EP1910523A1 - Modulation de la signalisation de l'egfr par modulation de la signalisation de sphingosine kinase - Google Patents

Modulation de la signalisation de l'egfr par modulation de la signalisation de sphingosine kinase

Info

Publication number
EP1910523A1
EP1910523A1 EP06752619A EP06752619A EP1910523A1 EP 1910523 A1 EP1910523 A1 EP 1910523A1 EP 06752619 A EP06752619 A EP 06752619A EP 06752619 A EP06752619 A EP 06752619A EP 1910523 A1 EP1910523 A1 EP 1910523A1
Authority
EP
European Patent Office
Prior art keywords
sphingosine kinase
egfr
cell
activity
mediated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06752619A
Other languages
German (de)
English (en)
Other versions
EP1910523A4 (fr
Inventor
Pu Xia
Olga Sukocheva
Mathew Alexander Vadas
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Medvet Science Pty Ltd
Original Assignee
Medvet Science Pty Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2005903259A external-priority patent/AU2005903259A0/en
Application filed by Medvet Science Pty Ltd filed Critical Medvet Science Pty Ltd
Publication of EP1910523A1 publication Critical patent/EP1910523A1/fr
Publication of EP1910523A4 publication Critical patent/EP1910523A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01091—Sphinganine kinase (2.7.1.91)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3517—Marker; Tag

