EP1841864A2 - Neutralisation de charge de complexes de polyions - Google Patents
Neutralisation de charge de complexes de polyionsInfo
- Publication number
- EP1841864A2 EP1841864A2 EP06718148A EP06718148A EP1841864A2 EP 1841864 A2 EP1841864 A2 EP 1841864A2 EP 06718148 A EP06718148 A EP 06718148A EP 06718148 A EP06718148 A EP 06718148A EP 1841864 A2 EP1841864 A2 EP 1841864A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- complex
- dna
- polycation
- cation
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0091—Purification or manufacturing processes for gene therapy compositions
Definitions
- polyampholyte in the presence of polyion.
- the polyampholyte is useful in delivering a polyion to a cell. More specifically, the polyion may be a nucleic acid in a preferred embodiment.
- Trubetskoy et al used two types of polymerization reactions to achieve DNA condensation: step polymerization and chain polymerization (Trubetskoy VS et al. 1998).
- Bis(2-aminoethyl)-l,3-propanediarnine (AEPD), a tetramine with 2.5 positive charges per molecule at pH 8 was polymerized in the presence of plasmid DNA using cleavable disulfide amino-reactive cross-linkers dithiobis
- the stability of DNA nanoassemblies based on DNA condensation is generally low in vivo because they easily engage in polyion exchange reactions with strong polyanions.
- the process of exchange consists of two stages: 1) rapid formation of a triple DNA-polycation- polyanion complex, 2) slow substitution of one same-charge polyion with another. At equilibrium conditions, the whole process eventually results in formation of a new binary complex and an excess of a third polyion.
- the presence of low molecular weight salt can greatly accelerate such exchange reactions, which often result in complete disassembly of condensed DNA particles. Hence, it is desirable to obtain more colloidally stable structures where DNA would stay in its condensed form in complex with corresponding polycation independently of environment conditions.
- DNA/polycation particles Trubetskoy VS et al. 1999.
- the principal DNA- polycation (DNA/pC) complex used in this study was DNA/PLL (1 :3 charge ratio) formed in low salt 25 mM HEPES buffer and recharged with increasing amounts of various polyanions.
- the DNA particles were characterized after addition of a third polyion component to a DNA/polycation complex using a new DNA condensation assay (Trubetskoy VS et al. 1999b) and static light scattering.
- polyanions such as poly(methacrylic acid) and poly(aspartic acid) decondensed DNA in DNA/PLL complexes.
- polyanions of lower charge density such as succinylated PLL and poly(glutamic acid)
- succinylated PLL and poly(glutamic acid) even when added in 20-fold charge excess to condensing polycation (PLL) did not decondense DNA in DNA/PLL (1 :3) complexes.
- displacement effects are salt-dependent.
- poly-L-glutamic acid but not the relatively weaker polyanion succinylated poly-L-lysine (SPLL) displaces DNA at higher sodium chloride concentrations.
- the polyanion can be covalently attached to the polycation using a variety of chemical reactions without the use of crosslinkers.
- the polyanion can contain reactive groups that covalently attach to groups on the polycation.
- a preferable situation includes formation of a specific complex between a polyanion and a polycation, leaving the polyion and the polyampholyte to non-covalently interact electrostatically.
- the utility of such complexes includes enhanced colloid stability in serum and in high salt solutions and delivery of polyion (DNA) to hepatocytes in vivo upon intravenous administration.
- nucleic acid complexes that can be delivered to cells comprising: condensing nucleic acid with a polycation, crosslinking the polycation to stabilize the complex and chemically modifying positively charged moieties on the polycation to reduce the surface charge of the particle. Reducing the charge of polycation-nucleic acid complexes reduces undesirable effects frequently associated with positively charge particles delivered in vivo.
- a process for delivering a nucleic acid to a cell, comprising, forming a compound having a net charge comprising nucleic acid and polycation in a solution, adding a multifunctional crosslinking reagent, adding a polymer-reactive agent to form a complex having a net charge less positively charged than the compound net charge, and inserting the complex into a mammal.
- the polycation condensed DNA particle is caged by addition of a multifunctional crosslinking reagent.
- the crosslinking reagent can be a homofunctional crosslinker or a heterofunctional crosslinker.
- a preferred crosslinker is a bifunctional crosslinking reagent.
- the crosslinker can contain a labile bond. The labile bond may be broken upon exposure to an acidic pH environment, a change in redox potential, cellular enzymes, cellular compounds, such as but not limited to glutathione, or a co-delivered or subsequently delivered reagent.
- the crosslinker can increase the positive surface charge of the polycation-nucleic acid complex, reduced the positive surface charge of the polycation- nucleic acid complex, or be chosen such that it does not effect the surface charge of the polycation-nucleic acid complex, hi a preferred embodiment, the crosslinker forms covalent linkages to amines on the polycation but does not completely knock out the positive charge associated with the amines.
- the positive surface charge of a polycation-nucleic acid complex is reduced by chemically modifying positively charge moieties on the polycation after formation of the complex.
- the complex Prior to neutralization of charge on the polycation, the complex is stabilized by crosslinking.
- the surface chare of the complex is reduced through modification of the polymer by the cation-reactive reagents.
- the cation-reactive reagents chemically modify positively charged groups or moieties on the polycation. The modification can be reversible or labile.
- the cation reactive reagent may be neutral or negatively charged.
- the cation-reactive reagent can contain a labile bond or from a labile bond with the polycation.
- the labile bond may be broken upon exposure to an acidic pH environment, cellular enzymes, cellular compounds, such as but not limited to glutathione, or a co-delivered or subsequently delivered reagent.
- an acidic pH environment cellular enzymes, cellular compounds, such as but not limited to glutathione, or a co-delivered or subsequently delivered reagent.
