EP2046808A2 - Methods and reagents for detecting hantavirus - Google Patents
Methods and reagents for detecting hantavirusInfo
- Publication number
- EP2046808A2 EP2046808A2 EP07836060A EP07836060A EP2046808A2 EP 2046808 A2 EP2046808 A2 EP 2046808A2 EP 07836060 A EP07836060 A EP 07836060A EP 07836060 A EP07836060 A EP 07836060A EP 2046808 A2 EP2046808 A2 EP 2046808A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- sequence
- seq
- primer
- probe
- forward primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/702—Specific hybridization probes for retroviruses
Definitions
- the present invention pertains generally to hantavirus and viral diagnostics.
- the invention relates to nucleic acids for use in the detection of hantavirus strains, including Hantaan (HTNV), Dobrava (DOBV), Seoul (SEOV), Puumala (PUUV), Sin Nombre (SNV), and Andes (ANDV).
- HTNV Hantaan
- DOBV Dobrava
- SEOV Seoul
- SEOV Dobrava
- PUUV Puumala
- SNV Sin Nombre
- ANDV Andes
- Hantaviruses are lipid -enveloped, minus-sense RNA viruses.
- the RNA of the viral genome is tripartite, consisting of three fragments generally designated as S, M and L for small, medium and large genome fragments, respectively.
- the M segment encodes a precursor protein that is processed to form the two envelope glycoproteins, termed Gl and G2.
- the S segment encodes a nucleocapsid protein, termed N which forms the filamentous helical nucleocapsid of the virus and elicits the humoral response.
- the L segment of the genome encodes an RNA-dependent RNA polymerase (RDRP).
- RDRP RNA-dependent RNA polymerase
- Hantavirus pulmonary syndrome also known as hantavirus cardiopulmonary syndrome (HCPS) is an acute febrile illness with up to a 50% mortality rate. Patients present with nonspecific symptoms and progress rapidly to fulminant pulmonary edema and cardiovascular collapse.
- SNV Sin Nombre virus
- SNV Sin Nombre virus
- HFRS-associated viruses include Hantaan (HTNV), Puumala (PUUV), Seoul (SEOV), and Dobrava-Belgrade (IX)BV) viruses (Lee et al., J. Infect. Dis. (1978) 137:298-308; Lee, et al., J. Infect. Dis. (1982) 146:638-644; Lee et al., J. Infect. Dis. (1982) 146:645-651 ; Brummer-Korvenkontio et al., J. Infect. Dis.
- HFRS nephropathia epidemica
- HFRS-associated hantaviruses HTNV, SEOV and DOBV are antigenically similar.
- the HCPS-associated viruses are also closely related to one another, and cross-react with PUUV. Antigenic cross-reactivity is most pronounced among the viral N proteins.
- the viral N antigen is dominant over the viral glycoproteins.
- Antibodies to the N antigen arise early in the course of infection and are universally detectable in convalescence. All persons with acute SNV infection have detectable antibodies against the SNV N antigen of the IgM class by the onset of clinical symptoms, and almost all have IgG antibodies directed against the N and Gl antigens (Bharadwaj et al., J.
- hantavirus All species of hantavirus appear to be primarily associated with a specific rodent host. There are three broad groups of hantaviruses and they are associated with the rodent subfamilies of Murinae, Arvicolinae and Sigmondontinae. The phylogenetic relations among rodents in these various subfamilies parallel, for the most part, the phylogenetic and antigenic relations of viruses associated with each particular reservoir. Each of these groups of hantaviruses contains one or more species or types that are known human pathogens. Information concerning the various hantaviruses is presented in Table 1.
- Antibodies may take days or weeks to develop from the time of infection and occasionally are not detectable in patient serum at times early enough to begin effective treatment.
- Assays for the hantavirus nucleic acids have been described (Garin et al. 2001 Microbes Infect. 3:739-745; Dekonenko et al. 1997 Clin. Diag. Virol. 8:1 13-121; Weidmann et al. J. Clin. Microbiol. 2005 43:808-812; Heiske et al. Kidney Intl 1999 55:2062-2069; Botten et al. Proc. Natl Acad Sci. 2000 97:10578-10583; Ahn et al. 2000 Clin Nephrol.
- nucleic acid diagnostic tests capable of efficiently detecting hantavirus in human specimens such as plasma, serum and respiratory secretions will assist the medical community in better diagnosing and treating hantavirus infections and maintaining the safety of the blood supply.
- the present invention is based on the development of sensitive, reliable nucleic acid-based diagnostic assays for the detection of hantaviruses in biological samples from potentially infected subjects.
- the invention provides methods and compositions for selectively detecting hantavirus strains Hantaan virus (HTNV), Dobrava virus (DOBV), Seoul virus (SEOV), Puumala virus (PUUV), Sin Nombre virus (SNV), and Andes virus (ANDV).
- the methods allow the rapid detection, in a single test, of hantavirus infection caused by one or several hantaviruses, such as caused by one or more strains of HTNV, DOBV, SEOV, PUUV, SNV, and ANDV.
- the methods can also be used to determine which hantavirus strains are present in a sample. If infection is detected and identified, the individual can be given appropriate treatment in adequate time to prevent serious illness. In addition, precautions could be taken to avoid the spread of the disease from infected individuals to the healthy population.
- the methods utilize sets of primers and, optionally, probes that are useful for amplifying and/or detecting target sequences of one or more hantavirus strains, to provide for the ability to detect single or multiple strains simultaneously in a single assay.
- the hantavirus sequences are detected using a fluorogenic 5' nuclease assay, such as the TaqMan technique.
- Other nucleic-acid based detection techniques such as but not limited to reverse transcriptase-polymerase chain reaction (RT- PCR) and transcription-mediated amplification (TMA), can also be used.
- infected individuals can be identified.
- the assays can be used to screen rodents and other animals, such as cats, dogs, pigs, cattle, and deer, for hantavirus infection in order to determine if a particular animal population is infected with the virus, thereby preventing infection in laboratory workers, field crews and others who work with and encounter such animals.
- infected blood samples can be detected and excluded from transfusion, as well as from the preparation of blood derivatives.
- a method for detecting hantavirus infection in a biological sample comprising: isolating a nucleic acid from a biological sample suspected of containing hantavirus nucleic acid, wherein if hantavirus nucleic acid is present, said nucleic acid comprises a target sequence; amplifying the nucleic acid using at least one set of oligonucleotide primers comprising a forward primer and a reverse primer capable of amplifying at least a portion of a hantavirus nucleic acid segment, wherein said primers are not more than about 40 nucleotides in length, wherein said set of primers is selected from the group consisting of:
- the detecting step is accomplished using at least one detectably labeled oligonucleotide probe sufficiently complementary to and capable of hybridizing with the hantavirus nucleic acid or amplicon thereof, if present, as an indication of the presence or absence of hantavirus in the sample.
- a strain specific probe is preferably used for detection of the amplified target.
- Preferred sets of primers and probes are selected from the group consisting of (a) a forward primer comprising the sequence of SEQ ID NO: 1 , a reverse primer comprising the sequence of SEQ ID NO:3, and a probe comprising the sequence of SEQ ID NO:2, (b) a forward primer comprising the sequence of SEQ ID NO:4, a reverse primer comprising the sequence of SEQ ID NO:6, and a probe comprising the sequence of SEQ ID NO.5, (c) a forward primer comprising the sequence of SEQ ID NO:7, a reverse primer comprising the sequence of SEQ ID NO:9, and a probe comprising the sequence of SEQ ID NO:8, (d) a forward primer comprising the sequence of SEQ ID NOrIO, a reverse primer comprising the sequence of SEQ ID NO: 12, and a probe comprising the sequence of SEQ ID NO:11, (e) a forward primer comprising the sequence of SEQ ID NO: 13, a reverse primer comprising the sequence of SEQ ID NO: 15, and a probe comprising
- the probe additionally comprises a detectable label, for example a fluorescent label selected from the group consisting of 6-carboxyfluorescein (FAM), tetramethyl rhodamine (TAMRA), 2', 4', 5', T- tetrachloro ⁇ -dichlorofluorescein (TET), Cy5, 6-carboxy-X-rhodamine (ROX); and CAL GOLD.
- FAM 6-carboxyfluorescein
- TAMRA tetramethyl rhodamine
- TET tetramethyl rhodamine
- ROX Cy5
- CAL GOLD 6-carboxyfluorescein
- the amplifying step generally uses a fluorogenic 5' nuclease assay (e.g., TaqMan), although Polymerase Chain Reaction (PCR), RT-PCR, transcription mediated amplification (TMA) or any other methods of amplification that utilize extension of oligonucleotide primers that hybridize to target sequence can be used, alone or in combination.
- a fluorogenic 5' nuclease assay e.g., TaqMan
- PCR Polymerase Chain Reaction
- RT-PCR RT-PCR
- transcription mediated amplification TMA or any other methods of amplification that utilize extension of oligonucleotide primers that hybridize to target sequence can be used, alone or in combination.
- the primer/probe sets described herein have been designed and optimized to work in combination with each other to provide minimal interference.
- a single set of strain specific primers and probe can be used in an assay to detect the specific strain, however, two or more sets of primers/probes are advantageously used together in a single assay where the identity of the hantavirus in the sample is unknown or where more than one hantavirus may be present.
- the invention also provides a kit comprising at least one set of hantavirus strain-specific primers wherein said primers are oligonucleotides that are each not more than about 40 nucleotides in length, wherein said set of primers is selected from the group consisting of:
- the kit may additionally contain a strain-specific probe for use with the corresponding strain-specific primer set, wherein said probe is an oligonucleotide not more than about 40 nucleotides in length and wherein the primer/probe sets are selected from the group consisting of:
- the probes maybe detectably labeled.
- the probes will comprise distinguishably different detectable labels, preferably, fluorescent labels.
- the kits may optionally comprise other components useful for amplifying and detecting nucleic acid targets, for example, enzymes (DNA polymerases, RNA polymerases, reverse transcriptases, RNases, etc), buffers, control templates, and the like.
- Figure 1 depicts exemplary primers and probes (SEQ ID NOS: 1-19) for amplification and detection of hantavirus RNA in a biological sample.
- Figure 2 depicts an exemplary nucleotide sequence from the S segment of hantavirus strain HTNV (SEQ ID NO:20) used in cloning and preparation of RNA for nucleic acid assays as described in Example 1.
- Figure 3 depicts an exemplary nucleotide sequence from the S segment of hantavirus strain PUUV (SEQ ID NO:21) used in cloning and preparation of RNA for nucleic acid assays as described in Example 1.
- Figure 4 depicts an exemplary nucleotide sequence from the S segment of hantavirus strain SEOV (SEQ ID NO:22) used in cloning and preparation of RNA for nucleic acid assays as described in Example 1.
- Figure 5 depicts an exemplary nucleotide sequence from the S segment of hantavirus strain DOBV (SEQ ID NO:23) used in cloning and preparation of RNA for nucleic acid assays as described in Example 1.
- Figure 6 depicts an exemplary nucleotide sequence from the S segment of hantavirus strain SNV(SEQ ID NO:24) used in cloning and preparation of RNA for nucleic acid assays as described in Example 1.
- Figure 7 depicts an exemplary nucleotide sequence from the S segment of hantavirus strain ANDV (SEQ ID NO:25) used in cloning and preparation of RNA for nucleic acid assays as described in Example 1.
- Figure 8 depicts an exemplary internal control sequence (SEQ ID NO:26) for use as a control for amplification of target nucleic acids. A region of the SNV nucleotide sequence was replaced with an internal control sequence as described in Example 1.
- Glutamic acid GIu (E)
- Glycine GIy (G)
- Threonine Thr (T) Tryptophan: Trp (W) Tyrosine: Tyr (Y) Valine: VaI (V)
- hantavirus refers to members of the Bunyaviridae family of enveloped, negative sense RNA viruses.
- the hantavirus genome comprises three RNA genome segments, designated as large (L), medium (M), and small (S) (Fields and Knipe (eds.) Fundamental Virology, 2nd edition, Raven Press, New York, NY, 1991).
- hantavirus may include any strain of hantavirus, which is capable of causing 5 disease (e.g., hemorrhagic fever with renal syndrome or hantavirus cardiopulmonary syndrome) in an animal or human subject.
- the term encompasses any strain of hantavirus associated with the rodent subfamilies of Murinae, Arvicolinae and Sigmondontinae, such as HTNV, DOBV, SEOV, PUUV, SNV, and ANDV, that causes disease in humans.
- a large number of hantavirus isolates have been partially or 0 completely sequenced. See, e.g., the GenBank database (website at ncbi.nlm.nih.gov), which contains complete sequences for hantavirus S, M and L genome segments.
- polypeptide and protein refer to a polymer of amino acid residues and are not limited to a minimum length of the product. Thus, peptides, oligopeptides, dimers, multimers, and the like, are included within the definition. Both full-length proteins and5 fragments thereof are encompassed by the definition.
- the terms also include postexpression modifications of the polypeptide, for example, glycosylation, acetylation, phosphorylation and the like.
- a "polypeptide” refers to a protein which includes modifications, such as deletions, additions and substitutions (generally conservative in nature), to the native sequence, so long as the0 protein maintains the desired activity.
- substantially purified generally refers to isolation of a substance (compound, polynucleotide, protein, polypeptide, polypeptide composition) such that the substance comprises the majority percent of the sample in which it resides.
- a substantially purified component comprises at least 50%, preferably at least 80%-85%, more preferably at least 90-95% of the sample.
- Techniques for purifying polynucleotides and polypeptides of interest are well-known in the art and include, for example, ion- exchange chromatography, affinity chromatography and sedimentation according to density.
- isolated is meant, when referring to a polypeptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macro-molecules of the same type.
- isolated with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated from the chromosome.
- “Homology” refers to the percent sequence identity between two polynucleotide or two polypeptide moieties.
- Two nucleic acid, or two polypeptide sequences are "substantially homologous" to each other when the sequences exhibit at least about 50% sequence identity, preferably at least about 75% sequence identity, more preferably at least about 80%-85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95%-98% sequence identity over a defined length of the molecules.
- substantially homologous also refers to sequences showing complete identity to the specified sequence.
- identity refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Percent identity can be determined by a direct comparison of the sequence information between two molecules (a test and a reference) by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the reference sequence, and multiplying the result by 100. Readily available computer programs can be used to aid in the analysis, such as ALIGN, Dayhoff, M.O. in Atlas of Protein Sequence and Structure M.O. Dayhoff ed., 5 Suppl.
- nucleotide sequence identity is available in the Wisconsin Sequence Analysis Package, Version 8 (available from Genetics Computer Group, Madison, WI) for example, the BESTFIT, FASTA and GAP programs, which also rely on the Smith and Waterman algorithm. These programs are readily utilized with the default parameters recommended by the manufacturer and described in the Wisconsin Sequence Analysis Package referred to above. For example, percent identity of a particular nucleotide sequence to a reference sequence can be determined using the homology algorithm of Smith and Waterman with a default scoring table and a gap penalty of six nucleotide positions.
- Another method of establishing percent identity in the context of the present invention is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by Intel liGenetics, Inc. (Mountain View, CA). From this suite of packages the Smith- Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated the "Match" value reflects "sequence identity.”
- Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters.
- homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments.
- DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.
- polynucleotide oligonucleotide
- nucleic acid nucleic acid molecule
- polynucleotide oligonucleotide
- nucleic acid molecule a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, the term includes triple-, double- and single-stranded DNA, as well as triple-, double- and single-stranded RNA. It also includes modifications, such as by methylation and/or by capping, and unmodified forms of the polynucleotide.
- polynucleotide examples include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing nonnucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids (PNAs)) and polymorpholino (commercially available from the Anti-Virals, Inc., Corvallis, Oregon, as Neugene) polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA.
- PNAs peptide nucleic acids
- polynucleotide oligonucleotide
- nucleic acid nucleic acid molecule
- these terms include, for example, 3'-deoxy-2',5'-DNA, oligodeoxyribonucleotide N3 1 P5' phosphoramidates, 2'-O-alkyl-substituted RNA, double- and single-stranded DNA, as well as double- and single-stranded RNA, DNArRNA hybrids, and hybrids between PNAs and DNA or RNA, and also include known types of modifications, for example, labels which are known in the art, methylation, "caps," substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates
- a hantavirus polynucleotide, oligonucleotide, nucleic acid and nucleic acid molecule, as defined above, is a nucleic acid molecule derived from a hantavirus, including, without limitation, any of the various species of hantavirus, including strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV.
- the molecule need not be physically derived from the particular isolate in question, but may be synthetically or recombinantly produced.
- Nucleic acid sequences for a number of hantavirus isolates are known. Representative sequences, including sequences of the S, M, and L RNA genome segments from hantavirus isolates found in various species of rodents, humans, and other mammals are listed in the National Center for Biotechnology Information (NCBI) database. See, for example, GenBank entries: Seoul virus 80-39 segment M, GenBank Accession No. NC 005237; Seoul virus 80-39 glycoprotein precusor gene, GenBank Accession No. S47716; Dobrava virus segment L, GenBank Accession No. NC_005235; Dobrava virus segment M, GenBank Accession No. NC_005234; Dobrava virus segment S, GenBank Accession No.
- NCBI National Center for Biotechnology Information
- a polynucleotide "derived from" a designated sequence refers to a polynucleotide sequence which comprises a contiguous sequence of approximately at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10-12 nucleotides, and even more preferably at least about 15-20 nucleotides corresponding, i.e., identical or complementary to, a region of the designated nucleotide sequence.
- the derived polynucleotide will not necessarily be derived physically from the nucleotide sequence of interest, but may be generated in any manner, including, but not limited to, chemical synthesis, replication, reverse transcription or transcription, which is based on the information provided by the sequence of bases in the region(s) from which the polynucleotide is derived. As such, it may represent either a sense or an antisense orientation of the original polynucleotide.
- Recombinant as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation is not associated with all or a portion of the polynucleotide with which it is associated in nature.
- the term "recombinant” as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide.
- the gene of interest is cloned and then expressed in transformed organisms, as described further below. The host organism expresses the foreign gene to produce the protein under expression conditions.
- a "solid support” refers to a solid surface such as a magnetic bead, latex bead, microtiter plate well, glass plate, nylon, agarose, acrylamide, and the like.
- a "DNA-dependent DNA polymerase” is an enzyme that synthesizes a complementary DNA copy from a DNA template. Examples are DNA polymerase I from E. coli and bacteriophage T7 DNA polymerase. All known DNA-dependent DNA polymerases require a complementary primer to initiate synthesis. Under suitable conditions, a DNA-dependent DNA polymerase may synthesize a complementary DNA copy from an RNA template.
- a "DNA-dependent RNA polymerase” or a “transcriptase” is an enzyme that synthesizes multiple RNA copies from a double-stranded or partially-double stranded DNA molecule having a (usually double-stranded) promoter sequence.
- the RNA molecules ("transcripts") are synthesized in the 5' to 3' direction beginning at a specific position just downstream of the promoter. Examples of transcriptases are the DNA-dependent RNA polymerase from E. coli and bacteriophages T7, T3, and SP6.
- RNA-dependent DNA polymerase or "reverse transcriptase” is an enzyme that synthesizes a complementary DNA copy from an RNA template. All known reverse transcriptases also have the ability to make a complementary DNA copy from a DNA template; thus, they are both RNA- and DNA-dependent DNA polymerases. A primer is required to initiate synthesis with both RNA and DNA templates.
- RNAse H is an enzyme that degrades the RNA portion of an RNA:DNA duplex. These enzymes may be endonucleases or exonucleases. Most reverse transcriptase enzymes normally contain an RNAse H activity in addition to their polymerase activity. However, other sources of the RNAse H are available without an associated polymerase activity. The degradation may result in separation of RNA from a RNA:DNA complex. Alternatively, the RNAse H may simply cut the RNA at various locations such that portions of the RNA melt off or permit enzymes to unwind portions of the RNA.
- target nucleic acid region or “target nucleic acid” denotes a nucleic acid molecule with a “target sequence” to be amplified.
- the target nucleic acid may be either single-stranded or double-stranded and may include other sequences besides the target sequence, which may not be amplified.
- target sequence refers to the particular nucleotide sequence of the target nucleic acid which is to be amplified.
- the target sequence may include a probe-hybridizing region contained within the target molecule with which a probe will form a stable hybrid under desired conditions.
- target sequence may also include the complexing sequences to which the oligonucleotide primers complex and extended using the target sequence as a template.
- target sequence also refers to the sequence complementary to the "target sequence” as present in the target nucleic acid. If the "target nucleic acid” is originally double-stranded, the term “target sequence” refers to both the plus (+) and minus (-) strands (or sense and anti-sense strands).
- primer refers to an oligonucleotide that hybridizes to the template strand of a nucleic acid and serves as an initiation point for synthesis of a nucleic acid strand complementary to the template strand when placed under conditions in which synthesis of a primer extension product is induced, i.e., in the presence of nucleotides and a polymerization-inducing agent such as a DNA or RNA polymerase and at suitable temperature, pH, metal concentration, and salt concentration.
- the primer is preferably single-stranded for maximum efficiency in amplification, but may alternatively be double-stranded.
- the primer can first be treated to separate its strands before being used to prepare extension products. This denaturation step is typically effected by heat, but may alternatively be carried out using alkali, followed by neutralization.
- a "primer" is complementary to a template, and complexes by hydrogen bonding or hybridization with the template to give a primer/template complex for initiation of synthesis by a polymerase, which is extended by the addition of covalently bonded bases linked at its 3' end complementary to the template in the process of DNA or RNA synthesis.
- hantavirus nucleic acids are amplified using at least one set of oligonucleotide primers comprising at least one "forward" primer and at least one "reverse” primer capable of hybridizing to regions of a hantavirus nucleic acid flanking the portion of the hantavirus nucleic acid to be amplified.
- a forward primer is in the 5' to 3 1 orientation complementary to the hantavirus negative sense genomic RNA strand.
- a reverse primer is in the reverse complement orientation and complementary to the antigenomic hantavirus template produced during replication or amplification of hantavirus nucleic acids.
- amplicon refers to the amplified nucleic acid product of a PCR reaction or other nucleic acid amplification process (e.g., ligase chain reaction (LGR), nucleic acid sequence based amplification (NASBA), transcription-mediated amplification (TMA), Q- beta amplification, strand displacement amplification).
- LGR ligase chain reaction
- NASBA nucleic acid sequence based amplification
- TMA transcription-mediated amplification
- Q- beta amplification strand displacement amplification
- Amplicons may comprise RNA or DNA depending on the technique used for amplification. For example, DNA amplicons may be generated by PCR or RT-PCR, whereas RNA amplicons may be generated by TMA or NASBA.
- probe or “oligonucleotide probe” refers to a polynucleotide, as defined above, that contains a nucleic acid sequence complementary to a nucleic acid sequence present in the target nucleic acid analyte or the amplicon produced by amplification of the target.
- the polynucleotide regions of probes may be composed of DNA, and/or RNA, and/or synthetic nucleotide analogs. Probes may be labeled in order to detect the target sequence. Such a label may be present at the 5' end, at the 3' end, at both the 5' and 3' ends, and/or internally.
- the probe when an "oligonucleotide probe" is to be used in a fluorogenic 5' nuclease assay, such as the TaqMan technique, the probe will typically contain at least one fluorescer and at least one quencher which is removed by the endonuclease or exonuclease activity of a polymerase used in the reaction in order to detect any amplified target oligonucleotide sequences.
- the oligonucleotide probe will have a sufficient number of phosphodiester linkages adjacent to its 5' end so that the 5' to 3' nuclease activity employed can efficiently degrade the bound probe to separate the fluorescers and quenchers.
- the oligonucleotide probe will typically be derived from a sequence that lies between the regions of the target hybridizing to the forward and the reverse primers when used in a 5' nuclease assay.
- an oligonucleotide probe is used in the TMA technique, it will be suitably labeled, as described below.
- capture oligonucleotide refers to an oligonucleotide that contains a nucleic acid sequence complementary to a nucleic acid sequence present in the target nucleic acid analyte such that the capture oligonucleotide can "capture” the target nucleic acid.
- One or more capture oligonucleotides can be used in order to capture the target analyte.
- the polynucleotide regions of a capture oligonucleotide may be composed of DNA, and/or RNA, and/or synthetic nucleotide analogs.
