EP1831377A1 - Method for producing polyunsaturated fatty acids in transgenic organisms - Google Patents

Abstract

The invention relates to a method for producing polyunsaturated fatty acids in an organism by introducing into the organism nucleic acids which encode polypeptides having ?-5-elongase, ?-6-desaturase, ?-5-desaturase, ?-4-desaturase, ?-12-desaturase and/or ?-6-elongase activity. Preferably, these desaturases and elongases are derived from Ostreococcus. The invention also relates to a method for producing oils and/or triacylglycerides having an increased content in long-chain polyunsaturated fatty acids. The invention further relates to the nucleic acid sequences, nucleic acid constructs, vectors and organisms comprising the inventive nucleic acid sequences, to vectors comprising the nucleic acid sequences and/or to the nucleic acid constructs and to transgenic organisms comprising the aforementioned nucleic acid sequences, nucleic acid constructs and/or vectors. Another part of the invention relates to oils, lipids and/or fatty acids produced according to the inventive method and to the use thereof. The invention finally relates to fatty acids and triglycerides having an increased content in unsaturated fatty acids and to the use thereof.<SUP/>

Description

Process for producing polyunsaturated fatty acids in transgenic organisms

description

The present invention relates to a process for the production of polyunsaturated fatty acids in an organism by introducing into the organism nucleic acids which are polypeptides having Δ 5 -enongase, Δ 6-desaturase, a Δ5-desaturase Encode Δ-4-desaturase, Δ-12-desaturase and / or Δ-6 elongase activity. These desaturases and elongases are advantageously derived from Ostreococcus. Furthermore, the invention relates to a process for the preparation of oils and / or triacylglycerides having an increased content of long-chain polyunsaturated fatty acids.

The invention further relates to the nucleic acid sequences, nucleic acid constructs, vectors and organisms containing the nucleic acid sequences of the invention, vectors comprising the nucleic acid sequences and / or the nucleic acid constructs and transgenic organisms contain the aforementioned nucleic acid sequences, nucleic acid constructs and / or vectors.

Another part of the invention relates to oils, lipids and / or fatty acids prepared by the process according to the invention and their use. In addition, the invention relates to unsaturated fatty acids and triglycerides having an increased content of unsaturated fatty acids and their use.

Fatty acids and triacylglycerides have a variety of uses in the food, animal nutrition, cosmetics and pharmaceutical industries. Depending on whether they are free saturated and unsaturated fatty acids or triacylglycerides with an increased content of saturated or unsaturated fatty acids, they are suitable for a wide variety of applications. Polyunsaturated fatty acids such as oleic and linolenic acids are essential for mammals as they can not be produced by them. Therefore multiple polyunsaturated ω-3 fatty acids and ω-6 fatty acids an important part of human and animal food are unsaturated long-chain ω-3 fatty acids such as eicosapentaenoic acid. (= EPA, C20: 5 ^{Δ5iβ> 11} - ¹⁴ - ¹⁷⁾ or docosahexaenoic acid (= DHA, C22: 6 ^{Δ47 '10 13 16} ' ¹⁹ ) are important components of the human diet because of their different roles in health, such as the development of the child's brain, the functionality of the eye, the synthesis of hormones and other signaling substances, as well as the prevention of cardiovascular complaints, cancer and diabetes include (Poulos, A

Lipids 30: 1-14, 1995; Horrocks, LA and Yeo YK Pharmacol Res 40: 211-225, 1999). There is therefore a need for the production of polyunsaturated long-chain fatty acids. Due to the customary composition of human food today, addition of polyunsaturated ω-3 fatty acids, which are preferred in fish oils, is particularly important for food. For example, polyunsaturated fatty acids such as docosahexaenoic acid (= DHA ₁ c22: 6 ^Ml711 ° ^l13116119 ) or icosapentaenoic acid (= EPA, C20: 5 ^Δ5 ' ⁸ ' ^{11 '14 17} ) are used to increase ^{infant formula}

Nutritional value added. The unsaturated fatty acid DHA is thereby attributed a positive effect on the development and maintenance of brain functions.

In the following, polyunsaturated fatty acids are referred to as PUFA, PUFAs, LCPUFA or LCPUFAs (poly unsaturated fatty acids, PUFA, polyunsaturated fatty acids, long chain poly unsaturated fatty acids, LCPUFA, long-chain polyunsaturated fatty acids).

Mainly the various fatty acids and triglycerides are obtained from microorganisms such as Mortierella or Schizochytrium or from oil-producing plants such as soybean, oilseed rape, algae such as Crypthecodinium or Phaeodactylum and others, where they are usually in the form of their triacylglycerides (= triglycerides = tri-glycerides). glycerols). But they can also be obtained from animals such as fish. The free fatty acids are advantageously prepared by saponification. Very long chain polyunsaturated fatty acids like DHA, EPA, arachidonic acid (= ARA, C20: 4 ^{Δ5Λ11 14} ), dihomo-γ-linolenic acid (C20: 3 ^{Δ8 11 14} ) or docosapentaenoic acid (DPA, c22: 5 ^A7i1 ° ' ¹³ ' ¹⁶ ' ¹⁹ ) are not synthesized in oil crop plants such as oilseed rape, soya, sunflower, dyer's safflower. Common natural sources of these fatty acids are fish such as herring, salmon, sardine, perch, eel, carp, trout, halibut, mackerel, zander or tuna or algae.

Depending on the application, oils with saturated or unsaturated fatty acids are preferred. For example, lipids with unsaturated fatty acids, especially polyunsaturated fatty acids, are preferred in the human diet. The polyunsaturated ω-3 fatty acids thereby a positive effect on the cholesterol level in the blood and thus the possibility of preventing heart disease is attributed. By adding these ω-3 fatty acids to the diet, the risk of heart disease, stroke or hypertension can be significantly reduced. Also, inflammatory, especially chronic inflammatory processes in the context of immunological diseases such as rheumatoid arthritis can be positively influenced by ω-3 fatty acids. They are therefore added to foods especially dietary foods or found in medicines application. ω-6 fatty acids such as arachidonic acid tend to have a negative effect on these diseases in these rheumatic diseases due to our usual food composition. ω-3- and ω-6 fatty acids are precursors of tissue hormones, the so-called eicosanoids such as the prostaglandins derived from dihomo-γ-linolenic acid, arachidonic acid and eicosapentaenoic acid, the thromoxanes and leukotrienes derived from arachidonic acid and Derive the eicosapentaenoic acid. Eicosanoids (so-called PG ₂ series), which are formed from ω-6 fatty acids usually promote inflammatory reactions, while eicosanoids (so-called PG ₃ series) of ω-3 fatty acids have little or no pro-inflammatory effect.

Due to their positive properties, there have been no shortage of attempts in the past to make genes involved in the synthesis of fatty acids or triglycerides available for the production of oils in various organisms with modified levels of unsaturated fatty acids. Thus, WO 91/13972 and its US equivalent describe a Δ-9-desaturase. In WO 93/11245 a Δ-15-desaturase is claimed in WO 94/11516 a Δ-12-desaturase. Further desaturases are described, for example, in EP-AO 550 162, WO 94/18337, WO 97/30582, WO 97/21340, WO 95/18222, EP-A-0 794 250, Stukey et al., J. Biol. Chem., 265 , 1990: 20144-20149, Wada et al., Nature 347, 1990: 200-203 or Huang et al., Lipids 34, 1999: 649-659. However, the biochemical characterization of the various desaturases has hitherto been inadequate, since the enzymes are very difficult to isolate and characterize as membrane-bound proteins (McKeon et al., Methods in Enzymol. 71, 1981: 12141-12147, Wang et al. , Plant Physiol. Biochem., 26, 1988: 777-792). As a rule, the characterization of membrane-bound desaturases takes place by introduction into a suitable organism, which is subsequently examined for enzyme activity by means of reactant and product analysis. Δ6-desaturases are described in WO 93/06712, US 5,614,393, US 5614393, WO 96/21022, WO00 / 21557 and WO 99/27111 and also the application for production in transgenic organisms as described in WO98 / 46763 WO98 / 46764, WO9846765. The expression of various desaturases as described in WO99 / 64616 or WO98 / 46776 and formation of polyunsaturated fatty acids is also described and claimed. Concerning. It should be noted that the expression of desaturases and their influence on the formation of polyunsaturated fatty acids has an effect on expression of a single desaturase, as described so far, only low levels of unsaturated fatty acids / lipids such as e.g. γ-ünolenic acid and stearidonic acid were achieved. Furthermore, a mixture of ω-3 and ω-6 fatty acids was obtained as a rule.

Particularly suitable microorganisms for the production of PUFAs are microorganisms such as microalgae such as Phaeodactylum tricomutum, Porphiridium species, Thraustochytrien species, Schizochytria species or Crypthecodinium species, ciliates such as Stylonychia or Colpidium, fungi such as Mortierella, Entomophthora or Mucor and / or mosses such as Physcomitrella, Ceratodon and Marchantia (R. Vazhappilly & F. Chen (1998) Botanica Marina 41: 553-558; K. Totani & K. Oba (1987) Lipids 22: 1060-1062; Akimoto, M. et al Appl. Biochemistry and Biotechnology 73: 269-278). Through strain selection, a number of mutant strains of the corresponding microorganisms have been developed which produce a number of desirable compounds, including PUFAs. However, mutation and selection of strains with improved production of a particular molecule, such as polyunsaturated fatty acids, is a time-consuming and difficult procedure. Therefore, whenever possible, genetic engineering techniques are preferred as described above. With the aid of the aforementioned microorganisms, however, only limited amounts of the desired polyunsaturated fatty acids such as DPA, EPA or ARA can be produced. These are usually obtained depending on the microorganism used as fatty acid mixtures of, for example, EPA, DPA and ARA. For the synthesis of arachidonic acid, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) various synthetic routes are discussed (Figure 1). Thus, the production of EPA or DHA in marine bacteria such as Vibrio sp. or Shewanel-Ia sp. according to the polyketide pathway (Yu, R. et al., Lipids 35: 1061-1064, 2000; Takeyama, H. et al., Microbiology 143: 2725-2731, 1997). An alternative strategy involves the changing activity of desaturases and elongases (Zank, TK et al., Plant Journal 31: 255-268, 2002, Sakuradani, E. et al., Gene 238: 445-453, 1999). A modification of the described pathway via Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase, Δ4-desaturase is the speaker-synthetic pathway (Sprecher 2000, Biochim Biophys Acta 1486: 219-231) in mammals. Chain length - instead of the Δ4-desaturation, a further elongation step at ₂₄ C, a further Δ6-desaturation and finally beta-oxidation to the C ₂₂ is carried out here. For the production in plants and microorganisms, however, the so-called spokesman synthesis path (see FIG. 1) is not suitable since the regulatory mechanisms are not known. The polyunsaturated fatty acids can be classified according to their desaturation pattern into two large classes, ω-6 or ω-3 fatty acids, which have metabolically and functionally different activities (Figure 1).

The starting material for the ω-6 pathway is the fatty acid linoleic acid (18: 2 ^{Δ9 12} ), while the ω-3 pathway is via linolenic acid (18: 3 ^Δ9 ' ¹² ' ¹⁵ ). Linolenic acid is formed by the activity of an ω-3-desaturase (Tocher et al., 1998, Prog. Lipid Res., 37, 73-117, Domergue et al., 2002, Eur. J. Biochem., 269, 4105-4113).

Mammals, and therefore also humans, have no corresponding desaturase activity (Δ-12 and ω-3-desaturase) and must ingest these fatty acids (essential fatty acids) through the diet. From the sequence of desaturase and elongase reactions, the physiologically important polyunsaturated fatty acids arachidonic acid (= ARA, 20: 4 ^{Δ5 8 11 '14} ), an ω-6 fatty acid and the two ω-3 fatty acids eicosapentaen then become from these precursors - (= EPA, 20: 5 ^Λ5 ' ^{8 11} ' ^{14 '17} ) and docosahexanoic acid (DHA, 22: 6 ^MJ ' ¹⁰ - ¹³ ' ¹⁷ ' ¹⁹ ). The application of ω-3 fatty acids shows the therapeutic effect as described above in the treatment of cardiovascular diseases (Shimikawa 2001, World Rev. Nutr., Diet., 88, 100-108),

Inflammations (Calder 2002, Proc Nutr Soc 61, 345-358) and Arthridis (Cleland and James 2000, J. Rheumatol 27, 2305-2307).

