normally found in the parasite. Replacement of the T. cruzi signal peptide with a signal sequence from influenza virus hemagglutinin targeted gp82 to the plasma membrane of Vero cells. Thus, both in vitro and in vivo, trypanosomatid signal peptides seem to be incompatible with ER protein translocation systems in other eukaryotes.
The cell free microsome preparation of the present invention may be used in methods translocating protozoan polypeptides across the microsomal ER membrane. The diversity and nonequi valence of signal sequences in vertebrate is receiving attention (Martoglio and Dobberstein, 1998, Trends Cell Biol; 8(10):410-5; Rutkowski et al., 2003, JBZo/ Chem; 278(32):30365-72; Hegde and Bernstein, 2006, Trends Biochem Sci; 31(10):563-712006; Harant et al., 2006, J Biol Chem; 281 (41):30492-502; and Besemer et al., 2005, Nature;
436(7048):290-3). Since trypanosome and vertebrate signal sequences and ER translocation mechanisms have intrinsic differences (Al-Qahtani et al., 1998, Biochem J; 331 :521-529), the T. brucei ER protein import pathway provides a target for drug discovery. The novel cell free microsome system for trypanosome ER protein import of the present invention is prepared from membranes from T. brucei (TbRM) and is able, unlike canine microsomes, to import proteins with trypanosome signal peptides. Thus, the cell free microsystem of the present invention provides for the identification and characterization of T. brucei signal sequences and other protozoan species. The cell-free microsome translocation system of the present invention can be used to identify candidate drugs for the treatment and prevention of diseases caused by protozoa. As described in Example 2, two natural compounds of fungal origin, CJ-21 ,058 (Sugie et al., 2002, J Antibiot (Tolcyo); 55(l):25-9) and equisetin, a SecA inhibitor (Vesonder et al., 1979, J Antibiol (Tokyo); 32(7):759-61 ), blocked import of a VSG polypeptide into TbRM, and killed T. brucei. Since trypanosome post-translational ER protein import may require molecular chaperones, inhibitors of Hsp70 were also tested. MAL3-101 (Fewell et al., 2004, J Biol Chem; 279(49):51131-40) blocked protein
translocation into TbRM and was trypanocidal at sub-mi cromolar concentrations. These studies establish the ER protein import pathway as a valid target for discovery of anti-trypanosome drugs, and presents the cell free microsome system of the present invention as system for performing focused screens of trypanocidal compounds that inhibit protein import into the ER
The cell free microsome system of the present invention may be used for the screening and identification of agents for the treatment and/or prevention of a protozoan infection. Such cell free microsome systems may be used for the screening and identification of agents that kill, inhibit the growth, and/or inhibit the reproduction of a protozoan. For example, one may find new anti-trypanosome compounds by either screening chemical libraries or by rational drug design. In rational drug design, one aims to find small molecules that inhibit the function of proteins that are essential for parasite viability (McKerrow, 1996, Biologicals; 24(3):207-8; Barrett et al., 1999, Trends Microbiol; 7(2):82-8; Hammarton et al., 2003, Prog Cell Cycle Res; 5:91 -101 ; Selzer et al., 1999, Proc Natl Acad Sci USA; 96(20) :11015-22; Naula et al., 2005, Biochim Biophys Acta; 1754(1 -2): 151-9; and GeIb et al., MoI Biochem Parasitol; 126(2): 155-63).
The cell free protozoan microsomes of the present invention demonstrate the capability of translocating polypeptides across the ER. As used herein, the term "polypeptide" refers to a polymer of amino acids linked by peptide bonds and does not refer to a specific length of a polymer of amino acids. Thus, for example, the terms peptide, oligopeptide, protein, and enzyme are included within the definition of polypeptide. A polypeptide may be, for example, an intact protozoan polypeptide, such as, for example, an intact VSV polyeptide, a truncated protozoan polypeptide, such as, for example, a truncated VSV polypeptide, a chimeric polypeptide, containing, for example, amino acid residues from two different species, such as, for example, trypanosome and human amino acid sequences, and altered polypeptides, in which selected amino acid residues have been changed, for example, by site directed mutatgenesis.
As used herein, the term isolated means that a preparation that is either removed from its natural environment or synthetically derived, for instance by recombinant techniques, or chemically or enzymatically synthesized. An
isolated polynucleotide denotes a polynucleotide that has been removed from its natural genetic milieu and is thus free of other extraneous or unwanted coding sequences, and is in a form suitable for use within genetically engineered protein production systems. When applied to a protein/polypeptide, the term isolated indicates that the protein is found in a condition other than its native environment. In a preferred form, the isolated protein is substantially free of other proteins.
The present invention includes agents that modulate ER translocation in a cell free protozoan microsome preparation. The present invention includes derivatives and analogs of such agents. As used herein the term "agent" includes both protein and non-protein moieties. In one embodiment, the agent is a small molecule. The agent may be derived from a library of low molecular weight compounds or a library of extracts from plants or other organisms. Such agents and derivatives and analogs thereof may be identified by any of the methods discussed herein. The present invention includes compositions of one or more such agents and/or derivatives and analogs thereof. A composition may be a pharmaceutical composition. A composition may include a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable," as used herein, means that the compositions or components thereof so described are suitable for use in contact with human skin without undue toxicity, incompatibility, instability, allergic response, and the like.
As used herein in vitro is in cell culture, ex vivo is a cell that has been removed from the body of a subject, and in vivo is within the body of a subject. The present invention includes methods of treating or preventing a protozoan infection in a subject by administering to the subject an effective amount of an agent that modulates the ER translocation of a polypeptide in a cell free preparation of protozoan microsomes. Such an agent may be identified by the methods described herein. As used herein "treating" or "treatment" includes both therapeutic and prophylactic treatments. Desirable effects of treatment include preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
The present invention includes methods of killing, inhibiting the growth of, and/or inhibiting the reproduction of a protozoan by contacting the protozoan with an agent modulates the ER translocation of a polypeptide in a cell free preparation of protozoan microsomes. Such an agent may be identified by any of the methods described herein. A modulation of ER translocation includes a reduction in the rate of ER translocation, an inhibition of ER translocation. In some aspect, a modulation of ER translocation is the halting or prevention of ER translocation. In some aspect, a modulation of ER translocation is an increase in the rate of ER translocation, an enhancement in ER translocation. As used herein, the term "inhibit" means prevent, decrease, or reverse.
