EP1971356A2 - Inhibition of cxcr4 and/or cell motility by phenylalanine, cysteine or peptides containing said aminoacids - Google Patents

Inhibition of cxcr4 and/or cell motility by phenylalanine, cysteine or peptides containing said aminoacids

Info

Publication number
EP1971356A2
EP1971356A2 EP06821674A EP06821674A EP1971356A2 EP 1971356 A2 EP1971356 A2 EP 1971356A2 EP 06821674 A EP06821674 A EP 06821674A EP 06821674 A EP06821674 A EP 06821674A EP 1971356 A2 EP1971356 A2 EP 1971356A2
Authority
EP
European Patent Office
Prior art keywords
seq
amino acid
peptide
derivative
cysteine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06821674A
Other languages
German (de)
French (fr)
Inventor
Tsvee Lapidot
Menachem Rubinstein
Asaf Spiegel
Mati Fridkin
Alexander Kalinkovich
Shoham Shivtiel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yeda Research and Development Co Ltd
Original Assignee
Yeda Research and Development Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yeda Research and Development Co Ltd filed Critical Yeda Research and Development Co Ltd
Publication of EP1971356A2 publication Critical patent/EP1971356A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/06Tripeptides
    • A61K38/063Glutathione
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08Peptides having 5 to 11 amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/195Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A61K31/198Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/05Dipeptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/06Tripeptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/07Tetrapeptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/10Peptides having 12 to 20 amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K5/00Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/06Dipeptides
    • C07K5/06008Dipeptides with the first amino acid being neutral
    • C07K5/06078Dipeptides with the first amino acid being neutral and aromatic or cycloaliphatic
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K5/00Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/06Dipeptides
    • C07K5/06086Dipeptides with the first amino acid being basic
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K5/00Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/06Dipeptides
    • C07K5/06086Dipeptides with the first amino acid being basic
    • C07K5/06095Arg-amino acid
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K5/00Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/08Tripeptides
    • C07K5/0802Tripeptides with the first amino acid being neutral
    • C07K5/0804Tripeptides with the first amino acid being neutral and aliphatic
    • C07K5/0808Tripeptides with the first amino acid being neutral and aliphatic the side chain containing 2 to 4 carbon atoms, e.g. Val, Ile, Leu
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K5/00Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/08Tripeptides
    • C07K5/0802Tripeptides with the first amino acid being neutral
    • C07K5/0804Tripeptides with the first amino acid being neutral and aliphatic
    • C07K5/081Tripeptides with the first amino acid being neutral and aliphatic the side chain containing O or S as heteroatoms, e.g. Cys, Ser
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K5/00Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/08Tripeptides
    • C07K5/0802Tripeptides with the first amino acid being neutral
    • C07K5/0812Tripeptides with the first amino acid being neutral and aromatic or cycloaliphatic
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K5/00Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/10Tetrapeptides
    • C07K5/1002Tetrapeptides with the first amino acid being neutral
    • C07K5/1005Tetrapeptides with the first amino acid being neutral and aliphatic
    • C07K5/1013Tetrapeptides with the first amino acid being neutral and aliphatic the side chain containing O or S as heteroatoms, e.g. Cys, Ser
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K5/00Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/10Tetrapeptides
    • C07K5/1019Tetrapeptides with the first amino acid being basic
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K5/00Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/10Tetrapeptides
    • C07K5/1024Tetrapeptides with the first amino acid being heterocyclic
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/06Linear peptides containing only normal peptide links having 5 to 11 amino acids

