EP1919953A1

EP1919953A1 - Antibodies directed against a ldl receptor

Info

Publication number: EP1919953A1
Application number: EP06794206A
Authority: EP
Inventors: Christian Behrens; Christine Gaucher; Jean-François Prost; Jamila Najib
Original assignee: LFB SA
Current assignee: LFB Biotechnologies SAS
Priority date: 2005-08-03
Filing date: 2006-07-25
Publication date: 2008-05-14
Also published as: AU2006274751A8; CA2618044A1; FR2889533B1; WO2007014991A1; US20090175789A1; FR2889533A1; JP2009502188A; AU2006274751A1

Abstract

The invention relates to a monoclonal antibody directed against a human LDL (Low Density Lipoprotein) receptor bound to a corresponding peptide of 195-222 (SEQ ID NO: 1) amino acids of the LDL receptor peptide sequence, to the use thereof in the form of a drug and in immune-histochemical analysis of cancerous, healthy or cirrhosis-free or cirrhosis tissues in western blot, ELISA or in an in vivo quantification tests.

Description

Antibodies to the LDL receptor

The present invention relates to a monoclonal antibody directed against the human LDL (Low Density Lipoprotein) receptor, binding to the peptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of the peptide sequence of the human LDL receptor, its use as a medicament, a pharmaceutical composition containing this _antibody, and to its use in immunohistochemical analysis of cancer tissues, healthy or cirrhosis, or in Western blot analyzes, ELISA test or quantifying in vivo.

Cholesterol is a lipid made by the liver, intestine and adrenal glands, but it is also provided by the diet. He is involved in the production of sex hormones, corticosteroids such as natural cortisone and bile components.

Insoluble in the blood, cholesterol is transported by lipoproteins, including LDL (Low Density Lipoprotein).

Cholesterol va ^'and enter the cell through a cell surface protein capable of recognizing the LDL: the LDL receptor (LDL-R). The LDL / LDL complex _. -R is then internalized by endocytosis and LDL will be digested by lysosomes, releasing> e cholesterol that the cell ^Ύ U use.

Cholesterolemia refers to the level of cholesterol in the blood. Hypocholesterolemia is a sign of cholesterol deficiency in the blood, while hypercholesterolemia is a sign of excess cholesterol in the blood.

It has been shown that hypercholesterolemia can as a result of a lack of LDL-LDL-R binding, or a lack of internalization of LDL, which may result from familial structural alteration of LDL-R in these patients (Beisiegel et al. , nineteen eighty one).

In addition, studies have shown that patients with certain cancers have hypocholesterolemia. This hypocholesterolemia is the consequence of overuse of cholesterol by cancer cells. For their survival, they induce an increase in LDL receptor expression level (LDL-R) in the tumor organs (Henricksson et al., 1989). There is thus a correlation between the increase in the level of expression of LDL-R by cells and certain cancers. These include cancer of the prostate, breast, liver, pancreas, ovaries, colon, lung, stomach and leukaemias.

In addition, it is now known that endocytosis of hepatitis C virus is mediated by LDL-R. Thus, the LDL-R may serve as a receiver ^viral.

Thus, it appears that LDL-R is involved in many mechanisms of importance in the cellular life, as well as in many pathologies.

The study of LDL-R therefore remains a major challenge, as much to understand its tissue expression profile in the pathologies in which it intervenes, as for the development and study of new therapeutic tools for the treatment of these pathologies .

It is to meet this need that the Applicant has sought to develop a new tool presenting sensitivity and specificity for LDL-R making it particularly suitable for the study of LDL-R expression, especially in immunohistochemical analyzes of healthy tissues, tumors or cirrhoses, in western blot, in ELISA, or in tests quantification in -vivo or for the manufacture of new therapeutic tools, especially for their implementation in the treatment against cancer.

Detailed description of the invention

Thus, the invention relates to a monoclonal antibody directed against the human LDL (Low Density Lipoprotein) receptor.

A first subject of the invention relates to a monoclonal antibody directed against the human LDL receptor (Low Density Lipoprotein), which binds to the peptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of the peptide sequence. of the human LDL receptor.

The human LDL receptor (LDL-R) is a transmetnbranaire protein of 839 amino acids which comprises three regions: the extracellular region (1-768), the transmembrane region (768-790) ^'and the cytoplasmic region (790- 839). The extracellular region is divided into two subregions: the LDL binding region (1-322) and the subregion outside the LDL binding zone _. / ^(322-768).

The antibody according to the invention has been produced so as to bind specifically to the peptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of the LDL-R peptide sequence. This peptide is located in the LDL binding zone. This peptide was chosen because it has good accessibility to the antibody according to the invention, due to its location in the LDL binding zone, and to its conformation. three-dimensional. In addition, it has the characteristic of being immunogenic, because of its amino acid composition.

Thus, this peptide has been chosen as a target of the antibodies according to the invention in order to produce a good LDL competitor antibody and thus having a good affinity for LDL-R. In addition, this peptide has 85% homology with murine LDL-R which allows the production of antibodies that cross-react in humans and mice, hence the possibility of implementing both (including toxicity) tests in mice and use in man.

Other advantages regarding the choice of this particular peptide will be apparent from the following description.

For purposes of the invention, the peptide to which the antibody binds may be a peptide included in the peptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of LDL-R. More particularly, the term "peptide" means a molecule formed by linking at least 2 amino acids, preferably 5 to ^'35 amino ^acids,' and possibly more than 35 amino acids. "^'

For purposes of the invention, the terms "monoclonal antibody" or "monoclonal antibody composition" refer to a preparation of antibody molecules having identical and unique specificity ¹ ! In addition, the term "antibody" means any whole antibody, as well as any polypeptide, peptide or protein, comprising at least one domain or fragment of immunoglobulin, as well as any antibody derivative. An immunoglobulin molecule is composed of 4 polypeptides: 2 identical heavy (H, Heavy) chains of 50 kDa each and 2 identical light (L, Light) chains of 25 kDa each. The light chain is composed of 2. domains, a variable domain V and a constant domain C, folded independently of each other in space. They are called VL and CL. The heavy chain also comprises a V domain denoted VH and 3 or 4 C domains denoted from CH1 to CH4. Each domain comprises about 110 amino acids and is structurally comparable. The 2 heavy chains are linked by disulfide bridges and each heavy chain is linked to a light chain by a disulfide bridge as well.

The region that determines the specificity of the antibody for the antigen is carried by the variable parts, whereas the constant parts can interact with the Fc receptors of the effector cells or molecules as complement to mediate different functional properties.

Thus, the term "immunoglobulin domain" is understood to mean any of the V L, CL, V H, CH 1, CH 2, CH 3 and CH 4 domains. The antibody according to the invention may advantageously contain one or more of these domains, all the combinations between the aforementioned domains are part of the invention. By "immunoglobulin fragment" is meant one of the fragments selected from the Fab, Fab ', F (ab') 2, Fc, scFv or CDR- (Complemantarity Determining Region) fragment.

The enzymatic digestion of the immunoglobulins by the papain generates 2 identical fragments, which one calls "Fragment Antigen Binding" fragment JF'ab, and a fragment Fc (crystallizable fragment). The Fc fragment is the support of the effector functions of immunoglobulins.

By digestion with pepsin, an F (ab ') 2 fragment is generated, where the two Fab fragments remain linked by two disulfide bridges, and the Fc fragment is split into several peptides. The F (ab ') 2 fragment is formed of two Fab' fragments, linked by disulfide bonds intercatenaries to form an F (ab ') 2.

As for the variable regions of the heavy and light chains, it is found that the sequence variability is not distributed in the same way. Indeed, the variable regions consist on the one hand of very little variable regions called "framework" or "framework" (FR) 4 in number (FR 1 to FR4) and on the other hand of regions in which the variability is extreme: these are the "hypervariable" regions, or CDRs, 3 in number (CDR1 to CDR3).

A scFv (Single Chain Fragment Variable) is a fragment consisting only of the variable domains VH ^' and VL of a monoclonal antibody, and whose structure is stabilized by a short flexible peptide arm placed between the two domains (Billiald et al., 1995). Such fragments can be produced by bacteria. These molecules retain the ability to specifically recognize an antigen. Small in size (29 kDa), they are poorly immunogenic and better tolerated than whole antibodies.

Thus, the antibody according to the invention can ^{"advantageously} contain ^a" or ^"""" many ^"of ^'these fragments, all combinations -between the fragments mentioned above are part of the invention. In a particular aspect of the According to the invention, the antibody according to the invention contains at least one immunoglobulin domain and at least one immunoglobulin fragment, for example an Fc fragment and one or more variable or hypervariable regions. "antibody" means any antibody, which antibody may comprise one or more mutations, substitutions, deletions and / or additions of one or more amino acid residues. The antibody according to the invention, which has the particularity of binding to the peptide corresponding to amino acids 195-222 (SEQ ID NO: 1), as well as the characteristics presented below, advantageously allows the recruitment of effector cells. . In this respect, an "effector cell" is a cell that causes the destruction of the cells to which the antibody is bound.

("Target cells"). More particularly, the effector cells express on their surface a receptor for the Fc fragment of the antibodies. In addition, "recruitment" is understood to mean the ability of the antibody according to the invention to bind cells capable of causing the destruction of the target cells. The destruction can be lysed, that is to say a destruction of the target cells with release of their contents. The peptide on which the antibody according to the invention ("target peptide") binds is located in the LDL binding region (natural ligand of LDL-R), so that the antibody according to the invention The invention is a good competitor of LDL, and thus has an affinity for LDL-R comparable to that of the natural LDL-R ligand.

Through this connection, the antibody according to the invention allows the recruitment ^• ^• de- cells "" capable ^"" cause the destruction of cells in which the polypeptide of the invention is related, that is to say cells expressing on their surface the LDL-R

("Target cells").

By "binding" is meant the attachment of the polypeptide to the target peptide, as well as the attachment of cells capable of causing the destruction of the target cells.