The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein. For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
EXAMPLES
Example 1
Preparation of T. brucei Microsomes
To prepare T. brucei microsomes (TbRM), blood stream trypanosomes were obtained from the blood of infected rats, and purified by DE-52 chromatography. Cells (1 x 1010) were resuspended in 5 milliliter (ml) of homogenization buffer (made up of 250 mM Sucrose, 50 mM HEPES-KOH, 50 mM KOAc, 6 mM Mg(OAc)2, ImM EDTA, ImM DTT, 1 μg/ml TLCK, 5 μg/ml leupeptin, 0.5mM PMSF (final concentrations). Two and half ml of resuspended cells were added to pre-chilled dounce homogenizer where they were lysed with 80 strokes of a pestle (specially selected for its tight-fitting to the homogenizer) on ice. After a one minute rest, another after 80 strokes was administered with the pestle. Homogenized cells were recovered and kept on ice while the remaining 2.5 ml of resuspended cells were being broken. Both sets of
homogenized lysates were pooled and centrifuged (2,000 rpm, 10 min, 4°C) in microfuge tubes. The supernatants were pooled, aliquoted into new microfuge tubes, and centrifuged at 12,000 rpm for 20 min at 40C5 and each pellet was resuspended in 50 μl (total volume) of fresh rough microsome buffer (RMB) (250 mM Sucrose, 50 mM HEPES-KOH, 50 mM KOAc, 6 mM Mg(OAc)2, ImM DTT, 0.5 μg/ml TLCK, 2.5 μg/ml leupeptin). The T. brucei microsome (TbRM) concentration was determined by measuring absorbance at 260 nm. Concentration of TbRM was adjusted (with RMB) to OD260 nanometers (nm) of 50, aliquoted, quick frozen in liquid nitrogen, and stored at -80°C. One equivalent of TbRM has an OD260 of 50 nm. Supernatant from the 12,000 rpm centrifugation was also saved.
Various unique properties distinguish T. brucei from canine pancreas microsomal system. Protein import into the endoplasmic reticulum has been studied extensively in vitro using a canine microsomal system (reviewed in Martoglio and Dobberstein, 1996, Trends Cell Biol; 6:142-147 and Walter and Blobel, 1983, Methods Enzymol; 96:84-93). Canine microsomes import protein co-translationally. They cannot import pre-synthesized protein. Consequently, there is no hard evidence that canine ER protein import requires cytoplasmic chaperones (such as, for example, Hsp70 and Hsp40). Finally, canine microsomal import system cannot recognize trypanosome signal peptides (Al-Qahtani et al., 1998, Biochem.J; 331 :521-529).
In contrast to the canine microsomal system, T. brucei microsomes (TbRM) of the present invention depend on trypanosome signal peptides to translocate protein into the endoplasmic reticulum (ER). Further, import of protein into TbRM can occur post-translationally, unlike the canine pancreatic system. Finally, translocation of full-length protein into TbRM requires cytosol from the parasite, and is inhibited by a small molecule that interferes with Hsp70 function, suggesting that Hsp40 is crucial for import of protein into TbRM.
Example 2
Endoplasmic Reticulum Protein Import as a Target for Anti-Trypanosome Drug Discovery
Caused by Trypanosoma brucei, human African trypanosomiasis is an emerging disease for which new drugs are needed. As an extracellular parasite in its vertebrate host, expression of proteins, including variant surface glycoprotein (VSG) on the plasma membrane is crucial for establishment and maintenance of an infection. Transport of the majority of proteins to the plasma membrane involves translocation into the endoplasmic reticulum (ER). Prevention of protein import into the parasite ER would be an effective target for the discovery of new anti-trypanosome compounds. In this example, a microsomal system that imports a model VSG__117 (VSG_117500) substrate was developed. This in vitro system was used in a focused screen to identify small molecules that block import of proteins into the microsomes from T. brucei (TbRM). Protein translocation blockers were then tested for anti-trypanosome effects. MAL3-101 , an inhibitor of Hsp40-regulated Hsp70 ATPase, blocked import of VSG_1 17 into TbRM. Similarly, equisetin and CJ -21,058 also inhibited import of VSG_l 17 into TbRM. In tests of trypanocidal activity, all compounds that blocked protein import into TbRM were toxic to trypanosomes. The concentrations at which fifty percent of parasites were killed (IC50) were 125 nM for MAL3-101, 3.3 μM for equisetin, and 7 μM for CJ-21,058. MAL3-101 and equisetin did not have discernible effects on human HeLa cells at concentrations that killed T. brucei. These observations establish TbRM protein import as a rapid assay for anti-trypanosome drug discovery. Drugs, including small molecule drugs, may be screened in the TbRM protein import system of the present invention to identify those that inhibit protein import into the microsomes and potentially kill the parasite. The TbRM protein import system of the present invention will identify lead compounds for anti-trypanosome drug discovery. TbRM protein import system of the present invention has identified MAL3-101 , equisetin, and CJ-21 ,058 as lead compounds for anti-trypanosome drug discovery.
Materials and Methods
Reagents and chemicals. Plasmid pVSG_l 17 (Bangs, et al., 1986, J Cell Biol; 103:255-263) was provided by Dr. J. Bangs (University of Wisconsin, Madison). CJ-21,058 and equisetin were gifts from Pfizer Inc., (New York, New York). Rabbit reticulocyte lysate (RRL) and methionine/cysteine-free amino acid mixture was purchased from Promega (Madison, Wisconsin). [35S]Redivue Promix™ was purchased from Amersham Biosciences (Piscataway, New Jersey), etoposide was purchased from Sigma (St. Louis, Missouri), and propidium iodide was purchased from Invitrogen (Carlsbad, California). Ampliscribe T7 in vitro transcription kit was purchased from Epicentre Technologies (Madison, Wisconsin).