- capture is meant that the analyte can be separated from other components of the sample by virtue of the binding of the capture molecule to the analyte.
- the capture molecule is associated with a solid support, either directly or indirectly.
- hybridizing sequences need not have perfect complementarity to provide stable hybrids. In many situations, stable hybrids will form where fewer than about 10% of the bases are mismatches, ignoring loops of four or more nucleotides. Accordingly, as used herein the term “complementary” refers to an oligonucleotide that forms a stable duplex with its "complement” under assay conditions, generally where there is about 90% or greater homology.
- hybridize and “hybridization” refer to the formation of complexes between nucleotide sequences which are sufficiently complementary to form complexes via Watson-Crick like base pairing.
- target template
- hybridizes with target (template)
- target template
- hybrids are sufficiently stable to serve the priming function required by, e.g., the DNA polymerase to initiate DNA synthesis.
- multiplexing herein refers to an assay or other analytical method in which uses more than one probe, each probe having a distinguishably different detectable label to detect one or more unknown targets in a single test.
- distinguishably different detectable label is meant that the signal from each label is distinguishable and uniquely identifiable from each of the other labels.
- each of the distinguishably different detectable labels has at least one different fluorescence characteristic (for example excitation wavelength, emission wavelength, emission intensity, FWHM (full width at half maximum peak height), or fluorescence lifetime) from each of the other labels.
- fluorescence characteristic for example excitation wavelength, emission wavelength, emission intensity, FWHM (full width at half maximum peak height), or fluorescence lifetime
- binding pair refers to first and second molecules that specifically bind to each other, such as complementary polynucleotide pairs capable of forming nucleic acid duplexes. "Specific binding" of the first member of the binding pair to the second member of the binding pair in a sample is evidenced by the binding of the first member to the second member, or vice versa, with greater affinity and specificity than to other components in the sample. The binding between the members of the binding pair is typically noncovalent
- selective bind is meant that the molecule binds preferentially to the target of interest or binds with greater affinity to the target than to other molecules.
- a DNA molecule will bind to a substantially complementary sequence and not to unrelated sequences.
- An oligonucleotide that "selectively binds" to or is “selective for" a particular type of hantavirus such as a particular strain of hantavirus (e.g., HTNV, DOBV, SEOV, PUUV, SNV, and ANDV), denotes an oligonucleotide, e.g., a primer, probe or a capture oligonucleotide, that binds to the particular type of hantavirus, but does not bind to a sequence from other strains of hantavirus under the same conditions .
- a particular strain of hantavirus e.g., HTNV, DOBV, SEOV, PUUV, SNV, and ANDV
- telomeres e.g., telomeres
- oligonucleotides e.g., primers, probes and/or capture oligonucleotides that are capable of detecting a particular hantavirus nucleic acid, for example, by amplifying and/or binding to at least a portion of an RNA segment from a particular type of hantavirus, such as a particular hantavirus strain (e.g., HTNV, DOBV, SEOV, PUUV, SNV, and ANDV), but that do not amplify and/or bind to sequences from other strains of hantaviruses under the same hybridization conditions.
- a particular hantavirus strain e.g., HTNV, DOBV, SEOV, PUUV, SNV, and ANDV
- the "melting temperature” or “Tm” of double-stranded DNA is defined as the temperature at which half of the helical structure of DNA is lost due to heating or other dissociation of the hydrogen bonding between base pairs, for example, by acid or alkali treatment, or the like.
- the T n of a DNA molecule depends on its length and on its base composition. DNA molecules rich in GC base pairs have a higher T n , than those having an abundance of AT base pairs. Separated complementary strands of DNA spontaneously reassociate or anneal to form duplex DNA when the temperature is lowered below the T m . The highest rate of nucleic acid hybridization occurs approximately 25 degrees C below the T m .
- a "biological sample” refers to a sample of tissue or fluid isolated from a subject, including but not limited to, for example, blood, plasma, serum, fecal matter, urine, bone marrow, bile, spinal fluid, lymph fluid, samples of the skin, external secretions of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, organs, biopsies and also samples of w? vitro cell culture constituents including but not limited to conditioned media resulting from the growth of cells and tissues in culture medium, e.g., recombinant cells, and cell components.
- hantavirus may be obtained from biological samples such as blood, plasma, serum, fecal matter, urine, or lung tissue from an individual infected with the virus.
- label and “detectable label” refer to a molecule capable of detection, including, but not limited to, radioactive isotopes, fluorescers, chemiluminescers, chromophores, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, semiconductor nanoparticles, dyes, metal ions, metal sols, ligands (e.g., biotin, strepavidin or haptens) and the like.
- fluorescer refers to a substance or a portion thereof which is capable of exhibiting fluorescence in the detectable range.
- Particular examples of labels which may be used under the invention include, but are not limited to, horse radish peroxidase (HRP), SYBR® green, SYBR® gold, fluorescein,
- FITC rhodamine
- dansyl rhodamine
- umbelliferone dimethyl acridinium ester
- Texas red 6-carboxyfluorescein
- TAMRA tetramethyl rhodamine
- TET T- tetrachloro- 4-7-dichIorofluorescein
- Cy5 CAL GOLD, luminol, NADPH and ⁇ - ⁇ - galactosidase.
- vertebrate subject any member of the subphylum chordata, including, without limitation, humans and other primates, including non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs; birds, including domestic, wild and game birds such as chickens, turkeys and other gallinaceous birds, ducks, geese, and the like.
- the term does not denote a particular age. Thus, both adult and newborn individuals are intended to be covered.
- the present invention is based on the discovery of reagents and methods for diagnosing infection caused by hantaviruses, including the human pathogenic hantaviruses (e.g., strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV) by the detection of hantavirus nucleic acids.
- the methods are useful for detecting hantavirus in biological samples such as saliva, sputum, or blood samples, including without limitation, in whole blood, serum and plasma.
- the methods can be used to diagnose hantavirus infection in a subject, as well as to detect hantavirus contamination in donated blood samples.
- Aliquots from individual donated samples or pooled samples can be screened for the presence of hantavirus and those samples or pooled samples contaminated with hantavirus can be eliminated before they are combined. In this way, a blood supply substantially free of hantavirus contamination can be provided.
- the methods use oligonucleotide reagents (e.g., oligonucleotide primers, probes, and optionally capture oligonucleotides) or a combination of reagents capable of detecting and identifying one or more pathogenic hantaviruses in a single multiplex assay.
- sets of primer pairs i.e., a forward primer and reverse primer
- probes are highly selective for a particular hantavirus, and are capable of selectively amplifying and/or detecting and/or binding to a particular RNA segment, or an amplicon produced therefrom, from one of the hantavirus strains (e.g., strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV).
- hantavirus strains e.g., strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV.
- These highly selective primers, probes, and optionally capture oligonucleotides can be used alone or in combination to detect and discriminate one or more hantaviruses in a single assay.
- the nucleic acid from one or more strains can be amplified and detected simultaneously by using a combination of sets of strain-specific primers and probes in a multiplex-type assay format.
- a plurality of primers and probes can be used to amplify and detect one or more pathogenic and non-pathogenic strains.
- the presence of the amplified nucleic acids can be detected using a plurality of detectably labeled oligonucleotide probes, each probe having a distinguishably different detectable label, wherein each probe selectively hybridizes to the RNA or amplicon thereof from one strain of hantavirus, if present, as an indication of the presence or absence of that hantavirus strain in the sample.
- a single pathogenic strain e.g., HTNV, DOBV, SEOV, PUUV, SNV, and ANDV
- strain-specific primers can be amplified with strain-specific primers and detected with the corresponding strain-specific probes.
- the probes and primers may be designed from conserved nucleotide regions of the polynucleotides of interest or from non-conserved nucleotide regions of the polynucleotide of interest.
- nucleic acid probes are developed from non-conserved or unique regions when maximum specificity is desired, and nucleic acid probes are developed from conserved regions when assaying for nucleotide regions that are closely related to, for example, different hantavirus isolates.
- Oligonucleotides for use in the assays described herein can be derived from any of the various regions of the hantavirus genome, including from any of the three segments S, M, or L.
- the primers and probes are derived from sequences of the S genome segment. Representative sequences from hantavirus isolates found in various species of rodents, humans, and other mammals are listed herein.
- primers, probes and capture oligonucleotides for use in hantavirus detection include those derived from one or more of the three genomic segments from any pathogenic hantavirus strain or isolate.
- NCBI National Center for Biotechnology Information
- NC_005218 Hantaan virus segment L, GenBank Accession No. NC_005222; Seoul virus segment L, GenBank Accession No. NC_005238; Seoul virus strain 80-39 segment S, GenBank Accession No. NC_005236; Sin Nombre virus segment M, GenBank Accession No. NC_OO5215; Sin Nombre virus, GenBank Accession No. NC_005217; Sin Nombre virus segment S, GenBank Accession No. NC_005216; Puumala virus segment L, GenBank Accession No. NC 005225; Puumala virus segment S, GenBank Accession No. NC_005224; Puumala virus segment M, GenBank Accession No. NC_005223; Andes virus segment L, GenBank Accession No.
- multiple sets of primers and probes are used, each set being selective for a different hantavirus strain.
- a set of primers comprising a forward primer comprising the sequence of SEQ ID NO: 1 and a reverse primer comprising the sequence of SEQ ID NO:3 (HTNV primers) is preferred;
- a set of primers comprising a forward primer comprising the sequence of SEQ ID NO:4 and a reverse primer comprising the sequence of SEQ ID NO:6 (PUUV primers) is preferred;
- PUUV primers for the detection of Seoul virus
- a set of primers comprising a forward primer comprising the sequence of SEQ ID NO:7 and a reverse primer comprising the sequence of SEQ ID NO:9 SEOV primers
- Dobrava virus a set of primers comprising a forward primer comprising the sequence of SEQ ID NO: 10 and a reverse primer comprising the sequence of SEQ ID NO: 12
- the selective primers sets described above can be used singly (i.e., a single set of primers) or can preferably be used in combinations of 2, 3, 4, 5 or 6 primer sets to amplify hantavirus nucleic acid targets.
- the amplified targets can be detected by conventional techniques, for example, gel electrophoresis, ethidium bromide staining, Southern blotting, melting curve analysis using intercalating dyes, hybridization with specific labeled probes, etc.
- gel electrophoresis for example, gel electrophoresis, ethidium bromide staining, Southern blotting, melting curve analysis using intercalating dyes, hybridization with specific labeled probes, etc.
- the presence in the sample of nucleic acid from any of the hantavirus strains corresponding to the selective primer sets used will produce a positive signal. This is suitable for analysis of samples for which it is desired only to determine the presence of a hantavirus from among the group HTNV, PUUV, SEOV
- the strain-specific primer sets described above are used with strain-specific probes.
- the strain specific probes are provided with distinguishably different detectable labels.
- a set of primers and probe comprising a forward primer comprising the sequence of SEQ ID NO:1 a reverse primer comprising the sequence of SEQ ID NO:3, and a probe comprising the sequence of SEQ ID NO:2 (HTNV primer/probe set) is preferred;
- a set of primers and probe comprising a forward primer comprising the sequence of SEQ ID NO:4, a reverse primer comprising the sequence of SEQ ID NO:6, and a probe comprising SEQ ID NO:5 PUUV primer/probe set
- Seoul virus nucleic acid a set of primers and probe comprising a forward primer comprising the sequence of SEQ
- the strain specific primer/probe sets can be used singly or preferably are used in combinations of 2, 3, 4, 5, or 6 primer/probe sets in a multiplex assay.
- the particular sets used will depend on the particular strain or strains of hantavirus that are suspected to be present in the sample. In situations in which there is little information on the hantavirus present, the use of all or most of the above primer/probe sets in combination will provide the greatest chance of identifying the particular hantavirus(es) in the sample.
- using a combination of all 6 strain-specific primer/probe sets in the methods described herein it is possible to detect the presence and determine the identity of any of six of the most prevalent pathogenic hantavirus strains.
- Primers, probes and capture oligonucleotides for use in the assays herein are derived from these sequences and are readily synthesized by standard techniques, e.g., solid phase synthesis via phosphoramidite chemistry, as disclosed in U.S. Patent Nos. 4,458,066 and 4,415,732, incorporated herein by reference; Beaucage et al., Tetrahedron (1992) 48:2223-231 1; and Applied Biosystems User Bulletin No. 13 (1 April 1987).
- Other chemical synthesis methods include, for example, the phosphotriester method described by Narang et al., Meth. Enzymol. (1979) 68:90 and the phosphodiester method disclosed by Brown et al., Meth. Enzymol.
- the primer oligonucleotides are in the range of between 10-100 nucleotides in length, such as between IS and 60, between 20 and 40 and so on, more typically in the range of between 17 and 30 nucleotides long, and any length between the stated ranges.
- a primer oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 18, and SEQ ID NO: 19; or a fragment thereof comprising at least about 6 contiguous nucleotides, preferably at least about 8 contiguous nucleotides, more preferably at least about 10, 11, 12, 13 or 14 contiguous nucleotides, and even more preferably at least about 15, 16, 17, 18, 19, or 20 contiguous nucleotides; or a variant thereof comprising a sequence having at least about 80-100% sequence identity thereto, including any percent identity within this range, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91,
- the primer comprises nucleotides in addition to those nucleotides in the specified SEQ ID NOs
- the additional nucleotides will be present at the 5' end of the primer oligonucleotide.
- the sequence at the 3' end of the oligonucleotide primer (which is the end that is extended during the amplification/polymerase reaction) is preferably the sequence of the recited SEQ ID NOs.
- a set of two primers is used, one primer capable of hybridizing to each strand and of being extended from the 3' end in a direction toward the hybridization site of the other primer.
- the primers in a set are often referred to, inter alia, as the "forward” and “reverse” primers or the "sense” and “anti-sense” primers.
- the preferred primer sets comprise the following combinations of primers: (a) a forward primer comprising the sequence of SEQ ID NO:1 and a reverse primer comprising the sequence of SEQ ID NO:3, (b) a forward primer comprising the sequence of SEQ ID NO:4 and a reverse primer comprising the sequence of SEQ ID NO:6, (c) a forward primer comprising the sequence of SEQ ID NO:7 and a reverse primer comprising the sequence of SEQ ID NO:9, (d) a forward primer comprising the sequence of SEQ ID NO: 10 and a reverse primer comprising the sequence of SEQ ID NO: 12, (e) a forward primer comprising the sequence of SEQ ID NO: 13 and a reverse primer comprising the sequence of SEQ ID NO: 15, (f) a forward primer comprising the sequence of SEQ ID NO: 16 and a reverse primers
- a probe oligonucleotide is in the range of between 10-100 nucleotides long, such as between 10 and 60, preferably between 15 and 40, more preferably between 20 and 35, and any length between the stated ranges.
- a probe oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO: 14, and SEQ ID NO: 17; or a fragment thereof comprising at least about 6 contiguous nucleotides, preferably at least about 8 contiguous nucleotides, more preferably at least about 10, 1 1, 12, 13 or 14 contiguous nucleotides, and even more preferably at least about 15, 16, 17, 18, 19, or 20 contiguous nucleotides; or a variant thereof comprising a sequence having at least about 80- 100% sequence identity thereto, including any percent identity within this range, such as 81, 82, 83, 84, 85, 86, 87
- the probes are preferably used in combination with one or more pairs of primers. It will be apparent to one of skill in the art that the probe selected will be derived from the same hantaviral strain as the primer set used for the amplifying step. In a positive sample, the probe will hybridize with the amplicon produced in the amplification reaction using the related primer pair (i.e., the primer pair that is specific to the same hantavirus strain).
- Preferred combinations of probes and primers include (a) a primer comprising the sequence of SEQ ID NO:1, a primer comprising the sequence of SEQ ID NO:3, and a probe comprising the sequence of SEQ ID NO:2, (b) a primer comprising the sequence of SEQ ID NO:4, a primer comprising the sequence of SEQ ID NO:6, and a probe comprising the sequence of SEQ ID NO:5, (c) a primer comprising the sequence of SEQ ID NO:7, a primer comprising the sequence of SEQ ID NO:9, and a probe comprising the sequence of SEQ ID NO:8, (d) a primer comprising the sequence of SEQ ID NO: 10, a primer comprising the sequence of SEQ ID NO: 12, and a probe comprising the sequence of SEQ ID NO:1 1, (e) a primer comprising the sequence of SEQ ID NO: 13, a primer comprising the sequence of SEQ ID NO: 15, and a probe comprising the sequence of SEQ ID NO: 14, and (f) a primer comprising the sequence
- the oligonucleotides may be coupled to labels for detection.
- labels for detection There are several means known for derivatizing S oligonucleotides with reactive functionalities which permit the addition of a label.
- biotinylating probes so that radioactive, fluorescent, chemiluminescent, enzymatic, or electron dense labels can be attached via avidin. See, e.g., Broken et al., Nucl. Acids Res. (1978) 5:363-384 which discloses the use of ferritin-avidin-biotin labels; and Chollet et al., Nucl. Acids Res.
- oligonucleotides may be fluorescently labeled by linking a fluorescent molecule to the non-ligating terminus of the molecule.
- Guidance for selecting appropriate fluorescent labels can be found in Smith et al., Meth. Enzymol. (1987)5 155:260-301 ; Karger et al., Nucl. Acids Res. (1991) 19:4955-4962; Haugland (1989) Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Inc., Eugene, OR).
- Suitable fluorescent labels include fluorescein and derivatives thereof, such as disclosed in U.S. Patent No. 4,318,846 and Lee et al., Cytometry (1989) K): 151-164.
- Dyes for use in the present invention include 3-phenyl-7-isocyanatocoumarin, acridines,0 such as 9-isothiocyanatoacridine and acridine orange, pyrenes, benzoxadiazoles, and stilbenes, such as disclosed in U.S. Patent No.4, 174,384.
- Additional dyes include SYBR® green, SYBR® gold, Yakima YellowTM, Texas Red®, 3-( ⁇ -carboxypentyl)-3'-ethyl-5,5'- dimethyloxa-carbocyanine (CYA); 6-carboxy fluorescein (FAM); 5,6-carboxyrhodamine- 1 10 (Rl 10); 6-carboxyrhodamtne-6G (R6G); N',N',N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); 6-carboxy-X-rhodamine (ROX); 2', 4', 5', T, - tetrachloro-4-7- dichlorofluorescein (TET); 2 ⁇ T- dimethoxy - 4', 5'- 6 carboxyrhodamine (JOE); 6- carboxy ⁇ ' ⁇ '.S'JJ'-hexachlorofluorescein (HEX); ALEXA
- Preferred fluorescent labels for use with the present invention include fluorescein and derivatives thereof, such as disclosed in U.S. Patent No.4,318,846 and Lee et al., Cytometry (1989) 10:151-164, and FAM, CAL GOLD, Cy5, JOE, TAMRA 5 ROX, HEX-I, HEX-2, ZOE, TET-I or NAN-2, and the like.
- the label chosen will be distinguishably different from each other.
- this will take the form of a distinguishable excitation or emission spectrum, such that the particular label present in the probe(s) that hybridizes to the ampHcon(s) produced can be identified and thus the hantavirus(es) present in the sample can be indentified.
- Oligonucleotides can also be labeled with a minor groove binding (MGB) molecule, such as disclosed in U.S. Patent No. 6,884,584, U.S. Patent No. 5,801,155; Afonina et al. (2002) Biotechniques 32:940-944, 946-949; Lopez-Andreo et al. (2005) Anal. Biochem. 339:73-82; and Belousov et al. (2004) Hum Genomics 1 :209-217.
- MGB minor groove binding
- oligonucleotides can be labeled with an acridinium ester (AE) using the techniques described below.
- AE acridinium ester
- Current technologies allow the AE label to be placed at any location within the probe. See, e.g., Nelson et al., (1995) "Detection of Acridinium Esters by Chemiluminescence” in Nonisotopic Probing, Blotting and Sequencing, Kricka L.J.(ed) Academic Press, San Diego, CA; Nelson et al. (1994) "Application of the Hybridization Protection Assay (HPA) to PCR” in The Polymerase Chain Reaction, Mullis et al. (eds.) Birkhauser, Boston, MA; Weeks et al., Clin.
- HPA Hybridization Protection Assay
- hantavirus probes and primers derived from the S segments of hantavirus strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV for use in the various assays are shown in Example 4 in Table 2.
- the oligonucleotides labeled as HTNV, DOBV, SEOV, PUUV, SNV, and ANDV-specific are oligonucleotides that selectively amplify, detect, and/or hybridize to HTNV, DOBV, SEOV, PUUV, SNV, and ANDV nucleic acids, respectively, and can therefore be used to specifically identify these viruses in the assays described herein.
- the specific primer and probe sets can be used in combinations of 2, 3, 4, 5 or 6 sets.
- each probe has a distinguishably different label such that the particular strain of hantaviral target being amplified is immediately apparent by the probe label that appears.
- HTNV-specific oligonucleotides that is, primers and probes
- DOBV-specific oligonucleotides could be used in combination with DOBV-specific oligonucleotides in order to determine the presence of either HTNV or DOBV using a single test.
- SEOV- specific oligonucleotides, PUUV-specif ⁇ c oligonucleotides, and HTNV-specific oligonucleotides could be used in combination in order to determine the presence of SEOV, PUUV or HTNV using a single test.
- ANDV-specific oligonucleotides, PUUV-specif ⁇ c oligonucleotides, and HTNV-specific oligonucleotides could be used in combination in order to test for the presence of ANDV, PUUV or HTNV in a single assay.
- DOBV-specific oligonucleotides, PUUV-specific oligonucleotides, and ANDV-specific oligonucleotides could be used in combination in order to test for the presence of DOBV, PUUV or ANDV in a single assay.
- HTNV-specific oligonucleotides, SNV-specific oligonucleotides, and PUUV-specific oligonucleotides could be used in combination in order to test for the presence of HTNV, SNV or PUUV in a single assay.
- strain specific primers and probes from all six hantavirus strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV could be used in combination in order to test for the presence of any of these strains in a single assay.
- the above combinations are illustrative only and not intended to be limiting. The skilled practicioner could readily determine other useful combinations of the primer pairs and probe sets.
- oligonucleotide primers oligonucleotide probes and capture oligonucleotides
- primers oligonucleotides designated as primers herein
- probes may be used as primers or capture oligonucleotides.
- primers oligonucleotides designated as primers herein
- probes may be used as primers or capture oligonucleotides.
- primers may be used as probes or capture oligonucleotides
- probes may be used as primers or capture oligonucleotides.
- One of skill in the art can readily determine appropriate primer and probe pairs, and optionally capture oligonucleotides, to use in order to detect hantavirus infection.
- the present invention provides a method of detecting a hantavirus infection in a subject by detecting the presence of hantavirus nucleic acid, primarily hantavirus RNA, in a biological sample from said subject.
- the method provides the steps of isolating the nucleic acids from the sample, amplifying the nucleic acids by contacting the nucleic acids with one or more sets of forward and reverse primer pairs as described herein, and detecting the amplified nucleic acid, if present.
- the nucleic acids are isolated from the sample by any suitable method. Many such methods are well-known in the art and can readily be determined by one of ordinary skill! in the art. One preferred method is described in US Patent No. 5,234,809.
- This method uses a silica reagent in the presence of a chaotropic compound to bind nucleic acid.
- An improved version of this method uses magnetized silica, which can be readily separated with the bound nucleic acid from the rest of the sample components. Kits for isolation of nucleic acid for biological samples are available from numerous manufacturers and any of these will be suitable for use in the present method.
- the amplifying of the isolated nucleic acid is accomplished by any of a number of well-known amplification methods, for example, polymerase chain reaction (PCR), reverse transcriptase PCR (RT-PCR), transcription mediated amplification, NASBA, and the like.
- amplification technique is the TaqMan method which uses a polymerase that also has 5' nuclease activity in conjunction with probes labeled with a fluorescer and a quencher (See, e.g., Holland et al 1991 Proc. Natl Acad. Sci. 88:7276; Heid et al. 1996 Genome Res. 6:986).
- Use of the TaqMan technique provides for both amplification and detection.
- strain-specific sets of forward primers and reverse primers for amplifying each of HTNV, PUUV, DOBV, SEOV, ANDV and SNV nucleic acids have been described herein.
- the strain-specific primer sets will selectively amplify the nucleic acid from the hantavirus strain for which it was designed and not from other hantavirus strains.