The effector cells may be NK cells

(Natural Killer). They can also be macrophages, neutrophils, the T4 lymphocyte, the T8 lymphocyte or the eosinophil. These cells possess on their surface receptors of the Fc fragment of the polypeptides according to the invention. These antibodies or polypeptides bind to the target cell by their variable fragment and bind to the effector cells by their constant fragment. This antibody-dependent relationship between the target cells and the effector cells causes lysis of the target cells by a mechanism of the ADCC (Antibody Dependent Cellular Cytotoxicity) type.

Advantageously, the target cells according to the invention are tumor cells.

Advantageously, the antibody according to the invention allows the destruction of cancer cells.

("Target cells"). Indeed, the recruitment of the effector cells causes destruction of the cells on which the antibody according to the invention is linked. However, studies have shown a correlation between the increase in the level of expression of LDL-R by cells and certain cancers. Indeed, it turns out that patients with certain cancers have hypocholesterolemia. - This hypocholesterolemia is the consequence of overuse of cholesterol by cancer cells. For survival, the latter induce an increase- du- level - d ^* expression ^'' dU ^{~ LDL} receptor (LDL-R) in tumor bodies

(Henricksson et al., 1989). Especially exemplary prostate, breast, liver, pancreas, ovarian, colon, lung ,, - ^'' stomach and leukemia.

Thus cancer cells overexpressing LDL-R will therefore be preferred targets of the antibody according to the invention.

The subject of the invention is therefore a monoclonal antibody directed against the human LDL receptor (Low Density Lipoprotein), binding to the peptide corresponding to the amino acids 195-222 (SEQ ID NO: 1) of the peptide sequence of the human LDL receptor.

Advantageously, at least one CDR region (Complementarity Determining Region) of each of the light chains of the antibody according to the invention has a peptide sequence having at least 70% identity with a sequence chosen from the sequences SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, and at least one CDR region of each of the heavy chains of the antibody according to The invention has a peptide sequence having at least 70% identity with a sequence selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23.

The CDR regions concerned are the CDR CDR1 and / or CDR2 and / or CDR3 regions.

The sequences SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 are defined according to Kabat [Kabat et al., "Sequences of Proteins of Immunological Interest, "NIH Publication, 91-3242 (1991)].

The sequences SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO T 22 and SEQ ID ^~ No ^" : 23 are defined according to the IMGT analysis (International ImMunoGeneTics database [Lefranc, M.P. et al., Dev Comp., Immunol., 27, 55-77 (2003)] This definition, different from that of Kabat based on the analysis of sequence variability alone, takes into account and combines the characterization of hypervariable loops [Chothia C. and Lesk AMJ Mol Biol 196: 901-17 (1987)] and structural analysis of antibodies by crystallography.

Particularly advantageously, the identity with each of the sequences mentioned above is at least 70%, preferably at least 80%, 90%, 95%, 99% and even more preferentially 100% identity. The percent identity is calculated by aligning the 2 sequences to be compared and counting the number of positions having an identical amino acid, which number is divided by the total number of amino acids in the sequence. In any case, these sequence differences do not affect the affinity of the monoclonal antibody for its target, nor its ability to recruit effector immune cells.

Particularly advantageously, each CDR region of each of the light chains of the antibody according to the invention has a peptide sequence having at least 70% identity with the sequences SEQ ID NO: 2 or SEQ ID NO: 18, SEQ ID NO: 3 or SEQ ID NO: 19, SEQ ID NO: 4 or SEQ ID NO: 20 respectively, and each CDR region of each of the heavy chains of the antibody according to the invention has a peptide sequence having at least 70% d identity with the sequences SEQ ID NO: 5 or SEQ ID NO: 21, SEQ ID NO: 6 or SEQ ID NO: 22, SEQ ID NO: 7 or SEQ ID NO: 23 respectively. Thus, the CDR1 region of each of the light chains of the antibody according to the invention has a peptide sequence having at least 70% identity with the sequence SEQ ID NO: 2 or with the sequence SEQ ID NO: 18, the region CDR2 of each of the light chains of the antibody according to the invention has / a peptide sequence having at least 70% identity with the sequence SEQ ID NO: 3 or with the sequence SEQ ID NO: 19, the CDR3 region of each light chains of the antibody according to the invention has a peptide sequence having at least 70% identity with the sequence SEQ ID NO: 4 or with the sequence SEQ ID NO: 20, and the CDR1 region of each of the heavy chains of the antibody according to the invention has a sequence peptide having at least 70% identity with the sequence SEQ ID NO: 5 or with the sequence SEQ ID NO:

21, the CDR2 region of each of the heavy chains of the antibody of the invention has a peptide sequence having at least 70% identity with ^"SEQ ID NO. 6 or SEQ ID NO:

22, the CDR3 region of each of the heavy chains of the antibody according to the invention has a peptide sequence having at least 70% identity with the sequence SEQ ID NO: 7 or with the sequence SEQ ID NO-: 23.De Particularly advantageously, the identity with each of the sequences mentioned above is at least 70%, preferably at least 80%, -90%, 95%, 99% and even more preferably 100% identity.

Advantageously, the variable region of each of the light chains of the antibody according to the invention is encoded by a nucleic acid sequence having at least 70% identity with the nucleic acid sequence SEQ ID NO: 8, and in the variable region of each heavy chain of the antibody of the invention is encoded by a nucleic acid sequence having at least 70% ^"identity ^with" nucleic acid sequence SEQ ID NO ^•: - 9.- - - ^• "

Particularly advantageously, the identity with each of the sequences mentioned above is at least 70%, and preferably at least 80%, and even more preferably 95% or 99% identity. . The percentage identity is calculated by aligning two sequences to be compared and by counting the number of positions with identical nucleotide, this number being divided by the number of nucleotides ^total sequence. The degeneracy of the genetic code may be at the origin of the fact that the same amino acid can be encoded by several triplets of different nucleotides. In any case, these Sequence differences do not affect the affinity of the monoclonal antibody for its target, nor its ability to recruit effector immune cells.

Preferably, the variable region of each of the light chains of the antibody according to the invention is encoded by the nucleic acid sequence SEQ ID NO: 8, and the variable region of each of its heavy chains is coded by the sequence of nucleic acid SEQ ID NO: 9.

Advantageously, the variable region of each of the light chains of the antibody according to the invention ^• has at least 70% identity with the amino acid sequence SEQ ID NO: 10 and of each of its heavy chain variable region has at least 70% identity with the ⁷ amino acid sequence SEQ ID NO: 11. in a particularly advantageous manner, identity to each of the sequences mentioned above is at least 70%, and most preferably of at least 80%, and even more preferably 95% or 99% identity. The percentage identity is calculated by aligning two sequences to be compared and by counting the number of ^"'positions with identical amino acid, that number - being' divided by the total number of amino acids in the sequence.

Preferably, the variable region of each of the light chains of the antibody according to the invention has the peptide sequence SEQ ID NO: 10 and the variable region of each of the heavy chains of the antibody according to the invention has the peptide sequence SEQ ID NO: 11. The peptide sequence SEQ ID NO: 10 'is the peptide sequence deduced from the nucleotide sequence SEQ ID NO: 8 and the peptide sequence SEQ ID NO: 11 is the sequence deduced from the nucleotide sequence SEQ ID NO: 9 . The antibody according to the invention also includes any modified antibody corresponding to the characteristics of the invention, in which one or more amino acids have been added, substituted or deleted. Such an addition, substitution or deletion may be located at any position in the molecule. In the case where several amino acids have been added, substituted or deleted, any combination of addition, substitution or deletion may be considered. Such alterations of the sequence of the variable regions of the antibody "according to the invention can be performed in order. To increase the number of residues likely to come in ^• contact with the target peptide.

Advantageously, an antibody according to the invention may be, that is to say, consist of an F (ab ') 2 fragment, an Fab' fragment, a Fab fragment, a CDR region or any version modified from any of these fragments or region.

Advantageously, the antibody according to the invention is a murine antibody. Advantageously, this murine monoclonal antibody is an IgGlkappa. An antibody-like antibody can be produced by immunizing an animal, in particular a mouse, with the peptide corresponding to amino acids 195-222 ( SEQ ID NO: 1), or with any other human LDL-R peptide located in the LDL binding region. Antibody production methods are known to those skilled in the art. According to a particular mode of production of monoclonal antibodies directed against the peptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of LDL-R, the peptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of the LDL-R sequence can be injected intraperitoneally to Balb / C mice in the presence of Freund's adjuvant. Several immunization boosters are performed in the presence of incomplete Freund's adjuvant. The monitoring of the immune response of the mice is carried out on blood samples by ELISA against SEQ ID NO: 1 peptide. Hybridomas are obtained from the fusion of splenic cells of mice immunized with mouse myeloma cells in the presence of PEG (polyethylene glycol). The cells are then cultured and then tested in ELISA for their response against peptide SEQ ID NO: 1.

Advantageously, the antibody according to the invention is a chimeric, humanized or human antibody. Preferably, ^'the antibody of the invention is chimeric.