DNA Templates and RNA Synthesis in vitro. DNA template (one μg) was transcribed using the Ampliscribe IM T7 kit (Epicentre Technologies) following the manufacturer's protocol. A template for in vitro transcription was obtained by PCR using the forward primer ccctaatacgactcactatagggaggaggg tttttaccatggactgccataca aaggag (SEQ ID NO:1), which contains a T7 promoter (italicized), and a translation enhancer (bolded) (Al-Qahtani and Mensa-Wilmot, 1996, Nucleic Acids Res.; 24: 1173-1174 33). The first 21 nucleotides of the VSG_117 coding sequence are in regular style font. The reverse primer for VSG_1 17 was cgaacaacgaaggggttct tatagtgcgtagattcgtagcttcgtttc (SEQ ID NO:2), and includes a Hinfϊ site and nucleotides 78-86 of the coding region of VSG_117. One ml (IMBU) of RNase free DNase I was added to the reaction and allowed to incubate at 370C for 15 minutes (1 MBU digests 1 mg of pUC19 DNA in 10 minutes). An equal volume of TE-saturated phenol/chloroform was then added to the reaction, which was vortexed, and centrifuged (13,200 rpm, 15 minutes) at 4°C. The aqueous phase was withdrawn, combined with an equal volume of chloroform, vortexed and centrifuged (15 minutes, 13,200 rpm,4°C). To this aqueous phase 0.3M sodium acetate (final concentration) and precipitated with ethanol at -200C overnight. The precipitate was recovered by centrifugation ( 13,200 rpm, 4°C for 15 minutes), rinsed with 70% ethanol, air-dried and dissolved 40 ml of nuclease free water. The RNA concentration was determined by measuring the absorbance at 260 nm, and confirmed by analysis with agarose gel electrophoresis and ethidium bromide staining.
Preparation of T. brucei microsomes (TbRM). Blood stream trypanosomes were obtained from the blood of infected rats, and purified by DE-52 chromatography. Cells (1 x 1010) were resuspended in 5 ml of homogenization buffer (made up of 250 mM Sucrose, 50 mM HEPES-KOH, 50 mM KOAc3 6 mM Mg(OAc)2, ImM EDTA, ImM DTT, lμg/ml TLCK, 5μg/ml leupeptin, 0.5mM PMSF (final concentrations). Two and half ml of resuspended cells were added to pre-chilled dounce homogenizer where they were lysed with 40 strokes of a pestle (specially selected for its tight-fitting to the homogenizer) on ice. After a one minute rest, another after 40 strokes was administered with the pestle. Homogenized cells were recovered and kept on ice while the remaining 2.5 ml of resuspended cells were being broken. Both sets of homogenized lysates were pooled and centrifuged (2,000 rpm, 10 minutes, 4°C) in microfuge tubes. The supernatants were pooled, aliquoted into new microfuge tubes, and centrifuged at 12,000 rpm for 20 minutes at 4°C, and pellets resuspended in 40 ml (total volume) of fresh rough microsome buffer (RMB) (250 mM Sucrose, 50 mM HEPES-KOH, 50 mM KOAc, 6 mM Mg(OAc)2, ImM DTT, 0.5 μg/ml TLCK, 2.5 μg/ml leupeptin). The T. brucei microsome (TbRM) concentration was determined by measuring absorbance at 260 nm. Concentration of TbRM was adjusted (with RMB) to OD260nm of 50, aliquoted, quick frozen in liquid nitrogen, and stored at -800C. One equivalent of TbRM has an OD260 of 50). Supernatant from the 12,000 rpm centrifugation was also saved.
Preparation of cytosol from T. brucei. The supernatant obtained during the preparation of TbRM described above was centrifuged at 65,000 x g (60 minutes, 4°C, Beckman TLA 100.3 rotor). Two milliliters of the resulting supernatant was concentrated twenty-fold by ultrafiltration with a Centricon-10 filter (Amicon). The retentate was retrieved, an aliquot was diluted 50-fold with 0.1% SDS, and the OD280 obtained. One equivalent of cytosol has an OD280 of 50. Aliquots were quick-frozen in liquid nitrogen, and stored at -800C. Protein import into TbRM. Two micrograms (μg) of RNA encoding a truncated substrate (e.g., VSG_1 17) was translated in 40 μl of a reaction mixture containing 20 μ 1 rabbit reticulocyte lysate, 60 μM amino acid mixture (-Met, -Cys), and 2.4 μCi [15S]Promix. The reaction was incubated at 37°C for 15
minutes. Cyclohcximide (50 μg/ml, final concentration) was used to stop further translation, and the mixture was divided into two portions. T. brucei microsomes (TbRM) (1 equivalent) was added to one aliquot, and to the other portion an equal volume of RM buffer was added. The reactions were incubated at 37°C for 45 minutes for protein import into TbRM to take place post-translationally.
Each reaction mixture was divided into three (each 10 μl) and treated with one of the following on ice for one hour: (I) RM buffer; (ii) 30 μg/ml protease K; (iii) nonidet P-40 (NP-40) (2%, final concentration) followed by protease K (30 μg /ml, final concentration). PMSF (20 mM final concentration) was added to stop protease K digestion. Samples were precipitated with an equal volume of cold (NH4)2SO4 sulphate (saturated) and resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (4% total acrylamide, 3% cross linker in tricene-HCl system) (Fekkes et al., 1998, MoI Microbiol; 29(5): 1179-90). The gels were dried, and radioactive polypeptides detected with a phosphorimager (Molecular Imager FX, (BioRad). Data bands were quantitated with QuantityOne software (BioRad), and graphs were plotted with DeltaGraph (Red Rock software).
Cell culture. Blood stream form T. brucei CA427 was cultured in HMI-9 medium (Hirumi and Hirumi, 1994, Parasitol Today; 10:80-84) to a maximum density of lOVml. For use in drug sensitivity studies, cells were seeded at
104/ml, and one hundred microliters added to each well of a 96- well plate, with or without test compounds at stated concentrations, as discussed in Brief Descriptions of Figs. 1-4. In controls, DMSO, the solvent for the compounds, was added. Cells were counted after 24 or 48 hours, using a hemocytometer, and the data graphed. AU experiments were performed in triplicates.