The elongation of fatty acids by elongases of 2 and 4 C atoms, respectively, is of crucial importance for the production of C ₂₀ and C ₂₂ PUFAs, respectively. This process runs over 4 stages. The first step is the condensation of malonyl-CoA the fatty acid-acyl-CoA by ketoacyl-CoA synthase (KCS, hereinafter referred to as elongase). This is followed by a reduction step (ketoacyl-CoA reductase, KCR), a dehydration step (dehydratase) and a final reduction step (enoyl-CoA reductase). It has been postulated that the activity of elongase affects the specificity and speed of the entire process (Miliar and Kunst, 1997 Plant Journal 12: 121-131).

In the past, numerous attempts have been made to obtain elongase genes. Miliar and Art, 1997 (Plant Journal 12: 121-131) and Miliar et al. 1999 (Plant Cell 11: 825-838) describe the characterization of plant elongases for the synthesis of mono-unsaturated long chain fatty acids (C22: 1) or for the synthesis of very long-chain fatty acids for the formation of waxes in plants (C ₂₈ -C _32). Descriptions of the synthesis of arachidonic acid and EPA can be found, for example, in WO0159128, WO0012720, WO02077213 and WO0208401. The synthesis of polyunsaturated C24 fatty acids is described, for example, in Tvrdik et al 2000, JCB 149: 707-717 or WO0244320.

To produce DHA (C22: 6n-3) in organisms that do not naturally produce this fatty acid, no specific elongase has yet been described. To date, only elongases have been described which provide C ₂₀ or C ₂₄ fatty acids. Δ5-elongase activity has not been described previously. Higher plants contain polyunsaturated fatty acids such as linoleic acid (C18: 2) and linolenic acid (C18: 3). ARA, EPA and DHA are absent or only found in the seed oil of higher plants (E. Ucciani: Nouveau Dictionnaire des Huiles Vegeches, Technique & Documentation - Lavoisier, 1995. ISBN: 2-7430-0009-0). However, it would be advantageous to produce LCPUFAs in higher plants, preferably in oilseeds such as oilseed rape, linseed, sunflower and soybean, since in this way large quantities of high-quality LCPUFAs can be obtained inexpensively for the food industry, animal nutrition and for pharmaceutical purposes. For this purpose, gene coding for enzymes of the biosynthesis of LCPUFAs in oilseeds must be advantageously introduced and expressed via genetic engineering methods. These are genes which encode, for example, Δ6-desaturases, Δ6-elongases, Δ5-desaturases or Δ4-desaturases. These genes can be advantageously isolated from microorganisms and lower plants that produce LCPUFAs and incorporate them into the membranes or triacylglycerides. For example, Δ6-desaturase genes from the moss Physcomitrella patens and Δ6 elongase genes from P. patens and the nematode C. elegans have been isolated.

First transgenic plants which contain and express genes encoding enzymes of LCPUFA biosynthesis and produce LCPUFAs have been described for the first time in, for example, DE 102 19 203 (Process for the Production of Polyunsaturated Fatty Acids in Plants). However, these plants produce LCPUFAs in quantities that need to be further optimized for processing the oils contained in the plants. Therefore, in order to facilitate fortification of food and feed with these polyunsaturated fatty acids, there is a great need for a simple, inexpensive process for producing these polyunsaturated fatty acids, especially in eukaryotic systems.

It was therefore the task of further genes or enzymes which are suitable for the synthesis of LCPUFAs, in particular genes which have a Δ-5-desaturase, Δ-4-desaturase, Δ-12-desaturase or Δ-6. Desaturase activity for the production of polyunsaturated fatty acids. Another object of this invention has been to provide genes or enzymes that allow for a shift from the ω-6 fatty acids to the ω-3 fatty acids. Another object was to develop a process for producing polyunsaturated fatty acids in an organism, preferably in a eukaryotic organism, preferably in a plant or a microorganism. This object has been achieved by the process according to the invention for the preparation of compounds of the general formula I

in transgenic organisms with a content of at least 1 wt .-% of these compounds based on the total lipid content of the transgenic organism, characterized in that it comprises the following steps: a) introducing at least one nucleic acid sequence into the organism, which for a Δ-6-desaturase And b) introduction of at least one nucleic acid sequence into the organism which codes for a Δ6-elongase activity, and c) introduction of at least one nucleic acid sequence into the organism which codes for a Δ5-desaturase activity, and d) introducing into the organism at least one nucleic acid sequence encoding Δ5-elongase activity, and e) introducing into the organism at least one nucleic acid sequence encoding a Δ4-desaturase activity, and wherein the variables and substituents in the formula I have the following meaning:

R 1 ¹ = = hydroxyl, coenzyme A (thioester), lyso-phosphatidylcholine, lyso-phosphatidylethanolamine, lyso-phosphatidylglycerol, lyso-diphosphatidylglycerol, lyso-phosphatidylserine, lyso Phosphatidylinositol, Sphingobase, or a radical of the general formula II

R ² = hydrogen, lyso-phosphatidylcholine, lyso-phosphatidylethanolamine, lysophosphatidylglycerol, lyso-diphosphatidylglycerol, lyso-phosphatidylserine, lyso-phosphatidylinositol or saturated or unsaturated C ₂ -C ₂₄ -alkylcarbonyl-,

R 3 ^J _ = hydrogen, saturated or unsaturated C ₂ -C ₂₄ -alkylcarbonyl-, or R ² or R ³ independently of one another a radical of general formula Ia:

n = 2, 3, 4, 5, 6, 7 or 9, m = 2, 3, 4, 5 or 6 and p = 0 or 3, dissolved.

R ¹ in general formula I denotes hydroxyl, coenzyme A (thioester), lysophosphatidylcholine, lyso-phosphatidylethanolamine, lyso-phosphatidylglycerol, lyso-diphosphatidylglycerol, lyso-phosphatidylserine, lyso-phosphatidylinositol, sphingobase, or a radical of the general formula II

The abovementioned radicals of R ¹ are always bonded in the form of their thioesters to the compounds of general formula I. R ² in the general formula II denotes hydrogen, lyso-phosphatidylcholine, lyso-phosphatidylethanolamine, lyso-phosphatidylglycerol, lyso-diphosphatidylglycerol, lyso-phosphatidylserine, lyso-phosphatidylinositol or saturated or unsaturated C ₂ -C ₂₄ - alkylcarbonyl,

As alkyl radicals are substituted or unsubstituted, saturated or unsaturated C ₂ -C ₂₄ -alkylcarbonyl chains such as ethylcarbonyl, n-propylcarbonyl, n-butylcarbonyl, n-pentyl carboπyl, n-hexylcarbonyl, n-heptylcarbonyl, n-octylcarbonyl, n-nonylcarbonyl, n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n- Pentadecylcarbonyl, n-hexadecylcarbonyl, n-hepta-decylcarbonyl, n-octadecylcarbonyl, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanylcarbonyl- containing one or more double bonds. Saturated or unsaturated C ₁₀ -C ₂₂ -alkylcarbonyl radicals such as n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-hepta decylcarbonyl, n-octadecylcarbonyl, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanylcarbonyl. containing one or more double bonds are preferred. Particular preference is given to saturated and / or unsaturated C ₁₀ -C ₂₂ -alkylcarbonyl radicals, such as C ₁₀ -alkylcarbonyl, C 1-4 -alkylcarbonyl, C ₁₂ -alkylcarbonyl, C _1-3 -alkylcarbonyl, C ₁₄ -alkylcarbonyl, C ₁₆ -alkylcarbonyl, , C ₁₈ - alkylcarbonyl, C ₂₀ alkylcarbonyl or C ₂₂ alkylcarbonyl radicals which contain one or more double bonds. Saturated or unsaturated C ₁₆ -C ₂₂ -alkylcarbonyl radicals such as C ₆ alkylcarbonyl, C ₁₈ alkylcarbonyl, C ₂₀ are especially preferred - alkylcarbonyl or C ₂₂ -alkylcarbonyl radicals which contain one or more double bonds. These advantageous radicals may contain two, three, four, five or six double bonds. The particularly advantageous radicals having 20 or 22 carbon atoms in the fatty acid chain contain up to six double bonds, advantageously three, four, five or six double bonds, more preferably five or six double bonds. All these radicals are derived from the corresponding fatty acids.

R ³ in the general formula II is hydrogen, saturated or unsaturated C ₂ -C ₂₄ -alkylcarbonyl. Alkyl radicals which may be substituted or unsubstituted, saturated or unsaturated C ₂ -C ₂₄ -alkylcarbonyl chains, such as ethylcarbonyl, n-propylcarbonyl, n-butylcarbonyl, n-pentylcarbonyl, n-hexylcarbonyl, n-heptylcarbonyl, n-octylcarbonyl, n-nonylcarbonyl, n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-hepta-decylcarbonyl , n-octadecylcarbonyl, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanylcarbonyl called, which contain one or more double bonds. Saturated or unsaturated C ₁ -C ₂₂ -alkylcarbonyl radicals such as n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-hepta decylcarbonyl, n-octadecylcarbonyl, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanylcarbonyl containing one or more double bonds are preferred. Particular preference is given to saturated and / or unsaturated C ₁₀ -C ₂₂ -alkylcarbonyl radicals, such as C ₁₀ -alkylcarbonyl, C 1-4 -alkylcarbonyl, C ₁₂ -alkylcarbonyl, C ₁₃ -alkylcarbonyl, C ₁₄ -alkylcarbonyl, C ₁₆ -alkylcarbonyl, , C ₁₈ - alkylcarbonyl, C ₂₀ alkylcarbonyl or C ₂₂ alkylcarbonyl radicals which contain one or more double bonds. Very particular preference is given to saturated or unsaturated C ₁₆ -C ₂₂ -alkylcarbonyl radicals, such as C ₁₆ -alkylcarbonyl, C ₁₈ -alkylcarbonyl, C ₂₀ -alkylcarbonyl or C ₂₂ -alkylcarbonyl radicals, having one or more double bonds contain. These advantageous radicals may contain two, three, four, five or six double bonds. The particularly advantageous radicals having 20 or 22 carbon atoms in the fatty acid chain contain up to six double bonds, advantageously three, four, five or six double bonds, more preferably five or six double bonds. All these radicals are derived from the corresponding fatty acids.

The abovementioned radicals of R ¹ , R ² and R ³ may be substituted by hydroxyl and / or epoxy groups and / or may contain triple bonds.

The polyunsaturated fatty acids prepared in the process according to the invention advantageously contain at least two, preferably three, four, five or six double bonds. Particularly advantageously, the fatty acids contain four five or six double bonds. Fatty acids produced in the process advantageously have 18, 20 or 22 C atoms in the fatty acid chain, preferably the fatty acids contain 20 or 22 carbon atoms in the fatty acid chain. Advantageously, saturated fatty acids are little or not reacted with the nucleic acids used in the process. Little is understood to mean that compared to polyunsaturated fatty acids, the saturated fatty acids have less than 5% of the activity, advantageously less than 3%, more preferably less than 2%, most preferably less than 1; 0.5; 0.25 or 0.125% are implemented. These produced fatty acids can be produced as the only product in the process or present in a fatty acid mixture. The nucleic acid sequences used in the method according to the invention are isolated nucleic acid sequences which are suitable for polypeptides having Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase and / or Δ- 4-encoding desaturase activity.

Nucleic acid sequences which code for polypeptides having Δ-6-desaturase, Δ-6-elongase, Δ-5-desaturase, Δ-5-elongase or Δ-4-desaturase activity, which are selected from among the following, are advantageously used in the process according to the invention A group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO 13 or b) nucleic acid sequences which, as a result of the degenerate genetic code, have the sequences shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 , SEQ ID NO: 12 or SEQ ID NO: 14 can be deduced amino acid sequences, or c) derivatives of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7,

SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO: 13 shown for polypeptides having at least 40% identity at the amino acid level with SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID N0: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12 or SEQ ID NO: 14 and have a Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase or Δ-4-desaturase activity.