By "chimeric antibody" is meant an antibody whose variable regions of the light and heavy chains belong to a different species from the constant regions of the light and heavy chains. Thus, the antibody according to the invention also has murine variable regions and constant regions belonging to a non-murine species. In this respect, all the families and species of mammals ^• non-murine - are " ^• " susceptible - to be used, and in particular the man, the monkey, the murids (except the mouse), the suids, the bovines , equidae, felids, canids, for example, as well as birds. More preferably, the constant regions of each of the light chains and of each of the heavy chains of the antibody according to the invention are human constants. This preferred embodiment of the invention makes it possible to reduce the immunogenicity of the antibody in humans and thereby improve its efficacy during its therapeutic administration in humans. In a preferred embodiment of the invention, the constant region of each of the light chains of the antibody according to the invention is of type K. Any allotype is suitable for carrying out the invention, for example Km (I), Km (I, 2), Km (I, 2 , 3) or Km (3). In another embodiment of the invention, the constant region of each of the light chains of the antibody according to the invention is of type λ. In a particular aspect of the invention, and especially when the constant regions of each of the light chains and of each of the heavy chains of the antibody according to the invention are human regions, the constant region of each of the heavy chains of the According to this variant, the constant region of each of the heavy chains of the antibody may be of the γ1 type, of the γ2 type, of the γ3 type, these three types of constant regions having the particularity of fixing the complement. human, or type γ4. Antibodies possessing a constant region of each of the γ heavy chains belong to the class of IgGs. Immunoglobulin type G (IgG) are heterodimers consisting of 2 heavy chains and 2 light chains, linked together by disulfide bridges. Each chain is constituted, in the N-te-e-rminal, region or ^• doma-ine going Riab-le- - (- codée- by rearranged VJ genes for the light chain and VDJ for the heavy chain ) specific for the antigen against which the antibody is directed, and in the C-terminal position, of a constant region consisting of a single CL domain for the light chain or of 3 domains (CH1, CH2 and CH3) for the heavy chain. The combination of the variable domains and the CH ₁ and CL domains of the heavy and light chains forms the Fab portions, which are connected to the Fc region by a very flexible hinge region allowing each Fab to bind to its antigenic target while the Fc region, mediator of the effector properties of the antibody remains accessible to effector molecules such as FcDR receptors and CIq. The Fc region, consisting of the 2 globular domains CD ₂ and CD _3, is glycosylated at the level of the CD ₂ domain with the presence, on each of the 2 chains, of a biantennary JV-glycan linked to Asn 297.

Preferably, the antibody constant region of the heavy chains of the antibody is of type γ1, since such an antibody shows an ability to generate ADCC activity (Antibody-Dependent Cellular

Cytotoxicity) in the largest number of individuals

(humans). In this respect, any allotype is suitable for carrying out the invention, for example Glm (3), GIm

(1, 2, 17), GIm (I, 17) or GIm (I, 3).

The chimeric antibodies according to the invention can be constructed using standard techniques of recombinant DNA, which are well known to those skilled in the art, and more particularly by using the chimeric antibody construction techniques described for example in Morrison et al. , Proc. Natl. Acad. Sci. USA, 81: 6851-55 (1984), where recombinant DNA technology is used to replace the constant region of a heavy chain and / or the constant region of an antibody-derived light chain. a non-human mammal with the corresponding regions of a human immunoglobulin. Such antibodies and their method of preparation have also been described in EP Patent Publication No. 173,494, Neuberger, MS et al., Nature 312 (5995): 604-8 (1985), and in US Pat. EP 125,023 for example. Methods for generating chimeric antibodies are widely available to those skilled in the art. For example, the heavy and light chains of the antibody may be expressed separately using a vector for each chain, or may be integrated into a single vector. An expression vector is a nucleic acid molecule in which the urine nucleic acid sequence encoding the variable domain of each of the heavy or light chains of the antibody and the nucleic acid sequence, preferably human, encoding for the constant region of each of the heavy or light chains of the antibody were inserted, in order to introduce and maintain them in a host cell. It allows the expression of these foreign nucleic acid fragments in the host cell because it possesses essential sequences (promoter, polyadenylation sequence> selection gene) to this expression. The vector -can for example be a plasmid, an adenovirus, a retrovirus or ¹ a bacteriophage, and the host cell can ^'be any mammalian cell, e.g., SP2 / 0, YB2 / 0, IR983F, Namalwa human myeloma, PERC6 the CHO lines, in particular CHO-KI, CHO-LeclO, CHO-Lecl, CHO-Lecl3, CHO Pro-5, CHO dhfr-, WiI-2, Jurkat, Vero, Molt-4, COS-7, 293-HEK , BHK, K6H6, NSO, SP2 / θ-Ag14 and P3X63Ag8.653.

For the construction of expression vectors for chimeric antibodies according to the invention, synthetic signal sequences and ^appropriate restriction sites can be ^"" "fused" to ^'regions, variables in the amplification reactions using PCR. The variable regions are then combined with the constant regions of an antibody, preferably a human IgG1. The _. The genes thus constructed are cloned under the control of a promoter (eg the RSV promoter) and upstream of a polyadenylation site, using two separate vectors (one for each chain). The vectors are also provided with selection genes known to those skilled in the art, such as, for example, the dhfr gene or the neomycin resistance gene. The chimeric antibodies according to the invention can to be produced by co-transfection into a host cell of the light chain expression vector and the heavy chain expression vector using a method well known to those skilled in the art (e.g. calcium phosphate, electroporation, microinjection, etc.). At the end of the transfection, the cells can be put in a selective medium, for example in RPMI medium (Invitrogen, ref 21875-034) containing 5% dialysis serum (Invitrogen, ref 10603-017), 500 μg / ml G418 (Invitrogen, ref 10131-027) and 2.5 nM methotrexate (Sigma, M8407). The supernatants of the resistant transfection wells are screened for the presence of chimeric immunoglobulin (Ig) by ELISA assay specific for human Ig sequences. The transfectants producing the most antibodies are amplified and their supernatants redosed by ELISA in order to estimate their productivity and to select the 3 best producers for limiting dilution cloning (40 cells / plate).

For humanized antibody is meant an antibody which contains CDR regions derived from an antibody of non-human origin, the other parts of the - derived antibody molecule étant- a ^'' (or ^* for "more Such antibodies can be prepared according to CDR grafting methods well known to those skilled in the art US Patent Nos. 5,225,539, US 6,180,370

; Jones et al., Nature 321 (6069): 522-5. (1986); Verhoeyen et al., Bioessays 8 (2): 74-8 (1988); Riechmann et al., Nature 332: 323-7 (1988); Queen C. et al., Proc Natl Acad Sci U S A 86 (24): 10029-33

(1989); Lewis AP and Crowe JS, Gene 101 (2): 297-302 (1991); Daugherty BL et al., Nucleic Acids Res 19 (9): 2471-6 (1991); Carter et al., Proc. Natl. Acad, Sci. USA, 89: 4285 (1992); Singer et al., J Immunol 150 (7): 2844-57 (1993); Presta et al., J. Immunol. , 151: 2623 (1993)]. The choice of human variable domains to graft for the production of humanized antibodies is important in order to reduce the immunogenicity of the antibody ..., without altering its affinity for its target. In a method for producing a humanized antibody, the variable domain sequence of a murine antibody is compared to a library of known human variable region sequences and the human variable sequence closest to the murine sequence is retained as a FR region. of the humanized antibody [Riechmann et al. , Nature 332: 323-7 (1988); Queen C. et al., Proc Natl. Acad Sci USA 86 (24): 10029-33 (1989); Sims et al., J. Immunol.,

151: 2296 (1993)]. Another method for selecting human FR regions is the comparison of the sequence of each subregion of the murine FR sequence (FR1, FR2, FR3 and FR4) with a library of known human FR sequences, in order to choose, for each region FR, the human FR sequence closest to the murine sequence [US Patent Publication 2003/0040606; Singer et al., J Immunol 150 (7): 2844-57 (1993); Sato K. et al Mol Immunol 31 (5): 371-81 (1994); Leung SO et al., Mol Immunol _. 32 (17-18): 1413-27 - (1995) ^" ]. Another method uses a particular FR region derived from a consensus sequence of all human antibodies of a particular subgroup. of heavy or light chain [Sato K. et al Mol Immunol 31 (5): 371-81 (1994)] CDR grafting is in most cases completed by the mutation of certain key residues located in the FR in order to maintain a good affinity of the humanized antibody for its target [Holmes MA and Foote J, Immunol 158 (5): 2192- "201 (1997)].

The humanized antibodies according to the invention are preferred for use in in vitro diagnostic methods, or prophylactic treatment and / or therapeutic in vivo.

The antibody according to the invention thus chimerised or humanized has the advantage of being better tolerated by the human organism, and at least as effective as the murine antibody. Particularly advantageously, the antibody thus chimerized or humanized is 2 times more cytotoxic than the corresponding murine antibody. Even more advantageously, the antibody thus chimerized or humanized is 10 times, or else 100 times, or more preferably more than 100 times more cytotoxic than the corresponding murine antibody. - •

The term "human antibody" is intended to mean an antibody for which each region is derived from a human antibody. These antibodies can be derived from transgenic mice bearing human antibody genes, or from human cells [Jakobovits et al., Curr Opin Biotechnol. Oct ; 6 (5): 561-6 (1995) ^' ; Lonberg N. and D. Huszar. Internai Review of Immunology 13: 65-93 (1995); Tomizuka K. et al., Proc. Natl. Acad, Sci. USA 97 (2): 722-727 (2000)].

Advantageously, ^'the antibody according to the invention is coupled to a toxin is toxine- --Ira- ", ^e.g.," diphtheria toxin or ricin. The binding between the antibody according to the invention and the toxin is sufficiently strong to prevent the systemic release of the toxin and also sufficiently labile, so that the toxin is released into the target cells.

In another aspect of the invention, the antibody is coupled to a radioisotope. The presence of the radioisotope greatly increases the cytotoxicity. Two isotopes are mainly used: iodine-131 (beta and gamma emitter), whose half-life is relatively long (8 days) and has an effect tumoricide about 1 mm around the tumor cell having fixed the antibody according to the invention. Iodine 131 has the advantage of making it possible to perform imaging, but requires compliance with radiation protection measures. Yttrium 90 (beta emitter), half-life of which is shorter (2.5 days), has tumoricidal effects over a distance of 5 mm.

Advantageously, the antibody according to the invention allows the recruitment of effector immune cells. Indeed, the antibody according to the invention is a good competitor of LDL: it has an affinity for LDL-R comparable to that of the natural ligand of LDL-R.