Definitions

  • the invention relates to phenylalanine, cysteine, derivatives of said amino acids, peptides comprising them, and to their use in diseases disorders or conditions whose pathology is caused by or associated with CXCR4 activity and/or cell motility.
  • Hematopoietic stem cells are a rare population of cells within the bone marrow microenvironment. Hematopoietic stem cells actively maintain the continuous production of all mature blood cell lineages, which include major components of the immune system such as T and B Lymphocytes throughout life while maintaining a small pool of undifferentiated stem and progenitor cells (Mayani, 2003).
  • stem cells migrate through the blood circulation and home into the bone marrow (BM), repopulating it with immature and maturing myeloid and lymphoid blood cells, which in turn are released into the circulation.
  • BM bone marrow
  • SDF-I chemokine stromal derived factor one
  • SDF-I is highly preserved throughout evolution. Human and mouse SDF-I are cross-reactive and differ in one amino acid. SDF-I (also named CXCL 12) serves as a survival factor for stem and progenitor cells, and is involved in immature B cell and megakaryocyte development (McGrath et al., 1999; Nagasawa et al, 1996). Homing of human stem cells and their subsequent proliferation and differentiation in transplanted immune deficient mice was found to be dependent on interactions between SDF-I, which is expressed by the host bone marrow, and its receptor CXCR4, which is expressed on the donor homing cells.
  • CXCR4 upregulation blocked the low levels of human CD34 + CXCR4 " cell engraftment.
  • the phenotype of repopulating human stem cells was defined as CD34+CD38 "/l0W CXCR4+ cells (Kollet et al., 2002).
  • cytokines such as G-CSF are used to recruit human stem cells from the circulation.
  • Proteolytic enzymes such as neutrophil elastase were found to degrade SDF- 1 in the bone marrow during G-CSF administration.
  • the levels of CXCR4 expression on hematopoietic cells within the bone marrow were found to increase prior to their mobilization.
  • Neutralizing antibody for CXCR4 or SDF-I reduced human and mouse stem cell mobilization, demonstrating SDF-1/CXCR4 signaling in cell egress (Petit et al., 2002).
  • stem cell homing and release/mobilization utilize similar mechanisms, and in both processes SDF-1/CXCR4 interactions play a major role.
  • SDF-I also plays an important role in the migration of leukemic cells. While normal and leukemic cells share similar mechanisms of migration, different homing patterns as well as SDF-I signaling pathways were found when comparing malignant human Pre-B ALL cells (B-cell precursor acute lymphoblastic leukemia) to normal immature CD34+ cells (Spiegel et al., 2004). In another malignant disease, acute myelogenous leukemia (AML), high levels of intracellular CXCR4 and SDF-I have been found in all leukemic cells, including cells that do not express surface CXCR4. CXCR4 is essential for the homing of these cells to the BM of immune deficient mice, demonstrating dynamic regulation of CXCR4 in these cells (Tavor et al., 2005).
  • AML acute myelogenous leukemia
  • CXCR4 is essential for the homing of these cells to the BM of immune deficient mice, demonstrating dynamic regulation of CXCR4 in these cells (Tavor
  • SDF-I activated the major adhesion molecules such as CD44, LFA-I, VLA-4 and VLA-5 on migrating human stem and progenitor cells as part of the multistep process of homing and transendothelial migration (Peled et al., 2000).
  • SDF-I is also involved in proliferation and survival of various cells including normal human CD34+ cells and leukemic cells (Lee et al., 2002; Nishii et al. 1999, and Tavor et al., 2005).
  • the invention relates to the use of the amino acid phenylalanine or a derivative thereof; the amino acid cysteine or a derivative thereof; a combination of amino acids comprising phenylalanine or a derivative thereof and cysteine or a derivative thereof; a peptide comprising up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof, at least one cysteine or a derivative thereof, or at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
  • the amino acid phenylalanine or a derivative thereof is used in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
  • the phenylalanine derivative is a solubility-improved derivative of phenylalanine.
  • the phenylalanine derivative is phenylalaninol (Phe-ol) or succinyl phenylalanine (Suc-Phe).
  • the phenylalanine derivative is ⁇ -phenylethylamine.
  • the amino acid cysteine or a derivative thereof is used in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
  • cysteine derivative is a solubility-improved derivative of cysteine.
  • cysteine derivative is selected from cysteine ethyl ester, cysteine sulfuric acid, and cysteinamine.
  • the combination of amino acids comprising phenylalanine or a derivative thereof and cysteine or a derivative thereof is used in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
  • a peptide of up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof is used in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
  • the peptide consists of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, or 21 amino acid residues comprising at least one phenylalanine .
  • the peptide comprises about 2, 3, 4, 5, or 6 consecutive amino acid residues including the at least one phenylalanine and at least one non-phenylalanine residue that is a charged amino acid.
  • the at least one non- phenylalanine residue is a positively charged amino acid or a negatively charged amino acid residue such as lysine or arginine.
  • the peptide comprises the amino acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or a derivative thereof linked to aminocaproic acid , SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 8.
  • the negatively charged amino acid residue is glutamic acid.
  • the peptide comprises the amino acid sequence of SEQ ID NO: 6 or SEQ ID NO: 7.
  • a peptide of up to 22 amino acid residues comprising at least one cysteine or a derivative thereof is used in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
  • the peptide consists of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, or 21 amino acid residues comprising at least one cysteine.
  • the peptide comprises about 2, 3, 4, 5, or 6 consecutive amino acid residues including the at least one cysteine and at least one non-cysteine residue selected from proline, arginine and glutamic acid.
  • the peptide consists of glutathione.
  • a peptide of up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof, except for a peptide from the amino terminus of SDF-I which includes the LSY motif (SEQ ID NO: 19) is used in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
  • the peptide consists of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, and 21 amino acid residues comprising at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof.
  • the peptide comprises about
  • the peptide comprises about 3, 4, 5, 6 or 7 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one non cysteine or non phenylalanine amino acid residue.
  • the peptide comprises 3 consecutive amino acid residues of SEQ ID NO: 12. In another further embodiment of the invention the peptide comprises 4 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one non cysteine or non phenylalanine amino acid residue. In another further embodiment of the invention the sequence of the 4 consecutive amino acid residues consists of SEQ ID NO: 11.
  • the first residue of the 4 consecutive amino acid residues is a proline such as in the sequence of the consecutive amino acid residues consisting of SEQ ID NO: 13.
  • the peptide comprises 5 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one non cysteine or non phenylalanine amino acid residue.
  • the first residue of the 5 consecutive amino acid residues is a proline such as in SEQ ID NO: 16, or a derivative of SEQ ID NO: 16 having instead of a Cysteine a dCys (Trt) residue.
  • the fifth residue of the 5 consecutive amino acid residues is a glutamic acid such as in SEQ ID NO: 10.
  • the peptide comprises 6 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one non cysteine or non phenylalanine amino acid residue.
  • the sixth residue of the 6 consecutive amino acid residues is glutamic acid and/or the first residue of the consecutive amino acid residues is proline such as in SEQ ID NO: 9.
  • the invention provides the use of a peptide of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
  • SEQ ID NO: 14 SEQ ID NO: 15, SEQ ID NO: 16 , a derivative of SEQ ID NO: 16 comprising instead of the cysteine a dCys(Trt) residue, or SEQ ID NO: 17 in the manufacture of a medicament for treating a disease, disorder or condition in which CXCR4 activity and/or cell motility is involved in the pathology or course of the disease, disorder or condition.
  • the invention also provides the use of a peptide of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 amino acid residues comprising the amino acid sequence C-X-X -F (SEQ ID NO: 18) wherein X is an arginine or an alanine in the manufacture of a medicament for treating a disease, disorder or condition in which CXCR4 activity and/or cell motility is involved in the pathology or course of the disease, disorder or condition.
  • the amino acid sequence consists of
  • the peptide is a fusion peptide and/or salt thereof.
  • the use of said amino acid (s) and/or peptide(s) is for the manufacture of a medicament for treating a disease, disorder or condition such as cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS) and/or inflammation.
  • a disease, disorder or condition such as cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS) and/or inflammation.
  • AIDS acquired immunodeficiency syndrome
  • the disease is cancer expressing CXCR4, such as leukemia, intraocular lymphoma, non-Hodgkin lymphoma, follicular center lymphoma, multiple myeloma, pancreatic cancer, kidney, prostate, breast, ovary, thyroid, colorectal cancer, oral squamous carcinoma, cervical cancer, neuroblastoma, glioma, astrocytoma, rhabdomyosarcoma, small cell lung cancer and melanoma.
  • CXCR4 such as leukemia, intraocular lymphoma, non-Hodgkin lymphoma, follicular center lymphoma, multiple myeloma, pancreatic cancer, kidney, prostate, breast, ovary, thyroid, colorectal cancer, oral squamous carcinoma, cervical cancer, neuroblastoma, glioma, astrocytoma, rhabdomyosarcoma, small cell lung cancer and melanoma.
  • the cancer is leukaemia, such as acute lymphoblastic leukemia.
  • the use is for the manufacture of a medicament for treating or preventing metastasis.
  • the use is for the manufacture of a medicament for treating AIDS.
  • the use is for treating or preventing an inflammatory disease, disorder or condition such as rheumatoid arthritis, septic arthritis, osteoarthritis, periodontitis, gingivitis, asthma, autoimmune disease, psoriasis, psoriatic arthritis, atopic dermatitis; interstitial nephritis, ocular inflammation, liver cirrhosis, neuroinflammatory disorders, graft versus host disease and inflammatory gastric conditions.
  • the invention provides a peptide of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues comprising the amino acid sequence C-X-X-F (SEQ ID NO: 18) wherein X is an arginine or an alanine.
  • the peptide comprises the amino acid sequence of SEQ ID NO: 14 or SEQ ID NO: 15,
  • the invention also provides a peptide of peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11,
  • amino acid residues comprising 3, 4, 5, 6, 7, or 8 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine residue or a derivative thereof separated by at least one alanine.
  • the cysteine or derivative thereof and the phenylalanine or derivative thereof are separated by one or two alanine residues.
  • the peptide comprises 4 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one alanine.
  • the first and/or the last amino acid residue of the 4 consecutive amino acid residues is cysteine or a derivative thereof and phenylalanine or a derivative thereof, respectively.
  • the invention also provides a peptide of up to 22 amino acid residues comprising 3, 4, 5, 6, or 7 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by one arginine, except for a peptide from the amino terminus of SDF-I which includes the LSY motif (SEQ ID NO: 19).
  • the peptide of up to 22 amino acid residues comprises 3 consecutive amino acid residues consisting of SEQ ID NO: 12.
  • the peptide of up to 22 amino acid residues comprises 4 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by one arginine.
  • the first and the last amino acid residue of the consecutive amino acid residues is cysteine or a derivative thereof and phenylalanine or a derivative thereof, respectively such as in the sequence of the 4 consecutive amino acid residues consisting of SEQ ID NO: 11.
  • the first amino acid residue of the 4 consecutive amino acid residues is a proline such as in the sequence of SEQ ID NO: 13.
  • the peptide of up to 22 amino acid residues comprises 5 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by one arginine.
  • the first amino acid residue of the 5 consecutive amino acid residues is a proline such as in the sequence of SEQ ID NO: 16, or a derivative of SEQ ID NO: 16 having instead of a Cysteine a dCys (Trt) residue.
  • the fifth residue of the 5 consecutive amino acid residues is a glutamic acid such as in the sequence of SEQ ID NO: 10.
  • the peptide of up to 22 amino acid residues comprises 6 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by one arginine.
  • the sixth residue of the 6 consecutive amino acid residues is glutamic acid.
  • the first residue of the 6 consecutive amino acid residues is proline such as in the sequence of SEQ ID NO: 9.
  • the invention also provides a peptide of up to 22 amino acid residues comprising 4, 5, 6, 7, or 8 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by two arginines such as in SEQ ID NO: 15.
  • the invention provides a peptide of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
  • the invention provides a peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acids comprising 3 consecutive amino acid residues consisting of SEQ ID NO: 1 linked to aminocaproic acid or of SEQ ID NO: 8.
  • the invention provides a peptide of about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acids comprising 4 consecutive amino acid residues consisting of SEQ ID NO: 5.
  • the invention provides a peptide consisting of amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 1 linked to aminocaproic acid , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, P SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, a derivative of SEQ ID NO: 16 comprising instead of the cysteine a dCys(Trt) residue or SEQ ID NO: 17.
  • the invention provides a peptide of about 3, 4, 5, 6, 7, 8, or 9 amino acid residues comprising the amino acid sequence C-R-F, except for a peptide from the amino terminus of SDF-I including the LSY motif or consisting of 6 to 9 amino acid residues lacking the LSY motif in which the last amino acid residue is serine.
  • Peptides provided by the invention include circularly permuted peptides and/or fusion peptides.
  • a fusion peptide is a peptide fused to a protein such as an immunoglobulin.
  • a fusion peptide is a peptide fused to a high molecular weight polymer such as polyethylene glycol (PEG).
  • PEG polyethylene glycol
  • the invention embraces a salt of a peptide provided by the invention.
  • the invention relates to an isolated DNA encoding a peptide provided by the invention, an expression vector comprising said DNA , a host cell harboring said DNA and/or expression vector, and to a method for producing said peptide comprising growing the host cell and isolating the protein produced.
  • the host cell is a eukaryotic cell, such as a mammalian cell e.g. HeLa, 293 T HEK and CHO, insect cell, or yeast cell.
  • a mammalian cell e.g. HeLa, 293 T HEK and CHO
  • insect cell or yeast cell.
  • the host cell is a prokaryotic cell.
  • the invention relates to the use of a peptide provided by the invention or a salt thereof in the manufacture of a medicament for treating or preventing a disease, disorder or condition selected from cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS), inflammation and metastasis.
  • a disease, disorder or condition selected from cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS), inflammation and metastasis.
  • AIDS acquired immunodeficiency syndrome
  • the invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a peptide provided by the invention or a salt thereof.
  • the invention relates to a pharmaceutically acceptable carrier and a peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues comprising about 3, 4, 5, 6, or 7 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by one arginine, except for a peptide from the amino terminus of SDF-I including the LSY motif.
  • the invention in another further aspect, relates to a pharmaceutical composition
  • a pharmaceutical composition comprising the DNA of the invention and a pharmaceutically acceptable carrier.
  • the invention in another further aspect, relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a vector of the invention and a pharmaceutically acceptable carrier.
  • the invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a mixture of amino acids consisting of phenylalanine or a derivative thereof and cysteine or a derivative thereof.
  • the invention relates to a method of treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility in a subject in need, comprising administering to the subject a therapeutically effective amount of the amino acid phenylalanine or a derivative thereof; the amino acid cysteine or a derivative thereof; a combination of amino acids comprising phenylalanine or a derivative thereof and cysteine or a derivative thereof; a peptide comprising up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof, at least one cysteine or a derivative thereof, or at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof, except for a peptide from the amino terminus of SDF-I including the LSY motif.
  • the invention relates to a method of treating or preventing a disease, disorder or condition in which the activity of CXCR4 is involved in the pathology or course of the disease, disorder or condition comprising administering to a subject in need a therapeutically effective amount of a peptide comprising a sequence set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, a derivative of SEQ ID NO: 16 comprising instead of the cysteine a dCys(Trt) residue, SEQ ID NO: 17 or a combination thereof.
  • the invention relates to a method of treating or preventing a disease, disorder or condition in which the activity of CXCR4 is involved in the pathology or course of the disease, disorder or condition comprising administering to a subject in need a therapeutically effective amount of a peptide comprising a sequence set forth in SEQ ID NO: 1, SEQ ID NO: 1 linked to aminocaproic acid , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 or a combination thereof.
  • the invention relates to a method of treating or preventing a disease, disorder or condition selected from cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS), inflammation and metastasis comprising administering to a subject in need a therapeutically effective amount of a peptide provided by the invention.
  • a disease, disorder or condition selected from cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS), inflammation and metastasis
  • Figs. 1A-1D show that a factor found in the conditioned medium of leukemic Bl cells inhibits migration of hematopoietic cells.
  • Bl a line prepared from precursor-B cells from a patient with acute lymphoblastic leukemia B cells [B- ALL]
  • B 1-2 a sub-clone derived from the Bl cells by means of limiting dilution cells grown in 24 well plates at high or low cell densities for 16 hours, were tested for their migration capability towards SDF-I (125ng/ ml) in a transwell migration assay. It was found that cells taken from the high density cultures migrated significantly less towards SDF-I than cells taken from low density cultures *p ⁇ 0.05.
  • CB CD34 + cells comprising hematopoietic precursors
  • leukemic G2 cells another precursor-B cell line prepared from a different precursor-B-ALL patient
  • CB CD34+ or G2 cells were pre-treated for 1 hour with conditioned medium taken from the high density B 1 culture or remained untreated, and their SDF- 1 dependent migration was tested in a transwell migration assay.
  • the tested cells CB CD34+ or G2
  • SDF-I 125 ng/ml
  • C. Shows inhibition of SDF-I mediated ERK phosphorylation in G2 cells preincubated with the conditioned medium of B 1.
  • D. Shows reduced levels of PKC- ⁇ mRNA (detected by PCR) in Bl cells taken from a high-density culture (2x10 6 cells/ml) compared to the levels of PKC- ⁇ mRNA in B l from a low density cultures (1x10 5 cells/ml) or G2 cells taken from high-density cultures (2x10 cells/ml).
  • Bl cell line taken from a high-density culture exhibit reduced expression of PKC- ⁇ .
  • Figs. 2A-2B show the separation of the migration inhibitory factor from the conditioned medium of B l.
  • A. Gel filtration separation was carried out using a superdex peptide column. Low ( ⁇ 3kDa) MW fractions of conditioned medium or appropriate control (consisting of Iscove's Modified Dulbecco's Medium or "IMDM") were loaded and fractionated on the column, and the migration inhibitory capability of the different fractions was tested in transwell assays using G2 cells. The arrow indicates the inhibitory fraction, which is absent in the IMDM.
  • B. Shows that fractions 33-34 inhibit SDF-I mediated migration of G2 cells by 40%.
  • Figs. 3A-3F show the effect of different amino acids, peptides and ⁇ - phenylethylamine on spontaneous and SDF-I mediated migration of cells.
  • A. Upper panel: the indicated concentrations of each of the amino acids Phe, GIu, Met, VaI, Pro, and Cys (upper panels) were added to the lower chamber of the transwell together with medium or with medium supplemented with SDF-I in order to check effect on spontaneous (left) or SDF-I dependent (right) G2 migration, respectively.
  • Phe and Cys were found to be potent inhibitors of both, SDF-I dependent and spontaneous G2 migration.
  • Figs. 4A-4C show the inhibitory effect of Phe-ol on cell adhesion, CXCR4 expression, and SDF-I -mediated calcium flux.
  • A. Shows assessment of adherence of untreated CB CD34+ cells or CD34+ cells pretreated with Phe-ol (at indicated concentration) to stromal cells MS-5 (known to express SDF-I). Adherence of CD34+ cells to MS-5 cells was found to be inhibited by Phe-ol in a dose response manner B.
  • FIGs. 5A-5B show inhibition of homing of transplanted human leukemic G2 cells to the bone marrow (BM) 5 spleen, liver and lung of NOD/SCID by preincubation of the cells with Phe-ol prior to transplantation.
  • NOD/SCID mice were transplanted with untreated or Phe-ol (5 or 10 mM) preincubated G2 cells (10 7 cells/mouse).
  • BM (A), spleen, liver and lungs (B) were harvested and assayed for the levels of human cell homing to such tissues.
  • Data represent the number of CD45 human cells per 10 6 acquired total cells.
  • Phe-ol inhibited homing of leukemic G2 cells to the bone marrow, spleen, liver and lung of NOD/SCID mice in a dose dependent manner.
  • Fig. 6 shows G2 spontaneous and SDF-I -induced (50 ng/ml) cell migration in the presence of L-cysteine, glutathione and cysteine derivates (all at 10 mM).
  • Culture medium alone or medium containing L-cysteine or its derivates were loaded into the bottom of transwell chambers.
  • G2 cells (10 1 VmI) were loaded into the upper chambers and allowed to migrate for 4 hrs at 37 0 C. Cells were collected from the bottom chambers and counted using a fluorescence-activated cell sorter (FACS Calibur).
  • Percentage of migrated cells is shown in: culture with medium alone (control) (1); supplemented with L-cysteine (2); L-cysteine ethyl ester hydrochloride (3); L-cysteine sulfmic acid (4); cysteinamine hydrochloride (5); or glutathione (6).
  • Fig. 7A-7B shows the effect of cysteine and phenylalanine-containing peptides on migration of primary T cells in vitro.
  • the effect of ImM (A) or 100 ⁇ M (B) cysteine and phenylalanine-containing peptides (1) P-C-R-F-F-E (SEQ ID NO: 9); (2) C-R-F-F-E (SEQ ID NO: 10); (3) C-R-F-F (SEQ ID NO: 11); (5) C-R-F (SEQ ID NO: 12); (6) P-C-R-F (SEQ ID NO: 13 ); (7) C-A-A-F (SEQ ID NO: 14); (8) C-R-R-F(SEQ ID NO: 15); and (13) the derivative of P-C-R-F-F (SEQ ID NO: 17), P-dCys(Trt)-R-F-F on SDF-I induced migration of human primary T-cells was explored in vitro.
  • the cells (I x 10 6 /mL) were incubated with the peptides for 2 hrs at 37 0 C, 95% humidity, then added unwashed into the upper chambers of Costar 24-well transwell plates with 5 ⁇ m pore filters (Corning Inc. Corning, NY) and allowed to migrate for 2hrs at 37 0 C, 95% humidity, 5% CO2 towards SDF-I (20 ng/mL).
  • Migrated cells were collected from the lower chambers and counted using a FACSCalibur flow cytometer (Becton Dickinson, San Jose, California). The cells were gated in forward and side scatters set at linear gain. Data are presented as a percentage of migrated cells that were pretreated with peptides compared to the percentage of migrated untreated cells taken as 100%.
  • the present invention relates to the use of the amino acid phenylalanine or a derivative thereof; the amino acid cysteine or a derivative thereof; a combination of amino acids comprising phenylalanine or a derivative thereof and cysteine or a derivative thereof; a peptide comprising up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof, at least one cysteine or a derivative thereof, or at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof, in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
  • agents such as the amino acids cysteine or a derivative thereof, phenylalanine or a derivative thereof, e.g. ⁇ - phenylethylamine which in nature is synthesized from the amino acid phenylalanine by enzymatic decarboxylation, solubility-improved derivatives of phenylalanine such as phenylalaninol, (Phe-ol), succinyl phenylalanine (Suc-Phe), cysteine ethyl ester, cysteine sulfinic acid, cysteinamine; and short peptides including cysteine, phenylalanine or the combination of both amino acids, can inhibit migration of cells and/or CXCR4 expression of cells or both, paves the way to new therapies for diseases, disorder or conditions responsive to inhibition of cell motility and/or CXCR4 activity or whose pathology can be ameliorated, alleviated or prevented by inhibition of cell motility and/or inhibition of CX
  • agents of the invention can be used to decrease the CXCR4 activity or response, without being bound by the mechanism, for example by decreasing expression level of CXCR4 in cells, and/or can be used to inhibit cell motility. Therefore these agents can be used for treating or preventing a disease, disorder, or condition whose pathology is caused by, or associated with the activity or signaling trough CXCR4 in cells and/or motility of cells.
  • a disease, disorder, or condition whose pathology is caused by or associated with the level of CXCR4 in cells and/or motility of cells is a disease, disorder, or condition responsive to inhibition of CXCR4 activity and/or to inhibition of cell motility and which can be prevented or ameliorated by inhibition of CXCR4 activity and/or motility.
  • inhibition of CXCR4 activity refers, for example, to inhibition of activity or inhibition of level of expression of CXCR4.
  • agents of the invention such as cysteine or derivatives thereof; phenylalanine or derivatives thereof such as ⁇ -phenylethylamine; and peptides including phenylalanine; inhibited the spontaneous, as well as the SDF-I dependent motility of Precursor-B ALL (Pre-BLL) cells, as measured in vitro by the transwell assay.
  • Pre-BLL is the most common childhood malignancy and the second most common adult acute leukemia.
  • the migration inhibitory effect of D and L phenylalanine was found to be similar and therefore the migration inhibitory effect is independent of the stereoisomeric form of the amino acid.
  • the findings according to the invention demonstrated that Phe-ol inhibited Pre-BLL cell migration in vivo (or homing) from the circulation to the bone marrow, spleen, lung, and liver.
  • the inhibitory effect of agents according to the invention was detected also in normal non-neoplastic cells.
  • motility of normal cells like hematopoietic cells CD34+ cells, was inhibited by Phe-ol and that motility of normal primary T was inhibited by short peptides including phenylalanine or by short peptides including phenylalanine and cysteine.
  • Findings according to the present invention show that agents of the invention can inhibit activities that are mediated by SDF-I and its receptor CXCR4.
  • the amino acid cysteine or phenylalanine; and derivatives of said amino acid such as phenylalaninol, (Phe- ol), succinyl phenylalanine (Suc-Phe), cysteine ethyl ester, cysteine sulfinic acid, cysteinamine; ⁇ -phenylethylamine; and short peptides which include amino acids cysteine and/or phenylalanine, are able to inhibit SDF-I dependent motility of cells.
  • Phe-ol is capable to mediate; inhibition of homing of Pre-BLL cells to bone marrow, a process known to be dependent on SDF-I activity; inhibition of SDF-I dependent Ca+ influx; and inhibition of adhesion of CD34+ cells to SDF-I producing cells.
  • the levels of expression of CXCR4 in cells treated with Phe-ol was tested according to the invention, and it was found that Phe-ol inhibited CXCR4 expression in neoplastic cells such as Pre BLL cells and in normal cells such as primary T cells and CD34+ cells.
  • the present invention provides the use of the amino acid phenylalanine or a derivative thereof like a solubility-improved derivative, for example, phenylalaninol (Phe-ol) or succinyl phenylalanine (Suc-Phe) or derivatives synthesized from the amino acid phenylalanine like phenylethylamide; the amino acid cysteine or derivatives thereof like cysteine ethyl ester, cysteine sulfmic acid, and cysteinamine; or a mixture of amino acids comprising phenylalanine or a derivative, and cysteine or a derivative thereof; in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
  • a solubility-improved derivative for example, phenylalaninol (Phe-ol) or succinyl phenylalanine (Suc-Phe) or derivatives synthe
  • amino acid refers either to a single amino acid or to a derivative thereof, or to a mixture of two ore more amino acids, unless otherwise specified, and includes all the natural occurring amino acids found in proteins and non-natural amino acids.
  • non-natural amino acids include, but are not limited to, 4-hydroxyproline, 5-hydroxylisine, and N-methyl amino acids such as N-methyllysine, ⁇ -carboxyglutamate, desmosine, selenocysteine, citrulline and ornithine.
  • Derivatives of amino acids may be an amino acid residue containing additional chemical moieties not normally part of the amino acid and is encompassed by the invention as long as it retains at least a portion of the function of the amino acid which permits its utility as inhibitor of CXCR4 expression or activity and/or as an inhibitor of spontaneous and/or SDF-I mediated cell migration.
  • ⁇ -phenylethylamine is a derivative of phenylalanine. In nature, it is synthesized from the amino acid phenylalanine by enzymatic decarboxylation.
  • An amino acids may exist in one or more stereoisomeric form, because of the presence of asymmetric atoms or rotational restrictions can exist as a number of stereoisomers with R or S stereochemistry at each chiral centre or as atropisomeres with R or S stereochemistry at each chiral axis.
  • the invention includes use of all such enantiomers and diastereoisomers and mixtures thereof.
  • Phenylalanine and/or cysteine amino acids and/or a derivative thereof like phenylalaninol, succinyl phenylalanine, ⁇ -phenylethylamine, cysteine ethyl ester, cysteine sulfide acid, and cysteinamine can be administered or used according to the invention together with additional amino acids such as, methionine, proline, valine, glutamic acid and/or a combination thereof.
  • the amino acid comprises the combination or mixture of phenylalanine, phenylalaninol, succinyl phenylalanine or phenylethylamine and cysteine, cysteine ethyl ester, cysteine sulfinic acid, or cysteinamine.
  • F-K, K-F, F-R, R-F and F-E were able to inhibit by about 50% of cell migration and F-L-K and F-K- ⁇ -aminocaproic acid were able to inhibit by about 30% of cell migration.
  • the invention provides the use of a short peptide of about 22 amino acid residues comprising at least one phenylalanine or a derivative thereof, or comprising a short peptide of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 amino acid residues comprising at least one phenylalanine or a derivative thereof.
  • the short peptide may comprise 2, 3, 4, 5 or 6 consecutive amino acid residues which include the at least one phenylalanine and at least one non- penylalanine residue that is a charged amino acid.
  • the charged amino acid can be a positively charged amino acid such as lysine or arginine, or a negatively charged amino acid such as glutamic acid.
  • Non limiting examples of such peptides are short peptides of up to 22 amino acid residues comprising one of the following amino acid sequences F-K, K-F, F-R, R-F, K-F-K-F, F-L-K, F-K- ⁇ -aminocaproic acid F-E, and E-F or a salt thereof. Additional amino acids can be included on either or both of the N- or C- termini of these sequences, of course, these additional amino acid residues should not significantly interfere with the functional activity of the peptides.
  • the invention also relates to the use of a short peptide of up to 22 amino acid comprising at least one cysteine or a derivative thereof, for example to a peptide of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20 or 21 amino acid residues comprising at least one cysteine, for example to a peptide of 2, 3, 4, 5, or 6 consecutive amino acids including the at least one cysteine and at least one non- cysteine residue selected from proline, arginine and glutamic acid.
  • such peptide is glutathione.
  • short peptides containing phenylalanine and cysteine residues such as, for example, P-C-R-F-F-E (SEQ ID NO: 9); C-R-F-F-E (SEQ ID NO: 10); C-R-F-F (SEQ ID NO: 11); C-R-F (SEQ ID NO: 12); P-C-R-F (SEQ ID NO: 13); C-A-A-F (SEQ ID NO: 14); C-R-R-F (SEQ ID NO: 15) and a derivative of P-C-R-F-F (SEQ ID NO: 16), P-dCys(Trt)-R-F-F were very potent inhibitors of SDF-I -mediated T cell migration, as measured by the in vitro transwell assay.
  • Peptide of SEQ ID NO: 9, P-C-R-F- F-E is a hexapeptide from the N-terminus sequence of SDF-I containing one proline residue at position 1 a cysteine residue at position 2 and two phenylalanine at positions 4 and 5, the cysteine and phenylalanine are separated by an arginine and the last residue is glutamic acid.
  • Peptide of SEQ ID NO: 10, C-R-F-F-E is similar to peptide of SEQ ID NO: 9, except that the proline is missing resulting in a pentapetide in which cysteine is at position 1.
  • Peptide of SEQ ID NO: 11, C-R-F-F is similar to peptide of SEQ ID NO: 10, except that the glutamic acid is missing resulting in a tetrapeptide in which cysteine is also at position 1, the last residue is phenylalanine and has in total two phenylalanine residues.
  • Peptide of SEQ ID NO: 12, C-R-F is similar to peptide of SEQ ID NO: 11, except that the last amino acid phenylalanine is missing resulting in a tetrapeptide in which cysteine is at position 1 and has only one phenylalanine residue at position 3 and in which the cysteine and phenylalanine are separated by one arginine.
  • Peptide of SEQ ID NO: 13, P-C-R-F is similar to peptide of SEQ ID NO: 9, except that one phenylalanine residue and one glutamic acid residue at positions 5 and 6 respectively are missing, resulting in a tetrapetide which has a proline at position 1 and the cysteine at position 2 and has only one phenylalanine.
  • Peptide of SEQ ID NO: 14, C-A-A-F is a tertrapeptide like peptide SEQ ID NO: 11 in which the arginine at position 2 and the phenylalanine at position 3 have been substituted by alanines, resulting in a peptide having a cysteine at position 1 and only one phenylalanine at position 4.
  • Peptide of SEQ ID NO: 15, C-R-R-F is a tertrapeptide like peptide of SEQ ID NO: 11 in which the phenylalanine at position 3 has been substituted by arginine resulting in a peptide having a cysteine at position 1 and only one phenylalanine at position 4.
  • Peptide P-dCys (Trt)-R-F-F is a derivative of peptide P-C-R-F-F (SEQ ID NO: 16) in which the cysteine residue which was substituted to the cysteine derivative dCys (TrT).
  • Trt is trity, a protecting group for the SH functional moiety of cysteine.
  • the Fmoc-CYS (Trt) was used as a building block peptide chain assembly. It was found according to the present invention that these peptides used at concentration that were non toxic to the cells, were very potent inhibitors (in range 50-90% inhibition) of T cell migration mediated by SDF-I . These peptides were able to inhibit the spontaneous migration as well, but to a lesser extent.
  • Peptides from the amino terminus of SDF-I of 10 amino acid or larger including the LSY motif were disclosed by Heveker et al. (1998, 2001), Loetscher et al. (1998) and Luo et al. (1999). Of note, all of the active disclosed peptides included the LSY motif. As disclosed by Heveker et al. (2001) the peptides displayed chemotactic effects on polymorphonuclear leucocytes (PMN) but none of them inhibited chemotaxis induced by SDF-I in these cells. The same author has indicated in an earlier publication that the LSY motif (SEQ ID NO: 19) was essential for HIV inhibition (Heveker 1998).
  • the peptides containing cysteine and phenylalanine which according to the invention are from the amino terminus of SDF-I, lack the LSY motif and are capable of inhibiting chemotaxis induced by SDF-I . Since the replication of the HIV, as the chemotactic activity of SDF-I, involves CXCR4 it is likely that these peptides of the invention will also be capable to inhibit HIV virus.
  • the present invention relates to the use of a peptide of up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof , except for a peptide from the amino terminus of SDF-I which includes the LSY motif, in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
  • the peptide can consist of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, and 21 amino acid residues comprising at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof, such as a peptide of up to 22 amino acid residues comprising 2, 3, 4, 5, 6 or 7 consecutive amino acid residues including the at least one cysteine residue or a derivative thereof and at the least one phenylalanine residue or a derivative thereof.
  • the peptide consists of 3, 4, 5, 6, or 7 consecutive amino acid residues including one cysteine residue or a derivative thereof and one phenylalanine residue or a derivative thereof separated by one or more arginines such as in the peptides P- C-R-F-F-E (SEQ ID NO: 9), C-R-F-F-E (SEQ ID NO: 10), C-R-F-F (SEQ ID NO: 11), C-R-F (SEQ ID NO: 12), P-C-R-F (SEQ ID NO: 13), C-R-R-F (SEQ ID NO: 15), P-dCys(Trt)-R-F-F (SEQ ID NO: 16).
  • the peptide comprises 3, 4, 5, 6 or 7 consecutive amino acids including one cysteine residue or a derivative thereof and one phenylalanine residue or a derivative thereof separated by one or more alanines like in peptide C-A-A-F.
  • the peptide comprises 4 consecutive amino acid residues wherein the first residue of the consecutive amino acid residues is cysteine or a derivative thereof and the fourth residue is phenylalanine or a derivative thereof like in the peptides C-A-A-F (SEQ ID NO: 14), C-R-R-F (SEQ ID NO: 15) and C-R-F-F (SEQ ID NO: 11).
  • the peptide comprises 4 or 5 consecutive amino acid residues including the at least one cysteine residue or a derivative thereof and at the least one phenylalanine residue or a derivative thereof wherein the first residue of the consecutive amino acid residues is a proline like for example in P-C-R-F (SEQ ID NO: 13) and P-dCys (Trt)-R-F-F (SEQ ID NO: 16), respectively.
  • the peptide comprises 5, 6 or 7 consecutive amino acid residues including the at least one cysteine residue or a derivative thereof and at the least one phenylalanine residue or a derivative thereof wherein the last residue of the consecutive amino cid residues is a glutamic acid such as in C-R-F-F-E (SEQ ID NO: 10), P-C-R-F-F-E (SEQ ID NO: 9) and C-P-C- R-F-F-E (SEQ ID NO: 17), respectively.
  • Exemplary peptides that can be used according to the invention include, but are not limited to, F-K, K-F, F-R, R-F, K-F-K-F, F-E, E-F, F-L-K, F-L- ⁇ - aminocaproic acid and glutathione, and peptides including amino acids of both types phenylalanine and cysteine such as C-P-C-R-F-F-E, P-C-R-F-F-E; C-R-F-F- E; C-R-F-F; C-R-F; P-C-R-F; C-A-A-F; C-R-R-F and P-dCys(Trt)-R-F-F, their salts, functional derivatives, as well as its active mutants, i.e.
  • peptides comprising phenylalanine, and cysteine wherein one or more amino acids of the structure are eliminated or substituted by other amino acids or one or more amino acids are added to that sequence in order to obtain peptides of up to 22 amino acid residues having the same activity such as inhibiting motility and/or CXCR4 activity of cells.
  • the peptides may comprise half-life extending moieties such as a protein or a high molecular weight polymer resulting in "fusion peptides" with extended half- life in body fluids.
  • peptides according to the invention can be fused to a protein such as, for example, an immunoglobulin or to a high molecular weight polymer, such as polyethylene glycol (PEG), or the like.
  • the invention provides peptides, for example it provides a peptide of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 amino acid residues comprising the amino acid sequence C-X-X-F (SEQ ID NO: 18) wherein X is an arginine or an alanine.
  • the peptide comprises the amino acid sequence of SEQ ID NO: 14 or SEQ ID NO: 15.
  • the invention provides a peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