Advantageously, the substituents R ² or R ³ in the general formulas I and II independently of one another are saturated or unsaturated C ₁₈ -C ₂₂ -alkylcarboπyls, particularly advantageously they independently of one another denote unsaturated C ₈ -, C ₂₀ - or C ₂₂ -alkylcarbonyl with at least two double bonds.

In a further preferred embodiment, the method is characterized in that a nucleic acid sequence is additionally introduced into the organism which codes for polypeptides having Δ12-desaturase activity, selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 15, or b) nucleic acid sequences which can be derived as a result of the degenerate genetic code from the amino acid sequence shown in SEQ ID NO: 16, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 15, which polypeptides have at least 50 % Identity at the amino acid level with SEQ ID NO: 16 and have Δ-12 desaturase activity.

These aforementioned Δ-12-desaturase sequences can be used alone or in combination with the ω3-desaturase sequences with the nucleic acid sequences used in the method which are useful for Δ-6-desaturases, Δ-6-elongases, Δ-5-desaturases, Δ-5-elongases and or Δ4-desaturases are used.

Table 1 represents the nucleic acid sequences, the organism of origin and the sequence ID number.

The polyunsaturated fatty acids produced in the process are advantageously bound in membrane lipids and / or triacylglycerides, but may also be present as free fatty acids or bound in the form of other fatty acid esters in the organisms. They may be present as "pure products" or advantageously in the form of mixtures of different fatty acids or mixtures of different glycerides. The different fatty acids bound in the triacylglycerides can thereby be derived from short-chain fatty acids having 4 to 6 C atoms, medium-chain fatty acids having 8 to 12 C atoms or long-chain fatty acids having 14 to 24 C atoms, preferably the long-chain fatty acids are particularly preferred the long-chain fatty acids LCPUFAs of C ₁₈ , C ₂ o and / or C ₂₂ fatty acids.

In the inventive process fatty acid ester with polyunsaturated C ₁₈ are advantageously -, C ₂ O and / or C ₂₂ -fatty acid molecules having at least two double bonds in the fatty acid ester, advantageously at least three, four, five or six double bonds in the fatty acid ester, particularly advantageously by at least five or six double bonds in the fatty acid ester and lead advantageously to the synthesis of linoleic acid (= LA, C18: 2 ^{Δ9 12} ), γ-linolenic acid (= GLA, C18: 3 ^{Δ69 12} ), ^stearidonic acid (= SDA, C18: 4 ^{Δ6 | 9 12 15)} 'Dihomo-γ-linolenic acid (= DGLA, 20: 3 ^{Δ8 | 11 M} ), ω-3-eicosatetraenoic acid (= ETA, C20: 4 ^ΔW114 ), arachidonic acid (ARA, C20: 4 ^{Δ5 8 11} ' ¹⁴ ), Eicosapentaenoic acid (EPA, C20: 5 ^{Δ58111 '14 17} ), ω-6-docosapentaenoic acid (C22: 5 ^Δ4 ' ⁷ ' ¹⁰ ' ^{13 '16} ), ω-6-docosatetraenoic acid (C22: 4 ^Δ ' ⁷ ' ¹⁰ ' ^{13 16} ), ω-3-docosapentaenoic acid (= DPA, C22: 5 ^Δ7 ' ¹⁰ ' ¹³ ' ¹⁶ ' ¹⁹ ), docosahexaenoic acid (= DHA, _C 22: 6 ^ΔV ' ¹⁰ ' ^{13 '16 19} ) or the mixtures, preferably ARA, EPA and / or DHA. Very particular preference is given to producing ω-3 fatty acids such as EPA and / or DHA.

The fatty acid esters with polyunsaturated C ₁₈ , C ₂₀ and / or C ₂₂ fatty acid molecules can be prepared from the organisms used for the preparation of the fatty acid esters in the form of an oil or lipid, for example in the form of compounds such as sphingolipids, phosphoglycerides , Lipids, glycolipids such as glycosphingolipids, phospholipids such as phosphatidylethanolamine, phosphatidylcholine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidylglycerol, monoacylglycerides, diacylglycerides, triacylglycerides or other fatty acid esters such as the acetyl-coenzymeA esters which contain at least two polyunsaturated fatty acids, preferably, they are isolated in the form of their diacylglycerides, triacylglycerides and / or in the form of the phosphatidylcholine, more preferably in the form of the triacylglycerides. In addition to these esters, the polyunsaturated fatty acids are also included as free fatty acids or bound in other compounds in the organisms beneficial to the plants. In general, the various compounds mentioned above (fatty acid esters and free fatty acids) are present in the organisms in an approximate distribution of 80 to 90% by weight of triglycerides, 2 to 5% by weight of diglycerides, 5 to 10% by weight of monoglycerides, 1 to 5 wt .-% of free fatty acids, 2 to 8 wt .-% phospholipids ago, wherein the sum of the various compounds to 100 wt .-% complements. In the process according to the invention, the LCPUFAs produced are present in a content of at least 3% by weight, advantageously of at least 5% by weight, preferably of at least 8% by weight, more preferably of at least 10% by weight, very particularly preferably at least 15 wt .-% based on the total fatty acids in the transgenic organisms advantageously produced in a transgenic plant. Advantageously, C ₁₈ and / or C ₂₀ fatty acids present in the host organisms become at least 10%, advantageously at least 20%, particularly advantageously at least 30%, very particularly advantageously at least 40% in the corresponding products such as DPA or DHA, to name just two. Advantageously, the fatty acids are prepared in bound form. With the aid of the nucleic acids used in the method according to the invention, these unsaturated fatty acids can be brought to the sn1, sn2 and / or sn3 position of the advantageously prepared triglycerides. Since in the process of the invention from the starting compounds linoleic acid (C18: 2) or linolenic acid (C18: 3) are passed through several reaction steps, the end products of the process such as

Arachidonic acid (ARA), eicosapentaenoic acid (EPA), ω-6-docosapentaenoic acid or DHA not as absolute pure products, there are always small traces of precursors in the final product included. If both linoleic acid and linolenic acid are present in the starting organism or in the starting plant, for example, the end products such as ARA, EPA or DHA are present as mixtures. The precursors should advantageously not more than 20 wt .-%, preferably not more than 15 wt .-%, more preferably not more than 10 wt .-%, most preferably not more than 5 wt .-% based on the amount of the respective Final product amount. Advantageously, only ARA, EPA or only DHA are bound in the process according to the invention or produced as free acids in a transgenic plant as end products. If the compounds ARA, EPA and DHA are prepared simultaneously, they are advantageously used in a ratio of at least 1: 1: 2 (EPA: ARA: DHA), preferably of at least 1: 1: 3, preferably of 1: 1: 4 preferably prepared from 1: 1: 5.

Fatty acid esters or fatty acid mixtures which have been prepared by the process according to the invention advantageously contain 6 to 15% palmitic acid, 1 to 6% stearic acid; 7 - 85% oleic acid; 0.5 to 8% of vaccenic acid, 0.1 to 1% of arachidic acid, 7 to 25% of saturated fatty acids, 8 to 85% of monounsaturated fatty acids and 60 to 85% of polyunsaturated fatty acids in each case based on 100% and on the total fatty acid content of the organisms. As advantageous polyunsaturated fatty acid in the fatty acid esters or fatty acid mixtures are preferably at least 0.1; 0.2; 0.3; 0.4; 0.5; 0.6; 0.7; 0.8; 0.9 or 1% based on the total fatty acid content of arachidonic acid. Furthermore, the fatty acid esters or fatty acid mixtures prepared by the process according to the invention advantageously contain fatty acids selected from the group of the fatty acids erucic acid (13-docosaic acid), sterculic acid (9,10-methylene octadec-9-enoic acid), malvalic acid (8,9 Methylene heptadec-8-enoic acid), chaulmo-gruoic acid (cyclopentenodecanoic acid), furan fatty acid (9,12-epoxy-octadeca-9,11-dienoic acid), vernon acid (9,10-epoxyoctadec-12-enoic acid), Taric acid (6-octadecynoic acid), 6-nonadecynoic acid, santalbinic acid (t11-octadecen-9-ynoic acid), 6,9- Octadecenynoic acid, pyrulic acid (t10-heptadecen-8-ynonic acid), crepenynic acid (9-octadecen-12-ynonic acid), 13,14-dihydrooropheic acid, octadecene-13-ene-9,11-diynoic acid, petroselenoic acid (cis-θ-octadecenoic acid) , 9c, 12t-octadecadienoic acid, calendic acid (δtiOt ^ c-octadecatrienoic acid), catalpinic acid (9t11t13c-octadecatrienoic acid), eelosteric acid (θci itiSt octadecatrienoic acid), jacric acid (8c10t12c octadecatrienoic acid), punicic acid (9c11t13c octadecatrienoic acid), parinaric acid (θcHtiStiδc Octadecatetraenoic acid), pinolenic acid (all-cis-5,9,12-octadecatrienoic acid), labialic acid (5,6-octadecadienelene acid), ricinoleic acid (12-hydroxyoleic acid) and / or coriolinic acid (IS-hydroxy-θci it-octadecadienoic acid) , The abovementioned fatty acids are generally advantageously present only in traces in the fatty acid esters or fatty acid mixtures prepared by the process according to the invention, that is to say they are less than 30%, preferably less than 25%, 24%, 23%, based on the total fatty acids. , 22% or 21%, more preferably less than 20%, 15%, 10%, 9%, 8%, 7%, 6% or 5%, most preferably less than 4%, 3%, 2% or 1% ago. Advantageously, the fatty acid esters or fatty acid mixtures prepared by the process according to the invention contain less than 0.1% based on the total fatty acids or no butyric acid, no cholesterol, no clupanodonic acid (= docosapentaenoic acid, C22: 5 ^ΔW2 ' ¹⁵ ' ²¹ ) and no nisic acid (tetracosahexaenoic acid, C23: 6 ^Δ3 ' ⁸ ' ^{12 '15 18 21} ). The nucleic acid sequences according to the invention or the nucleic acid sequences used in the method according to the invention can increase the yield of polyunsaturated fatty acids by at least 50%, advantageously by at least 80%, particularly advantageously by at least 100%, very particularly advantageously by at least 150% compared to the non-transgenic starting organism For example, a yeast, an alga, a fungus, or a plant such as Arabidopsis or flax can be obtained by comparison in GC analysis, see Examples.

Also, chemically pure polyunsaturated fatty acids or fatty acid compositions can be prepared by the methods described above. For this purpose, the fatty acids or fatty acid compositions from the organism such as the microorganisms or plants or the culture medium in which or on which the organisms were grown, or from the organism and the culture medium in a known manner, for example, extraction, distillation, crystallization, chromatography or combinations isolated from these methods. These chemically pure fatty acids or fatty acid compositions are advantageous for applications in the food industry, the cosmetics industry and especially the pharmaceutical industry.

In principle, all organisms such as microorganisms, non-human animals or plants come into question as organism for the preparation in the process according to the invention. As plants, in principle, all plants are in question, which are able to synthesize fatty acids as all dicotyledonous or monocotyledonous plants, algae or mosses. Advantageous plants are selected from the group of the plant families Adelotheciaceae, Anacardiaceae, Asteraceae, Apiaceae, Betulaceae, Boraginaceae, Brassicaceea, Bromeliaceae, Caricaceae, Cannabaceae, Convolvulaceae, Chenopodiaceae, Crypthecodiniaceae, Cucurbitaceae, Ditrichaceae, Elaeagnaceae, Ericaceae, Euphorbiaceae , Fabaceae, Geraniaceae, Gramineae, Juglandaceae, Lauraceae, Leguminose, Linaceae, Prasinophyceae or vegetables or ornamental plants such as Tagetes.