Such an antibody, by its good specificity and good sensitivity, is a tool that can be used to mediate reactions of ADCC (Antibody Dependent Cellular Cytotoxicity). Indeed, the antibody according to the invention can be modified so as to induce ADCC, for example by being chimerised or humanized. The antibody according to the invention allows the recruitment of effector immune cells. For purposes of the invention, the term ^"" immune cell-rice effect "a cell that -provoque -Ira --- destruetron ^¬ .cellules to which the antibody of the invention is related (" target cells "). More particularly, the effector cells express on their surface a receptor of the Fc region of the antibodies, for example the effector cells are NK (Natural Killer) cells, and they may also be macrophages, neutrophils or T4 lymphocytes. The T8 lymphocyte or the eosinophil, these cells possess on their surface receptors of the Fc region antibodies according to the invention.

In addition, "recruitment" is understood to mean the faculty possessed by the polypeptide according to the invention to cells capable of. cause the destruction of the target cells. Destruction may be lysis, that is, destruction of the target cells with release of their contents.

Advantageously, the antibody according to the invention allows the destruction of cancer cells. Indeed, the recruitment of the effector cells by the antibody according to the invention causes destruction of the cells to which the antibody is bound.

(target cell) . Cancer cells overexpressing LDL-R will therefore be preferred targets of the antibody according to the invention. Thus, the lysed cells will be near-specific cancer cells, healthy cells not overexpressing or little LDL-R and thus being preserved.

In one embodiment, the antibody is produced in mouse SP2 / O-AG14 (ATCC CRL-1581).

A preferred antibody according to the invention is the 12G4 antibody produced by the H12G4 hybridoma (deposited under the number 1-3487 at the CNCM). The variable region of each of the light chains of the monoclonal antibody produced by the hybridoma H12G4 is encoded by the nucleic acid sequence SEQ ID NO: 8, and the variable region of each of the heavy chains of the monoclonal antibody produced by the hybridoma H12G4 is encoded by the nucleic acid sequence SEQ ID NO: S.

A particular object of the invention relates to a monoclonal antibody binding to LDL-R and allowing the recruitment of effector cells. This antibody is 12G4, or any chimeric, humanized or human antibody possessing the variable parts of the antibody 12G4.

Another object of the invention relates to a stable cell line producing an antibody according to the invention as described ^'above.

Advantageously, the stable cell line according to the invention is chosen from the group consisting of: SP2 / 0, YB2 / 0 (cell YB2 / 3HL.P2.GI1.16Ag.20, deposited at the American Type Culture Collection under ATCC number CRL-1662), SP2 / 0-AG14 (ATCC CRL-1581), IR983F, Namalwa human myeloma, PERC6, CHO / CHO-KI lines, CHO-LeclO, CHO-Lecl, CHO-Lecl3 , CHO Pro-5, CHO dήfr-, Wil-2, Jurkat, Vero, Molt-4, COS-7, 293-HEK, BHK, K6H6, NSO, SP2 / O-Ag14 and P3X63Ag8.653.

Another subject of the invention relates to the hybridoma H12G4 deposited under registration number CNCM 1-3487 at the National Collection of Cultures of Microorganisms (CNCM, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15). . - ^'

Another subject of the invention relates to a DNA fragment of sequence SEQ ID NO: 9 coding for the variable region of the heavy chain of an antibody according to the invention. This DNA fragment may be used for the preparation of a peptide-binding polypeptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of the peptide sequence of the human LDL receptor, which polypeptide may be an antibody.

Another ^object of the invention relates to a sequence of DNA fragment SEQ ID NO: 8 encoding the variable region of the light chain of an antibody according to the invention. Similarly, this DNA fragment can be used for the preparation of a peptide-binding polypeptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of the peptide sequence of the human LDL receptor, which polypeptide can be an antibody.

Another subject of the invention relates to an expression vector comprising at least one DNA fragment chosen from the fragments of sequence SEQ ID NO: 9 or SEQ ID NO: 8.

Another subject of the invention is the peptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of the peptide sequence of the human LDL receptor.

Another object of the invention is the use of an antibody according to the invention for activating FcγRIII receptors of immune effector cells in vitro or in vivo. Indeed, the antibodies of the invention can be used for their ability to activate the FcγRIIIA receptor by their Fc region. This is of considerable interest because this receptor is expressed on the surface of cells called "effector cells": the binding of the Fc region of the antibody to its receptor carried by the effector cell causes the activation of FcγRIIIA. and the destruction of the target cells. The effector cells are, for example, NK (Natural Killer) cells, macrophages, neutrophils, CD8 lymphocytes, Tγδ lymphocytes, NKT cells, eosinophils, basophils or mast cells.

Another particular object of the invention is an antibody as previously described for use as a medicament. In a particular aspect of the invention, the antibody used binds to the human LDL receptor, and allows the recruitment of effector cells. Advantageously, this cytotoxic antibody can bind to all or part of the extracellular region of the LDL receptor, that is to say that it is capable of binding to the LDL binding region (corresponding to amino acids 1 to 322) or to the region outside the LDL binding zone (corresponding to amino acids 322-768 of LDL-R). In this regard, the antibody according to the invention, which binds to the peptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of the peptide sequence of the LDL receptor, is a particular embodiment of this object. - the invention.

More particularly, an object of the invention is the use of an antibody as described above for the manufacture of a medicament. Advantageously, this cytotoxic antibody can bind to all or part of the extracellular region of the human LDL receptor, that is to say that it is capable of binding to the LDL binding region.

(corresponding to amino acids 1 to 322) or to the region outside the LDL-binding zone

(corresponding to amino acids 322-768 of LDL-R). In this regard, the antibody according to the invention, which binds to the peptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of the peptide sequence of the human LDL receptor, is a particular embodiment of this object. of the invention.

Another subject of the invention is the use of an antibody as described above, that is to say having the capacity to bind to all or part of the extracellular region of the LDL receptor and advantageously to the corresponding peptide. with acids Amines 195-222 (SEQ ID NO: 1), for the manufacture of a medicament for the treatment of cancer. Indeed, the antibody according to the invention targets LDL-R specifically. In this respect, the antibody according to the invention, by binding to this receptor, will generate a lysis reaction of the target cancer cells, in particular by ADCC against the target cancer cells and allow the lysis of the latter. Thus, the lysed cells will be in a quasi-specific manner cancer cells, healthy cells not over-expressing little or no LDL-R and thus being preserved.

Advantageously, the cancers treated with the antibody according to the invention are cancers for which the LDL receptor is overexpressed on the surface of the cancer cells, and this relative to the corresponding healthy cells.

Particularly advantageously, the treated cancer is cancer of the prostate, breast, liver, pancreas, stomach, ovaries, colon, lung or leukemias, for which there is an increase in density receptors ^"LDL to ^'the surface membraπaire -des cancer ^cells.' the target cancer cells, may be lysed by the effector cells recruited during the reaction ADCC, healthy cells are preserved as they overexpress not the LDL-R.

Particularly advantageously, the antibody according to the invention is used for the preparation of a medicament for the treatment of cancers, including acute myeloid leukemia, acute monocytic leukemias, myelomonocytic leukemias, chronic myeloid leukemia in blast crisis, lymphoid leukemias, chronic lymphoid leukemias, solid tumors such as cervical squamous cell carcinoma, endometrial adenocarcinoma, gastric carcinoma, hepatocellular carcinoma, choriocarcinoma, brain tumors.

Another subject of the invention relates to a pharmaceutical composition comprising an antibody according to the invention as described above and a pharmaceutically acceptable excipient and / or vehicle. This pharmaceutical composition is intended to target cancer cells, including those overexpressing LDL-R. As these cancer cells express on their surface a quantity of LDL receptors greater than the quantity of receptors expressed by the healthy cells, the drug thus prepared will be preferentially bound by the cancer cells.

The excipient may be any solution, such as saline, physiological, isotonic, buffered, etc., as well as any suspension, gel, powder, etc., compatible with a pharmaceutical use and known to those skilled in the art. The compositions according to the invention may additionally contain one or more agents or vehicles selected from among dispersants, solubilisers, ^{^{'stabilizers',}} ^"" ^{surfactaïït'} s, preservatives, etc. On the other hand, the compositions according to the invention may comprise other agents or active principles.

Furthermore, the compositions can be administered in different ways and in different forms. Administration can be carried out by any conventional route for this type of therapeutic approach, such as in particular via the systemic route, in particular by intravenous, intradermal _/ intratumoral, subcutaneous, intraperitoneal, intramuscular or intraarterial injection. etc. For example, injection intra-tumor or injection into an area close to the tumor or irrigating the tumor.

The doses may vary according to the number of administrations, the association with other active ingredients, the stage of evolution of the pathology, etc.

Another object of the invention is the use of the antibody of the invention in immunohistochemical analyzes of cancerous ^tissues' healthy or cirrhosis, or in the Western analysis. Blot, in ELISA or in vivo quantification test.

Other aspects and advantages of the invention will be described in the examples which follow, which should be considered as illustrative and do not limit the scope of the invention.

Legends of figures

Figure 1: Screening of the expression level of LDL-R in cancer lines (results expressed in arbitrary fluorescence units).

Figure 2: Binding of LDL-DiI on HepG2 cells (results expressed as percentage of fluorescent cells).

Figure 3: Screening of breast cancer cell lines for LDL-R expression (results expressed as percentage of fluorescent cells).

4A: "Binding of anti-LDL-R 12G4 antibodies to A549 cells (results ^• expressed as a percentage of fluorescent cells) Anti-LDL-R 12G4 antibodies are produced by hybridoma H12G4 and are directed against the peptide corresponding to amino acids 195-222 of the LDL receptor sequence (SEQ ID NO: 1).

Figure 4B: Binding of anti-LDL-R 12G4 antibodies on A549 cells (results expressed as average fluorescence).

Figure 5A: Binding of anti-LDL-R 12G4 antibodies on MDA-MB-231 cells (results expressed as percentage of fluorescent cells).