- the amplified nucleic acid if present, can be detected by a nonspecific detection method, such as ethidium bromide staining, or may be detected by the binding of a strain-specific probe.
- the amplified nucleic acid will be detected by the binding of a strain-specific probe.
- a nucleic acid probe When utilizing a hybridization-based detection system, a nucleic acid probe is chosen that is complementary to a target nucleic acid sequence. By selection of appropriate conditions, the probe and the target sequence “selectively hybridize,” or bind, to each other to form a hybrid molecule.
- An oligonucleotide that "selectively hybridizes" to a particular hantavirus sequence from a particular hantavirus strain denotes an oligonucleotide, e.g., a primer, probe or a capture oligonucleotide, that binds to the hantavirus sequence of that particular strain but does not bind to a sequence from a hantavirus of a different strain.
- a nucleic acid molecule is capable of binding selectively to a target sequence under moderately stringent hybridization conditions.
- moderately stringent hybridization conditions allow detection of a target nucleic acid sequence of at least 14 nucleotides in length having at least approximately 70% sequence identity with the sequence of the selected nucleic acid probe.
- selective hybridization is performed under stringent hybridization conditions.
- Stringent hybridization conditions allow detection of target nucleic acid sequences of at least 14 nucleotides in length having a sequence identity of greater than 90% with the sequence of the selected nucleic acid probe.
- Hybridization conditions useful for probe/target hybridization where the probe and target have a specific degree of sequence identity can be determined as is known in the art (see, for example, Nucleic Acid Hybridization: A Practical Approach, editors B.D. Hames and S.J. Higgins, (1985) Oxford; Washington, DC; IRL Press).
- Hybrid molecules can be formed, for example, on a solid support, in solution, and in tissue sections. The formation of hybrids can be monitored by inclusion of a reporter molecule, typically, in the probe.
- reporter molecules, or detectable labels include, but are not limited to, radioactive elements, fluorescent markers, and molecules to which an enzyme-conjugated ligand can bind.
- stringency conditions for hybridization it is well known in the art that numerous equivalent conditions can be employed to establish a particular stringency by varying, for example, the following factors: the length and nature of probe and target sequences, base composition of the various sequences, concentrations of salts and other hybridization solution components, the presence or absence of blocking agents in the hybridization solutions (e.g., formamide, d ⁇ xtran sulfate, and polyethylene glycol), hybridization reaction temperature and time parameters, as well as, varying wash conditions.
- blocking agents in the hybridization solutions e.g., formamide, d ⁇ xtran sulfate, and polyethylene glycol
- hybridization reaction temperature and time parameters as well as, varying wash conditions.
- the selection of a particular set of hybridization conditions is well known (see, for example, Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, (1989) Cold Spring Harbor, N. Y.).
- the primers and probes can be used in polymerase chain reaction (PCR)-based techniques, such as RT-PCR, to detect the presence of hantaviral nucleic acid (which can be indicative of hantavirus infection) in biological samples.
- PCR is a technique for amplifying a desired target nucleic acid sequence contained in a nucleic acid molecule or mixture of molecules.
- a pair of primers is employed in excess to hybridize to the complementary strands of the target nucleic acid.
- the primers are each extended by a polymerase using the target nucleic acid as a template. The extension products become target sequences themselves after dissociation from the original target strand.
- New primers are then hybridized and extended by a polymerase, and the cycle is repeated to geometrically increase the number of target sequence molecules.
- the PCR method for amplifying target nucleic acid sequences in a sample is well known in the art and has been described in, e.g., Innis et al. (eds.) PCR Protocols (Academic Press, NY 1990); Taylor (1991) Polymerase chain reaction: basic principles and automation, in PCR: A Practical Approach, McPherson et al. (eds.) IRL Press, Oxford; Saiki et al. (1986) Nature 324:163; as well as in U.S. Patent Nos. 4,683,195, 4,683,202 and 4,889,818, all incorporated herein by reference in their entireties.
- PCR uses relatively short oligonucleotide primers which flank the target nucleotide sequence to be amplified, oriented such that their 3' ends face each other, each primer extending toward the other.
- the polynucleotide sample is extracted and denatured, preferably by heat, and hybridized with first and second primers that are present in molar excess.
- Polymerization is catalyzed in the presence of the four deoxyribonucleotide triphosphates (dNTPs - dATP, dGTP, dCTP and dTTP) using a primer- and template-dependent polynucleotide polymerizing agent, such as any enzyme capable of producing primer extension products, for example, E.
- thermostable DNA polymerases isolated from Thermus aquaticus (Taq), available from a variety of sources (for example, Perkin Elmer), Thermus thermophilus (United States Biochemicals), Bacillus stereothermophilus (Bio-Rad), or Thermococcus litoralis ("Vent" polymerase, New England Biolabs). This results in two "long products" which contain the respective primers at their 5' ends covalently linked to the newly synthesized complements of the original strands.
- the reaction mixture is then returned to polymerizing conditions, e.g., by lowering the temperature, inactivating a denaturing agent, or adding more polymerase, and a second cycle is initiated.
- the second cycle provides the two original strands, the two long products from the first cycle, two new long products replicated from the original strands, and two "short products" replicated from the long products.
- the short products have the sequence of the target sequence with a primer at each end.
- an additional two long products are produced, and a number of short products equal to the number of long and short products remaining at the end of the previous cycle.
- the number of short products containing the target sequence grows exponentially with each cycle.
- PCR is carried out with a commercially available thermal cycler, e.g., Perkin Elmer.
- RNAs may be amplified by reverse transcribing the RNA into cDNA, and then performing PCR (RT-PCR), as described above. Alternatively, a single enzyme may be used for both steps as described in U.S. Patent No. 5,322,770, incorporated herein by reference in its entirety. RNA may also be reverse transcribed into cDNA, followed by asymmetric gap ligase chain reaction (RT-AGLCR) as described by Marshall et al. (1994) PCR Melh App. 4:80-84.
- RT-PCR reverse transcribing the RNA into cDNA
- RT-AGLCR reverse transcribed into cDNA
- RT-AGLCR asymmetric gap ligase chain reaction
- the fluorogenic 5' nuclease assay known as the TaqManTM assay (Perkin-Elmer), is a powerful and versatile PCR-based detection system for nucleic acid targets.
- the hantavirus strain specific primer and probe sets described herein can be used in TaqManTM analyses to detect the presence of infection in a biological sample. Analysis is performed in conjunction with thermal cycling by monitoring the generation of fluorescence signals.
- the assay system dispenses with the need for gel electrophoretic analysis, and is capable of generating quantitative data allowing the determination of target copy numbers. For example, standard curves can be produced using serial dilutions of previously quantified hantaviral suspensions. A standard graph can be produced with copy numbers of each of the panel members against which sample unknowns can be compared.
- the fluorogenic 5" nuclease assay is conveniently performed using, for example,
- AmpliTaq GoldTM DNA polymerase which has endogenous 5' nuclease activity, to digest an internal oligonucleotide probe labeled with both a fluorescent reporter dye and a quencher (see, Holland et al., Proc. Natl. Acad.Sci. USA (1991) 88:7276-7280; Heid et al. (1996) supra, and Lee et al., Nucl. Acids Res. (1993) 21:3761-3766).
- Assay results are detected by measuring changes in fluorescence that occur during the amplification cycle as the fluorescent probe is digested, uncoupling the dye and quencher labels and causing an increase in the fluorescent signal that is proportional to the amplification of target nucleic acid.
- the amplification products can be detected in solution or using solid supports.
- the TaqManTM probe is designed to hybridize to a target sequence within the desired PCR product.
- the 5' end of the TaqManTM probe contains a fluorescent reporter dye.
- the 3" end of the probe is blocked to prevent probe extension and contains a dye that will quench the fluorescence of the 5' fluorophore (quencher).
- quencher contains a dye that will quench the fluorescence of the 5' fluorophore
- the 5' fluorescent label is cleaved off if a polymerase with 5 1 exonuclease activity is present in the reaction. The reporter label is thus removed from the quencher and results in an increase in fluorescence that can be detected.
- a relatively new class of quenchers known as "Black Hole Quenchers” such as BHQl and BHQ2, can be used in the nucleic acid assays described above. These quenchers reduce background and improve signal to noise in PCR assays. These quenchers are described in, e.g., Johansson et al., J. Chem. Soc. (2002) 124:6950-6956 and are commercially available from Biosearch Technologies (Novato, CA).
- the present invention relates to methods for amplifying a target hantavirus nucleotide sequence using a nucleic acid polymerase having 5' to 3' nuclease activity, one or more primers capable of hybridizing to the hantavirus target sequence, and an oligonucleotide probe capable of hybridizing to the amplified hantavirus target sequence.
- the polymerase digests the oligonucleotide probe when it is hybridized to the target sequence, thereby separating the reporter molecule from the quencher molecule.
- the fluorescence of the reporter molecule is monitored, with fluorescence corresponding to the occurrence of nucleic acid amplification.
- the oligonucleotide probes specific for each strain of hantavirus preferably will be labeled with a distinguishably different reporter.
- the same quencher can be used on all probes provided that it is suitable to quench any fluorescence emission from each of the reporters while in proximity thereto.
- the probe sequences are generally selected such that they have a higher melt temperature than the primer sequences.
- the probe sequences have an estimated melt temperature that is about 10 0 C higher than the melt temperature for the amplification primer sequences.
- the primer sequences are generally shorter than the probe sequences.
- the primer sequences are in the range of between 10-75 nucleotides long, more typically in the range of between 17 and 30 nucleotides long.
- the primers may contain additional, non-target hybridizing sequence, particularly at the S'end, (for example, promoter sequences, restriction enzyme cleavage sites, etc).
- the primer oligonucleotide may be longer than the typical 17 to 30 nucleotide length, however, the target hybridizing sequence of the primer will be only a portion of the entire primer sequence and will generally be in the range of 17 to 30 nucleotides.
- the typical probe is in the range of between 10 and 50 nucleotides long, more typically between 15 and 40 nucleotides in length, most typically between 20 and 35 nucleotides in length.
- Representative primers and probes useful in TaqManTM assays are described above.
- TMA transcription-mediated amplification
- Other known amplification methods which can be utilized herein include but are not limited to the so-called "NASBA” or “3SR” technique described by Guatelli et al., Proc. Natl. Acad. ScL USA (1990) 87:1874-1878 and J. Compton, Nature (1991) 350:91-92 (1991); Q-beta amplification; strand displacement amplification (as described in Walker et al., Clin. Chem. (1996) 42:9-13 and EPA 684,315; target mediated amplification, as described in International Publication No. WO 93/22461.
- Suitable DNA polymerases include reverse transcriptases, such as avian myeloblastosis virus (AMV) reverse transcriptase (available from, e.g., Seikagaku America, Inc.) and Moloney murine leukemia virus (MMLV) reverse transcriptase (available from, e.g., Bethesda Research Laboratories).
- AMV avian myeloblastosis virus
- MMLV Moloney murine leukemia virus
- Promoters or promoter sequences suitable for incorporation in the primers are nucleic acid sequences (either naturally occurring, produced synthetically or a product of a restriction digest) that are specifically recognized by an RNA polymerase that recognizes and binds to that sequence and initiates the process of transcription whereby RNA transcripts are produced.
- the sequence may optionally include nucleotide bases extending beyond the actual recognition site for the RNA polymerase which may impart added stability or susceptibility to degradation processes or increased transcription efficiency.
- useful promoters include those which are recognized by certain bacteriophage polymerases such as those from bacteriophage T3, T7 or SP6, or a promoter from E. coli. These RNA polymerases are readily available from commercial sources, such as New England Biolabs and Epicentre.
- RNAse H activity
- AMV reverse transcriptase an RNAse H activity
- exogenous RNAse H such as E. coli RNAse H
- RNAse H is readily available from, e.g., New England Biolabs.
- RNA transcripts produced by these methods may serve as templates to produce additional copies of the target sequence through the above-described mechanisms.
- the system is autocatalytic and amplification occurs autocatalytically without the need for repeatedly modifying or changing reaction conditions such as temperature, pH, ionic strength or the like.
- Detection may be done using a wide variety of methods, including direct sequencing, hybridization with sequence-specific oligomers, gel electrophoresis and mass spectrometry. These methods can use heterogeneous or homogeneous formats, isotopic or nonisotopic labels, as well as no labels at all.
- probes may be used in hybridization protection assays (HPA).
- HPA hybridization protection assays
- the probes are conveniently labeled with acridinium ester (AE), a highly chemiluminescent molecule. See, e.g., Nelson et al.
- AE molecule is directly attached to the probe using a non-nucleotide-based linker arm chemistry that allows placement of the label at any location within the probe. See, e.g., U.S. Patent Nos. 5,585,481 and 5,185,439. Chemiluminescence is triggered by reaction with alkaline hydrogen peroxide which yields an excited N-methyl acridone that subsequently collapses to ground state with the emission of a photon.
- HPA generally consists of the following steps: (a) the AE-labeled probe is hybridized with the target nucleic acid in solution for about 15 to about 30 minutes. A mild alkaline solution is then added and AE coupled to the unhybridized probe is hydrolyzed. This reaction takes approximately 5 to 10 minutes. The remaining hybrid- associated AE is detected as a measure of the amount of target present. This step takes approximately 2 to 5 seconds.
- the differential hydrolysis step is conducted at the same temperature as the hybridization step, typically at 50 to 70 0 C. Alternatively, a second differential hydrolysis step may be conducted at room temperature.
- HPA is described in detail in, e.g., U.S. Patent Nos. 6,004,745; 5,948,899; and 5,283,174, the disclosures of which are incorporated by reference herein in their entireties.
- an isolated nucleic acid sample suspected of containing a hantavirus target sequence, is mixed with a buffer concentrate containing the buffer, salts, magnesium, nucleotide triphosphates, primers, dithiothreitol, and spermidine.
- the reaction is optionally incubated at about 100 °C for approximately two minutes to denature any secondary structure.
- reverse transcriptase, RMA polymerase, and RNAse H are added and the mixture is incubated for two to four hours at 37 °C.
- the reaction can then be assayed by denaturing the product, adding a probe solution, incubating 20 minutes at 60 0 C, adding a solution to selectively hydrolyze the unhybridized probe, incubating the reaction six minutes at 60 0 C, and measuring the remaining chemiluminescence in a luminometer.
- two or more of the tests described above are performed to confirm the presence of the hantavirus.
- TMA transcription mediated amplification
- NAT nucleic acid testing
- hantavirus can be specifically and selectively detected even when the sample contains other organisms, such as HIV and/or HCV, for example.
- the methods of detection of the invention utilize a biological sample suspected of containing hantavirus nucleic acids.
- Typical biological samples suitable for use with the method of the invention include, without limitation, blood, plasma, serum, fecal matter, urine, bone marrow, bile, spinal fluid, lymph fluid, samples of the skin, external secretions of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, organs, biopsies and also samples of in vitro cell culture constituents including but not limited to conditioned media resulting from the growth of cells and tissues in culture medium, e.g., recombinant cells, and cell components.
- hantavirus may be obtained from biological samples such as blood, plasma, serum, fecal matter, urine, or lung tissue from an individual infected with the virus.
- a biological sample may be pre-treated in any number of ways prior to isolation of hantavirus nucleic acids.
- the sample may be treated to disrupt (or lyse) any viral particles (virions), for example by treating the samples with one or more detergents and/or denaturing agents ⁇ e.g., guanidinium agents).
- Nucleic acids may also be extracted from samples, for example, after detergent treatment and/or denaturing as described above. Total nucleic acid (i.e., both DNA and RNA) extraction may be performed using known techniques, for example by non-specific binding to a solid phase ⁇ e.g., silica). See, e.g., U.S. Patent Nos. 5,234,809, 6,849,431 ; 6,838,243; 6,815,541 ; and 6,720,166.
- the nucleic acid from the sample need only be isolated to the extent necessary to make it available for amplification of the target sequences.
- the sample nucleic acid is separated from other components of the biological sample that might interfere with the amplification reaction, but typically the nucleic acid need not be substantially purified.
- the nucleic acid may be concentrated (e.g., by precipitation, filtration, etc) prior to the amplifying step.
- the target nucleic acids are separated from nonhomologous nucleic acids present in the sample using capture oligonucleotides immobilized on a solid support.
- capture oligonucleotides contain nucleic acid sequences that are complementary to a nucleic acid sequence present in the target hantavirus nucleic acid analyte such that the capture oligonucleotide can "capture" (i.e., bind) the target nucleic acid.
- the biological sample potentially carrying target nucleic acid is contacted with a solid support in association with capture oligonucleotides.
- the capture oligonucleotides which may be used separately or preferably in combination, may be associated with the solid support, for example, by covalent binding of the capture moiety to the solid support, by affinity association, hydrogen binding, or nonspecific association.
- the capture oligonucleotides will be complementary to a hantaviral region that occurs on the same genomic segment as the target sequence (i.e., the region to be detected by amplification).
- the capture oligonucleotide(s) will preferably comprise hantaviral sequence(s) from conserved regions of the hantavirus genome.
- the capture oligos may comprise mixtures of sequences representing all sequence variations of hantaviral nucleic acids.
- Internal control sequence templates and internal control probes may be included in the isolation and/or amplifying and/or detection steps of the method.
- Internal control sequence templates are polynucleotides (DNA or RNA) that can be amplified by the same sets of primers as the hantaviral target sequence(s) but the amplicons from the internal control templates are detected with different probes than the hantaviral target amplicons.
- the internal control sequence template will thus contain sequences that hybridize to a set of strain-specific forward and reverse primers but not to the strain-specific probe.
- the internal control sequence templates are most easily prepared by modification of cloned hantaviral target sequences (for example, the sequences provided herein as SEQ ID NO:20-25) to remove a portion of the internal sequence and replace this with a sequence complementary to the internal control probe.
- an internal control sequence template polynucleotide comprising SEQ ID NO:26 was prepared from the plasmid containing SEQ ID NO:24 (a portion of the SNV small genome segment) by removing an interior segment and replacing it with a sequence that hybridizes to SEQ ID NO:27 (See Example 1 herein).
- An oligo comprising SEQ ID NO:27 can be used as an internal control probe.
- the internal control probe will comprise a distinguishably different detectable label.
- One or more internal control sequence template will be added to the biological sample at or prior to some step in the method, preferably prior to the isolating step.
- kits can be provided in kits, with suitable instructions and other necessary reagents, in order to conduct the assays as described above.
- the kit will normally contain the combination of primers and probes, control template(s), labeled reagents when the assay format requires same and signal generating reagents (e.g., enzyme substrate) if the label does not generate a signal directly.
- signal generating reagents e.g., enzyme substrate
- Instructions e.g., written, tape, VCR, CD-ROM, etc.
- for carrying out the assay usually will be included in the kit.
- the kit can also contain, depending on the particular assay used, other packaged reagents and materials (e.g., DNA polymerases, RNA polymerases, Reverse transcriptases, RNAses, and other enzymes, labels, diluent buffers, wash buffers and the like). Standard assays, such as those described above, can be conducted using these kits.
- other packaged reagents and materials e.g., DNA polymerases, RNA polymerases, Reverse transcriptases, RNAses, and other enzymes, labels, diluent buffers, wash buffers and the like. Standard assays, such as those described above, can be conducted using these kits.
- Hantavirus RNA transcripts were prepared in vitro from cloned hantaviral nucleocapsid genes from 6 strains of hantavirus. Both the prepared transcripts and the linearized plasmid were used as the target nucleic acid for RT-PCR and/or TaqMan fluorogenic 5' nuclease PCR with the hantavirus strain-specific primer and probe sets.
- Polynucleotides comprising the sequences of SEQ ID NOS:20-25 ( Figures 2-7), encoding the nucleocapsid proteins from the six hantavirus strains HTNV, PUUV, SEOV, DOBV, SNV and ANDV, were cloned into the yeast vector pBS24.1 as described in International Patent Application No. PCT/US2005/18066, herein incorporated by reference in its entirety.
- Cloned DNA was treated with the restriction enzymes MIuI and Sail.
- the resulting fragments were isolated by gel electrophoresis and purified by the MINELUTE gel purification kit (Qiagen, Valencia, CA).
- the fragments were each cloned into a pGEM-4z vector (Promega, Madison WI) modified with a multiple cloning region to facilitate cloning with the desired restriction sites.
- the pGEM-4z vector has both SP6 and T7 RNA polymerase promoters flanking the multiple cloning region to facilitate the making of RNA transcripts using either SP6 or T7 RNA polymerases.
- the resulting clones were transformed into HBlOl cells and large quantities of plasmid DNA were isolated, treated and used in the preparation of RNA transcripts.
- the RNA transcripts were prepared using a commercial in vitro RNA transcription kit (MEGAscript High Yield Transcription Kit, Ambion, Inc. Austin, Texas).
- RNA transcripts were used for RT-PCR/TaqMan assays as described in Example 5.
- the pGEM-4z plasmids were linearized and used as templates for the multiplex TaqMan assays described in Example 4.
- An internal control template was prepared by modifying the plasmid containing the SNV-N sequence (SEQ ID NO:24) to remove the region detected by the SNV probe and replacing it with a non-hantaviral sequence. A new probe was designed to detect this region of the internal control.
- the internal control sequence (SEQ ID NO:26) is amplified with the SNV primer set but is detected using the control sequence probe (CCAGTGACATGCAGGTCTAGCT SEQ ID NO:27).
- RNA Isolation Hantavirus RNA can be isolated from samples by a number of methods including non-specific binding to silica in the presence of chaotropic agents (the Boom method) or by specific binding to capture oligos on a solid solid.
- the non-specific method is described below for isolation of hantavirus from cell culture (Sin Nombre strain is used in the example) but the same method can be used to prepare nucleic acid from biological samples for testing by the multiplex assay.
- nucleic acids bind to silica.
- a chaotropic salt such as guanidinium isothiocyanate
- nucleic acids bind to silica.
- Small sized nucleic acids bind more efficiently to silica under conditions of acidic pH.
- the bound nucleic acids are efficiently eluted in low salt, alkaline pH buffer at high temperatures.
- magnetized silica for regular silica greatly facilitates the washing and elution steps of nucleic acid isolation.
- a magnetic base can be used to capture the nucleic acid-bound silica particles, thus eliminating centrifugations required to sediment regular silica particles.
- Lysis buffer from Organon-Teknika (Durham, N.C.) is used to extract Sin Nombre virus nucleic acids from an in vitro Sin Nombre virus culture.
- the lysis buffer containing guanidinium isothiocyanate and Triton X-100, solubilizes proteins, releases nucleic acids, and inactivates RNases and DNases.
- One 9.0-mL aliquot of lysis reagent is used to extract nucleic acids from 0.5 mL of serially diluted Sin Nombre virus culture. After release from associated proteins, the nucleic acid is isolated by binding to magnetized silica (Novagen, Madison, Wl) particles and a magnetic base is used to capture the nucleic acid-bound silica particles.
- the bound nucleic acid is eluted in 60 ⁇ L of alkaline buffer containing 1 mM EDTA, 10 mM Tris, pH 9.0.
- An advantage of nucleic acid purification by adsorption to silica is that isolated nucleic acids can be used to test for several targets or several regions of one target. A 50 ⁇ L aliquot of the eluted nucleic acid is amplified using the TAQMAN RT-PCR amplification-detection assay described below.
- the target nucleic acids are mixed with the hantavirus strain-specific probe(s).
- Appropriate sets of hantavirus strain specific primers are added to one-step RT-PCR master mix (Applied Biosystems, Foster City, CA) and 100 ⁇ L of this mixture is added to the isolated nucleic acids from the sample.
- a number of control nucleic acids can be extracted or captured and amplified.
- an internal control as described above can be added during the nucleic acid isolation.
- Armored RNA (Ambion Diagnostics, Austin, TX) can be used as a more stable internal control.
- TaqManTM technology was used for amplifying the target nucleic acids from hantavirus strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV prepared in Example 3.
- the target templates used were the linearized plasm ids described in Example 1.
- Strain specific primers and probes comprising sequences from the S segments of hantaviruses were designed to amplify and detect nucleic acid targets from each hantavirus strain specifically.
- Strain specific probes were labeled with different fluorophores to allow discrimination among the different hantavirus strains used in the samples in multiplex assays. Sets of primers and probes for each hantavirus strain are listed in Table 2. The fluorophore indicated in the Table was used on the probe as a reporter molecule.