By way of example, the following plants may be selected from the group Adelotheciaceae, such as the genera Physcomitrella, e.g. the genus and species Physcomitrella patens, Anacardiaceae such as the genera Pistacia, Mangifera, Anacardium e.g. the genus and species Pistacia vera [pistachio], Mangifer indica [Mango] or Anacardium occidentale [cashew], Asteraceae such as the genera Calendula, Carthage, Centaurea, Cichorium, Cynara, Helianthus, Lactuca, Locusta, Tagetes, Valeriana e.g. the genus and species Calendula officinalis [garden calendula], Carthamus tinctorius [safflower], Centaurea cyanus [cornflower], Cichorium intybus [chicory], Cynara scolymus [Artichoke], Helianthus annus [sunflower], Lactuca sativa, Lactuca crispa, Lactuca esculenta, Lactuca scariola L. ssp. sativa, Lactuca scariola L. var. integrata, Lactuca scariola L. var. integrifolia, Lactuca sativa subsp. romana, Locusta communis, Valeriana locusta [lettuce], Tagetes lucida, Tagetes erecta or Tagetes tenuifolia [marigold], Apiaceae such as the genus Daucus e.g. the genus and species Daucus carota [carrot], Betulaceae such as the genus Corylus e.g. the genera and species Corylus avellana or Corylus colurna [hazelnut], Boraginaceae such as the genus Borago e.g. the genus and species Borago officinalis [borage], Brassicaceae such as the genera Brassica, Camelina, Melanosinapis, Sinapis, Arabopsopsis e.g. the genera and species Brassica napus, Brassica rapa ssp. [Canola], Sinapis arvensis Brassica juncea, Brassica juncea var. Juncea, Brassica juncea var. Crispifolia, Brassica juncea var. Foliosa, Brassica nigra, Brassica sinapioides, Camelina sativa, Melanosinapis communis [mustard], Brassica oleracea [fodder beet] or Arabica dopsis thaliana, Bromeliaceae such as the genera Anana, Bromelia (pineapple) eg the genera and species Anana comosus, pineapple pineapple or Bromelia comosa

[Pineapple], Caricaceae such as the genus Carica such as the genus and Art Carica papaya [Papaya], Cannabaceae such as the genus Cannabis such as the genus and Art Cannabis sative [hemp], Convolvulaceae such as the genera Ipomea, Convolvulus e.g. the genera and species Ipomoea batatus, Ipomoea pandurata, Convolvulus batatas, Convolvulus tiliaceus, Ipomoea fastigiata, Ipomoea tiliacea, Ipomoea triloba or

Convolvulus panduratus [sweet potato], Chenopodiaceae such as the genus Beta such as the genera and species Beta Vulgaris, Beta vulgaris var. Altissima, Beta vulgaris var. Vulgaris, Beta maritima, Beta vulgaris var. Perennis, Beta vulgaris var. Conditiva or Beta vulgaris var. esculenta [sugar beet], Crypthecodiniaceae such as the genus Crypthecodinium eg the genus and species Cryptecodinium cohnii, Cucurbitaceae such as the genus Cucubita eg the genera and species Cucurbita maxima, Cucurbita mixta, Cucurbita pepo or Cucurbita moschata [pumpkin], Cymbellaceae such as the genera Amphora , Cymbella, Okedenia, Phaeodactylum, Reimeria eg the genus and species Phaeodactylum tricornutum, Ditrichaceae such as the genera Ditrichaceae, Astomiopsis, Ceratodon, Chrysoblastella, Ditrichum, Distichium, Eccremidium, Lophidion, Philibertiella, Pleuridium, Saelania, Trichodon, Skottsbergia eg the genera and species Ceratodon antarcticus, Ceratodon columbiae, Ceratodon heterophyllus, Ceratodon puφurascens, Ceratodon purpureus, Ceratodon purpureus ssp. convolutus, Ceratodon purpureus ssp. stenocarpus, Ceratodon purpureus var. rotundifolius, Ceratodon ratodon, Ceratodon stenocarpus, Chrysoblastella chilensis, Ditrichum ambiguum, Ditrichum brevisetum, Ditrichum crispatissimum, Ditrichum difficile, Ditrichum falcifolium, Ditrichum flexicaule, Ditrichum giganteum, Ditrichum heteromallum, Ditrichum linear, Ditrichum linear, Ditrichum montanum, Ditrichum montanum, Ditrichum pallidum, Ditrichum punctulatum, Ditrichum pusillum, Ditrichum pusillum var. Tortile, Ditrichum rhynchostegium, Ditrichum schimperi, Ditrichum tortile, Distichium capillaceum, Distichium hagenii, Distichium inclinatum, Distichium macounii, Eccremidium floridanum, Eccremidium whiteleggei, Lophidion strictus, Pleuridium acuminatum , Pleuridium alternifolium, Pleuridium holdridgei, Pleuridium mexicanum, Pleuridium ravenelii, Pleuridium subulatum, Saelania glaucescens, Trichodon borealis, Trichodon cylindricus or Trichodon cylindricus var. Oblongus, Elaeagnaceae as the genus Elaeagnus eg the genus and Art Olea europaea [Olive], Ericaceae as the genus Kalmia eg the genera and species Kalmia latifolia, Kalmia angustifolia, Kalmia microphylla, Kalmia polifolia, Kalmia occidentalis, Cistus chamaerhodendros or Kalmia lucida [Berglorbeer], Euphorbiaceae such as the genera Manihot, Janipha, Jatropha Ricinus eg the genera and species Manihot utilissima, Janipha manihot ,, Jatropha manihot, Manihot aipil, Manihot dulcis, Manihot manihot, Manihot melanobasis, Manihot esculenta [Manihot] or Ricinus communis [Castor], Fabaceae as the genera Pisum, Albizia , Cathormion, Feuillea, Inga, Pithecolobium, Acacia, Mimosa, Medicajo, Glycine, Dolichos, Phaseolus, Soy eg the genera and species Pisum sativum, Pisum arvense, Pisum humile [pea], Albizia berteriana, Albizia julibrissin, Albizia lebbeck, Acacia berteriana , Acacia littoralis, Albizia berteriana, Albizzia berteriana, Cathormion berteriana, Feuillea berteriana, Inga fragrans, Pithecellobium berterianum, Pithecellobium fragrans, Pithecolobium berterianum, Pseudalbizzia berteriana, Acacia julibrissin, Acacia nemu, Albizia nemu, Feuilleea julibrissin, Mimosa julibrissin, Mimosa speciosa, Sericanrda julibrissin, Acacia lebbeck, Acacia macrophyl Ia, Albizia lebbek, Feuilleea lebbeck, Mimosa lebbeck, Mimosa speciosa [Seidenbaum], Medicago sativa, Medicago falcata, Medicago varia [Alfalfa] Glycine max Dolichos soya, Glycine gracilis, Glycine hispida, Phaseolus max, Soy hispida or Soy max [Soy bean], Funariaceae such as the genera Aphanorrhegma, Entosthodon, Funaria,

Physcomitrella, Physcomitrium eg the genera and species Aphanorrhegma serrateum, Entosthodon attenuatus, Entosthodon bolanderi, Entosthodon bonplandii, Entosthodon californicus, Entosthodon drummondii, Entosthodon jamesonii, Entosthodon leibergii, Entosthodon neoscoticus, Entosthodon rubrisetus, Entosthodon spathulifolia, Entosthodon tucsoni, Funaria americana Funaria bolanderi, Funaria calcarea, Funaria californica, Funaria calvescens, Funaria convoluta, Funaria flavicans, Funaria groutiana, Funaria hygrometrica, Funaria hygrometrica var. Arctica, Funaria hygrometrica var. Calvescens, Funaria hygrometrica var. Convoluta, Funaria hygrometrica var. Muralis , Funaria hygrometrica var. Utahensis, Funaria microstoma, Funaria microstoma var. Obtusifolia, Funaria muhlenbergii, Funaria orcuttii, Funaria piano- convexa, Funaria polaris, Funaria ravenelii, Funaria rubriseta, Funaria serrata, Fúnaria sonorae, Funaria sublimbatus, Funaria tucsoni, Physcomitrella californica, Physcomitrella patens, Physcomitrella readeri, Physcomitrium spp., Physcomitrium californicum, Physcomitrium collenchymatum, Physcomitrium coloradense, Physcomitrum cupuliferum Physcomitrium drummondii, Physcomitrium eurystomum, Physcomitrium flexifolium, Physcomitrium hookeri, Physcomitrium hookeri var. Serratum, Physcomitrium immersum, Physcomitrium kellermanii, Physcomitrium megalocarpum, Physcomitrium pyriforme, Physcomitrium pyriforme var. Serratum, Physcomitrium rufipes, Physcomitrium sandbergii, Physcomitrium subsphaericum, Physcomitrium washingtoniense, Geraniaceae such as the genera Pelargonium, Cocos, Oleum eg the genera and species Cocos nucifera, Pelargonium grossularioides or Oleum cocois [coconut], Gramineae such as the genus Saccharum eg the genus and species Saccharum officinarum, Juglandaceae as well the genera of Juglans, Wallia eg the genera and species Juglans regia, Juglans ailanthifolia, Juglans sieboldiana, Juglans cinerea, Wallia cinerea, Juglans bixbyi, Juglans californica, Juglans hindsii, Juglans intermedia, Juglans jamaicensis, Juglans major, Juglans microcarpa, Juglans nigra or Wallia nigra [Walnut], Lauraceae Like the genera Persea, Laurus eg the genera and species Laurus nobilis [Laurel], Persea ameήcana, Persea gratissima or Persea persea [Avocado], Leguminosae such as the genus Arachis eg the genus and species Arachis hypogaea [ Peanut], Linaceae as the genera Linum, Adenolinum eg the genera and species Linum usitatissimum, Linum humile, Linum austήacum, Linum bienne, Linum angustifolium, Linum catharticum, Linum flavum, Linum grandiflorum, Adenolinum grandiflorum, Linum lewisii, Linum narbonense, Linum perenne , Linum perenne var. Lewisii, Linum pratense or Linum trigynum [flax], Lythrarieae as the genus Punica eg the genus and Art Punica gran atum [pomegranate], Malvaceae such as the genus Gossypium eg the genera and species Gossypium hirsutum, Gossypium arboreum, Gossypium barbadense, Gossypium herbaceum or Gossypium thurberi [cotton], Marchantiaceae such as the genus Marchantia eg the genera and species Marchantia berteroana, Marchantia foliacea , Marchantia macropora, Musaceae as the genus Musa eg the genera and species Musa nana, Musa acuminata, Musa paradisiaca, Musa spp. [Banana], Onagraceae such as the genera Camissonia, Oenothera eg the genera and species Oenothera biennis or Camissonia brevipes [evening primrose], Palmae as the genus Elacis eg the genus and species Elaeis guineensis [oil palm], Papaveraceae as the genus Papaver eg the genera and Species Papaver Oriental, Papaver rhoeas, Papaver dubium [poppy], Pedaliaceae as the genus Sesamum eg the genus and species Sesamum indicum [sesame], Piperaceae as the genera Piper, Artanthe, Peperomia, Steffenia eg the genera and species Piper adυncum, Piper amalago, Piper angustifolium, Piper auritum, Piper betel, Piper cubeba, Piper longum, Piper nigrum, Piper retrofracture, Artanthe adunca, Artanthe elongata, Peperomia elongata, Piper elongatum,

Steffensia elongata. [Cayenne pepper], Poaceae such as the genera Hordeum, Seeale, Avena, Sorghum, Andropogon, Holcus, Panicum, Oryza, Zea (maize), Triticum eg the genera and species Hordeum vulgare, Hordeum jubatum, Hordeum murinum, Hordeum secalinum, Hordeum distichon Hordeum aegiceras, Hordeum hexastichon, Hordeum hexastichum, Hordeum irregular, Hordeum sativum, Hordeum secalinum [Barley], Sea ale cereale [Rye], Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. Sativa, Avena hybrida [Oats], Sorghum bicolor, Sorghum halepense, Sorghum saccharatum, Sorghum vulgaris, Andropogon drummondii, Holcus bicolor, Holcus Sorghum, Sorghum aethiopicum, Sorghum arundinaceum, Sorghum caffrorum, Sorghum cernuum, Sorghum dochna, Sorghum drummondii, Sorghum durra, Sorghum guineense, Sorghum lanceolatum, Sorghum nervosum, Sorghum saccharatum, Sorghum subglabrescens, Sorghum verticilliflorum, Sorghum vulgaris, Holcus halepensis, Sorghum Miliaceum, Panicum militaceum [millet], Oryza sativa, Oryza latifolia [rice], Zea mays [maize] Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum or Triticum vulgare [wheat], Porphyridaceae the genera Chroothece, Flintiella, Petrovanella, Porphyridium, Rhodel- Ia, Rhodosorus, Vanhoeffenia eg the genus and species Porphyridium crutentum, Proteaceae such as the genus Macada mia eg the genus and species Macadamia intergrifolia [Macadamia], Prasinophyceae such as the genera Nephroselmis, Prasinococcus, Scherffelia, Tetraselmis, Mantoniella, Ostreococcus eg the genera and species