- the surface charge, or zeta potential, of the complex maybe less positively charged than the unmodified complex, charge neutral, or negatively charged.
- the cation-reactive reagents that reduce the measured zeta potential of the particle may contain an interaction modifier.
- a preferred interaction modifier consists of polyethylene glycol, hi another preferred embodiment, the cation-reactive reagents that reduce the measured zeta potential of the particle are acid-labile maleic anhydride derivatives.
- a targeting ligand may be attached to the particle either before or after the reduction of the particle's zeta potential.
- FIG. 1 Illustration of salt stability for cross-linked and non-crosslinked DNA/PLL/SPLL particles.
- FIG. 2 Illustration of the effect of varying amounts of SPLL polyanion on the surface charge of DNA/PLL complexes.
- FIG. 3 Illustration of delivery of non-crosslinked complexes, crosslinked complexes, and charge reduced complexes to the liver of mice in vivo.
- DNA particles condensed with an excess of cation have a positive zeta potential, which is the difference in the charge between the layer of ions surrounding the particle and the charge of the bulk fluid surrounding this particle.
- the zeta potential is usually measured in millivolts.
- a positive zeta potential such condensed DNA particles interact nonspecifically with cells, and extracellular components such as serum proteins (Wolfert et al. 1996, Dash et al. 1999, Plank et al. 1996, Ogris et al. 1999).
- PEGylation polyethylene glycol
- hydrophilic polymer to the condensing polycation.
- PEGylation decreases the strength of the interaction between DNA and polycation.
- PEGylation does not prevent the displacement of DNA by polyanions (Mannisto Vanderkerken et al. 2002).
- a method to prevent displacement of DNA by polyanion is caging, or cross-linking, which is linking of two moieties of a polymer or polymers to one another using a multifunctional chemical linker.
- Covalent linking bifunctional linkers may be homobifunctional (which involves the same chemical reaction for linking both moieties) or heterobifunctional (involves two different reactions allowing linkage of different functional groups).
- a cage may be formed around or near the polyion creating a more stable complex of polyion and polymer.
- Cross-linking the polymer protects the polyion from being destroyed by enzymes and other degrading substrates.
- the DNA is resistant to displacement by polyanions.
- the stability of the caged DNA particle enables one to modify the particle with reagents that reduce its zeta potential by reducing the basicity of the constituent charged groups of the polycation, thereby reducing the charge of the polycation at neutral pH.
- acylation of an amine-containing polycation reduces the charge of the polymer by forming amide groups that have a greatly reduced pKa. In this way, the zeta potential of a
- DNA particle may be controlled.
- acylation reagents include activated esters, e.g. N-hydroxy succinimide esters, and anhydrides.
- zeta potential small, salt stable DNA/polycation complexes with reduced surface charge (zeta potential) can be formed by condensing the DNA with a polycation, crosslinking the polycation and subsequently modifying the polycation in the complex with cation- reactive reagents that reduced the measured zeta potential of the complex.
- the crosslinking reagent may contain a pH or redox labile bond.
- the cation-reactive reagents, which reduce the surface charge of the complex may contain polyethylene glycol or a similar hydrophilic polymer.
- the cation-reactive reagent may form an acid-labile modification of the polymer.
- a cation-reactive agent may be, but is not limited to, a maleic anhydride derivative.
- the cation-reactive reagent may be negatively charged.
- a targeting ligand may also be attached to the complex.
- Template polymerizations can be defined as polymerizations in which polymer chains are able to grow along template macromolecules for the greater part of their lifetime (van de Grampel HT et al. 1990). Such a mode of propagation can be achieved through the existence of cooperative interactions between the growing chain and the template chain and usually leads to the formation of an interpolymer complex.
- a well-chosen template is able to affect the rate of polymerization as well as the molecular weight and microstructure of the formed polymer (daughter polymer).
- the concepts of template polymerization were described by Ballard and Bamford with the ring opening polymerization of the N- carboxyanhydride of DL-phenylalanine on a polysarcosine template.
- template polymerization propagation of new polymer chain occurs predominantly along the template, a macromolecular chain, through specific cooperative interaction.
- the nature of interaction can be electrostatic, H-bonding, charge-transfer, and Van der Waals forces in combination with stereochemical matching.
- the presence of template usually affects various polymerization characteristics as well as the microstructure of the polymer formed.
- the daughter polymer could be the drug.
- the template is the drug (defined to include pharmaceuticals, therapeutic agents or biologically active substances).
- the process of using template polymerization for drug delivery comprises mixing the template with monomers and having a daughter polymer forming from the monomers. The mixture of template polymer and daughter polymer is then administered to a cell by putting the mixture in contact with a cell or near a cell. The mixture of template and daughter polymer could also be placed in a pharmaceutical formulation and vial for delivery to an animal.
- the template polymer could be a polyanion such as nucleic acid including DNA, RNA or an antisense sequence.
- templates polymerization networks or additional networks can be added to the polymer. These could be used to cross-link the polymers. For example, the polymer could be cross- linked to "cage" the template. Also targeting groups can be added during the initial template polymerization stage or during subsequent polymerization steps. Definitions:
- a polymer is a molecule built up by repetitive bonding together of smaller units called monomers.
- the term polymer includes both oligomers which have two to about 80 monomers and polymers having more than 80 monomers.
- the polymer can be linear, branched network, star, comb, or ladder types of polymer.
- the polymer can be a homopolymer in which a single monomer is used or can be copolymer in which two or more monomers are used. Types of copolymers include alternating, random, block and graft.
- Monomers can also be hydrophobic, hydrophilic or amphipathic.
- Amphipathic compounds have both hydrophilic (water-soluble) and hydrophobic (water-insoluble) parts.