HeLa cell line was maintained in RPMI-1640 supplemented with 10% bovine serum, 100 U/ml penicillin/streptomycin, and 2 mM L-glutamine at 37°C in 5% CO2.
HeLa cell viability assays. Propidium iodide exclusion assay (reviewed in Steff et al., 2001 , Cytometry; 45(4):237-43 and Wigg et al., 2003, Anal Biochem; 3 17(1 ): 19-25) was used to determine HeLa cell viability after drug treatment. Cells were plated at 1 x 104 cells per well (96 well plate) with or without addition of test compounds for the stated time periods, as discussed in
Brief Descriptions of Figs. 1-4. Etoposide stock (2mM in DMSO) was and diluted in RPMl 1640 to 100 μM immediately before use. Adherent cells were rinsed with phosphate buffered saline (PBS), trypsinized (37°C for 5 minutes), pelleted (2,000 g, 2 minutes), resuspended in PBS (500 μl) containing propidium iodide (1 μg/ ml), DAPI [4'-6-Diarnidmo-2-phenylindole] (5 μg/ml) and analyzed by flow cytometry on a Dakocytomation CyAn without gating. Single fluorophore controls were acquired prior to the collection of the experimental data.
Mitochondrial XTT reduction assays (Ranta et al., 1998, J Cell Physiol; 176(l):92-8 and Berridge et al., 2005, Biotechnol Annu Rev; 1 1 :127-52) were performed as follows. HeLa cells were seeded in 96 well plates (1 x 10" cells/well) (100 μl). At stated times, XTT dye (sodium
3,3-{l -[(phenylamino)carbonyl]- 3,4-tetrazolium}-bis (4-methoxy-6-nitro) (25 μl of 1 mg/ml), and 5-methylphenzanium sulfate (25 μM, final concentration) were added to each well. Plates were incubated for two hours (37°C, 5% CO2), and absorbance at 450 nm was read using a Versimax Tuneable Micro Plate Reader (Molecular Devices).
Results T. brucei microsomes (TbRM) can import proteins post-translationally.
Microsomes from canine pancreas are a model system used to study protein import into the ER of vertebrates and many other eukaryotes. However, ER signal sequences of T. brucei are not, in general, compatible with the protein import machinery of vertebrate ER (Al-Qahtani et al., 19998, Biochem ./; 331 :521-529 and Ramirez et al., 1999, J 'Eukarγot Microbiol; 46(6):557-65). Consequently, it was crucial, in order to study the biogenesis of trypanosome proteins such as VSG_1 17, to develop a new protein import system using ER membranes from T. brucei. Two standard tests for successful microsomal ER protein import include proteinase (PK) protection of the translocated protein, and loss of protease protection after detergent permeabilization of microsomes (Connolly et al., 1989, J Cell Biol; 108(2):299-307). In the detergent permeabilization of microsomes test, detergent creates pores in the microsomal membranes that allow protease to access and digest imported proteins (GeIb et
al.> 2003, MoI Biochem Parasitol; 126(2):155-63).
A model trypanosome protein VSG_1 17 was translated in rabbit reticulocyte lysate and cycloheximide was added to terminate protein synthesis. Subsequently, T. brucei microsomes (TbRM) was added, the mixture was incubated at 37°C to facilitate protein import into TbRM, and reaction mixtures were (or were not) treated with proteinase K and/or detergent. See Fig. 1 A for an outline of the experimental scheme. In the absence of TbRM, VSG_117 was degraded by proteinase K (Fig. IB, lane T). TbRM protected VSG_117 from proteinase K digestion (Fig. IB, lane 4). Detergent permeabilization of TbRM resulted in proteinase K digestion of VSG_117 (Fig. IB, lane 5). From these data, it is concluded that VSG_117 is imported post-translationally into TbRM. Signal peptide dependence of VSG_1 17 translocation into TbRM was investigated. When the signal sequence was deleted from VSG_117 the protein was not imported into TbRM. From this example, it can be concluded that VSG_1 17 is translocated into
TbRM, a signal sequence is necessary for import of protein into TbRM, and import of VSG_1 17 into TbRM occurs posttranslationally. Co-translational import of protein into TbRM could not be studied because the microsomes inhibit translation of protein. A small molecule inhibitor of Hsp70-Hsp40 interaction blocks protein translocation into TbRM. Post-translational ER protein translocation in Saccharomyces cerevisiae and E. coli requires cytosolic chaperones. In the yeast S. cerevisiae, for example, Ssalp (Hsp70) and co-chaperone Ydjlp (Hsp40) (Becker et al., 1996, MoI Cell Biol; 16(8):4378-86; Ngosuwan et al., 2003, J Biol Chem; 278(9):7034-42; and McClellan et al., 1998, MoI Biol Cell;
9(12):3533-45) as well as Kar2p/BiP stimulate post-translational protein import (Lyman and Schekman, 1995, J Cell Biol; 131 (5): 1 163-71 ; Panzner et al., 1995, Cell; 81 (4):561 -70; and Holkeri et al., 1998, J Cell Sci; 1 1 1 :749-757).
E. coli, SecB and SecA chaperone protein secretion through the inner membrane (Zhou and Xu, 2003, Nat Struct Biol; 10(11):942-7; Ullers et al., 2004, Proc Natl Acad Sci USA; 101(20):7583-8; and Fekkes et al., 1998, MoI Microbiol; 29(5): 1 179-90), the topological equivalent of the eukaryote ER. Since protein import into T. brucei microsomes is post-translational the possibility that a
trypanosome Hsp70 influenced protein translocation into TbRM was coonsidered. Notably, the sequences of Ssalp and a T. hrucei cytosoHc Hsp70 (Van der Ploeg et al., 1985, Science; 228(4706): 1443-6) are 70% identical. To explore this concept, MAL3-101 was used as a small molecule inhibitor of Hsp40-mediated Hsp70 ATPase (Fewell et al., 2004, J Biol Chem;
279(49):51 131-40) that inhibits import of prepro alpha-factor into microsomes from S. cerevisiae. T. brucei cytosol was pre-incubated with MAL3-101 (or an equal volume of DMSO), while VSG_117 mRNA was translated in a reticulocyte lysate. TbRM was then added post-translationally to the T. brucei cytosol-supplemented reticulocyte lysate, and after incubation, to promote import of protein into the microsomes, each mixture was treated with proteinase K. See Fig. 2 A for flow chart of procedures.