Nephroselmis olivacea, Prasinococcus capsulatus, Scherffelia dubia, Tetraselmis chui, Tetraselmis suecica, Mantoniella squamata, Ostreococcus tauri, Rubiaceae such as the genus Coffea e.g. the genera and species Cofea spp., Coffea arabica, Coffea canephora or Coffea liberica [coffee], Scrophulariaceae such as the genus Verbascum e.g. the genera and species Verbascum blattaria, Verbascum chaixii, Verbascum densiflorum, Verbascum lagurus, Verbascum longifolium, Verbascum lychnitis, Verbascum nigrum, Verbascum olympicum, Verbascum phlomoides, Verbascum phenicum, Verbascum pulverulentum or Verbascum thapsus [Mullein], Solanaceae such as the genera Capsicum, Nicotiana , Solanum, Lycopersicon eg the genera and species Capsicum annuum, Capsicum annuum var. glabriusculum, Capsicum frutescens [pepper], Capsicum annuum [paprika], Nicotiana tabacum, Nicotiana alata, Nicotiana attenuata, Nicotiana glauca, Nicotiana slowdorifii, Nicotiana obtusifolia, Nicotiana quadrivalvis, Nicotiana repanda, Nicotiana rustica, Nicotiana sylvestris [tobacco], Solanum tuberosum [potato], Solanum melongena [eggplant] Lycopersicon esculentum, Lycopersicon lycopersicum., Lycopersicon pyήforme, Solanum integrifolium or Solanum lycopersicum [tomato], Sterculiaceae such as the genus Theobroma eg the genus and species Theobroma cacao [cocoa] or Theaceae such as the genus Camellia e.g. the genus and species Camellia sinensis [tea].

Advantageous microorganisms are, for example, fungi selected from the group of the families Chaetomiaceae, Choanephoraceae, Cryptococcaceae, Cunninghamellaceae, Demetiaceae, Moniliaceae, Mortierellaceae, Mucoraceae, Pythiaceae, Sacharomycesaceae, Saprolegniaceae, Schizosacharomycetaceae, Sodariaceae or Tubercularaceae.

Examples include the following microorganisms selected from the group: Choanephoraceae as the genera Blakeslea, Choanephora eg the genera and species Blakeslea trispora, Choanephora cueurbitarum, Choanephora infundibulifera var. Cueurbitarum, Mortierellaceae as the genus Mortierella eg the genera and species Mortierella isabellina, Mortierella polycephala , Mortierella ramanniana, Mortierella vinacea, Mortierella zonata, Pythiaceae such as the genera Phytium, Phytophthora eg the genera and species Pythium debaryanum, Pythium intermedium, Pythium irregular, Pythium megalacanthum, Pythium paroecandrum, Pythium sylvaticum, Pythium ultimum, Phytophthora cactorum, Phytophthora cinnamomi, Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, Phytophthora erythroseptica, Phytophthora lateralis, Phytophthora megasperma, Phytophthora nicotianae, Phytophthora nicotianae var. parasitica, Phytophthora palmivora, Phytophthora parasitica, Phytophthora syringae, Saccharomycetaceae such as the genera Hansenula, Pichia, Saccharomyces, Saccharomyces, Yarrowia eg the genera and species Hansenula anomala, Hansenula californica, Hansenula canadensis, Hansenula capsulata, Hansenula ciferrii, Hansenula glucozyma, Hansenula henricii, Hansenula holstii, Hansenula minuta, Hansenula nonfermentans, Hansenula philodendri, Hans enula polymorph, Hansenula saturnus, Hansenula subpelliculosa, Hansenula wickerhamii, Hansenula wingei, Pichia alcoholophila, Pichia angusta, Pichia anomala, Pichia bispora, Pichia burtonii, Pichia canadensis, Pichia capsulata, Pichia carsonii, Pichia cellobiosa, Pichia ciferrii, Pichia farinosa, Pichia fermentans , Pichia finlandica, Pichia glucozyma, Pichia guilliermondii, Pichia haplophila, Pichia henricii, Pichia holstii, Pichia jadinii, Pichia lindnerii, Pichia membranaefaciens, Pichia methanolica, Pichia minuta var. Minuta, Pichia minuta var. Nonfermentans, Pichia norvegensis, Pichia ohmeri, Pichia pastoris, Pichia philodendri, Pichia pini, Pichia polymorph, Pichia quercuum, Pichia rhodanensis, Pichia sargentensis, Pichia stipitis, Pichia strasburgensis, Pichia subpelliculosa, Pichia toletana, Pichia trehalophila, Pichia vini, Pichia xylosa, Saccharomyces aceti, Saccharomyces bailii, Saccharomyces bayanus, Saccharomyces bisporus, Saccharomyces capensis, Saccharomyces carlsbe rgensis, Saccharomyces cerevisiae, Saccharomyces cerevisiae var. ellipsoideus, Saccharomyces chevalieri, Saccharomyces delbrueckii, Saccharomyces diastaticus, Saccharomyces drosophilarum, Saccharomyces elegans, Saccharomyces ellipsoideus, Saccharomyces fermentati, Saccharomyces florentinus, Saccharomyces fragilis, Saccharomyces heterogenicus, Saccharomyces hienipiensis, Saccharomyces inusitatus, Saccharomyces italicus, Saccharomyces kluyveri, Saccharomyces krusei, Saccharomyces lactis, Saccharomyces marxianus, Saccharomyces microellipsoides, Saccharomyces montanus, Saccharomyces norbensis, Saccharomyces oleaceus, Saccharomyces paradoxus, Saccharomyces pastorianus, Saccharomyces pretoriensis, Saccharomyces rosei, Saccharomyces rouxii, Saccharomyces uvarum, Saccharomyces ludwigii, Yarrowia lipolytica,

Schizosaccharomyces eg Schizosaccharomyces eg the Schizosaccharomyces japonicus var. Japonicus, Schizosaccharomyces japonicus var. Versatilis, Schizosaccharomyces malidevorans, Schizosaccharomyces octosporus, Schizosaccharomyces pombe var. Malidevorans, Schizosaccharomyces pombe var. Pombe, Thraustochytriaceae such as the Genera Althomia, Aplanochytrium, Japono- chytrium, Schizochytrium, Thraustochytrium eg the species Schizochytrium aggregatum, Schizochytrium limacinum, minutum Schizochytrium mangrovei, Schizochytrium, Schizochytrium octosporum, aggregatum Thraustochytrium, Thraustochytrium amoe- boideum, antacticum Thraustochytrium, Thraustochytrium arudimentale, aureum Thraustochytrium, benthicola Thraustochytrium, globosum Thraustochytrium, Thrausto- chytrium indicum, Thraustochytrium kerguelense, Thraustochytrium kinnei, Thraustochytrium motivum, Thraustochytrium multirudimentale, Thraustochytrium pachydermum, Thraustochytrium proliferum, Thraustochytrium roseum, Thraustochytrium rossii, Thraustochytrium striatum or Thraustochytrium visurgense. Further advantageous microorganisms are, for example, bacteria selected from the group of the families Bacillaceae, Enterobacteriacae or Rhizobiaceae.

Examples include the following microorganisms selected from the group: Bacillaceae such as the genus Bacillus eg the genera and species Bacillus acidocaldarius, Bacillus acidoterrestris, Bacillus alcalophilus, Bacillus amyloliquefaciens, Bacillus amylolyticus, Bacillus brevis, Bacillus cereus, Bacillus circulans, Bacillus coagulans, Bacillus sphaericus subsp. fusiformis, Bacillus galactophilus, Bacillus globisporus, Bacillus globisporus subsp. marinus, Bacillus halophilus, Bacillus lentimorbus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus polymyxa, Bacillus psychrosaccharolyticus, Bacillus pumilus, Bacillus sphaericus, Bacillus subtilis subsp. spizizenii, Bacillus subtilis subsp. subtilis or Bacillus thuringiensis; Enterobacteriacae such as the genera Citrobacter, Edwardsieila, Enterobacter, Erwinia, Escherichia, Klebsiella, Salmonella or Serratia eg the genera and species Citrobacter amalonaticus, Citrobacter diversus, Citrobacter freundii, Citrobacter genomicpecies, Citrobacter gillenii, Citrobacter intermedium, Citrobacter koseri, Citrobacter murliniae, Citrobacter sp., Edwardsiella hoshinae, Edwardsieila ictaluri, Edwardsiella tarda, Erwinia alni, Erwinia amylovora, Erwiniaananatis, Erwinia aphidicola, Erwinia billingiae, Erwinia cacticida, Erwinia carcinogena, Erwinia carnegieana, Erwinia carotovora subsp. atroseptica, Erwinia carotovora subsp. betavasculorum, Erwinia carotovora subsp. odorifera, Erwinia carotovora subsp. wasabiae, Erwinia chrysanthe- / 77 /, Erwinia cypripedii, Erwinia dissolvens, Erwinia herbicola, Erwinia mallotivora,

Erwinia milletiae, Erwinia nigrifluens, Erwinia nimipressuralis, Erwinia persicina, Erwinia psidii, Erwinia pyrifoliae, Erwinia quercina, Erwinia rhapontici, Erwinia rubrifaciens, Erwinia salicis, Erwinia stewartii, Erwinia tracheiphila, Erwinia uredovora, Escherichia adecarboxylata, Escherichia anindolica, Escherichia aurescens, Escherichia blattae , Escherichia coli, Escherichia coli var. Communior, Escherichia coli mutabile, Escherichia fergusonii, Escherichia hermannii, Escherichia sp., Escherichia vulneris, Klebsiella aerogenes, Klebsiella edwardsii subsp. atlantae, Klebsiella ornithinolytica, Klebsiella oxytoca, Klebsiella planticola, Klebsiella pneumoniae, Klebsiella pneumoniae subsp. pneumoniae, Klebsiella spp., Klebsiella terrigena, Klebsiella trevisanii, Salmonella abony, Salmonella arizonae, Salmonella bongori, Salmonella choleraesuis subsp. arizonae, Salmonella choleraesuis subsp. bongori, Salmonella choleraesuis subsp. cholereasuis, Salmonella choleraesuis subsp. diarizonae, Salmonella choleraesuis subsp. houtenae, Salmonella choleraesuis subsp. indica, Salmonella choleraesuis subsp. Salamae, Salmonella daressalaam, Salmonella enterica subsp. houtenae, Salmonella enterica subsp. salamae, Salmonella enteritidis, Salmonella gallinarum, Salmonella heidelberg, Salmonella panama, Salmonella senftenberg, Salmonella typhimurium, Serratia entomophila, Serratia ficaria, Serratia fonticola, Serratia grimesii, Serratia liquefaciens, Serratia marcescens, Serratia marcescens subsp. marcescens, Serratia marinorubra, Serratia odorifera, Serratia plymouthensis, Serratia plymuthica, Serratia proteamaculans, Serratia proteamaculans subsp. quinovora, Serratia quinivorans or Serratia rubidaea; Rhizobiaceae such as the genera Agrobacterium, Carbophilus, Chelatobacter, Ensifer, Rhizobium, Sinorhizobium eg the genera and species Agrobacterium atlanticum, Agrobacterium ferrugineum, Agrobacterium gelatino- vorum, Agrobacterium larrymoorei, Agrobacterium meteori, Agrobacterium radiobacter, Agrobacterium rhizogenes, Agrobacterium rubi, Agrobacterium stellulatum , Agrobacterium tumefaciens, Agrobacterium vitis, Carbophilus carboxidus, Chelatobacter heintzii, Ensifer adhaerens, Ensifer arboris, Ensifer fredii, Ensifer costiensis, Ensifer kummerowiae, Ensifer medicae, Ensifer meliloti, Ensifer saheli, Ensifer terangae, Ensifer xinjiangensis, Rhizobium ciceri Rhizobium etli, Rhizobium fredii, Rhizobium galegae, Rhizobium gallicum, Rhizobium giardinii, Rhizobium hainanense, Rhizobium huakuii, Rhizobium huautlense, Rhizobium indigoferae, Rhizobium japonicum, Rhizobium leguminosarum, Rhizobium loessse, Rhizobium loti, Rhizobium lupini, Rhizobium mediterraneum, Rhizobium meliloti, Rhi zobium mongolense, Rhizobium phaseoli, Rhizobium radiobacter, Rhizobium rhizogenes, rubi Rhizobium, sullae Rhizobium, tianshanense Rhizobium trifolii Rhizobium, tropici Rhizobium, Rhizobium undicola, Rhizobium vitis, Sinorhizobium adhaerens, Sinorhizobium arboris, fredii Sinorhizobium, Sinorhizobium kostiense, kummerowiae Sinorhizobium, Sinorhizobium medicae , Sinorhizobium meliloti, Sinorhizobium morelense, Sinorhizobium saheli or Sinorhizobium xinjiangense.