Definitions

  • the present invention relates generally to a method of modulating EGFR-mediated cellular functional activity and agents useful for same. More particularly, the present invention relates to a method of modulating agonist induced EGFR-mediated cellular proliferation by modulating upstream intracellular sphingosine kinase signalling.
  • the method of the invention is useful, inter alia, in the treatment and/or prophylaxis of conditions characterised by aberrant EGFR-mediated cellular functioning, in particular aberrant EGFR-mediated cellular proliferation.
  • oestrogen has been known for decades to be coupled with growth factor networks exhibiting the enhanced growth-promoting activity in breast cancer cells.
  • a large number of growth factors and their receptors have been illustrated to interact with oestrogen signalling, among which the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases are of particular interest due to their critical involvement in human cancer (Bange et al, 2001 , Nat Med, 7:548-552; Levin, 2003, MoI Endocrinol, 17:309-317).
  • EGFR epidermal growth factor receptor
  • oestrogen primarily acts on nuclear estrogen receptors (ER) leading to regulation of gene expression, which was traditionally deemed the genomic action of oestrogen.
  • ER nuclear estrogen receptors
  • Many of these oestrogen-responsive genes are indeed key signalling molecules that participate in EGFR signalling (Levin, 2003, supra).
  • EGFR signalling is capable of activating ER in the absence of oestrogen (Picard et al, 1997, Biochem Soc Trans, 25:597-602).
  • mER may be derived from the same or an alternative transcript related to nuclear ER (Razandi et al., 1999, MoI Endocrinol, 13:307-319), or belongs to a GPCR family (e.g., GPR30) (Filardo et al, 2000, supra), or may be a part of GPCR-ER complex (Razandi et al, 2003. supra). Therefore, the true nature of mER is still undefined and the mechanism underlying oestrogen induced transactivation of EGFR remains largely unknown.
  • sphingosine kinase plays a critical role in mediating oestrogen non-genomic signalling for the criss-cross transactivation of EGFR via SlP receptors. Accordingly, sphingosine kinase mediates the interaction between three membrane spanning events induced by oestrogen, SlP and EGF.
  • nucleotide sequence information prepared using the programme Patentln Version 3.1, presented herein after the bibliography.
  • Each nucleotide sequence is identified in the sequence listing by the numeric indicator ⁇ 201> followed by the sequence identifier (eg, ⁇ 210>l, ⁇ 210>2, etc).
  • the length, type of sequence (DNA, etc) and source organism for each nucleotide sequence is indicated by information provided in the numeric indicator fields ⁇ 211>, ⁇ 212> and ⁇ 213>, respectively.
  • Nucleotide sequences referred to in the specification are identified by the indicator SEQ ID NO: followed by the sequence identifier (eg. SEQ ID NO: 1 , SEQ ID NO:2, etc.).
  • sequence identifier referred to in the specification correlates to the information provided in numeric indicator field ⁇ 400> in the sequence listing, which is followed by the sequence identifier (eg. ⁇ 400>l, ⁇ 400>2, etc). That is SEQ ID NO:1 as detailed in the specification correlates to the sequence indicated as ⁇ 400>l in the sequence listing.
  • One aspect of the present invention is directed to a method of modulating EGFR-mediated cellular functional activity, said method comprising modulating the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulates EGFR-mediated intracellular signalling.
  • a method of modulating agonist induced EGFR- mediated cellular functional activity comprising modulating the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulates said agonist induced EGFR-mediated intracellular signalling.
  • a method of modulating agonist induced EGFR- mediated cellular proliferation comprising modulating the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulates said agonist induced EGFR-mediated intracellular signalling.
  • Still yet another aspect of the present invention provides a method of downregulating agonist induced EGFR-mediated neoplastic cell proliferation, said method comprising downregulating the functioning of sphingosine kinase mediated signalling in said cell.
  • Yet still another aspect of the present invention provides a method of downregulating agonist induced EGFR-mediated neoplastic cell proliferation, said method comprising downregulating the functioning of sphingosine kinase- 1 mediated signalling in said cell.
  • a further aspect of the present invention is directed to a method for the treatment and/or prophylaxis of a condition characterised by aberrant, unwanted or otherwise inappropriate EGFR-mediated cell activity, said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulates EGFR-mediated intracellular signalling.
  • a method for the treatment and/or prophylaxis of a condition characterised by aberrant, unwanted or otherwise inappropriate agonist induced EGFR-mediated cell activity comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulates said agonist induced EGFR-mediated intracellular signalling.
  • a method for the treatment and/or prophylaxis of a condition characterised by aberrant, unwanted or otherwise inappropriate agonist induced EGFR-mediated cellular proliferation comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulate EGFR-mediated intracellular signalling.
  • Still another further aspect of the present invention provides a method for the treatment and/or prophylaxis of an oestrogen induced breast cell malignancy, said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to downregulate the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulates EGFR-mediated intracellular signalling.
  • the present invention relates to the use of an agent capable of modulating the functional activity of sphingosine kinase mediated signalling in the manufacture of a medicament for the treatment and/or prophylaxis of a condition characterised by aberrant, unwanted or otherwise inappropriate EGFR-mediated cell activity wherein downregulating said sphingosine kinase signalling downregulates EGFR-mediated intracellular signalling.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a modulatory agent as hereinbefore defined and one or more pharmaceutically acceptable carriers and/or diluents.
  • Yet another aspect of the present invention relates to modulatory agents, as hereinbefore defined, when used in the method of the present invention.
  • Figure 1 is an image depicting that. SlP transactivates EGFR.
  • MCF -7 cells were stimulated with (A) 1 mmol/L SlP for the indicated time or (B) an increasing concentration of SlP for 15 min.
  • Cell lysates were subjected to SDS-PAGE, and phosphorylation of EGFR and ERKl/2 was analysed by phospho-specific antibodies.
  • the bar graphs represent three combined experiments expressed in percent of the control value (the mean ⁇ SD). The density values of activities were normalised by total protein levels.
  • FIG. 2 is an image depicting that. SlP mimics E2 to induce EGFR transactivation in MCF-7 cells.
  • Serum-starved MCF-7 cells were (A) preincubated for 16 hrs with PTX (100 ng/ml), or for 1 hr with AG1478 (50 mmol/L), and PP2 (100 nmol/L), or (B) pretreatment for 1 hr with the MMP inhibitor phenanthroline (20 mmol/L), GM6001 (50 nmol/L), or the EGF neutralising antibodies (15 mg/ml), followed by stimulation with 10 nmol/L E2, 1 mmol/L SlP or 25 ng/ml EGF for 15 min.
  • FIG. 3 is an image depicting the effect of SphK activity on E2-induced EGFR transactivation.
  • A Stably transfected MCF-7 cells overexpressing SphKl ⁇ , SphKl G82D or vector alone were stimulated with 10 nmol/L E2, 1 mmol/L SlP or 25 ng/ml EGF for 15 min. Cell lysates were then analysed by Western blotting and the extent of phosphorylated EGFR and ERKl/2 was quantified as in Figure 1. Data are mean ⁇ SD. *p ⁇ 0.01 ; f p ⁇ 0.05, SphKl WT or S ⁇ hKl G82D versus vector alone.
  • B Flow cytometry profiles show the cell-surface expression levels of EGFR in the transfected MCF-7 cell lines.
  • FIG. 4 is an image depicting that SphKl, but not SphK2, is responsible for the E2- induced EGFR transactivation.
  • MCF-7 cells were transfected with siRNA specifically for SphKl, SphK2 or scramble control RNA as described in 'Material and Methods'. After 24 hrs transfection, the following experiments were conducted: (A) Levels of SphKl and
  • SphK2 mRNA were determined by RT-PCR and quantified by the ratio to GAPDH mRNA level.
  • B The siRNA-transfected MCF-7 cells were stimulated with 10 nmol/L E2, 1 mmol/L SlP or 25 ng/ml EGF for 15 min. SphK activity was then assayed, and
  • C levels of phosphorylated EGFR and ERK1/2 were analysed as in Figure 1. Data are mean ⁇ SD. *p ⁇ 0.01; f p ⁇ 0.05, SphKl or SphK2 siRNA versus control.
  • FIG. 5 is an image depicting that E2-induced EGFR transactivation is mediated by SlP release from MCF-7 cells.
  • A Extracellular SlP levels were determined in transfected MCF-7 cells overexpressing SphKl , SphKl or vector alone after stimulation with 10 nmol/L E2 for 15 min. Data are mean ⁇ SD.
  • B MCF-7 cells were pretreated with or without PTX for 16 hrs and stimulated for 15 min with conditioned medium derived from the transfected MCF-7 cells treated with or without E2. Levels of phosphorylated EGFR were then determined as in Figure 1.
  • Figure 6 is an image of E2 stimulating Edg-3 internalisation in MCF-7 cells. After stimulation for 2 min or 30 min with 10 nmol/L estrogen or 100 nmol/L SlP, MCF-7 cells were immunofluorescently stained with antibodies against Edg-3 (upper panels) or EGFR (middle panels). The images of Edg-3 (red) and EGFR (green) staining are merged in bottom panels.
  • Figure 7 is an image depicting the effect of Edg-3 on E2-induced EGFR transactivation.
  • MCF-7 cells were transfected with Edg-3 antisense or sense as described in 'Material and Methods'. After 24 hrs transfection, the following studies were performed: (A) Levels of Edg-3 mRNA were determined by RT-PCR and quantified by the ratio to GAPDH mRNA level. (B) The Edg-3 sense or antisense-transfected cells were stimulated with 10 nmol/L E2, 1 mmol/L S IP or 25 ng/ml EGF for 15 min, and the extent of phosphorylated EGFR and ERK1/2 was analysed as in Figure 1. Data are mean ⁇ SD. * ⁇ ⁇ 0.01; fp ⁇ 0.05, Edg-3 antisense versus the sense.
  • Figure 8 is a schematic representation of a model for E2-induced EGFR transactivation through activation of the SphK 1 /S 1 P signalling pathway.
  • the present invention is predicated, in part, on the identification of the existence of a crisscross mechanism of signalling which leads to the upregulation of EGFR-mediated cell signalling. Accordingly, this finding facilitates the development of alternative means of treating aberrant EGFR-mediated cellular functioning, this being particularly relevant in terms of treating cancers such as anti-oestrogen resistant breast cancers. Further, the determination that sphingosine kinase is a crucial upstream mediator of EGFR-related cell signalling provides a specific target, other than the currently utilised EGFR itself, or in the case of breast cancer oestrogen, for therapeutic intervention.