- Hydrophilic groups indicate in qualitative terms that the chemical moiety is water-preferring. Typically, such chemical groups are water soluble, and are hydrogen bond donors or acceptors with water. Examples of hydrophilic groups include compounds with the following chemical moieties carbohydrates; polyoxyethylene, peptides, oligonucleotides and groups containing amines, amides, alkoxy amides, carboxylic acids, sulfurs, or hydroxyls.
- Hydrophobic groups indicate in qualitative terms that the chemical moiety is water-avoiding. Typically, such chemical groups are not water soluble, and tend not to hydrogen bond. Hydrocarbons are hydrophobic groups.
- Monomers can also be intercalating agents such as acridine, thiazole organge, or ethidium bromide.
- Polymers can have other groups that increase their utility. These groups can be incorporated into monomers prior to polymer formation or attached to the polymer after its formation. These groups may contain main chain atoms, side chain atoms, polymer terminating atoms, or a combination of these. Functional groups include cell targeting signals, nuclear localization signals, compounds that enhance release of contents from endosomes or other intracellular vesicles (releasing signals), and other compounds that alter the behavior or interactions of the compound or complex to which they are attached. These groups (or moieties) can be covalently linked to a polycation in a nucleic acid/polycation complex prior to or after formation of the complex.
- polynucleotide or nucleic acid or polynucleic acid
- Nucleotides are the monomelic units of polynucleotide polymers. Polynucleotides with less than 120 monomelic units are often called oligonucleotides.
- Natural nucleic acids have a deoxyribose- or ribose-phosphate backbone.
- An artificial or synthetic polynucleotide is any polynucleotide that is polymerized in vitro or in a cell free system and contains the same or similar bases but may contain a backbone of a type other than the natural ribose-phosphate backbone.
- Bases include purines and pyrimidines, which further include the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs. Synthetic derivatives of purines and pyrimidines include, but are not limited to, modifications which place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkylhalides.
- the term base encompasses any of the known base analogs of DNA and RNA.
- polynucleotide includes deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) and combinations of DNA, RNA and other natural and synthetic nucleotides.
- a polynucleotide can be delivered to a cell to express an exogenous nucleotide sequence, to inhibit, eliminate, augment, or alter expression of an endogenous nucleotide sequence, or to affect a specific physiological characteristic not naturally associated with the cell.
- a polynucleotide-based gene expression inhibitor comprises any polynucleotide containing a sequence whose presence or expression in a cell causes the degradation of or inhibits the function, transcription, or translation of a gene in a sequence-specific manner.
- Polynucleotide-based expression inhibitors may be selected from the group comprising: siRNA, microRNA, interfering RNA or RNAi, dsRNA, ribozymes, antisense polynucleotides, and DNA expression cassettes encoding siRNA, microRNA, dsRNA, ribozymes or antisense nucleic acids.
- SiRNA comprises a double stranded structure typically containing 15-50 base pairs and preferably 19-25 base pairs and having a nucleotide sequence identical or nearly identical to an expressed target gene or RNA within the cell.
- An siRNA may be composed of two annealed polynucleotides or a single polynucleotide that forms a hairpin structure.
- MicroRNAs are small noncoding polynucleotides, about 22 nucleotides long, that direct destruction or translational repression of their mRNA targets.
- Antisense polynucleotides comprise sequence that is complimentary to an gene or mRNA.
- Antisense polynucleotides include, but are not limited to: morpholinos, 2'-O-methyl polynucleotides, DNA, RNA and the like.
- the polynucleotide-based expression inhibitor may be polymerized in vitro, recombinant, contain chimeric sequences, or derivatives of these groups.
- the polynucleotide-based expression inhibitor may contain ribonucleotides, deoxyribonucleotides, synthetic nucleotides, or any suitable combination such that the target RNA and/or gene is inhibited.
- Condensing a polymer means decreasing the volume that the polymer occupies.
- An example of condensing nucleic acid is the condensation of DNA that occurs in cells.
- the DNA from a human cell is approximately one meter in length but is condensed to fit in a cell nucleus that has a diameter of approximately 10 microns.
- the cells condense (or compacts) DNA by a series of packaging mechanisms involving the histones and other chromosomal proteins to form nucleosomes and chromatin.
- the DNA within these structures is rendered partially resistant to nuclease DNase) action.
- the process of condensing polymers can be used for delivering them into cells of an organism.
- Substructure means the chemical structure of the compound and any compounds derived from that chemical structure from the replacement of one or more hydrogen atoms by any other atom or change in oxidation state.
- the substructure is succinic anhydride
- methylsuccinic anhydride, 2,2-dimethylsuccinic anhydride, 3-oxabicyclo[3.1.0]hexane- 2,4-dione, maleic anhydride, citriconic anhydride, and 2,3-dimethylmaleic anhydride have the same substructure.
- Succinylated means the compound obtained from the chemical reaction of the amine with succinic anhydride.
- succinylated poly-L-lysine means the product from the chemical reaction between poly-L-lysine and succinic anhydride.
- a salt is any compound containing ionic bonds, that is bonds in which one or more electrons are transferred completely from one atom to another. Salts are ionic compounds that dissociate into cations and anions when dissolved in solution and thus increase the ionic strength of a solution.
- Pharmaceutically acceptable acid addition salts are those salts that retain the biological effectiveness and properties of the free bases, are not biologically or otherwise undesirable, and are formed with inorganic acids such as hydrochloric acid, hydrobromic acis, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as acetic acid, propionic acid, pyruvic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethansulfonic acid, p-toluenesulfonic acid, salicylic acid, trifluoroacetic acid, and the like.