- Multiplex assays were performed with an ABI 7500 real-time PCR system thermocycler (Applied Biosystems, Foster City, CA) capable of detecting five different fluorophores in multiplex assays. Because of the limitation of the detection instrument, only 3 hantaviral targets could be assayed simultaneously, leaving one fluorophore to be used for the background signal and one fluorophore for the internal control signal. For each multiplex assay, a total of nine oligonucleotides (3 primer/probe sets) were used for amplification and detection of three target hantavirus strains. Multiplex assays were performed with the following combinations of probes:
- ANDV-TAMRA probe SNV-FAM probe, PUUV-Cy5 probe SEOV-FAM probe, PUUV-Cy5 probe, HTNV-CAL GOLD probe ANDV-TAMRA probe, PUUV-Cy5 probe, HTNV-CAL GOLD probe DOBV-FAM probe, PUUV-Cy5 probe, ANDV-TAMRA probe
- multiplex assays contained ROX as a background fluorophore and an internal control consisting of a modified SNV transcript with an altered probe-binding sequence (SEQ ID NO:26) detectable with a TET labeled control probe(SEQ ID NO:27).
- the internal control transcript can be amplified by the SNV primers (SEQ ID NO: 16 and SEQ ID NO: 19), and is used for determining false negatives. Black Hole Quenchers (Biosearch Technologies, Novato CA) were used as quencher for all of the probes.
- Reagents for the TaqManTM analysis were obtained from Applied Biosystems, Foster City, CA. In some assays, three different plasmid templates (corresponding to each of the strain specific primer/probe sets) were used as the target; in other assays, only one of the three transcripts was used as target.
- the reaction in a final volume of 100 ⁇ L contained, 50 ⁇ L of PCR Mastermix (Applied Biosystems, Inc., Foster City, CA), 100 pmol each of the amplification primers, and 25 pmol each of the probes with the remaining volume made up of hantavirus target nucleic acids and water.
- reaction conditions included 10 minutes at 95 0 C to activate the Taq enzyme followed by 50 cycles of 30 seconds at 95 0 C, alternating with 1 minute at 60 0 C in the ABI 7500 instrument.
- Table 4 shows the results of assays using a combination of primers and probes for PUUV, DOBV, and ANDV where only a single target is present in the assay. Only the probe for the target DNA present in the sample is detectable. The results show the specificity of the primers and probes for their target hantavirus strains.
- Table 5 shows the results of assays using a combination of 4 primer/probe sets (HTNV, PUUV, DOBV, and ANDV) where only a single target is present in the assay. Only the probe corresponding to the target DNA present in the sample is detectable. These results provide further evidence of the specificity of the serospecific primers and probes for detection of individual hantavirus strains. Table 5. Assay with primer/probe sets for HTNV, PUUV, DOBV, ANDV and a single target DNA
- RNA templates corresponding to each of 6 hantavirus strains.
- the RNA templates were prepared as in vitro RNA transcripts from the cloned hantaviral nucleocapsid genes as described in Example 1.
- the assays were carried out as described in Example 4 except that the target nucleic acid in the samples was RNA transcript at 10 6 or 10 8 copies/reaction.
- a single set of primers/probe and target RNA from a single hantavirus strain was used for each assay.
- Ct was determined in triplicate for each concentration of RNA target. The results are shown in Tables 6-11.
- oligonucleotide reagents derived from hantaviruses such as primers, probes and capture oligonucleotides, and the like, as well as methods of using the reagents for detecting hantavirus are described.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Virology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Methods and oligonucleotide reagents for detecting hantavirus are described. In particular, the invention relates to methods of detecting hantavirus nucleic acid from several prevalent pathogenic Hantavirus strains, including strains Hantaan virus (HTNV), Dobrava virus (DOBV), Seoul virus (SEOV), Puumala virus (PUUV), Sin Nombre virus(SNV), and Andes virus (ANDV).
Description
METHODS AND REAGENTS FOR DETECTING HANTAVIRUS
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with support under NIH Grant UOl AIO54779-01 , from the National Institute of Allergy and Infectious Diseases. Accordingly, the United States Government has certain rights in this invention.
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Ser. Nos. 60/831,154, filed July 13, 2006, the disclosure of which is incorporated herein by reference in its entirety.
TECHNICAL FIELD
The present invention pertains generally to hantavirus and viral diagnostics. In particular, the invention relates to nucleic acids for use in the detection of hantavirus strains, including Hantaan (HTNV), Dobrava (DOBV), Seoul (SEOV), Puumala (PUUV), Sin Nombre (SNV), and Andes (ANDV).
BACKGROUND
Hantaviruses (Bunyaviridae: Hantavirus) are lipid -enveloped, minus-sense RNA viruses. The RNA of the viral genome is tripartite, consisting of three fragments generally designated as S, M and L for small, medium and large genome fragments, respectively. The M segment encodes a precursor protein that is processed to form the two envelope glycoproteins, termed Gl and G2. The S segment encodes a nucleocapsid protein, termed N which forms the filamentous helical nucleocapsid of the virus and elicits the humoral response. The L segment of the genome encodes an RNA-dependent RNA polymerase (RDRP). Over 20 distinct hantaviruses are found in association with specific rodent or insectivore hosts worldwide. Their modes of transmission to humans, natural reservoirs, and the clinical features of human infection have been reviewed (see, e.g., Mertz et al., Adv. Internal Med. (1997) 42:369-421).
Hantavirus pulmonary syndrome (HPS), also known as hantavirus cardiopulmonary syndrome (HCPS) is an acute febrile illness with up to a 50% mortality rate. Patients present with nonspecific symptoms and progress rapidly to fulminant
pulmonary edema and cardiovascular collapse. The predominant agent of HCPS in North America is Sin Nombre virus (SNV; also known as Four Corners virus and Muerto Canyon virus). (Song et al., Lancet (1994) 344: 1637; Khan et al., J. Med. Virol (1995) 46:281-286; Kahn et al., Am. J. Med. (1996) 100:46-48; Morzunov et al., J. Virol (1995) 69:1980-1983; Rollin et al., J. Med. Virol (1995) 46:35-39; Centers for Disease Control and Prevention, Morbid. Mortal. Weekly Rep. (1993) 43:45-48). At least three other hantaviruses have been associated with HPS in North America, including New York virus (NYV), Black Creek Canal virus (BCCV) and Bayou virus (BAYV).
Worldwide, a larger toll of illness is caused by the Eurasian hantaviruses that cause hemorrhagic fever with renal syndrome (HFRS). HFRS-associated viruses include Hantaan (HTNV), Puumala (PUUV), Seoul (SEOV), and Dobrava-Belgrade (IX)BV) viruses (Lee et al., J. Infect. Dis. (1978) 137:298-308; Lee, et al., J. Infect. Dis. (1982) 146:638-644; Lee et al., J. Infect. Dis. (1982) 146:645-651 ; Brummer-Korvenkontio et al., J. Infect. Dis. (1980) 141:131-134). Clinical manifestations of HFRS are generally most severe for HTNV and DOBV infections, whereas PUUV infection is associated with a milder form of HFRS, nephropathia epidemica (NE), occurring in Scandinavia, Finland, Western Russia and Central Europe. Mortality rates of up to 20% have been reported from the most severe forms of HFRS.
Among the HFRS-associated hantaviruses, HTNV, SEOV and DOBV are antigenically similar. The HCPS-associated viruses are also closely related to one another, and cross-react with PUUV. Antigenic cross-reactivity is most pronounced among the viral N proteins. In recombinant antigen diagnostic assays, the viral N antigen is dominant over the viral glycoproteins. Antibodies to the N antigen arise early in the course of infection and are universally detectable in convalescence. All persons with acute SNV infection have detectable antibodies against the SNV N antigen of the IgM class by the onset of clinical symptoms, and almost all have IgG antibodies directed against the N and Gl antigens (Bharadwaj et al., J. Infect. Dis. (2000) 182:43-48). SNV Gl antibodies are not reactive with the Gl antigens of other hantaviruses (Jenison et al., J. Virol. (1994) 68:3000-3006; Hjelle et al, J.Gen. Virol. (1994) 75:2881-2888). Hantaviruses are transmitted to humans via inhalation of virus-contaminated aerosols of rodent saliva, urine and feces. A worker can contract hantavirus infection merely by entering into a room with infected rodents, which strongly supports the prevailing view that hantaviruses are transmitted through the air. This observation is also supported by a recent epidemiologic investigation showing that indoor exposures are
extremely common. Person-to-person transmission has been demonstrated for the Andes virus (ANDV) in Argentina and is likely to be responsible for two family clusters in Chile. The virus may also be transmitted after rodent bites and possibly through ingestion of contaminated food or water.
All species of hantavirus appear to be primarily associated with a specific rodent host. There are three broad groups of hantaviruses and they are associated with the rodent subfamilies of Murinae, Arvicolinae and Sigmondontinae. The phylogenetic relations among rodents in these various subfamilies parallel, for the most part, the phylogenetic and antigenic relations of viruses associated with each particular reservoir. Each of these groups of hantaviruses contains one or more species or types that are known human pathogens. Information concerning the various hantaviruses is presented in Table 1.
Table 1.
Significant strides have been made in the management of hantavirus infection, but successful management requires that patients be diagnosed before the immediate preagonal stage of illness. Advances in tertiary care management have occurred that may reduce mortality due to hantavirus infection. However, since infection progresses very rapidly, these advances are likely to affect the prognosis only of those patients for whom a diagnosis can be made in a timely manner. Hantavirus antibody tests are available from Focus Diagnostics (Cypress, CA) and a rapid antibody test for several hantavirus strains has recently been described (Hujakka et al. 2003 J. Virol. Meth. 108:117). Antibodies, however, may take days or weeks to develop from the time of infection and occasionally are not detectable in patient serum at times early enough to begin effective treatment. Assays for the hantavirus nucleic acids have been described (Garin et al. 2001 Microbes Infect. 3:739-745; Dekonenko et al. 1997 Clin. Diag. Virol. 8:1 13-121; Weidmann et al. J. Clin. Microbiol. 2005 43:808-812; Heiske et al. Kidney Intl 1999 55:2062-2069; Botten et al. Proc. Natl Acad Sci. 2000 97:10578-10583; Ahn et al. 2000 Clin Nephrol. 53:79-89; Giebel et al. Virus Res. 19990 16:127-136; Xiao et al. J. Med Virol. 1991 33:277-282;
Nuovo et al. Am J. Pathol. 1996 148:685-692; Xiao et al. J. Gen. Virol. 1992 73:567-573; Puthavathana et al. Virus Res. 1992 26:1-14; Kim et al. J. Med. Virol. 1994245-248; Aitichou et al. 2005 J. Virol. Meth. 124:21; Nordstrom et al. 2004 J. Med. Virol. 72:646) but no nucleic acid tests are available commercially. Thus, there remains a need for the development of effective strategies for the diagnosis, treatment, and prevention of hantavirus infection. The availability of nucleic acid diagnostic tests capable of efficiently detecting hantavirus in human specimens such as plasma, serum and respiratory secretions will assist the medical community in better diagnosing and treating hantavirus infections and maintaining the safety of the blood supply.
SUMMARY OF THE INVENTION
The present invention is based on the development of sensitive, reliable nucleic acid-based diagnostic assays for the detection of hantaviruses in biological samples from potentially infected subjects. In particular, the invention provides methods and compositions for selectively detecting hantavirus strains Hantaan virus (HTNV), Dobrava virus (DOBV), Seoul virus (SEOV), Puumala virus (PUUV), Sin Nombre virus (SNV), and Andes virus (ANDV). The methods allow the rapid detection, in a single test, of hantavirus infection caused by one or several hantaviruses, such as caused by one or more strains of HTNV, DOBV, SEOV, PUUV, SNV, and ANDV. The methods can also be used to determine which hantavirus strains are present in a sample. If infection is detected and identified, the individual can be given appropriate treatment in adequate time to prevent serious illness. In addition, precautions could be taken to avoid the spread of the disease from infected individuals to the healthy population. The methods utilize sets of primers and, optionally, probes that are useful for amplifying and/or detecting target sequences of one or more hantavirus strains, to provide for the ability to detect single or multiple strains simultaneously in a single assay. In certain embodiments, the hantavirus sequences are detected using a fluorogenic 5' nuclease assay, such as the TaqMan technique. Other nucleic-acid based detection techniques, such as but not limited to reverse transcriptase-polymerase chain reaction (RT- PCR) and transcription-mediated amplification (TMA), can also be used.
Using the methods of the invention, infected individuals can be identified. Moreover, the assays can be used to screen rodents and other animals, such as cats, dogs, pigs, cattle, and deer, for hantavirus infection in order to determine if a particular animal
population is infected with the virus, thereby preventing infection in laboratory workers, field crews and others who work with and encounter such animals. Additionally, infected blood samples can be detected and excluded from transfusion, as well as from the preparation of blood derivatives. Thus, the present invention provides:
a method for detecting hantavirus infection in a biological sample, the method comprising: isolating a nucleic acid from a biological sample suspected of containing hantavirus nucleic acid, wherein if hantavirus nucleic acid is present, said nucleic acid comprises a target sequence; amplifying the nucleic acid using at least one set of oligonucleotide primers comprising a forward primer and a reverse primer capable of amplifying at least a portion of a hantavirus nucleic acid segment, wherein said primers are not more than about 40 nucleotides in length, wherein said set of primers is selected from the group consisting of:
(a) a forward primer comprising the sequence of SEQ ID NO:1 and a reverse primer comprising the sequence of SEQ ID NO:3, (b) a forward primer comprising the sequence of SEQ ID NO:4 and a reverse primer comprising the sequence of SEQ ID NO:6, (c) a forward primer comprising the sequence of SEQ ID NO:7 and a reverse primer comprising the sequence of SEQ ID NO:9, (d) a forward primer comprising the sequence of SEQ ID NO: 10 and a reverse primer comprising the sequence of SEQ ID NO: 12, (e) a forward primer comprising the sequence of SEQ ID NO: 13 and a reverse primer comprising the sequence of SEQ ID NO:15, (f) a forward primer comprising the sequence of SEQ ID NO: 16 and a reverse primer comprising the sequence of SEQ ID NO: 19; (g) a forward primer and a reverse primer each comprising at least 10 contiguous nucleotides from the corresponding nucleotide sequences of the forward primer and reverse primer of a primer set selected from the group consisting of (a) through (f); and (h) a forward primer and a reverse primer comprising nucleotide sequences having at least 90% sequence identities to the corresponding nucleotide sequences of the forward primer and reverse primer of a primer set selected from the group consisting of (a) through (f); and detecting the presence of the amplified nucleic acid. Preferably, the detecting step is accomplished using at least one detectably labeled oligonucleotide probe sufficiently complementary to and capable of hybridizing with the hantavirus nucleic acid or amplicon thereof, if present, as an indication of the presence or absence of hantavirus in the sample.
In combination with the strain specific primer sets above, a strain specific probe is preferably used for detection of the amplified target. Preferred sets of primers and probes are selected from the group consisting of (a) a forward primer comprising the sequence of SEQ ID NO: 1 , a reverse primer comprising the sequence of SEQ ID NO:3, and a probe comprising the sequence of SEQ ID NO:2, (b) a forward primer comprising the sequence of SEQ ID NO:4, a reverse primer comprising the sequence of SEQ ID NO:6, and a probe comprising the sequence of SEQ ID NO.5, (c) a forward primer comprising the sequence of SEQ ID NO:7, a reverse primer comprising the sequence of SEQ ID NO:9, and a probe comprising the sequence of SEQ ID NO:8, (d) a forward primer comprising the sequence of SEQ ID NOrIO, a reverse primer comprising the sequence of SEQ ID NO: 12, and a probe comprising the sequence of SEQ ID NO:11, (e) a forward primer comprising the sequence of SEQ ID NO: 13, a reverse primer comprising the sequence of SEQ ID NO: 15, and a probe comprising the sequence of SEQ ID NO: 14, (f) a forward primer comprising the sequence of SEQ ID NO: 16, a reverse primer comprising the sequence of SEQ ID NO: 19, and a probe comprising the sequence of SEQ ID NO: 17, (g) a forward primer, a reverse primer, and a probe, each comprising at least 10 contiguous nucleotides from the corresponding nucleotide sequences of the forward primer, reverse primer and probe sets selected from the group consisting of (a) through (f); and (h) a forward primer, a reverse primer, and a probe comprising nucleotide sequences having at least 90% sequence identities to the corresponding nucleotide sequences of the forward primer, reverse primer and probe set selected from the group consisting of (a) through (f). Preferably the probe additionally comprises a detectable label, for example a fluorescent label selected from the group consisting of 6-carboxyfluorescein (FAM), tetramethyl rhodamine (TAMRA), 2', 4', 5', T- tetrachloro^^-dichlorofluorescein (TET), Cy5, 6-carboxy-X-rhodamine (ROX); and CAL GOLD.
The amplifying step generally uses a fluorogenic 5' nuclease assay (e.g., TaqMan), although Polymerase Chain Reaction (PCR), RT-PCR, transcription mediated amplification (TMA) or any other methods of amplification that utilize extension of oligonucleotide primers that hybridize to target sequence can be used, alone or in combination.
The primer/probe sets described herein have been designed and optimized to work in combination with each other to provide minimal interference. A single set of strain specific primers and probe can be used in an assay to detect the specific strain, however, two or more sets of primers/probes are advantageously used together in a single assay
where the identity of the hantavirus in the sample is unknown or where more than one hantavirus may be present.
The invention also provides a kit comprising at least one set of hantavirus strain- specific primers wherein said primers are oligonucleotides that are each not more than about 40 nucleotides in length, wherein said set of primers is selected from the group consisting of:
(a) a forward primer comprising the sequence of SEQ ID NO:1 and a reverse primer comprising the sequence of SEQ ID NO:3, (b) a forward primer comprising the sequence of SEQ ID NO:4 and a reverse primer comprising the sequence of SEQ ID NO:6, (c) a forward primer comprising the sequence of SEQ ID NO:7 and a reverse primer comprising the sequence of SEQ ID NO:9, (d) a forward primer comprising the sequence of SEQ ID NO: 10 and a reverse primer comprising the sequence of SEQ ID NO: 12, (e) a forward primer comprising the sequence of SEQ ID NO: 13 and a reverse primer comprising the sequence of SEQ ID NO: 15, (f) a forward primer comprising the sequence of SEQ ID NO: 16 and a reverse primer comprising the sequence of SEQ ID NO: 19; (g) a forward primer and a reverse primer each comprising at least 10 contiguous nucleotides from the corresponding nucleotide sequences of the forward primer and reverse primer of a primer set selected from the group consisting of (a) through (f); and (h) a forward primer and a reverse primer comprising nucleotide sequences having at least 90% sequence identities to the corresponding nucleotide sequences of the forward primer and reverse primer of a primer set selected from the group consisting of (a) through (f).
The kit may additionally contain a strain-specific probe for use with the corresponding strain-specific primer set, wherein said probe is an oligonucleotide not more than about 40 nucleotides in length and wherein the primer/probe sets are selected from the group consisting of:
(a) a forward primer comprising the sequence of SEQ ID NO: 1 , a reverse primer comprising the sequence of SEQ ID NO:3, and a probe comprising the sequence of SEQ ID NO:2, (b) a forward primer comprising the sequence of SEQ ID NO:4, a reverse primer comprising the sequence of SEQ ID NO:6, and a probe comprising the sequence of SEQ ID NO:5, (c) a forward primer comprising the sequence of SEQ ID NO:7, a reverse primer comprising the sequence of SEQ ID NO:9, and a probe comprising the sequence of SEQ ID NO:8, (d) a forward primer comprising the sequence of SEQ ID NO: 10, a reverse primer comprising the sequence of SEQ ID NO: 12, and a probe comprising the sequence of SEQ ID NO: 1 1 , (e) a forward primer comprising the sequence of SEQ ID NO: 13, a
reverse primer comprising the sequence of SEQ ID NO: 15, and a probe comprising the sequence of SEQ ID NO: 14, (f) a forward primer comprising the sequence of SEQ ID NO: 16, a reverse primer comprising the sequence of SEQ ID NO: 19, and a probe comprising the sequence of SEQ ID NO: 17, (g) a forward primer, a reverse primer, and a probe, each comprising at least 10 contiguous nucleotides from the corresponding nucleotide sequences of the forward primer, reverse primer and probe sets selected from the group consisting of (a) through (f); and (h) a forward primer, a reverse primer, and a probe comprising nucleotide sequences having at least 90% sequence identities to the corresponding nucleotide sequences of the forward primer, reverse primer and probe set selected from the group consisting of (a) through (f). The probes maybe detectably labeled. Preferably, the probes will comprise distinguishably different detectable labels, preferably, fluorescent labels. The kits may optionally comprise other components useful for amplifying and detecting nucleic acid targets, for example, enzymes (DNA polymerases, RNA polymerases, reverse transcriptases, RNases, etc), buffers, control templates, and the like.
These and other embodiments of the subject invention will readily occur to those of skill in the art in view of the disclosure herein.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 depicts exemplary primers and probes (SEQ ID NOS: 1-19) for amplification and detection of hantavirus RNA in a biological sample.
Figure 2 depicts an exemplary nucleotide sequence from the S segment of hantavirus strain HTNV (SEQ ID NO:20) used in cloning and preparation of RNA for nucleic acid assays as described in Example 1.
Figure 3 depicts an exemplary nucleotide sequence from the S segment of hantavirus strain PUUV (SEQ ID NO:21) used in cloning and preparation of RNA for nucleic acid assays as described in Example 1.
Figure 4 depicts an exemplary nucleotide sequence from the S segment of hantavirus strain SEOV (SEQ ID NO:22) used in cloning and preparation of RNA for nucleic acid assays as described in Example 1.
Figure 5 depicts an exemplary nucleotide sequence from the S segment of hantavirus strain DOBV (SEQ ID NO:23) used in cloning and preparation of RNA for nucleic acid assays as described in Example 1.
Figure 6 depicts an exemplary nucleotide sequence from the S segment of hantavirus strain SNV(SEQ ID NO:24) used in cloning and preparation of RNA for nucleic acid assays as described in Example 1.
Figure 7 depicts an exemplary nucleotide sequence from the S segment of hantavirus strain ANDV (SEQ ID NO:25) used in cloning and preparation of RNA for nucleic acid assays as described in Example 1.
Figure 8 depicts an exemplary internal control sequence (SEQ ID NO:26) for use as a control for amplification of target nucleic acids. A region of the SNV nucleotide sequence was replaced with an internal control sequence as described in Example 1.
DETAILED DESCRIPTION OF THE INVENTION
The practice of the present invention will employ, unless otherwise indicated, conventional methods of virology, chemistry, biochemistry, recombinant DNA techniques and immunology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Fundamental Virology, 3rd Edition, vol. I & II (B.N. Fields and D.M. Knipe, eds.); Handbook of Experimental Immunology, VoIs. I-IV (D.M. Weir and CC. Blackwell eds., Blackwell Scientific Publications); T.E. Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.).
All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entireties.
The following amino acid abbreviations are used throughout the text: Alanine: Ala (A) Arginine: Arg (R)
Asparagine: Asn (N) Aspartic acid: Asp (D)
Cysteine: Cys (C) Glutamine: GIn (Q)
Glutamic acid: GIu (E) Glycine: GIy (G)
Histidine: His (H) Isoleucine: He (I)
Leucine: Leu (L) Lysine: Lys (K)
Methionine: Met (M) Phenylalanine: Phe (F)
Proline: Pro (P) Serine: Ser (S)
Threonine: Thr (T) Tryptophan: Trp (W)
Tyrosine: Tyr (Y) Valine: VaI (V)
1. DEFINITIONS
In describing the present invention, the following terms will be employed, and are S intended to be defined as indicated below.
It must be noted that, as used in this specification and the appended claims, the singular forms "a", "an" and "the" include plural references unless the content clearly dictates otherwise. Thus, for example, reference to "a hantavirus oligonucleotide" includes a mixture of two or more such oligonucleotides, and the like. 0 As used herein, the term "hantavirus" refers to members of the Bunyaviridae family of enveloped, negative sense RNA viruses. The hantavirus genome comprises three RNA genome segments, designated as large (L), medium (M), and small (S) (Fields and Knipe (eds.) Fundamental Virology, 2nd edition, Raven Press, New York, NY, 1991). The term hantavirus may include any strain of hantavirus, which is capable of causing 5 disease (e.g., hemorrhagic fever with renal syndrome or hantavirus cardiopulmonary syndrome) in an animal or human subject. In particular, the term encompasses any strain of hantavirus associated with the rodent subfamilies of Murinae, Arvicolinae and Sigmondontinae, such as HTNV, DOBV, SEOV, PUUV, SNV, and ANDV, that causes disease in humans. A large number of hantavirus isolates have been partially or 0 completely sequenced. See, e.g., the GenBank database (website at ncbi.nlm.nih.gov), which contains complete sequences for hantavirus S, M and L genome segments.