In control reactions with DMSO in the reaction, TbRM imported 80% of VSG_117, as measured by protection from proteinase K digestion (Fig. 2B, compare lanes 1, 2). In contrast, only 13% of VSG_117 was translocated into TbRM when MAL3-101 was present (Fig. 2B, lanes 3, 4). In control experiments, MAL3-51 and MAL3-90 were examined. These data suggest that an Hsp70 family member is important for protein import into TbRM. More importantly, MAL3-101 is identified as a small molecule inhibitor of protein import into TbRM.
Equisetin and CJ-21 ,058 block protein translocation into TbRM. Post- translational protein secretion in E. coli is mediated by SecA (Watanabe and Blobel, 1993, Proc Natl Acd Sci USA; 90:901 1 -9015 and Knott and Robinson, 1994, J Biol Chem; 269(l l):7843-6). CJ-21 , 058, isolated from the soil fungus CL47745, (Sugie et al., 2002, J Antibioi (Tokyo); 55(l):25-9) is' reported to inhibit of SecA. Speculating that CJ-21 , 058 might inhibit post-translational import of protein into TbRM, the effect of the compound was tested on VSG_1 17 import into TbRM, following a protocol outlined in the description of Fig. I A. CJ-21 ,058 (20 μM) inhibited translocation of VSGJ 17 into TbRM by 95% (Fig. 2B, compare lanes 7 and 8).
Equisetin, an analog of CJ-21, 058, is produced by the soil fungus Fusaήum heterosporum (Vesonder et al., 1979, J Antibiot (Tokyo); 32(7):759-61). Since CJ-21, 058 blocked protein translocation into TbRM, it was
tested if equisetin had similar effects. Equisetin (25 μM) inhibited translocation of VSGJ.17 into TbRM by 95% (Fig. 2B, compare lanes 9 and 10). Hence, both CJ-21,058 and equisetin block VSG_117 translocation into TbRM.
TbRM protein translocation blockers (PTBs) are trypanocidal. Many important cell surface proteins in T. brucei enter the secretory pathway via the ER (Steverding et al., 1995, J Cell Biol; 131 :1 173-1 182). Consequently, it is anticipated that preventing the movement of proteins into the ER would reduce the amount of cell surface proteins some of which perform vital physiological functions, and lead to parasite death. Therefore, compounds that blocked protein translocation into TbRM (such as protein translocation blockers (PTBs)) were tested for trypanocidal activity against cultured trypanosomes.
MAL3-101 killed T. brucei in dose-dependent fashion (Fig. 3A). Fifty percent of parasites were killed at 125 nM (IC50), and one hundred percent of parasites were killed at 500 nM (ICi00). The related compound MAL3-51 lacked trypanocidal activity at concentrations as high as 5 mM (Fig. 3B). Similarly, MAL3-90 did not kill T. brucei at 3 mM.
Equisetin and CJ-21 ,058 exhibited antitrypanosomal properties. Equisetin had an IC50 of 3.3 μM (Fig. 3C). CJ-21,058 was also trypanocidal with an IC50 of 7 μM (Fig. 3D). In control studies using two assays of human HeLa cell viability, the amount of drugs that killed all trypanosomes had no measurable effect on host cells (Fig. 4).
It is concluded that inhibition of import of protein into TbRM is associated with trypanocidal action. Thus, the in vitro protein import system of the present invention will be valuable for identifying compounds that can kill T. brucei blood stream form.
To obtain a sense of the effects of the newly discovered anti-trypanosome compounds on host (vertebrate) cells, the drugs were tested on human HeLa cells using concentrations that killed one hundred percent T. brucei (IC100). No statistically significant differences were detected between drug-treated cells and control HeLa cells, using a cell viability assay based on propidium iodide exclusion (Fig. 4A). MAL3-101 (up to 10 mM) did not affect HeLa cell viability. Similarly, neither CJ-21 ,058 (20 μM) nor equisetin (26 μM) decreased viability of HeLa cells. In contrast, the positive control, etoposide, an inhibitor of
topoisomerase II, produced significant cell death (Fig. 4A). Similar results were obtained with the XTT assay (Fig. 4B).
The data in Figs. 1 to 4 are representative of many others performed that produced very similar results.
Discussion
Cell-free protein import into trypanosome ER membranes. An earlier study indicated that a signal peptide is important for secretion of a reporter protein in T. brucei (Bangs et al., 1996, J Biol Chem; 271 :18387-18393). However, SRP is dispensable for protein entry into the secretory pathway (Liu et al., 2002, J Biol Chem; 277(49):47348-57), leading the authors of that study to propose the existence of an "alternative pathway" for protein entry into T. brucei ER. This example shows that T. brucei microsomes import proteins post-translationally (Fig. 1 ) in a signal sequence dependent manner. MAL3-101 an inhibitor of j-domain stimulated Hsp70 ATPase blocked import of VSG__117 into TbRM (Fig. 2), consistent with the likely participation of a T. brucei homolog of an Hsp70 (cytosolic or localized to the ER) in ER protein import.
The properties of protein import into TbRM are reminiscent of observations made with fungi microsomes. S. cerevisiae and Candida maltosa microsomes can import proteins post-translationally (Hansen et al., 1986, Cell; 45:397-406; Brodsky et al., 1995, / 'roc Natl Acad Sci USA; 92(21 ):9643-6; Brodsky et al., 1993, J Cell Biol; 120:95-102; and Wiedmann et al., 1988, EMBO J; 7(6): 1763-8), and a soluble factor that stimulated import of alpha-mating factor into S. cerevisiae microsomes (Waters et al., 1986, J Cell Biol; 103(6 Pt 2): p. 2629-36) was identified as Hsp70 Ssalp) (Ngosuwan et al., 2003, J Biol Chem; 278(9):7034-42; McClellan et al., 1998, MoI Biol Cell; 9(12):3533-45; and Chirico et al., 1988, Nature; 332(6167):805-10), which interacts specifically with the J -domain protein Hsp40 (Ydjlp) (Becker et al., 1996, MoI Cell Biol; 16(8):4378-86; McClellan et al., 1998, MoI Biol Cell; 9(12): 3533-45; and Cyr and Douglas, \99A, J Biol Chem; 269(13):9798-804). These data suggest that T. brucei, like the yeasts, can use a chaperone-dependent pathway for protein translocation into the ER. More generally, this example will augment future investigations into the mechanisms by which proteins are post-translationally
translocated across the T. brucei ER membrane.