  • amino acid residues comprising 3, 4, 5, 6, 7, or 8 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by at least one alanine.
  • the peptide comprises one cysteine or derivative thereof and one phenylalanine or derivative thereof separated by one or two alanine residues.
  • the invention relates also to a peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues comprises 4 consecutive amino acid residues wherein the first and the last amino acid residue of the consecutive amino acid residues is cysteine or a derivative thereof and phenylalanine or a derivative thereof, respectively.
  • the invention provides also a peptide of up to 22 amino acid residues comprising 3, 4, 5, 6, or 7 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by one arginine, except for a peptide from the amino terminus of SDF-I including the LSY motif and except for a peptide consisting of 6, 7, 8, 9, 10 or 11 amino acid residues which excludes the LSY motif having a serine as the last residue.
  • the peptide comprises 3 consecutive amino acid of SEQ ID NO: 12.
  • the peptide of up to 22 amino acid residues comprises 4 consecutive amino acid residues wherein the first and the last amino acid residue of the consecutive amino acid residues is cysteine or a derivative thereof and phenylalanine or a derivative thereof, respectively like in SEQ ID NO: 1 1.
  • the peptide of up to 22 amino acid residues comprises 4 consecutive amino acid residues wherein the first amino acid residue of the consecutive amino acid residues is a proline like in SEQ ID NO: 13.
  • the peptide of up to 22 amino acid residues comprises 5 consecutive amino acid residues wherein the first amino acid residue of the consecutive amino acid residues is a proline like in SEQ ID NO: 16, or a derivative of SEQ ID NO: 16 having instead of a Cysteine a dCys(Trt) residue.
  • the peptide of up to 22 amino acid residues comprises 5 consecutive amino acid residues wherein the fifth residue of the consecutive amino acid residues is a glutamic acid like in SEQ ID NO: 10.
  • the peptide of up to 22 amino acid residues comprises 6 consecutive amino acid residues wherein the sixth residue of the consecutive amino acid residue is glutamic acid and/or wherein the first residue of the consecutive amino acid residues is proline like in SEQ ID NO: 9.
  • the peptide of up to 22 amino acid residues comprises 7 consecutive amino acid residues wherein the seventh residue of the consecutive amino acid residue is glutamic acid and/or wherein the " first residue of the consecutive amino acid residues is a cysteine like in C-P-C-R-F-F-E (SEQ ID NO: 17).
  • the invention provides a peptide of up to 22 amino acid residues comprising 3, 4, 5, 6, 7, or 8 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by two arginines, like in SEQ ID NO: 15.
  • a peptide of 3, 4, 5, 6, 7, 8, or 9 amino acid residues comprising the amino acid sequence C-R-F (SEQ ID NO: 12), except for a peptide from the amino terminus of SDF-I including the LSY motif (SEQ ID NO: 19).
  • the invention also provides a peptide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, 21 or 22 amino acids comprising: 2 consecutive amino acid consisting of F-K, K-F, F-R, R-F, F-E or E-F; 3 consecutive amino acid consisting of F-L-K or F-K- ⁇ -aminocaproic acid; or 4 consecutive amino acid consisting of K-F-K-F.
  • the invention provides a peptide of up to 12 amino acids comprising the amino acid sequence of F-K, K-F, F-R, R-F, K-F-K-F, F-L-K, F-K- ⁇ -aminocaproic acid, F-E, E-F, P-C-R-F-F-E, C-R-F-F-E, C-R-F-F, C-R-F, P-C-R- F, C-A-A-F, C-R-R-F, or P-dCys(Trt)-R-F-F.
  • the peptide consists of F-K, K-F, F-R, R-F, K-F-K-F, F-L-K, F-K- ⁇ -aminocaproic acid, F-E, E-F, P-C-R-F-F-E, C-R-F-F- E, C-R-F-F, C-R-F, P-C-R-F, C-A-A-F, C-R-R-F, P-C-R-F-F or P-dCys(Trt)-R-F- F.
  • Additional amino acids can be included on either or both of the N- or C- termini these sequences, of course, these additional amino acid residues should not significantly interfere with the functional activity of the peptides.
  • the invention provides a peptide consisting of amino acid sequence of SEQ ID NO: I 5 SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 1 linked to aminocaproic acid, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 5 SEQ ID NO: 12, P SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, a derivative of SEQ ID NO: 16 comprising instead of the cysteine a dCys(Trt) residue or SEQ ID NO: 17 (C-P-C-R-F-F-E.), a derivative thereof, or a combination thereof.
  • K-F-K-F is a dual peptide comprising two K-F peptides which also has inhibitory activity therefore in another embodiment; the present invention provides a multiple peptide comprising a number of the same or different peptides of the present invention.
  • the peptides of the invention can be "protected" at the terminal amino group for example by coupling with any of various amino-terminal protecting groups traditionally employed in peptide synthesis.
  • suitable groups include acyl protecting groups, like formyl, acetyl, and benzoyl; aromatic urethane protecting groups, for example, benzyloxycarbonyl; and aliphatic urethane protecting groups, for example, tert-butoxycarbonyl.
  • the peptides of the invention can be "protected" at the terminal carboxyl group, for example by coupling with any of various carboxy-terminal protecting groups.
  • suitable protecting groups include tert-butyl or benzyl, which are linked to the terminal caroxyl group through an ester or ether bond.
  • the term peptide relates to chains of amino acids and/or amino acid derivatives.
  • a derivative of a peptide according to the invention may contain additional chemical moieties as a part of the peptide. Examples of such chemical moieties are amides of carboxyl groups at the C-terminal end of the peptides and amides of free carboxyl groups of aspartic or glutamic acid residues.
  • any such derivatives which are embraced according to the invention must have substantially similar activity to the peptide of the invention.
  • the peptides may comprise D and/or L amino acids.
  • the advantage of using peptides comprising one or more than one D amino acid residues is that these peptides may be more resistant to proteolytic degradation and therefore may have increased half life in biological fluids such as plasma.
  • the peptide is a short peptide and consists of up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues, up to 10 amino acid residues, or of 2, 3, 4, 5, 6, 7, 8, or 9 amino acid residues.
  • the invention embraces also peptides of the invention that are circularly permuted peptides.
  • the term "circularly permuted” as used herein refers to a linear peptide in which the termini have been joined together, either directly or through a linker, to produce a circular peptide, and then the circular peptide is opened at another location to produce a new linear peptide with termini different from the termini in the original peptide.
  • Circular permutations include those peptides whose structure is equivalent to a peptide that has been circularized and then opened.
  • a circularly permuted peptide may be synthesized de novo as a linear peptide and never go through a circularization and opening step.
  • Circularly permuted peptides are single-chain peptides, which have their normal termini fused, often with a linker, and contain new termini at another position. See Goldenberg, et al. J. MoI. Biol., 165: 407-413 (1983) and Pan et al. Gene 125: 111-114 (1993), both incorporated by reference herein.
  • Circular permutation is functionally equivalent to taking a straight-chain peptide, fusing the ends to form a circular peptide, and then cutting the circular peptide at a different location to form a new straight chain peptide with different termini. Circular permutation thus has the effect of essentially preserving the sequence and identity of the amino acids of a peptide while generating new termini at different locations.
  • the peptides according to the invention can be linear or cyclic peptides. Additional peptides according to the invention comprising different amino acid combinations which include phenylalanine and/or cysteine and exhibit motility and/or CXCR4 inhibitory potency can be produced, for example, by chemical synthesis or by recombinant technology. These methods are known in the art.
  • chemical synthesis is the solid method using a multiple peptide synthesizer (AMS 422. Abimed Analyzer Tech).
  • an Fmoc (N-9 Fluorentylmethoxycarbonyl) strategy was employed following commercial protocols of the company. This approach of peptide synthesis is widely used (Fridkin et al., 2006).
  • peptides that show motility and/or CXCR4 inhibitory potency can be selected by using the transwell in vitro assay as described in the Example section and/or as described below.
  • Expression of a peptide or fusion peptides of the invention in a mammalian cell may be approached by inserting the DNA coding for the peptide or for the fusion peptide into a vector comprising a promoter, optionally an intron sequence and splicing donor/acceptor signals, and further optionally comprising a termination sequence.
  • the above promoter, intron, and termination sequences are operable in mammalian cells.
  • the promoter is preferably a strong promoter such as the above- noted RSV, CMV, or MPSV promoter.
  • the promoter may also be the SV40 early promoter (Everett, et al.
  • a cellular promoter such as the beta-actin promoter or the ELF-I promoter (Tokushige, et al., 1997).
  • a hybrid promoter may be used, such as the hybrid between the lac operator and the human ELF-I alpha promoter as described by Edamatsu et al. 1997, the CMV-beta actin hybrid promoter described by Akagi et al (1997), or the hybrid between the operator sequences and the CMV promoter (Furth et al., 1994, and references therein).
  • Intron sequences which may be inserted as complete sequences, i.e., including the splice donor and acceptor sites, may be inserted into the coding sequence of the polypeptide, which it is desired to express. Insertion if such intron sequences may enhance RNA stability and thus enhance production of the desired polypeptide. While in principle, suitable intron sequences may be selected from any gene containing introns, exemplary intron sequences are the beta-actin intron, the SV 40 intron, and the p55 TNF receptor intron.
  • the intron sequence may contain enhancer elements, which may enhance transcription from the above-noted promoters.
  • intron sequences also contain transcriptional or translational control sequences that confer tissue specific expression. Therefore, when it is desired to express a peptide or fusion peptides of the invention in a tissue-specific manner, such intron sequences may be advantageously employed.
  • An example of an intron containing tissue-specific enhancer elements is the erythroid-specific enhancer located in intron 8 of the human 5-aminolevulinate synthase 2 gene (Surinya et al. 1998), and a discussion of the principle of enhancing protein production using intron sequences, together with example intron sequences, is provided in Huang et al. 1990.
  • Transcriptional termination sequences and polyadenylation signals may be added at the 3 ' end of the DNA coding for the polypeptide that it is desired to express. Such sequences may be found in many or even most genes.
  • the SV 40 polyadenylation signal can be used (Schek et al., 1992, and references therein).
  • Vectors for expression of peptides of invention or fusion peptides in a mammalian cell could be used for example the pcDNA3.1 vector (Invitrogen), which contains the CMV promoter for driving expression of the gene encoding the desired polypeptide and pMPSVEH vectors with the MPSV promoters.
  • pcDNA3.1 vector Invitrogen
  • pMPSVEH vectors with the MPSV promoters.
  • Recombinant polypeptides can be produced either in bacterial or eukaryotic (e.g. CHO) cultured host cells transfected with vectors encoding such polypeptides or in transgenic animals. When using transgenic animals it is particularly advantageous to produce heterologous polypeptides in their milk. Dairy animals such as cattle, sheep and goats are thus exemplary hosts. See, for example, patent specifications WO 88/00239, WO 90/05188, WO 91/02318, and WO 92/11757; and U.S. Pat. Nos. 4,873,191 ; 4,873,316; and 5,304,489, which are incorporated herein by reference in their entirety.
  • the present invention also provides expression vectors comprising the DNA sequence encoding a peptide or fusion peptide of the invention and methods for their production by introducing said vector in prokaryotic or eukaryotic host cells, such as insect cells, yeast cells, or mammalian cell such as HeLa, 293 T HEK and CHO cells, growing the cells and isolating the protein produced.
  • prokaryotic or eukaryotic host cells such as insect cells, yeast cells, or mammalian cell such as HeLa, 293 T HEK and CHO cells, growing the cells and isolating the protein produced.
  • the invention provides a viral vector encoding a peptide, or its fusion peptide.
  • additional peptides according to the invention can be isolated, for example by; chemical synthesis or recombinant expression of cysteine and/or phenylalanine-containing peptides of up to 22 amino acid residues, evaluation of their motility inhibitory effect and/or on SDF-1/CXCR4 inhibitory activity, and selection of peptides exhibiting similar motility inhibitory effect and/or on SDF- 1/CXCR4 inhibitory activity like peptides of SEQ ID NO: 1 to SEQ ID NO: 16.
  • cysteine and/or phenylalanine-containing peptides or fusion peptides can be synthesized and can be tested at various concentrations on SDF-I and/or spontaneous induced migration in vitro or in vivo employing human primary T-cells, CD34+ stem cells or Pre-BLL cells.
  • cells e.g. 1 x 10 6 /mL
  • peptides for example for 2 hrs at 37 0 C, 95% humidity, then added unwashed into the upper chambers of Costar 24-well transwell plates with 5 ⁇ m pore filters (Corning Inc.
  • the peptide may be added to the lower chamber of the transwell assay.
  • Migrated cells can be collected from the lower chambers and counted using a FACSCalibur flow cytometer (Becton Dickinson, San Jose, California). The cells can be gated in forward and side scatters set at linear gain. Data can be presented as a percentage of migrated cells that were pretreated with peptides compared to the percentage of migrated untreated cells taken as 100%.
  • the concentration of the peptide in the lower well and/or in contact with the tested cells can be in the range of 5 nM to 100 nM or 0.1 mM to 10 mM or up to 50 mM and 100 mM; up to 5 or 10 mM; and about 0.1 mM, 1 mM, 5 mM or 10 mM.
  • the invention pertains to a peptide according to the invention as defined above, or to a salt thereof and/or derivative thereof and/or a fusion peptide thereof.
  • salts herein refers to both salts of carboxyl groups and to acid addition salts of amino groups of the peptides of the invention.
  • Salts of a carboxyl group may be formed by means known in the art and include inorganic salts, for example, sodium, calcium, ammonium, ferric or zinc salts, and the like, and salts with organic bases as those formed, for example, with amines, such as triethanolamine, arginine or lysine, piperidine, procaine and the like.
  • Acid addition salts include, for example, salts with mineral acids such as, for example, hydrochloric acid or sulfuric acid, and salts with organic acids such as, for example, acetic acid or oxalic acid. Of course, any such salts must have substantially similar activity to the peptide of the invention.
  • the present invention relates also to the DNA sequence encoding peptides or fusion peptides according to the invention. Moreover, the present invention further concerns the DNA sequences encoding a biologically active peptide, fragment or fusion peptides of a peptide according to the invention.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising an agent according to the invention such as phenylalanine or a derivative thereof, cysteine or a derivative thereof, a mixture or combination of phenylalanine or derivative thereof and cysteine or derivative thereof, peptides of up to 22 amino acid residues comprising phenylalanine or derivative thereof and/or cysteine or derivative thereof, a DNA encoding said peptides or a vector harboring said DNA and a pharmaceutically acceptable carrier.
  • an agent according to the invention such as phenylalanine or a derivative thereof, cysteine or a derivative thereof, a mixture or combination of phenylalanine or derivative thereof and cysteine or derivative thereof, peptides of up to 22 amino acid residues comprising phenylalanine or derivative thereof and/or cysteine or derivative thereof, a DNA encoding said peptides or a vector harboring said DNA and a pharmaceutically acceptable carrier.
  • a pharmaceutical or veterinary composition for treating a disease or condition caused by, or associated with CXCR4, or a ' disease or condition responsive to inhibition of CXCR4, comprising an agent according to the invention together with a pharmaceutically or veterinary acceptable excipient or carrier.
  • the present invention provides the use of agents according to the invention in subjects in need such as human patients or in veterinary medicine in the management (namely, treatment or prophylaxis) of a disease, disorder or condition responsive to inhibition of CXCR4 activity or inhibition of motility or disease or condition in which pathogenesis of the disease, disorder or condition is caused by, or associated with, the level or activity of the chemokine receptor CXCR4 and/or with the level of cell motility.
  • the agent according to the invention can be administered in vivo or ex-vivo.
  • a disease, disorder or condition responsive to inhibition of CXCR4, inhibition of cell motility, or inhibition of both CXCR4 or cell motility is a disease, disorder or condition that can be ameliorated or prevented by inhibition of CXCR4 expression or activity in cells involved or responsible for the pathogenesis or course of said disease, disorder or condition, inhibition of cell motility in cells involved or responsible for the pathogenesis or course of said disease, disorder or condition, or inhibition of both CXCR4 expression or activity and inhibition of motility in cells involved or responsible for the pathogenesis or course of said disease, disorder or condition.
  • disorders, diseases or conditions caused by, or associated with CXCR4 activity or responsive to inhibition of CXCR4 activity include, but are not limited to, primary tumor growth, invasion by secondary metastases; inflammatory diseases such as rheumatoid arthritis, septic arthritis, osteoarthritis, periodontitis, gingivitis, asthma, autoimmune disease, psoriasis, psoriatic arthritis, atopic dermatitis; interstitial nephritis, ocular inflammation, liver cirrhosis, an inflammatory condition of the nervous system or neuroinfiammatory disorders, e. g. multiple sclerosis, transplant rejection (e. g. graft versus host disease), inflammatory gastric conditions, e. g.
  • inflammatory diseases such as rheumatoid arthritis, septic arthritis, osteoarthritis, periodontitis, gingivitis, asthma, autoimmune disease, psoriasis, psoriatic arthritis, atopic dermatitis
  • CXCR4 Crohn's disease, inflammatory bowel disease, and ulcerative colitis, and acquired immunodeficiency syndrome (AIDS).
  • CXCR4 is known to be involved in neuronal cell migration and therefore the invention encompasses the use of an agent according to the invention in neurological diseases such as Parkinson's disease and schizophrenia.
  • CXCR4 seems to be commonly expressed on cancer cells and to play a role in migration, invasion, proliferation, survival and other malignant processes. Malignant cells from at least 23 different types of cancer express the chemokine receptor CXCR4 and respond to its ligand SDF-I .
  • CXCR4 receptor was suggested by Balkwill on 2004 to be involved in directed migration of cancer cells to sites of metastasis, increase survival of cancer cells and establishment of a tumor promoting cytokine/chemokine network. Therefore, CXCR4 antagonists are important in cancer therapy. While not wishing to be bound by theory, the inventors believe that an antagonist of the CXCR4 provides effective treatment of cancers that express CXCR4 by decreasing the rate of proliferation or by causing cessation of proliferation or by causing death of cancer cells.
  • the invention relates to the use of an agent according to the invention for treatment of a cancer that expresses CXCR4.
  • CXCR4/SDF-1 is important for blood vessel formation and endothelial cell migration. Therefore, CXCR4 inhibition appears to be advantageous for treatment of a disease in which preventing blood vessel formation is desirable, such as solid cancer.
  • cancers that express CXCR4 include, but are not limited to, B- CLL, AML, B-lineage ALL, intraocular lymphoma Non-Hodgkin lymphoma, follicular center lymphoma, CML, Multiple myeloma, pancreatic cancer, prostate (localized and metastatic cancer), kidney, breast, ovary, thyroid, kidney, colorectal cancer, oral squamous carcinoma, cervical cancer, neuroblastoma, glioma, astrocytoma, rhabdomyosarcoma, small cell lung cancer and melanoma.
  • cancer cells that over express CXCR4 include, but are not limited to, B-CLL, B- lineage ALL, follicular center lymphoma, and astrocytoma (Balkwill, 2004).
  • Precursor-B ALL is the most common childhood malignancy and the second most common adult acute leukemia.
  • Leukemic cells have the ability to infiltrate the liver, spleen, lymph nodes, and central nervous system.
  • High expression of CXCR4 by leukemic cells is strongly predictive for organ invasiveness, including infiltration to the central nervous system in patients with childhood ALL.
  • an agent according to the invention prevented homing of B-cell acute lymphoblastic leukemic cells to the bone marrow, spleen, liver and lung.
  • said agent may be aimed at preventing organ invasiveness of leukemic cells.
  • the invention provides the use of an agent according to the invention for treating or preventing leukemia such as B cell acute lymphoblastic leukemia.
  • leukemia such as B cell acute lymphoblastic leukemia.
  • CXCR4/SDF-1 interaction has been linked to metastasis in some cancer types including prostate cancer, renal cancer, neuroblastoma, ovarian cancer, breast cancer, head and neck and melanoma to organs that are an abundant source of SDF-I, including lymph node, bone marrow, and skin.
  • the invention relates to the use of an agent according to the invention for treating or preventing metastasis.
  • CXCR4 and/or cell motility are known to play a role in inflammation.
  • SDF-I levels are increased in inflammatory liver disease, in synoviocytes of the hyperplastic lining layer of rheumatoid joint.
  • exogenous SDF-I injected in periathric tissues, elicited an inflammatory response (reviewed by Balkwill 2004).
  • Treating mice with CXCR4 antagonist AMD3100 before appearance of first symptoms was found to be beneficial.
  • SDF-I is involved in the destruction of cartilage in osteoarthritis and rheumatoid arthritis (Kanbe et al., 2004).
  • CXCR4 and SDF-I have been implicated inflammation induced inflammation/infection.
  • CXCR4 antagonists and/or inhibitor of cell migration are beneficial for preventing or treating inflammation.
  • the invention provides the use of an agent according to the invention for treating or preventing inflammation.
  • CXCR4 is known in the art to serve as co-receptor for the human immunodeficiency virus (HIV). CXCR4 interact with HIV and with the cellular CD4 receptor to facilitate viral entry into cells. Therapeutic approaches based on antagonist of these receptors have been developed, some of which are currently in clinical trials (Murakami and Yamamoto, 2000). Therefore, CXCR4 antagonists are beneficial in preventing or treating acquired immunodeficiency syndrome (AIDS).
  • HIV human immunodeficiency virus
  • the invention provides the use of an agent according to the invention for treating or preventing AIDS.
  • agents according to the invention may be used to prevent antigen-activated T cell to migrate from the blood to sites of inflammation.
  • agents of the invention, particularly peptides of the invention, that block T cell migration may be used as therapeutic agents for decreasing or inhibiting the pathology of T cell-infiltrative autoimmune diseases.
  • the invention provides a method for treating and/or preventing a disease, disorder or condition whose pathogenesis is caused by, or associated with, the activity of the chemokine receptor CXCR4, comprising administering to a subject in need thereof a therapeutically effective amount of an agent according to the invention or a salt thereof, optionally together with a pharmaceutically acceptable carrier.
  • the invention relates to a method of management (namely, treatment or prophylaxis) of a disease or condition responsive to inhibition of CXCR4 in a subject in need, in particular in a human patient, which method comprises administering to the subject an effective amount of an agent according to the invention defined above, or a pharmaceutical acceptable salt thereof.
  • phenylalanine, cysteine, a derivative of said amino acids and peptides comprising them can be administered as inhibitors of CXCR4 activity and/or cell motility, for example, for the treatment or prevention of cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS), inflammation and metastasis.
  • Single or multiple administrations of the composition may be administered depending on the dosage and frequency as required and tolerated by the subject.
  • the concentration of composition in these formulations will be so designed as to deliver in the body an amount of molecules sufficient, for obtaining a therapeutic effect.
  • composition will be designed such as to deliver an amount of compound or agent that is sufficient to affect the course and severity of disease or condition mentioned herein, leading to reduction or remission of the disease.
  • the effective amount will depend on the route of administration, the disease to be treated and the condition of the subject.
  • Whether a cancer patient would benefit from treatment with the agent according to the invention can be determined, if desired, by obtaining a tumor sample from the patient and determining whether CXCR4 is expressed in the sample (e.g., by measuring CXCR4 as exemplified below and/or by mRNA levels or any other method well known in the art) or by determining in said sample the ability of SDF-I to modulate proliferation, adhesion, motility, homing, calcium release and other activities signaled by SDF-I .
  • Preventive administration is especially useful in patients having high-risk to be ill or suffer from a disease or condition mentioned herein.
  • agent according to the invention may also be used in a combination therapy in conjunction with other therapeutic agents such as anti-viral agents (e.g., nucleoside or non-nucleoside HIV reverse transcriptase inhibitors, HIV protease inhibitors, and HIV integrase inhibitors), anti-neoplastic agents such as chemotherapy or with other anti-inflammatory agents.
  • anti-viral agents e.g., nucleoside or non-nucleoside HIV reverse transcriptase inhibitors, HIV protease inhibitors, and HIV integrase inhibitors
  • anti-neoplastic agents such as chemotherapy or with other anti-inflammatory agents.
  • pharmaceutically acceptable is meant to encompass any carrier, which does not interfere with effectiveness of the biological activity of the active ingredient and that is not toxic to the host to which it is administered.
  • pharmaceutically acceptable for parenteral administration, the substance according to the invention may be formulated in a unit dosage form for injection in vehicles such as saline, dextrose solution, serum albumin and Ringer's solution.
  • the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination and the severity of the particular disease undergoing therapy. Optimum dose levels and frequency of dosing will be determined by clinical trial.
  • the compounds with which the invention is concerned may be prepared for administration by any route consistent with their pharmacokinetic properties.
  • compositions may be in the form of tablets, capsules, powders, granules, lozenges, and liquid or gel preparations, such as oral, topical, or sterile parenteral solutions or suspensions.
  • Tablets and capsules for oral administration may be in unit dose presentation form, and may contain conventional excipients such as binding agents, for example syrup, acacia, gelatin, sorbitol, tragacanth, or polyvinyl-pyrrolidone; fillers for example lactose, sugar, maize- starch, calcium phosphate, sorbitol or glycine; tabletting lubricant, for example magnesium stearate, talc, polyethylene glycol or silica; disintegrants for example potato starch, or acceptable wetting agents such as sodium lauryl sulphate.
  • binding agents for example syrup, acacia, gelatin, sorbitol, tragacanth, or polyvinyl-pyrrolidone
  • fillers for example lactose
  • Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for reconstitution with water or other suitable vehicle before use.
  • Such liquid preparations may contain conventional additives such as suspending agents, for example sorbitol, syrup, methyl cellulose, glucose syrup, gelatin hydrogenated edible fats; emulsifying agents, for example lecithin, sorbitan monooleate, or acacia;
  • Non-aqueous vehicles which may include edible oils), for example almond oil, fractionated coconut oil, oily esters such as glycerine, propylene glycol, or ethyl alcohol; preservatives, for example methyl or propyl p-hydroxybenzoate or sorbic acid, and if desired conventional flavouring or colouring agents.
  • the drug may be made up into a cream, lotion or ointment.
  • Cream or ointment formulations which may be used for the drug are conventional formulations well known in the art, for example as described in standard textbooks of pharmaceutics such as the British Pharmacopoeia.
  • the drug may be made up into a solution or suspension in a suitable sterile aqueous or non-aqueous vehicle.
  • Additives for instance buffers such as sodium metabisulphite or disodium edeate; preservatives including bactericidal and fungicidal agents such as phenyl mercuric acetate or nitrate,benzalkonium chloride or chlorhexidine, and thickening agents such ashypromellose may also be included.
  • the active ingredient may also be administered parenterally in a sterile medium.
  • the drug can either be suspended or dissolved in the vehicle.
  • adjuvants such as local anaesthetic, preservative and buffering agents can be dissolved in the vehicle.
  • MS-5 and CD34+ cells were cultured in RPMI 1640 medium supplemented with 10% heat inactivated FCS, antibiotics and glutamine.
  • Murine MS-5 stromal cell line (Millennium Pharmaceuticals, Cambridge, Massachusetts, USA) was previously described (Bleul et al., 1996).
  • pre-B ALL cell lines G2 and B 1 were previously described (Freedman et al., 1993). Bl and G2 cells were cultured in IMDM supplemented with 10% heat inactivated FCS, antibiotics and glutamine
  • Transwell assay (H) Transwell assay. Transwell assays were performed using Costar transwells (6.5 mm/diameter, 5 ⁇ m/pore) as previously described (Aiuti et al., 1997).
  • human G2 cells (10 7 /mouse, for testing homing) were injected into tail vein of 8-week old NOD-SCID mice. 16 hours after injection (for evaluating homing), mice were sacrificed. BM cells were flushed from femurs, tibias, and pelvic bones. Percentages of human cells were determined by flow cytometry as described below.
  • Bl cells a line prepared from B cells from a patient with acute lymphoblastic leukemia B cells [B-ALL]
  • B-ALL acute lymphoblastic leukemia B cells
  • leukemic Bl cells B 1-2 cells (a sub-clone derived from the Bl cells), leukemic G2 cells (another precursor-B cell line prepared from a different precursor-B-ALL patient) or normal cord blood (CB) CD34+ cells pre-treated with medium of B 1 cells from a high density cell culture and were assayed for their ability to migrate towards a gradient of SDF-I in the transwell assay.
  • the upper well of the transwell was loaded with 1-2 xlO 5 cells and the lower well with Bl conditioned medium from a high-density cell culture or with control IMDM.
  • the results summarized in Fig. 1 show inhibition of SDF-I dependent migration of leukemic B l cells, G2 cells and normal CB CD34+ cells by the conditioned medium of Bl (35% and 25% inhibition of G2 and CD34+ cells, respectively).
  • the results obtained show that a cell-migration inhibitory factor is found in the conditioned medium of Bl cells, which were grown to high cell density.
  • PKC- ⁇ is another kinase involved in SDF-I signaling.
  • PKC- ⁇ expression was found significantly downregulated in B l cells growing at the high concentration conditions (Fig. ID). Such down regulation of PKC- ⁇ expression was not recorded in another leukemic G2 cell grown at similar high cell concentration but lacking such a cell-migration inhibitory factor.
  • Example 2 Isolation of the cell-migration inhibitory factor present in the conditioned medium of Bl cells.
  • the conditioned medium of Bl containing the factor was filtered through amicon filters with various pore sizes, and the capability to inhibit cell migration was tested in both filtrate and retentate fractions. Inhibition of G2 migration was observed with filtrate fractions of molecular weight ⁇ 3 IcDa but not with fractions of molecular weight > 3kDa.
  • the amicon-filtered low MW (OkDa) fraction was separated by gel filtration on a 24 ml superdex peptide HR 10/30 column. 0.5 ml fractions were loaded on the column and eluted using triple distilled water. The migration inhibitory capability of the different fractions was measured in the transwell motility assay with G2 cells (0.5 ml of Iscove's Modified Dulbecco's Medium, IMDM was separated in the column as control).
  • the results summarized in Fig. 2A show that fractions 33-34, corresponding to MW of ⁇ 150 Dalton, inhibited migration of G2 cells by 40% (Fig. 2A, B).
  • the low molecular weight cell-migration inhibitory factor was found to be resistant to boiling and low pH conditions (6N HCL).
  • the characteristics of the cell-migration inhibitory factor indicated that it is phenylalanine.
  • Example 3 The amino acids phenylalanine and cysteine are potent cell- migration inhibitory factors.
  • phenylalanine derivatives which were more soluble than phenylalanine, was also tested (Fig. 3 A, lower panel).
  • the inhibitory effect of phenylalanine derivatives such as L-phenylalaninol (Phe-ol) and N-succinyl-L- phenylalanine (suc-Phe) (provided by prof. Mati Fridkin, Weizmann Institute) was evaluated on spontaneous or SDF-I dependent cell migration. Phe-ol and Suc-Phe were very potent inhibitors of spontaneous and SDF-I dependent migration. Either L- or D-phenylalanine added to the lower well of the transwell was found to inhibit migration of G2 cells (Fig 3B).
  • Peptides Phe-lys, Lys-Phe, Phe-Arg, Arg-Phe and Phe-Glu were able to inhibit by about 50% of cell migration and Phe-Leu-Lys and Phe-Lys- ⁇ - aminocaproic acid were able to inhibit by about 30% of cell migration.
  • Example 4 Phe-ol induces CXCR4 down regulation, reduced adhesion and altered SDF-I signaling in G2 cells.
  • phenylalanine and its derivatives have an inhibitory effect on SDF-I activity related to cell migration.
  • SDF-I regulates additional activities in cells.
  • the following experiments were carried out to assess whether the inhibitory effect of the phenylalanine derivatives involves other activities of SDF-I.
  • One such activity is regulation of stem cells adhesion (Peled et al., 1999; Peled et al., 2000).
  • Example 5 Homing of acute lymphoblastic leukemia B cells (Pre-B ALL) to bone marrow, spleen, liver and lung of transplanted NOD-SCID mice is inhibited by Phe-ol.
  • Pre-B ALL acute lymphoblastic leukemia B cells
  • Pre-B ALL is the most common childhood malignancy and the second most common adult acute leukemia.
  • the leukemic cells have the ability to infiltrate the liver, spleen, lymph nodes, and central nervous system.
  • high expression of CXCR4 in the leukemic cells is strongly predictive for organ invasiveness, including infiltration to the central nervous system.
  • the amino acid phenylalanine and its derivatives were capable of inhibiting SDF-I signaling. Since homing of leukemic cell to bone marrow involves SDF-1/CXCR4 interaction, the potential of the phenylalanine derivative Phe-ol to inhibit homing of G2 cells to the bone marrow, spleen, liver and lung of transplanted NOD-SCID mice was tested.
  • G2 cells (10 7 cells/mouse) preincubated for 1 hour with 5 or 10 mM Phe-ol or with medium (as the control) were injected into the tail vein of eight week old NOD/SCID mice, 16 hours after the injection mice were sacrificed, bone marrow (flushed from femurs, tibias, and pelvic bones), spleen, liver and lung were harvested and assayed for the presence of the human G2 cells (as determined by flow cytometry).
  • Example 6 Inhibition of normal and leukemic human cell migration and proliferation by the amino acid cysteine and its derivatives.
  • Chemokines are classified as CXC or CC members based on their composition of the amino acid Cysteine. Our preliminary results reveal that cysteine can inhibit migration of leukemic human progenitors (see Example 3), normal progenitors and of mature cells (not shown). The effect of L-cysteine and its derivates (all at 10 mM) and glutathione (6) on G2 spontaneous and SDF-I -induced (50 ng/ml) migration was tested by the transwell assay.
  • Example 7 inhibition of T cell migration by cysteine and phenylalanine containing peptides.
  • Small peptides were synthesized based on the N-terminus sequence of the SDF-I molecule, which has cysteine and phenylalanine residues (amino acids 9-15 of SDF-I), C-P-C-R-F-F-E (SEQ ID NO: 17).
  • Peptide 1 P-C-R-F-F-E (SEQ ID NO: 9) is a hexapeptide from the N- terminus sequence of SDF-I containing one cysteine residue at position 2 and two phenylalanines at positions 4 and 5.
  • Peptide 2 C-R-F-F-E (SEQ ID NO: 10) is similar to peptide 1, except for the first residue proline resulting in a pentapetide in which cysteine is at position 1.
  • Peptide 3 C-R-F-F (SEQ ID NO: 11) is similar to peptide 2, except that it lacks the last amino acid glutamic acid resulting in a tetrapeptide in which cysteine is also at position 1 and has two phenylalanine residues.
  • Peptide 4 C-R-F (SEQ ID NO: 12) is similar to peptide 3, except that it lacks the last amino acid phenylalanine resulting in a tetrapeptide in which cysteine is also at position 1 and has only one phenylalanine residue.
  • Peptide 5 C-R-F (SEQ ID NO: 12) is another batch of a peptide similar to peptide 4.
  • Peptide 6 P-C-R-F (SEQ ID NO: 13) is similar to peptide 1, except that it lacks the phenylalanine residue and glutamic acid residue at positions 5 and 6 respectively, resulting in a tetrapetide which has the cysteine at position 2 and has one phenylalanine.
  • Peptide 7 C-A-A-F (SEQ ID NO: 14) is a tertrapeptide like peptide 3 in which the arginine at position 2 and the phenylalanine at position 3 have been substituted by alanine, resulting in a peptide having a cysteine at position 1 and only one phenylalanine at position 4.
  • Peptide 8 C-R-R-F (SEQ ID NO: 15) is a tertrapeptide like peptide 3 in which the phenylalanine at position 3 have been substituted by arginine resulting in a peptide having a cysteine at position 1 and only one phenylalanine at position 4.
  • Peptide 12 P-C-R-F-F-E (SEQ ID NO: 9), another batch of peptide #1.
  • Peptide 13 P-dCys (Trt)-R-F-F (a derivative of P-C-R-F-F in SEQ ID NO: 16) is similar to peptide 1 , except for the cysteine residue which was substituted to dCys (TrT) and the glutamic acid residue is missing. Trt is trity a protecting group for the SH functional moiety of cysteine.
  • the Fmoc-CYS (Trt) was used as a building block peptide chain assembly.
  • Migrated cells were collected from the lower chambers and counted using a FACSCalibur flow cytometer (Becton Dickinson, San Jose, California). The cells were gated in forward and side scatters set at linear gain. Data are presented as a percentage of migrated cells that were pretreated with peptides compared to the percentage of migrated untreated cells taken as 100%.
  • Fig. 7A The peptides containing cysteine and phenylalanine at concentration of ImM (Fig. 7A) were found to be very potent inhibitors of T cell migration mediated by SDF-I (in range 50-90% inhibition). The same trend of activity was observed upon testing these peptides at concentration of 100 ⁇ M (Fig.7B). These peptides inhibited spontaneous migration of T cells as well, but the inhibition of spontaneous migration by these peptides was less potent than the inhibition of SDF-I mediated migration (not shown).
  • the chemokine SDF-I is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ progenitors to the peripheral blood. J. Exp. Med. 185:111-120 (1997).
  • Fridkin G. Rahimipour S, Ben-Aroya N, Kapitkovsky A, Di-Segni S, Rosenberg M, Kustanovich I 5 Koch Y, Gilon C, Fridkin M. Novel cyclic azo- bridged analogs of gonadotropin-releasing hormone. J Pept Sci Feb; 12(2):106-15. (2006). Freedman, M.H. et al. Autocrine and paracrine growth control by granulocyte-monocyte colony-stimulating factor of acute lymphoblastic leukemia cells. Blood. 81 :3068-3075 (1993).
  • the chemokine SDF-I activates the integrins LFA-I, VLA-4, and VLA-5 on immature human CD34(+) cells: role in transendothelial/stromal migration and engraftment of NOD/SCID mice. Blood. 95(11):3289-96 (2000).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Oncology (AREA)
  • AIDS & HIV (AREA)
  • Communicable Diseases (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Transplantation (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Zoology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The invention relates to phenylalanine, cysteine, derivatives of said amino acids, peptides comprising them, and to their use in diseases disorders or conditions whose pathology is caused by or associated with CXCR4 activity and/or cell motility.