- inorganic acids such as hydrochloric acid, hydrobromic acis, sulfuric acid, nitric acid, phosphoric acid and the like
- organic acids such as acetic acid, propionic acid, pyruvic acid, maleic acid, malonic acid, succinic acid, fuma
- Pharmaceutically acceptable base addition salts are those salts that retain the biological effectiveness and properties of the free acids, and are not biologically or otherwise undesirable. These salts are prepared from the addition of an inorganic base or an organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, calcium, lithium, ammonium, magnesium, zinc, and aluminum salts and the like. Salts derived from organic bases include, but are not limited to salts of primary secondary, and tertiary amines, such as methylamine, triethylamine, and the like.
- a lipid is any of a diverse group of organic compounds that are insoluble in water, but soluble in organic solvents such as chloroform and benzene. Lipids contain both hydrophobic and hydrophilic sections. Lipids is ment to include complex lipids, simple lipids, and synthetic lipids. Complex lipids are the esters of fatty acids and include glycerides (fats and oils), glycolipids, phospholipids, and waxes. Simple lipids include steroids and terpenes.
- Synthetic lipids includes amides prepaired from fatty acids wherin the carboxylic acid has been converted to the amide, synthetic variants of complex lipids in which one or more oxygen atoms has been substitutied by another heteroatom (such as Nitrogen or Sulfur), and derivatives of simple lipids in which additional hydrophilic groups have been chemically attached. Synthetic lipids may contain one or more labile group.
- Glycolipids are sugar containing lipids.
- the sugars are typically galactose, glucose or inositol.
- Phospolipids are lipids having both a phosphate group and one or more fatty acids (as esters of the fatty acid). The phosphate group may be bound to one or more additional organic groups.
- Fats are glycerol esters of long-chain carboxylic acids. Hydrolysis of fats yields glycerol and a carboxylic acid — a fatty acid. Fatty acids may be saturated or unsaturated (contain one or more double bonds). Fatty acids are considered the hydrolysis product of lipids (fats, waxes, and phosphoglycerides).
- Oils are esters of carboxylic acids or are glycerides of fatty acids.
- Waxes are any of various solid or semisolid substances generally being esters of fatty acids.
- Hydrophobic groups indicate in qualitative terms that the chemical moiety is water-avoiding. Typically, such chemical groups are not water soluble, and tend not to form hydrogen bonds.
- Hydrophilic groups indicate in qualitative terms that the chemical moiety is water-preferring. Typically, such chemical groups are water soluble, and are hydrogen bond donors or acceptors with water. Examples of hydrophilic groups include compounds with the following chemical moieties; carbohydrates, polyoxyethylene, peptides, oligonucleotides, and groups containing amines, amides, alkoxy amides, carboxylic acids, sulfurs, or hydroxyls.
- Example 1 represents general procedures for the synthesis of PLL-SPLL polyampholyte in the presence of DNA using water-soluble carbodiimide.
- Example 2 teaches that the formation of PLL-SPLL polyampholyte in the presence of DNA increases the colloid stability of the DNA complex in physiological salt solutions.
- Example 3 states that the net charge of cross-linked DNA/PLL/SPLL stays negative.
- Example 4 demonstrates enhanced colloid stability of DNA/polyampholyte complex in the presence of serum.
- Example 5 teaches about delivery of DNA/P LL-SPLL polyampholyte complex to hepatocytes in vivo.
- Example 6 is about the same with DNA/ polyallylamine-cysteine-polyacrylic acid-thioester polyampholyte.
- Example 1 General procedure for the formation of the polyampholyte in the presence of DNA. Crosslinking of polycation and polyanion layers on theDNA/PLL/SPLL particles using l[3-(dimethylamino)propyl]-3-ethyl carbodiimide (EDC) and sulfo-N-hydroxysuccinmide (SNHS). Plasmid DNA (pCILuc) and PLL (M. w. 46 kDa) were mixed in a charge ratio 1 :3 (100 ⁇ g and 190 ⁇ g respectively in 0.5 ml of 20 mM MES, pH 6.5.
- EDC l[3-(dimethylamino)propyl]-3-ethyl carbodiimide
- SNHS sulfo-N-hydroxysuccinmide
- Succinylated PLL (SPLL) was activated with EDC/SNHS in 50 ⁇ l of unbuffered solution at pH 5.0 for 10 min (690 ⁇ g SPLL, 1.4 mg EDC, 700 ⁇ g SNHS). Then the DNA/PLL complex and activated SPLL were mixed (DNA:PLL:SPLL charge ratio 1:3:10) and the mixture was incubated overnight at room temperature.
- Example 2 Formation of PLL-SPLL polyampholyte in the presence of DNA increases the colloid stability in physiological salt solutions, hi this example the colloid stability of DNA/polyampholyte particles obtained in Example 1 and control DNA/PLL/SPLL complexes were compared using quasielastic light scattering.
- Control DNA/PLL/SPLL complexes were prepared using the same charge ratios (1:3:10) as DNA/polyampholyte complex in Example 1 but without EDC/SNHS activation (no polyampholyte was formed).
- the complexes were sized in 10 mM HEPES, pH 7.5 or HEPES buffered saline (20 ⁇ g DNA/ml) using Zeta Plus Particle Size Analyzer (Brookhaven Instruments Corp.).
- Polyampholyte complexes demonstrate more resistance to aggregation in NaCl-containing solutions as compared to control non-covalent complexes (FIG. 1, XL stands for cross- linking).
- Example 3 Surface charge of DNA complexes obtained by formation of PLL-SPLL polyampholyte in the presence of DNA.
- the series of complexes were prepared as described in Example 1 except various amounts of activated SPLL were added to DNA/PLL (1:3) complex.