  • one aspect of the present invention is directed to a method of modulating EGFR-mediated cellular functional activity, said method comprising modulating the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulates EGFR-mediated intracellular signalling.
  • EGFR epidermal growth factor receptor
  • TGF- ⁇ transforming growth factor- ⁇
  • a method of modulating agonist induced EGFR- mediated cellular functional activity comprising modulating the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulates said agonist induced EGFR-mediated intracellular signalling.
  • Reference to "agonist induced" EGFR-mediated cellular functional activity should be understood as a reference to EGFR-mediated cellular functional activity which is initially induced by the actions of a molecule which couples to a receptor other than the EGFR receptor.
  • the molecule which commences the cascade of steps leading to EGFR stimulation is the binding of oestrogen into the oestrogen receptor.
  • the subject "agonist” is oestrogen.
  • EGFR-mediated cellular functional activity should be understood as a reference to any one or more of the functional activities which a cell is capable of performing as a result of EGFR stimulation.
  • said functional activity is cellular proliferation.
  • a method of modulating agonist induced EGFR-mediated cellular proliferation comprising modulating the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulates said agonist induced EGFR-mediated intracellular signalling.
  • the cell in the context of the present invention is a reference to any form or type of cell, irrespective of its origin.
  • the cell may be a naturally occurring normal or abnormal cell or it may be manipulated, modified or otherwise treated either in vitro or in vivo such as a cell which has been freezed/thawed or genetically, biochemically or otherwise modified either in vitro or in vivo (including, for example, cells which are the result of the fusion of two distinct cell types).
  • the cell is a neoplastic cell.
  • neoplastic cell is meant a cell exhibiting uncontrolled proliferation.
  • the neoplastic cell may be a benign cell or a malignant cell.
  • the cell is malignant.
  • the neoplastic cell is a malignant cell the proliferation of which would form a solid tumour such as a malignant cell derived from the breast, colon, stomach, lung, brain, bone, oesophagus or pancreas.
  • a method of do wnregulating agonist induced EGFR-mediated neoplastic cell proliferation comprising downregulating the functioning of sphingosine kinase mediated signalling in said cell.
  • said neoplastic cell is a malignant cell derived from the breast, colon, stomach, lung, brain, bone, oesophagus, pancreas, ovary or uterus.
  • said agonist is oestrogen and said cell is a malignant breast cell or an anti-oestrogen resistant malignant breast cell.
  • sphingosine kinase should be understood as reference to all forms of this protein and to functional derivatives thereof. This includes, for example, any isoforms which arise from alternative splicing of the subject sphingosine kinase mRNA or functional mutants or polymorphic variants of these proteins. For example, this definition extends to the isoforms sphingosine kinase- 1 and sphingosine kinase-2, although said sphingosine kinase is preferably sphingosine kinase-1.
  • a method of downregulating agonist induced EGFR- mediated neoplastic cell proliferation comprising downregulating the functioning of sphingosine kinase-1 mediated signalling in said cell.
  • said neoplastic cell is a malignant cell derived from the breast, colon, stomach, lung, brain, bone, oesophagus, pancreas, ovary or uterus.
  • said agonist is oestrogen and said cell is a malignant breast cell or an anti-oestrogen resistant malignant breast cell.
  • sphingosine kinase mediated signalling should be understood as a reference to the intracellular signalling pathway which utilises sphingosine kinase or functional derivatives thereof.
  • Sphingosine kinase is a key regulatory enzyme in the activity of the sphingosine kinase signalling pathway and functions to generate the endogenous sphingolipid mediator sphingosine- 1 -phosphate. Still further, and without limiting the present invention in any way, sphingosine kinase has been found to form part of a novel signalling system which mediates EGFR transactivation.
  • oestrogen stimulates activation of sphingosine kinase and the release of sphingosine- 1 -phosphate, by which oestrogen is able to activate a sphingosine- 1 -phosphate specific GPCR, Edg3, leading to EGFR transactivation in a matrix metalloprotease-dependent manner.
  • references to modulating the "functioning" of sphingosine kinase mediated signalling should be understood as a reference to modulating the level of sphingosine kinase activity which is present in any given cell as opposed to the concentration of sphingosine kinase, per se.
  • a decrease in the intracellular concentration of sphingosine kinase will generally correlate to a decrease in the level of sphingosine kinase functional activity which is observed in a cell, the person skilled in the art would also understand that decreases in the level of activity can be achieved by means other than merely decreasing absolute intracellular sphingosine kinase concentrations.
  • reference to modulation of sphingosine kinase mediated signalling does not necessarily mean that the activity of this signalling pathway need be returned to baseline levels. Rather, the level need only be one which is changed relative to the pretreatment level. Accordingly, the method of the present invention may be applied to at least reduce uncontrolled cellular proliferation until such time as it can be entirely ceased.
  • the subject modulation may be transient or long term, depending on the requirements of the particular situation.
  • modulation of the "activity" of sphingosine kinase mediated signalling should be understood as a reference to either up-regulating or down-regulating the signalling mechanism.
  • the preferred method is to down-regulate the subject signalling in the context of a patient exhibiting uncontrolled cellular proliferation, there may be certain circumstances where it is desirable to up-regulate sphingosine kinase signalling, for example to facilitate the analysis of a cell line model or to facilitate the rapid expansion of a cellular population without necessarily inducing transformation of the subject cells.
  • Either form of modulation may be achieved by any suitable means and include:
  • sphingosine kinase mediated signalling pathway such as sphingosine kinase and/or sphingosine- 1 -phosphate, such that either more or less of these molecules are available for activation and/or to interact with downstream targets such as Edg-3.
  • agonising or antagonising the components of the sphingosine kinase mediated signalling pathway such as sphingosine kinase and/or sphingosine- 1 -phosphate, such that the functional effectiveness of any one or more of these molecules is either increased or decreased.
  • increasing the half life of sphingosine kinase may achieve an increase in the overall level of sphingosine kinase activity without actually necessitating an increase in the absolute intracellular concentration of sphingosine kinase.
  • the partial antagonism of sphingosine kinase or sphingosine-1 -phosphate may act to reduce, although not necessarily eliminate, the effectiveness of the signalling which they provide. Accordingly, this may provide a means of down- regulating sphingosine kinase mediated signalling without necessarily down- regulating the absolute concentrations of the components of this pathway.
  • introducing into a cell a proteinaceous or non-proteinaceous molecule which modulates transcriptional and/or translational regulation of a gene, wherein this gene may be any sphingosine kinase signalling pathway component, in particular sphingosine kinase or sphingosine-1 -phosphate or functional portion thereof, or some other gene which directly or indirectly modulates the expression of the components of sphingosine kinase mediated signalling pathways;
  • a proteinaceous or non-proteinaceous molecule which functions as an antagonist to any one or more components of the sphingosine kinase signalling pathway expression product such as N'N'-dimethylsphingosine (sphingosine kinase chemical inhibitor), DL-threo-dihydrosphingosine or SphK G 2D (mutant sphingosine kinase dominant negative).
  • sphingosine kinase signalling pathway expression product such as N'N'-dimethylsphingosine (sphingosine kinase chemical inhibitor), DL-threo-dihydrosphingosine or SphK G 2D (mutant sphingosine kinase dominant negative).
  • the proteinaceous molecules described above may be derived from any suitable source such as natural, recombinant or synthetic sources and includes fusion proteins or molecules which have been identified following, for example, natural product screening.
  • the reference to non-proteinaceous molecules may be, for example, a reference to a nucleic acid molecule or it may be a molecule derived from natural sources, such as for example natural product screening, or may be a chemically synthesised molecule.
  • the present invention contemplates analogues of the sphingosine kinase signalling pathway components or small molecules capable of acting as agonists or antagonists.
  • Chemical agonists may not necessarily be derived from the components of the sphingosine kinase mediated signalling pathway product but may share certain conformational similarities. Alternatively, chemical agonists may be specifically designed to meet certain physiochemical properties. Antagonists may be any compound capable of blocking, inhibiting or otherwise preventing components of the sphingosine kinase mediated signalling pathway from carrying out their normal biological function, such as molecules which prevent activation or else prevent the downstream functioning of activated molecules.
  • Antagonists include monoclonal antibodies, dominant-negative sphingosine kinase mutants and antisense nucleic acids which prevent transcription or translation of the genes or mRNA of components of the sphingosine kinase mediated signalling pathway in mammalian cells. Modulation of expression may also be achieved utilising antigens, RNA (particularly siRNA), ribosomes, DNAzymes, RNA aptamers, antibodies or molecules suitable for use in cosuppression.
  • RNA particularly siRNA
  • ribosomes ribosomes
  • DNAzymes DNAzymes
  • RNA aptamers antibodies or molecules suitable for use in cosuppression.
  • modulatory agents The proteinaceous and non-proteinaceous molecules referred to in points (i)-(vii), above, are herein collectively referred to as "modulatory agents”.
  • Screening for the modulatory agents hereinbefore defined can be achieved by any one of several suitable methods including, but in no way limited to, contacting a cell comprising the sphingosine kinase gene (or any other gene which encodes a component of the sphingosine kinase signalling pathway) or functional equivalent or derivative thereof with an agent and screening for the modulation of sphingosine kinase protein production or functional activity, modulation of the expression of a nucleic acid molecule encoding sphingosine kinase or modulation of the activity or expression of a downstream sphingosine kinase cellular target. Detecting such modulation can be achieved utilising techniques such as Western blotting, electrophoretic mobility shift assays and/or the readout of reporters of sphingosine kinase activity such as luciferases, CAT and the like.