Description

INHIBITION OF CXCR4 AND/OR CELL MOTILITY
FIELD OF THE INVENTION
The invention relates to phenylalanine, cysteine, derivatives of said amino acids, peptides comprising them, and to their use in diseases disorders or conditions whose pathology is caused by or associated with CXCR4 activity and/or cell motility.
BACKGROUND OF THE INVENTION
Hematopoietic stem cells are a rare population of cells within the bone marrow microenvironment. Hematopoietic stem cells actively maintain the continuous production of all mature blood cell lineages, which include major components of the immune system such as T and B Lymphocytes throughout life while maintaining a small pool of undifferentiated stem and progenitor cells (Mayani, 2003).
During development, or in experimental and clinical transplantation, stem cells migrate through the blood circulation and home into the bone marrow (BM), repopulating it with immature and maturing myeloid and lymphoid blood cells, which in turn are released into the circulation. The process of hematopoietic stem cell homing and repopulation, which is crucial for stem cell function and development of the immune system, is not well understood. The chemokine stromal derived factor one (SDF-I), which is produced by many cell types and also by bone marrow stromal and endothelial cells, is a powerful chemoattractant for immature and mature hematopoietic cells, regulating leukocyte trafficking in steady state homeostasis.
SDF-I is highly preserved throughout evolution. Human and mouse SDF-I are cross-reactive and differ in one amino acid. SDF-I (also named CXCL 12) serves as a survival factor for stem and progenitor cells, and is involved in immature B cell and megakaryocyte development (McGrath et al., 1999; Nagasawa et al, 1996). Homing of human stem cells and their subsequent proliferation and differentiation in transplanted immune deficient mice was found to be dependent on interactions between SDF-I, which is expressed by the host bone marrow, and its receptor CXCR4, which is expressed on the donor homing cells. Interfering with SDF-1/CXCR4 interactions by pretreatment of immature human CD34+ cells with neutralizing anti CXCR4 antibody blocked their in vivo homing and repopulation, while untreated cells could home within hours into the BM of recipient mice [Peled et al., 1999 (a)].
Increasing CXCR4 expression by cytokine stimulation was found to enhance response to SDF-I, accompanied by improved homing and engraftment. Immature human CD34+ cells that do not express cell surface CXCR4 contain internal
CXCR4, which can oscillate in vivo following transplantation. Prevention of this
CXCR4 upregulation blocked the low levels of human CD34+CXCR4" cell engraftment. Thus, the phenotype of repopulating human stem cells was defined as CD34+CD38"/l0WCXCR4+ cells (Kollet et al., 2002).
Release and mobilization of stem cells from the bone marrow into the circulation are induced for clinical transplantation. Multiple stimulations with cytokines such as G-CSF are used to recruit human stem cells from the circulation.
SDF-1/CXCR4 interaction within the BM following G-CSF administration was found to be involved in the mobilization process (Petit et al., 2002).
Proteolytic enzymes such as neutrophil elastase were found to degrade SDF- 1 in the bone marrow during G-CSF administration. In parallel, the levels of CXCR4 expression on hematopoietic cells within the bone marrow were found to increase prior to their mobilization. Neutralizing antibody for CXCR4 or SDF-I reduced human and mouse stem cell mobilization, demonstrating SDF-1/CXCR4 signaling in cell egress (Petit et al., 2002).
Thus, stem cell homing and release/mobilization utilize similar mechanisms, and in both processes SDF-1/CXCR4 interactions play a major role.
SDF-I also plays an important role in the migration of leukemic cells. While normal and leukemic cells share similar mechanisms of migration, different homing patterns as well as SDF-I signaling pathways were found when comparing malignant human Pre-B ALL cells (B-cell precursor acute lymphoblastic leukemia) to normal immature CD34+ cells (Spiegel et al., 2004). In another malignant disease, acute myelogenous leukemia (AML), high levels of intracellular CXCR4 and SDF-I have been found in all leukemic cells, including cells that do not express surface CXCR4. CXCR4 is essential for the homing of these cells to the BM of immune deficient mice, demonstrating dynamic regulation of CXCR4 in these cells (Tavor et al., 2005).
The expression of SDF-I on the cell surface of endothelial cells within the blood vessels was found to be crucial for inducing cell arrest under shear flow, an essential step for a successful transendothelial migration from the circulation into the bone marrow. In addition, SDF-I activated the major adhesion molecules such as CD44, LFA-I, VLA-4 and VLA-5 on migrating human stem and progenitor cells as part of the multistep process of homing and transendothelial migration (Peled et al., 2000).
The mechanisms that induce cell motility and migration following SDF-I stimulation and signal transduction pathways, which are triggered by binding of SDF-I to CXCR4, are not known. Activation of PBK, but not MAPK, has been found to be required for motility of enriched immature CD34+ cells. The atypical PKC zeta isoform was found to be essential for the process of migration. Moreover, activation of PKC zeta by SDF-I was found to be PBK dependent (Petit et al., 2005).
It has been suggested that SDF-I mediates adhesion and anchorage of stem cells to the extracellular matrix of the BM niches by altering the cytoskeleton and relocating surface CD44 expression (Avigdor et al., 2004).
Beside its role in migration and adhesion, SDF-I is also involved in proliferation and survival of various cells including normal human CD34+ cells and leukemic cells (Lee et al., 2002; Nishii et al. 1999, and Tavor et al., 2005).
SUMMARY OF THE INVENTION In one aspect, the invention relates to the use of the amino acid phenylalanine or a derivative thereof; the amino acid cysteine or a derivative thereof; a combination of amino acids comprising phenylalanine or a derivative thereof and cysteine or a derivative thereof; a peptide comprising up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof, at least one cysteine or a derivative thereof, or at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility. In one embodiment of the invention the amino acid phenylalanine or a derivative thereof is used in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
In a further embodiment of the invention the phenylalanine derivative is a solubility-improved derivative of phenylalanine.
In another further embodiment of the invention the phenylalanine derivative is phenylalaninol (Phe-ol) or succinyl phenylalanine (Suc-Phe).
In another further embodiment of the invention the phenylalanine derivative is β-phenylethylamine. In another embodiment of the invention, the amino acid cysteine or a derivative thereof is used in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
In a further embodiment of the invention the cysteine derivative is a solubility-improved derivative of cysteine.
In another further embodiment of the invention the cysteine derivative is selected from cysteine ethyl ester, cysteine sulfuric acid, and cysteinamine.
In another embodiment of the invention the combination of amino acids comprising phenylalanine or a derivative thereof and cysteine or a derivative thereof is used in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
In another embodiment of the invention a peptide of up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof is used in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
In a further embodiment of the invention the peptide consists of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, or 21 amino acid residues comprising at least one phenylalanine .
In another further embodiment of the invention the peptide comprises about 2, 3, 4, 5, or 6 consecutive amino acid residues including the at least one phenylalanine and at least one non-phenylalanine residue that is a charged amino acid. In another further embodiment of the invention the at least one non- phenylalanine residue is a positively charged amino acid or a negatively charged amino acid residue such as lysine or arginine.
In another further embodiment of the invention the peptide comprises the amino acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or a derivative thereof linked to aminocaproic acid , SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 8.
In another further embodiment of the invention the negatively charged amino acid residue is glutamic acid.
In another further embodiment of the invention the peptide comprises the amino acid sequence of SEQ ID NO: 6 or SEQ ID NO: 7.
In another embodiment of the invention a peptide of up to 22 amino acid residues comprising at least one cysteine or a derivative thereof is used in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility. In a further embodiment of the invention the peptide consists of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, or 21 amino acid residues comprising at least one cysteine.
In another further embodiment of the invention the peptide comprises about 2, 3, 4, 5, or 6 consecutive amino acid residues including the at least one cysteine and at least one non-cysteine residue selected from proline, arginine and glutamic acid.
In another further embodiment of the invention the peptide consists of glutathione. In another embodiment of the invention a peptide of up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof, except for a peptide from the amino terminus of SDF-I which includes the LSY motif (SEQ ID NO: 19) is used in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
In a further embodiment of the invention the peptide consists of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, and 21 amino acid residues comprising at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof. In another further embodiment of the invention the peptide comprises about
2, 3, 4, 5, 6 or 7 consecutive amino acid residues including the at least one cysteine or a derivative thereof and the at least one phenylalanine residue or a derivative thereof.
In another further embodiment of the invention the peptide comprises about 3, 4, 5, 6 or 7 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one non cysteine or non phenylalanine amino acid residue.
In another further embodiment of the invention the peptide comprises 3 consecutive amino acid residues of SEQ ID NO: 12. In another further embodiment of the invention the peptide comprises 4 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one non cysteine or non phenylalanine amino acid residue. In another further embodiment of the invention the sequence of the 4 consecutive amino acid residues consists of SEQ ID NO: 11.
In another further embodiment of the invention the first residue of the 4 consecutive amino acid residues is a proline such as in the sequence of the consecutive amino acid residues consisting of SEQ ID NO: 13. In another further embodiment of the invention the peptide comprises 5 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one non cysteine or non phenylalanine amino acid residue.
In another further embodiment of the invention the first residue of the 5 consecutive amino acid residues is a proline such as in SEQ ID NO: 16, or a derivative of SEQ ID NO: 16 having instead of a Cysteine a dCys (Trt) residue.
In another further embodiment of the invention the fifth residue of the 5 consecutive amino acid residues is a glutamic acid such as in SEQ ID NO: 10.
In another further embodiment of the invention the peptide comprises 6 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one non cysteine or non phenylalanine amino acid residue.
In another further embodiment of the invention the sixth residue of the 6 consecutive amino acid residues is glutamic acid and/or the first residue of the consecutive amino acid residues is proline such as in SEQ ID NO: 9.
The invention provides the use of a peptide of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20 or 21 amino acid residues comprising a sequence of
SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:
13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 , a derivative of SEQ ID NO: 16 comprising instead of the cysteine a dCys(Trt) residue, or SEQ ID NO: 17 in the manufacture of a medicament for treating a disease, disorder or condition in which CXCR4 activity and/or cell motility is involved in the pathology or course of the disease, disorder or condition.
The invention also provides the use of a peptide of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 amino acid residues comprising the amino acid sequence C-X-X -F (SEQ ID NO: 18) wherein X is an arginine or an alanine in the manufacture of a medicament for treating a disease, disorder or condition in which CXCR4 activity and/or cell motility is involved in the pathology or course of the disease, disorder or condition. In one embodiment of the invention, the amino acid sequence consists of
SEQ ID NO: 14 or SEQ ID NO: 15.
In a further embodiment of the invention, the peptide is a fusion peptide and/or salt thereof.
In one embodiment of the invention, the use of said amino acid (s) and/or peptide(s) is for the manufacture of a medicament for treating a disease, disorder or condition such as cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS) and/or inflammation.
In a further embodiment of the invention, the disease is cancer expressing CXCR4, such as leukemia, intraocular lymphoma, non-Hodgkin lymphoma, follicular center lymphoma, multiple myeloma, pancreatic cancer, kidney, prostate, breast, ovary, thyroid, colorectal cancer, oral squamous carcinoma, cervical cancer, neuroblastoma, glioma, astrocytoma, rhabdomyosarcoma, small cell lung cancer and melanoma.
In a further embodiment of the invention, the cancer is leukaemia, such as acute lymphoblastic leukemia.
In a further embodiment of the invention, the use is for the manufacture of a medicament for treating or preventing metastasis.
In a further embodiment of the invention, the use is for the manufacture of a medicament for treating AIDS. In a further embodiment of the invention, the use is for treating or preventing an inflammatory disease, disorder or condition such as rheumatoid arthritis, septic arthritis, osteoarthritis, periodontitis, gingivitis, asthma, autoimmune disease, psoriasis, psoriatic arthritis, atopic dermatitis; interstitial nephritis, ocular inflammation, liver cirrhosis, neuroinflammatory disorders, graft versus host disease and inflammatory gastric conditions.
In another aspect, the invention provides a peptide of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues comprising the amino acid sequence C-X-X-F (SEQ ID NO: 18) wherein X is an arginine or an alanine.
In one embodiment of the invention, the peptide comprises the amino acid sequence of SEQ ID NO: 14 or SEQ ID NO: 15,
The invention also provides a peptide of peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues comprising 3, 4, 5, 6, 7, or 8 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine residue or a derivative thereof separated by at least one alanine.
In one embodiment of the invention, the cysteine or derivative thereof and the phenylalanine or derivative thereof are separated by one or two alanine residues. In a further embodiment of the invention, the peptide comprises 4 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one alanine.
In another further embodiment of the invention, the first and/or the last amino acid residue of the 4 consecutive amino acid residues is cysteine or a derivative thereof and phenylalanine or a derivative thereof, respectively.
The invention also provides a peptide of up to 22 amino acid residues comprising 3, 4, 5, 6, or 7 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by one arginine, except for a peptide from the amino terminus of SDF-I which includes the LSY motif (SEQ ID NO: 19). In one embodiment of the invention, the peptide of up to 22 amino acid residues comprises 3 consecutive amino acid residues consisting of SEQ ID NO: 12.
In another embodiment of the invention, the peptide of up to 22 amino acid residues comprises 4 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by one arginine.
In a further embodiment of the invention, the first and the last amino acid residue of the consecutive amino acid residues is cysteine or a derivative thereof and phenylalanine or a derivative thereof, respectively such as in the sequence of the 4 consecutive amino acid residues consisting of SEQ ID NO: 11.
In a further embodiment of the invention, the first amino acid residue of the 4 consecutive amino acid residues is a proline such as in the sequence of SEQ ID NO: 13. In another embodiment of the invention, the peptide of up to 22 amino acid residues comprises 5 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by one arginine.
In a further embodiment of the invention, the first amino acid residue of the 5 consecutive amino acid residues is a proline such as in the sequence of SEQ ID NO: 16, or a derivative of SEQ ID NO: 16 having instead of a Cysteine a dCys (Trt) residue.
In a further embodiment of the invention, the fifth residue of the 5 consecutive amino acid residues is a glutamic acid such as in the sequence of SEQ ID NO: 10.
In another embodiment of the invention, the peptide of up to 22 amino acid residues comprises 6 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by one arginine. In a further embodiment of the invention, the sixth residue of the 6 consecutive amino acid residues is glutamic acid.
In a further embodiment of the invention, the first residue of the 6 consecutive amino acid residues is proline such as in the sequence of SEQ ID NO: 9.
The invention also provides a peptide of up to 22 amino acid residues comprising 4, 5, 6, 7, or 8 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by two arginines such as in SEQ ID NO: 15. In addition, the invention provides a peptide of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues comprising 2 consecutive amino acid consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 7.
Also, the invention provides a peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acids comprising 3 consecutive amino acid residues consisting of SEQ ID NO: 1 linked to aminocaproic acid or of SEQ ID NO: 8.
The invention provides a peptide of about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acids comprising 4 consecutive amino acid residues consisting of SEQ ID NO: 5.
The invention provides a peptide consisting of amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 1 linked to aminocaproic acid , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, P SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, a derivative of SEQ ID NO: 16 comprising instead of the cysteine a dCys(Trt) residue or SEQ ID NO: 17.
Also, the invention provides a peptide of about 3, 4, 5, 6, 7, 8, or 9 amino acid residues comprising the amino acid sequence C-R-F, except for a peptide from the amino terminus of SDF-I including the LSY motif or consisting of 6 to 9 amino acid residues lacking the LSY motif in which the last amino acid residue is serine.
Peptides provided by the invention include circularly permuted peptides and/or fusion peptides. In one embodiment of the invention, a fusion peptide is a peptide fused to a protein such as an immunoglobulin.
In one embodiment of the invention, a fusion peptide is a peptide fused to a high molecular weight polymer such as polyethylene glycol (PEG).
In addition, the invention embraces a salt of a peptide provided by the invention.
In further aspects, the invention relates to an isolated DNA encoding a peptide provided by the invention, an expression vector comprising said DNA , a host cell harboring said DNA and/or expression vector, and to a method for producing said peptide comprising growing the host cell and isolating the protein produced.
In one embodiment of the invention, the host cell is a eukaryotic cell, such as a mammalian cell e.g. HeLa, 293 T HEK and CHO, insect cell, or yeast cell.
In one embodiment of the invention, the host cell is a prokaryotic cell.
In a further aspect, the invention relates to the use of a peptide provided by the invention or a salt thereof in the manufacture of a medicament for treating or preventing a disease, disorder or condition selected from cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS), inflammation and metastasis.
In another further aspect, the invention relates to a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a peptide provided by the invention or a salt thereof.
In another further aspect, the invention relates to a pharmaceutically acceptable carrier and a peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues comprising about 3, 4, 5, 6, or 7 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by one arginine, except for a peptide from the amino terminus of SDF-I including the LSY motif.
In another further aspect, the invention relates to a pharmaceutical composition comprising the DNA of the invention and a pharmaceutically acceptable carrier.
In another further aspect, the invention relates to a pharmaceutical composition comprising a vector of the invention and a pharmaceutically acceptable carrier.
In another further aspect, the invention relates to a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a mixture of amino acids consisting of phenylalanine or a derivative thereof and cysteine or a derivative thereof.
In another further aspect, the invention relates to a method of treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility in a subject in need, comprising administering to the subject a therapeutically effective amount of the amino acid phenylalanine or a derivative thereof; the amino acid cysteine or a derivative thereof; a combination of amino acids comprising phenylalanine or a derivative thereof and cysteine or a derivative thereof; a peptide comprising up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof, at least one cysteine or a derivative thereof, or at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof, except for a peptide from the amino terminus of SDF-I including the LSY motif.
In another further aspect, the invention relates to a method of treating or preventing a disease, disorder or condition in which the activity of CXCR4 is involved in the pathology or course of the disease, disorder or condition comprising administering to a subject in need a therapeutically effective amount of a peptide comprising a sequence set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, a derivative of SEQ ID NO: 16 comprising instead of the cysteine a dCys(Trt) residue, SEQ ID NO: 17 or a combination thereof.
In another further aspect, the invention relates to a method of treating or preventing a disease, disorder or condition in which the activity of CXCR4 is involved in the pathology or course of the disease, disorder or condition comprising administering to a subject in need a therapeutically effective amount of a peptide comprising a sequence set forth in SEQ ID NO: 1, SEQ ID NO: 1 linked to aminocaproic acid , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 or a combination thereof. In another further aspect, the invention relates to a method of treating or preventing a disease, disorder or condition selected from cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS), inflammation and metastasis comprising administering to a subject in need a therapeutically effective amount of a peptide provided by the invention.
BRIEF DESCRIPTION OF THE FIGURES
Figs. 1A-1D show that a factor found in the conditioned medium of leukemic Bl cells inhibits migration of hematopoietic cells. A. Bl (a line prepared from precursor-B cells from a patient with acute lymphoblastic leukemia B cells [B- ALL]) and B 1-2 (a sub-clone derived from the Bl cells by means of limiting dilution) cells grown in 24 well plates at high or low cell densities for 16 hours, were tested for their migration capability towards SDF-I (125ng/ ml) in a transwell migration assay. It was found that cells taken from the high density cultures migrated significantly less towards SDF-I than cells taken from low density cultures *p<0.05. B. Purified umbilical cord blood (CB) CD34+ cells (comprising hematopoietic precursors) or leukemic G2 cells (another precursor-B cell line prepared from a different precursor-B-ALL patient) were pre-treated for 1 hour with conditioned medium taken from the high density B 1 culture or remained untreated, and their SDF- 1 dependent migration was tested in a transwell migration assay. In the transwell migration assay the tested cells (CB CD34+ or G2) were placed in the upper chamber and SDF-I (125 ng/ml) in the lower chamber. Conditioned medium of B 1 was also placed on the lower chamber of the transwell assay in which pre- treated cells were tested. SDF-I dependent migration of both, leukemic cells and normal cord blood CD34+ cells was found to be significantly inhibited by the condition medium of Bl cells*p<0.05. C. Shows inhibition of SDF-I mediated ERK phosphorylation in G2 cells preincubated with the conditioned medium of B 1. D. Shows reduced levels of PKC-ζ mRNA (detected by PCR) in Bl cells taken from a high-density culture (2x106 cells/ml) compared to the levels of PKC-ζ mRNA in B l from a low density cultures (1x105 cells/ml) or G2 cells taken from high-density cultures (2x10 cells/ml). Bl cell line taken from a high-density culture exhibit reduced expression of PKC-ζ.
Figs. 2A-2B show the separation of the migration inhibitory factor from the conditioned medium of B l. A. Gel filtration separation was carried out using a superdex peptide column. Low (<3kDa) MW fractions of conditioned medium or appropriate control (consisting of Iscove's Modified Dulbecco's Medium or "IMDM") were loaded and fractionated on the column, and the migration inhibitory capability of the different fractions was tested in transwell assays using G2 cells. The arrow indicates the inhibitory fraction, which is absent in the IMDM. B. Shows that fractions 33-34 inhibit SDF-I mediated migration of G2 cells by 40%.
Figs. 3A-3F show the effect of different amino acids, peptides and β- phenylethylamine on spontaneous and SDF-I mediated migration of cells. A. Upper panel: the indicated concentrations of each of the amino acids Phe, GIu, Met, VaI, Pro, and Cys (upper panels) were added to the lower chamber of the transwell together with medium or with medium supplemented with SDF-I in order to check effect on spontaneous (left) or SDF-I dependent (right) G2 migration, respectively. In this assay, Phe and Cys were found to be potent inhibitors of both, SDF-I dependent and spontaneous G2 migration. Lower panel: the indicated concentrations of each of the amino acids derivatives L-phenylalaninol (Phe-ol) or N-succinyl-L-phenylalanine (suc-Phe) were added to the lower chamber of the transwell together with medium or medium supplemented with SDF-I to check effect on spontaneous (left) or SDF-I dependent (right) G2 migration, respectively. In this assay, both phenylalanine derivatives were found to be potent inhibitors of both, SDF-I dependent and spontaneous G2 migration in a dose dependent manner. B. Shows inhibition of spontaneous migration of G2 cells by L- and D- Phenylalanine added to the lower well at the indicated concentrations. C. Shows inhibition of spontaneous migration of G2 cells by short peptides containing phenyl alanine residues added to the lower well at the indicated concentrations. From left to right control, F-K (SEQ ID NO: I)5 K-F(SEQ ID NO: 2), F-R(SEQ ID NO: 3), R- F(SEQ ID NO: 4), K-F-K-F(SEQ ID NO: 5), F-E(SEQ ID NO: 6), E-F(SEQ ID NO: 7), F-L-K(SEQ ID NO: 8), and F-K-ε-aminocaproic acid. D. Shows different concentrations of the phenylalanine derivative Phe-ol added to the lower well of the transwell assay (with or without SDF-I containing medium) to check its effect on migration of CD34+ progenitors (left) or T cells (right). Phe-ol was found to be an effective inhibitor of CD34+ and T cell SDF-I mediated or spontaneous migration. E. Shows the levels of PKC-ζ mRNA in G2 cells pretreated with medium (IMDM), conditioned medium of Bl cells (upper panel), or Phe-ol (lower panel). Expression of PKC-ζ is downregulated in G2 cells following treatment with conditioned medium of Bl or with Phe-ol. F. β-phenylethylamine (from Sigma cat no. p-6513) at indicated concentrations was added to the lower well of a transwell assay together with medium or medium supplemented with SDF-I and was found to inhibit both spontaneous and SDF-I dependent migration of G2 cells.