Further advantageous microorganisms for the method according to the invention are, for example, protists or diatoms selected from the group of the families Dinophyceae, Turaniellidae or Oxytrichidae such as the genera and species: Crypthecodinium cohnii, Phaeodactylum tricornutum, Stylonychia mytilus, Stylonychia pustulara, Stylonychia putrina, Stylonychia notophora , Stylonychia sp., Colpidium campylum or Colpidium sp.

Advantageous in the process according to the invention are transgenic organisms such as fungi such as Mortierella or Traustochytrium, yeasts such as Saccharomyces or Schizosaccharomyces, mosses such as Physcomitrella or Ceratodon, nonhuman animals such as Caenorhabditis, algae such as Nephroselmis, Pseudoscourfielda, Prasinococcus, Scherffelia, Tetraselmis, Mantoniella, Ostreococcus , Crypthecodinium or Phaeodactylum or plants such as dicotyledonous or monocotyledonous plants. Organisms which belong to the oil-producing organisms, ie those used for the production of oils, such as fungi such as Mortierella or Thraustochytrium, algae such as Nephroselmis, Pseudoscourfielda, Prasinococcus, Scherffelia, Tetraselmis, are particularly advantageously used in the process according to the invention. Mantoniella, Ostreococcus, Crypthecodinium, Phaeodactylum or plants, especially plants prefers oilseed crops containing high levels of lipid compounds such as peanut, rapeseed, canola, sunflower, safflower (Carthamus tinctoria), poppy, mustard, hemp, castor, olive, sesame, calendula , Punica, evening primrose, mullein, thistle, wild roses, hazelnut, almond, macadamia, avocado, bay leaf, pumpkin, flax, soya, pistachios, borage, trees (oil palm, coconut or walnut) or crops such as corn, wheat, rye, oats, triticale, rice, barley, cotton, cassava, pepper, Tagetes, Solanaceae plants such as potato, tobacco, eggplant and tomato, Vicia species, pea, alfalfa or Bush plants (coffee, cocoa, tea), Salix species and perennial grasses and forage crops. Preferred plants according to the invention are oil crop plants, such as peanut, canola, canola,

Sunflower, safflower, poppy, mustard, hemp, castor, olive, calendula, punica, evening primrose, pumpkin, flax, soy, borage, trees (oil palm, coconut). Particularly preferred are C 18: 2 and / or C18: 3 fatty acid rich plants such as sunflower, safflower, tobacco, mullein, sesame, cotton, pumpkin, poppy, evening primrose, walnut, flax, hemp, thistle or safflower. Very particularly preferred are

Plants such as safflower, sunflower, poppy, evening primrose, walnut, flax or hemp.

In principle, all genes of the fatty acid or lipid metabolism may advantageously be used in combination with the inventive Δ-5-desaturase (s), Δ-δ-desaturase (s), Δ-4-desaturase (s) and / or Δ- 12-desaturase (s) [in the meaning of this application, the plural is to include the singular and vice versa] in the process for producing polyunsaturated fatty acids are advantageous genes of fatty acid or lipid metabolism selected from the group acyl-CoA dehydrogenase (s), acyl ACP [= acyl carrier protein] desaturase (s), acyl-ACP thioesterase (s), fatty acid acyltransferase (s), acyl-CoAlysophospholipid acyltransferases, fatty acid synthase (s), fatty acid hydroxylase ( n), acetyl coenzyme A carboxylase (s), acyl coenzyme A oxidase (s), fatty acid desaturase (s), fatty acid acetylenases, lipoxygenases, triacylglycerol lipases, allene oxide synthases, hydroperoxide lyases or Fatty acid elongase (s) in combination with Δ-5-desaturase (s), Δ-6-desaturase (s), Δ-4-desaturase ( n) and / or Δ-12-desaturase (s). Particular preference is given to genes selected from the group of Δ-4-desaturases, Δ-5-desaturases, Δ-6-desaturases, Δ-9-desaturases, Δ-12-desaturases, Δ-6-elongases or Δ-5. Elongases in combination with the abovementioned genes for the Δ-5-desaturase (s), Δ-δ-desaturase (s), Δ-4-desaturase (s) and / or Δ-12-desaturase (s) are used, wherein individual Genes or multiple genes can be used in combination. The Δ-5 elongases according to the invention have the advantageous property that they do not elongate C ₂₂ -fatty acids to the corresponding C 24 -fatty acids compared to the human elongases. Particularly advantageous Δ-5-elongases preferably convert only unsaturated C ₂ o-fatty acids. Advantageously, only C ₂ o-fatty acids are reacted with a double bond in Δ 5-position, with ω-3-C ₂₀ fatty acids being preferred (EPA). Furthermore, in a preferred embodiment of the invention they have the property that they have no or only a relatively low Δ6-elongase activity in addition to the Δ-5 elongase activity. Advantageously, in a yeast feeding text in which EPA has been added to the yeasts as substrate, at least 15% by weight of the EPA added to docosapentaenoic acid (DPA, c22: 5 ^{Δ7 | 1} ° ^{i13 16 19} ), advantageously at least 20% by weight , Particularly advantageous at least 25 wt .-% to. If γ-linolenic acid (= GLA, C18: 3 ^Δ6 ' ^{9 12} ) is added as the substrate, it is advantageously not elongated at all. Likewise, C18: 3 ^{Δ5t9 12 is also} not elongated. In another advantageous embodiment, less than 60% by weight of the added th GLA to dihomo-γ-linolenic acid (= C20: 3 ^{A8 '11 14} ), preferably less than 55 wt .-%, preferably less than 50 wt .-%, more preferably less than 45 wt .-%, very particularly advantageously less than 40 wt .-%. In a further very preferred embodiment of the Δ 5-elongase activity according to the invention, GLA is not reacted.

The Δ-4-desaturases according to the invention, Δ-5-desaturases and Δ-6-desaturases have the advantage over the known Δ-4-desaturases, Δ-5-desaturases and Δ-6-desaturases that they bind to fatty acids or phospholipids CoA fatty acid esters, advantageous to implement CoA fatty acid esters. Advantageously, the processes according to the invention used Δ-12-desaturases oleic acid (C18: 1 ^Δ9 ) to give linoleic acid (C18: 2 ^{Δ9 12} ) or C18: 2 ^{Δ6 | 9} to C18: 3 ^{Δ6 9 '12} (= GLA). Advantageously, the Δ-12-desaturases used bind fatty acids bound to phospholipids or CoA fatty acid esters, advantageously bound to CoA fatty acid esters. Advantageously, the desaturases used in the process according to the invention convert their respective substrates in the form of the CoA fatty acid esters. This leads, if previously a Elongationsschritt has taken place, advantageously to an increased product yield. The respective desaturation products are thereby synthesized in higher amounts, since the elongation step usually takes place on the CoA fatty acid esters, while the desaturation step takes place predominantly on the phospholipids or on the triglycerides. An exchange reaction, which would make a further possibly limiting enzyme reaction erfoderlich, between the CoA fatty acid esters and the phospholipids or triglycerides is therefore not required.

By the enzymatic activity of the nucleic acids used in the method according to the invention, for polypeptides with Δ-5-desaturase, Δ-6-desaturase, Δ-4-desaturase, Δ-12-desaturase, Δ-5-elongase and or Δ6-elongase activity, advantageously in combination with nucleic acid sequences which are suitable for polypeptides of the fatty acid or lipid metabolism, such as further polypeptides having Δ-4-, Δ-5, Δ-6, Δ-12-desaturase or Δ-5 or Δ-6 elongase activity, it is possible to prepare a wide variety of polyunsaturated fatty acids in the process according to the invention. Depending on the selection of the organisms used for the process according to the invention, such as the advantageous plant, it is possible to prepare mixtures of the various polyunsaturated fatty acids or individual polyunsaturated fatty acids, such as EPA or ARA, in free or bound form. Depending on which fatty acid composition prevails in the starting plant (C18: 2 or C18: 3 fatty acids), fatty acids derived from C18: 2 fatty acids, such as GLA, DGLA or ARA, or those derived from C18: 3 fatty acids derive, such as SDA, ETA or EPA. If only linoleic acid (= LA, C18: 2 ^{Δ9 12} ) is present as unsaturated fatty acid in the plant used for the process, only GLA ₁ DGLA and ARA can be produced as products of the process, which may be present as free fatty acids or bound. Is in the plant used in the process as unsatisfactory For example, as in flax, the only products of the method that can be produced are SDA, ETA, EPA and / or DHA, which are as described above as free fatty acids or fatty acids only α-linolenic acid (= ALA, C18: 3 ^Λ9 ' ¹² ' ¹⁵ ) may be present. By modifying the activity of the enzymes involved in the synthesis Δ-5-desaturase, Δ-6-desaturase, Δ-4-desaturase, Δ-12-desaturase, Δ-5 elongase and / or Δ-6 elongase can be targeted in the aforementioned organisms advantageously produce only individual products in the aforementioned plants. Due to the activity of Δ-6-desaturase and Δ-6 elongase, for example, GLA and DGLA or SDA and ETA are formed, depending on the starting plant and unsaturated fatty acid. Preference is given to DGLA or ETA or mixtures thereof. If the Δ-5-desaturase, the Δ-5 elongase and the Δ-4-desaturase are additionally introduced into the organism advantageously into the plant, ARA, EPA and / or DHA are additionally produced. Advantageously, only ARA, EPA or DHA or their mixtures are synthesized, depending on the fatty acid present in the organism or in the plant, which serves as the starting substance for the synthesis. Since these are biosynthetic chains, the respective end products are not present as pure substances in the organisms. There are always small amounts of precursor compounds in the final product. These small amounts are less than 20 wt .-%, advantageously less than 15 wt .-%, more preferably less than 10 wt .-%, most preferably less than 5, 4, 3, 2 or 1 wt .-% based to the end product DGLA, ETA or mixtures thereof or ARA, EPA, DHA or mixtures thereof advantageously EPA or DHA or mixtures thereof.