- Zeta potential was measured in 10 mM HEPES, pH 7.5 at DNA concentration of 20 ⁇ g/ml using Zeta Plus instrument. The results clearly indicate charge reversal when sufficient amounts of activated SPLL are added to form polyampholyte (FIG. 2).
- Example 4 Crosslinking ofpolycation andpolyanion layers on the DNA-containing particles increases their stability in serum and on the cell surface.
- Negatively charged (recharged) particles of condensed DNA can possess the same physico-chemical properties as positively charged (non-recharged) ones. This includes flocculation in high salt solutions (including physiologic concentration).
- chemical cross-linking of cationic and anionic layers of the DNA particles can substantially improve stability of the particles in serum as well as on the cell surface.
- Table 2 shows the time course of unimodal particle size of DNA/PLL/SPLL crosslinked and non-crosslinked particles in 80% bovine serum as determined by dynamic light scattering.
- Crosslinked particles essentially do not change their size in 200 min at room temperature while non-crosslinked control flocculates rapidly. Crosslinking with cleavable reagents might help to overcome an inactivity problem.
- the polymers can also contain cleavable groups within themselves. When attached to the targeting group, cleavage leads to reduce interaction between the complex and the receptor for the targeting group. Cleavable groups include but are not restricted to disulfide bonds, diols, diazo bonds, ester bonds, sulfone bonds, acetals, ketals, enol ethers, enol esters, enamines and imines, acyl hydrazones, and Schiff bases.
- Example 5 Hepatocyte delivery of cross-linked tertiary DNA/PLL/SPLL complexes by tail vein injection.
- Plasmid DNA pCILuc
- Cy3 LableIT Minis Corporation, Madison WI
- Labeled DNA were typically dissolved in water at concentrations ranged from 1.5-2 mg/ml.
- PoIy-L- Lysine, PLL MW 31 kDa
- Succinylated PLL was prepared as previously described and dissolved in water at 20 mg/ml.
- DNA/PLL/SPLL cross-linked tertiary complexes were formed at a charge ratio of 1 :3 : 10 as follows for a single injection: SPLL (345 ⁇ g in 50 ⁇ l of 2OmM MES, pH 5) were activated with the addition of 292 ⁇ g of EDC followed by 583 ⁇ g of sulfo-NHS, both were dissolved in H 2 O at 100 mg/1.2 ml, and incubated for 10 min. At the end of the activation period, 50 ⁇ g of cy3-labeled DNA in 100 ⁇ l of 20 mM MES, pH 6.5 was added to 95 ⁇ g of PLL in 100 ⁇ l of 20 mM MES, pH 6.5 and mixed immediately.
- the condensed DNA/PLL complexes were added immediately to the activated SPLL solution and mixed thoroughly.
- the cross-linked particles were allowed to incubate at room temperature for at least 2 hr before in-vivo injections. Typically, a majority of the particles size ranged from 60-200 nm with an average size around 130 nm and a ⁇ -potential of -40 mV. Salt and serum stability of particles were evaluated by particles size changes over time in the presence of physiologic salt solution or serum.
- the cross-linked particles solution containing 50 ⁇ g of Cy3-DNA in 250 ⁇ l were injected into a mouse through the tail vein.
- liver samples were submerged in HistoPrep (Fisher Scientific) and snapped frozen in liquid nitrogen. Frozen liver sections, 4-5 ⁇ m thick, were prepared and were counter stained sequentially for 20 min each by 10 nm Sytox green ( Molecular Probe) in PBS for cell nuclei and 15 ng/ml of Alexa 488 phalloidin (Molecular Probe) in PBS for actin filaments. Stained slides were analyzed for hepatocytes uptake of Cy3-DNA containing particles using a Zeiss laser scanning confocal microscope. Hepatocytes were distinguishable by their larger size in comparison to other cells and bi- nucleated for a large percentage of the population. A large number of particles were also found in Kuppfer and endothelial cells.
- Example 6 Hepatocyte delivery ofDNA/polyallylamine-cysteine/polyacrylic acid-thioester complexes.
- succinimidyl ester was then added, with rapid stirring, to a solution of polyallylamine hydrochloride MW 50,000 (10 mg, 0.8 eq) that had been dissolved in a solution of methanol (20 mL) and diisopropylethylamine (0.5 mL). After one hour, the solvents were removed by rotary evaporation. The white solid was then dissolved in trifluoroacetic acid (5 mL), triisopropylsilane (0.25 mL), and water (0.25 mL). After two hours, the solvents were removed by rotary evaporation. The resulting solid was then dissolved in water (25 mL) and the pH was adjusted to 9 by the addition of potassium carbonate.
- Example 7 Synthesis of amine-containing polyvinyl ethers.
- 2-Vinyloxy Ethyl Phathalimide was added to a oven dried round bottom flask under a blanket of nitrogen in anhydrous dichloromethane to this solution was added ethyl vinyl ether, propyl vinyl ether, or butyl vinyl ether. These solutions were then brought to -78°C and BF 3 OEt 2 (0.1 molar equivalents relative to total vinyl ether) is added and the reaction is allowed to proceed for 2 hours at -78°C. The polymerization is then stopped by the addition of 50/50 mixture of ammonium hydroxide in methanol. The solvents are then removed by rotary evaporation.
- the polymer is then dissolved in 3OmL of 1,4- dioxane/methanol (2/1). To this solution was added hydrazine (10 molar equivalents) and the mixture was heated to reflux for 3 hours. The solvents are then removed by rotary evaporation and the resulting solid was then brought up in 2OmL of 0.5M HCl and refluxed for 15 minutes, diluted with 2OmL distilled water, and refluxed for additional hour. This solution was then neutralized with NaOH cooled to room temperature and transfer to 3,500 MWCO cellulose tubing and dialyzed for 24 h (2x20L) against distilled water, and freeze dried.