Figs. 4A-4C show the inhibitory effect of Phe-ol on cell adhesion, CXCR4 expression, and SDF-I -mediated calcium flux. A. Shows assessment of adherence of untreated CB CD34+ cells or CD34+ cells pretreated with Phe-ol (at indicated concentration) to stromal cells MS-5 (known to express SDF-I). Adherence of CD34+ cells to MS-5 cells was found to be inhibited by Phe-ol in a dose response manner B. Shows CXCR4 expression in untreated primary T cells, G2 cells and CD34+ (top left panel - primary T cells, top right panel- G2 cells, bottom panel- CD34+ cells) cells or CXCR4 expression in the same cells treated by a two-hour incubation with Phe-ol (at indicated concentration). Phe-ol reduced the CXCR4 expression in all of the cells tested. In experiments carried out with the CD34 cells it was shown that Phe-ol reduced the CXCR4 expression in a dose dependent manner. C. Shows SDF-I induced calcium influx in G2 cells (upper curve) or in G2 cells pre-incubated with Phe-ol (lower curve). Phe-ol was found to inhibit SDF-I induced calcium influx in G2 cells. Figs. 5A-5B show inhibition of homing of transplanted human leukemic G2 cells to the bone marrow (BM)5 spleen, liver and lung of NOD/SCID by preincubation of the cells with Phe-ol prior to transplantation. NOD/SCID mice were transplanted with untreated or Phe-ol (5 or 10 mM) preincubated G2 cells (107 cells/mouse). Sixteen hours later, BM (A), spleen, liver and lungs (B) were harvested and assayed for the levels of human cell homing to such tissues. Data represent the number of CD45 human cells per 106 acquired total cells. Phe-ol inhibited homing of leukemic G2 cells to the bone marrow, spleen, liver and lung of NOD/SCID mice in a dose dependent manner.
Fig. 6 shows G2 spontaneous and SDF-I -induced (50 ng/ml) cell migration in the presence of L-cysteine, glutathione and cysteine derivates (all at 10 mM). Culture medium alone or medium containing L-cysteine or its derivates were loaded into the bottom of transwell chambers. G2 cells (101VmI) were loaded into the upper chambers and allowed to migrate for 4 hrs at 370C. Cells were collected from the bottom chambers and counted using a fluorescence-activated cell sorter (FACS Calibur). Percentage of migrated cells is shown in: culture with medium alone (control) (1); supplemented with L-cysteine (2); L-cysteine ethyl ester hydrochloride (3); L-cysteine sulfmic acid (4); cysteinamine hydrochloride (5); or glutathione (6).
Fig. 7A-7B shows the effect of cysteine and phenylalanine-containing peptides on migration of primary T cells in vitro. The effect of ImM (A) or 100 μM (B) cysteine and phenylalanine-containing peptides (1) P-C-R-F-F-E (SEQ ID NO: 9); (2) C-R-F-F-E (SEQ ID NO: 10); (3) C-R-F-F (SEQ ID NO: 11); (5) C-R-F (SEQ ID NO: 12); (6) P-C-R-F (SEQ ID NO: 13 ); (7) C-A-A-F (SEQ ID NO: 14); (8) C-R-R-F(SEQ ID NO: 15); and (13) the derivative of P-C-R-F-F (SEQ ID NO: 17), P-dCys(Trt)-R-F-F on SDF-I induced migration of human primary T-cells was explored in vitro. In these experiments, the cells (I x 106/mL) were incubated with the peptides for 2 hrs at 370C, 95% humidity, then added unwashed into the upper chambers of Costar 24-well transwell plates with 5 μm pore filters (Corning Inc. Corning, NY) and allowed to migrate for 2hrs at 370C, 95% humidity, 5% CO2 towards SDF-I (20 ng/mL). Migrated cells were collected from the lower chambers and counted using a FACSCalibur flow cytometer (Becton Dickinson, San Jose, California). The cells were gated in forward and side scatters set at linear gain. Data are presented as a percentage of migrated cells that were pretreated with peptides compared to the percentage of migrated untreated cells taken as 100%.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to the use of the amino acid phenylalanine or a derivative thereof; the amino acid cysteine or a derivative thereof; a combination of amino acids comprising phenylalanine or a derivative thereof and cysteine or a derivative thereof; a peptide comprising up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof, at least one cysteine or a derivative thereof, or at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof, in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility. The finding according to the invention that agents such as the amino acids cysteine or a derivative thereof, phenylalanine or a derivative thereof, e.g. β- phenylethylamine which in nature is synthesized from the amino acid phenylalanine by enzymatic decarboxylation, solubility-improved derivatives of phenylalanine such as phenylalaninol, (Phe-ol), succinyl phenylalanine (Suc-Phe), cysteine ethyl ester, cysteine sulfinic acid, cysteinamine; and short peptides including cysteine, phenylalanine or the combination of both amino acids, can inhibit migration of cells and/or CXCR4 expression of cells or both, paves the way to new therapies for diseases, disorder or conditions responsive to inhibition of cell motility and/or CXCR4 activity or whose pathology can be ameliorated, alleviated or prevented by inhibition of cell motility and/or inhibition of CXCR4 expression level and/or activity in cells.
In fact, the results obtained according to the invention uncovered that the above agents (named herein as "agents of the invention" or "agents according to the invention") can be used to decrease the CXCR4 activity or response, without being bound by the mechanism, for example by decreasing expression level of CXCR4 in cells, and/or can be used to inhibit cell motility. Therefore these agents can be used for treating or preventing a disease, disorder, or condition whose pathology is caused by, or associated with the activity or signaling trough CXCR4 in cells and/or motility of cells. A disease, disorder, or condition whose pathology is caused by or associated with the level of CXCR4 in cells and/or motility of cells, is a disease, disorder, or condition responsive to inhibition of CXCR4 activity and/or to inhibition of cell motility and which can be prevented or ameliorated by inhibition of CXCR4 activity and/or motility. The term inhibition of CXCR4 activity refers, for example, to inhibition of activity or inhibition of level of expression of CXCR4.
It has been found according to the present invention that agents of the invention such as cysteine or derivatives thereof; phenylalanine or derivatives thereof such as β-phenylethylamine; and peptides including phenylalanine; inhibited the spontaneous, as well as the SDF-I dependent motility of Precursor-B ALL (Pre-BLL) cells, as measured in vitro by the transwell assay. Pre-BLL is the most common childhood malignancy and the second most common adult acute leukemia. In fact, the migration inhibitory effect of D and L phenylalanine was found to be similar and therefore the migration inhibitory effect is independent of the stereoisomeric form of the amino acid. Notably, the findings according to the invention demonstrated that Phe-ol inhibited Pre-BLL cell migration in vivo (or homing) from the circulation to the bone marrow, spleen, lung, and liver.
The inhibitory effect of agents according to the invention was detected also in normal non-neoplastic cells. For example, it was demonstrated according to the invention that motility of normal cells, like hematopoietic cells CD34+ cells, was inhibited by Phe-ol and that motility of normal primary T was inhibited by short peptides including phenylalanine or by short peptides including phenylalanine and cysteine.
Findings according to the present invention show that agents of the invention can inhibit activities that are mediated by SDF-I and its receptor CXCR4. For example, it has been found according to the invention that the amino acid cysteine or phenylalanine; and derivatives of said amino acid such as phenylalaninol, (Phe- ol), succinyl phenylalanine (Suc-Phe), cysteine ethyl ester, cysteine sulfinic acid, cysteinamine; β-phenylethylamine; and short peptides which include amino acids cysteine and/or phenylalanine, are able to inhibit SDF-I dependent motility of cells. Also, it was demonstrated according to the invention that Phe-ol is capable to mediate; inhibition of homing of Pre-BLL cells to bone marrow, a process known to be dependent on SDF-I activity; inhibition of SDF-I dependent Ca+ influx; and inhibition of adhesion of CD34+ cells to SDF-I producing cells. The levels of expression of CXCR4 in cells treated with Phe-ol was tested according to the invention, and it was found that Phe-ol inhibited CXCR4 expression in neoplastic cells such as Pre BLL cells and in normal cells such as primary T cells and CD34+ cells.
The present invention provides the use of the amino acid phenylalanine or a derivative thereof like a solubility-improved derivative, for example, phenylalaninol (Phe-ol) or succinyl phenylalanine (Suc-Phe) or derivatives synthesized from the amino acid phenylalanine like phenylethylamide; the amino acid cysteine or derivatives thereof like cysteine ethyl ester, cysteine sulfmic acid, and cysteinamine; or a mixture of amino acids comprising phenylalanine or a derivative, and cysteine or a derivative thereof; in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
The term "amino acid" as used herein refers either to a single amino acid or to a derivative thereof, or to a mixture of two ore more amino acids, unless otherwise specified, and includes all the natural occurring amino acids found in proteins and non-natural amino acids. Examples of non-natural amino acids include, but are not limited to, 4-hydroxyproline, 5-hydroxylisine, and N-methyl amino acids such as N-methyllysine, γ-carboxyglutamate, desmosine, selenocysteine, citrulline and ornithine.
Derivatives of amino acids may be an amino acid residue containing additional chemical moieties not normally part of the amino acid and is encompassed by the invention as long as it retains at least a portion of the function of the amino acid which permits its utility as inhibitor of CXCR4 expression or activity and/or as an inhibitor of spontaneous and/or SDF-I mediated cell migration.
This term includes but is not limited to esters of OH, SH (present in cysteine) or carboxy groups of the amino acids; ethers of OH and SH; amides; substitutions at the amino group, etc. β-phenylethylamine is a derivative of phenylalanine. In nature, it is synthesized from the amino acid phenylalanine by enzymatic decarboxylation.
An amino acids may exist in one or more stereoisomeric form, because of the presence of asymmetric atoms or rotational restrictions can exist as a number of stereoisomers with R or S stereochemistry at each chiral centre or as atropisomeres with R or S stereochemistry at each chiral axis. The invention includes use of all such enantiomers and diastereoisomers and mixtures thereof.
Phenylalanine and/or cysteine amino acids and/or a derivative thereof like phenylalaninol, succinyl phenylalanine, β-phenylethylamine, cysteine ethyl ester, cysteine sulfide acid, and cysteinamine can be administered or used according to the invention together with additional amino acids such as, methionine, proline, valine, glutamic acid and/or a combination thereof.
In one embodiment of the invention, the amino acid comprises the combination or mixture of phenylalanine, phenylalaninol, succinyl phenylalanine or phenylethylamine and cysteine, cysteine ethyl ester, cysteine sulfinic acid, or cysteinamine.
It was found according to the invention that short synthetic peptides of 2, 3,
4, 5 or 6 amino acid residues including phenylalanine and/or cysteine inhibit migration of cells. The inhibitory effect of such peptides on spontaneous and/or SDF-I dependent migration was detected in assays of in vitro migration carried out with leukemic cells (G2), as well as with normal mature T cells.
It was found according to the invention that a phenylalanine comprising peptide like F-K (SEQ ID NO: I)5 a peptide like the one in SEQ ID NO: 1 but which is linked to aminocaproic acid such as F-K-ε-aminocaproic acid, K-F (SEQ ID NO: 2), F-R (SEQ ID NO: 3) , R-F (SEQ ID NO:4), K-F-K-F (SEQ ID NO: 5), F-E (SEQ ID NO:6) , E-F (SEQ ID NO:7), and F-L-K (SEQ ID NO: 8); or that the cysteine containing peptide such as glutathione inhibited spontaneous migration of Pre-BLL cells. F-K, K-F, F-R, R-F and F-E were able to inhibit by about 50% of cell migration and F-L-K and F-K-ε-aminocaproic acid were able to inhibit by about 30% of cell migration.
Thus the invention provides the use of a short peptide of about 22 amino acid residues comprising at least one phenylalanine or a derivative thereof, or comprising a short peptide of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 amino acid residues comprising at least one phenylalanine or a derivative thereof. The short peptide may comprise 2, 3, 4, 5 or 6 consecutive amino acid residues which include the at least one phenylalanine and at least one non- penylalanine residue that is a charged amino acid. The charged amino acid can be a positively charged amino acid such as lysine or arginine, or a negatively charged amino acid such as glutamic acid. Non limiting examples of such peptides are short peptides of up to 22 amino acid residues comprising one of the following amino acid sequences F-K, K-F, F-R, R-F, K-F-K-F, F-L-K, F-K-ε-aminocaproic acid F-E, and E-F or a salt thereof. Additional amino acids can be included on either or both of the N- or C- termini of these sequences, of course, these additional amino acid residues should not significantly interfere with the functional activity of the peptides.
The invention also relates to the use of a short peptide of up to 22 amino acid comprising at least one cysteine or a derivative thereof, for example to a peptide of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20 or 21 amino acid residues comprising at least one cysteine, for example to a peptide of 2, 3, 4, 5, or 6 consecutive amino acids including the at least one cysteine and at least one non- cysteine residue selected from proline, arginine and glutamic acid. In one embodiment of the invention such peptide is glutathione.
It was found according to the invention that short peptides containing phenylalanine and cysteine residues such as, for example, P-C-R-F-F-E (SEQ ID NO: 9); C-R-F-F-E (SEQ ID NO: 10); C-R-F-F (SEQ ID NO: 11); C-R-F (SEQ ID NO: 12); P-C-R-F (SEQ ID NO: 13); C-A-A-F (SEQ ID NO: 14); C-R-R-F (SEQ ID NO: 15) and a derivative of P-C-R-F-F (SEQ ID NO: 16), P-dCys(Trt)-R-F-F were very potent inhibitors of SDF-I -mediated T cell migration, as measured by the in vitro transwell assay.
These are synthetic small peptides based on the N-terminus sequence of the SDF-I molecule, which has cysteine and phenylalanine residues (amino acids 9-15 of SDF-I) C-P-C-R-F-F-E (SEQ ID NO: 17). Peptide of SEQ ID NO: 9, P-C-R-F- F-E, is a hexapeptide from the N-terminus sequence of SDF-I containing one proline residue at position 1 a cysteine residue at position 2 and two phenylalanine at positions 4 and 5, the cysteine and phenylalanine are separated by an arginine and the last residue is glutamic acid. Peptide of SEQ ID NO: 10, C-R-F-F-E, is similar to peptide of SEQ ID NO: 9, except that the proline is missing resulting in a pentapetide in which cysteine is at position 1. Peptide of SEQ ID NO: 11, C-R-F-F, is similar to peptide of SEQ ID NO: 10, except that the glutamic acid is missing resulting in a tetrapeptide in which cysteine is also at position 1, the last residue is phenylalanine and has in total two phenylalanine residues. Peptide of SEQ ID NO: 12, C-R-F, is similar to peptide of SEQ ID NO: 11, except that the last amino acid phenylalanine is missing resulting in a tetrapeptide in which cysteine is at position 1 and has only one phenylalanine residue at position 3 and in which the cysteine and phenylalanine are separated by one arginine. Peptide of SEQ ID NO: 13, P-C-R-F, is similar to peptide of SEQ ID NO: 9, except that one phenylalanine residue and one glutamic acid residue at positions 5 and 6 respectively are missing, resulting in a tetrapetide which has a proline at position 1 and the cysteine at position 2 and has only one phenylalanine. Peptide of SEQ ID NO: 14, C-A-A-F, is a tertrapeptide like peptide SEQ ID NO: 11 in which the arginine at position 2 and the phenylalanine at position 3 have been substituted by alanines, resulting in a peptide having a cysteine at position 1 and only one phenylalanine at position 4. Peptide of SEQ ID NO: 15, C-R-R-F, is a tertrapeptide like peptide of SEQ ID NO: 11 in which the phenylalanine at position 3 has been substituted by arginine resulting in a peptide having a cysteine at position 1 and only one phenylalanine at position 4. Peptide P-dCys (Trt)-R-F-F is a derivative of peptide P-C-R-F-F (SEQ ID NO: 16) in which the cysteine residue which was substituted to the cysteine derivative dCys (TrT). Peptide of SEQ ID NO; 16 similar to peptide of SEQ ID NO: 9 except for the cysteine residue which was substituted to dCys (TrT) and for the missing glutamic acid. Trt is trity, a protecting group for the SH functional moiety of cysteine. The Fmoc-CYS (Trt) was used as a building block peptide chain assembly. It was found according to the present invention that these peptides used at concentration that were non toxic to the cells, were very potent inhibitors (in range 50-90% inhibition) of T cell migration mediated by SDF-I . These peptides were able to inhibit the spontaneous migration as well, but to a lesser extent.
Peptides from the amino terminus of SDF-I of 10 amino acid or larger including the LSY motif were disclosed by Heveker et al. (1998, 2001), Loetscher et al. (1998) and Luo et al. (1999). Of note, all of the active disclosed peptides included the LSY motif. As disclosed by Heveker et al. (2001) the peptides displayed chemotactic effects on polymorphonuclear leucocytes (PMN) but none of them inhibited chemotaxis induced by SDF-I in these cells. The same author has indicated in an earlier publication that the LSY motif (SEQ ID NO: 19) was essential for HIV inhibition (Heveker 1998). In contrast to the reported peptides, the peptides containing cysteine and phenylalanine which according to the invention are from the amino terminus of SDF-I, lack the LSY motif and are capable of inhibiting chemotaxis induced by SDF-I . Since the replication of the HIV, as the chemotactic activity of SDF-I, involves CXCR4 it is likely that these peptides of the invention will also be capable to inhibit HIV virus. Thus, in another aspect, the present invention relates to the use of a peptide of up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof , except for a peptide from the amino terminus of SDF-I which includes the LSY motif, in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
The peptide can consist of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, and 21 amino acid residues comprising at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof, such as a peptide of up to 22 amino acid residues comprising 2, 3, 4, 5, 6 or 7 consecutive amino acid residues including the at least one cysteine residue or a derivative thereof and at the least one phenylalanine residue or a derivative thereof. In one embodiment of the invention the peptide consists of 3, 4, 5, 6, or 7 consecutive amino acid residues including one cysteine residue or a derivative thereof and one phenylalanine residue or a derivative thereof separated by one or more arginines such as in the peptides P- C-R-F-F-E (SEQ ID NO: 9), C-R-F-F-E (SEQ ID NO: 10), C-R-F-F (SEQ ID NO: 11), C-R-F (SEQ ID NO: 12), P-C-R-F (SEQ ID NO: 13), C-R-R-F (SEQ ID NO: 15), P-dCys(Trt)-R-F-F (SEQ ID NO: 16). In another embodiment of the invention the peptide comprises 3, 4, 5, 6 or 7 consecutive amino acids including one cysteine residue or a derivative thereof and one phenylalanine residue or a derivative thereof separated by one or more alanines like in peptide C-A-A-F. In another embodiment of the invention the peptide comprises 4 consecutive amino acid residues wherein the first residue of the consecutive amino acid residues is cysteine or a derivative thereof and the fourth residue is phenylalanine or a derivative thereof like in the peptides C-A-A-F (SEQ ID NO: 14), C-R-R-F (SEQ ID NO: 15) and C-R-F-F (SEQ ID NO: 11).
In one embodiment of the invention, the peptide comprises 4 or 5 consecutive amino acid residues including the at least one cysteine residue or a derivative thereof and at the least one phenylalanine residue or a derivative thereof wherein the first residue of the consecutive amino acid residues is a proline like for example in P-C-R-F (SEQ ID NO: 13) and P-dCys (Trt)-R-F-F (SEQ ID NO: 16), respectively.
In another embodiment of the invention, the peptide comprises 5, 6 or 7 consecutive amino acid residues including the at least one cysteine residue or a derivative thereof and at the least one phenylalanine residue or a derivative thereof wherein the last residue of the consecutive amino cid residues is a glutamic acid such as in C-R-F-F-E (SEQ ID NO: 10), P-C-R-F-F-E (SEQ ID NO: 9) and C-P-C- R-F-F-E (SEQ ID NO: 17), respectively. Further embodiments of the invention relate to a peptide of up to 22 amino acid residues comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive amino acid residues and when the first amino acid is proline and/or the last amino acid is glutamic acid and when at least one cysteine residue or a derivative thereof and at least one phenylalanine residue or a derivative thereof are separated by one or two amino acid residues that are different from cysteine or phenylalanine, such as arginine or alanine residues.
Exemplary peptides that can be used according to the invention include, but are not limited to, F-K, K-F, F-R, R-F, K-F-K-F, F-E, E-F, F-L-K, F-L-ε- aminocaproic acid and glutathione, and peptides including amino acids of both types phenylalanine and cysteine such as C-P-C-R-F-F-E, P-C-R-F-F-E; C-R-F-F- E; C-R-F-F; C-R-F; P-C-R-F; C-A-A-F; C-R-R-F and P-dCys(Trt)-R-F-F, their salts, functional derivatives, as well as its active mutants, i.e. other peptides comprising phenylalanine, and cysteine wherein one or more amino acids of the structure are eliminated or substituted by other amino acids or one or more amino acids are added to that sequence in order to obtain peptides of up to 22 amino acid residues having the same activity such as inhibiting motility and/or CXCR4 activity of cells.
The peptides may comprise half-life extending moieties such as a protein or a high molecular weight polymer resulting in "fusion peptides" with extended half- life in body fluids. For example, peptides according to the invention can be fused to a protein such as, for example, an immunoglobulin or to a high molecular weight polymer, such as polyethylene glycol (PEG), or the like.
Since peptides according to the invention were found to be very potent inhibitors of T cell migration, they can be used as medication in diseases, disorder or conditions in which the pathology involves T cell recruitment. Thus, inhibition of T cell recruitment by these peptides can be beneficial to prevent or ameliorate the pathology of said disease, disorder or condition. Examples of diseases disorder or conditions in which the pathology involves T cell recruitment are autoimmune diseases and inflammation. In another aspect, the invention provides peptides, for example it provides a peptide of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 amino acid residues comprising the amino acid sequence C-X-X-F (SEQ ID NO: 18) wherein X is an arginine or an alanine. In one embodiment of the invention, the peptide comprises the amino acid sequence of SEQ ID NO: 14 or SEQ ID NO: 15. Also, the invention provides a peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues comprising 3, 4, 5, 6, 7, or 8 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by at least one alanine.
In one embodiment of the invention, the peptide comprises one cysteine or derivative thereof and one phenylalanine or derivative thereof separated by one or two alanine residues.
The invention relates also to a peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues comprises 4 consecutive amino acid residues wherein the first and the last amino acid residue of the consecutive amino acid residues is cysteine or a derivative thereof and phenylalanine or a derivative thereof, respectively.
The invention provides also a peptide of up to 22 amino acid residues comprising 3, 4, 5, 6, or 7 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by one arginine, except for a peptide from the amino terminus of SDF-I including the LSY motif and except for a peptide consisting of 6, 7, 8, 9, 10 or 11 amino acid residues which excludes the LSY motif having a serine as the last residue.
In one embodiment of the invention the peptide comprises 3 consecutive amino acid of SEQ ID NO: 12. In another embodiment of the invention the peptide of up to 22 amino acid residues comprises 4 consecutive amino acid residues wherein the first and the last amino acid residue of the consecutive amino acid residues is cysteine or a derivative thereof and phenylalanine or a derivative thereof, respectively like in SEQ ID NO: 1 1. In another embodiment of the invention the peptide of up to 22 amino acid residues comprises 4 consecutive amino acid residues wherein the first amino acid residue of the consecutive amino acid residues is a proline like in SEQ ID NO: 13.
In another embodiment of the invention the peptide of up to 22 amino acid residues comprises 5 consecutive amino acid residues wherein the first amino acid residue of the consecutive amino acid residues is a proline like in SEQ ID NO: 16, or a derivative of SEQ ID NO: 16 having instead of a Cysteine a dCys(Trt) residue.
In another embodiment of the invention the peptide of up to 22 amino acid residues comprises 5 consecutive amino acid residues wherein the fifth residue of the consecutive amino acid residues is a glutamic acid like in SEQ ID NO: 10.
In another embodiment of the invention the peptide of up to 22 amino acid residues comprises 6 consecutive amino acid residues wherein the sixth residue of the consecutive amino acid residue is glutamic acid and/or wherein the first residue of the consecutive amino acid residues is proline like in SEQ ID NO: 9. In another embodiment of the invention the peptide of up to 22 amino acid residues comprises 7 consecutive amino acid residues wherein the seventh residue of the consecutive amino acid residue is glutamic acid and/or wherein the "first residue of the consecutive amino acid residues is a cysteine like in C-P-C-R-F-F-E (SEQ ID NO: 17). In addition, the invention provides a peptide of up to 22 amino acid residues comprising 3, 4, 5, 6, 7, or 8 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by two arginines, like in SEQ ID NO: 15. There is also provided according to the invention, a peptide of 3, 4, 5, 6, 7, 8, or 9 amino acid residues comprising the amino acid sequence C-R-F (SEQ ID NO: 12), except for a peptide from the amino terminus of SDF-I including the LSY motif (SEQ ID NO: 19).
The invention also provides a peptide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, 21 or 22 amino acids comprising: 2 consecutive amino acid consisting of F-K, K-F, F-R, R-F, F-E or E-F; 3 consecutive amino acid consisting of F-L-K or F-K-ε-aminocaproic acid; or 4 consecutive amino acid consisting of K-F-K-F.
In addition, the invention provides a peptide of up to 12 amino acids comprising the amino acid sequence of F-K, K-F, F-R, R-F, K-F-K-F, F-L-K, F-K- ε-aminocaproic acid, F-E, E-F, P-C-R-F-F-E, C-R-F-F-E, C-R-F-F, C-R-F, P-C-R- F, C-A-A-F, C-R-R-F, or P-dCys(Trt)-R-F-F.
In one embodiment of the invention, the peptide consists of F-K, K-F, F-R, R-F, K-F-K-F, F-L-K, F-K-ε-aminocaproic acid, F-E, E-F, P-C-R-F-F-E, C-R-F-F- E, C-R-F-F, C-R-F, P-C-R-F, C-A-A-F, C-R-R-F, P-C-R-F-F or P-dCys(Trt)-R-F- F. Additional amino acids can be included on either or both of the N- or C- termini these sequences, of course, these additional amino acid residues should not significantly interfere with the functional activity of the peptides.
The invention provides a peptide consisting of amino acid sequence of SEQ ID NO: I5 SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 1 linked to aminocaproic acid, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 115 SEQ ID NO: 12, P SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, a derivative of SEQ ID NO: 16 comprising instead of the cysteine a dCys(Trt) residue or SEQ ID NO: 17 (C-P-C-R-F-F-E.), a derivative thereof, or a combination thereof. K-F-K-F is a dual peptide comprising two K-F peptides which also has inhibitory activity therefore in another embodiment; the present invention provides a multiple peptide comprising a number of the same or different peptides of the present invention. The peptides of the invention can be "protected" at the terminal amino group for example by coupling with any of various amino-terminal protecting groups traditionally employed in peptide synthesis. For example , suitable groups include acyl protecting groups, like formyl, acetyl, and benzoyl; aromatic urethane protecting groups, for example, benzyloxycarbonyl; and aliphatic urethane protecting groups, for example, tert-butoxycarbonyl.