  • the sphingosine kinase gene or functional equivalent or derivative thereof may be naturally occurring in the cell which is the subject of testing or it may have been transfected into a host cell for the purpose of testing. Further, the naturally occurring or transfected gene may be constitutively expressed - thereby providing a model useful for, inter alia, screening for agents which down regulate sphingosine kinase activity, at either the nucleic acid or expression product levels, or the gene may require activation - thereby providing a model useful for, inter alia, screening for agents which up regulate sphingosine kinase expression.
  • a sphingosine kinase nucleic acid molecule may comprise the entire sphingosine kinase gene or it may merely comprise a portion of the gene such as the portion which regulates expression of the sphingosine kinase product.
  • the sphingosine kinase promoter region may be transfected into the cell which is the subject of testing.
  • detecting modulation of the activity of the promoter can be achieved, for example, by ligating the promoter to a reporter gene.
  • the promoter may be ligated to luciferase or a CAT reporter, the modulation of expression of which gene can be detected via modulation of fluorescence intensity or CAT reporter activity, respectively.
  • the subject of detection could be a downstream sphingosine kinase regulatory target (for example, sphingosine- 1 -phosphate), rather than sphingosine kinase itself.
  • sphingosine kinase regulatory target for example, sphingosine- 1 -phosphate
  • the subject of detection could be a downstream sphingosine kinase regulatory target (for example, sphingosine- 1 -phosphate), rather than sphingosine kinase itself.
  • sphingosine kinase binding sites ligated to a minimal reporter for example, modulation of sphingosine kinase activity can be detected by screening for the modulation of the proliferative capacity of a breast cell.
  • This is an example of an indirect system where modulation of sphingosine kinase expression, / ⁇ r se, is not the subject of detection. Rather, modulation of the molecules which s
  • These methods provide a mechanism for performing high throughput screening of putative modulatory agents such as the proteinaceous or non-proteinaceous agents comprising synthetic, combinatorial, chemical and natural libraries. These methods will also facilitate the detection of agents which bind either the sphingosine kinase nucleic acid molecule or expression product itself or which modulate the expression of an upstream molecule, which upstream molecule subsequently modulates sphingosine kinase expression or expression product activity. Accordingly, these methods provide a mechanism of detecting agents which either directly or indirectly modulate sphingosine kinase expression and/or activity.
  • the agents which are utilised in accordance with the method of the present invention may take any suitable form.
  • proteinaceous agents may be glycosylated or unglycosylated, phosphorylated or dephosphorylated to various degrees and/or may contain a range of other molecules used, linked, bound or otherwise associated with the proteins such as amino acids, lipid, carbohydrates or other peptides, polypeptides or proteins.
  • the subject non-proteinaceous molecules may also take any suitable form.
  • Both the proteinaceous and non-proteinaceous agents herein described may be linked, bound or otherwise associated with any other proteinaceous or non-proteinaceous molecules.
  • said agent is associated with a molecule which permits its targeting to a localised region.
  • the subject proteinaceous or non-proteinaceous molecule may act either directly or indirectly to modulate the expression of sphingosine kinase or the activity of the sphingosine kinase expression product.
  • Said molecule acts directly if it associates with the sphingosine kinase nucleic acid molecule or expression product to modulate expression or activity, respectively.
  • Said molecule acts indirectly if it associates with a molecule other than the sphingosine kinase nucleic acid molecule or expression product which other molecule either directly or indirectly modulates the expression or activity of the sphingosine kinase nucleic acid molecule or expression product, respectively.
  • the method of the present invention encompasses the regulation of sphingosine kinase nucleic acid molecule expression or expression product activity via the induction of a cascade of regulatory steps.
  • expression refers to the transcription and translation of a nucleic acid molecule.
  • Reference to “expression product” is a reference to the product produced from the transcription and translation of a nucleic acid molecule.
  • Reference to “modulation” should be understood as a reference to up-regulation or down-regulation.
  • “Derivatives” of the molecules herein described include fragments, parts, portions or variants from either natural or non-natural sources.
  • Non- natural sources include, for example, recombinant or synthetic sources.
  • recombinant sources is meant that the cellular source from which the subject molecule is harvested has been genetically altered. This may occur, for example, in order to increase or otherwise enhance the rate and volume of production by that particular cellular source.
  • Parts or fragments include, for example, active regions of the molecule.
  • Derivatives may be derived from insertion, deletion or substitution of amino acids.
  • Amino acid insertional derivatives include amino and/or carboxylic terminal fusions as well as intrasequence insertions of single or multiple amino acids.
  • Insertional amino acid sequence variants are those in which one or more amino acid residues are introduced into a predetermined site in the protein although random insertion is also possible with suitable screening of the resulting product.
  • Deletional variants are characterised by the removal of one or more amino acids from the sequence.
  • Substitutional amino acid variants are those in which at least one residue in a sequence has been removed and a different residue inserted in its place. Additions to amino acid sequences include fusions with other peptides, polypeptides or proteins, as detailed above.
  • Derivatives also include fragments having particular epitopes or parts of the entire protein fused to peptides, polypeptides or other proteinaceous or non-proteinaceous molecules.
  • sphingosine kinase or derivative thereof may be fused to a molecule to facilitate its entry into a cell.
  • Analogs of the molecules contemplated herein include, but are not limited to, modification to side chains, incorporating of unnatural amino acids and/or their derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods which impose conformational constraints on the proteinaceous molecules or their analogs.
  • nucleic acid sequences which may be utilised in accordance with the method of the present invention may similarly be derived from single or multiple nucleotide substitutions, deletions and/or additions including fusion with other nucleic acid molecules.
  • the derivatives of the nucleic acid molecules utilised in the present invention include oligonucleotides, PCR primers, antisense molecules, molecules suitable for use in cosuppression and fusion of nucleic acid molecules.
  • Derivatives of nucleic acid sequences also include degenerate variants.
  • a "variant" of sphingosine kinase or sphingosine- 1 -phosphate should be understood to mean molecules which exhibit at least some of the functional activity of the form of sphingosine kinase or sphingosine- 1 -phosphate of which it is a variant.
  • a variation may take any form and may be naturally or non-naturally occurring.
  • a mutant molecule is one which exhibits modified functional activity.
  • homologue is meant that the molecule is derived from a species other than that which is being treated in accordance with the method of the present invention. This may occur, for example, where it is determined that a species other than that which is being treated produces a form of sphingosine kinase or sphingosine-1 -phosphate which exhibits similar and suitable functional characteristics to that of the sphingosine kinase or sphingosine- 1- phosphate which is naturally produced by the subject undergoing treatment.
  • Chemical and functional equivalents should be understood as molecules exhibiting any one or more of the functional activities of the subject molecule, which functional equivalents may be derived from any source such as being chemically synthesised or identified via screening processes such as natural product screening.
  • functional equivalents can be designed and/or identified utilising well known methods such as combinatorial chemistry or high throughput screening of recombinant libraries or following natural product screening.
  • libraries containing small organic molecules may be screened, wherein organic molecules having a large number of specific parent group substitutions are used.
  • a general synthetic scheme may follow published methods (eg., Bunin BA, et al. (1994) Proc. Natl. Acad. Set USA, 91:4708-4712; DeWitt SH, et al. (1993) Proc. Natl. Acad. ScL USA, 90:6909-6913). Briefly, at each successive synthetic step, one of a plurality of different selected substituents is added to each of a selected subset of tubes in an array, with the selection of tube subsets being such as to generate all possible permutation of the different substituents employed in producing the library.
  • One suitable permutation strategy is outlined in US. Patent No. 5,763,263.
  • Ligands discovered by screening libraries of this type may be useful in mimicking or blocking natural ligands or interfering with the naturally occurring ligands of a biological target.
  • they may be used as a starting point for developing sphingosine kinase and/or sphingosine-1 -phosphate analogues which exhibit properties such as more potent pharmacological effects.
  • Sphingosine kinase and/or sphingosine-1 -phosphate or a functional part thereof may according to the present invention be used in combination libraries formed by various solid-phase or solution-phase synthetic methods (see for example U.S. Patent No. 5,763,263 and references cited therein).
  • U.S. Patent No. 5,763,263 By use of techniques, such as that disclosed in U.S. Patent No. 5,753,187, millions of new chemical and/or biological compounds may be routinely screened in less than a few weeks. Of the large number of compounds identified, only those exhibiting appropriate biological activity are further analysed.
  • oligomeric or small-molecule library compounds capable of interacting specifically with a selected biological agent, such as a biomolecule, a macromolecule complex, or cell, are screened utilising a combinational library device which is easily chosen by the person of skill in the art from the range of well-known methods, such as those described above.