In addition to the production of the starting fatty acids for the Δ-5-desaturase used in the method according to the invention, Δ-6-desaturase, Δ-4-desaturase, Δ-12-desaturase, Δ-5 elongase and / or Δ-6 elongase directly in Organism, the fatty acids can also be fed from the outside. For cost reasons, production in the organism is preferred. Preferred substrates are the linoleic acid (C18: 2 ^{Δ9 '12} ), the γ-linolenic acid (C18: 3 ^{Δ6 9 12} ), the eicosadienoic acid (C20: 2 ^{Δ11 14} ), the dihomo-γ-linolenic acid (C20: 3 ^Δ8 ' ^{11 '14),} arachidonic acid (C20: 4 ^{Δ5811'. 14)} docosatetraenoic acid _{(C22 4} ^{Δ7, i o, i3, i6)} _{and DJE Docosapen} taensäure (C22: 5 ^{Δ4Λ10 _'13 15).}

To increase the yield in the described process for the preparation of oils and / or triglycerides having an advantageously increased content of polyunsaturated fatty acids, it is advantageous to increase the amount of starting material for the fatty acid synthesis, this can be achieved, for example, by introducing a nucleic acid into the organism for a polypeptide encoded with Δ-12-desaturase. This is particularly advantageous in oil-producing organisms such as the family Brassicaceae such as the genus Brassica eg rape; the family of Elaeagnaceae as the genus Elaeagnus eg the genus and species Olea europaea or family Fabaceae as the genus Glycine eg the genus and species Glycine max, which have a high oleic acid content. Since these organisms have only a low content of linoleic acid (Mikoklajczak et al., Journal of the American Oil Chemical Society, 38, 1961, 678-681), the use of said Δ-12-desaturases for the preparation of the starting product linoleic acid is advantageous. Nucleic acids used in the method according to the invention are advantageously derived from plants such as algae, for example algae of the family Prasinophyceae as from the genera Heteromastix, Mammella, Mantoniella, Micromonas, Nephroselmis, Ostreococcus, Prasinocladus, Prasinococcus, Pseudoscourfielda, Pycnococcus, Pyramimonas, Scherffelia or Tetraselmis such as the genera and Heteromastix longifillis, Mamiella gilva, Mantoniella squamata, Micromonas pusilla, Nephroselmis olivacea, Nephroselmis pyriformis, Nephroselmis rotunda, Ostreococcus tauri, Ostreococcus sp. Prasinocladus ascus, Prasinocladus lubricus, Pycnococcus provasolii, Pyramimonas amylifera, Pyramimonas disomata, Pyramimonas obovata, Pyramimonas orientalis, Pyramimonas parkeae, Pyramimonas spinifera, Pyramimonas sp., Tetraselmis apiculata, Tetraselmis carteriaformis, Tetraselmis chui, Tetraselmis convolutae, Tetraselmis desikacharyi, Tetraselmis gracilis, Tetraselmis hazeni, Tetraselmis impellucida, Tetraselmis inconspicua, Tetraselmis levis, Tetraselmis maculata, Tetraselmis marina, Tetraselmis striata, Tetraselmis subcordiformis, Tetraselmis suecica, Tetraselmis tetrabrachia, Tetraselmis tetrathele, Tetraselmis verrucosa, Tetraselmis verrucosa fo. Rubens or Tetraselmis sp. Advantageously, the nucleic acids used are derived from algae of the genera Mantonielle or Ostreococcus.

Further advantageous plants are algae such as Isochrysis or Crypthecodinium, algae / diatoms such as Thalassiosira, Phaeodactylum or Thraustochytrium, mosses such as Physcomitrella or Ceratodon or higher plants such as Primulaceae such as

Aleuritia, Calendula stellata, Osteospermum spinescens or Osteospermum hyose roides, microorganisms such as fungi such as Aspergillus, Thraustochytrium, Phytophthora, Entomophthora, Mucor or Mortierella, bacteria such as Shewanella, yeasts or animals such as nematodes such as Caenorhabditis, insects or fish. Advantageously, the isolated nucleic acid sequences according to the invention are derived from an animal from the

Order of the Vertebrates. Preferably, the nucleic acid sequences are of the vertebrate class; Euteleostomi, Actinopterygii; Neopterygii; Teleostei; Euteleostei, Protacanthopterygii, Salmoniformes; Salmonidae or Oncorhynchus. The nucleic acids originate particularly advantageously from fungi, animals or from plants such as algae or mosses, preferably from the order of the Salmoniformes such as the family Salmonidae such as the genus Salmo, for example from the genera and species Oncorhynchus mykiss, Trutta trutta or Salmo trutta fario, from algae such as the genera Mantonielle or Ostreococcus or from the diatoms such as the genera Thalassiosira or Crypthecodinium.

Advantageous in the method according to the invention are the abovementioned nucleic acid sequences or their derivative or homologs which code for polypeptides which still possess the enzymatic activity of the proteins encoded by nucleic acid sequences. These sequences are used singly or in combination with the nucleic acid sequences encoding Δ12-desaturase, Δ4-desaturase, Δ5-desaturase, Δ6-desaturase, Δ5-elongase and / or Δ6-elongase cloned into expression constructs and used for introduction and expression in organisms. This expression By their construction, constructs enable a favorable optimum synthesis of the polyunsaturated fatty acids produced in the process according to the invention.

In a preferred embodiment, the method further comprises the step of obtaining a cell or a whole organism containing the nucleic acid sequences used in the method, wherein the cell and / or the organism with a nucleic acid sequence according to the invention, for the Δ-12-desaturase , Δ-4-desaturase, Δ-5-desaturase, Δ-6-desaturase, Δ-5 elongase and / or Δ-6 elongase, a gene construct or a vector as described below, alone or in combination with other nucleic acid sequences which code for proteins of the fatty acid or lipid metabolism is transformed. In a further preferred embodiment, this method further comprises the step of recovering the oils, lipids or free fatty acids from the organism or from the culture. The culture may be, for example, a fermentation culture, for example, in the case of culturing microorganisms such as e.g. Mortierella, Thalassiosira, Mantoniella, Ostreococcus, Saccharomyces or Thraustochytrium or to act as a greenhouse or field crop of a plant. The cell or organism thus produced is advantageously a cell of an oil-producing organism such as an oil crop such as peanut, canola, canola, flax, hemp, peanut, soybean, safflower, hemp, sunflower or borage. Cultivation is, for example, culturing in the case of plant cells, tissue or organs on or in a nutrient medium or the whole plant on or in a substrate, for example in hydroponics, potting soil or on arable land.

"Transgene" or "recombinant" in the sense of the invention means, for example, a nucleic acid sequence, an expression cassette (= gene construct) or a vector containing the nucleic acid sequence according to the invention or an organism transformed with the nucleic acid sequences, expression cassette or vector according to the invention all such by genetic engineering methods Constructions in which either a) the nucleic acid sequence according to the invention, or b) a genetic control sequence functionally linked to the nucleic acid sequence according to the invention, for example a promoter, or c) (a) and (b) are not in their natural, genetic environment or were modified by genetic engineering methods, the modification being exemplified by

Substitution, addition, deletion, inversion or insertion of one or more nucleotide residues. Natural genetic environment means the natural genomic or chromosomal locus in the source organism or presence in a genomic library. In the case of a genomic library, the natural, genetic environment of the nucleic acid sequence preferably at least partially preserved. The environment flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, more preferably at least 1000 bp, most preferably at least 5000 bp. A naturally occurring expression cassette - for example, the naturally occurring combination of the natural promoter of the nucleic acid sequences of the invention with the corresponding Δ-12-desaturase, Δ-4-desaturase, Δ-5-desaturase, Δ-6-desaturase and / or Δ -5-elongase genes - becomes a transgenic expression cassette when modified by non-natural, synthetic ("artificial") methods such as mutagenization. Corresponding methods are described, for example, in US Pat. No. 5,565,350 or WO 00/15815.

Under the transgenic organism or transgenic plant according to the invention as mentioned above is to be understood that the nucleic acids used in the method are not in their natural place in the genome of an organism, while the nucleic acids can be expressed homologously or heterologously. However, transgene also means, as mentioned, that the nucleic acids according to the invention are in their natural place in the genome of an organism, but that the sequence has been changed compared to the natural sequence and / or the regulatory sequences of the natural sequences have been changed. Transgenic is preferably understood to mean the expression of the nucleic acids according to the invention at a non-natural site in the genome, that is to say a homologous or preferably heterologous expression of the nucleic acids is present. Preferred transgenic organisms are fungi such as Mortierella or Phytophthora, mosses such as Physcomitrella, algae such as Mantoniella or Ostreococcus, diatoms such as Thalassiosira or Crypthecodinium or plants such as the oil crop plants.

In principle, all organisms which are capable of synthesizing fatty acids, especially unsaturated fatty acids, or which are suitable for the expression of recombinant genes, are suitable in principle as organisms or host organisms for the nucleic acids, the expression cassette or the vector used in the method according to the invention. Examples include plants such as Arabidopsis, Asteraceae such as calendula or crops such as soybean, peanut, castor, sunflower, corn, cotton, flax, rapeseed, coconut, oil palm, dyer safflower (Carthamus tinctorius) or cocoa bean, microorganisms such as fungi, for example, the genus Mortierella, Thrausto- chytrium, saprolegnia, phytophthora or pythium, bacteria such as the genus Escherichia or Shewanella, yeasts such as the genus Saccharomyces, cyanobacteria,

Ciliates, algae such as Mantoniella or Ostreococcus or protozoans such as dinoflagellates such as Thalassiosira or Crypthecodinium called. Preference is given to organisms which are naturally capable of synthesizing oils in large quantities, such as fungi such as Mortierella alpina, Pythium insidiosum, Phytophtora infestans or plants such as soybean, oilseed rape, coconut, oil palm, dyer's safflower, flax, hemp, castor, calendula, peanut,

Cocoa bean or sunflower or yeasts such as Saccharomyces cerevisiae, with particular preference being given to soybean, flax, rapeseed, dyer's safflower, sunflower, calendula, mortierella or Saccharomyces cerevisiae. In principle, as host organisms next Transgenic animals are advantageously also suitable for non-human animals, for example C. elegans, for the abovementioned transgenic organisms.

Useful host cells are also mentioned in: Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Useful expression strains e.g. those which have lower protease activity are described in: Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128.

These include plant cells and certain tissues, organs and parts of plants in all their manifestations, such as anthers, fibers, root hairs, stems, embryos, cilia, kotelydons, petioles, crops, plant tissue, reproductive tissue and cell cultures, that of the actual transgenic plant is derived and / or can be used to produce the transgenic plant.

Transgenic plants which contain the polyunsaturated fatty acids synthesized in the process according to the invention can advantageously be marketed directly without the synthesized oils, lipids or fatty acids having to be isolated. Plants in the process according to the invention include whole plants and all plant parts, plant organs or plant parts such as leaves, stems, seeds, roots, tubers, anthers, fibers, root hairs, stems, embryos, callosis, kotelydons, petioles, crop material, plant tissue, reproductive tissue, Cell cultures that can be derived from the transgenic plant and / or used to produce the transgenic plant. The seed includes all seed parts such as the seed shells, epidermis and sperm cells, endosperm or embryonic tissue. However, the compounds prepared in the process according to the invention can also be isolated from the organisms advantageously plants in the form of their oils, fat, lipids and / or free fatty acids. Polyunsaturated fatty acids produced by this process can be harvested by harvesting the organisms either from the culture in which they grow or from the field. This can be done by pressing or extraction of the plant parts, preferably the plant seeds. In this case, the oils, fats, lipids and / or free fatty acids by so-called cold beat or cold pressing can be obtained without supplying heat by pressing. In order for the plant parts, especially the seeds, to be easier to digest, they are first crushed, steamed or roasted. The thus pretreated seeds can then be pressed or extracted with solvents such as warm hexane. Subsequently, the solvent is removed again. In the case of microorganisms, these are harvested after harvesting, for example, directly without further working steps, or else extracted after digestion by various methods known to the person skilled in the art. In this way, more than 96% of the compounds prepared in the process can be isolated. Subsequently, the products thus obtained are further processed, that is refined. First of all, for example, the mucilages and turbid matter are removed. So-called degumming can be enzymatic or _∞

wise chemically / physically by addition of acid such as phosphoric acid. Subsequently, the free fatty acids are removed by treatment with a base, for example sodium hydroxide solution. The product obtained is thoroughly washed with water to remove the lye remaining in the product and dried. In order to remove the dyes still contained in the product, the products of a

Bleaching with, for example, bleaching earth or activated carbon subjected. Finally, the product is still deodorized, for example, with steam.