- Lyophilized polymer was dissolved in water. 5 mL aliquots were placed onto a 2.5x20 cm column packed with Sephacryl S-200. The column was eluted with 25 mM (NH 4 ) 2 CO 3 5% ethanol and 10 mL fractions were collected after dead volume (25 mL). Fractions were then assayed by trinitrobenzenesulfonic acid for amine content. Four equal fractions were then pooled and lyophilized. The first fraction, with an approximate molecular weight >10,000, was used for in vivo tracking assays.
- Example 8 PEG modification of polyvinyl ether.
- Polyvinyl ethers as described above were modified with N-hydroxysuccinimide esters of polyethylethylene glycol (NHS-PEG from Nektar) at 0.2-1.0 weight equivalents. 0.01 weight equivalents of PEG groups also have a terminal biotin group (Nektar).
- the modified polyvinyether is then isolated by size exclusion chromatography using Sephacryl S-200.
- polymer DW872 was synthesized from a 1 :1 molar feed ratio mixture of phthalimido and butyl vinyl ethers. After size exclusion chromatography, it was modified with 0.45 weight equivalents of NHS-PEG (MW 5000) and 0.05 weight equivalents of NHS-PEG-biotin. Similarly, polymer DW863 was synthesized from a 1 : 1 NH 2 :butyl feed ratio followed by modification with 20 weight percent PEG.
- Example 9 Synthesis of CDM-PEG derivatives.
- 2-propionic-3-methylmaleic anhydride (30 mg, 0.16 mmol) in 5 mL methylene chloride was added oxalyl chloride (200 mg, 10 eq) and dimethylformamide (1 ⁇ L).
- oxalyl chloride 200 mg, 10 eq
- dimethylformamide (1 ⁇ L).
- the reaction was allowed to proceed overnight at which time the excess oxalyl chloride and methylene chloride were removed by rotary evaporation to yield the acid chloride, a clear oil.
- the acid chloride was dissolved in 1 mL of methylene chloride.
- Example 10 DNA labeling. Covalent labeling of plasmid DNA with fiuorophores was performed using tetramethylrhodamine (TMR) or Oregon Green (OG) LabelIT reagent (Minis Corp., Madison, WI) according to the manufacturer's recommendations. Briefly, plasmid DNA and a solution of LabelIT reagent in methyl sulfoxide (100 mg/ml) were mixed in 1 ml of 10 mM HEPES, pH 7.5 at a reagent/DNA ratio of 5:1 (w/w). The reaction mixture was incubated for 1 h at 37°C. Labeled DNA was then precipitated three times in 70% ethanol with 0.2 M NaCl.
- TMR tetramethylrhodamine
- OG Oregon Green
- Example 11 DNA condensation assay.
- the collapse of TMR-labeled DNA was assessed using a quantitative assay based on condensation-induced quenching of a fluorophore covalently attached to DNA.
- TMR-DNA (10 ⁇ g) was mixed with various quantities of polyvinyl ethers or melittin in 0.5 ml of 10 mM HEPES, pH 7.5.
- Rhodamine fluorescence of the samples was measured using a Varian spectrofluorometer (excitation wavelength ( ⁇ ex ) of 546 nm; emission wavelength ( ⁇ em ) of 576 nm) at room temperature.
- Example 12 Synthesis of Disulfide-containing Dialdehyde.
- 1-thioglycerol was oxidized to a disulfide by addition of iodine in methylene chloride until the purple iodine color remained.
- the disulfide was then precipitated from solution by addition of 10 volume equivalents of diethylether and incubation at -78°C for a week.
- the resulting disulfide was then oxidized in water by the addition of 12 weight equivalents of sodium periodate. After 3 hours of oxidation, the dialdehyde solution was used.
- Example IS Crosslinking DNA-condensed particle by addition of Disulfide-containing Dialdehyde. 10 ⁇ g/mL tetramethylrhodamine labeled DNA in 5 mM HEPES pH8.0 isotonic glucose was condensed with 20 ⁇ g/mL PLL. To the particles was then added 0, 1, 2, 3, 4,5 6, 7, 8, 9, or 10 ⁇ g/mL disulfide-containing dialdehyde. After 2 hour, 150 mM NaCl and 100 ⁇ g/mL polyacrylic acid 15kDa was added. Fluorescence was then measured and normalized to flourescence of uncondensed DNA. Each data point is the average of duplicates.
- Example 14 Crosslinking DNA-condensed particle by addition of glutaraldehyde. 10 ⁇ g/mL Oregon Green labeled DNA in 5 mM HEPES pH8.0 isotonic glucose was condensed with 60 ⁇ g/mL DW765 (synthesized from 1 : 1 molar mixture of putati Ve-NH 2 and propyl vinyl ethers and modified with 15 wt. % PEG5000). To the particles was then added 0, 3, 6, 7.5, 15, or 30 ⁇ g/mL glutaraldehyde. After 2 hour, 150 mM NaCL and 200 ⁇ g/mL polyacrylic acid 15k was added. The fluorescence was then measured and normalized to flourescence of uncondensed DNA. Each data point is the average of duplicates.
- Example 15 Modification of Glutaraldehyde-Crosslinked Particle Charge.
- Polymer DW863 was added to DNA at a weight ratio of 1:10 in 400 ⁇ l of 5mM HEPES, pH 8, 290 mM glucose. Complexes were crosslinked for 3 hr at room temperature with 12.5 ⁇ g glutaraldehyde (relative to DW863).
- the zeta potential was then measured using a Brookhaven Zeta Plus with ZetaPALS. An average of ten measurements is reported.
- Example 16 Chemical Neutralization of Disulfide-Containing Dialdehyde-Crosslinked Particles.