The terms "polypeptide" and "protein" refer to a polymer of amino acid residues and are not limited to a minimum length of the product. Thus, peptides, oligopeptides, dimers, multimers, and the like, are included within the definition. Both full-length proteins and5 fragments thereof are encompassed by the definition. The terms also include postexpression modifications of the polypeptide, for example, glycosylation, acetylation, phosphorylation and the like. Furthermore, for purposes of the present invention, a "polypeptide" refers to a protein which includes modifications, such as deletions, additions and substitutions (generally conservative in nature), to the native sequence, so long as the0 protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.
"Substantially purified" generally refers to isolation of a substance (compound, polynucleotide, protein, polypeptide, polypeptide composition) such that the substance comprises the majority percent of the sample in which it resides. Typically in a sample, a substantially purified component comprises at least 50%, preferably at least 80%-85%, more preferably at least 90-95% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are well-known in the art and include, for example, ion- exchange chromatography, affinity chromatography and sedimentation according to density.
By "isolated" is meant, when referring to a polypeptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macro-molecules of the same type. The term "isolated" with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated from the chromosome.
"Homology" refers to the percent sequence identity between two polynucleotide or two polypeptide moieties. Two nucleic acid, or two polypeptide sequences are "substantially homologous" to each other when the sequences exhibit at least about 50% sequence identity, preferably at least about 75% sequence identity, more preferably at least about 80%-85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95%-98% sequence identity over a defined length of the molecules. As used herein, substantially homologous also refers to sequences showing complete identity to the specified sequence.
In general, "identity" refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Percent identity can be determined by a direct comparison of the sequence information between two molecules (a test and a reference) by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the reference sequence, and multiplying the result by 100. Readily available computer programs can be used to aid in the analysis, such as ALIGN, Dayhoff, M.O. in Atlas of Protein Sequence and Structure M.O. Dayhoff ed., 5 Suppl. 3:353-358, National biomedical Research Foundation, Washington, DC, which adapts the local homology algorithm of Smith and Waterman Advances inAppl. Math. 2:482-489, 1981 for peptide analysis. Programs for determining nucleotide sequence identity are available in the
Wisconsin Sequence Analysis Package, Version 8 (available from Genetics Computer Group, Madison, WI) for example, the BESTFIT, FASTA and GAP programs, which also rely on the Smith and Waterman algorithm. These programs are readily utilized with the default parameters recommended by the manufacturer and described in the Wisconsin Sequence Analysis Package referred to above. For example, percent identity of a particular nucleotide sequence to a reference sequence can be determined using the homology algorithm of Smith and Waterman with a default scoring table and a gap penalty of six nucleotide positions.
Another method of establishing percent identity in the context of the present invention is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by Intel liGenetics, Inc. (Mountain View, CA). From this suite of packages the Smith- Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated the "Match" value reflects "sequence identity." Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters. For example, BLASTN and BLASTP can be used using the following default parameters: genetic code = standard; filter = none; strand = both; cutoff = 60; expect = 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + Swiss protein + Spupdate + PIR. Details of these programs are readily available.
Alternatively, homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments. DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.
The terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule" are used herein to include a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of
the molecule. Thus, the term includes triple-, double- and single-stranded DNA, as well as triple-, double- and single-stranded RNA. It also includes modifications, such as by methylation and/or by capping, and unmodified forms of the polynucleotide. More particularly, the terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule" include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing nonnucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids (PNAs)) and polymorpholino (commercially available from the Anti-Virals, Inc., Corvallis, Oregon, as Neugene) polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. There is no intended distinction in length between the terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule," and these terms will be used interchangeably. Thus, these terms include, for example, 3'-deoxy-2',5'-DNA, oligodeoxyribonucleotide N31 P5' phosphoramidates, 2'-O-alkyl-substituted RNA, double- and single-stranded DNA, as well as double- and single-stranded RNA, DNArRNA hybrids, and hybrids between PNAs and DNA or RNA, and also include known types of modifications, for example, labels which are known in the art, methylation, "caps," substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), and with positively charged linkages (e.g., aminoalklyphosphoramidates, aminoalkylphosphotriesters), those containing pendant moieties, such as, for example, proteins (including nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide or oligonucleotide. In particular, DNA is deoxyribonucleic acid.
A hantavirus polynucleotide, oligonucleotide, nucleic acid and nucleic acid molecule, as defined above, is a nucleic acid molecule derived from a hantavirus, including, without limitation, any of the various species of hantavirus, including strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV. The molecule need not be physically
derived from the particular isolate in question, but may be synthetically or recombinantly produced.
Nucleic acid sequences for a number of hantavirus isolates are known. Representative sequences, including sequences of the S, M, and L RNA genome segments from hantavirus isolates found in various species of rodents, humans, and other mammals are listed in the National Center for Biotechnology Information (NCBI) database. See, for example, GenBank entries: Seoul virus 80-39 segment M, GenBank Accession No. NC 005237; Seoul virus 80-39 glycoprotein precusor gene, GenBank Accession No. S47716; Dobrava virus segment L, GenBank Accession No. NC_005235; Dobrava virus segment M, GenBank Accession No. NC_005234; Dobrava virus segment S, GenBank Accession No. NC 005233; Hantaan virus segment M, GenBank Accession No. NC 005219; Hantaan virus segment S, GenBank Accession No. NC_005218; Hantaan virus segment L, GenBank Accession No. NC 005222; Seoul virus segment L, GenBank Accession No. NC_005238; Seoul virus strain 80-39 segment S, GenBank Accession No. NC 005236; Sin Nombre virus segment M, GenBank Accession No. NC_005215; Sin Nombre virus, GenBank Accession No. NC_005217; Sin Nombre virus segment S, GenBank Accession No. NC_005216; Puumala virus segment L, GenBank Accession No. NC_005225; Puumala virus segment S, GenBank Accession No. NC_005224; Puumala virus segment M, GenBank Accession No. NC_005223; Andes virus segment L, GenBank Accession No. NC_003468; Andes virus segment M, GenBank Accession No. NC_003467; Andes virus segment S, GenBank Accession No. NC 003466; Seoul virus 80-39 L gene for RNA-dependent RNA polymerase, genomicRNA, Accession X56492; Hantaan virus S segment encoding nucleocapsid protein; Accession M 14626; Hantaan virus, complete M RNA segment coding for Gl and G2 proteins, complete cds, Accession M 14627; Hantaan virus gene for putative polymerase, genomic RNA, Accession X55901; Puumala virus CG 1820 segment S nucleocapsid protein mRNA, 5' end, Accession M32750; Puumala virus CGl 820 virus M genome segment, complete cds, Accession M29979; Puumala virus CG 1820 RNA-dependent RNA polymerase gene in L RNA segment, Accession M63194; Seoul virus strain 80-39 segment S, complete sequence, Accession AY273791; Seoul virus 80-39 glycoprotein precusor gene, complete cds, Accession S47716; Sin Nombre virus S segment nucleocapsid protein gene, complete cds, Accession L25784; Sin Nombre virus M segment glycoprotein precursor gene (GPC), complete cds, Accession L25783; Sin Nombre virus (NM HlO) RNA L segment encoding RNA polymerase (L protein),
complete cds, Accession L37901 ; Andes virus strain Chile-9717869 segment S nucleocapsid protein gene, complete cds, Accession AF291702; Andes virus strain Chile- 9717869 segment M Gl and G2 surface glycoprotein precursor, gene, complete cds, Accession AF291703; Andes virus strain Chile-9717869 segment L, complete sequence, Accession AF291704.See also Scharninghausen et al. (2004) Bosn. J. Basic. Med. Sci. 4:13-18; Plyusnin (2002) Arch. Virol. 147:665-682; Monroe et al. (1999) Emerg. Infect. Dis. 5:75-86; Schmaljohn et al. (1997) Emerg. Infect. Dis. 3: 95-104; for sequence comparisons and a discussion of genetic diversity and phylogenetic analysis of hantavirus. A polynucleotide "derived from" a designated sequence refers to a polynucleotide sequence which comprises a contiguous sequence of approximately at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10-12 nucleotides, and even more preferably at least about 15-20 nucleotides corresponding, i.e., identical or complementary to, a region of the designated nucleotide sequence. The derived polynucleotide will not necessarily be derived physically from the nucleotide sequence of interest, but may be generated in any manner, including, but not limited to, chemical synthesis, replication, reverse transcription or transcription, which is based on the information provided by the sequence of bases in the region(s) from which the polynucleotide is derived. As such, it may represent either a sense or an antisense orientation of the original polynucleotide. "Recombinant" as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation is not associated with all or a portion of the polynucleotide with which it is associated in nature. The term "recombinant" as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide. In general, the gene of interest is cloned and then expressed in transformed organisms, as described further below. The host organism expresses the foreign gene to produce the protein under expression conditions.
As used herein, a "solid support" refers to a solid surface such as a magnetic bead, latex bead, microtiter plate well, glass plate, nylon, agarose, acrylamide, and the like. A "DNA-dependent DNA polymerase" is an enzyme that synthesizes a complementary DNA copy from a DNA template. Examples are DNA polymerase I from E. coli and bacteriophage T7 DNA polymerase. All known DNA-dependent DNA polymerases require a complementary primer to initiate synthesis. Under suitable conditions, a DNA-dependent DNA polymerase may synthesize a complementary DNA
copy from an RNA template.
A "DNA-dependent RNA polymerase" or a "transcriptase" is an enzyme that synthesizes multiple RNA copies from a double-stranded or partially-double stranded DNA molecule having a (usually double-stranded) promoter sequence. The RNA molecules ("transcripts") are synthesized in the 5' to 3' direction beginning at a specific position just downstream of the promoter. Examples of transcriptases are the DNA-dependent RNA polymerase from E. coli and bacteriophages T7, T3, and SP6.
An "RNA-dependent DNA polymerase" or "reverse transcriptase" is an enzyme that synthesizes a complementary DNA copy from an RNA template. All known reverse transcriptases also have the ability to make a complementary DNA copy from a DNA template; thus, they are both RNA- and DNA-dependent DNA polymerases. A primer is required to initiate synthesis with both RNA and DNA templates.
"RNAse H" is an enzyme that degrades the RNA portion of an RNA:DNA duplex. These enzymes may be endonucleases or exonucleases. Most reverse transcriptase enzymes normally contain an RNAse H activity in addition to their polymerase activity. However, other sources of the RNAse H are available without an associated polymerase activity. The degradation may result in separation of RNA from a RNA:DNA complex. Alternatively, the RNAse H may simply cut the RNA at various locations such that portions of the RNA melt off or permit enzymes to unwind portions of the RNA. As used herein, the term "target nucleic acid region" or "target nucleic acid" denotes a nucleic acid molecule with a "target sequence" to be amplified. The target nucleic acid may be either single-stranded or double-stranded and may include other sequences besides the target sequence, which may not be amplified. The term "target sequence" refers to the particular nucleotide sequence of the target nucleic acid which is to be amplified. The target sequence may include a probe-hybridizing region contained within the target molecule with which a probe will form a stable hybrid under desired conditions. The "target sequence" may also include the complexing sequences to which the oligonucleotide primers complex and extended using the target sequence as a template. Where the target nucleic acid is originally single-stranded, the term "target sequence" also refers to the sequence complementary to the "target sequence" as present in the target nucleic acid. If the "target nucleic acid" is originally double-stranded, the term "target sequence" refers to both the plus (+) and minus (-) strands (or sense and anti-sense strands).
The term "primer" or "oligonucleotide primer" as used herein, refers to an oligonucleotide that hybridizes to the template strand of a nucleic acid and serves as an initiation point for synthesis of a nucleic acid strand complementary to the template strand when placed under conditions in which synthesis of a primer extension product is induced, i.e., in the presence of nucleotides and a polymerization-inducing agent such as a DNA or RNA polymerase and at suitable temperature, pH, metal concentration, and salt concentration. The primer is preferably single-stranded for maximum efficiency in amplification, but may alternatively be double-stranded. If double-stranded, the primer can first be treated to separate its strands before being used to prepare extension products. This denaturation step is typically effected by heat, but may alternatively be carried out using alkali, followed by neutralization. Thus, a "primer" is complementary to a template, and complexes by hydrogen bonding or hybridization with the template to give a primer/template complex for initiation of synthesis by a polymerase, which is extended by the addition of covalently bonded bases linked at its 3' end complementary to the template in the process of DNA or RNA synthesis. Typically, hantavirus nucleic acids are amplified using at least one set of oligonucleotide primers comprising at least one "forward" primer and at least one "reverse" primer capable of hybridizing to regions of a hantavirus nucleic acid flanking the portion of the hantavirus nucleic acid to be amplified. A forward primer is in the 5' to 31 orientation complementary to the hantavirus negative sense genomic RNA strand. A reverse primer is in the reverse complement orientation and complementary to the antigenomic hantavirus template produced during replication or amplification of hantavirus nucleic acids.
The term "amplicon" refers to the amplified nucleic acid product of a PCR reaction or other nucleic acid amplification process (e.g., ligase chain reaction (LGR), nucleic acid sequence based amplification (NASBA), transcription-mediated amplification (TMA), Q- beta amplification, strand displacement amplification). Amplicons may comprise RNA or DNA depending on the technique used for amplification. For example, DNA amplicons may be generated by PCR or RT-PCR, whereas RNA amplicons may be generated by TMA or NASBA. As used herein, the term "probe" or "oligonucleotide probe" refers to a polynucleotide, as defined above, that contains a nucleic acid sequence complementary to a nucleic acid sequence present in the target nucleic acid analyte or the amplicon produced by amplification of the target. The polynucleotide regions of probes may be composed of DNA, and/or RNA, and/or synthetic nucleotide analogs. Probes may be labeled in order to
detect the target sequence. Such a label may be present at the 5' end, at the 3' end, at both the 5' and 3' ends, and/or internally. For example, when an "oligonucleotide probe" is to be used in a fluorogenic 5' nuclease assay, such as the TaqMan technique, the probe will typically contain at least one fluorescer and at least one quencher which is removed by the endonuclease or exonuclease activity of a polymerase used in the reaction in order to detect any amplified target oligonucleotide sequences. In this context, the oligonucleotide probe will have a sufficient number of phosphodiester linkages adjacent to its 5' end so that the 5' to 3' nuclease activity employed can efficiently degrade the bound probe to separate the fluorescers and quenchers. Additionally, the oligonucleotide probe will typically be derived from a sequence that lies between the regions of the target hybridizing to the forward and the reverse primers when used in a 5' nuclease assay. When an oligonucleotide probe is used in the TMA technique, it will be suitably labeled, as described below.
As used herein, the term "capture oligonucleotide" refers to an oligonucleotide that contains a nucleic acid sequence complementary to a nucleic acid sequence present in the target nucleic acid analyte such that the capture oligonucleotide can "capture" the target nucleic acid. One or more capture oligonucleotides can be used in order to capture the target analyte. The polynucleotide regions of a capture oligonucleotide may be composed of DNA, and/or RNA, and/or synthetic nucleotide analogs. By "capture" is meant that the analyte can be separated from other components of the sample by virtue of the binding of the capture molecule to the analyte. Typically, the capture molecule is associated with a solid support, either directly or indirectly.
It will be appreciated that the hybridizing sequences need not have perfect complementarity to provide stable hybrids. In many situations, stable hybrids will form where fewer than about 10% of the bases are mismatches, ignoring loops of four or more nucleotides. Accordingly, as used herein the term "complementary" refers to an oligonucleotide that forms a stable duplex with its "complement" under assay conditions, generally where there is about 90% or greater homology.
The terms "hybridize" and "hybridization" refer to the formation of complexes between nucleotide sequences which are sufficiently complementary to form complexes via Watson-Crick like base pairing. Where a primer "hybridizes" with target (template), such complexes (or hybrids) are sufficiently stable to serve the priming function required by, e.g., the DNA polymerase to initiate DNA synthesis.
The term "multiplexing" herein refers to an assay or other analytical method in which uses more than one probe, each probe having a distinguishably different detectable label to detect one or more unknown targets in a single test. By "distinguishably different detectable label" is meant that the signal from each label is distinguishable and uniquely identifiable from each of the other labels. For fluorescent labels, each of the distinguishably different detectable labels has at least one different fluorescence characteristic (for example excitation wavelength, emission wavelength, emission intensity, FWHM (full width at half maximum peak height), or fluorescence lifetime) from each of the other labels. By "plurality" is intended at least two.
As used herein, the term "binding pair" refers to first and second molecules that specifically bind to each other, such as complementary polynucleotide pairs capable of forming nucleic acid duplexes. "Specific binding" of the first member of the binding pair to the second member of the binding pair in a sample is evidenced by the binding of the first member to the second member, or vice versa, with greater affinity and specificity than to other components in the sample. The binding between the members of the binding pair is typically noncovalent
By "selectively bind" is meant that the molecule binds preferentially to the target of interest or binds with greater affinity to the target than to other molecules. For example, a DNA molecule will bind to a substantially complementary sequence and not to unrelated sequences. An oligonucleotide that "selectively binds" to or is "selective for" a particular type of hantavirus, such as a particular strain of hantavirus (e.g., HTNV, DOBV, SEOV, PUUV, SNV, and ANDV), denotes an oligonucleotide, e.g., a primer, probe or a capture oligonucleotide, that binds to the particular type of hantavirus, but does not bind to a sequence from other strains of hantavirus under the same conditions .
The terms "selectively detects" or "selectively detecting" refer to the detection of hantavirus nucleic acids using oligonucleotides, e.g., primers, probes and/or capture oligonucleotides that are capable of detecting a particular hantavirus nucleic acid, for example, by amplifying and/or binding to at least a portion of an RNA segment from a particular type of hantavirus, such as a particular hantavirus strain (e.g., HTNV, DOBV, SEOV, PUUV, SNV, and ANDV), but that do not amplify and/or bind to sequences from other strains of hantaviruses under the same hybridization conditions.
The "melting temperature" or "Tm" of double-stranded DNA is defined as the temperature at which half of the helical structure of DNA is lost due to heating or other
dissociation of the hydrogen bonding between base pairs, for example, by acid or alkali treatment, or the like. The Tn, of a DNA molecule depends on its length and on its base composition. DNA molecules rich in GC base pairs have a higher Tn, than those having an abundance of AT base pairs. Separated complementary strands of DNA spontaneously reassociate or anneal to form duplex DNA when the temperature is lowered below the Tm. The highest rate of nucleic acid hybridization occurs approximately 25 degrees C below the Tm. The Tn, may be estimated using the following relationship: Tm = 69.3 + 0.41(GC)% (Marmur et al. (1962) J. MoI. Biol. 5:109-118).
As used herein, a "biological sample" refers to a sample of tissue or fluid isolated from a subject, including but not limited to, for example, blood, plasma, serum, fecal matter, urine, bone marrow, bile, spinal fluid, lymph fluid, samples of the skin, external secretions of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, organs, biopsies and also samples of w? vitro cell culture constituents including but not limited to conditioned media resulting from the growth of cells and tissues in culture medium, e.g., recombinant cells, and cell components. In particular, hantavirus may be obtained from biological samples such as blood, plasma, serum, fecal matter, urine, or lung tissue from an individual infected with the virus.
As used herein, the terms "label" and "detectable label" refer to a molecule capable of detection, including, but not limited to, radioactive isotopes, fluorescers, chemiluminescers, chromophores, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, semiconductor nanoparticles, dyes, metal ions, metal sols, ligands (e.g., biotin, strepavidin or haptens) and the like. The term "fluorescer" refers to a substance or a portion thereof which is capable of exhibiting fluorescence in the detectable range. Particular examples of labels which may be used under the invention include, but are not limited to, horse radish peroxidase (HRP), SYBR® green, SYBR® gold, fluorescein,
FITC, rhodamine, dansyl, umbelliferone, dimethyl acridinium ester (DMAE), Texas red, 6-carboxyfluorescein (FAM), tetramethyl rhodamine (TAMRA), 2', 4', 5', T- tetrachloro- 4-7-dichIorofluorescein (TET), Cy5, CAL GOLD, luminol, NADPH and α-β- galactosidase. By "vertebrate subject" is meant any member of the subphylum chordata, including, without limitation, humans and other primates, including non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs; birds, including domestic,
wild and game birds such as chickens, turkeys and other gallinaceous birds, ducks, geese, and the like. The term does not denote a particular age. Thus, both adult and newborn individuals are intended to be covered.
2. MODES OF CARRYING OUT THE INVENTION
Before describing the present invention in detail, it is to be understood that this invention is not limited to particular formulations or process parameters as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting.
Although a number of methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the preferred materials and methods are described herein.
The present invention is based on the discovery of reagents and methods for diagnosing infection caused by hantaviruses, including the human pathogenic hantaviruses (e.g., strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV) by the detection of hantavirus nucleic acids. The methods are useful for detecting hantavirus in biological samples such as saliva, sputum, or blood samples, including without limitation, in whole blood, serum and plasma. Thus, the methods can be used to diagnose hantavirus infection in a subject, as well as to detect hantavirus contamination in donated blood samples. Aliquots from individual donated samples or pooled samples can be screened for the presence of hantavirus and those samples or pooled samples contaminated with hantavirus can be eliminated before they are combined. In this way, a blood supply substantially free of hantavirus contamination can be provided. The methods use oligonucleotide reagents (e.g., oligonucleotide primers, probes, and optionally capture oligonucleotides) or a combination of reagents capable of detecting and identifying one or more pathogenic hantaviruses in a single multiplex assay. In one format, sets of primer pairs (i.e., a forward primer and reverse primer) and probes are highly selective for a particular hantavirus, and are capable of selectively amplifying and/or detecting and/or binding to a particular RNA segment, or an amplicon produced therefrom, from one of the hantavirus strains (e.g., strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV). These highly selective primers, probes, and optionally capture
oligonucleotides can be used alone or in combination to detect and discriminate one or more hantaviruses in a single assay.
There are a number of assay designs that can be used to detect human pathogenic hantavirus strains alone or in combination with each other. In one embodiment, the nucleic acid from one or more strains can be amplified and detected simultaneously by using a combination of sets of strain-specific primers and probes in a multiplex-type assay format. For example, a plurality of primers and probes can be used to amplify and detect one or more pathogenic and non-pathogenic strains. The presence of the amplified nucleic acids can be detected using a plurality of detectably labeled oligonucleotide probes, each probe having a distinguishably different detectable label, wherein each probe selectively hybridizes to the RNA or amplicon thereof from one strain of hantavirus, if present, as an indication of the presence or absence of that hantavirus strain in the sample. Alternatively, a single pathogenic strain (e.g., HTNV, DOBV, SEOV, PUUV, SNV, and ANDV) can be amplified with strain-specific primers and detected with the corresponding strain-specific probes.
The probes and primers may be designed from conserved nucleotide regions of the polynucleotides of interest or from non-conserved nucleotide regions of the polynucleotide of interest. Generally, nucleic acid probes are developed from non-conserved or unique regions when maximum specificity is desired, and nucleic acid probes are developed from conserved regions when assaying for nucleotide regions that are closely related to, for example, different hantavirus isolates.
Oligonucleotides for use in the assays described herein can be derived from any of the various regions of the hantavirus genome, including from any of the three segments S, M, or L. Preferably, the primers and probes are derived from sequences of the S genome segment. Representative sequences from hantavirus isolates found in various species of rodents, humans, and other mammals are listed herein. Thus, primers, probes and capture oligonucleotides for use in hantavirus detection include those derived from one or more of the three genomic segments from any pathogenic hantavirus strain or isolate.