The peptides of the invention can be "protected" at the terminal carboxyl group, for example by coupling with any of various carboxy-terminal protecting groups. For example, suitable protecting groups include tert-butyl or benzyl, which are linked to the terminal caroxyl group through an ester or ether bond. The term peptide relates to chains of amino acids and/or amino acid derivatives. A derivative of a peptide according to the invention may contain additional chemical moieties as a part of the peptide. Examples of such chemical moieties are amides of carboxyl groups at the C-terminal end of the peptides and amides of free carboxyl groups of aspartic or glutamic acid residues. Of course, any such derivatives which are embraced according to the invention must have substantially similar activity to the peptide of the invention.
The peptides may comprise D and/or L amino acids. The advantage of using peptides comprising one or more than one D amino acid residues is that these peptides may be more resistant to proteolytic degradation and therefore may have increased half life in biological fluids such as plasma.
In certain embodiments of the invention the peptide is a short peptide and consists of up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues, up to 10 amino acid residues, or of 2, 3, 4, 5, 6, 7, 8, or 9 amino acid residues.
The invention embraces also peptides of the invention that are circularly permuted peptides. The term "circularly permuted" as used herein refers to a linear peptide in which the termini have been joined together, either directly or through a linker, to produce a circular peptide, and then the circular peptide is opened at another location to produce a new linear peptide with termini different from the termini in the original peptide. Circular permutations include those peptides whose structure is equivalent to a peptide that has been circularized and then opened. Thus, a circularly permuted peptide may be synthesized de novo as a linear peptide and never go through a circularization and opening step. The particular circular permutation of a peptide is designated by brackets containing the amino acid residues between which the peptide bond is eliminated. Circularly permuted peptides are single-chain peptides, which have their normal termini fused, often with a linker, and contain new termini at another position. See Goldenberg, et al. J. MoI. Biol., 165: 407-413 (1983) and Pan et al. Gene 125: 111-114 (1993), both incorporated by reference herein. Circular permutation is functionally equivalent to taking a straight-chain peptide, fusing the ends to form a circular peptide, and then cutting the circular peptide at a different location to form a new straight chain peptide with different termini. Circular permutation thus has the effect of essentially preserving the sequence and identity of the amino acids of a peptide while generating new termini at different locations.
The peptides according to the invention can be linear or cyclic peptides. Additional peptides according to the invention comprising different amino acid combinations which include phenylalanine and/or cysteine and exhibit motility and/or CXCR4 inhibitory potency can be produced, for example, by chemical synthesis or by recombinant technology. These methods are known in the art. One example of chemical synthesis is the solid method using a multiple peptide synthesizer (AMS 422. Abimed Analyzer Tech). In one embodiment an Fmoc (N-9 Fluorentylmethoxycarbonyl) strategy was employed following commercial protocols of the company. This approach of peptide synthesis is widely used (Fridkin et al., 2006). After production of peptides, peptides that show motility and/or CXCR4 inhibitory potency can be selected by using the transwell in vitro assay as described in the Example section and/or as described below. Expression of a peptide or fusion peptides of the invention in a mammalian cell may be approached by inserting the DNA coding for the peptide or for the fusion peptide into a vector comprising a promoter, optionally an intron sequence and splicing donor/acceptor signals, and further optionally comprising a termination sequence. These techniques are in general described in Ausubel et al., Current Protocols in Molecular Biology (Chapter 16), Greene Publications and Wiley Interscience, New York, NY5 1987-1995; Sambrook et al,, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989. The above promoter, intron, and termination sequences are operable in mammalian cells. The promoter is preferably a strong promoter such as the above- noted RSV, CMV, or MPSV promoter. The promoter may also be the SV40 early promoter (Everett, et al. 1983, and references therein), or a cellular promoter, such as the beta-actin promoter or the ELF-I promoter (Tokushige, et al., 1997). Also, a hybrid promoter may be used, such as the hybrid between the lac operator and the human ELF-I alpha promoter as described by Edamatsu et al. 1997, the CMV-beta actin hybrid promoter described by Akagi et al (1997), or the hybrid between the operator sequences and the CMV promoter (Furth et al., 1994, and references therein). Intron sequences, which may be inserted as complete sequences, i.e., including the splice donor and acceptor sites, may be inserted into the coding sequence of the polypeptide, which it is desired to express. Insertion if such intron sequences may enhance RNA stability and thus enhance production of the desired polypeptide. While in principle, suitable intron sequences may be selected from any gene containing introns, exemplary intron sequences are the beta-actin intron, the SV 40 intron, and the p55 TNF receptor intron.
The intron sequence may contain enhancer elements, which may enhance transcription from the above-noted promoters.
Often, intron sequences also contain transcriptional or translational control sequences that confer tissue specific expression. Therefore, when it is desired to express a peptide or fusion peptides of the invention in a tissue-specific manner, such intron sequences may be advantageously employed. An example of an intron containing tissue-specific enhancer elements is the erythroid-specific enhancer located in intron 8 of the human 5-aminolevulinate synthase 2 gene (Surinya et al. 1998), and a discussion of the principle of enhancing protein production using intron sequences, together with example intron sequences, is provided in Huang et al. 1990.
Transcriptional termination sequences and polyadenylation signals may be added at the 3 ' end of the DNA coding for the polypeptide that it is desired to express. Such sequences may be found in many or even most genes. Advantageously, the SV 40 polyadenylation signal can be used (Schek et al., 1992, and references therein).
Vectors for expression of peptides of invention or fusion peptides in a mammalian cell could be used for example the pcDNA3.1 vector (Invitrogen), which contains the CMV promoter for driving expression of the gene encoding the desired polypeptide and pMPSVEH vectors with the MPSV promoters.
Recombinant polypeptides can be produced either in bacterial or eukaryotic (e.g. CHO) cultured host cells transfected with vectors encoding such polypeptides or in transgenic animals. When using transgenic animals it is particularly advantageous to produce heterologous polypeptides in their milk. Dairy animals such as cattle, sheep and goats are thus exemplary hosts. See, for example, patent specifications WO 88/00239, WO 90/05188, WO 91/02318, and WO 92/11757; and U.S. Pat. Nos. 4,873,191 ; 4,873,316; and 5,304,489, which are incorporated herein by reference in their entirety. The present invention also provides expression vectors comprising the DNA sequence encoding a peptide or fusion peptide of the invention and methods for their production by introducing said vector in prokaryotic or eukaryotic host cells, such as insect cells, yeast cells, or mammalian cell such as HeLa, 293 T HEK and CHO cells, growing the cells and isolating the protein produced. Moreover, the invention provides a viral vector encoding a peptide, or its fusion peptide.
Thus, additional peptides according to the invention can be isolated, for example by; chemical synthesis or recombinant expression of cysteine and/or phenylalanine-containing peptides of up to 22 amino acid residues, evaluation of their motility inhibitory effect and/or on SDF-1/CXCR4 inhibitory activity, and selection of peptides exhibiting similar motility inhibitory effect and/or on SDF- 1/CXCR4 inhibitory activity like peptides of SEQ ID NO: 1 to SEQ ID NO: 16. Thus, additional cysteine and/or phenylalanine-containing peptides or fusion peptides can be synthesized and can be tested at various concentrations on SDF-I and/or spontaneous induced migration in vitro or in vivo employing human primary T-cells, CD34+ stem cells or Pre-BLL cells. Typically, for in vitro migration experiments, cells (e.g. 1 x 106/mL) can be incubated with peptides for example for 2 hrs at 370C, 95% humidity, then added unwashed into the upper chambers of Costar 24-well transwell plates with 5 μm pore filters (Corning Inc. Coming, NY) and allowed to migrate for 2 hrs at 370C, 95% humidity, 5% CO2 spontaneously or towards SDF-I (20 ng/mL). Alternatively, the peptide may be added to the lower chamber of the transwell assay. Migrated cells can be collected from the lower chambers and counted using a FACSCalibur flow cytometer (Becton Dickinson, San Jose, California). The cells can be gated in forward and side scatters set at linear gain. Data can be presented as a percentage of migrated cells that were pretreated with peptides compared to the percentage of migrated untreated cells taken as 100%.
The concentration of the peptide in the lower well and/or in contact with the tested cells can be in the range of 5 nM to 100 nM or 0.1 mM to 10 mM or up to 50 mM and 100 mM; up to 5 or 10 mM; and about 0.1 mM, 1 mM, 5 mM or 10 mM.
The invention pertains to a peptide according to the invention as defined above, or to a salt thereof and/or derivative thereof and/or a fusion peptide thereof. The term "salts" herein refers to both salts of carboxyl groups and to acid addition salts of amino groups of the peptides of the invention. Salts of a carboxyl group may be formed by means known in the art and include inorganic salts, for example, sodium, calcium, ammonium, ferric or zinc salts, and the like, and salts with organic bases as those formed, for example, with amines, such as triethanolamine, arginine or lysine, piperidine, procaine and the like. Acid addition salts include, for example, salts with mineral acids such as, for example, hydrochloric acid or sulfuric acid, and salts with organic acids such as, for example, acetic acid or oxalic acid. Of course, any such salts must have substantially similar activity to the peptide of the invention.
The present invention relates also to the DNA sequence encoding peptides or fusion peptides according to the invention. Moreover, the present invention further concerns the DNA sequences encoding a biologically active peptide, fragment or fusion peptides of a peptide according to the invention.
In another aspect, the invention provides a pharmaceutical composition comprising an agent according to the invention such as phenylalanine or a derivative thereof, cysteine or a derivative thereof, a mixture or combination of phenylalanine or derivative thereof and cysteine or derivative thereof, peptides of up to 22 amino acid residues comprising phenylalanine or derivative thereof and/or cysteine or derivative thereof, a DNA encoding said peptides or a vector harboring said DNA and a pharmaceutically acceptable carrier. In one aspect of the invention, there is provided a pharmaceutical or veterinary composition for treating a disease or condition caused by, or associated with CXCR4, or a' disease or condition responsive to inhibition of CXCR4, comprising an agent according to the invention together with a pharmaceutically or veterinary acceptable excipient or carrier. The present invention provides the use of agents according to the invention in subjects in need such as human patients or in veterinary medicine in the management (namely, treatment or prophylaxis) of a disease, disorder or condition responsive to inhibition of CXCR4 activity or inhibition of motility or disease or condition in which pathogenesis of the disease, disorder or condition is caused by, or associated with, the level or activity of the chemokine receptor CXCR4 and/or with the level of cell motility. The agent according to the invention can be administered in vivo or ex-vivo.
The terms cell motility and cell migration as used in the present description are interchangeable. When "treating/ameliorating" a disease, disorder or condition the agent or substance according to the invention is given after onset of the disease, "prevention" relates to administration of the substance according to the invention before any signs of disease can be noted in the patient.
A disease, disorder or condition responsive to inhibition of CXCR4, inhibition of cell motility, or inhibition of both CXCR4 or cell motility is a disease, disorder or condition that can be ameliorated or prevented by inhibition of CXCR4 expression or activity in cells involved or responsible for the pathogenesis or course of said disease, disorder or condition, inhibition of cell motility in cells involved or responsible for the pathogenesis or course of said disease, disorder or condition, or inhibition of both CXCR4 expression or activity and inhibition of motility in cells involved or responsible for the pathogenesis or course of said disease, disorder or condition.
Examples of disorders, diseases or conditions caused by, or associated with CXCR4 activity or responsive to inhibition of CXCR4 activity include, but are not limited to, primary tumor growth, invasion by secondary metastases; inflammatory diseases such as rheumatoid arthritis, septic arthritis, osteoarthritis, periodontitis, gingivitis, asthma, autoimmune disease, psoriasis, psoriatic arthritis, atopic dermatitis; interstitial nephritis, ocular inflammation, liver cirrhosis, an inflammatory condition of the nervous system or neuroinfiammatory disorders, e. g. multiple sclerosis, transplant rejection (e. g. graft versus host disease), inflammatory gastric conditions, e. g. Crohn's disease, inflammatory bowel disease, and ulcerative colitis, and acquired immunodeficiency syndrome (AIDS). CXCR4 is known to be involved in neuronal cell migration and therefore the invention encompasses the use of an agent according to the invention in neurological diseases such as Parkinson's disease and schizophrenia. CXCR4 seems to be commonly expressed on cancer cells and to play a role in migration, invasion, proliferation, survival and other malignant processes. Malignant cells from at least 23 different types of cancer express the chemokine receptor CXCR4 and respond to its ligand SDF-I . The CXCR4 receptor was suggested by Balkwill on 2004 to be involved in directed migration of cancer cells to sites of metastasis, increase survival of cancer cells and establishment of a tumor promoting cytokine/chemokine network. Therefore, CXCR4 antagonists are important in cancer therapy. While not wishing to be bound by theory, the inventors believe that an antagonist of the CXCR4 provides effective treatment of cancers that express CXCR4 by decreasing the rate of proliferation or by causing cessation of proliferation or by causing death of cancer cells.
Thus, in one embodiment the invention relates to the use of an agent according to the invention for treatment of a cancer that expresses CXCR4. CXCR4/SDF-1 is important for blood vessel formation and endothelial cell migration. Therefore, CXCR4 inhibition appears to be advantageous for treatment of a disease in which preventing blood vessel formation is desirable, such as solid cancer.
Examples of cancers that express CXCR4 include, but are not limited to, B- CLL, AML, B-lineage ALL, intraocular lymphoma Non-Hodgkin lymphoma, follicular center lymphoma, CML, Multiple myeloma, pancreatic cancer, prostate (localized and metastatic cancer), kidney, breast, ovary, thyroid, kidney, colorectal cancer, oral squamous carcinoma, cervical cancer, neuroblastoma, glioma, astrocytoma, rhabdomyosarcoma, small cell lung cancer and melanoma. Examples of cancer cells that over express CXCR4 include, but are not limited to, B-CLL, B- lineage ALL, follicular center lymphoma, and astrocytoma (Balkwill, 2004).
Precursor-B ALL is the most common childhood malignancy and the second most common adult acute leukemia. Leukemic cells have the ability to infiltrate the liver, spleen, lymph nodes, and central nervous system. High expression of CXCR4 by leukemic cells is strongly predictive for organ invasiveness, including infiltration to the central nervous system in patients with childhood ALL.
It was found according to the present invention that in-vivo, an agent according to the invention prevented homing of B-cell acute lymphoblastic leukemic cells to the bone marrow, spleen, liver and lung. Thus, said agent may be aimed at preventing organ invasiveness of leukemic cells.
Thus, in one embodiment, the invention provides the use of an agent according to the invention for treating or preventing leukemia such as B cell acute lymphoblastic leukemia. The linkage between cell motility and/or CXCR4/SDF-1 interaction and development of metastasis is well established. CXCR4/SDF-1 interaction has been linked to metastasis in some cancer types including prostate cancer, renal cancer, neuroblastoma, ovarian cancer, breast cancer, head and neck and melanoma to organs that are an abundant source of SDF-I, including lymph node, bone marrow, and skin.
Thus, in another embodiment the invention relates to the use of an agent according to the invention for treating or preventing metastasis.
Signaling of CXCR4 and/or cell motility is known to play a role in inflammation. For instance, SDF-I levels are increased in inflammatory liver disease, in synoviocytes of the hyperplastic lining layer of rheumatoid joint. In a murine model of rheumatoid arthritis exogenous SDF-I, injected in periathric tissues, elicited an inflammatory response (reviewed by Balkwill 2004). Treating mice with CXCR4 antagonist AMD3100 before appearance of first symptoms was found to be beneficial. SDF-I is involved in the destruction of cartilage in osteoarthritis and rheumatoid arthritis (Kanbe et al., 2004). There is recent evidence for the involvement of CXCR4 and SDF-I in neurotoxicity induced inflammation/infection.
Therefore, CXCR4 antagonists and/or inhibitor of cell migration are beneficial for preventing or treating inflammation. Thus, in one embodiment, the invention provides the use of an agent according to the invention for treating or preventing inflammation.
CXCR4 is known in the art to serve as co-receptor for the human immunodeficiency virus (HIV). CXCR4 interact with HIV and with the cellular CD4 receptor to facilitate viral entry into cells. Therapeutic approaches based on antagonist of these receptors have been developed, some of which are currently in clinical trials (Murakami and Yamamoto, 2000). Therefore, CXCR4 antagonists are beneficial in preventing or treating acquired immunodeficiency syndrome (AIDS).
Thus, in one embodiment, the invention provides the use of an agent according to the invention for treating or preventing AIDS.
Since findings according to the invention show decrease in SDF-I -induced migration of T cells in vitro in the presence of peptide according to the invention, such peptides may be used in various pathological situations in which SDF- 1/CXCR4 axis is involved. T cell recruitment from the blood is thought to be essential for the initiation and maintenance of pathologic tissue damage and inflammation. Therefore, agents according to the invention may be used to prevent antigen-activated T cell to migrate from the blood to sites of inflammation. These agents of the invention, particularly peptides of the invention, that block T cell migration may be used as therapeutic agents for decreasing or inhibiting the pathology of T cell-infiltrative autoimmune diseases.
In another aspect, the invention provides a method for treating and/or preventing a disease, disorder or condition whose pathogenesis is caused by, or associated with, the activity of the chemokine receptor CXCR4, comprising administering to a subject in need thereof a therapeutically effective amount of an agent according to the invention or a salt thereof, optionally together with a pharmaceutically acceptable carrier. Thus, the invention relates to a method of management (namely, treatment or prophylaxis) of a disease or condition responsive to inhibition of CXCR4 in a subject in need, in particular in a human patient, which method comprises administering to the subject an effective amount of an agent according to the invention defined above, or a pharmaceutical acceptable salt thereof. For a review on suitable salts, see Handbook of Pharmaceutical Salts: Properties, Selection, and Use by Stahl and Wermuth (Wiley- VCH, Weinheim, Germany, 2002). Thus, in one aspect of the invention, phenylalanine, cysteine, a derivative of said amino acids and peptides comprising them can be administered as inhibitors of CXCR4 activity and/or cell motility, for example, for the treatment or prevention of cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS), inflammation and metastasis. Single or multiple administrations of the composition may be administered depending on the dosage and frequency as required and tolerated by the subject. The concentration of composition in these formulations will be so designed as to deliver in the body an amount of molecules sufficient, for obtaining a therapeutic effect. The composition will be designed such as to deliver an amount of compound or agent that is sufficient to affect the course and severity of disease or condition mentioned herein, leading to reduction or remission of the disease. The effective amount will depend on the route of administration, the disease to be treated and the condition of the subject.
Whether a cancer patient would benefit from treatment with the agent according to the invention can be determined, if desired, by obtaining a tumor sample from the patient and determining whether CXCR4 is expressed in the sample (e.g., by measuring CXCR4 as exemplified below and/or by mRNA levels or any other method well known in the art) or by determining in said sample the ability of SDF-I to modulate proliferation, adhesion, motility, homing, calcium release and other activities signaled by SDF-I .
Preventive administration is especially useful in patients having high-risk to be ill or suffer from a disease or condition mentioned herein.
The agent according to the invention may also be used in a combination therapy in conjunction with other therapeutic agents such as anti-viral agents (e.g., nucleoside or non-nucleoside HIV reverse transcriptase inhibitors, HIV protease inhibitors, and HIV integrase inhibitors), anti-neoplastic agents such as chemotherapy or with other anti-inflammatory agents.
The definition of "pharmaceutically acceptable" is meant to encompass any carrier, which does not interfere with effectiveness of the biological activity of the active ingredient and that is not toxic to the host to which it is administered. For example, for parenteral administration, the substance according to the invention may be formulated in a unit dosage form for injection in vehicles such as saline, dextrose solution, serum albumin and Ringer's solution.
It will be understood that the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination and the severity of the particular disease undergoing therapy. Optimum dose levels and frequency of dosing will be determined by clinical trial. The compounds with which the invention is concerned may be prepared for administration by any route consistent with their pharmacokinetic properties.
The orally administrable compositions may be in the form of tablets, capsules, powders, granules, lozenges, and liquid or gel preparations, such as oral, topical, or sterile parenteral solutions or suspensions. Tablets and capsules for oral administration may be in unit dose presentation form, and may contain conventional excipients such as binding agents, for example syrup, acacia, gelatin, sorbitol, tragacanth, or polyvinyl-pyrrolidone; fillers for example lactose, sugar, maize- starch, calcium phosphate, sorbitol or glycine; tabletting lubricant, for example magnesium stearate, talc, polyethylene glycol or silica; disintegrants for example potato starch, or acceptable wetting agents such as sodium lauryl sulphate. The tablets may be coated according to methods well known in normal pharmaceutical practice. Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for reconstitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, for example sorbitol, syrup, methyl cellulose, glucose syrup, gelatin hydrogenated edible fats; emulsifying agents, for example lecithin, sorbitan monooleate, or acacia; Non-aqueous vehicles (which may include edible oils), for example almond oil, fractionated coconut oil, oily esters such as glycerine, propylene glycol, or ethyl alcohol; preservatives, for example methyl or propyl p-hydroxybenzoate or sorbic acid, and if desired conventional flavouring or colouring agents.
For topical application to the skin, the drug may be made up into a cream, lotion or ointment. Cream or ointment formulations, which may be used for the drug are conventional formulations well known in the art, for example as described in standard textbooks of pharmaceutics such as the British Pharmacopoeia.
For topical application to the eye, the drug may be made up into a solution or suspension in a suitable sterile aqueous or non-aqueous vehicle. Additives, for instance buffers such as sodium metabisulphite or disodium edeate; preservatives including bactericidal and fungicidal agents such as phenyl mercuric acetate or nitrate,benzalkonium chloride or chlorhexidine, and thickening agents such ashypromellose may also be included.
The active ingredient may also be administered parenterally in a sterile medium. Depending on the vehicle and concentration used, the drug can either be suspended or dissolved in the vehicle. Advantageously, adjuvants such as local anaesthetic, preservative and buffering agents can be dissolved in the vehicle.
Having now fully described this invention, it will be appreciated by those skilled in the art that the same can be performed within a wide range of equivalent parameters, concentrations and conditions without departing from the spirit and scope of the invention and without undue experimentation. All references cited herein, including journal articles or abstracts, published or unpublished U.S. or foreign patent application, issued U.S. or foreign patents or any other references, are entirely incorporated by reference herein.
Reference to known method steps, conventional methods steps, known methods or conventional methods is not any way an admission that any aspect, description or embodiment of the present invention is disclosed, taught or suggested in the relevant art.
The present invention will now be described in more detail in the following non-limiting examples and the accompanying drawings.
EXAMPLES
MATERIAL AND METHODS.
(i) Cell cultures. Enrichment of human CB CD34+ cells was performed using magnetic bead separation as previously described (Kollet et al.5 2001).
MS-5 and CD34+ cells were cultured in RPMI 1640 medium supplemented with 10% heat inactivated FCS, antibiotics and glutamine. Murine MS-5 stromal cell line (Millennium Pharmaceuticals, Cambridge, Massachusetts, USA) was previously described (Bleul et al., 1996).
The pre-B ALL cell lines G2 and B 1 were previously described (Freedman et al., 1993). Bl and G2 cells were cultured in IMDM supplemented with 10% heat inactivated FCS, antibiotics and glutamine
(H) Transwell assay. Transwell assays were performed using Costar transwells (6.5 mm/diameter, 5 μm/pore) as previously described (Aiuti et al., 1997).
Typically, cells (1-2x105 in 100 μl medium) were placed in the upper chamber of the transwell apparatus. Regular medium or Bl conditioned medium
(600 μl) with or without SDF-I (125 ng/ml) was placed in the lower chamber. Cells migrating within 4hrs to the bottom chamber were counted using a FACSort
(Becton Dickinson). Recombinant human SDF-I was purchased from PeproTech.