- Polymer DW863 was added to DNA at a weight ratio of 1 : 10 in 400 ⁇ l of 5 mM HEPES, pH 8, 290 mM glucose. Complexes were crosslinked for 3 hr at room temperature with 0.8 weight equivalents of disulfide-containing dialdehyde. The resultant caged
- Example 17 Preparation of T7 -peptide streptavidin (SA) conjugates.
- SA Stackson ImmunoResearch Laboratories, West Grove, PA
- Two mg of SA was dissolved in 200 ⁇ l of dH 2 O and added to a 200 ⁇ l solution of 100 mM sodium phosphate, 300 mM NaCl, 2 mM EDTA, pH 7.2.
- a 20 mole equivalent of SPDP (Pierce) dissolved in DMF at 10 mg/ml was then added to the SA solution and mixed at RT for 1 hr.
- the SPSP-modified streptavidin was then purified using a G-25 Sephadex column.
- SA molecule contained an average of 6-8 PDP groups based on a pyridine-2-thione assay.
- the SA-PDP conjugate was added to MC920 (a liver targeting T7-peptide) or MC993 (a non-targeting T7-peptide) at a 1 :3 molar ratio and incubated for 24 hr at 4C.
- the MC920-SA and MC993-SA conjugates were then purified on a G-25 Sephadex column. The sample was then freeze-dried and dissolved in a solution of 25 mM MES, 125 mM NaCl, pH 6.5 at 3 mg/ml.
- the targeting functions of the conjugates were confirmed by delivery of biotinylated molecules.
- Example 18 The In Vivo Hepatocyte Targeting of Condensed DNA Particles.
- Cationic Polymer DW872 was added to Cy3-DNA at a weight ratio of 1 : 10 in 400 ⁇ l of 5mM HEPES, pH 8, 290 mM glucose. DNA condensation was verified by fluorescence quenching. Complexes were cross- linked for 3 hr at room temperature with 12.5 ⁇ g glutaraldehyde (relative to DW872).
- the resultant caged DNA:DW872 complexes were -55-60 nm in size with approximate zeta potential greater than +10 mV.
- the caged complexes were modified with sulfo-NHS-acetate (Pierce Biotechnology, Rockford, IL) or CDM-PEG 500 (2-Propionic-3-Methylmaleic Anhydride-PEGsoo). F° r modification with sulfo-NHS-acetate, reaction was incubated overnight at room temperature to allow for hydrolysis of excess reagent prior to addition of pl7 peptide conjugate (see below).
- P17 peptide is a hepatocyte targeting ligand.
- the final ⁇ -potential for these complexes was less than +10 mV.
- CDM- PEG 50O was added to complexes 10 min prior to injection.
- the ⁇ -potential of these complexes was also less than +10 mV.
- 2 equivalents (streptavidin to biotin) of streptavidin-targeting peptide conjugate was then added to each sample.
- we have also conjugated other targeting ligands such as galactose to the crosslinked, acylated particles.
- 20 ⁇ g of DNA complexes in 250 ⁇ l of the formulation buffer was injected. Liver samples were excised, frozen, and sectioned 1 hr after injection.
- Crosslinking the particles enhanced DNA delivery significantly. Chemical charge reduction of the particles, by removal of amine charges, resulted in the highest levels of hepatocyte targeting (FIG. 3).
- siRNA and siRNA expression cassette formulation Polyvinyl ether was synthesized from a feed ratio of 70% NH 2 , 25% butyl, and 5% dodecyl vinyl ethers. After purification and separation by size exclusion chromatography, the polymer was modified with 20-30 mole percent lactobionic acid using EDC as an activating reagent.
- siRNA and a DNA-based siRNA expression cassette derived complexes were formulated with lactobionylated polymer at a 1 :20 nucleic acid:polymer wt:wt ratio. The complexes are crosslinked with 7.5 wt%, relative to polymer, glutaraldehyde. The complexes are then reacted with 20 mole% acetate sulfo-N- hydroxysuccinimide ester.
- Injection of complexes in vivo The ability to target the knockdown of a gene in vivo was analyzed by measurement of mRNA for peroxisome proliferator-activated receptor alpha (PPAR- ⁇ ). Lactobionylated polymer (100 ⁇ g) was modified with 5 wt equivalents of CDM- PEG (average molecular weight is 350) and injected into the tail vein of a mouse (volume of injection was 100 ⁇ L). 10 minutes post-injection, siRNA or siRNA expression cassette formulated with lactobionylated polymer was injected into the tail vein of the mouse (20 ⁇ g of siRNA and 400 ⁇ g polymer in 400 ⁇ L isotonic glucose solution).
- PPAR- ⁇ peroxisome proliferator-activated receptor alpha
- a 21 -nucleotide long, anti-luciferase sequence with 2 overhanging 5' nucleotides at each end was used as a nontarget control. 48 hours post-injection, the animals were sacrificed and livers were removed for total RNA isolation using the TRIzol Reagent.
- RNA from liver was quantitated using a SPECTRAmax Plus spectrophotometer (Molecular Devices).
- Total RNA 500 ng was reverse transcribed using Superscript III (Invitrogen) and oligo-dT primers according to the manufacturer's protocol.
- Quantification of gene-specific mRNA levels was performed by qRT-PCR using an iCycler iQ system (BioRad).
- Relative levels of PPARa and GAPDH were measured in biplex reactions performed in triplicate using TaqMan ® Universal PCR Master Mix and the TaqMan ® Gene Expression Assay for PPARa (Applied Biosystems, Foster City, CA) following the manufacturer's protocol.