Trypanosome secretory pathway as a target for drug discovery. Cell surface proteins, for example VSG (Pays and Nolan, 1998, MoI. Biochem. Parasitol; 91 :3-36 and Sheader et al., 2005, Proc Natl Acad Sci USA; 102(24): 8716-21), transferrin receptors (Steverding et al ., 1995, J Cell Biol;
131 :1 173-1182), nucleobase transporters, and GP63 (El-Sayed and Donelson, 1997, J Biol Chern; 272:26742-26748) are important for establishment and maintenance of trypanosomatid infections in humans. Movement of these proteins to the plasma membrane is dependent on initial entry into the parasite ER, following paradigms worked out in model eukaryotes (reviewed in Wickner and Schekman, 2005, Science; 310(5753):1452-6). The ER is a gateway for targeting of proteins to the Golgi, endosomes, lysosomes and plasma membrane. Due to the large number of proteins that transit through the ER as part of their biogenesis, it seems plausible the small molecules that interfere with import of proteins into the ER of parasites may have potential as anti-parasite agents. Such inhibitors are likely to have pleiotropic effects on parasite viability by inhibiting the biogenesis of cell surface receptors, nutrient transporters, and protective surface proteins.
In vertebrates, protein import into the ER is co-transtational and dependent on signal recognition particle (SRP) (Rapoport et al., 1996, Annit Rev Biochem; 65:271-303). In contrast, several protein in T. brucei are imported into the ER without SRP (Liu et al., 2002, J Biol Chem; 277(49):47348-57). Further, T. brucei VSG_117 and VSG MVAT7 can be imported into TbRM post-translationally (Fig. 1). Hence, both in vitro and in vivo data indicate that proteins can be imported into the ER of T. brucei post-translationally. In theory, mechanistic differences may exist between pathways used by vertebrate (hosts) and T. brucei to translocate proteins into the ER. If so, it is possible that compounds that interfere with post-translational ER protein import in T. brucei may compromise viability of the parasite without significant effect on vertebrate host cells, and become lead compounds for discovery of novel anti-trypanosome drugs. The complexity of the ER co-translational and post-translational protein translocation pathways (reviewed in Wickner and Schekman, 2005, Science; 310(5753): 1452-6) promises to offer multiple targets for drug discovery.
T. brucei ER protein translocation inhibitors (PTBs) are trypanocidal. Molecular chaperones (e.g., Hsp70, Kar2p(BiP), SecB, SecA) and co-chaperones (J-domain proteins Hsp40 and Sec63p) are important for post-translational protein import into the ER of eukaryotes, and for protein secretion in prokaryotes (for reviews see, Wickner and Schekman, 2005, Science; 310(5753): 1452-6; Driessen et al., 2001, Nat Struct Biol; 8(6):492-8; and Mitra et al., 2006, Nat Struct MoI Biol; 13(1 1):957-64). The compound NSC 630668-R/l (also called R/l) inhibits endogenous as well as Hsp40 stimulated Hsp70 activity (Fewell et al., 2004, J Biol Chem; 279(49):51 131-40). Further, R/l also inhibits post-translational protein translocation into ER microsomes from S. cerevesiae (Fewell et al., 2004, J Biol Chem; 279(49):51 131-40 and Fewell et al., 2001, J Biol Chem; 276(2):910-4). Using combinatorial chemistry approaches, analogs of R/l have been produced, and designated as MAL3 series (Fewell et al., 2004, J Biol Chem; 279(49):51 131-40). MAL3-101 and MAL3-39 inhibit Hsp40 mediated ATPase of Hsp70, and MAL3-101 inhibits post-translational translocation of α-mating factor into yeast microsomes (Fewell et al., 2004, J Biol Chem; 279(49):51 131-40).
This example studied the effect of small molecule modulators of Hsp70 on protein import into TbRM. MAL3-101 (structure shown in Fig. 5) blocked import ofVSG_l 17 into TbRM (Fig. 2, lanes 3 and 4). Surprisingly, M AL3-51 and MAL3-90 that inhibit intrinsic Hsp70 ATPase activity (Fewell et al., 2004, J Biol Chem; 279(49):51131-40) do not inhibit protein translocation into TbRM. The difference in results between MAL3-51 (or MAL3-90) and MAL3-101 suggests that J-domain protein (e.g., Hsp40 or Sec63) modulation of Hsp70 (or Kar2p) contributes to translocation of protein into TbRM. Thus, T. brucei homologs of Hsp70/Hsp40 or Kar2p/Sec63p may be important for protein import into TbRM.
MAL3 compounds were tested for their effect on cultured T. brucei. MAL3-101 killed T. brucei at sub-mi cromolar level (Fig. 4A) and had undetectable effect on a mammalian cell line (Fig. 4A). The IC50 of MAL3-101 is comparable to that of drugs currently to treat human African trypanosomiasis (HAT) (IC50 of suramin is 1.4-2.3 μM, pentamidine is 0.3 nM) (del Rayo Camacho et al., 2002, Phytother Res; 16(5):432-6). MAL3-51 and MAL3-90
were not trypanocidal, even at millimolar concentrations, consistent with their inability to inhibit protein translocation into TbRM. These data suggest that MAL3-101 is a lead compound for anti-trypanosome drug discovery.
Equisetin and CJ-21,058 are natural products from the fungii Fusarium heterosporum (Vesonder et al., 1979, J Antibiot (Tokyo); 32(7):759-61), and CL47745 (Sugie et al., 2002, J Antibiot (Tokyo); 55(l):25-9), respectively. They are acyl tetramic acid derivatives (pyrrolidine-2,4-diones) (Burke et al., 2000, Org Lett; 2(23):3611-3) some of which have antibiotic or antiviral activities. Equisetin may be produced in large amounts, since it has been synthesized chemically (Burke et al., 2000, Org Lett; 2(23):3611-3).