(Hi) Adhesion assay. Human CB CD34+ cells (I x 105/well) were labeled with CFSE (Molecular Probes), incubated with medium or medium supplemented with Phe-ol (5 mM or 10 mM) for about 2 hours, and allowed to adhere to confluent MS-5 cells for 45 minutes at 370C (1 x 105 cells/well) in a 96-well plate. Nonadherent cells were washed twice in FACS buffer (PBS + 1% FCS + 0.02% NaNO3). Adherent cells were collected in 150 μl FACS buffer plus 0.5 mM EDTA. The number of CFSE+ cells was determined by FACS analysis (FACSCalibur; BD).
(iv) Calcium influx assay. Calcium influx assay with G2 cells following stimulation with SDF-I (0.5 μg/ml) was performed as previously described (Aiuti, et al., 1997).
(v) In-vivo experiments. Were carried out with NOD/LtSz-Prkdc510"^ (NOD- SCID) mice were bred and maintained under defined flora conditions in ventilated sterile micro isolator cages. An in vivo model was developed to identify normal and leukemic human CD34+CD38-/low stem cells based on their functional ability to initiate human hematopoiesis in transplanted immune deficient NOD/SCID and NOD/SCID/B2mnull (Lapidot et.al 1997).
After a 2-hour preincubation with Phe-ol (5mM) or Phe-ol (1OmM) containing medium, human G2 cells (107/mouse, for testing homing) were injected into tail vein of 8-week old NOD-SCID mice. 16 hours after injection (for evaluating homing), mice were sacrificed. BM cells were flushed from femurs, tibias, and pelvic bones. Percentages of human cells were determined by flow cytometry as described below.
(vi) Flow cytometry. Levels of human cells in the BM of engrafted mice were detected with anti-human CD45 FITC (IQ Products) as previously described (Spiegel et al., 2004). After staining, cells were analyzed by FACSCalibur using CellQuest software (BD Biosciences).
Expression of CXCR4 was detected with anti-CXCR4 PE (BD Biosciences Pharmingen).
(vii) Western Blot Analysis. Untreated G2 cells or G2 cells pre-treated with Bl conditioned medium overnight were stimulated with 200 ng/ml SDF-I for the indicated times, and cell lysates were obtained by 1-hour incubation with lysis buffer (25 raM Tris pH 7.5, 1% Triton, 0.5 mM EDTA, 150 niM NaCl, 10 niM NaF, NaVO3, PMSF, 1% protease inhibitor cocktail [Sigma- Aldrich]). Proteins were resolved by 10% SDS-PAGE. Antibodies used to detect phosphorylated ERK blotted into nitrocellulose include: anti-phosphorylated ERK and anti-ERK from Sigma.
(viii) RT-PCR for PKC-ζ. Total RNA was isolated from Bl cells or G2 cells using TRI Reagent (Molecular Research Center Inc.). RT-PCR was performed as previously described (Petit et al., 2005) using specific primers for PKC-ζ, sense 5' 'TATCTACCGCCGGGGAGCCAGAAGA' (SEQ ID NO: 20), antisense 5' ' TAGCTCCCGCGCCCGATGACTCTGA' (SEQ ID NO: 21); PCR product of 451 bp). β-actin was the RT-PCR control for normalization of the RNA amount.
(ix) Fractionation of the conditioned medium of Bl and separation of the inhibitory migration factor. A Cl 8 column was used in order to separate according to hydrophobicity. HPLC was carried out on a Cl 8 column with a linear gradient of water (with 0.1% trifluoroacetic acid) to acetonitrile (with 0.1% trifiuoroacetic acid). Detection was carried out with a UV spectrophotometer tuned to 220 nm and 254 nm. Gel filtration separation of the Bl conditioned medium or Cl 8 active fractions was carried out using a superdex peptide HR 10/30 column, and samples were eluted with distilled deionized water (DDW).
Low (<3 IcDa) MW fractions of conditioned medium or appropriate control Iscove's Modified Dulbecco's Medium (IMDM) were separated on the columns, and the migration inhibitory capacity of the different fractions were evaluated by transwell assay using G2 cells.
(x) synthesis of the peptides. Pep tides were synthesized by the solid phase method using a multiple peptide synthesizer (AMS 422. Abimed Analyzer Tech). An Fmoc (N-9 Fluorenylmethoxycarbonyl) strategy was employed following commercial protocols of the company as described by Fridkin et al., 2006.
(xi) Preparation of primary T cells. Primary T cell preparation was carried out as described by Zanin-Zhorov et al., 2006. Example 1: A factor present in the conditioned medium of lymphoblastic leukemia precursor-B cells inhibits motility of leukemic and normal hematopoietic cells.
That Bl cells (a line prepared from B cells from a patient with acute lymphoblastic leukemia B cells [B-ALL]) taken from a culture grown at high cell density migrated significantly less towards an SDF-I gradient than Bl cells taken from a culture grown at low cell density was observed (as tested by an in-vitro transwell migration assay) (Fig. 1 A). Thus, it was further explored whether the inhibition of migration was a result of cell density that could lead to inhibitory cell- cell interactions or due to a factor secreted by the cells into the medium. Thus, leukemic Bl cells, B 1-2 cells (a sub-clone derived from the Bl cells), leukemic G2 cells (another precursor-B cell line prepared from a different precursor-B-ALL patient) or normal cord blood (CB) CD34+ cells pre-treated with medium of B 1 cells from a high density cell culture and were assayed for their ability to migrate towards a gradient of SDF-I in the transwell assay. The upper well of the transwell was loaded with 1-2 xlO5 cells and the lower well with Bl conditioned medium from a high-density cell culture or with control IMDM. The results summarized in Fig. 1 show inhibition of SDF-I dependent migration of leukemic B l cells, G2 cells and normal CB CD34+ cells by the conditioned medium of Bl (35% and 25% inhibition of G2 and CD34+ cells, respectively).
Thus, the results obtained show that a cell-migration inhibitory factor is found in the conditioned medium of Bl cells, which were grown to high cell density.
The following experiments were carried out to evaluate whether the cell- migration inhibitory factor acts through inhibition of the signal transduced by SDF- 1.
Since SDF-I stimulation is required for migration of CD34+ human progenitors and activates a signaling pathway that involves ERK phosphorylation (Petit et al., 2005), we incubated G2 cells with conditioned medium of Bl cells (overnight at 37 0C) and monitored SDF-I -induced ERK phosphorylation in these cells compared to SDF-I induced ERK phosphorylation in untreated cells. ERK phosphorylation was evaluated by Western immunoblotting analysis of cell lysates using for detection antibodies specific to phosphorylated ERK. The results obtained are summarized in Fig. 1C and show that incubation of G2 cells with conditioned medium of Bl reduced SDF-I induced ERK phosphorylation signal by ~xl.6 folds.
PKC-ζ is another kinase involved in SDF-I signaling. PKC-ζ expression was found significantly downregulated in B l cells growing at the high concentration conditions (Fig. ID). Such down regulation of PKC-ζ expression was not recorded in another leukemic G2 cell grown at similar high cell concentration but lacking such a cell-migration inhibitory factor.
In all, it is shown that a cell-migration inhibitory factor present in the conditioned medium of Bl inhibits SDF-I signaling.
Example 2: Isolation of the cell-migration inhibitory factor present in the conditioned medium of Bl cells.
In order to determine the size of the cell-migration inhibitory factor, the conditioned medium of Bl containing the factor was filtered through amicon filters with various pore sizes, and the capability to inhibit cell migration was tested in both filtrate and retentate fractions. Inhibition of G2 migration was observed with filtrate fractions of molecular weight <3 IcDa but not with fractions of molecular weight > 3kDa.
The amicon-filtered low MW (OkDa) fraction was separated by gel filtration on a 24 ml superdex peptide HR 10/30 column. 0.5 ml fractions were loaded on the column and eluted using triple distilled water. The migration inhibitory capability of the different fractions was measured in the transwell motility assay with G2 cells (0.5 ml of Iscove's Modified Dulbecco's Medium, IMDM was separated in the column as control). The results summarized in Fig. 2A show that fractions 33-34, corresponding to MW of ~150 Dalton, inhibited migration of G2 cells by 40% (Fig. 2A, B). The low molecular weight cell-migration inhibitory factor was found to be resistant to boiling and low pH conditions (6N HCL).
The cell migration inhibitory factor purified by fractionation of amicon- filtered low MW (<3 IcDa) on a hydrophobic C18 column, followed by fractionation in the superdex gel filtration column, was characterized by mass spectra analysis and was found to have a MW of 165 Dalton as phenylalanine. Mass spec analysis of the inhibitory peak showed that it is enriched in phenylalanine.
Next the elution pattern of phenylalanine in a C 18 column and superdex column was tested, and it found to be similar to the elution pattern of the cell- migration inhibitory factor.
In all, the characteristics of the cell-migration inhibitory factor indicated that it is phenylalanine.
Example 3: The amino acids phenylalanine and cysteine are potent cell- migration inhibitory factors.
Our results obtained in the preceding example indicated that the cell- migration inhibitory factor present in the conditioned medium of Bl is phenylalanine. The following experiment was carried out to test the capability of phenylalanine or other amino acids to inhibit spontaneous and SDF-I mediated motility of G2 cells.
The effect of incubation of G2 cells with various concentrations of each of the following amino acids on SDF-I -mediated or spontaneous motility in the transwell assay was tested: phenylalanine (Phe), glutamic acid (GIu), valine (VaI), proline (Pro), cysteine (Cys) and methionine (Met). The results summarized in Fig. 3A show that the amino acids inhibited migration of the cells, that Phe and Cys were the most potent inhibitors of either spontaneous (Fig. 3 A, upper left) and SDF-I induced (Fig. 3 A, upper right) migration and that their inhibition was dose dependent. The migration inhibitory capability of phenylalanine derivatives, which were more soluble than phenylalanine, was also tested (Fig. 3 A, lower panel). The inhibitory effect of phenylalanine derivatives such as L-phenylalaninol (Phe-ol) and N-succinyl-L- phenylalanine (suc-Phe) (provided by prof. Mati Fridkin, Weizmann Institute) was evaluated on spontaneous or SDF-I dependent cell migration. Phe-ol and Suc-Phe were very potent inhibitors of spontaneous and SDF-I dependent migration. Either L- or D-phenylalanine added to the lower well of the transwell was found to inhibit migration of G2 cells (Fig 3B).
The effect of short peptides including phenylalanine residues, Phe-lys, Lys- Phe, Phe-Arg, Arg-Phe, Lys-Phe-Lys-Phe, Phe-Glu, Glu-Phe, Phe-Leu-Lys, and Phe-Lys-ε-aminocaproic acid on spontaneous G2 cell migration was tested (Fig. 3C). It was found that all the peptides were capable of inhibiting migration of G2 cells. Peptides Phe-lys, Lys-Phe, Phe-Arg, Arg-Phe and Phe-Glu were able to inhibit by about 50% of cell migration and Phe-Leu-Lys and Phe-Lys-ε- aminocaproic acid were able to inhibit by about 30% of cell migration.
In order to explore the molecular mechanism of Phe-ol inhibition, and to check if it is similar to that of the conditioned medium of Bl cells (see Fig. ID), the levels of PKC-ζ mRNA in G2 cells pretreated with medium (IMDM), conditioned medium of Bl cells (Fig. 3E, upper panel), or Phe-ol (Fig. 3E, lower panel) were monitored. The expression of PKC-ζ was found to be downregulated in G2 cells following treatment with Phe-ol or with condition medium of Bl cells. Thus, Bl conditioned medium and Phe-ol inhibit migration through the same signaling pathway that is regulated by PKC-ζ.
The following experiment was carried out in order to check the effect of the phenylalanine derivative Phe-ol on spontaneous and SDF-I dependent migration of normal stem cells and mature T cells (Fig. 3D). For this purpose G2, CD34+ progenitors (left) or primary T cells prepared as previously described (Zanin- Zhorov et al., 2005) (right) cells were loaded in the upper well and Phe-ol was added to the lower well (with or without SDF-I containing medium) and migration to the lower well was measured. Phe-ol was found to be an effective inhibitor of G2, CD34+ (Fig. 3A left panel) and T cell SDF-I mediated or spontaneous migration. Different concentrations of β-phenylethylamine (from Sigma cat no. p-
6513), were added to the lower well of a transwell assay together with medium or medium supplemented with SDF-I. Phenylethylamine was found to inhibit both spontaneous and SDF-I dependent migration of G2 cells loaded into the upper well (Fig. 3F).
Example 4: Phe-ol induces CXCR4 down regulation, reduced adhesion and altered SDF-I signaling in G2 cells.
In the preceding experiments, it has been shown that phenylalanine and its derivatives have an inhibitory effect on SDF-I activity related to cell migration. As mentioned, SDF-I regulates additional activities in cells. The following experiments were carried out to assess whether the inhibitory effect of the phenylalanine derivatives involves other activities of SDF-I. One such activity is regulation of stem cells adhesion (Peled et al., 1999; Peled et al., 2000). Human CB CD34+ cells (1 x 105/well) were labeled with CFSE (Molecular Probes), incubated with Phe-ol (5 and 10 mM), and allowed to adhere to confluent MS-5 cells (known to express SDF-I) for 45 minutes at 37°C (1 x 105 cells/well) plus 0.2% BSA in a 96-well plate. Non-adherent cells were washed twice in FACS buffer. Adherent cells were collected in 150 μl FACS buffer plus 0.5 mM EDTA. The number of CFSE+ cells was determined by FACS analysis (FACSCalibur; BD). The results obtained are summarized on Fig. 4A and show that Phe-ol inhibited adhesion of CD34+ progenitors to stromal cells and that the inhibitory activity of Phe-ol was dose dependent.
Next, the effect of Phe-ol in calcium mobilization induced by SDF-I in G2 cells was explored. Phe-ol was found to inhibit calcium flux in response to SDF-I stimulation (Fig. 4C).
The results obtained herein demonstrate that Phe-ol is capable of inhibiting various activities signaled by SDF-I, such as cell migration, cell adhesion and calcium mobilization. The following experiment was carried out in order to assess whether inhibition of SDF-I related activities by Phe-ol correlates with down regulation of the SDF-I receptor, CXCR4. For this purpose primary T cells, G2 cells or CD34+ cells were pretreated by a 2 hour-incubation with Phe-ol or remain untreated and expression of CXCR4 was monitored and compared in treated and untreated cells. The results summarized in Fig. 4B show that pretreatment with Phe-ol downregulated CXCR4 expression in all the cells tested and that the degree of inhibition was dose dependent (Fig. 4B lower panel).
In all, the results obtained indicate that the amino acid phenylalanine and its derivatives Phe-ol and suc-Phe are capable of inhibiting signaling by SDF-I in different cells, apparently, by down regulating surface CXCR4 expression.
Example 5: Homing of acute lymphoblastic leukemia B cells (Pre-B ALL) to bone marrow, spleen, liver and lung of transplanted NOD-SCID mice is inhibited by Phe-ol.
Pre-B ALL is the most common childhood malignancy and the second most common adult acute leukemia. The leukemic cells have the ability to infiltrate the liver, spleen, lymph nodes, and central nervous system. In patients with childhood ALL high expression of CXCR4 in the leukemic cells is strongly predictive for organ invasiveness, including infiltration to the central nervous system.
In the preceding examples it was shown that the amino acid phenylalanine and its derivatives were capable of inhibiting SDF-I signaling. Since homing of leukemic cell to bone marrow involves SDF-1/CXCR4 interaction, the potential of the phenylalanine derivative Phe-ol to inhibit homing of G2 cells to the bone marrow, spleen, liver and lung of transplanted NOD-SCID mice was tested. For this purpose, G2 cells (107 cells/mouse) preincubated for 1 hour with 5 or 10 mM Phe-ol or with medium (as the control) were injected into the tail vein of eight week old NOD/SCID mice, 16 hours after the injection mice were sacrificed, bone marrow (flushed from femurs, tibias, and pelvic bones), spleen, liver and lung were harvested and assayed for the presence of the human G2 cells (as determined by flow cytometry).
The results obtained are summarized on Fig. 5 and show that pre-treatment of G2 cells with Phe-ol prior to injection inhibited homing of the leukemic G2 cells to the BM5 spleen, liver and lung and that the inhibition was dose dependent.
The results obtained herein show the inhibitory effect of the phenyl derivative Phe-ol on homing of leukemic G2 cells to different organs. Thus, Phe and its derivatives may be aimed at preventing organ invasiveness of leukemic cells.
Example 6: Inhibition of normal and leukemic human cell migration and proliferation by the amino acid cysteine and its derivatives.
Chemokines are classified as CXC or CC members based on their composition of the amino acid Cysteine. Our preliminary results reveal that cysteine can inhibit migration of leukemic human progenitors (see Example 3), normal progenitors and of mature cells (not shown). The effect of L-cysteine and its derivates (all at 10 mM) and glutathione (6) on G2 spontaneous and SDF-I -induced (50 ng/ml) migration was tested by the transwell assay. Culture medium alone or medium containing L-Cysteine, glutathione or each of the following cysteine derivates, L-Cysteine ethyl ester hydrochloride (3), L-Cysteine sulfinic acid (4), Cysteinamine hydrochloride (5) were loaded into the lower transwell chambers. G2 cells (106/ml) were loaded into the upper chambers and allowed to migrate for 4 hrs at 370C to the lower chamber. After this period of time, cells were collected from the lower chambers and counted using a fluorescence-activated cell sorter (FACS Calibur). It was found that cysteine and cysteine derivatives inhibited both, spontaneous and SDF-I induced migration. However, the inhibitory effect of cysteine and its derivatives was more pronounced in spontaneous migration. The mechanism of action is currently not known, but it may be different from that of phenylalanine inhibition, and might involve the charge and the redox potential of cysteine. Example 7: inhibition of T cell migration by cysteine and phenylalanine containing peptides.
Small peptides were synthesized based on the N-terminus sequence of the SDF-I molecule, which has cysteine and phenylalanine residues (amino acids 9-15 of SDF-I), C-P-C-R-F-F-E (SEQ ID NO: 17). The following peptides were synthesized: 1) P-C-R-F-F-E (SEQ ID NO: 9); 2) C-R-F-F-E (SEQ ID NO: 10); 3) C-R-F-F (SEQ ID NO: 11) ; 4) C-R-F (SEQ ID NO: 12); 5) C-R-F (SEQ ID NO: 12), another batch of peptide #4; 6) P-C-R-F (SEQ ID NO: 13); 7) C-A-A-F (SEQ ID NO: 14); 8) C-R-R-F (SEQ ID NO: 15); 12) P-C-R-F-F-E (SEQ ID NO: 17), another batch of peptide #1; 13) P-dCys(Trt)-R-F-F a derivative of P-C-R-F-F (SEQ ID NO: 16).
Peptide 1 P-C-R-F-F-E (SEQ ID NO: 9) is a hexapeptide from the N- terminus sequence of SDF-I containing one cysteine residue at position 2 and two phenylalanines at positions 4 and 5. Peptide 2 C-R-F-F-E (SEQ ID NO: 10) is similar to peptide 1, except for the first residue proline resulting in a pentapetide in which cysteine is at position 1. Peptide 3 C-R-F-F (SEQ ID NO: 11) is similar to peptide 2, except that it lacks the last amino acid glutamic acid resulting in a tetrapeptide in which cysteine is also at position 1 and has two phenylalanine residues. Peptide 4 C-R-F (SEQ ID NO: 12) is similar to peptide 3, except that it lacks the last amino acid phenylalanine resulting in a tetrapeptide in which cysteine is also at position 1 and has only one phenylalanine residue. Peptide 5 C-R-F (SEQ ID NO: 12) is another batch of a peptide similar to peptide 4. Peptide 6 P-C-R-F (SEQ ID NO: 13) is similar to peptide 1, except that it lacks the phenylalanine residue and glutamic acid residue at positions 5 and 6 respectively, resulting in a tetrapetide which has the cysteine at position 2 and has one phenylalanine. Peptide 7 C-A-A-F (SEQ ID NO: 14) is a tertrapeptide like peptide 3 in which the arginine at position 2 and the phenylalanine at position 3 have been substituted by alanine, resulting in a peptide having a cysteine at position 1 and only one phenylalanine at position 4. Peptide 8 C-R-R-F (SEQ ID NO: 15) is a tertrapeptide like peptide 3 in which the phenylalanine at position 3 have been substituted by arginine resulting in a peptide having a cysteine at position 1 and only one phenylalanine at position 4. Peptide 12 P-C-R-F-F-E (SEQ ID NO: 9), another batch of peptide #1. Peptide 13 P-dCys (Trt)-R-F-F (a derivative of P-C-R-F-F in SEQ ID NO: 16) is similar to peptide 1 , except for the cysteine residue which was substituted to dCys (TrT) and the glutamic acid residue is missing. Trt is trity a protecting group for the SH functional moiety of cysteine. The Fmoc-CYS (Trt) was used as a building block peptide chain assembly.
The influence of ImM or 100 μM of these cysteine-phenylalanine-containing peptides on SDF-I and spontaneous induced migration in vitro of human primary T- cells was tested. These peptides at the tested concentrations were found to be not toxic to the cells (not shown). In the migration experiments, the cells (I x 106/mL) were incubated with peptides for 2 hrs at 370C, 95% humidity, then added unwashed into the upper chambers of Costar 24-well transwell plates with 5 μm pore filters (Corning Inc. Corning, NY) and allowed to migrate for 2 hrs at 370C, 95% humidity, 5% CO2 spontaneously or towards SDF-I (20 ng/mL). Migrated cells were collected from the lower chambers and counted using a FACSCalibur flow cytometer (Becton Dickinson, San Jose, California). The cells were gated in forward and side scatters set at linear gain. Data are presented as a percentage of migrated cells that were pretreated with peptides compared to the percentage of migrated untreated cells taken as 100%.
The peptides containing cysteine and phenylalanine at concentration of ImM (Fig. 7A) were found to be very potent inhibitors of T cell migration mediated by SDF-I (in range 50-90% inhibition). The same trend of activity was observed upon testing these peptides at concentration of 100 μM (Fig.7B). These peptides inhibited spontaneous migration of T cells as well, but the inhibition of spontaneous migration by these peptides was less potent than the inhibition of SDF-I mediated migration (not shown). REFERENCES
Aiuti, A., Webb, IJ., Bleul, C3 Springer, T., and Gutierrez-Ramos, J.C. The chemokine SDF-I is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ progenitors to the peripheral blood. J. Exp. Med. 185:111-120 (1997).
Avigdor A, Goichberg P, Shivtiel S, Dar A, Peled A, Samira S5 Kollet O, Hershkoviz R, Alon R, Hardan I, Ben-Hur H, Naor D, Nagler A, Lapidot T. CD44 and hyaluronic acid cooperate with SDF-I in the trafficking of human CD34+ stem/progenitor cells to bone mavrow. Blood. Apr 15; 103(8):2981-9 (2004).
Balkwill F. The significance of cancer cell expression of the chemokine receptor CXCR4. Semin Cancer Biol. 14(3): 171-9 (2004).
Bleul C, Fuhlbrigge RC, Casanovas JM, Aiuti A, Springer TA: A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-I). J Exp Med 184: 1101, (1996).
Fridkin G., Rahimipour S, Ben-Aroya N, Kapitkovsky A, Di-Segni S, Rosenberg M, Kustanovich I5 Koch Y, Gilon C, Fridkin M. Novel cyclic azo- bridged analogs of gonadotropin-releasing hormone. J Pept Sci Feb; 12(2):106-15. (2006). Freedman, M.H. et al. Autocrine and paracrine growth control by granulocyte-monocyte colony-stimulating factor of acute lymphoblastic leukemia cells. Blood. 81 :3068-3075 (1993).
Heveker N, Montes M, Germeroth L, Amara A, Trautmann A, Alizon M, Schneider-Mergener J. Dissociation of the signalling and antiviral properties of SDF-1-derived small peptides. Curr Biol. 8(7):369-76 (1998).
Heveker N, Tissot M, Thuret A, Schneider-Mergener J, Alizon M, Roch M, Marullo S. Pharmacological properties of peptides derived from stromal cell- derived factor 1 : study on human polymorphonuclear cells. MoI Pharmacol. 59(6): 1418-25 (2001). Kanbe K, Takemura T, Takeuchi K, Chen Q, Takagishi K5 Inoue K. Synovectomy reduces stromal-cell-derived factor- 1 (SDF-I) which is involved in the destruction of cartilage in osteoarthritis and rheumatoid arthritis. J Bone Joint Surg Br. 86(2):296-300 (2004). Kollet O, Petit I, Kahn J, Samira S, Dar A, Peled A, Deutsch V, Gunetti M5
Piacibello W5 Nagler A, Lapidot T. Human CD34(+)CXCR4(-) sorted cells harbor intracellular CXCR4, which can be functionally expressed and provide NOD/SCID repopulation. Blood 100(8):2778-86 (2002).
Kollet, O. et al. Rapid and efficient homing of human CD34(+)CD38(- /low)CXCR4(+) stem and progenitor cells to the bone marrow and spleen of NOD/SCID and NOD/SCID/B2m(null) mice. Blood 97:3283-3291 (2001).
Lapidot T, Fajerman Y, Kollet O. Immune-deficient SCID and NOD/SCID mice models as functional assays for studying normal and malignant human hematopoiesis. JMoI Med. 75(9):664-73 (1997). Lee Y, Gotoh A5 Kwon HJ, You M5 Kohli L, Mantel C5 Cooper S5 Hangoc
G, Miyazawa K5 Ohyashiki K5 Broxmeyer HE. Enhancement of intracellular signaling associated with hematopoietic progenitor cell survival in response to SDF- 1/CXCL12 in synergy with other cytokines. Blood. 99(12):4307-17. (2002)
Loetscher P5 Gong JH5 Dewald B, Baggiolini M, Clark-Lewis I. N-terminal peptides of stromal cell-derived factor- 1 with CXC chemokine receptor 4 agonist and antagonist activities.J Biol Chem. 273(35):22279-83 (1998).
Luo Z5 Zhou N5 Luo J5 Hall JW5 Huang Z. The role of positively charged residues in CXCR4 recognition probed with synthetic peptides. Biochem Biophys Res Commun. 263(3):691-5 (1999). PMID: 10512741 [PubMed - indexed for MEDLINE]
Mayani H et al., Biology of human hematopoietic stem and progenitor cells present in circulation. Arch Med Res 34:476-488 (2003).
McGrath, K.E., Koniski, A.D., Maltby, K.M., McGann, J.K., and Palis, J. Embryonic expression and function of the chemokine SDF-I and its receptor, CXCR4. Dev. Biol. 213:442-456 (1999). Murakami and Yamamoto IntJHematol 72:412-7 (2000).
Nagasawa, T. et al. Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature. 382:635- 638 (1996). Nishii K5 Katayama N, Miwa H, Shikami M, Masuya M, Shiku H, Kita K.
Survival of human leukaemic B-cell precursors is supported by stromal cells and cytokines: association with the expression of bcl-2 protein. Br J Haematol. 105(3):701-10 (1999).
Peled A, Kollet O, Ponomaryov T, Petit I, Franitza S, Grabovsky V, Slav MM, Nagler A, Lider O, Alon R, Zipori D, Lapidot T. The chemokine SDF-I activates the integrins LFA-I, VLA-4, and VLA-5 on immature human CD34(+) cells: role in transendothelial/stromal migration and engraftment of NOD/SCID mice. Blood. 95(11):3289-96 (2000).
Peled A, Petit I, Kollet O, Magid M, Ponomaryov T, Byk T, Nagler A5 Ben- Hur H, Many A5 Shultz L, Lider O5 Alon R5 Zipori D, Lapidot T. Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCRA. Science 283(5403):845-8 (a) (1999).
Peled, A. et al. Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4. Science 283, 845-8 (1999). Peled, A. et al. The chemokine SDF-I activates the integrins LFA-I5 VLA-4, and VLA-5 on immature human CD34(+) cells: role in transendothelial/stromal migration and engraftment of NOD/SCID mice. Blood 95, 3289-3296 (2000).
Peled, A. et al. The chemokine SDF-I stimulates integrin-mediated arrest of CD34(+) cells on vascular endothelium under shear flow. J Clin Invest 104, 1199- 211 (1999).
Petit I5 Goichberg P5 Spiegel A5 Peled A5 Brodie C5 Seger R, Nagler A5 Alon R5 Lapidot T. Atypical PKC-zeta regulates SDF-I -mediated migration and development of human CD34+ progenitor cells. J Clin Invest. 115(l): 168-76.(2005)
Petit, I. et al.G-CSF induces stem cell mobilization by decreasing bone marrow SDF-I and upregulating CXCR4. Nat. Immunol. 3:687-694 (2000). Spiegel A, Kollet O5 Peled A5 Abel L, Nagler A5 Bielorai B, Rechavi G5 Vormoor J5 Lapidot T. Unique SDF-I -induced activation of human precursor-B ALL cells as a result of altered CXCR4 expression and signaling. Blood. 2004 Apr 15;103(8):2900-7 (2004). Tavor S, Petit I5 Porozov S, Goichberg P5 Avigdor A5 Sagiv S5 Nagler A5
Naparstek E5 Lapidot T. Motility, proliferation and egress to the circulation of human AML cells in transplanted NOD/SCID mice are elastase dependent. Blood (2005).
Zanin-Zhorov A. et al Heat Shock protein 60 activates cytokine-associated negative regulator suppressor of cytokine signaling 3 in T-cells: effects on signaling, chemotaxis and inflammation. J of Immunology 175:276-285 (2005).
Zanin-Zhorov A, Cahalon L5 TaI G5 Margalit R, Lider O5 Cohen IR. Heat shock protein 60 enhances CD4+CD25+ regulatory T cell function via innate TLR2 signaling. J Clin Invest. JuI (7);2022-32 (2006).