- the GAPDH primers and probe Integrated DNA technologies, Coralville, IA were:
- G/LPDH-forward 5'-AAATGGTGAAGGTCGGTGTG-S'
- GAPDH- ⁇ eyerse 5'-CATGTAGTTGAGGTCAATGAAGG-S'
- Probe S'-Hex/CGTGCCGCCTGGAGAAACCTGCC/BHQ-S'
- Anti SEAP expression cassettes (Wooddell et al.) were formulated using 20 ⁇ g of DNA and injected into secreted alkaline phosphate (SEAP) expressing transgenic mice. At 10 days postinjection, SEAP activity in mouse plasma was measured using the Phospha-Light chemiluminescent reporter assay Kit (Tropix, Bedford, MA), according to the manufacturer's instructions. SEAP expression in control group, which received DNA without anti-SEAP construct, was down 17% on average and the group receiving anti-SEAP expression cassette was down 43% on average (both groups had 3 animals).
Abstract
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US64729305P | 2005-01-26 | 2005-01-26 | |
US11/046,598 US7094605B2 (en) | 2001-01-02 | 2005-01-28 | Formation of polyampholytes in the presence of a polyion |
PCT/US2006/001037 WO2006081074A2 (fr) | 2005-01-26 | 2006-01-12 | Neutralisation de charge de complexes de polyions |
Publications (2)
Publication Number | Publication Date |
---|---|
EP1841864A2 true EP1841864A2 (fr) | 2007-10-10 |
EP1841864A4 EP1841864A4 (fr) | 2008-11-12 |
Family
ID=36740948
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP06718148A Withdrawn EP1841864A4 (fr) | 2005-01-26 | 2006-01-12 | Neutralisation de charge de complexes de polyions |
Country Status (2)
Country | Link |
---|---|
EP (1) | EP1841864A4 (fr) |
WO (1) | WO2006081074A2 (fr) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000003694A1 (fr) * | 1998-07-17 | 2000-01-27 | Mirus Corporation | Inversion de charges de complexes de polyions |
US20020052335A1 (en) * | 1999-11-29 | 2002-05-02 | Rozema David B. | Charge reversal of polyion complexes |
WO2003099228A2 (fr) * | 2002-05-28 | 2003-12-04 | Mirus Corporation | Compositions et procedes d'inhibition de l'expression genetique au moyen de polynucleotides |
US20040067587A1 (en) * | 2002-10-04 | 2004-04-08 | Trubetskoy Vladimir S. | Process for generating multilayered particles |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7220400B2 (en) * | 2002-05-24 | 2007-05-22 | Mirus Bio Corporation | Compositions for delivering nucleic acids to cells |
-
2006
- 2006-01-12 WO PCT/US2006/001037 patent/WO2006081074A2/fr active Application Filing
- 2006-01-12 EP EP06718148A patent/EP1841864A4/fr not_active Withdrawn
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000003694A1 (fr) * | 1998-07-17 | 2000-01-27 | Mirus Corporation | Inversion de charges de complexes de polyions |
US20020052335A1 (en) * | 1999-11-29 | 2002-05-02 | Rozema David B. | Charge reversal of polyion complexes |
WO2003099228A2 (fr) * | 2002-05-28 | 2003-12-04 | Mirus Corporation | Compositions et procedes d'inhibition de l'expression genetique au moyen de polynucleotides |
US20040067587A1 (en) * | 2002-10-04 | 2004-04-08 | Trubetskoy Vladimir S. | Process for generating multilayered particles |
Non-Patent Citations (1)
Title |
---|
See also references of WO2006081074A2 * |
Also Published As
Publication number | Publication date |
---|---|
EP1841864A4 (fr) | 2008-11-12 |
WO2006081074A2 (fr) | 2006-08-03 |
WO2006081074A3 (fr) | 2006-09-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP6290848B2 (ja) | siRNAの標的化送達のための組成物 | |
US8211468B2 (en) | Endosomolytic polymers | |
US7816337B2 (en) | Reversible attachment of a membrane active polymer to a polynucleotide | |
US7022525B2 (en) | Process of making a compound by forming a polymer from a template drug | |
US7682626B2 (en) | Polyvinylethers for delivery of polynucleotides to mammalian cells | |
US8217015B2 (en) | Endosomolytic polymers | |
US20040162235A1 (en) | Delivery of siRNA to cells using polyampholytes | |
US7470539B2 (en) | Formation of polyampholytes in the presence of a polyion | |
US20020082237A1 (en) | Cationic polymers and lipids for the delivery of nucleic acids | |
US7871818B2 (en) | Membrane active polymers | |
US6881576B2 (en) | Formation of polyampholytes in the presence of a polyion | |
EP1841864A2 (fr) | Neutralisation de charge de complexes de polyions | |
EP1073707A1 (fr) | Technique permettant de fabriquer un compose en formant un polymere a partir d'un medicament matrice |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20070109 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR |
|
RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: WAKEFIELD, DARREN, H. Inventor name: WOLFF, JON, A. Inventor name: BUDKER, VLADIMIR, G. Inventor name: KLEIN, JASON Inventor name: ROZEMA, DAVID, B. Inventor name: WONG, SO Inventor name: HAGSTROM, JAMES, E. Inventor name: TRUBETSKOY, VLADIMIR |
|
RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: WOLFF, JON, A. Inventor name: TRUBETSKOY, VLADIMIR Inventor name: HAGSTROM, JAMES, E. Inventor name: BUDKER, VLADIMIR, G. Inventor name: ROZEMA, DAVID, B. Inventor name: KLEIN, JASON Inventor name: WAKEFIELD, DARREN, H. Inventor name: WONG, SO |
|
DAX | Request for extension of the european patent (deleted) | ||
A4 | Supplementary search report drawn up and despatched |
Effective date: 20081013 |
|
17Q | First examination report despatched |
Effective date: 20090116 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20100803 |