Representative sequences from the genomes of different hantavirus strains are known and can be found in the National Center for Biotechnology Information (NCBI) database See, for example, GenBank entries: Seoul virus 80-39 segment M, GenBank Accession No. NC_005237; Seoul virus 80-39 glycoprotein precusor gene, GenBank Accession No. S47716; Dobrava virus segment L, GenBank Accession No. NC_005235; Dobrava virus segment M, GenBank Accession No. NC 005234; Dobrava virus segment S, GenBank
Accession No. NC_005233; Hantaan virus segment M, GenBank Accession No. NC_005219; Hantaan virus segment S, GenBank Accession No. NC_005218; Hantaan virus segment L, GenBank Accession No. NC_005222; Seoul virus segment L, GenBank Accession No. NC_005238; Seoul virus strain 80-39 segment S, GenBank Accession No. NC_005236; Sin Nombre virus segment M, GenBank Accession No. NC_OO5215; Sin Nombre virus, GenBank Accession No. NC_005217; Sin Nombre virus segment S, GenBank Accession No. NC_005216; Puumala virus segment L, GenBank Accession No. NC 005225; Puumala virus segment S, GenBank Accession No. NC_005224; Puumala virus segment M, GenBank Accession No. NC_005223; Andes virus segment L, GenBank Accession No. NC 003468; Andes virus segment M, GenBank Accession No. NC 003467; Andes virus segment S, GenBank Accession No. NC_003466; Seoul virus 80-39 L gene for RNA-dependent RNA polymerase, genomicRNA, Accession X56492; Hantaan virus S segment encoding nucleocapsid protein; Accession M 14626; Hantaan virus, complete M RNA segment coding for Gl and G2 proteins, complete cds, Accession M14627; Hantaan virus gene for putative polymerase, genomic RNA, Accession X55901; Puumala virus CG 1820 segment S nucleocapsid protein mRNA, 5' end, Accession M32750; Puumala virus CGl 820 virus M genome segment, complete cds, Accession M29979; Puumala virus CGl 820 RNA-dependent RNA polymerase gene in L RNA segment, Accession M63194; Seoul virus strain 80-39 segment S, complete sequence, Accession AY273791 ; Seoul virus 80-39 glycoprotein precusor gene, complete cds,
Accession S47716; Sin Nombre virus S segment nucleocapsid protein gene, complete cds, Accession L25784; Sin Nombre virus M segment glycoprotein precursor gene (GPC), complete cds, Accession L25783; Sin Nombre virus (NM HlO) RNA L segment encoding RNA polymerase (L protein), complete cds, Accession L37901 ; Andes virus strain Chile- 9717869 segment S nucleocapsid protein gene, complete cds, Accession AF291702;
Andes virus strain Chile-9717869 segment M Gl and G2 surface glycoprotein precursor, gene, complete cds, Accession AF291703; Andes virus strain Chile-9717869 segment L, complete sequence, Accession AF291704.
In a preferred embodiment of the method of invention, multiple sets of primers and probes are used, each set being selective for a different hantavirus strain. In particular, for the detection of Hantaan virus a set of primers comprising a forward primer comprising the sequence of SEQ ID NO: 1 and a reverse primer comprising the sequence of SEQ ID NO:3 (HTNV primers) is preferred; for the detection of Puumala virus a set of primers comprising a forward primer comprising the sequence of SEQ ID NO:4 and a reverse
primer comprising the sequence of SEQ ID NO:6 (PUUV primers) is preferred; for the detection of Seoul virus a set of primers comprising a forward primer comprising the sequence of SEQ ID NO:7 and a reverse primer comprising the sequence of SEQ ID NO:9 (SEOV primers) is preferred; for the detection of Dobrava virus a set of primers comprising a forward primer comprising the sequence of SEQ ID NO: 10 and a reverse primer comprising the sequence of SEQ ID NO: 12 (DOBV primers) is preferred; for the detection of Andes virus a set of primers comprising a forward primer comprising the sequence of SEQ ID NO: 13 and a reverse primer comprising the sequence of SEQ ID NO: 15 (ANDV primers) is preferred; and for the detection of Sin Nombre virus a set of primers comprising a forward primer comprising the sequence of SEQ ID NO: 16 and a reverse primer comprising the sequence of SEQ ID NO: 19 (SNV primers) is preferred. The selective primers sets described above can be used singly (i.e., a single set of primers) or can preferably be used in combinations of 2, 3, 4, 5 or 6 primer sets to amplify hantavirus nucleic acid targets. The amplified targets can be detected by conventional techniques, for example, gel electrophoresis, ethidium bromide staining, Southern blotting, melting curve analysis using intercalating dyes, hybridization with specific labeled probes, etc. Thus, in a single assay, the presence in the sample of nucleic acid from any of the hantavirus strains corresponding to the selective primer sets used will produce a positive signal. This is suitable for analysis of samples for which it is desired only to determine the presence of a hantavirus from among the group HTNV, PUUV, SEOV, DOBV, ANDV and SNV and not necessarily to identify the particular strain present.
If identification (selective detection) of the particular Hantavirus strain or strains present in a sample is desirable, the strain-specific primer sets described above are used with strain-specific probes. The strain specific probes are provided with distinguishably different detectable labels. Thus, to identify Hantaan virus nucleic acid present in a sample a set of primers and probe comprising a forward primer comprising the sequence of SEQ ID NO:1, a reverse primer comprising the sequence of SEQ ID NO:3, and a probe comprising the sequence of SEQ ID NO:2 (HTNV primer/probe set) is preferred; for the identification of Puumala virus nucleic acid, a set of primers and probe comprising a forward primer comprising the sequence of SEQ ID NO:4, a reverse primer comprising the sequence of SEQ ID NO:6, and a probe comprising SEQ ID NO:5 (PUUV primer/probe set) is preferred; for the identification of Seoul virus nucleic acid, a set of primers and probe comprising a forward primer comprising the sequence of SEQ ID NO:7, a reverse primer comprising the sequence of SEQ ID NO:9, and a probe
comprising the sequence of SEQ ID NO:8 (SEOV primer/probe set) is preferred; for the identification of Dobrava virus nucleic acid, a set of primers and probe comprising a forward primer comprising the sequence of SEQ ID NO: 10, a reverse primer comprising the sequence of SEQ ID NO: 12, and a probe comprising the sequence of SEQ ID NO: 11 (DOBV primers) is preferred; for the identification of Andes virus nucleic acid, a set of primers and probe comprising a forward primer comprising the sequence of SEQ ID NO: 13, a reverse primer comprising the sequence of SEQ ID NO: 15, and a probe comprising SEQ ID NO: 14 (ANDV primer/probe set) is preferred; and for the identification of Sin Nombre virus a set of primers and probe comprising a forward primer comprising the sequence of SEQ ID NO: 16, a reverse primer comprising the sequence of SEQ ID NO: 19, and a probe comprising SEQ ID NO: 17 (SNV primer/probe set) is preferred. The strain specific primer/probe sets can be used singly or preferably are used in combinations of 2, 3, 4, 5, or 6 primer/probe sets in a multiplex assay. The particular sets used will depend on the particular strain or strains of hantavirus that are suspected to be present in the sample. In situations in which there is little information on the hantavirus present, the use of all or most of the above primer/probe sets in combination will provide the greatest chance of identifying the particular hantavirus(es) in the sample. Thus, in a single assay, using a combination of all 6 strain-specific primer/probe sets in the methods described herein, it is possible to detect the presence and determine the identity of any of six of the most prevalent pathogenic hantavirus strains.
Primers, probes and capture oligonucleotides for use in the assays herein are derived from these sequences and are readily synthesized by standard techniques, e.g., solid phase synthesis via phosphoramidite chemistry, as disclosed in U.S. Patent Nos. 4,458,066 and 4,415,732, incorporated herein by reference; Beaucage et al., Tetrahedron (1992) 48:2223-231 1; and Applied Biosystems User Bulletin No. 13 (1 April 1987). Other chemical synthesis methods include, for example, the phosphotriester method described by Narang et al., Meth. Enzymol. (1979) 68:90 and the phosphodiester method disclosed by Brown et al., Meth. Enzymol. (1979) 68:109. PoIy(A) or poly(C), or other non-complementary nucleotide extensions may be incorporated into oligonucleotides using these same methods. Hexaethylene oxide extensions may be coupled to the oligonucleotides by methods known in the art. Cload et al., J. Am. Chem. Soc. (1991) 111:6324-6326; U.S. Patent No. 4,914,210 to Levenson et al.; Durand et al., Nucleic Acids Res. (1990) 18:6353-6359; and Horn et al., Tet. Lett. (1986) 27:4705-4708.
Typically, the primer oligonucleotides are in the range of between 10-100 nucleotides in length, such as between IS and 60, between 20 and 40 and so on, more typically in the range of between 17 and 30 nucleotides long, and any length between the stated ranges. In certain embodiments, a primer oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 18, and SEQ ID NO: 19; or a fragment thereof comprising at least about 6 contiguous nucleotides, preferably at least about 8 contiguous nucleotides, more preferably at least about 10, 11, 12, 13 or 14 contiguous nucleotides, and even more preferably at least about 15, 16, 17, 18, 19, or 20 contiguous nucleotides; or a variant thereof comprising a sequence having at least about 80-100% sequence identity thereto, including any percent identity within this range, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% sequence identity thereto. In those instances in which the primer comprises nucleotides in addition to those nucleotides in the specified SEQ ID NOs, preferably the additional nucleotides will be present at the 5' end of the primer oligonucleotide. In this way, the sequence at the 3' end of the oligonucleotide primer (which is the end that is extended during the amplification/polymerase reaction) is preferably the sequence of the recited SEQ ID NOs. In a typical amplification reaction to produce a double-stranded amplicon, a set of two primers is used, one primer capable of hybridizing to each strand and of being extended from the 3' end in a direction toward the hybridization site of the other primer. The primers in a set are often referred to, inter alia, as the "forward" and "reverse" primers or the "sense" and "anti-sense" primers. In the present invention, the preferred primer sets comprise the following combinations of primers: (a) a forward primer comprising the sequence of SEQ ID NO:1 and a reverse primer comprising the sequence of SEQ ID NO:3, (b) a forward primer comprising the sequence of SEQ ID NO:4 and a reverse primer comprising the sequence of SEQ ID NO:6, (c) a forward primer comprising the sequence of SEQ ID NO:7 and a reverse primer comprising the sequence of SEQ ID NO:9, (d) a forward primer comprising the sequence of SEQ ID NO: 10 and a reverse primer comprising the sequence of SEQ ID NO: 12, (e) a forward primer comprising the sequence of SEQ ID NO: 13 and a reverse primer comprising the sequence of SEQ ID NO: 15, (f) a forward primer comprising the sequence of SEQ ID NO: 16 and a reverse primer comprising the sequence of SEQ ID NO: 19; (g) a forward primer and a reverse primer each comprising at least 10 contiguous nucleotides from the corresponding
nucleotide sequences of the forward primer and reverse primer of a primer set selected from the group consisting of (a) through (f); and (h) a forward primer and a reverse primer comprising nucleotide sequences having at least 90% sequence identities to the corresponding nucleotide sequences of the forward primer and reverse primer of a primer set selected from the group consisting of (a) through (f).
The typical probe oligonucleotide is in the range of between 10-100 nucleotides long, such as between 10 and 60, preferably between 15 and 40, more preferably between 20 and 35, and any length between the stated ranges. In certain embodiments, a probe oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO: 14, and SEQ ID NO: 17; or a fragment thereof comprising at least about 6 contiguous nucleotides, preferably at least about 8 contiguous nucleotides, more preferably at least about 10, 1 1, 12, 13 or 14 contiguous nucleotides, and even more preferably at least about 15, 16, 17, 18, 19, or 20 contiguous nucleotides; or a variant thereof comprising a sequence having at least about 80- 100% sequence identity thereto, including any percent identity within this range, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% sequence identity thereto.
In a typical amplification reaction, the probes are preferably used in combination with one or more pairs of primers. It will be apparent to one of skill in the art that the probe selected will be derived from the same hantaviral strain as the primer set used for the amplifying step. In a positive sample, the probe will hybridize with the amplicon produced in the amplification reaction using the related primer pair (i.e., the primer pair that is specific to the same hantavirus strain). Preferred combinations of probes and primers include (a) a primer comprising the sequence of SEQ ID NO:1, a primer comprising the sequence of SEQ ID NO:3, and a probe comprising the sequence of SEQ ID NO:2, (b) a primer comprising the sequence of SEQ ID NO:4, a primer comprising the sequence of SEQ ID NO:6, and a probe comprising the sequence of SEQ ID NO:5, (c) a primer comprising the sequence of SEQ ID NO:7, a primer comprising the sequence of SEQ ID NO:9, and a probe comprising the sequence of SEQ ID NO:8, (d) a primer comprising the sequence of SEQ ID NO: 10, a primer comprising the sequence of SEQ ID NO: 12, and a probe comprising the sequence of SEQ ID NO:1 1, (e) a primer comprising the sequence of SEQ ID NO: 13, a primer comprising the sequence of SEQ ID NO: 15, and a probe comprising the sequence of SEQ ID NO: 14, and (f) a primer comprising the
sequence of SEQ ID NO: 16, a primer comprising the sequence of SEQ ID NO: 19, and a probe comprising the sequence of SEQ ID NO: 17.
Moreover, the oligonucleotides, particularly the probe oligonucleotides, may be coupled to labels for detection. There are several means known for derivatizing S oligonucleotides with reactive functionalities which permit the addition of a label. For example, several approaches are available for biotinylating probes so that radioactive, fluorescent, chemiluminescent, enzymatic, or electron dense labels can be attached via avidin. See, e.g., Broken et al., Nucl. Acids Res. (1978) 5:363-384 which discloses the use of ferritin-avidin-biotin labels; and Chollet et al., Nucl. Acids Res. (1985) ϋ: 1529-15410 which discloses biotinylation of the 5' termini of oligonucleotides via an aminoalkylphosphoramide linker arm. Several methods are also available for synthesizing amino-derivatized oligonucleotides which are readily labeled by fluorescent or other types of compounds derivatized by amino-reactive groups, such as isothiocyanate, N- hydroxysuccinimide, or the like, see, e.g., Connolly, Nucl. Acids Res. (1987) 15:3131-5 3139, Gibson et al. Nucl. Acids Res. (1987) 15:6455-6467 and U.S. Patent No. 4,605,735 to Miyoshi et al. Methods are also available for synthesizing sulfhydryl-derivatized oligonucleotides which can be reacted with thiol-specific labels, see, e.g., U.S. Patent No. 4,757,141 to Fung et al., Connolly et al., Nucl. Acids Res. (1985) 13:4485-4502 and Spoat et al. Nucl. Acids Res. (1987) 15:4837-4848. A comprehensive review of methodologies0 for labeling DNA fragments is provided in Matthews et al., Anal. Biochem. (1988) 169: 1- 25.
For example, oligonucleotides may be fluorescently labeled by linking a fluorescent molecule to the non-ligating terminus of the molecule. Guidance for selecting appropriate fluorescent labels can be found in Smith et al., Meth. Enzymol. (1987)5 155:260-301 ; Karger et al., Nucl. Acids Res. (1991) 19:4955-4962; Haugland (1989) Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Inc., Eugene, OR). Suitable fluorescent labels include fluorescein and derivatives thereof, such as disclosed in U.S. Patent No. 4,318,846 and Lee et al., Cytometry (1989) K): 151-164. Dyes for use in the present invention include 3-phenyl-7-isocyanatocoumarin, acridines,0 such as 9-isothiocyanatoacridine and acridine orange, pyrenes, benzoxadiazoles, and stilbenes, such as disclosed in U.S. Patent No.4, 174,384. Additional dyes include SYBR® green, SYBR® gold, Yakima Yellow™, Texas Red®, 3-(ε-carboxypentyl)-3'-ethyl-5,5'- dimethyloxa-carbocyanine (CYA); 6-carboxy fluorescein (FAM); 5,6-carboxyrhodamine- 1 10 (Rl 10); 6-carboxyrhodamtne-6G (R6G); N',N',N',N'-tetramethyl-6-carboxyrhodamine
(TAMRA); 6-carboxy-X-rhodamine (ROX); 2', 4', 5', T, - tetrachloro-4-7- dichlorofluorescein (TET); 2\ T- dimethoxy - 4', 5'- 6 carboxyrhodamine (JOE); 6- carboxy^'^^'.S'JJ'-hexachlorofluorescein (HEX); ALEXA; VIC, CAL GOLD, Cy3 and Cy5. These dyes are commercially available from various suppliers such as Applied Biosystems Division of Perkin Elmer Corporation (Foster City, Calif.), Amersham
Biosciences (Sunnyvale Calif.) and Molecular Probes, Inc. (Eugene, Oregon). Preferred fluorescent labels for use with the present invention include fluorescein and derivatives thereof, such as disclosed in U.S. Patent No.4,318,846 and Lee et al., Cytometry (1989) 10:151-164, and FAM, CAL GOLD, Cy5, JOE, TAMRA5 ROX, HEX-I, HEX-2, ZOE, TET-I or NAN-2, and the like. When used to label the oligonucleotide probes in the multiplex assay of the present invention, the label chosen will be distinguishably different from each other. Generally, this will take the form of a distinguishable excitation or emission spectrum, such that the particular label present in the probe(s) that hybridizes to the ampHcon(s) produced can be identified and thus the hantavirus(es) present in the sample can be indentified.
Oligonucleotides can also be labeled with a minor groove binding (MGB) molecule, such as disclosed in U.S. Patent No. 6,884,584, U.S. Patent No. 5,801,155; Afonina et al. (2002) Biotechniques 32:940-944, 946-949; Lopez-Andreo et al. (2005) Anal. Biochem. 339:73-82; and Belousov et al. (2004) Hum Genomics 1 :209-217. Oligonucleotides having a covalently attached MGB are more sequence specific for their complementary targets than unmodified oligonucleotides. In addition, an MGB group increases hybrid stability with complementary DNA target strands compared to unmodified oligonucleotides, allowing hybridization with shorter oligonucleotides.
Additionally, oligonucleotides can be labeled with an acridinium ester (AE) using the techniques described below. Current technologies allow the AE label to be placed at any location within the probe. See, e.g., Nelson et al., (1995) "Detection of Acridinium Esters by Chemiluminescence" in Nonisotopic Probing, Blotting and Sequencing, Kricka L.J.(ed) Academic Press, San Diego, CA; Nelson et al. (1994) "Application of the Hybridization Protection Assay (HPA) to PCR" in The Polymerase Chain Reaction, Mullis et al. (eds.) Birkhauser, Boston, MA; Weeks et al., Clin. Chem. (1983) 29: 1474- 1479; Berry et al., Clin. Chem. (1988) 34:2087-2090. An AE molecule can be directly attached to the probe using non-nucleotide-based linker arm chemistry that allows placement of the label at any location within the probe. See, e.g., U.S. Patent Nos. 5,585,481 and 5,185,439.
Representative hantavirus probes and primers derived from the S segments of hantavirus strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV for use in the various assays are shown in Example 4 in Table 2. The oligonucleotides labeled as HTNV, DOBV, SEOV, PUUV, SNV, and ANDV-specific are oligonucleotides that selectively amplify, detect, and/or hybridize to HTNV, DOBV, SEOV, PUUV, SNV, and ANDV nucleic acids, respectively, and can therefore be used to specifically identify these viruses in the assays described herein. The specific primer and probe sets can be used in combinations of 2, 3, 4, 5 or 6 sets. Preferably, each probe has a distinguishably different label such that the particular strain of hantaviral target being amplified is immediately apparent by the probe label that appears. If multiple hantavirus strains are present in the sample, multiple probe labels will appear and each will be distinguishable from the others. Preferably, all 6 sets are used, with each probe having a different distinguishable label. In practice, the number of different probes that can be distinguished may depend upon the capacity of the detection instrument. Accordingly, for example, HTNV-specific oligonucleotides (that is, primers and probes) could be used in combination with DOBV-specific oligonucleotides in order to determine the presence of either HTNV or DOBV using a single test. Similarly, SEOV- specific oligonucleotides, PUUV-specifϊc oligonucleotides, and HTNV-specific oligonucleotides could be used in combination in order to determine the presence of SEOV, PUUV or HTNV using a single test. Alternatively, ANDV-specific oligonucleotides, PUUV-specifϊc oligonucleotides, and HTNV-specific oligonucleotides could be used in combination in order to test for the presence of ANDV, PUUV or HTNV in a single assay. Alternatively, DOBV-specific oligonucleotides, PUUV-specific oligonucleotides, and ANDV-specific oligonucleotides could be used in combination in order to test for the presence of DOBV, PUUV or ANDV in a single assay. Alternatively, HTNV-specific oligonucleotides, SNV-specific oligonucleotides, and PUUV-specific oligonucleotides could be used in combination in order to test for the presence of HTNV, SNV or PUUV in a single assay. In a further example, strain specific primers and probes from all six hantavirus strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV, could be used in combination in order to test for the presence of any of these strains in a single assay. The above combinations are illustrative only and not intended to be limiting. The skilled practicioner could readily determine other useful combinations of the primer pairs and probe sets.
Although the primary and preferred use of the oligonucleotide primers, oligonucleotide probes and capture oligonucleotides are as described herein, oligonucleotides designated as primers herein, may be used as probes or capture oligonucleotides, and probes may be used as primers or capture oligonucleotides. One of skill in the art can readily determine appropriate primer and probe pairs, and optionally capture oligonucleotides, to use in order to detect hantavirus infection.
The present invention provides a method of detecting a hantavirus infection in a subject by detecting the presence of hantavirus nucleic acid, primarily hantavirus RNA, in a biological sample from said subject. The method provides the steps of isolating the nucleic acids from the sample, amplifying the nucleic acids by contacting the nucleic acids with one or more sets of forward and reverse primer pairs as described herein, and detecting the amplified nucleic acid, if present. The nucleic acids are isolated from the sample by any suitable method. Many such methods are well-known in the art and can readily be determined by one of ordinary skill! in the art. One preferred method is described in US Patent No. 5,234,809. This method uses a silica reagent in the presence of a chaotropic compound to bind nucleic acid. An improved version of this method uses magnetized silica, which can be readily separated with the bound nucleic acid from the rest of the sample components. Kits for isolation of nucleic acid for biological samples are available from numerous manufacturers and any of these will be suitable for use in the present method.
The amplifying of the isolated nucleic acid is accomplished by any of a number of well-known amplification methods, for example, polymerase chain reaction (PCR), reverse transcriptase PCR (RT-PCR), transcription mediated amplification, NASBA, and the like. One particularly preferred amplification technique is the TaqMan method which uses a polymerase that also has 5' nuclease activity in conjunction with probes labeled with a fluorescer and a quencher (See, e.g., Holland et al 1991 Proc. Natl Acad. Sci. 88:7276; Heid et al. 1996 Genome Res. 6:986). Use of the TaqMan technique provides for both amplification and detection. Strain-specific sets of forward primers and reverse primers for amplifying each of HTNV, PUUV, DOBV, SEOV, ANDV and SNV nucleic acids have been described herein. The strain-specific primer sets will selectively amplify the nucleic acid from the hantavirus strain for which it was designed and not from other hantavirus strains. The amplified nucleic acid, if present, can be detected by a nonspecific detection method, such as ethidium bromide staining, or may be detected by the
binding of a strain-specific probe. Preferably , the amplified nucleic acid will be detected by the binding of a strain-specific probe.
When utilizing a hybridization-based detection system, a nucleic acid probe is chosen that is complementary to a target nucleic acid sequence. By selection of appropriate conditions, the probe and the target sequence "selectively hybridize," or bind, to each other to form a hybrid molecule. An oligonucleotide that "selectively hybridizes" to a particular hantavirus sequence from a particular hantavirus strain (e.g., HTNV, DOBV, SEOV, PUUV, SNV, and ANDV) under hybridization conditions described below, denotes an oligonucleotide, e.g., a primer, probe or a capture oligonucleotide, that binds to the hantavirus sequence of that particular strain but does not bind to a sequence from a hantavirus of a different strain.