  • a selected biological agent such as a biomolecule, a macromolecule complex, or cell
  • each member of the library is screened for its ability to interact specifically with the selected agent.
  • a biological agent is drawn into compound-containing tubes and allowed to interact with the individual library compound in each tube. The interaction is designed to produce a detectable signal that can be used to monitor the presence of the desired interaction.
  • the biological agent is present in an aqueous solution and further conditions are adapted depending on the desired interaction. Detection may be performed for example by any well-known functional or non-functional based method for the detection of substances.
  • sphingosine kinase and/or sphingosine-1 -phosphate it may also be desirable to identify and utilise molecules which function agonistically or, most preferably, antagonistically to sphingosine kinase and/or sphingosine-1 -phosphate in order to up or down-regulate the functional activity of sphingosine kinase and/or sphingosine-1 -phosphate in relation to modulating EGFR- mediated cellular proliferation.
  • the use of such molecules is described in more detail below.
  • the subject molecule is proteinaceous, it may be derived, for example, from natural or recombinant sources including fusion proteins or following, for example, the screening methods described above.
  • the non-proteinaceous molecule may be, for example, a chemical or synthetic molecule which has also been identified or generated in accordance with the methodology identified above. Accordingly, the present invention contemplates the use of chemical analogues of sphingosine kinase and/or sphingosine-1 -phosphate capable of acting as agonists or antagonists.
  • Chemical agonists may not necessarily be derived from sphingosine kinase and/or sphingosine-1 -phosphate but may share certain conformational similarities.
  • chemical agonists may be specifically designed to mimic certain physiochemical properties of sphingosine kinase and/or sphingosine-1 -phosphate.
  • Antagonists may be any compound capable of blocking, inhibiting or otherwise preventing sphingosine kinase and/or sphingosine-1 -phosphate from carrying out its normal biological functions.
  • Antagonists include monoclonal antibodies specific for sphingosine kinase and/or sphingosine-1 -phosphate or parts of sphingosine kinase and/or sphingosine-1 -phosphate.
  • Analogues of sphingosine kinase and/or sphingosine-1 -phosphate or of sphingosine kinase and/or sphingosine-1 -phosphate agonistic or antagonistic agents contemplated herein include, but are not limited to, modifications to side chains, incorporating unnatural amino acids and/or derivatives during peptide, polypeptide or protein synthesis and the use of crosslinkers and other methods which impose conformational constraints on the analogues.
  • the specific form which such modifications can take will depend on whether the subject molecule is proteinaceous or non-proteinaceous. The nature and/or suitability of a particular modification can be routinely determined by the person of skill in the art.
  • examples of side chain modifications contemplated by the present invention include modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH4; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction with NaBH 4 .
  • modifications of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH4; amidination with methylacetimidate; acylation with acetic anhydride; carbamoylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS);
  • the guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2,3-butanedione, phenylglyoxal and glyoxal.
  • the carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivatisation, for example, to a corresponding amide.
  • Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteic acid; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4-chloromercuribenzoate, 4-chloromercuriphenylsulphonic acid, phenylmercury chloride, 2-chloromercuri-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.
  • Tryptophan residues may be modified by, for example, oxidation with N-bromosuccinimide or alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphenyl halides.
  • Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
  • Modification of the imidazole ring of a histidine residue may be accomplished by alkylation with iodoacetic acid derivatives or N-carboethoxylation with diethylpyrocarbonate.
  • Examples of incorporating unnatural amino acids and derivatives during protein synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3- hydroxy- 5 -phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D-isomers of amino acids.
  • a list of unnatural amino acids contemplated herein is shown in Table 1.
  • Non-conventional Code Non-conventional Code amino acid amino acid ⁇ -aminobuty ⁇ c acid Abu L-N-methylalanine Nmala ⁇ -amino- ⁇ -methylbutyrate Mgabu L-N-methylarginine Nmarg aminocyclopropane- Cpro L-N-methylasparagine Nmasn carboxylate L-N-methylaspartic acid Nmasp aminoisobutyric acid Aib L-N-methylcysteine Nmcys aminonorbornyl- Norb L-N-methylglutamine Nmgln carboxylate L-N-methylglutamic acid Nmglu cyclohexylalanine Chexa L-N-methylhistidine Nmhis cyclopentylalanine Cpen L-N-niethylisolleucine Nmile
  • D-N-methyltryptophan Dnmtrp N-(l-methylethyl)glycine Nval
  • D-N-methyltyrosine Dnmtyr N-methyla-napthylalanine Nmanap
  • the method of the present invention contemplates the modulation of EGFR-mediated cellular activity, in particular proliferation, both in vitro and in vivo.
  • the preferred method is to treat an individual in vivo it should nevertheless be understood that it may be desirable that the method of the invention may be applied in an in vitro environment, for example to provide an in vitro model for the analysis of cellular proliferation, such as uncontrollable cellular proliferation.
  • the application of the method of the present invention to an in vitro environment may extend to providing a readout mechanism for screening technologies such as those hereinbefore described. That is, molecules identified utilising these screening techniques can be assayed to observe the extent and/or nature of their functional effect on hyperglycaemia- induced endothelial cell functioning.
  • the preferred method is to downregulate EGFR-mediated cellular proliferation, in particular agonist induced EGFR-mediated cellular proliferation (for example in order to downregulate the progression of uncontrolled cellular proliferation), it should be understood that there may also be circumstances in which it is desirable to upregulate the subject functional activity, for example to facilitate an episode of rapid but controlled cellular proliferation.
  • the present invention is applied to a mammal in order to modulate EGFR-mediated functional activity in vivo.
  • a further aspect of the present invention relates to the use of the invention in relation to the treatment and/or prophylaxis of disease conditions.
  • the method of the present invention contributes significantly to this objective in that it facilitates a means of downregulating unwanted agonist induced EGFR-mediated cellular functional activity, this being particularly important in the context of agonist induced EGFR-mediated unwanted cellular proliferation. Accordingly, the method of the present invention is particularly useful, but in no way limited to, use in the treatment of primary and secondary malignancies such as those associated with solid tumours of the breast, colon, stomach, lung, brain, bone, oesophagus and pancreas. Although the preferred method is to down-regulate uncontrolled cellular proliferation in a subject, up-regulation of cell growth may also be desirable in certain circumstances such as to promote wound healing, angiogenesis or other healing process.
  • yet another aspect of the present invention is directed to a method for the treatment and/or prophylaxis of a condition characterised by aberrant, unwanted or otherwise inappropriate EGFR-mediated cell activity, said method comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulates EGFR-mediated intracellular signalling.
  • a method for the treatment and/or prophylaxis of a condition characterised by aberrant, unwanted or otherwise inappropriate agonist induced EGFR-mediated cell activity comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulates said agonist induced EGFR-mediated intracellular signalling.
  • a method for the treatment and/or prophylaxis of a condition characterised by aberrant, unwanted or otherwise inappropriate agonist induced EGFR-mediated cellular proliferation comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to modulate the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulate EGFR-mediated intracellular signalling.
  • Reference to "aberrant, unwanted or otherwise inappropriate” cellular proliferation should be understood as a reference to over active cell growth, to physiologically normal cell growth which is inappropriate in that it is unwanted or to insufficient cell growth.
  • said inappropriate cell growth is uncontrolled cell proliferation.
  • said cellular proliferation is uncontrolled neoplastic cell proliferation.
  • said malignant cell is derived from the breast, colon, stomach, lung, brain, bone, oesophagus, pancreas, ovary or uterus.
  • said aberrant EGFR-mediated cellular proliferation is agonist induced.
  • said condition is an oestrogen induced breast cell malignancy or an anti-oestrogen resistant breast cell malignancy.
  • a method for the treatment and/or prophylaxis of an oestrogen induced breast cell malignancy comprising administering to said mammal an effective amount of an agent for a time and under conditions sufficient to downregulate the functioning of sphingosine kinase mediated signalling in said cell wherein downregulating said sphingosine kinase signalling downregulates EGFR-mediated intracellular signalling.
  • the method of the present invention preferably facilitates the subject proliferation being reduced, retarded or otherwise inhibited.
  • Reference to "reduced, retarded or otherwise inhibited” should be understood as a reference to inducing or facilitating the partial or complete inhibition of cell proliferation.
  • the subject of the treatment or prophylaxis is generally a mammal such as but not limited to human, primate, livestock animal (eg. sheep, cow, horse, donkey, pig), companion animal (eg. dog, cat), laboratory test animal (eg. mouse, rabbit, rat, guinea pig, hamster), captive wild animal (eg. fox, deer).
  • livestock animal eg. sheep, cow, horse, donkey, pig
  • companion animal eg. dog, cat
  • laboratory test animal eg. mouse, rabbit, rat, guinea pig, hamster
  • captive wild animal eg. fox, deer
  • the mammal is a human or primate.
  • the mammal is a human.
  • the present invention is exemplified utilising a murine model, this is not intended as a limitation on the application of the method of the present invention to other species, in particular, humans.
  • treatment does not necessarily imply that a mammal is treated until total recovery.