Figure 5B: Binding of anti-LDL-R 12G4 antibodies on MDA-MB-231 cells (results expressed as average fluorescence).

Figure 6A: Cross-reactivity of anti-LDL-R 12G4 antibody on C2C12 cells, CHO-Kl and ^'YB2 / 0 (results expressed as percentage of fluorescent cells).

Figure 6B: Cross-reactivity of anti-LDL-R 12G4 antibody on ^cells' C2C12, CHO-Kl and YB2 / 0 (results expressed as mean fluorescence).

Figure 7: Competition of anti-LDL-R 12G4 antibodies with LDL, on A549 cells (results expressed as mean fluorescence).

Figure 8: Kinetics of internalization of anti-LDL-R 12G4 antibodies with LDL, on A549 cells (results expressed as percentage of internalization).

Figure 9: Characterization of the 12G4 antibody in Western Blot Examples

Example 1 Production, characterization and selection ^/ monoclonal antibodies directed against the peptide corresponding to the sequence of amino acids 195-222 of the .séquence the human LDL receptor (SEQ ID NO: 1)

Choice of the appropriate peptide sequence The peptide fragment corresponding to the sequence SEQ ID NO: 1 (corresponding to amino acids 195-222 of the human LDL receptor sequence) located in the LDL binding region was synthesized. SEQ ID NO: 1 selected has been changed _(. Replacement of the cysteines by serines ..) in order to avoid formation of disulfide bridges in the case of oxidation of the thiol group of cysteine, the correpondante sequence is the sequence SEQ ID NO: 17.

Peptide synthesis

The peptide was synthesized by the solid phase synthesis method on an ABI 433 A model automatic synthesizer (Applied Biosystems Inc., California, USA), using a Boc / Bzl strategy on a 0.5 mmol MBHA resin.

Mass spectrometry

The molecular weight was determined using an ion electrospray mass spectrometer. The spectrum of electrospray was obtained using an API (Perkin-Elmer-Sciex) on a single quadrupole ion electrospray mass spectrometer equipped with a dye spray. Ions (electrospray assisted nebulizer) (Sciex, Toronto, Canada).

Production of monoclonal antibodies

The monoclonal antibodies directed against the peptide corresponding to the sequence SEQ ID NO: 1 ^' are produced by immunizing male BALB / c mice by intraperitoneal injection of the peptide corresponding to SEQ ID NO: 17, the peptide being previously emulsified with an equal volume of Freund's complete adjuvant.

Three injections were then made every two weeks in the presence of incomplete Freund's adjuvant. Four days after the last injection, the spleens of the animals are removed, then the cells are isolated and fused with Sp 2/0-Agl4 mouse myeloma cells in the presence of a fusion agent such as polyethylene glycol. The fused cells are then incubated in a selective medium (HAT medium) which inhibits the growth of unfused malignant cells.

In order to ensure the monoclonal character of the hybridomas, limited dilution subcloning was performed. At the end of these subclonings, a hybridoma called "H12G4", producer of antibodies directed against the peptide corresponding to SEQ ID NO: 1 was selected. This hybridoma belongs to the class of IgG, of subclass 1.

The antibodies produced by the hybridoma H12G4 ^• were tested by ELISA for the secretion of a monoclonal antibody of desired specificity, • namely against the peptide corresponding to SEQ ID NO: 1.

Ascites were obtained from male BALB / c mice, previously injected with pristane and to which 2.10 ⁶ H12G4 hybridoma cells were injected.

The monoclonal antibodies were isolated by precipitation with 27% ammonium sulfate and then purified by protein A gel affinity chromatography (HiTrap columns, Protein A HP, Amersham Bioscience, Uppsala, Sweden). The unbound proteins were removed by washing with a buffered saline solution (PBS: Phosphate 50 mmol / L, pH 7.2, NaCl 150 mmol / L). The elution of the monoclonal IgG immunoglobulins specific for the antibody directed against the peptide corresponding to the sequence SEQ ID NO: was accomplished using 0.2 M glycine at pH2.8. The purified antibodies were dialysed immediately against 10 mmol / L of PBS, concentrated by freeze-drying, and then kept in aliquots of 0.5 to 1 μg +/- 1% BSA at -20 ^° C. These antibodies will be called hereinafter "Anti-LDL-R 12G4".

Western Blot Analysis (Figure 9)

Anti-LDL-R 12G4 antibodies were tested in Western Blot. Total protein extracts of MDA-MB-231 cells were denaturing electrophoresis on SDS-PAGE gel (10%) and then transferred to a nitrocellulose membrane and reacted with anti-LDL-R 12G4 antibodies. Immunoreactive proteins were visualized with a monoclonal anti-IgG antibody conjugated with peroxidase (Chemiσon). The development of the reaction was carried out by chemiluminescence (Amersham, Biosciences). • •

isotyping

Isotyping of the hybridomas was carried out by ELISA with the SBA Clonotyping System / HRP Kit (SouthernBiotech) and with the Isosirip Mouse Monoclonal Antibody Isotyping Test (Roche-reference 1493027).

Example 2: Screening the level at. expression of LDL-R in cancer lines

The following cancer cell lines were screened for the expression of LDL-R: HepG2, HeLa, MCF-7, Jurkat, Ramos, HuH7 and Hek293 by the study of labeled LDL binding (Figures 1 and 2). For this, the LDL (density = 1.03-1.053 g / ml) were prepared by ultracentrifugation, dialyzed in PBS buffer, pH 7.4 and validated by SDS-PAGE under denaturing conditions, then labeled with the fluorochrome 1,1'-dioctadecyl -3,3,3 ', 3'-tetramethyl-indocarbocyanide (DiI). The LDL-DiI were incubated on cells at final concentrations of 0, 10 and 100 μg / ml for 3 hours at ^{40 °} C. After washing with PBS, the binding was analyzed by FACS cytofluorometry (Fluorescence-Activated CeIl Sorting) i.e., the fluorescence of each cell within a given population is individually measured: by flow cytometry on a Facscalibur device (Becton Dickinson). The measured parameters are FSC (Forward Scatter), SSC (Side Scatter) and fluorescence emitted at the wavelength of 530 nm after excitation with an Argon laser at 488 nm. The results were expressed as a percentage of fluorescent cells (Figure 1).

The results presented in Figure 1 show that HepG2 cells and HeLa cells most strongly express LDL-R. ^'

In addition, ^'several cell ^lines' die of breast cancer are available: MCF7-ras, MDA-MB-435 and MDA-MB-231. The expression of LDL-R on these human cancer cell lines has been demonstrated by studying the binding of labeled LDL on this cell line. For this, the LDL (d = 1.03-1.053) were prepared by ultracentrifugation, dialysed in PBS buffer, pH 7.4 and validated by SDS-PAGE under denaturing conditions, then labeled with the fluorochrome 1,1'-dioctadecyl- 3, 3, 3 ', 3' - tetramethyl-indocarbocyanide (DiI). LDL-DiI were incubated on cells at final concentrations of 6.25, 12.5, 25, 50 and 100 μg / ml for 3 hours. hours at ⁴⁰ C. After washing with PBS, the binding was analyzed by cytofluorometry (FACS) and the results were expressed as a percentage of fluorescent cells.

Thus, each line was tested for its level of expression of LDL-R (Figure 2): the MCF7-ras and the MDA-MB-435 have an LDL-R expression level equivalent to half that HepG2. MDA-MB-231 represents a homogeneous population that expresses high-level LDL-R.

EXAMPLE 3 In Vitro Functional Tests of the Monoclonal Antibodies Directed Against the Peptide Corresponding to the Sequence SEQ ID NO: 1 Selected, in Example 1

The functionality of the monoclonal antibodies directed against the peptide corresponding to the sequence SEQ ID NO: 1 was evaluated by studying the binding of antibodies to LDL-R at the cellular level (A549 cells and MDA-MB-231 cells), the study of the cross-reactivity of the LDL-R antibodies of C2C12 cells (mouse), CHO-K1 (hamster), YB2 / 0 (rat), the study of the competition between these antibodies and the LDLs on LDL - R ^'A45S cells -l'étude- of --leur kinetics ince'rnalisation and 1_ study of. ^" pxo-apoptotic character of the antibodies.

Study of the binding of Anti-LDL-R 12G4 antibodies to the LDL-R of A549 cells

The binding of Anti-LDL-R 12G4 antibodies to LDL-R was evaluated by quantification of cell labeling.

A549 grown in the presence of LPDS (Lipoprotein

Deficient Serum) for 24h, by flow cytometry

(FACS). To carry out this test, the antibodies Anti-LDL-

R 12G4 were incubated at final concentrations of

(1, 3, 10, 30, 100 μg / ml) for 3 hours at ^{40 °} C. The commercial antibodies 1C6 (anti-SREBP2, IgG1, ATCC- LGC Promochem CRL-2224) and C7 (anti-LDL-R, IgG2b, ATCC CRL-1691), prepared and incubated under the same conditions as Anti-LDL-R 12G4, served as control antibodies, negative and positive respectively . Revelation of binding was done using a secondary anti-IgG-PE antibody. The results were expressed as percentage of fluorescent cells (FIG. 4A) and fluorescence average (FIG. 4B).

Anti-LDL-R 12G4 antibodies and C7 control antibody recognize the LDL-R of A549 cells.

Study of the binding of Anti-LDL-R '12G4 antibodies to LDL-R of cells _. MDA-MB-231. . .