Both equisetin and CJ-21,058 inhibit import of proteins into TbRM (Fig. 2), and both compounds are trypanocidal (Fig. 3), with little effect on human HeLa cells (Fig. 4). TC50 of equisetin (3.3 μM) and CJ-21,058 (7 μM) is comparable to that of suramin that is used for treatment of HAT. Equisetin has been considered for treatment of HIV infection (reviewed in De Clercq, 200O5 Med Res Rev; 20(5):323-49).
Finally, the minimum concentration at which MAL3-101, equisetin, and CJ-21,058 exhibited trypanocidal effect (IC100) was used to test their protein translocation blocking effect on TbRM. All compound inhibited protein translocation into TbRM at the concentration used. From this example, one can surmise that inhibition of protein import into the ER may an important mode of the antitrypanosomal action of these compounds in vivo. MAL3-101 , equisetin., and CJ-21,058 are lead compounds for anti-trypanosome drug development.
Example 3 Role of Cytosol in Translocation
The present invention has developed, for the first time, a cell-free microsomal system for import of trypanosome proteins into the parasite ER. This example shows that cytosol from T. brucei is required for translocation of the full-length variant surface glycoproteins VSG_1 17 and VSG_MVAT7 into T. brucei microsomes (TbRM).
Trypanosome microsome preparation. Following procedures also described in Examples 1 and 2, T. brucei blood stream form were harvested from infected rat blood, washed in phosphate buffered saline, and resuspended (2 x 109/ml) in homogenization buffer (50 itiM HEPES-KOH, pH 7.5, 250 mM sucrose, 50 mM KOAc, 0.1 mM EDTA, 1 mM DTT). Each milliliter (ml) of parasites was lysed by Dounce homogenization, and cell lysis verified by microscopic examination. Lysates were centrifuged at 2,000-x g (10 minutes, 4°C) to pellet nuclei and large aggregates. The supernatant from the first centrifugation was centrifuged at 12,000-x g (20 minutes, 4°C), and the pellet saved as T. brucei rough microsomes (TbRM). The supernatant was centrifuged at 186,000-x g (4°C, 60 min) to obtain an 186,00Og-RM. All pellets were resuspended in rough microsome buffer (RMB) (at OD280 — 50 per ml) and stored at -80°C until use. One microliter (μl) of this TbRM preparation equals one equivalent of microsomes. Preparation of cytosol from T. brucei. To obtain cytosol, the supernatant from preparation of the 186,00Og-RM described above was filtered and concentrated. Two ml of supernatant was placed in an ultrafiltration tube (Microcon-10; molecular weight cut-off, 10 kDa) (Amicon). The tube was centrifuged (3,000-x g, 4°C, 120 min), producing a 40 μl retentate, the cytosol preparation that was frozen in liquid nitrogen, and stored at -800C.
Coding sequences for "cargo proteins" (for ER translocation) were cloned downstream of a (phage) T7 promoter. mRNAs were synthesized in vitro with the Ampliscribe T7 transcription kit (Epicenter), and concentrated as directed by the kit manufacturer. Rabbit reticulocyte lysate (Promega) was used to synthesize potential cargo proteins (e.g., VSG_1 17). [35S]Methionine was added to the reticulocyte lysate, following vendor's instructions, in order to produce [35S]Met-labeled protein that could be monitored easily by phosphorimager detection.
Import of trypanosome proteins. As detailed in Example 2, rough microsomes from T. brucei (TbRM) import a truncated form of VSG_1 17S6
(approximately 86 amino acids long (VSG86), termed mini-VSG)) synthesized in vitro. Protein import activity was associated with TbRM but not the 186,00Og-RM. Signal peptide dependence of mini-VSG translocation into
TbRM was investigated. When the signal sequence was deleted from mini-VSG the protein was not imported. ER translocation of mini-VSG only works with T. brucei microsomes, but not canine microsomes. A signal sequence is necessary for import of protein into TbRM3 and translocation of mini-VSG into TbRM is posttranslational because TbRM was introduced into the reaction mixture after cycloheximide, which inhibits protein synthesis in T. brucei, had been added.
Cytosol from T. brucei is required for the import of a 27-kDa Protein into TbRM. Encouraged by the successful import of mini-VSG into TbRM, it was next attempted to import longer versions of the protein. A 114-amino acid long VSG_117 (VSG_J 17 , 14) was imported efficiently but a substrate that was 260 amino acids long (VSG_1 17260) could not be translocated into TbRM. Similarly, full-length VSG_1 17 was not imported into TbRM under these circumstances. These results were baffling, because all substrates contained the same signal sequence that facilitated import of mini-VSG into TbRM. Since all the protein translocation studied occurred posttranslationally, it was reasoned that a longer substrate might not translocate into TbRM because it may have adopted a conformation that was not "favorable" for import into the ER. In yeasts and E. coli that have posttranslational protein import systems, aggregated proteins can be "disentangled" by molecular "disaggregases" in the cytoplasm. Based on this information, it was suspected that cytosol from T. brucei might contain factors that could stimulate import of full-length VSG_117 into TbRM. To test this idea, cytosol was prepared from T. brucei, and used to supplement the in vitro system for translocation of VSG_MVAT7.
TbRM could not import full-length VSG_MVAT7 in the absence of cytosol. In the presence of cytosol, however, VSG_MVAT7 was protected from proteinase K. When detergent was added to permeabilize the microsomes prior to protease digestion, VSG_MVAT7 was degraded. Similar results were obtained with full-length VSG_1 17. Thus, it can be concluded that T. brucei cytosol contains a factor that is essential for posttranslational import of full-length VSG into TbRM.