In one embodiment of the present invention, a nucleic acid molecule is capable of binding selectively to a target sequence under moderately stringent hybridization conditions. In the context of the present invention, moderately stringent hybridization conditions allow detection of a target nucleic acid sequence of at least 14 nucleotides in length having at least approximately 70% sequence identity with the sequence of the selected nucleic acid probe. In another embodiment, such selective hybridization is performed under stringent hybridization conditions. Stringent hybridization conditions allow detection of target nucleic acid sequences of at least 14 nucleotides in length having a sequence identity of greater than 90% with the sequence of the selected nucleic acid probe. Hybridization conditions useful for probe/target hybridization where the probe and target have a specific degree of sequence identity, can be determined as is known in the art (see, for example, Nucleic Acid Hybridization: A Practical Approach, editors B.D. Hames and S.J. Higgins, (1985) Oxford; Washington, DC; IRL Press). Hybrid molecules can be formed, for example, on a solid support, in solution, and in tissue sections. The formation of hybrids can be monitored by inclusion of a reporter molecule, typically, in the probe. Such reporter molecules, or detectable labels include, but are not limited to, radioactive elements, fluorescent markers, and molecules to which an enzyme-conjugated ligand can bind. With respect to stringency conditions for hybridization, it is well known in the art that numerous equivalent conditions can be employed to establish a particular stringency by varying, for example, the following factors: the length and nature of probe and target sequences, base composition of the various sequences, concentrations of salts and other hybridization solution components, the presence or absence of blocking agents in the
hybridization solutions (e.g., formamide, dβxtran sulfate, and polyethylene glycol), hybridization reaction temperature and time parameters, as well as, varying wash conditions. The selection of a particular set of hybridization conditions is well known (see, for example, Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, (1989) Cold Spring Harbor, N. Y.).
As explained above, the primers and probes can be used in polymerase chain reaction (PCR)-based techniques, such as RT-PCR, to detect the presence of hantaviral nucleic acid (which can be indicative of hantavirus infection) in biological samples. PCR is a technique for amplifying a desired target nucleic acid sequence contained in a nucleic acid molecule or mixture of molecules. In PCR, a pair of primers is employed in excess to hybridize to the complementary strands of the target nucleic acid. The primers are each extended by a polymerase using the target nucleic acid as a template. The extension products become target sequences themselves after dissociation from the original target strand. New primers are then hybridized and extended by a polymerase, and the cycle is repeated to geometrically increase the number of target sequence molecules. The PCR method for amplifying target nucleic acid sequences in a sample is well known in the art and has been described in, e.g., Innis et al. (eds.) PCR Protocols (Academic Press, NY 1990); Taylor (1991) Polymerase chain reaction: basic principles and automation, in PCR: A Practical Approach, McPherson et al. (eds.) IRL Press, Oxford; Saiki et al. (1986) Nature 324:163; as well as in U.S. Patent Nos. 4,683,195, 4,683,202 and 4,889,818, all incorporated herein by reference in their entireties.
In particular, PCR uses relatively short oligonucleotide primers which flank the target nucleotide sequence to be amplified, oriented such that their 3' ends face each other, each primer extending toward the other. The polynucleotide sample is extracted and denatured, preferably by heat, and hybridized with first and second primers that are present in molar excess. Polymerization is catalyzed in the presence of the four deoxyribonucleotide triphosphates (dNTPs - dATP, dGTP, dCTP and dTTP) using a primer- and template-dependent polynucleotide polymerizing agent, such as any enzyme capable of producing primer extension products, for example, E. coli DNA polymerase I, Klenow fragment of DNA polymerase I, T4 DNA polymerase, thermostable DNA polymerases isolated from Thermus aquaticus (Taq), available from a variety of sources (for example, Perkin Elmer), Thermus thermophilus (United States Biochemicals), Bacillus stereothermophilus (Bio-Rad), or Thermococcus litoralis ("Vent" polymerase, New England Biolabs). This results in two "long products" which contain the respective
primers at their 5' ends covalently linked to the newly synthesized complements of the original strands. The reaction mixture is then returned to polymerizing conditions, e.g., by lowering the temperature, inactivating a denaturing agent, or adding more polymerase, and a second cycle is initiated. The second cycle provides the two original strands, the two long products from the first cycle, two new long products replicated from the original strands, and two "short products" replicated from the long products. The short products have the sequence of the target sequence with a primer at each end. On each additional cycle, an additional two long products are produced, and a number of short products equal to the number of long and short products remaining at the end of the previous cycle. Thus, the number of short products containing the target sequence grows exponentially with each cycle. Preferably, PCR is carried out with a commercially available thermal cycler, e.g., Perkin Elmer.
RNAs may be amplified by reverse transcribing the RNA into cDNA, and then performing PCR (RT-PCR), as described above. Alternatively, a single enzyme may be used for both steps as described in U.S. Patent No. 5,322,770, incorporated herein by reference in its entirety. RNA may also be reverse transcribed into cDNA, followed by asymmetric gap ligase chain reaction (RT-AGLCR) as described by Marshall et al. (1994) PCR Melh App. 4:80-84.
The fluorogenic 5' nuclease assay, known as the TaqMan™ assay (Perkin-Elmer), is a powerful and versatile PCR-based detection system for nucleic acid targets. Hence, the hantavirus strain specific primer and probe sets described herein can be used in TaqMan™ analyses to detect the presence of infection in a biological sample. Analysis is performed in conjunction with thermal cycling by monitoring the generation of fluorescence signals. The assay system dispenses with the need for gel electrophoretic analysis, and is capable of generating quantitative data allowing the determination of target copy numbers. For example, standard curves can be produced using serial dilutions of previously quantified hantaviral suspensions. A standard graph can be produced with copy numbers of each of the panel members against which sample unknowns can be compared. The fluorogenic 5" nuclease assay is conveniently performed using, for example,
AmpliTaq Gold™ DNA polymerase, which has endogenous 5' nuclease activity, to digest an internal oligonucleotide probe labeled with both a fluorescent reporter dye and a quencher (see, Holland et al., Proc. Natl. Acad.Sci. USA (1991) 88:7276-7280; Heid et al.
(1996) supra, and Lee et al., Nucl. Acids Res. (1993) 21:3761-3766). Assay results are detected by measuring changes in fluorescence that occur during the amplification cycle as the fluorescent probe is digested, uncoupling the dye and quencher labels and causing an increase in the fluorescent signal that is proportional to the amplification of target nucleic acid.
The amplification products can be detected in solution or using solid supports. In this method, the TaqMan™ probe is designed to hybridize to a target sequence within the desired PCR product. The 5' end of the TaqMan™ probe contains a fluorescent reporter dye. The 3" end of the probe is blocked to prevent probe extension and contains a dye that will quench the fluorescence of the 5' fluorophore (quencher). During subsequent amplification, the 5' fluorescent label is cleaved off if a polymerase with 51 exonuclease activity is present in the reaction. The reporter label is thus removed from the quencher and results in an increase in fluorescence that can be detected.
For a detailed description of the TaqMan™ assay, reagents and conditions for use therein, see, e.g., Holland et al., Proc. Natl. Acad. Sci, U.S.A. (1991) 88:7276-7280; U.S. Patent Nos. 5,538,848, 5,723,591, and 5,876,930, all incorporated herein by reference in their entireties.
A relatively new class of quenchers, known as "Black Hole Quenchers" such as BHQl and BHQ2, can be used in the nucleic acid assays described above. These quenchers reduce background and improve signal to noise in PCR assays. These quenchers are described in, e.g., Johansson et al., J. Chem. Soc. (2002) 124:6950-6956 and are commercially available from Biosearch Technologies (Novato, CA).
Accordingly, the present invention relates to methods for amplifying a target hantavirus nucleotide sequence using a nucleic acid polymerase having 5' to 3' nuclease activity, one or more primers capable of hybridizing to the hantavirus target sequence, and an oligonucleotide probe capable of hybridizing to the amplified hantavirus target sequence. During amplification, the polymerase digests the oligonucleotide probe when it is hybridized to the target sequence, thereby separating the reporter molecule from the quencher molecule. As the amplification is conducted, the fluorescence of the reporter molecule is monitored, with fluorescence corresponding to the occurrence of nucleic acid amplification. In the practice of the present invention, the oligonucleotide probes specific for each strain of hantavirus preferably will be labeled with a distinguishably different reporter. The same quencher can be used on all probes provided that it is suitable to quench any fluorescence emission from each of the reporters while in proximity thereto.
While the length of the primers and probes can vary, the probe sequences are generally selected such that they have a higher melt temperature than the primer sequences. Preferably, the probe sequences have an estimated melt temperature that is about 100C higher than the melt temperature for the amplification primer sequences. Hence, the primer sequences are generally shorter than the probe sequences. Typically, the primer sequences are in the range of between 10-75 nucleotides long, more typically in the range of between 17 and 30 nucleotides long. In certain applications, the primers may contain additional, non-target hybridizing sequence, particularly at the S'end, (for example, promoter sequences, restriction enzyme cleavage sites, etc). In these instances, the primer oligonucleotide may be longer than the typical 17 to 30 nucleotide length, however, the target hybridizing sequence of the primer will be only a portion of the entire primer sequence and will generally be in the range of 17 to 30 nucleotides.
The typical probe is in the range of between 10 and 50 nucleotides long, more typically between 15 and 40 nucleotides in length, most typically between 20 and 35 nucleotides in length. Representative primers and probes useful in TaqMan™ assays are described above.
The hantavirus sequences described herein may also be used as a basis for transcription-mediated amplification (TMA) assays. TMA is an isothermal, autocatalytic nucleic acid target amplification system that can provide more than a billion RNA copies of a target sequence, and thus provides a method of identifying target nucleic acid sequences present in very small amounts in a biological sample. For a detailed description of TMA assay methods, see, e.g., Hill (2001) Expert Rev. MoI. Diagn. 1:445-55; WO 89/1050; WO 88/10315; EPO Publication No. 408,295; EPO Application No. 881 1394- 8.9; WO91/02818; U.S. Patent Nos. 5,399,491, 6,686,156, and 5,556,771, all incorporated herein by reference in their entireties. Other known amplification methods which can be utilized herein include but are not limited to the so-called "NASBA" or "3SR" technique described by Guatelli et al., Proc. Natl. Acad. ScL USA (1990) 87:1874-1878 and J. Compton, Nature (1991) 350:91-92 (1991); Q-beta amplification; strand displacement amplification (as described in Walker et al., Clin. Chem. (1996) 42:9-13 and EPA 684,315; target mediated amplification, as described in International Publication No. WO 93/22461.
Suitable DNA polymerases include reverse transcriptases, such as avian myeloblastosis virus (AMV) reverse transcriptase (available from, e.g., Seikagaku
America, Inc.) and Moloney murine leukemia virus (MMLV) reverse transcriptase (available from, e.g., Bethesda Research Laboratories).
Promoters or promoter sequences suitable for incorporation in the primers are nucleic acid sequences (either naturally occurring, produced synthetically or a product of a restriction digest) that are specifically recognized by an RNA polymerase that recognizes and binds to that sequence and initiates the process of transcription whereby RNA transcripts are produced. The sequence may optionally include nucleotide bases extending beyond the actual recognition site for the RNA polymerase which may impart added stability or susceptibility to degradation processes or increased transcription efficiency. Examples of useful promoters include those which are recognized by certain bacteriophage polymerases such as those from bacteriophage T3, T7 or SP6, or a promoter from E. coli. These RNA polymerases are readily available from commercial sources, such as New England Biolabs and Epicentre.
Some of the reverse transcriptases suitable for use in the methods herein have an RNAse H activity, such as AMV reverse transcriptase. It may, however, be preferable to add exogenous RNAse H, such as E. coli RNAse H, even when AMV reverse transcriptase is used. RNAse H is readily available from, e.g., New England Biolabs.
The RNA transcripts produced by these methods may serve as templates to produce additional copies of the target sequence through the above-described mechanisms. The system is autocatalytic and amplification occurs autocatalytically without the need for repeatedly modifying or changing reaction conditions such as temperature, pH, ionic strength or the like.
Detection may be done using a wide variety of methods, including direct sequencing, hybridization with sequence-specific oligomers, gel electrophoresis and mass spectrometry. These methods can use heterogeneous or homogeneous formats, isotopic or nonisotopic labels, as well as no labels at all.
One preferable method of detection is the use of target sequence-specific oligonucleotide probes described above. The probes may be used in hybridization protection assays (HPA). In this embodiment, the probes are conveniently labeled with acridinium ester (AE), a highly chemiluminescent molecule. See, e.g., Nelson et al.
(1995) "Detection of Acridinium Esters by Chemiluminescence" in Nonisotopic Probing, Blotting and Sequencing, Kricka L.J.(ed) Academic Press, San Diego, CA; Nelson et al. (1994) "Application of the Hybridization Protection Assay (HPA) to PCR" in The Polymerase Chain Reaction, Mullis et al. (eds.) Birkhauser, Boston, MA; Weeks et al.,
Clin. Chem. (1983) 29: 1474-1479; Berry et al., Clin. Chem. (1988) 34:2087-2090. One AE molecule is directly attached to the probe using a non-nucleotide-based linker arm chemistry that allows placement of the label at any location within the probe. See, e.g., U.S. Patent Nos. 5,585,481 and 5,185,439. Chemiluminescence is triggered by reaction with alkaline hydrogen peroxide which yields an excited N-methyl acridone that subsequently collapses to ground state with the emission of a photon.
When the AE molecule is covalently attached to a nucleic acid probe, hydrolysis is rapid under mildly alkaline conditions. When the AE-labeled probe is exactly complementary to the target nucleic acid, the rate of AE hydrolysis is greatly reduced. Thus, hybridized and unhybridized AE-labeled probe can be detected directly in solution, without the need for physical separation.
HPA generally consists of the following steps: (a) the AE-labeled probe is hybridized with the target nucleic acid in solution for about 15 to about 30 minutes. A mild alkaline solution is then added and AE coupled to the unhybridized probe is hydrolyzed. This reaction takes approximately 5 to 10 minutes. The remaining hybrid- associated AE is detected as a measure of the amount of target present. This step takes approximately 2 to 5 seconds. Preferably, the differential hydrolysis step is conducted at the same temperature as the hybridization step, typically at 50 to 70 0C. Alternatively, a second differential hydrolysis step may be conducted at room temperature. This allows elevated pHs to be used, for example in the range of 10-11, which yields larger differences in the rate of hydrolysis between hybridized and unhybridized AE-labeled probe. HPA is described in detail in, e.g., U.S. Patent Nos. 6,004,745; 5,948,899; and 5,283,174, the disclosures of which are incorporated by reference herein in their entireties.
In one example of a typical TMA assay, an isolated nucleic acid sample, suspected of containing a hantavirus target sequence, is mixed with a buffer concentrate containing the buffer, salts, magnesium, nucleotide triphosphates, primers, dithiothreitol, and spermidine. The reaction is optionally incubated at about 100 °C for approximately two minutes to denature any secondary structure. After cooling to room temperature, reverse transcriptase, RMA polymerase, and RNAse H are added and the mixture is incubated for two to four hours at 37 °C. The reaction can then be assayed by denaturing the product, adding a probe solution, incubating 20 minutes at 60 0C, adding a solution to selectively hydrolyze the unhybridized probe, incubating the reaction six minutes at 60 0C, and measuring the remaining chemiluminescence in a luminometer.
In another aspect of the invention, two or more of the tests described above are performed to confirm the presence of the hantavirus. For example, if the first test used transcription mediated amplification (TMA) to amplify the nucleic acids for detection, then an alternative nucleic acid testing (NAT) assay is performed, for example, by using PCR amplification, RT-PCR, and the like, as described herein. Thus, hantavirus can be specifically and selectively detected even when the sample contains other organisms, such as HIV and/or HCV, for example.
The methods of detection of the invention utilize a biological sample suspected of containing hantavirus nucleic acids. Typical biological samples suitable for use with the method of the invention include, without limitation, blood, plasma, serum, fecal matter, urine, bone marrow, bile, spinal fluid, lymph fluid, samples of the skin, external secretions of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, organs, biopsies and also samples of in vitro cell culture constituents including but not limited to conditioned media resulting from the growth of cells and tissues in culture medium, e.g., recombinant cells, and cell components. In particular, hantavirus may be obtained from biological samples such as blood, plasma, serum, fecal matter, urine, or lung tissue from an individual infected with the virus.
A biological sample may be pre-treated in any number of ways prior to isolation of hantavirus nucleic acids. For instance, in certain embodiments, the sample may be treated to disrupt (or lyse) any viral particles (virions), for example by treating the samples with one or more detergents and/or denaturing agents {e.g., guanidinium agents). Nucleic acids may also be extracted from samples, for example, after detergent treatment and/or denaturing as described above. Total nucleic acid (i.e., both DNA and RNA) extraction may be performed using known techniques, for example by non-specific binding to a solid phase {e.g., silica). See, e.g., U.S. Patent Nos. 5,234,809, 6,849,431 ; 6,838,243; 6,815,541 ; and 6,720,166.
Typically, for the practice of the invention, the nucleic acid from the sample need only be isolated to the extent necessary to make it available for amplification of the target sequences. In general, the sample nucleic acid is separated from other components of the biological sample that might interfere with the amplification reaction, but typically the nucleic acid need not be substantially purified. The nucleic acid may be concentrated (e.g., by precipitation, filtration, etc) prior to the amplifying step.
In certain embodiments, the target nucleic acids are separated from nonhomologous nucleic acids present in the sample using capture oligonucleotides
immobilized on a solid support. Such capture oligonucleotides contain nucleic acid sequences that are complementary to a nucleic acid sequence present in the target hantavirus nucleic acid analyte such that the capture oligonucleotide can "capture" (i.e., bind) the target nucleic acid. In one embodiment of the present invention the biological sample potentially carrying target nucleic acid is contacted with a solid support in association with capture oligonucleotides. The capture oligonucleotides, which may be used separately or preferably in combination, may be associated with the solid support, for example, by covalent binding of the capture moiety to the solid support, by affinity association, hydrogen binding, or nonspecific association.
As will be apparent, the capture oligonucleotides will be complementary to a hantaviral region that occurs on the same genomic segment as the target sequence (i.e., the region to be detected by amplification). In order that nucleic acid from any/all hantavirus strains present in the sample are captured, the capture oligonucleotide(s) will preferably comprise hantaviral sequence(s) from conserved regions of the hantavirus genome. Alternatively, or in addition, the capture oligos may comprise mixtures of sequences representing all sequence variations of hantaviral nucleic acids.
Internal control sequence templates and internal control probes may be included in the isolation and/or amplifying and/or detection steps of the method. Internal control sequence templates are polynucleotides (DNA or RNA) that can be amplified by the same sets of primers as the hantaviral target sequence(s) but the amplicons from the internal control templates are detected with different probes than the hantaviral target amplicons. The internal control sequence template will thus contain sequences that hybridize to a set of strain-specific forward and reverse primers but not to the strain-specific probe. The internal control sequence templates are most easily prepared by modification of cloned hantaviral target sequences (for example, the sequences provided herein as SEQ ID NO:20-25) to remove a portion of the internal sequence and replace this with a sequence complementary to the internal control probe. As an example, an internal control sequence template polynucleotide comprising SEQ ID NO:26 was prepared from the plasmid containing SEQ ID NO:24 (a portion of the SNV small genome segment) by removing an interior segment and replacing it with a sequence that hybridizes to SEQ ID NO:27 (See Example 1 herein). An oligo comprising SEQ ID NO:27 can be used as an internal control probe. Other internal control sequence templates can be prepared in similar fashion from the plasmid containing SEQ ID NOs 20, 21, 22, 23, and 25. The internal control probe
will comprise a distinguishably different detectable label. One or more internal control sequence template will be added to the biological sample at or prior to some step in the method, preferably prior to the isolating step.
As is readily apparent, design of the assays described herein are subject to a great deal of variation, and many formats are known in the art. The above descriptions are merely provided as guidance and one of skill in the art can readily modify the described protocols, using techniques well known in the art.
The above-described assay reagents, including the primers, probes, as well as other reagents for amplification and/or detection, can be provided in kits, with suitable instructions and other necessary reagents, in order to conduct the assays as described above. The kit will normally contain the combination of primers and probes, control template(s), labeled reagents when the assay format requires same and signal generating reagents (e.g., enzyme substrate) if the label does not generate a signal directly. Instructions (e.g., written, tape, VCR, CD-ROM, etc.) for carrying out the assay usually will be included in the kit. The kit can also contain, depending on the particular assay used, other packaged reagents and materials (e.g., DNA polymerases, RNA polymerases, Reverse transcriptases, RNAses, and other enzymes, labels, diluent buffers, wash buffers and the like). Standard assays, such as those described above, can be conducted using these kits.
3. EXPERIMENTAL
Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.
Example 1
Production of Hantavirus Target Templates Hantavirus RNA transcripts were prepared in vitro from cloned hantaviral nucleocapsid genes from 6 strains of hantavirus. Both the prepared transcripts and the linearized plasmid were used as the target nucleic acid for RT-PCR and/or TaqMan fluorogenic 5' nuclease PCR with the hantavirus strain-specific primer and probe sets.
Polynucleotides comprising the sequences of SEQ ID NOS:20-25 (Figures 2-7), encoding the nucleocapsid proteins from the six hantavirus strains HTNV, PUUV, SEOV, DOBV, SNV and ANDV, were cloned into the yeast vector pBS24.1 as described in International Patent Application No. PCT/US2005/18066, herein incorporated by reference in its entirety. Cloned DNA was treated with the restriction enzymes MIuI and Sail. The resulting fragments were isolated by gel electrophoresis and purified by the MINELUTE gel purification kit (Qiagen, Valencia, CA). The fragments were each cloned into a pGEM-4z vector (Promega, Madison WI) modified with a multiple cloning region to facilitate cloning with the desired restriction sites. The pGEM-4z vector has both SP6 and T7 RNA polymerase promoters flanking the multiple cloning region to facilitate the making of RNA transcripts using either SP6 or T7 RNA polymerases. The resulting clones were transformed into HBlOl cells and large quantities of plasmid DNA were isolated, treated and used in the preparation of RNA transcripts. The RNA transcripts were prepared using a commercial in vitro RNA transcription kit (MEGAscript High Yield Transcription Kit, Ambion, Inc. Austin, Texas).
The RNA transcripts were used for RT-PCR/TaqMan assays as described in Example 5. Alternatively, the pGEM-4z plasmids were linearized and used as templates for the multiplex TaqMan assays described in Example 4.
An internal control template was prepared by modifying the plasmid containing the SNV-N sequence (SEQ ID NO:24) to remove the region detected by the SNV probe and replacing it with a non-hantaviral sequence. A new probe was designed to detect this region of the internal control. The internal control sequence (SEQ ID NO:26) is amplified with the SNV primer set but is detected using the control sequence probe (CCAGTGACATGCAGGTCTAGCT SEQ ID NO:27).
Example 2 RNA Isolation Hantavirus RNA can be isolated from samples by a number of methods including non-specific binding to silica in the presence of chaotropic agents (the Boom method) or by specific binding to capture oligos on a solid solid. The non-specific method is described below for isolation of hantavirus from cell culture (Sin Nombre strain is used in
the example) but the same method can be used to prepare nucleic acid from biological samples for testing by the multiplex assay.
The method described by Boom et al. (1990) J. Clin. Microbiol. 28:495-503 is followed with modifications. In the presence of high concentrations of a chaotropic salt, such as guanidinium isothiocyanate, nucleic acids bind to silica. Small sized nucleic acids bind more efficiently to silica under conditions of acidic pH. The bound nucleic acids are efficiently eluted in low salt, alkaline pH buffer at high temperatures. The substitution of magnetized silica for regular silica greatly facilitates the washing and elution steps of nucleic acid isolation. Thus, a magnetic base can be used to capture the nucleic acid-bound silica particles, thus eliminating centrifugations required to sediment regular silica particles.
Lysis buffer from Organon-Teknika (Durham, N.C.) is used to extract Sin Nombre virus nucleic acids from an in vitro Sin Nombre virus culture. The lysis buffer, containing guanidinium isothiocyanate and Triton X-100, solubilizes proteins, releases nucleic acids, and inactivates RNases and DNases. One 9.0-mL aliquot of lysis reagent is used to extract nucleic acids from 0.5 mL of serially diluted Sin Nombre virus culture. After release from associated proteins, the nucleic acid is isolated by binding to magnetized silica (Novagen, Madison, Wl) particles and a magnetic base is used to capture the nucleic acid-bound silica particles. The bound nucleic acid is eluted in 60 μL of alkaline buffer containing 1 mM EDTA, 10 mM Tris, pH 9.0. An advantage of nucleic acid purification by adsorption to silica is that isolated nucleic acids can be used to test for several targets or several regions of one target. A 50 μL aliquot of the eluted nucleic acid is amplified using the TAQMAN RT-PCR amplification-detection assay described below.