The binding of Anti-LDL-R 12G4 antibodies to LDL-R of MDA-MB-231 cells was evaluated. according to the same protocol described for the study of the binding of the antibodies Anti-LDL-R 12G4 to the LDL-R of A549 cells, by quantification of the labeling of MDA-MB-231 cells cultured in the presence of LPDS for 24h, by cytometry. flow (FACS). To perform this test, Anti-LDL-R 12G4 antibodies were incubated at final concentrations of (1, 3, 10, 30, 100 μg / ml) for 3 hours at ^{40 °} C. Antibodies-commercial-- 1C6 (anti-SREBP2, IgGl) ^"and: C7: _ (anti-LDL-R, .._ ..IgG2b.) _, prepared and incubated under the same conditions as the anti-LDL-R 12G4 have.. Control binding was performed using anti-IgG-PE The results were expressed as percent of fluorescent cells (Figure 5A) and mean fluorescence (Figure 5B). ).

At low antibody concentrations (1-3 μg / ml), the C7 control antibody binds to the LDL-R of MDA-MB-231 cells more significantly than the Anti-LDL-R 12G4 antibodies. On the other hand, for higher concentrations (10-100 μg / ml), Anti-LDL-R antibody 12G4 recognizes LDL-R more than C7.

Study of the cross-reactivity of Anti-LDL-R 12G4 antibodies to LDL-R cells C2C12, CHO-K1 and YB2 / Q The cross-reactivity of anti-LDL-R ^' antibodies was tested in mice (C2C12 cells) , in rats (YB2 / 0 cells) and in hamster (CHO-K1 cells). Anti-LDL-R 12G4 antibodies were incubated at a final concentration of 30 μg / ml for 3 hours at ^{40 °} C. on C2C12, CHO-K1 and YB2 / 0 cells previously cultivated under LPDS conditions for 24 hours. Commercial antibodies 1C6 (anti-SREBP2, IgG1) and C7 (anti-LDL-R, IgG2b) have _. served as negative and positive control antibodies - respectively. Revelation of binding was performed using anti-IgG-PE. The results were expressed as percentage of fluorescent cells (FIG. 6A) and fluorescence average (FIG. 6B).

Only Anti-LDL-R 12G4 antibodies cross-react with mouse, rat and hamster. The C7 antibody does not cross-react with the mouse or the hamster, but nevertheless has a very low cross-reactivity with the rat.

Study of Anti-LDL-R 12G4 Antibody Competition with LDL on A549 Cells

LDL competition with Anti-LDL-R 12G4 antibodies was investigated by binding anti-LDL-R 12G4 antibodies at 30 μg / ml in competition with unlabeled LDL at increasing concentrations (1 , 4 and 16 times the concentration of the antibodies, expressed in nM) on A549 cells for 3 h at ^{40 °} C. The revelation of the binding was carried out using an anti-IgG-PE. The binding of antibodies to LDL-R was then analyzed by FACS and the results expressed as mean fluorescence (FIG. 7). This competition test of the antibodies with LDL made it possible to demonstrate that the binding of the antibody C1 to the LDL-R of the A549 cells is not diminished by the addition of LDL at physiological concentrations in the medium. This means that the C7 antibodies do not bind at the same site as the LDLs. In contrast, Anti-LDL-R 12G4 antibody binds LDL-R less well in the presence of LDL (60% decrease in binding, mean fluorescence ≈ 55 in the absence of LDL, mean fluorescence = 20 in excess 16 times LDL). These results indicate that the binding site of the Anti-LDL-R 12G4 antibody is the same as that of LDL.

Kinetics of internalization of Anti-LDL-R 12G4 antibodies

The internalization kinetics of the Anti-LDL-R 12G4 antibody were studied over 24 hours during the incubation at 37 ° C of the rhodamine-labeled antibody (30 μg / ml) (NHS-rhodamine, Pierce , ref 46102) on A549 cells. The kinetics of internalization of the C7 control antibody (30 μg / ml) labeled with rhodamine and LDL - DiI (30 μg / ml) were studied in parallel. Post 2, 4, 6 am - 24 --- and incubation, antibodies / LDL-Dil related but ^'nόή internalis.es were won by dextran sulfate and quantified by fluorimetry. The A549 cells were then lysed with sodium hydroxide (0.1 N) and then the amount of internalized antibodies was quantified by fluorimetry. The percentage of internalization was calculated according to the following formula: fluorescence of the internalized antibodies / (fluorescence of the internalized antibodies + fluorescence of the bound but not internalized antibodies).

The kinetics of internalization, antibodies Anti - LDL -

R 12G4 is intermediate between that of LDL

(fastest kinetics with 60% internalisation at 4h) and that of C7 gui internalizes a little more slowly (Figure 8). As for LDL, the kinetics of internalization of the antibodies is biphasic with rapid intemalisation during the first 4 to 6 hours. After 6h of incubation, the three antibodies tested show the same rate of ¹ internalizing with a tray of internalizing about 60% to 24h.

Study of the Proapoptotic Nature of Anti-LDL-R 12G4 Antibodies

The growth of A549 cells in the presence and absence of Anti-LDL-R 12G4 antibodies was studied by double labeling FITC-annexin V (which binds to the phosphatidylserine of apoptotic cells in the early phase) and propidium iodide. (PI, which only marks necrotic cells whose plasma membrane is damaged) by flow cytometry (FACS). To carry out this test, AntiτLDL-R 12G4 antibodies were incubated at a final concentration of 30 μg / ml for 16 hours (duration of an ADCC test) at 37 ^° C. The commercial antibodies 1C6 (anti-SREBP2, IgG1) and C7 (anti-LDL-R, IgG2b), prepared and incubated under the same conditions as Anti-LDL-R 12G4, were used _. reference. A . Control ^~ néga.tif ^cell's ^{^"."} without antibodies and a positive control cells incubated with camptothecin were carried out in parallel.

Anti-LTL-R 12G4 antibodies do not show a strongly pro-apoptotic effect on A549 cells after 16 hours of incubation.

Example 4 In Vivo Studies

The model arîimal ^'chosen is a xenograft model of human tumor tissue in mice ^•' nude. The xenograft of tumor cells is implanted subcutaneously. Choice of the human cancer cell line for xenotransplantation

• Screening of cell lines for LDL-R expression Several breast cancer cell lines are available: MCF7-ras, MDA-MB-435 and MDA-MB-231 and the choice of the line to be implanted depends on our study the level of expression of LDL-R. The expression of LDL-R on these cancer cell ^lines' human has been demonstrated by the study of LDL link marked on this cell line. For this, LDL (d = 130-1.053 g / ml) was prepared by ultracentrifugation, dialyzed in buffer. PBS, pH 7.4 and validated by SDS-PAGE under denaturing conditions, then labeled with fluorochrome 1,1'-dioctadecyl-3,3,3 ', 3'-tetramethyl-indocarbocyanide (DiI). The LDL-DiI were incubated on the cells at final concentrations of 6.25, 12.5, 25, 50 and 100 μg / ml for 3 hours at ^{40 °} C. After washing with PBS, the binding was analyzed by cytofluorometry (FACS) and the results were expressed as a percentage of fluorescent cells.

Thus, ^{^'each'} line ^has been "^{^'tested'}'pottr"' level of expression of the LDL-R - (Figures 2 and -3 ^{^~:)} - -: •• ^• MCF7-ras as well as the MDA-MB-435 has an LDL-R expression level equivalent to half that of HepG2. MDA-MB-231 represents a homogeneous population that expresses high-level LDL-R. In view of these results, our choice on the lineage to be implanted was focused on the MDA-MB-231.

• Determination of the number of cells to be implanted for xenotransplantation

The speed of appearance of the tumor as a function of the number of implanted cells in nude mice been studied. The study is about. implantation of 0.5.10 ^6, 10 ^6, 2.1O ⁶ and 5.10 ⁶ cells.

• Binding of Anti-LDL-R 12G4 Antibody to LDL-R of MDA-MB-231

The binding of the anti-LDL-R 12G4 antibody to the LDL-R was studied on MDA-MB-231 cells according to the same protocol as for the study of the binding of the anti-LDL-R 12G4 antibody to LDL-R on HepG2 cells (Example 2), indirectly since the antibody was not directly labeled: the antibody was incubated on MDA-MB-231 cells for 3 hours at ^{40 °} C., then revealed with a FITC conjugated anti-IgG monoclonal antibody for FACS analysis. The results are expressed as a percentage of fluorescent cells.

. • Anti-LDL-R antibody competition study

12G4 with LDL on MDA-MB-231 cells Competition of LDL with Anti-LDL-R 12G4 antibody was studied by testing the binding of DiI-labeled LDL at 12.5 μg / ml in competition with the antibody anti-LDL-R 12G4 at concentrations ^"increasing (6.25, 12.5, 25 ^', 50 and 80 mcg / ml) on cells MDA-MB-231 for 3 h at 4 ° C. The binding of antibodies LDL-R was then analyzed by FACS and the results are expressed as a percentage of fluorescent cells.

In vivo protocol

For the treatment of mice with Anti-LDL-R 12G4 antibody, the approach chosen is to inject the cell line and the antibody simultaneously (Winn's test). This approach makes it possible to evaluate the ability of the antibody to prevent the formation of the tumor. The first group, Control group, comprises 5 nude mice implanted with 10 ⁶ MDA-MB-231 cells taken up in 200 μl of a control antibody, of the same isotype as the anti-LDL-R 12G4 antibody (IgG ₁ ) which does not recognize not LDL-R, without subsequent treatment of cell implantation.

The second group comprises 5 nude mice implanted with 10 ⁶ MDA-MB-231 cells taken up in 200 .mu.l of Anti-LDL-R 12G4 antibody, without subsequent treatment with implantation of the cells.

Moreover, a "modified" approach of the Winn test consisting of treating nude mice after simultaneous implantation of MDA-MB-231 cells and Anti-LDL-R 12G4 antibody with Anti-LDL-R 12G4 antibody, twice a week during the 4 weeks of the study (third group) was set up. The third group comprises 5 nude mice implanted with 10 ⁶ MDA-MB-231 cells taken up in 200 μl of Anti-LDL-R 12G4 antibodies, treated intraperitoneally with 500 μg of Anti-LDL-R 12G4 antibody, twice per week (the first treatment with 500 μg occurred 3 to 4 hours after implantation of the cells).