  • prophylaxis does not necessarily mean that the subject will not eventually contract a disease condition. Accordingly, treatment and prophylaxis including amelioration of the symptoms of a particular condition or preventing or otherwise reducing the risk of developing a particular condition.
  • treatment and prophylaxis including amelioration of the symptoms of a particular condition or preventing or otherwise reducing the risk of developing a particular condition.
  • the term “prophylaxis” may be considered as reducing the severity or onset of a particular condition. “Treatment” may also reduce the severity of an existing condition.
  • modulatory agent in the form of a pharmaceutical composition, may be performed by any convenient means.
  • the modulatory agent of the pharmaceutical composition is contemplated to exhibit therapeutic activity when administered in an amount which depends on the particular case. The variation depends, for example, on the human or animal and the modulatory agent chosen. A broad range of doses may be applicable. Considering a patient, for example, from about 0.1 mg to about 1 mg of modulatory agent may be administered per kilogram of body weight per day. Dosage regimes may be adjusted to provide the optimum therapeutic response.
  • the modulatory agent may be administered in a convenient manner such as by the oral, intravenous (where water soluble), intraperitoneal, intramuscular, subcutaneous, intradermal or suppository routes or implanting (e.g. using slow release molecules).
  • the modulatory agent may be administered in the form of pharmaceutically acceptable nontoxic salts, such as acid addition salts or metal complexes, e.g. with zinc, iron or the like (which are considered as salts for purposes of this application).
  • the tablet may contain a binder such as tragacanth, corn starch or gelatin; a disintegrating agent, such as alginic acid; and a lubricant, such as magnesium stearate.
  • Routes of administration include, but are not limited to, respiratorally, intratracheally, nasopharyngeal ⁇ , intravenously, intraperitoneally, subcutaneously, intracranially, intradermally, intramuscularly, intraoccularly, intrathecally, intracereberally, intranasally, infusion, orally, rectally, via IV drip patch and implant.
  • the present invention relates to the use of an agent capable of modulating the functional activity of sphingosine kinase mediated signalling in the manufacture of a medicament for the treatment and/or prophylaxis of a condition characterised by aberrant, unwanted or otherwise inappropriate EGFR-mediated cell activity wherein downregulating said sphingosine kinase signalling downregulates EGFR-mediated intracellular signalling.
  • said cell activity is cellular proliferation.
  • said cellular proliferation is uncontrolled neoplastic cell proliferation and even more preferably malignant cell proliferation.
  • said malignant cell is derived from the breast, colon, stomach, lung, brain, bone, oesophagus, pancreas, ovary or uterus.
  • said aberrant EGFR-mediated cellular proliferation is agonist induced.
  • said condition is an oestrogen induced breast cell malignancy or an anti-oestrogen resistant breast cell malignancy.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a modulatory agent as hereinbefore defined and one or more pharmaceutically acceptable carriers and/or diluents.
  • Said modulatory agents are referred to as the active ingredients.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion or may be in the form of a cream or other form suitable for topical application. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of superfactants.
  • the preventions of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilisation.
  • dispersions are prepared by incorporating the various sterilised active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof.
  • the active ingredients When the active ingredients are suitably protected they may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet.
  • the active compound For oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • Such compositions and preparations should contain at least 1% by weight of active compound.
  • the percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit. The amount of active compound in such therapeutically useful compositions in such that a suitable dosage will be obtained.
  • Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit form contains between about 0.1 ⁇ g and
  • the tablets, troches, pills, capsules and the like may also contain the components as listed hereafter: a binder such as gum, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin may be added or a flavouring agent such as peppermint, oil of wintergreen, or cherry flavouring.
  • a binder such as gum, acacia, corn starch or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid and the like
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose, lactose or saccharin
  • a flavouring agent such as peppermint, oil of wintergreen, or
  • tablets, pills, or capsules may be coated with shellac, sugar or both.
  • a syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and > propylparabens as preservatives, a dye and flavouring such as cherry or orange flavour.
  • any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed.
  • the active compound(s) may be incorporated into sustained-release preparations and formulations.
  • the pharmaceutical composition may also comprise genetic molecules such as a vector capable of transfecting target cells where the vector carries a nucleic acid molecule encoding a modulatory agent.
  • the vector may, for example, be a viral vector.
  • Yet another aspect of the present invention relates to modulatory agents, as hereinbefore defined, when used in the method of the present invention.
  • the human breast cancer MCF-7 cells (ER ⁇ +/ ⁇ +; ATCC HTB-22) were cultured in phenol red-free Dulbecco's modified Eagle's medium (CSL Biosciences, Parkville, Australia) containing 10% Fetal Bovine Serum (FBS).
  • FBS Fetal Bovine Serum
  • siRNA duplexes with 3 '-Fluorescein modification were purchased from Qiagen-Xeragon (Germantown, MD).
  • the siRNA targeted sequences were: AAGAGCTGCAAGGCCTTGCCC (SEQ ID NO: 1) (SphKl),
  • AACCTCATCCAGACAGAACGA (SEQ ID NO:2) (SphK2), and AATTCTCCGAACGTGTCACGT (SEQ ID NO:3)(for a scrambled control siRNA).
  • the following 18-mer phosphothioate oligonucleotides were synthesized by Geneworks (Australia): EDG-3 antisense, 5'-CGGGAGGGCAGTTGCCAT-S ' (SEQ ID NO:4); EDG- 3 sense, 5'-ATGGCAACTGCCCTCCCG-S' (SEQ ID NO:5).
  • Lipofectamine-2000 reagent (Invitrogen) was used and MCF-7 cells were seeded into 6-well plates at a density of 50,000 cells per well the day before the experiment. After 36-48 h transfection, the targeted gene expression levels were detected by RT-PCR and/or Westernblot. Reverse transcriptase polymerase chain reaction (RT-PCR) analysis.
  • RT-PCR Reverse transcriptase polymerase chain reaction
  • Omniscript reverse transcriptase Qiagen
  • oligo-dT primer Geneworks
  • the primers used to amplify were: SphKl (sense) 5'-TTGAACCATTATGCTGGCTATGA (SEQ ID NO:6) and SphKl (antisense) 5'- GCAGGTGTCTTGGAACCC(SEQ ID NO.-7); SphK2 (sense) 5'- GCTCAACTGCTCACTGTTGC (SEQ ID NO:8) and SphK2 (antisense) 5'- GCAGGTCAGACACAGAACGA (SEQ ID NO:9); Edg-3 (sense) 5'- GCCCTCTCGTGGATTTTGG (SEQ ID NO-.10) and Edg-3 (antisense) 5'- CGCATGGAGACGATCAGTTG (SEQ ID NO: 11).
  • the amplified products were visualized by electrophoresis on 1.5% agarose stained with ethidium bromide. Images were captured on UVitec Gel documentation system.
  • Cells were harvested and lysed by sonication in lysis buffer containing 50 mM Tris/HCl (pH 7.4), 10% glycerol, 0.05% Triton X-100, 150 mM NaCl, 1 mM dithiothreitol, 2 mM Na 3 VO 4 , 10 mM NaF, 1 mM EDTA and protease inhibitors (Roche Molecular Biochemicals). Aliquots of cell lysates were resolved by 8-12% SDS-PAGE and transferred to Hybond-P membranes (Amersham). The membranes were then probed with appropriate antibodies according to manufacturer's standard method. The immunocomplexes were detected with an enhanced chemiluminescence PLUS kit
  • MCF-7 cells were seeded onto fibronectin coated 8-well chamber slides (Lab-Tech) and cultured for 48 hours. After stimulation, cells were fixed with 4% paraformaldehyde and permeabilised in 0.1% Triton X-IOO. The cells were then incubated with monoclonal anti- Edg-3 (1:100) and polyclonal anti-EGFR (1:100) antibodies and indirect immunofluorescence detected by incubation with the fluorophore (Alexa Fluor 488 or Fluor 594 ) coupled secondary antibodies. The fluorescence stained cells were imaged by epifluorescent microscopy on an Olympus BX-51 microscope equipped with a Cool Snap FX charge-coupled device camera (Photometries). Images were analysed with V++ software (Digital Optics Ltd. Auckland New Zealand).
  • SphK activity was routinely determined by incubating the cytosolic fraction with 5 mM D- erythro-sphingosine dissolved in 0.1% Triton X-100 and [ ⁇ 32P]ATP for 30 min at 37 0 C as described previously (Xia et ah, 1998, Proc Natl Acad Sci USA, 95:14196-14201).
  • the enzyme activity was defined as the amount of SlP formation (pmol)/min/mg protein.
  • cells were metabolically labelled with [3H] serine (5 ⁇ Ci/ml) for 48h.
  • SlP stimulates activation of EGFR in MCF-7 cells.
  • Figure IA shows that in response to 1 mmol/L SlP, tyrosine phosphorylation of EGFR increased in a time-dependent manner in MCF-7 cells. EGFR phosphorylation peaked at 10 min decreasing thereafter but was still evident at 240 min post treatment. In parallel, ERK1/2, key downstream signalling molecules of EGFR 5 were also phosphorylated in a similar time-dependent pattern to the EGFR phosphorylation (Figure IA). The concentration response for SlP showed an approximate EC 5 0 of 5 nmol/L for phosphorylation of both EGFR and ERK 1/2, and maximum phosphorylation was observed at about 500 nmol/L ( Figure IB). Collectively, these results demonstrate an ability of SlP to induce EGFR activation in the breast cancer cells.
  • Src family kinases have been suggested to play a signalling role in GPCR-mediated transactivation of EGFR (Gschwind et ah, 2001, supra).
  • PP2 the Src inhibitor
  • FIG. 2A both E2 and S IP-stimulated EGFR transactivation were significantly inhibited by PP2 treatment.
  • HB-EGF heparin-binding EGF
  • MMP matrix metalloprotease
  • SphKl activation is involved in E2-induced EGFR transactivation
  • SphKl and SphK2 Two mammalian SphK isoforms (i.e., SphKl and SphK2) have been cloned and both isoforms account for total cellular SphK activity (Kohama et ah, 1998, J Biol Chem, 273:23722-23728; Liu et al., 1999, MoI Biol Cell, 10:1179-1190).
  • a siRNA strategy was used to knock down each SphK isoform gene expression in MCF-7 cells.
  • SlP receptor, Edg-3 is required for the SphKl -dependent transactivation of EGFR by E2.
  • Estrogen-induced activation of Erk-1 and Erk-2 requires the G protein-coupled receptor homolog, GPR30, and occurs via trans-activation of the epidermal growth factor receptor through release of HB-EGF.
  • Tumor necrosis factor-alpha induces adhesion molecule expression through the sphingosine kinase pathway.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Virology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