Example 3
Nucleic Acid Amplification and Detection
The target nucleic acids (either DNA or RNA) are mixed with the hantavirus strain-specific probe(s). Appropriate sets of hantavirus strain specific primers are added to one-step RT-PCR master mix (Applied Biosystems, Foster City, CA) and 100 μL of this mixture is added to the isolated nucleic acids from the sample. For quantitative determination, a number of control nucleic acids can be extracted or captured and amplified. In order to monitor the assay for extraction and amplification, an internal control as described above can be added during the nucleic
acid isolation. Armored RNA (Ambion Diagnostics, Austin, TX) can be used as a more stable internal control.
Example 4 Multiplex PCR for Selective Detection and Identification of Hantavirus Strains
TaqMan™ technology was used for amplifying the target nucleic acids from hantavirus strains HTNV, DOBV, SEOV, PUUV, SNV, and ANDV prepared in Example 3. For these multiplex experiments the target templates used were the linearized plasm ids described in Example 1. Strain specific primers and probes comprising sequences from the S segments of hantaviruses were designed to amplify and detect nucleic acid targets from each hantavirus strain specifically. Strain specific probes were labeled with different fluorophores to allow discrimination among the different hantavirus strains used in the samples in multiplex assays. Sets of primers and probes for each hantavirus strain are listed in Table 2. The fluorophore indicated in the Table was used on the probe as a reporter molecule.
Table 2. Primer/Probe Oligonucleotides
Multiplex assays were performed with an ABI 7500 real-time PCR system thermocycler (Applied Biosystems, Foster City, CA) capable of detecting five different fluorophores in multiplex assays. Because of the limitation of the detection instrument, only 3 hantaviral targets could be assayed simultaneously, leaving one fluorophore to be used for the background signal and one fluorophore for the internal control signal. For each multiplex assay, a total of nine oligonucleotides (3 primer/probe sets) were used for amplification and detection of three target hantavirus strains. Multiplex assays were performed with the following combinations of probes:
ANDV-TAMRA probe, SNV-FAM probe, PUUV-Cy5 probe SEOV-FAM probe, PUUV-Cy5 probe, HTNV-CAL GOLD probe ANDV-TAMRA probe, PUUV-Cy5 probe, HTNV-CAL GOLD probe DOBV-FAM probe, PUUV-Cy5 probe, ANDV-TAMRA probe
In addition, multiplex assays contained ROX as a background fluorophore and an internal control consisting of a modified SNV transcript with an altered probe-binding sequence (SEQ ID NO:26) detectable with a TET labeled control probe(SEQ ID NO:27). The internal control transcript can be amplified by the SNV primers (SEQ ID NO: 16 and SEQ ID NO: 19), and is used for determining false negatives. Black Hole Quenchers (Biosearch Technologies, Novato CA) were used as quencher for all of the probes.
Reagents for the TaqMan™ analysis were obtained from Applied Biosystems, Foster City, CA. In some assays, three different plasmid templates (corresponding to each of the strain specific primer/probe sets) were used as the target; in other assays, only one of the three transcripts was used as target. The
reaction in a final volume of 100 μL contained, 50 μL of PCR Mastermix (Applied Biosystems, Inc., Foster City, CA), 100 pmol each of the amplification primers, and 25 pmol each of the probes with the remaining volume made up of hantavirus target nucleic acids and water. The reaction conditions included 10 minutes at 95 0C to activate the Taq enzyme followed by 50 cycles of 30 seconds at 95 0C, alternating with 1 minute at 60 0C in the ABI 7500 instrument. A "reactive" (i.e., positive) sample is one in which the probe signal is detected within 45 cycles or less based on a 50 cycle experiment (Ct = 45 or lower).
After amplification, fluorescence from the fluorophores of probes specific for the hantavirus target nucleic acids was measured. Results of multiplex (triplex) assays using a combination of three primer pairs and probes to simultaneously detect target nucleic acids from three different hantavirus strains are shown in Table 3. Three different fluorescent signals are detected corresponding to each template that is present in the assay.
Table 3. Triplex Assays using Linear Plasmid DNAs as Targets and 3 sets of primer/probe combos. For each Triplex assay, N=5 and targets at 10,000 copies/reaction. A reactive (positive) sample is Ct of 45 or less based on 50 cycles.
Triplex 2: Targets=SNV, PUUV, ANDV Primers=SNV, PUUV, ANDV Probes=SNV-FAM, PUUV-Cy5, ANDV-TAMRA
Table 4 shows the results of assays using a combination of primers and probes for PUUV, DOBV, and ANDV where only a single target is present in the
assay. Only the probe for the target DNA present in the sample is detectable. The results show the specificity of the primers and probes for their target hantavirus strains.
Table 4. Assay with PLJUV, DOBV, and ANDV Primers/Probes with single target template (N=3; Total cycles =50; reactive = Ct of 45 or less)
Table 5 shows the results of assays using a combination of 4 primer/probe sets (HTNV, PUUV, DOBV, and ANDV) where only a single target is present in the assay. Only the probe corresponding to the target DNA present in the sample is detectable. These results provide further evidence of the specificity of the serospecific primers and probes for detection of individual hantavirus strains.
Table 5. Assay with primer/probe sets for HTNV, PUUV, DOBV, ANDV and a single target DNA
Example 5
Assays using RNA targets
RT-PCR/TaqMan assays were also carried out on RNA templates corresponding to each of 6 hantavirus strains. The RNA templates were prepared as in vitro RNA transcripts from the cloned hantaviral nucleocapsid genes as described in Example 1.
The assays were carried out as described in Example 4 except that the target nucleic acid in the samples was RNA transcript at 106 or 108 copies/reaction. A single set of primers/probe and target RNA from a single hantavirus strain was used for each assay. Ct was determined in triplicate for each concentration of RNA target. The results are shown in Tables 6-11.
Table 6. HTNV RNA transcript with HTNV primer set and CaIGoId labeled HTNV probe
Table 7. PUUV RNA transcript with PUUV primer set and Cy5 labeled PUUV probe
Table 8. SEOV RNA transcript with SEOV primer set and FAM labeled SEOV probe
Table 9. DOBV RNA transcript with DOBV primer set and FAM labeled DOBV probe
Table 10. ANDV RNA transcript with ANDV primer set and TAMRA labeled ANDV probe
Table 1 1. SNV RNA transcript with SNV primer set and FAM labeled SNV probe
Thus, oligonucleotide reagents derived from hantaviruses, such as primers, probes and capture oligonucleotides, and the like, as well as methods of using the reagents for detecting hantavirus are described. Although preferred embodiments of the subject invention have been described in some detail, it is understood that obvious variations can be made without departing from the spirit and the scope of the invention as disclosed herein.
Claims
WHAT IS CLAIMED IS:
I . A method for detecting hantavirus infection in a biological sample, the method comprising: isolating a nucleic acid from a biological sample suspected of containing hantavirus nucleic acid, wherein if hantavirus nucleic acid is present, said nucleic acid comprises a target sequence; amplifying the nucleic acid using at least one set of oligonucleotide primers comprising a forward primer and a reverse primer capable of amplifying at least a portion of a hantavirus nucleic acid segment, wherein said primers are not more than about 40 nucleotides in length, wherein said set of primers is selected from the group consisting of:
(a) a forward primer comprising the sequence of SEQ ID NO:1 and a reverse primer comprising the sequence of SEQ ID NO:3, (b) a forward primer comprising the sequence of SEQ ID NO:4 and a reverse primer comprising the sequence of SEQ ID NO:6, (c) a forward primer comprising the sequence of SEQ ID NO:7 and a reverse primer comprising the sequence of SEQ ID NO:9, (d) a forward primer comprising the sequence of SEQ ID NO: 10 and a reverse primer comprising the sequence of SEQ ID NO: 12, (e) a forward primer comprising the sequence of SEQ ID NO: 13 and a reverse primer comprising the sequence of SEQ ID NO: 15, (f) a forward primer comprising the sequence of SEQ ID NO: 16 and a reverse primer comprising the sequence of SEQ ID
NO: 19; (g) a forward primer and a reverse primer each comprising at least 10 contiguous nucleotides from the corresponding nucleotide sequences of the forward primer and reverse primer of a primer set selected from the group consisting of (a) through (f); and (h) a forward primer and a reverse primer comprising nucleotide sequences having at least 90% sequence identities to the corresponding nucleotide sequences of the forward primer and reverse primer of a primer set selected from the group consisting of (a) through (f); and detecting the presence of the amplified nucleic acid.
2. The method of claim 1, wherein said detecting is accomplished using at least one detectably labeled oligonucleotide probe sufficiently complementary to and capable of hybridizing with the amplified nucleic acid, if present, as an indication of the presence or absence of hantavirus in the sample.
3. The method of claim 2, wherein at least one set of primers and a probe are used for detecting hantavirus infection in a biological sample, wherein said set of primers and said probe are selected from the group consisting of (a) a forward primer comprising the sequence of SEQ ID NO: 1 , a reverse primer comprising the sequence of SEQ ID NO:3, and a probe comprising the sequence of SEQ ID NO:2, (b) a forward primer comprising the sequence of SEQ ID NO:4, a reverse primer comprising the sequence of SEQ ID NO:6, and a probe comprising the sequence of SEQ ID NO:5, (c) a forward primer comprising the sequence of SEQ ID NO:7, a reverse primer comprising the sequence of SEQ ID NO:9, and a probe comprising the sequence of SEQ ID NO:8, (d) a forward primer comprising the sequence of SEQ ID NO: 10, a reverse primer comprising the sequence of SEQ ID NO: 12, and a reverse probe comprising the sequence of SEQ ID NO: 1 1 , (e) a forward primer comprising the sequence of SEQ ID NO: 13, a reverse primer comprising the sequence of SEQ ID NO: 15, and a probe comprising the sequence of SEQ ID NO: 14, (f) a forward primer comprising the sequence of SEQ ID NO: 16, a reverse primer comprising the sequence of SEQ ID NO: 19, and a probe comprising the sequence of SEQ ID NO: 17, (g) a forward primer, a reverse primer, and a probe, each comprising at least 10 contiguous nucleotides from the corresponding nucleotide sequences of the forward primer, reverse primer and probe sets selected from the group consisting of (a) through (f); and (h) a forward primer, a reverse primer, and a probe comprising nucleotide sequences having at least 90% sequence identities to the corresponding nucleotide sequences of the forward primer, reverse primer and probe set selected from the group consisting of (a) through (f).
4. The method of any one of claim 1, 2 or 3, wherein amplifying comprises RT- PCR, transcription-mediated amplification (TMA) or a fluorogenic 5' nuclease assay, or a combination thereof.
5. The method of claim 4, wherein detecting is done using at least one probe comprising a detectable label.
6. The method of claim 5, wherein the detectable label is a fluorescent label selected from the group consisting of 6-carboxyfluorescein (FAM), tetramethyl rhodamine (TAMRA), 2\ 4', 51, T- tetrachloro^-T-dichlorofluorescein (TET), Cy5, and CAL GOLD.
7. The method of claim 1, wherein an internal control sequence template is added to the sample.
8. The method of claim 1, wherein more than one set of oligonucleotide primers is S used.
9. The method of claim 8, wherein at least 3 sets of primers are used.
10. The method of claim 8, wherein at least 4 sets of primers are used. 0
11. The method of claim 8, wherein at least 5 sets of primers are used.
12. The method of claim 9, wherein at least 6 sets of primers are used. 5 13. A kit for detecting hantavirus infection in a biological sample, the kit comprising: at least one set of oligonucleotide primers comprising a forward primer and a reverse primer capable of amplifying at least a portion of a hantavirus nucleic acid segment, wherein said primers are not more than about 40 nucleotides in length, wherein0 said set of primers is selected from the group consisting of:
(a) a forward primer comprising the sequence of SEQ ID NO:1 and a reverse primer comprising the sequence of SEQ ID NO:3, (b) a forward primer comprising the sequence of SEQ ID NO:4 and a reverse primer comprising the sequence of SEQ ID NO:6, (c) a forward primer comprising the sequence of SEQ ID NO:7 and a reverse5 primer comprising the sequence of SEQ ID NO:9, (d) a forward primer comprising the sequence of SEQ ID NO: 10 and a reverse primer comprising the sequence of SEQ ID NO: 12, (e) a forward primer comprising the sequence of SEQ ID NO: 13 and a reverse primer comprising the sequence of SEQ ID NO: 15, (f) a forward primer comprising the sequence of SEQ ID NO: 16 and a reverse primer comprising the sequence of SEQ ID0 NO: 19; (g) a forward primer and a reverse primer each comprising at least 10 contiguous nucleotides from the corresponding nucleotide sequences of the forward primer and reverse primer of a primer set selected from the group consisting of (a) through (f); and (h) a forward primer and a reverse primer comprising nucleotide sequences having at least 90% sequence identities to the corresponding nucleotide sequences of the forward primer and reverse primer of a primer set selected from the group consisting of (a) through (f).
14. The kit of claim 13, comprising at least one set of forward and reverse primers S and a detectably labeled probe, wherein said probe is not more than about 40 nucleotides in length and wherein said set is selected from the group consisting of:
(a) a forward primer comprising the sequence of SEQ ID NO:1, a reverse primer comprising the sequence of SEQ ID NO:3, and a probe comprising the sequence of SEQ ID NO:2, (b) a forward primer comprising the sequence of SEQ ID NO:4, a reverse primer 0 comprising the sequence of SEQ ID NO:6, and a probe comprising the sequence of SEQ ID NO:5, (c) a forward primer comprising the sequence of SEQ ID NO:7, a reverse primer comprising the sequence of SEQ ID NO:9, and a probe comprising the sequence of SEQ ID NO:8, (d) a forward primer comprising the sequence of SEQ ID NO: 10, a reverse primer comprising the sequence of SEQ ID NO: 12, and a probe comprising the sequence 5 of SEQ ID NO: 11 , (e) a forward primer comprising the sequence of SEQ ID NO: 13, a reverse primer comprising the sequence of SEQ ID NO: 15, and a probe comprising the sequence of SEQ ID NO: 14, (f) a forward primer comprising the sequence of SEQ ID NO: 16, a reverse primer comprising the sequence of SEQ ID NO: 19, and a probe comprising the sequence of SEQ ID NO: 17, (g) a forward primer, a reverse primer, and a0 probe, each comprising at least 10 contiguous nucleotides from the corresponding nucleotide sequences of the forward primer, reverse primer and probe sets selected from the group consisting of (a) through (f); and (h) a forward primer, a reverse primer, and a probe comprising nucleotide sequences having at least 90% sequence identities to the corresponding nucleotide sequences of the forward primer, reverse primer and probe set5 selected from the group consisting of (a) through (f).
15. The kit of claim 14, comprising at least two sets of forward and reverse primers and detectably labeled probe, wherein each said probe is not more than about 40 nucleotides in length and wherein said sets are selected from the group consisting of:0 (a) a forward primer comprising the sequence of SEQ ID NO: 1 , a reverse primer comprising the sequence of SEQ ID NO:3, and a probe comprising the sequence of SEQ ID NO:2, (b) a forward primer comprising the sequence of SEQ ID NO:4, a reverse primer comprising the sequence of SEQ ID NO:6, and a probe comprising the sequence of SEQ ID NO:5, (c) a forward primer comprising the sequence of SEQ ID NO:7, a reverse primer comprising the sequence of SEQ ID NO:9, and a probe comprising the sequence of SEQ ID NO:8, (d) a forward primer comprising the sequence of SEQ ID NO: 10, a reverse primer comprising the sequence of SEQ ID NO: 12, and a probe comprising the sequence of SEQ ID NO: 11 , (e) a forward primer comprising the sequence of SEQ ID NO: 13, a reverse primer comprising the sequence of SEQ ID NO: 15, and a probe comprising the sequence of SEQ ID NO: 14, and (f) a forward primer comprising the sequence of SEQ ID NO:16, a reverse primer comprising the sequence of SEQ ID NO: 19, and a probe comprising the sequence of SEQ ID NO: 17.
16. The kit of claim 14, wherein each of said probes comprises a distinguishably different detectable label.
17. The kit of claiml3, comprising six said sets of forward primer and reverse primer.
18. The kit of claim 13, further comprising a polymerase.
19. A method for selectively detecting one or more hantavirus strains in a biological sample, the method comprising: isolating nucleic acid from a biological sample suspected of containing hantavirus nucleic acid, wherein if hantavirus nucleic acid is present, said nucleic acid comprises a target sequence; amplifying the nucleic acid by contacting the sample with a plurality of sets of primer pairs, each of which set is capable of amplifying at least a portion of a hantavirus nucleic acid segment from at least one strain of hantavirus, wherein said primers are not more than about 40 nucleotides in length, wherein one or more of said sets of primer pairs are selected from the group consisting of:
(a) a forward primer comprising the sequence of SEQ ID NO: 1 and a reverse primer comprising the sequence of SEQ ID NO:3, (b) a forward primer comprising the sequence of SEQ ID NO:4 and a reverse primer comprising the sequence of SEQ ID NO:6, (c) a forward primer comprising the sequence of SEQ ID NO:7 and a reverse primer comprising the sequence of SEQ ID NO:9, (d) a forward primer comprising the sequence of SEQ ID NO: 10 and a reverse primer comprising the sequence of SEQ ID NO: 12, (e) a forward primer comprising the sequence of SEQ ID NO: 13 and a reverse primer comprising the sequence of SEQ ID NO: 15, (f) a forward primer comprising the sequence of SEQ ID NO: 16 and a reverse primer comprising the sequence of SEQ ID NO: 19; (g) a forward primer and a reverse primer each comprising at least 10 contiguous nucleotides from the corresponding nucleotide sequences of the forward primer and reverse primer of a primer pair selected from the group consisting of (a) through (f); and (h) a forward primer and a reverse primer comprising nucleotide sequences having at least 90% sequence identities to the corresponding nucleotide sequences of the forward primer and reverse primer of a primer pair selected from the group consisting of (a) through (f); and detecting the presence of the amplified nucleic acids by contacting the amplified nucleic acids with a plurality of detectably labeled oligonucleotide probes, wherein each probe has a distinguishably different detectable label, wherein each probe selectively hybridizes to the nucleic acid or amplicon thereof from one strain of hantavirus, if present, as an indication of the presence or absence of said hantavirus strain in the sample, wherein the probe is not more than about 40 nucleotides in length.
20. The method of claim 19, wherein said sets of forward primer and reverse primer and probes are selected from the group consisting of (a) a forward primer comprising the sequence of SEQ ID NO:1, a reverse primer comprising the sequence of SEQ ID NO:3, and a probe comprising the sequence of SEQ ID NO:2, (b) a forward primer comprising the sequence of SEQ ID NO:4, a reverse primer comprising the sequence of SEQ ID NO:6, and a probe comprising the sequence of SEQ ID NO:5, (c) a forward primer comprising the sequence of SEQ ID NO:7, a reverse primer comprising the sequence of SEQ ID NO:9, and a probe comprising the sequence of SEQ ID NO:8, (d) a forward primer comprising the sequence of SEQ ID NO: 10, a reverse primer comprising the sequence of SEQ ID NO: 12, and a probe comprising the sequence of SEQ ID NO: 1 1 , (e) a forward primer comprising the sequence of SEQ ID NO: 13, a reverse primer comprising the sequence of SEQ ID NO: 15, and a probe comprising the sequence of SEQ ID NO: 14, and (f) a forward primer comprising the sequence of SEQ ID NO: 16, a reverse primer comprising the sequence of SEQ ID NO: 19, and a probe comprising the sequence of SEQ ID NO: 17.
21. The method of claim 19, wherein amplifying comprises RT-PCR, transcription-mediated amplification (TMA) or a fluorogenic 5' nuclease assay, or a combination thereof.
22. The method of claim 21, wherein each probe contains a distinguishably different detectable label comprising a fluorescent label selected from the group consisting of 6-carboxyfluorescein (FAM), tetramethyl rhodamine (TAMRA), 2', 41, 5', T- tetrachloro-4-7-dichlorofluorescein (TET), Cy5, and CAL GOLD.
23. The method of claim 1 or claim 19, wherein the nucleic acids are isolated from the biological sample by a method comprising:
(a) contacting a solid support comprising one or more capture oligonucleotide associated therewith with a biological sample under hybridizing conditions wherein hantavirus nucleic acid strands, if present in the biological sample, hybridize with the capture oligonucleotide; and (b) separating the solid support from the sample.
24. A method of preparing a blood supply comprising whole blood, plasma or serum, substantially free of hantavirus comprising: (a) screening aliquots of whole blood, plasma or serum from collected blood samples by the method of claim 1 or claim 19; (b) eliminating samples where hantavirus is detected; and (c) combining samples where hantavirus is not detected to provide a blood supply substantially free of hantavirus.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US83115406P | 2006-07-13 | 2006-07-13 | |
| PCT/US2007/015912 WO2008008444A2 (en) | 2006-07-13 | 2007-07-12 | Methods and reagents for detecting hantavirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP2046808A2 true EP2046808A2 (en) | 2009-04-15 |
Family
ID=38923897
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP07836060A Withdrawn EP2046808A2 (en) | 2006-07-13 | 2007-07-12 | Methods and reagents for detecting hantavirus |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP2046808A2 (en) |
| WO (1) | WO2008008444A2 (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101815105B1 (en) * | 2015-10-16 | 2018-01-05 | 국방과학연구소 | Hantavirus Whole Genome Sequence Identification Methods Using a Multiplex PCR-based Next-Generation Sequencing and Uses Thereof |
| CN107383176A (en) * | 2017-05-10 | 2017-11-24 | 于学杰 | For the polypeptide to HFRS parting caused by hantaan virus and SEOV |
| CN110021353B (en) * | 2017-09-30 | 2020-11-06 | 厦门艾德生物医药科技股份有限公司 | Screening method of molecular reverse probe for capturing specific region of enriched genome |
| CN110373503B (en) * | 2019-08-27 | 2023-03-10 | 中国人民解放军东部战区疾病预防控制中心 | Complete set of nucleic acid, kit and detection method for detecting Hancheng virus by RPA |
| KR102494775B1 (en) * | 2022-04-11 | 2023-02-06 | 국방과학연구소 | Primer sets and TaqMan probes for detecting hantavirus, and analysis method for hantavirus using the same |
| CN116064934A (en) * | 2022-07-29 | 2023-05-05 | 圣湘生物科技股份有限公司 | Composition and kit for detecting and typing hantavirus, and application and method thereof |
| CN118308540B (en) * | 2024-06-11 | 2024-08-27 | 南方医科大学南方医院 | Detection kit for Hantavirus HTNV type and SEOV type |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5614193A (en) * | 1991-11-14 | 1997-03-25 | The United States Of America As Represented By The Secretary Of The Army | Hantavirus vaccine |
-
2007
- 2007-07-12 EP EP07836060A patent/EP2046808A2/en not_active Withdrawn
- 2007-07-12 WO PCT/US2007/015912 patent/WO2008008444A2/en not_active Ceased
Non-Patent Citations (1)
| Title |
|---|
| See references of WO2008008444A3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2008008444A2 (en) | 2008-01-17 |
| WO2008008444A3 (en) | 2008-10-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20120219941A1 (en) | Identification of Oligonucleotides for the Capture, Detection and Quantitation of Hepatitis A Viral Nucleic Acid | |
| EP1537235B1 (en) | Diagnostic assays for parvovirus b19 | |
| EP2904120B1 (en) | Methods and reagents for detection, quantitation, and serotyping of dengue viruses | |
| US8119338B2 (en) | Methods and compositions for detecting rhinoviruses | |
| CA2617635C (en) | Methods and compositions for detecting bk virus | |
| WO2008008444A2 (en) | Methods and reagents for detecting hantavirus | |
| US20030143527A1 (en) | Identification of oligonucleotides for the capture, detection and quantitation of hepatitis B viral DNA | |
| AU2012261529B2 (en) | Methods and compositions for detecting BK virus | |
| AU2002348426A1 (en) | Identification of oligonucleotides for the capture, detection and quantitation of hepatitis B viral DNA | |
| HK1115613B (en) | Methods and compositions for detecting bk virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN |
|
| 17P | Request for examination filed |
Effective date: 20090212 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL BA HR MK RS |
|
| 18W | Application withdrawn |
Effective date: 20090406 |