The mouse cont cont'd daily with measurement of weight gain and the size of the tumor 3 times a week. At the end of the 4 weeks of the protocol, the mice are sacrificed and the liver, heart, kidneys and spleen are recovered and frozen at -80 ^° C. for each of the 5 mice of each group. Moreover, the sera of the mice are also recovered and frozen.

Example 5: Therapeutic feasibility study

The purpose of the study of the therapeutic feasibility was to highlight an over-expression of LDL-R in cancerous tissue compared to healthy tissue, in different types of cancers. For this, a Western Blot (WB) analysis of hepatocellular carcinomas was performed.

Western blot analysis was performed using tissue from patients with hepatocellular carcinoma (HCC) in alcohol-induced cirrhosis (3 patients) or cirrhosis caused by infection with hepatitis C (15 patients). Two tissue samples were provided for each patient: (i) a sample taken from a non-tumor but cirrhosis area and (ii) a sample taken from tumor tissue from the same patient (with a minimum of 70%). tumor hepatocytes).

Western Blot analyzes, using a rabbit polyclonal anti-LDL-R antibody (Research Diagnostics Inc), were performed on these tissues. A 160 kDa band, which corresponds to the mature form of LDL-R, has been observed in both cirrhosis and cancerous tissues. In addition to this band, a band at 120 kDa, corresponding to the immature form of the LDL-R ^'' (ήôri ^{"glycosylated),} is present.

Quantification of the band corresponding to mature LDL-R, normalized with respect to actin, made it possible to highlight:

- Expression of LDL-R in the healthy tissue of 3 patients with HCC on alcohol-induced cirrhosis and in the healthy tissue of 2 out of 15 HCC patients with cirrhosis originating from infection with the 1-hepatitis C virus.

Over-expression of LDL-R in cancer tissue in 7 patients in 15 patients with HCC in cirrhosis with Hepatitis C virus infection (level of over-expression in these patients is between 2 and 14 times).

Six patients with HCC on cirrhosis caused by hepatitis C virus infection did not show differential LDL-R expression.

Example 6: Study of the Specificity of the Antibody

The immunohistochemical study was performed on microarray tissue slides of normal human tissue, with 108 spots corresponding to 54 different normal human tissues fixed, 10% formalin. The C7 antibody was diluted ^'1/10 (lOμg / ml) and the anti-LDL-R 12G4 antibody was diluted 1/50 (2μg / ml). The antigenic reactivation was carried out in the microwave, 3 times 5 minutes at 750 Watts in 10mM citrate buffer, pH 6.

It has been observed a lack of marking in the hematopoietic system (amygdala, spleen and lymph node), muscle tissue (heart and skeletal muscle skeleton), skin coating and breast tissue, regardless of the "body" used ". The central nervous system (cerebral cortex, cerebellum, basal ganglia, hippocampus and spinal cord), adrenal glands (cortex and medulla), liver and gall bladder were labeled with both antibodies. The anti-LDL-R 12O4 antibody and the C7 antibody marked the testes, the colon and the pancreas, with a better labeling with the Anti-LDL-R 12G4 antibody for these last two organs. Only the Anti-LDL-R 12G4 antibody marks the gastric mucosa, the squamous epithelium of the oral and exocervical mucosa and the different renal tubes.

These results are in agreement with the literature on LDL-R tissue distribution since adrenal, liver, central nervous system, testes and kidneys have been described as tissues strongly expressing LDL-R. The Anti-LDL-R 12G4 antibody and the Cl antibody give markings of equivalent intensity, with a slight superiority of the Anti-LDL-R 12G4 antibody. Due to its good sensitivity and specificity, the Anti-LDL-R 12G4 antibody has been selected for the immunohistochemical analysis of mammary adenocarcinomas.

Immunohistochemical analysis of mammary adenocarcinomas

The expression of LDL-R was studied by immunohistochemistry on 34 mammary adenocarcinomas and on adjacent non-tumor tissue with the antibody

Anti-LDL-R 12G4.

The labeling was of a high intensity and each time that a marking was observed (65% of the samples), only the tumor cells were labeled, thus highlighting over-expression of LDL-R in the cancer cells.

Example ^7; _. Amplification and sequencing of variable regions of anti-LDL-R 12G4 antibodies

1.Amplification of the VH and VK regions

'

The total RNA of murine hybridoma 12G4, producing an IgG1, K type immunoglobulin, was extracted (Nucleospin RNA Macherey-Nagel kit 740609.250). The variable domains of light (VK) and heavy chains

(VH) of the 12G4 antibody were amplified by the 5 'RACE (Rapid Amplification of DNA Ends) technique.

(5'RACE kit, Invitrogen 18374.041) anchoring in the murine constant Kappa region (CK), for the Kappa light chain, or Murine Gl, for the chain heavy.

Briefly, a first reverse transcription step was first performed using a primer located in the 5 'region of the murine CK OR Gl constant regions. A poly-dC sequence was then added at 3 'to the synthesized cDNAs before amplifying the VK and VH regions using a 5' 'primer recognizing the poly-DC sequence and a 3' primer. , located in the murine CK OR Gl constant regions 5 'of the reverse transcription primer. In order to improve the specificity of the amplification, a second "semi-nested" PCR was carried out on the VH PCR product using a 3 'primer located 5' of the 3 'primer of the first PCR.

The primers used for these different steps are as follows:

1) reverse transcription primers a. Murine Kappa specific antisense primer

5'- ACT GCC ATC AAT CTT CCA CTT GAC -3 '(SEQ ID NO: 12) b. Gl specific murine antisense primer ^{'5'CTGGACAGGGATCCAGAGTTCCA-} -3' ^• (SEQ ID NO: 13) ^'

2) 5'RACE PCR primers a. Murine Kappa-specific antisense primer 5'-TTGTTCAAGAAGCACACGACTGAGGCAC -3 '(SEQ ID NO: 14) b. Murine Gl-specific antisense primers PCR primers:

5'- TGTCACTGGCTCAGGGAAATAGCCCTTGAC -3 '(SEQ ID NO:

15)

"Semi-nested" PCR primer:

5''CACCATGGAGTTAGTTTGGGCAGCAGATCCA - 3 '(SEQ ID NO:

16) -,

2. Determination of the sequence of the VH and VK regions After amplification, the VK and VH sequences of the 12G4 antibody were cloned into the plasmid pCR4 ~ TOPO (TOPO-TA-cloning kit for sequencing, Invitrogen, Cat.No. 45-0030). Plasmids from at least 3 recombinant colonies were purified and their insert sequenced using the universal primers M13 uni and rev.

The nucleotide sequence of the VK region of the 12G4 murine antibody is indicated under the sequence SEQ ID NO: 8 and the deduced peptide sequence is the sequence SEQ ID NO: 10. The VK gene belongs to the Vκ8 subgroup (Almagro JC and Immunogenetics 1998, 47: 355-363). The CDR1, CDR2 and CDR3 sequences of the murine 12G4 VK region, defined according to Kabat [Kabat et al., "Sequences of Proteins of Immunological Interest", NIH Publication, 91-3242 (1991) 3 are indicated under the following sequences: SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, respectively. The CDR1-IMGT, CDR2-IMGT and CDR3-IMGT sequences of the VK region of the murine 12G4 antibody, defined according to the IMGT (International ImMunoGeneTics database) analysis [Lefranc, M. -P. et al., Dev. ^• Conip. Immunol. , 27, 55-77 ^"(2003)] are indicated 'sόαs" the following ^sequences: SEQ ID NO: 18, SEQ- ID NO-: 19 and SEQ ID NO: 20, respectively. This definition, which is different from that of Kabat based solely on the analysis of sequence variability, takes into account and combines the characterization of hypervariable loops [Chothia C. and Lesk AMJ Mol. Biol. 196: 901-17 (1987)] and structural analysis of antibodies by crystallography.

The nucleic acid sequence of the VH region of 12G4 is SEQ ID NO: 9 and the deduced peptide sequence is SEQ ID NO: 11. The VH gene belongs to the VH9 subgroup (Honjo T. and Matsuda F. in "Immunoglobulin genes." Honjo T. and Alt FW eds, Academy Press, London, 1996, ppl45-171). The CDR1, CDR2 and CDR3 sequences of the murine 12G4 VH region, defined according to Kabat [Kabat et al., "Sequences of Proteins of Immunological Interest", NIH Publication, 91-3242 (1991)] are indicated under the following sequences: SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, respectively. The CDR1-IMGT, CDR2-IMGT and CDR3-IMGT sequences of the VH region of the 12G4 murine antibody, defined according to IMGT analysis (International ImMunoGeneTics database) [Lefranc, M. -P. et al., Dev. Comp. Immunol., 27, 55-77 (2003)] are indicated under. the following sequences: SEQ ID NO: 21, SEQ ID NO: 22 and SEQ ID NO: 23, respectively. This definition, different from that of Kabat based on the analysis of sequence variability alone, takes into account and combines the characterization of hypervariable loops [Chothia C. and Lesk AMJ Mol. Biol. 196: 901-17 (1987)] and structural analysis of antibodies by crystallography.

References

Agnani, G., Delpierre, C., et al. (1989). "Antipeptide antibody against the human low-density-lipoprotein receptor." Characterization and cross-reactivity with bovine lymphocytes. Biochem J 263 (3): 753-60.

Carter P., L. Presta, et al., (1992) "Humanization of an anti-ρ185HER2 antibody for human cancer therapy." Proc. Natl. Acad, Sci. USA, 89: 4285.

Chothia C. and A. M. Lesk (1987) "Canonical structures for the hypervariable regions of immunoglobulins." J. Mol. Biol. 196: 901-17.