La présente invention concerne généralement un procédé de modulation d’activité fonctionnelle cellulaire induite par l’EGFR et les agents utiles pour ce faire. Plus particulièrement, la présente invention concerne un procédé de modulation d’antagoniste induit par la prolifération cellulaire induite par l’EGFR en modulant en amont la signalisation de sphingosine kinase intracellulaire. Le procédé de l’invention s’avère utile, entre autres, dans le traitement et/ou la prophylaxie des états caractérisés par le fonctionnement cellulaire induit par l’EGFR, en particulier une prolifération cellulaire aberrante induite par l’EGFR.
EP06752619A 2005-06-21 2006-06-21 Modulation de la signalisation de l'egfr par modulation de la signalisation de sphingosine kinase Withdrawn EP1910523A4 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2005903259A AU2005903259A0 (en) 2005-06-21 A method of modulating cellular activity and agents for use therein
PCT/AU2006/000865 WO2006135967A1 (fr) 2005-06-21 2006-06-21 Modulation de la signalisation de l’egfr par modulation de la signalisation de sphingosine kinase

Publications (2)

Publication Number Publication Date
EP1910523A1 true EP1910523A1 (fr) 2008-04-16
EP1910523A4 EP1910523A4 (fr) 2009-05-27

Family

ID=37570026

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06752619A Withdrawn EP1910523A4 (fr) 2005-06-21 2006-06-21 Modulation de la signalisation de l'egfr par modulation de la signalisation de sphingosine kinase

Country Status (4)

Country Link
EP (1) EP1910523A4 (fr)
JP (1) JP2008546720A (fr)
CA (1) CA2612640A1 (fr)
WO (1) WO2006135967A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2166094A1 (fr) 2008-09-23 2010-03-24 Ecole Normale Superieure De Lyon Procédés pour le prolongement des avantages sanitaires déclenchés par une restriction alimentaire utilisant un inhibiteur de la sphingosine kinase