Claims

1. Use of the amino acid phenylalanine or a derivative thereof; the amino acid cysteine or a derivative thereof; a combination of amino acids comprising phenylalanine or a derivative thereof and cysteine or a derivative thereof; a peptide comprising up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof, at least one cysteine or a derivative thereof, or at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
2. The use according to claim 1 of the amino acid phenylalanine or a derivative thereof in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
3. The use according to claim 2, wherein the phenylalanine derivative is a solubility-improved derivative of phenylalanine.
4. The use according to claim 3, wherein the phenylalanine derivative is phenylalaninol (Phe-ol) or succinyl phenylalanine (Suc-Phe).
5. The use according to claim 2, wherein the phenylalanine derivative is β- phenylethylamine.
6. The use according to claim 1 of the amino acid cysteine or a derivative thereof in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
7. The use according to claim 6, wherein the cysteine derivative is a solubility- improved derivative of cysteine.
8. The use according to claim 6, wherein the cysteine derivative is selected from cysteine ethyl ester, cysteine sulfinic acid, and cysteinamine.
9. The use according to claim 1 of a combination of amino acids comprising phenylalanine or a derivative thereof and cysteine or a derivative thereof, in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
10. The use according to claim 1 of a peptide of up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof, in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
1 l . The use according to claim 10, wherein the peptide consists of 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, or 21 amino acid residues comprising at least one phenylalanine .
12. The use according to claim 11, wherein the peptide comprises about 2, 3, 4, 5, or 6 consecutive amino acid residues including the at least one phenylalanine and at least one non-phenylalanine residue that is a charged amino acid.
13. The use according to claim 12, wherein the at least one non-phenylalanine residue is a positively charged amino acid.
14. The use according to claim 13, wherein the positively charged amino acid is lysine or arginine.
15. The use according to any one of claims 10 to 14, wherein the peptide comprises the amino acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or a derivative thereof linked to aminocaproic acid , SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 8.
16. The use according to claim 12, wherein the at least one non-phenylalanine residue is a negatively charged amino acid residue.
17. The use according to claim 16, wherein the negatively charged amino acid residue is glutamic acid.
18. The use according to any one of claims 10 to 12, 16 and 17, wherein the peptide comprises the amino acid sequence of SEQ ID NO: 6 or SEQ ID NO: 7.
19. The use according to claim 1 of a peptide of up to 22 amino acid residues comprising at least one cysteine or a derivative thereof in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
20. The use according to claim 19, wherein the peptide consists of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, or 21 amino acid residues comprising at least one cysteine.
21. The use according to claim 20, wherein the peptide comprises about 2, 3, 4, 5, or 6 consecutive amino acid residues including the at least one cysteine and at least one non-cysteine residue selected from proline, arginine and glutamic acid.
22. The use according to claim 20, wherein the peptide consists of glutathione.
23. The use according to claim 1 of a peptide of up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof, except for a peptide from the amino terminus of SDF-I which comprises the LSY motif (SEQ ID NO: 19) in the manufacture of a medicament for treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility.
24. The use according to claim 23, wherein the peptide consists of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, and 21 amino acid residues comprising at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof.
25. The use according to claim 24, wherein the peptide comprises about 2, 3, 4, 5, 6 or 7 consecutive amino acid residues including the at least one cysteine or a derivative thereof and the at least one phenylalanine residue or a derivative thereof.
26. The use according to claim 25, wherein the peptide comprises about 3, 4, 5, 6 or 7 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one non cysteine or non phenylalanine amino acid residue.
27. The use according to claim 26, wherein the peptide comprises 3 consecutive amino acid residues of SEQ ID NO: 12.
28. The use according to claim 26, wherein the peptide comprises 4 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one non cysteine or non phenylalanine amino acid residue.
29. The use according to claim 28, wherein the sequence of the consecutive amino acid residues consists of SEQ ID NO: 11.
30. The use according to claim 28, wherein the first residue of the consecutive amino acid residues is a proline.
31. The use according to claim 30, wherein the sequence of the consecutive amino acid residues consists of SEQ ID NO: 13.
32. The use according to claim 26, wherein the peptide comprises 5 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one non cysteine or non phenylalanine amino acid residue.
33. The use according to claim 32, wherein the first residue of the consecutive amino acid residues is a proline.
34. The use according to claim 33, wherein the sequence of the consecutive amino acid residues consists of SEQ ID NO: 16, or a derivative of SEQ ID NO: 16 having instead of a Cysteine a dCys (Trt) residue.
35. The use according to claim 32, wherein the fifth residue of the consecutive amino acid residues is a glutamic acid.
36. The use according to claim 35, wherein the sequence of the consecutive amino acid residues consists of SEQ ID NO: 10.
37. The use according to claim 26, wherein the peptide comprises 6 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine or a derivative thereof separated by at least one non cysteine or non phenylalanine amino acid residue.
38. The use according to claim 37, wherein the sixth residue of the consecutive amino acid residues is glutamic acid.
39. The use according to claim 37, wherein the first residue of the consecutive amino acid residues is proline.
40. The use according to claim 38 or 39, wherein the sequence of the consecutive amino acid residues consists of SEQ ID NO: 9.
41. Use of a peptide of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20 or 21 amino acid residues comprising a sequence of SEQ ID NO: 9, SEQ ID
NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 , a derivative of SEQ ID NO: 16 comprising instead of the cysteine a dCys(Trt) residue, or SEQ ID NO: 17 in the manufacture of a medicament for treating a disease, disorder or condition in which CXCR4 activity and/or cell motility is involved in the pathology or course of the disease, disorder or condition.
42. Use of a peptide of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 amino acid residues comprising the amino acid sequence C-X-X -F (SEQ ID NO: 18) wherein X is an arginine or an alanine in the manufacture of a medicament for treating a disease, disorder or condition in which CXCR4 activity and/or cell motility is involved in the pathology or course of the disease, disorder or condition.
43. The use according to claim 42, wherein the amino acid sequence consists of SEQ ID NO: 14 or SEQ ID NO: 15.
44. The use according to any one of claims 10 to 43, wherein the peptide is a fusion peptide and/or salt thereof.
45. The use according to anyone of claims 1 to 44, wherein the disease, disorder or condition is selected from cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS), and an inflammation.
46. The use according to claim 45, wherein the disease is cancer expressing CXCR4.
47. The use according to claim 46, wherein the cancer expressing CXCR4 is selected from leukemia, intraocular lymphoma, non-Hodgkin lymphoma, follicular center lymphoma, multiple myeloma, pancreatic cancer, kidney, prostate, breast, ovary, thyroid, colorectal cancer, oral squamous carcinoma, cervical cancer, neuroblastoma, glioma, astrocytoma, rhabdomyosarcoma, small cell lung cancer and melanoma.
48. The use according to claim 47, wherein the cancer is leukemia.
49. The use according to claim 48, wherein the leukemia is B cell acute lymphoblastic leukemia.
50. The use according to any one of claims 1 to 44, for treating or preventing metastasis.
51. The use according to claim 45, wherein the disease is AIDS.
52. The use according to claim 45, for treating or preventing an inflammatory disease, disorder or condition.
53. The use according to claim 52, wherein the inflammatory disease, disorder or condition is selected from rheumatoid arthritis, septic arthritis, osteoarthritis, periodontitis, gingivitis, asthma, autoimmune disease, psoriasis, psoriatic arthritis, atopic dermatitis; interstitial nephritis, ocular inflammation, liver cirrhosis, neuroinflammatory disorders, graft versus host disease and inflammatory gastric conditions.
54. A peptide of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues comprising the amino acid sequence C-X-X-F (SEQ ID NO: 18) wherein X is an arginine or an alanine.
55. The peptide according to claim 54, comprising the amino acid sequence of SEQ ID NO: 14 or SEQ ID NO: 15,
56. A peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues comprising 3, 4, 5, 6, 7, or 8 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine residue or a derivative thereof separated by at least one alanine.
57. The peptide according to claim 56, wherein the cysteine or derivative thereof and the phenylalanine or derivative thereof are separated by one or two alanine residues.
58. The peptide according to claim 56 or 57, wherein the peptide comprises 4 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine residue or a derivative thereof separated by at least one alanine.
59. The peptide according to claim 58, wherein the first and/or the last amino acid residue of the consecutive amino acid residues is cysteine or a derivative thereof and phenylalanine or a derivative thereof, respectively.
60. A peptide of up to 22 amino acid residues comprising 3, 4, 5, 6, or 7 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by one arginine, except for a peptide from the amino terminus of SDF-I which has a LSY motif (SEQ ID NO: 19).
61. The peptide according to claim 60, wherein the peptide of up to 22 amino acid residues comprises 3 consecutive amino acid residues consisting of SEQ ID NO: 12.
62. The peptide according to claim 60, wherein the peptide of up to 22 amino acid residues comprises 4 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine residue or a derivative thereof separated by one arginine.
63. The peptide according to claim 62, wherein the first and the last amino acid residue of the consecutive amino acid residues is cysteine or a derivative thereof and phenylalanine or a derivative thereof, respectively.
64. The peptide according to claim 63, wherein the sequence of the consecutive amino acid residues consists of SEQ ID NO: 11.
65. The peptide according to claim 62, wherein the first amino acid residue of the consecutive amino acid residues is a proline.
66. The peptide according to claim 65, wherein the sequence of the consecutive amino acid residues consists of SEQ ID NO: 13.
67. The peptide according to claim 60, wherein the peptide of up to 22 amino acid residues comprises 5 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine residue or a derivative thereof separated by one arginine.
68. The peptide according to claim 67, wherein the first amino acid residue of the consecutive amino acid residues is a proline.
69. The peptide according to claim 68, wherein the sequence of the consecutive amino acid residues consists of SEQ ID NO: 16, or a derivative of SEQ ID NO:
16 having instead of a Cysteine a dCys (Trt) residue.
70. The peptide according to claim 67, wherein the fifth residue of the consecutive amino acid residues is a glutamic acid.
71. The peptide according to claim 70, wherein the sequence of the consecutive amino acid residues consists of SEQ ID NO: 10.
72. The peptide according to claim 60, wherein the peptide of up to 22 amino acid residues comprises 6 consecutive amino acid residues comprising one cysteine or a derivative thereof and one phenylalanine residue or a derivative thereof separated by one arginine.
73. The peptide according to claim 72, wherein the sixth residue of the consecutive amino acid residue is glutamic acid.
74. The peptide according to claim 72, wherein the first residue of the consecutive amino acid residues is proline.
75. The peptide according to claim 73 or 74, wherein the sequence of the consecutive amino acids consists of SEQ ID NO: 9.
76, A peptide of up to 22 amino acid residues comprising 4, 5, 6, 7, or 8 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by two arginines.
77. The peptide according to claim 76, wherein the sequence of the consecutive amino acid residues consists of SEQ ID NO: 15.
78. A peptide of 2, 3, 4, 5, 6, 7, 8, 9, 1O5 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, 21 or 22 amino acid residues comprising 2 consecutive amino acid consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 7.
79. A peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acids comprising 3 consecutive amino acid residues consisting of SEQ ID NO: 1 linked to aminocaproic acid or of SEQ ID NO: 8.
80. A peptide of about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 ,19, 20, 21 or 22 amino acids comprising 4 consecutive amino acid residues consisting of SEQ ID NO: 5.
81. A peptide consisting of amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 1 linked to aminocaproic acid , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, P SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, a derivative of SEQ ID NO: 16 comprising instead of the cysteine a dCys(Trt) residue or SEQ ID NO: 17.
82. A peptide of about 3, 4, 5, 6, 7, 8, or 9 amino acid residues comprising the amino acid sequence C-R-F, except for a peptide from the amino terminus of SDF-I including the LSY motif or consisting of 6 to 9 amino acid residues lacking the LSY motif in which the last amino acid residue is serine.
83. A circularly permuted peptide according to any one of claims 54 to 82.
84. A fusion peptide comprising a peptide of any one of claims 54 to 83.
85. The fusion peptide according to claim 84, wherein the peptide is fused to a protein.
86. The fusion peptide according to claim 85, wherein the protein is an immunoglobulin.
87. The fusion peptide according to claim 84, wherein the peptide is fused to a high molecular weight polymer.
88. The fusion peptide according to claim 87, wherein the polymer is polyethylene glycol (PEG).
89. A salt of a peptide according to any one of claim 54 to 88.
90. An isolated DNA encoding a peptide according to any one of claims 54 to 86.
91. An expression vector comprising a DNA according to claim 90.
92. A host cell harboring a DNA according to claim 90.
93. A host cell harboring an expression vector according to claim 91.
94. The host cell according to claim 93, wherein the cell is a eukaryotic cell.
95. The host cell according to claim 94, wherein the eukaryotic cell is a mammalian, insect, or yeast cell.
96. The host cell according to claim 95, wherein the mammalian cell is selected from HeLa, 293 T HEK and CHO cells.
97. The host cell according to claim 93, wherein the cell is a prokaryotic cell
98. A method for producing a peptide according to any one of claims 54 to 86 comprising growing a host cell according to any one of claims 92 to 97 and isolating the protein produced.
99. The use of a peptide according to any one of claims 54 to 88 or a salt thereof in the manufacture of a medicament for treating or preventing a disease, disorder or condition selected from cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS), inflammation and metastasis.
100. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a peptide according to any one of claims 54 to 88 or a salt thereof.
101. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a peptide of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 amino acid residues comprising about 3, 4, 5, 6, or 7 consecutive amino acid residues comprising one cysteine or a derivative thereof one phenylalanine residue or a derivative thereof separated by one arginine, except for a peptide from the amino terminus of SDF-I including the LSY motif.
102. A pharmaceutical composition comprising a DNA according to claim 90 and a pharmaceutically acceptable carrier.
103. A pharmaceutical composition comprising a vector according to claim 91 and a pharmaceutically acceptable carrier.
104. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a mixture of amino acids consisting of phenylalanine or a derivative thereof and cysteine or a derivative thereof.
105. A method of treating or preventing a disease, disorder or condition responsive to inhibition of CXCR4 activity and/or inhibition of cell motility in a subject in need, comprising administering to the subject a therapeutically effective amount of the amino acid phenylalanine or a derivative thereof; the amino acid cysteine or a derivative thereof; a combination of amino acids comprising phenylalanine or a derivative thereof and cysteine or a derivative thereof; a peptide comprising up to 22 amino acid residues comprising at least one phenylalanine or a derivative thereof, at least one cysteine or a derivative thereof, or at least one phenylalanine or a derivative thereof and at least one cysteine or a derivative thereof, except for a peptide from the amino terminus of SDF-I including the LSY motif.
106. A method of treating or preventing a disease, disorder or condition in which the activity of CXCR4 is involved in the pathology or course of the disease, disorder or condition comprising administering to a subject in need a therapeutically effective amount of a peptide comprising a sequence set forth in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, a derivative of SEQ ID NO: 16 comprising instead of the cysteine a dCys(Trt) residue, SEQ ID NO: 17 or a combination thereof.
107. A method of treating or preventing a disease, disorder or condition in which the activity of CXCR4 is involved in the pathology or course of the disease, disorder or condition comprising administering to a subject in need a therapeutically effective amount of a peptide comprising a sequence set forth in SEQ ID NO: 1, SEQ ID NO: 1 linked to aminocaproic acid , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 or a combination thereof.
108. A method of treating or preventing a disease, disorder or condition selected from cancer expressing CXCR4, acquired immunodeficiency syndrome (AIDS), inflammation and metastasis comprising administering to a subject in need a therapeutically effective amount of a peptide according to any one of claims 54 to 88 or a salt thereof.
EP06821674A 2005-12-29 2006-12-27 Inhibition of cxcr4 and/or cell motility by phenylalanine, cysteine or peptides containing said aminoacids Withdrawn EP1971356A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IL172896A IL172896A0 (en) 2005-12-29 2005-12-29 Cxcr4 inhibition
PCT/IL2006/001494 WO2007074456A2 (en) 2005-12-29 2006-12-27 Inhibition of cxcr4 and/or cell motility by phenylalanine, cysteine or peptides containing said aminoacids

Publications (1)

Publication Number Publication Date
EP1971356A2 true EP1971356A2 (en) 2008-09-24

Family

ID=38093072

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06821674A Withdrawn EP1971356A2 (en) 2005-12-29 2006-12-27 Inhibition of cxcr4 and/or cell motility by phenylalanine, cysteine or peptides containing said aminoacids

Country Status (6)

Country Link
EP (1) EP1971356A2 (en)
JP (1) JP2009521917A (en)
AU (1) AU2006329534A1 (en)
CA (1) CA2635770A1 (en)
IL (2) IL172896A0 (en)
WO (1) WO2007074456A2 (en)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010066858A1 (en) * 2008-12-10 2010-06-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the treatment and the prognosis of cancer
US9155780B2 (en) 2009-02-11 2015-10-13 Yeda Research And Development Co. Ltd. Short beta-defensin-derived peptides
CA2779161A1 (en) * 2009-10-28 2011-05-05 University Of Manitoba Yellow pea seed protein-derived peptides
CN104902922B (en) 2012-11-13 2017-12-12 阿道恰公司 Rapid-acting insulin preparations comprising substituted anionic compounds
US9795678B2 (en) 2014-05-14 2017-10-24 Adocia Fast-acting insulin composition comprising a substituted anionic compound and a polyanionic compound
FR3020947B1 (en) 2014-05-14 2018-08-31 Adocia AQUEOUS COMPOSITION COMPRISING AT LEAST ONE PROTEIN AND A SOLUBILIZING AGENT, ITS PREPARATION AND ITS USES
FR3043557B1 (en) 2015-11-16 2019-05-31 Adocia RAPID ACID COMPOSITION OF INSULIN COMPRISING A SUBSTITUTED CITRATE
WO2019185907A1 (en) * 2018-03-29 2019-10-03 Universite Paris Est Creteil Val De Marne Phenylalanine derivatives for use in the treatment of cancers
DE102020201019A1 (en) * 2020-01-29 2021-07-29 Beiersdorf Aktiengesellschaft Allergen protection for the skin
CN111574597B (en) * 2020-05-07 2023-03-31 中国科学院微生物研究所 anti-HIV polypeptide modified by high molecular weight PEG (polyethylene glycol), preparation method and application thereof

Family Cites Families (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH01146817A (en) * 1987-12-02 1989-06-08 Norio Shimura Agent for alleviating acquired immune deficiency syndrome
FR2657259A1 (en) * 1990-01-25 1991-07-26 Adir USE OF N-MYRISTOYL- (S) -PHENYLALANINE FOR THE PRODUCTION OF MEDICAMENTS FOR THE TREATMENT OF DISEASES INVOLVING MYRISTOYLATION
US5977073A (en) * 1991-06-06 1999-11-02 Life Sciences' Technologies, Inc. Nutrient composition for treatment of immune disorders
US20040121952A1 (en) * 1997-05-21 2004-06-24 Children's Medical Center Corporation Treatment of cancer
DE19734161A1 (en) * 1997-08-07 1999-04-01 Jerini Biotools Gmbh Antagonists of stroma cell-derived factor-1, for diagnosis and treatment of human immune deficiency virus (HIV) infection
US6251868B1 (en) * 1998-04-30 2001-06-26 Teijin Limited Method for treating a human immunodeficiency virus infection
US6103748A (en) * 1998-06-19 2000-08-15 Bryan; Thomas B. Method of treating an autoimmune disorder
EP1004302A3 (en) * 1998-10-29 2003-06-04 Ajinomoto Co., Inc. Immunomodulator
ES2218116T3 (en) * 1999-02-18 2004-11-16 F. Hoffmann-La Roche Ag DERIVATIVES OF PHENYLALANINOL.
US20020155468A1 (en) * 1999-09-23 2002-10-24 Corixa Corporation Ovarian tumor antigen and methods of use therefor
EP1286684B1 (en) * 2000-05-09 2004-04-28 The University Of British Columbia use of cxcr4 antagonists for treating autoimmune diseases and cancer
US6337317B1 (en) * 2000-06-27 2002-01-08 The University Of British Columbia Antimicrobial peptides and methods of use thereof
MY129000A (en) * 2000-08-31 2007-03-30 Tanabe Seiyaku Co INHIBITORS OF a4 MEDIATED CELL ADHESION
US20020147206A1 (en) * 2001-04-05 2002-10-10 Pfizer Inc. Combination treatment of multiple sclerosis (MS), other demyelinating conditions and peripheral neuropathy, especially painful neuropathies and diabetic neuropathy
KR20030021857A (en) * 2001-09-08 2003-03-15 주식회사 에코윈 Anticancerigenic Agent Including Copper(Ⅱ) Aminoacidate 1:1 Complex And Method Of Preparing The Same
US7892559B2 (en) * 2002-01-30 2011-02-22 Survac Aps Survivin-derived peptides and use thereof
DE10225144A1 (en) * 2002-05-29 2003-12-18 Immatics Biotechnologies Gmbh Tumor-associated peptides binding to MHC molecules
EP1371660A1 (en) * 2002-06-14 2003-12-17 Consejo Superior De Investigaciones Cientificas Vaccine
US7183258B2 (en) * 2002-06-19 2007-02-27 Lipps Binie V Two synthetic peptides for treatment and prevention of cancers
US7329486B2 (en) * 2003-03-31 2008-02-12 The Board Of Regents Of The University Of Texas System High-throughput assay for virus entry and drug screening
US20040247686A1 (en) * 2003-04-04 2004-12-09 Boehringer Ingelheim International Gmbh Pharmaceutical compositions comprising epinastine for the treatment of skin diseases
EP1589030A1 (en) * 2004-04-14 2005-10-26 Friedrich-Alexander-Universität Erlangen-Nürnberg Bob-1 specific T cells and methods to use
AU2006212922B2 (en) * 2005-02-09 2011-04-21 Helix Biomedix Inc. Antimicrobial hexapeptides
JPWO2007004613A1 (en) * 2005-07-01 2009-01-29 味の素株式会社 Inflammatory bowel disease therapeutic agent and TNF-α production inhibitor

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2007074456A2 *

Also Published As

Publication number Publication date
JP2009521917A (en) 2009-06-11
IL172896A0 (en) 2006-06-11
IL192372A0 (en) 2008-12-29
CA2635770A1 (en) 2007-07-05
AU2006329534A1 (en) 2007-07-05
WO2007074456A3 (en) 2008-05-29
WO2007074456A2 (en) 2007-07-05

Similar Documents

Publication Publication Date Title
EP1779859B1 (en) Use of depsipeptide and congeners thereof as immunosuppressants in preventing or treating rejection following transplantation and for induction of apoptosis of activated CD4 or CD8 T-cells
EP1286684B1 (en) use of cxcr4 antagonists for treating autoimmune diseases and cancer
Hanaoka et al. Development of a 111In-labeled peptide derivative targeting a chemokine receptor, CXCR4, for imaging tumors
US6265535B1 (en) Peptides and peptide analogues designed from binding sites of tumor necrosis factor receptor superfamily and their uses
US8071552B2 (en) Peptides and peptidomimetics binding to CD23
US20110118193A1 (en) Treatment of liquid cancers
EP0478101B1 (en) Therapeutic use of peptides having thrombospondin-like activity
US7119071B2 (en) Amino terminal substance P compositions and methods for using the same
EP3007717B1 (en) Peptides with antagonistic activities against natural cxcr4
EP1971356A2 (en) Inhibition of cxcr4 and/or cell motility by phenylalanine, cysteine or peptides containing said aminoacids
US20130224109A1 (en) Compositions and methods featuring il-6 and il-21 antagonists
US6828302B1 (en) Therapeutic uses of depsipeptides and congeners thereof
Patrussi et al. The CXCL12/CXCR4 axis as a therapeutic target in cancer and HIV-1 infection
Tamamura et al. Development of low molecular weight CXCR4 antagonists by exploratory structural tuning of cyclic tetra-and pentapeptide-scaffolds towards the treatment of HIV infection, cancer metastasis and rheumatoid arthritis
US6906170B1 (en) Anti-inflammatory peptides derived from IL-2 and analogues thereof
JP2012509312A (en) Tumor necrosis factor alpha inhibitory peptide and method of use thereof
CA2063055A1 (en) Peptides having thrombospondin-like activity and their therapeutic use
AU761717B2 (en) Cytomodulating lipophilic peptides for modulating immune system activity and inhibiting inflammation
WO1996009062A1 (en) Polypeptide agonists and antagonists of human interleukin-8
IL140732A (en) Synthetic peptides for diagnosis and treatment of antiphospholipid syndrome
AU2005276117A1 (en) Peptide inhibitors for mediating stress responses
Hershkoviz et al. Treatment of immune cell-mediated liver damage by nonpeptidic mimetics of the extracellular matrix-associated Arg-Gly-Asp epitope
Tsutsumi et al. Inhibitors of the chemokine receptor CXCR4: Chemotherapy of AIDS, metastatic cancer, leukemia and rheumatoid arthritis
CA2640088A1 (en) Compositions and methods for inhibition leukocyte function
Sachpatzidis Identification of two allosteric peptide agonists of CXCR4 using genetic selection in the yeast Saccharomyces cerevisiae

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20080627

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR MK RS

RBV Designated contracting states (corrected)

Designated state(s): CH DE ES FR GB IT LI

17Q First examination report despatched

Effective date: 20100309

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20100701