Daugherty BL, JA DeMartino, et al., (1991) "Polymerase chain reaction ^" facilitated cloning, CDR-grafting, and rapid expression of a monoclonal murine antibody directed against the CD18 component of leukocyte integrins. "Nucleic Acids Res 19 (9) ): -2471-6. ^'

GaI, D., M. Ohashi, et al. (19-81). "Low-density lipoprotein as a potential agent for chemotherapeutic agents and radionucleotides in the management of gynecology neoplasms." Am J Obstet Gynecol 139 (8): 877-85.

Henriksson, P., M. Eriksson, et al. (1989). "Hypocholesterolaemia and increased elimination of low-density lipoproteins in metastatic cancer of the prostate." Lancet 2 (8673): 1178-80. Holmes MA and Foote J., (1997) "Structural consequences of humanizing an antibody." J Immunol 158 (5): 2192-201.

Jones, P., P. Dear, et al. (1986). "Replacing the complementarity-determining regions in - a human antibody with those from a mouse." Nature 321 (6069): 522-5.

Lefranc, M.P., C.Pommié, et al., (2003) "IMGT single numbering for immunoglobulin and variable T cell receptor domains and Ig superfamily V-like domains." Dev. Comp. Immunol., 27, 55-77.

. Leung SODM ^• Goldenberg, et al, (1995) "Construction and characterization of a humanized, intemalizing, B-cell (CD22) ^-Specifies' leukemia / lymphoma antibody, LL2." Mol Immunol 32 (17-18): 1413 -27.

AP Lewis and Crowe JS, (1991) "Immunoglobulin complementarity-determining region grafting by recombinant polymerase chain reaction to generate humanised monoclonal ^antibodies." "Gene 101 (2): 297-302.

Lonberg N. and D. Huszar. (.1995) "Human Antibodies from Transgenic Mice." Internai Review of Immunology 13: 65-93.

J

Morrison S.L., M.J. Johnson, et al., (1984) "Chimeric human antibody molecules: mouse 'antigen-binding domains with constant human area domains." Proc. Natl. Acad. Sci. U.S.A. 81: 6851-55.

Neuberger MS, GT, Williams, et al., (1985), "Recombinant antibody possessing novel effector functions." Nature 312 (5995): 604-8. Presta LG, SJ Lahr, et al., (1993) "Humanization of an IgE-Directed Antibody." J. Immunol. 151: 2623

Queen C, W. P. Schneider, et al., (1989) "A humanized antibody that binds to the receptor interleukin." Proc Natl Acad Sci U S A 86 (24): 10029-33

Riechmann, L., M. Clark, et al. (1988). "Reshaping human antibodies for therapy." Nature .322 (6162): 323-7.

Rudling, M., V. Collins, and -al. (1983). "Delivery of aclacinomycin A to human glioma cells in vitro by the low-density lipoprotein pathway." Cancer Res. 43 (10): 4600-4605.

Rudling, M., E. Reihner, et al. (1990). ^Λλ Low Density Lipoprotein Receptor-Binding Activity in Human Tissues: Quantitative Importance of Evidence for Hepatic Receptors and Regulation of Their Expression in vivo "PISTAS ^'87 ^(9') ^': 3469-3473 - ^•.

Sato K., M. Tsuchiya, et al (1994) "Humanization of a mouse anti-human interleukin-6 receptor antibody comparing two methods for selecting human framework regions." Mol Immunol 31 (5): 371-81. j

Sims M.J., D.G. Hassal, et al., (1993) "A humanized CD18 antibody can block function without cell destruction." J. Immunol., 151: 2296.

Singer, I., D. Kawka, et al. (1993). Optimal humanization of 1B4, anti-murine monoclonal anti-CD18 antibody, is achieved by correct choice of human + J X.

Sequence framework region. "J. Immunol., 150 (7): 2844-2857.

Tokui, T., Kuroiwa C., et al. (1995). "Lipoprotein Plasma as Carriers Tumor Tissues After Administration of a Lipophilic Agent to Mice." Biopharm Drug Dispos 16 (2): 91-103.-

Tokui, T., Kuroiwa C., et al. (1994). "Contribution of serum lipoproteins as antitumour agents agent RS-1541 (palmitoyl rhizoxin) in mice." Biopharm Drug Disposal 15 (2): 93-107.

Tomizuka K., T. Shinohara, et al., (2000) "Double trans-chromosome mice: 'maintenance of two individual human chromosome fragments containing Ig heavy and k loci and expression of fuiIy human antibodies." Proc. Natl. Acad, Sci. USA 97 (2): 722-727

Verhoeyen, M. and L. Riechmann (1988). ^w Engineering of antibodies. Bioessays 8 (2): 74-8.

Claims

• 1. A monoclonal antibody directed against the human LDL (Low Density Lipoprotein) receptor, binding to the peptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of the peptide sequence of the human LDL receptor.

2. Antibody according to claim 1, characterized in that at least one CDR (Complementarity Determining Region) region of each of its light chains has a peptide sequence having at least 70% identity with a sequence chosen from SEQ ID sequences. NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and in that at least one CDR region of each of its heavy chains has a peptide sequence having at least 70% identity with a sequence selected from the sequences SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23.

3. Antibody according to any one of claims 1 or 2, characterized in that each CDR region of each of its light chains has a peptide sequence having at least 70% identity with the sequences SEQ ID NO: 2 or SEQ ID- _'NO: 18, SEQ ID NO: 3 or SEQ ID NO: 19, SEQ ID NO: 4 or SEQ ID NO: 20 respectively, and in that each CDR region of each of its heavy chains has a peptide sequence having at least 70% identity with the sequences SEQ ID NO: 5 or SEQ ID NO: 21, SEQ ID NO: 6 or SEQ ID NO: 22, SEQ ID NO: 7 or SEQ ID NO: 23 respectively.

4. Antibody according to any one of the preceding claims, characterized in that the variable region of each of its light chains is encoded by a nucleic acid sequence ^'having at least 70% identity with the nucleic acid sequence SEQ ID NO: 8, and in that the variable region of each of its heavy chains is encoded by a nucleic acid sequence having at least 70% identity with the nucleic acid sequence SEQ ID NO: 9.

An antibody according to any one of the preceding claims, characterized in that said variable region of each of its light chains is encoded by the nucleic acid sequence SEQ ID NO: 8, and in that said variable region of each of its heavy chains is encoded by the nucleic acid sequence SEQ ID NO: 9.

6. Antibody according to any one of the preceding claims, characterized in that it is an F (ab ') 2 fragment, an Fab' fragment, a Fab fragment or a CDR region. or any modified version of any ^{^"of"} these ^fragments or region.

7. Antibody according to any one of the preceding claims, characterized in that it is murine.

8. Antibody according to any one of claims 1 to 6, characterized in that it is chimeric, humanized or human.

9. Antibody according to any one of the preceding claims, characterized in that it is coupled to a toxin.

10. - Antibody according to any one of the preceding claims, characterized in that it allows the recruitment of effector immune cells-s.

11. Antibody according to any one of the preceding claims, characterized in that it allows the destruction of cancer cells.

An antibody according to any one of the preceding claims, characterized in that it is produced in the mouse SP2 / 0-AG14 cell line. . . - ••. •

13. Antibody according to. any of claims 1 to 11, characterized in that it is produced by the hybridoma H12G4 (filed under number 1-3487 at the CNCM).

A stable cell line producing an antibody according to any one of claims 1 to 11.

15. A stable cell line according to claim 14 selected from the group consisting of: SP2 / O-AG14, YB2 / 0, IR983F, Namalwa human myeloma, PERC6, CHO lines, especially CHO-KI, CHO- LeclO, CHO-LECL, CH0-Lecl3 CHO Prα.-5, CHO dhfr-, Wil-2, Jurkat, Vero, MOIT-4, COS-7, ^'-HEK 293, BHK, K6H6, NSO, SP2 / 0 -Ag 14 and P3X63Ag8.653.

16. Hybridoma H12G4 deposited under registration number CNCM 1-3487 at the National Collection of Cultures of Microorganisms (CNCM).

17. DNA fragment of sequence SEQ ID NO: 9 coding for the variable region of the heavy chain of an antibody according to any one of claims 1 to 13.

18. A DNA fragment of sequence SEQ ID NO: 8 encoding the variable region of the light chain of an antibody according to any one of claims 1 to 13.

19. Expression vector comprising at least one DNA fragment chosen from fragments of sequence SEQ ID NO: 9, SEQ ID NO: 8.

20-. Peptide corresponding to amino acids 195-222 (SEQ ID NO: 1) of the peptide sequence of the human LDL receptor.

21. Use of an antibody according to any one of claims 1 to 13 for activating in vitro FcvRIII receptors of effector immune cells.

22. Use of an antibody according to any one of claims 1 to 13 for the manufacture of a medicament.

23. Use of an antibody according to claim 22 for the manufacture of a medicament for the treatment of cancer.

24. Use according to any one of claims 22 or 23, characterized in that the treated cancers are cancers for which the LDL receptor is overexpressed on the surface of cancer cells.

25. Use according to any one of claims 22 to 24, characterized in that said cancer is cancer of the prostate, pancreas, liver, breast, stomach, ovary, colon, lung or leukemia.

26. Use according to any one of claims 22 to 24 for the preparation of a medicament for the treatment of cancers, including acute myeloid leukemia, acute monocytic leukemias, myelomonocytic leukemias, chronic myeloid leukemia in blast crisis, leukemias lymphoids, chronic lymphocytic leukemias, solid tumors such as cervical squamous cell carcinoma, endometrial adenocarcinoma, gastric carcinoma, hepatocellular carcinoma, choriocarcinoma, brain tumors. -

27. A pharmaceutical composition comprising an antibody according to any one of claims 1 to 13 and a pharmaceutically acceptable excipient and / or carrier.

28. Use of the antibody according to any of claims ^{^'1'} ^'13' '' in ^'' the ^"analysis of immunohistochemical - cancerous tissues - healthy - or cirrhosis, Western blot, ELISA or test quantification in vivo.