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999061581A2 (fr) * 1998-05-26 1999-12-02 Office Of The Dean Of Research And Graduate Education Clonage, expression et procedes d'utilisation de la sphingosine kinase
WO2001085953A1 (fr) * 2000-05-11 2001-11-15 Medvet Science Pty. Ltd. Sphingosine kinase et ses utilisations
WO2004046332A2 (fr) * 2002-11-19 2004-06-03 Amgen Inc. Genes amplifies impliques dans un cancer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999061581A2 (fr) * 1998-05-26 1999-12-02 Office Of The Dean Of Research And Graduate Education Clonage, expression et procedes d'utilisation de la sphingosine kinase
WO2001085953A1 (fr) * 2000-05-11 2001-11-15 Medvet Science Pty. Ltd. Sphingosine kinase et ses utilisations
WO2004046332A2 (fr) * 2002-11-19 2004-06-03 Amgen Inc. Genes amplifies impliques dans un cancer

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
DOLL ET AL: "The epidermal growth factor stimulates sphingosine kinase-1 expression and activity in the human mammary carcinoma cell line MCF7" BIOCHIMICA AND BIOPHYSICA ACTA. MOLECULAR AND CELL BIOLOGY OFLIPIDS, ELSEVIER, AMSTERDAM, NL, vol. 1738, no. 1-3, 30 December 2005 (2005-12-30), pages 72-81, XP005262452 ISSN: 1388-1981 *
FRENCH KEVIN J ET AL: "Discovery and evaluation of inhibitors of human sphingosine kinase." CANCER RESEARCH, vol. 63, no. 18, 15 September 2003 (2003-09-15), pages 5962-5969, XP002522495 ISSN: 0008-5472 *
MACEYKA M ET AL: "Sphingosine kinase, sphingosine-1-phosphate, and apoptosis" BIOCHIMICA AND BIOPHYSICA ACTA. MOLECULAR AND CELL BIOLOGY OFLIPIDS, ELSEVIER, AMSTERDAM, NL, vol. 1585, no. 2-3, 30 December 2002 (2002-12-30), pages 193-201, XP004402377 ISSN: 1388-1981 *
NAVA V E ET AL: "Sphingosine kinase type 1 promotes estrogen-dependent tumorigenesis of breast cancer MCF-7 cells" EXPERIMENTAL CELL RESEARCH, ACADEMIC PRESS, US, vol. 281, no. 1, 15 November 2002 (2002-11-15), pages 115-127, XP002999187 ISSN: 0014-4827 *
PYNE S ET AL: "REVIEW ARTICLE SPHINGOSINE 1-PHOSPHATE SIGNALLING IN MAMMALIAN CELLS" BIOCHEMICAL JOURNAL, THE BIOCHEMICAL SOCIETY, LONDON, vol. 349, 1 January 2000 (2000-01-01), pages 385-402, XP000939036 ISSN: 0264-6021 *
SARKAR ET AL: "Sphingosine kinase 1 is required for migration, proliferation and survival of MCF-7 human breast cancer cells" FEBS LETTERS, ELSEVIER, AMSTERDAM, NL, vol. 579, no. 24, 10 October 2005 (2005-10-10), pages 5313-5317, XP005098804 ISSN: 0014-5793 *
See also references of WO2006135967A1 *
SUKOCHEVA OLGA A ET AL: "Sphingosine kinase (SphK) mediates transactivation of the epidermal growth factor receptor (EGFR) by estrogen in breast cancer cells." PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL MEETING, vol. 47, April 2006 (2006-04), page 690, XP002522496 & 97TH ANNUAL MEETING OF THE AMERICAN-ASSOCIATION-FOR-CANCER-RESEARCH (AACR); WASHINGTON, DC, USA; APRIL 01 -05, 2006 ISSN: 0197-016X *
SUKOCHEVA OLGA A ET AL: "Sphingosine kinase transmits estrogen signaling in human breast cancer cells." MOLECULAR ENDOCRINOLOGY, vol. 17, no. 10, October 2003 (2003-10), pages 2002-2012, XP002522494 ISSN: 0888-8809 *
TAHA TAREK A ET AL: "Loss of sphingosine kinase-1 activates the intrinsic pathway of programmed cell death: modulation of sphingolipid levels and the induction of apoptosis" FASEB JOURNAL, vol. 19, no. 14, December 2005 (2005-12), XP002522497 ISSN: 0892-6638 *

Also Published As

Publication number Publication date
JP2008546720A (ja) 2008-12-25
CA2612640A1 (fr) 2006-12-28
WO2006135967A1 (fr) 2006-12-28
EP1910523A4 (fr) 2009-05-27

Similar Documents

Publication Publication Date Title
EP1290182B1 (fr) Sphingosine kinase et ses utilisations
US7172879B2 (en) Detection of sphingosine kinase activity and sphingosine kinase agonist or antagonist activity
AU2001256001A1 (en) Sphingosine kinase and uses thereof
US20050100547A1 (en) Sphingosine kinase interacts with traf2 and modulates tumor necrosis factor-induced cellular activity
EP1910523A1 (fr) Modulation de la signalisation de l'egfr par modulation de la signalisation de sphingosine kinase
WO2006135968A1 (fr) Modulation de la signalisation de la sphingosine kinase
US20080279897A1 (en) Method of Treating Cellular Damage
AU2006261582A1 (en) Modulation of EGFR signalling by modulation of sphingosine kinase signalling
WO2006135969A1 (fr) Modulation de la signalisation de la sphingosine kinase
US7105480B1 (en) Method of treatment and agents useful for same
US20070265196A1 (en) Method of Modulating Pro-Inflammatory and Inflammatory Activity Mediated by C-Reactive Protein
US20050009732A1 (en) Method of treatment and agents useful for same
WO2003082322A1 (fr) Méthode de modulation d'activité cellulaire
US20060111286A1 (en) Method of modulating endothelial cell activity
US20060205688A1 (en) Method of modulating epithelial cell activity by modulating the functional levels of sphingosine kinase
US20070116687A1 (en) Method of modulating cellular transmigration and agents for use therein
WO2005123115A1 (fr) Procede de modulation de l'activite cellulaire faisant intervenir une sphingosine kinase, agents utilises a cet effet et variantes de sphingosine kinase
AU2006207818A1 (en) A method of treating cellular damage
AU2002304973A1 (en) Sphingosine kinase interacts with TRAF2 and modulates tumor necrosis factor-induced cellular activity
AU2006261583A1 (en) Modulation of sphingosine kinase signalling
AU2006261584A1 (en) Modulation of sphingosine kinase signalling
WO2004083453A1 (fr) Procede de modulation du fonctionnement des cellules des muscles lisses par la modulation de la signalisation assuree par la sphingosine kinase

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20080121

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

DAX Request for extension of the european patent (deleted)
RIN1 Information on inventor provided before grant (corrected)

Inventor name: XIA, PU

Inventor name: SUKOCHEVA, OLGA

Inventor name: VADAS, MATHEW, ALEXANDER

RIN1 Information on inventor provided before grant (corrected)

Inventor name: VADAS, MATHEW, ALEXANDER

Inventor name: XIA, PU

Inventor name: SUKOCHEVA, OLGA

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1115415

Country of ref document: HK

A4 Supplementary search report drawn up and despatched

Effective date: 20090428

17Q First examination report despatched

Effective date: 20090821

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20100105