Example 4 Specificity of TbRM for Signal Peptides from Different Biological Families
Several studies have indicated that trypanosomatid signal peptides are not compatible with the translocon in vertebrates. However, T. brucei microsomes (TbRM) import proteins from the parasite, as expected. This example determined that the species-specificity of signal peptide utilization of canine microsomes is also exhibited by T. brucei microsomes. For this purpose, proteins from E. coli (β -lactamase), S. cerevisiae (prepro-alpha mating factor), Bos taiirus (bovine) (preprolactin) and Leishmania major (gp63) were each translated in vitro and incubated with microsomes and cytosol from T. brucei. Translocation of the proteins into TbRM was tested with protease protection assays, as described in the previous examples.
Trypanosome TbRM could not protect proteins from the other species listed above from digestion by protease K. In control experiments, VSG_1 17 was protected from the protease under identical conditions. From these data, it can be concluded the TbRM is specific, in general, for signal peptides from T. brucei. Failure of gp63 to enter TbRM was surprising since I,, major is a trypanosomatid. However, the composition and design of Leishmania major signal peptides is similar to those from Gram-positive bacteria whereas T. brucei signal sequences are not very similar in composition or orgnization of the subdomains to the prokaryote signal sequences.
Example 5
Defining Properties of Trypanosoma brucei Signal Peptides
Plasma membrane proteins are important for cellular communication and viability. Movement of proteins to the plasma membrane requires translocation into the endoplasmic reticulum (ER). An N-terminal signal sequence is required for import of proteins into the ER. In T. brucei,, rudimentary properties of the ER protein translocation system have not been studied, despite the glaring importance of the pathway in the parasite. For instance, the essential features of signal peptides have not been defined. Although signal sequences had been
thought to be interchangeable between species, in general, signal peptides from T. brucei are not functional with canine microsomes that are widely used to study mechanisms of ER protein import. ER signal peptides contain an h-region that is thought to be composed of random hydrophobic amino acids. Bioinformatic analyses reveal that h-regions of T. brucei contain conserved peptide patterns (motifs). Human h-regions contain motifs that are different from those in T. brucei.
The objective of this example is to provide a comprehensive account of the pathways and mechanisms of protein import into the ER of trypanosomes. Accomplishing this goal requires a study of both signal peptides and factors that are required for translocation of protein into TbRM. By comparing the properties of the trypanosome protein import pathway with those of mammalian host cells, new lead anti-trypanosome compounds will be identified.
In this example, T. brucei signal sequences will be studied. Specifically, this example will test whether peptide motifs that have discovered in h-regions (i.e., h-motifs) contribute to VSG translocation into the ER. The importance of specific amino acids (e.g., Leu and VaI), order of residues, and hydrophobicity of the amino acids will be examined using both in vitro and in vivo approaches.
Two trypanosome proteins (VSG_117 and VSG_MVAT7) will be used to investigate the role of h-region motifs in the import of a native T. brucei protein into the ER. Motifs will be altered by site-directed mutagenesis to determine how h-region motifs affect signal peptide function. Then, h-motifs will be studied in context of a model peptide that will enable us to test whether or not T. brucei h-motifs are important for signal sequence activity in a trypanosome. First, this example will detennine if a single motif in a natural h-region is sufficient for protein import into the ER. Second, this example will explore whether the positioning of hydrophobic amino acids in a motif is sufficient for signal peptide activity, based on the observations that the all the fixed and ambiguous components in the T. brucei motifs arc hydrophobic amino acids, although T. brucei signal sequences have many polar residues (e.g., Ser and Thr). It is predicted that any three hydrophobic residues (from the group Ala, Met, Cys, Phe, Leu, VaI or lie) could be substituted for the fixed and ambiguous components of the motif without diminishing biological activity of the signal
peptide. Third, this example will investigate whether the order of amino acids in a motif is important for biological function. It is predicted that scrambling the h-motif sequence will either inhibit or abolish import of protein into the ER. Fourth, this example will evaluate the importance of h-motifs for variant surface glycoprotein (VSG_117) translocation into the ER in vivo.
Full-length VSG_1 17 containing the h-region mutants or the unmutated signal sequence will be tested for translocation into TbRM and the data quantitated. For each cargo substrate, the relative efficiency of VSG import into TbRM will be normalized to the activity of the unmutated VSG_117 h-region, in order to assess any inhibitory (or stimulatory) effects of the mutations on entry of VSG_1 17 into the ER. For a change in VSG import to be considered significant, the decrease in protein translocation must be greater than 50%.
H-regions containing various T. brucei h-motifs (singly, and in combinations found in the two native signal peptides VSG_1 17 and VSG_M VAT7) will be used to replace that of VSG_1 17, using megaprimer oligonucleotide-directed PCR mutagenesis and a cDNA encoding VSG_117 as template. RNA will be prepared using the purified PCR products as template for transcription, and used for translation/translocation with T. brucei microsomes. The proportion of protein imported into TbRM will be quantitated by comparing the residual radiolabeled substrate after protease K treatment with input (total) radiolabeled protein.
This example will determine how different motifs in h-regions of T. brucei alone, in multiple copies, or in different combinations contribute to signal peptide activity in T. brucei. It will also determine how the different h-motifs in two native signal peptides (VSG_1 17 and VSG_MVAT7) affect the ability of the proteins to enter the ER of a trypanosome.
Example 6 Drug Discovery With TbRM
The TbRM system of the present invention will advance our understanding of structure and function of trypanosome signal peptides that are
important for targeting of nutrient receptors, virulence factors, and variant surface antigens to the plasma membrane of the parasite.
Using the methods described in more detail in Example 2, which identified equisetin, CJ21,058, and MAL3-101 as new lead compounds for anti-trypanosome drug discovery, additional compounds will be screened, to identify additional lead compounds.
Example 7 Preparation of Microsomes From Other Parasitic Organisms
Using the methods described in more detail in Examples 1-6, for the preparation of microsomes from trypanosomes, microsomes will be prepared from other protozoan parasites, including, various Leishmania species, such as, for example, Leishmania major. Such microsomes may be used for the characterization of signaling sequences in the transport and translocation of proteins in protozoan parasites and in assays for the identification of lead compounds for the development of new drugs for the treatment and prevention of diseases caused by various parasitic organisms. The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PlR, PRF5 PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims. AU headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
Sequence Listing Free Text
SEQ ID NO: 1 -2 Synthetic oligonucleotide primers