The PUFAs or LCPUFAs C ₁ 8, C ₂ O or C ₂₂ fatty acid molecules produced by this process are preferably C ₂₀ - or C ₂₂ -fatty acid molecules having at least two double bonds in the fatty acid molecule, preferably three, four, five or six double bonds , These C ₁₈ , C ₂₀ or C ₂₂ fatty acid molecules can be isolated from the organism in the form of an oil, lipid or a free fatty acid. Suitable organisms are, for example, those mentioned above. Preferred organisms are transgenic plants. One embodiment of the invention is therefore oils, lipids or fatty acids or fractions thereof which have been prepared by the method described above, more preferably oil, lipid or fatty acid composition comprising PUFAs derived from transgenic plants.

These oils, lipids or fatty acids advantageously contain 6 to 15% palmitic acid, 1 to 6% stearic acid as described above; 7 - 85% oleic acid; 0.5 to 8% of vaccenic acid, 0.1 to 1% of arachidic acid, 7 to 25% of saturated fatty acids, 8 to 85% of monounsaturated fatty acids and 60 to 85% of polyunsaturated fatty acids in each case based on 100% and on the total fatty acid content of the organisms. As advantageous polyunsaturated fatty acid in the fatty acid esters or fatty acid mixtures are preferably at least 0.1; 0.2; 0.3; 0.4; 0.5; 0.6; 0.7; 0.8; 0.9 or 1% based on the total fatty acid content of arachidonic acid. Furthermore, the fatty acid esters or fatty acid mixtures prepared by the process according to the invention advantageously contain fatty acids selected from the group of the fatty acids erucic acid (13-docosaoic acid), sterculic acid (9,10-methylene octadec-9-enoic acid), malvalic acid (8,9 -Methylene heptadec-8-enoic acid), chaulmoogric acid (cyclopentenodecanoic acid), furan fatty acid (9,12-epoxy-octadeca-9,11-dienoic acid), vernonic acid (9,10-epoxyoctadec-12-enoic acid), tartric acid ( 6- octadecynoic acid), 6-nonadecynoic acid, santalbic acid (t11-octadecen-9-ynoic acid), 6,9-octadecenynoic acid, pyrulic acid (t10-heptadecen-8-ynonic acid), crepenyninic acid (9-octadecen-12-ynonic acid) , 13,14-dihydrooropheic acid, octadecene-13-ene-9,11-diynoic acid, petroselenoic acid (cis-6-octadecenoic acid), 9c, 12t-octadecadienoic acid, calendulic acid (8t10t12c octadecatrienoic acid), catalpinic acid (9t11t13c octadecatrienoic acid), Eleosteric acid (9c11t13t octadecatrienoic acid), Jaca ricinic acid (8c10t12c-octadecatrienoic acid), punicic acid (9c11t13c-octadecatrienoic acid), parinaric acid (9c11t13t15c-octadecatetraenoic acid), pinolenic acid (all-cis-

5,9,12-octadecatrienoic acid), labialic acid (5,6-octadecadienelene acid), ricinoleic acid (12-hydroxyoleic acid) and / or coriolinic acid (13-hydroxy-9c, 11t-octadecadienoic acid). acid). The abovementioned fatty acids are generally advantageously present only in traces in the fatty acid esters or fatty acid mixtures prepared by the process according to the invention, that is to say they are less than 30%, preferably less than 25%, 24%, 23%, based on the total fatty acids. , 22% or 21%, more preferably less than 20%, 15%, 10%, 9%, 8%, 7%, 6% or 5%, most preferably less than 4%, 3%, 2% or 1% ago. Advantageously, the fatty acid esters or mixtures of fatty acids prepared by the process according to the invention contain less than 0.1% based on the total fatty acids or no butter butyric acid, no cholesterol, no clupanodonic acid (= docosapentaenoic acid, C22: 5 ^A4t8 ' ¹² ' ^{15 '21} ) and none Nisic acid (tetracosahexaenoic acid, C23 _' 6 ^{A3 | 8} _' ^{12 |} i ⁵ _l ^{| 8 | 2} -u

The oils, lipids or fatty acids according to the invention advantageously contain at least 0.5%, 1%, 2%, 3%, 4% or 5%, advantageously at least 6%, 7%, 8%, 9% or 10%, particularly advantageously at least 11%, 12%, 13%, 14% or 15% ARA or at least 0.5%, 1%, 2%, 3%, 4% or 5%, advantageously at least 6%, or 7%, especially advantageous at least 8%, 9% or 10% EPA and / or DHA based on the total fatty acid content of the production organism advantageously a plant, particularly advantageous an oil crop such as soybean, rapeseed, coconut, oil palm, safflower, flax, hemp, castor, calendula, peanut , Cocoa bean, sunflower or the above-mentioned other monocotyledonous or dicotyledonous oil crops.

Another embodiment of the invention is the use of the oil, lipid, fatty acids and / or fatty acid composition in feed, food, cosmetics or pharmaceuticals. The oils, lipids, fatty acids or fatty acid mixtures according to the invention can be used in the manner known to those skilled in the art for blending with other oils, lipids, fatty acids or fatty acid mixtures of animal origin, such as fish oils. These oils, lipids, fatty acids or fatty acid mixtures, which consist of vegetable and animal components, can be used for the production of feed, food, cosmetics or pharmaceuticals. The term "oil", "lipid" or "fat" is understood as meaning a fatty acid mixture which contains unsaturated, saturated, preferably esterified fatty acid (s). It is preferred that the oil, lipid or fat contains a high proportion of polyunsaturated free or advantageously esterified fatty acid (s), in particular linoleic acid, γ-linolenic acid, dihomo-γ-linolenic acid, arachidonic acid, α-linolenic acid, stearidonic acid, eicosatetraenoic acid, eicosapentaenoic acid, Docosapentaenoic acid or docosahexaenoic acid has. Preferably, the proportion of unsaturated esterified fatty acids is about 30%, more preferred is a proportion of 50%, even more preferred is a proportion of 60%, 70%, 80% or more. For the determination, for example, the proportion of fatty acid after conversion of the fatty acids into the methyl esters can be determined by transesterification by gas chromatography. The oil, lipid or fat can be various other saturated or unsaturated fatty acids, eg calendulic acid, palmitic, palmitoleic, stearic, oleic acid etc., contain. In particular, depending on the starting organism, the proportion of the various fatty acids in the oil or fat may vary.

The polyunsaturated fatty acids having advantageously at least two double bonds which are produced in the process are, as described above, for example sphingolipids, phosphoglycerides, lipids, glycolipids, phospholipids, monoacylglycerol, diacylglycerol, triacylglycerol or other fatty acid esters.

From the polyunsaturated fatty acids thus produced in the process according to the invention advantageously having at least five or six double bonds, the polyunsaturated fatty acids containing, for example, via an alkali treatment, for example aqueous KOH or NaOH or acid hydrolysis in the presence of an alcohol such as methanol or ethanol or over a release enzymatic cleavage and isolate via, for example, phase separation and subsequent acidification over, for example, H ₂ SO ₄ . The release of the fatty acids can also be carried out directly without the workup described above. The nucleic acids used in the process can after introduction into a

Organism advantageously a plant cell or plant are either on a separate plasmid or advantageously integrated into the genome of the host cell. When integrated into the genome, integration may be at random or by such recombination as to replace the native gene with the incorporated copy, thereby modulating the production of the desired compound by the cell, or by using a gene in trans such that Gene having a functional expression unit, which contains at least one expression of a gene ensuring sequence and at least one polyadenylation of a functionally transcribed gene ensuring sequence is operably linked. Advantageously, the nucleic acids are brought into the plants via multi-expression cassettes or constructs for multiparallel expression in the organisms, advantageously for multiparallel seed-specific expression of genes.

Moose and algae are the only known plant systems that produce significant amounts of polyunsaturated fatty acids, such as arachidonic acid (ARA) and / or eicosapentaenoic acid (EPA) and / or docosahexaenoic acid (DHA). Moose contain PUFAs in membrane lipids, while algae, algae-related organisms and some fungi also accumulate significant levels of PUFAs in the triacylglycerol fraction. Therefore, nucleic acid molecules isolated from strains which also accumulate PUFAs in the triacylglycerol fraction are particularly advantageous for the process of the invention and thus for modification of the lipid and PUFA production system in a host, in particular plants such as oilseed crops, for example oilseed rape. Canola, flax, hemp, soy, sunflower, borage. They are therefore advantageous for use in the process according to the invention.

As substrates of the nucleic acids used in the method according to the invention which are useful for polypeptides having Δ-12-desaturase, Δ-5-desaturase, Δ-4-desaturase, Δ-6

Encode desaturase, Δ-5 elongase and / or Δ-6 elongase activity, and / or the other used nucleic acids such as the nucleic acids selected for polypeptides of fatty acid or lipid metabolism from the group acyl-CoA dehydrogenase (s), acyl-ACP [= acyl carrier protein] desaturase (s), acyl-ACP thioesterase (n ), Fatty acid acyltransferase (s), acyl-CoAlysophospholipid acyltransferase (s), fatty acid synthase (s), fatty acid hydroxylase (s), acetyl

Coenzyme A carboxylase (s), acyl coenzyme A oxidase (s), fatty acid desaturase (s), fatty acid acetylenase (s), lipoxygenase (s), triacylglycerol lipase (s), allene oxide synthase (s) , Hydroperoxide lyase (s) or fatty acid elongase (s) encode advantageously Ci ₆ -, C ₁₈ - or C ₂ o fatty acids. The fatty acids reacted as substrates in the process are preferably reacted in the form of their acyl-CoA esters and / or their phospholipid esters.

To prepare the long-chain PUFAs according to the invention, the polyunsaturated C ₁₈ -fatty acids must first be desaturated by the enzymatic activity of a desaturase and then be extended by at least two carbon atoms via an elongase. After one round of elongation, this enzyme activity leads to C ₂₀ -fatty acids, and after two rounds of elongation to C ₂₂ -fatty acids. The activity of the method of the desaturases and elongases used in the invention preferably leads to C ₈ -, C ₂₀ - and / or C ₂₂ fatty acids advantageously having at least two double bonds in the fatty acid molecule, preferably with three, four, five or six double bonds, especially preferably to C ₂₀ - and / or C ₂₂ fatty acids having at least two double bonds in the fatty acid molecule, preferably having three, four, five or six double bonds, most preferably having five or six double bonds in the molecule. After a first desaturation and extension, further desaturation and elongation steps, such as desaturation at Δ-5 and Δ-4 positions, may occur. Particularly preferred products of the process according to the invention are dihomo-γ-linolenic acid, arachidonic acid, eicosapentaenoic acid, docosapentaenoic acid and / or docosaheic acid. The C ₂₀ fatty acids having at least two double bonds in the fatty acid can be extended by the enzymatic activity according to the invention in the form of the free fatty acid or in the form of the esters, such as phospholipids, glycolipids, sphingolipids, phosphoglycerides, monoacylglycerol, diacylglycerol or triacylglycerol.

The preferred biosynthesis site of fatty acids, oils, lipids or fats in the advantageously used plants is, for example, generally the seed or cell layers of the seed, so that a seed-specific expression of the nucleic acids used in the process makes sense. However, it is obvious that the biosynthesis of fatty acids, oils or lipids need not be limited to the seed tissue, but may also be tissue-specific in all other parts of the plant - for example in epidermal cells or in the tubers.

Are in the process of the invention as organisms microorganism such as yeasts such as Saccharomyces or Schizosaccharomyces, fungi such as Mortierella, Aspergillus, Phytophtora, Entomophthora, Mucor or Thraustochytrium algae such as Isochrysis, Mantonielia, Ostreococcus, Phaeodactylum or Crypthecodinium used, these organisms are advantageously attracted to fermentation.

By using the nucleic acids according to the invention which code for a Δ-5 elongase, the polyunsaturated fatty acids prepared in the process can be at least 5%, preferably at least 10%, more preferably at least 20%, very particularly preferably at least 50%. be increased compared to the wild type of organisms that do not contain the nucleic acids recombinantly.

By the method according to the invention, the polyunsaturated fatty acids produced in the organisms used in the process can in principle be increased in two ways. Advantageously, the pool of free polyunsaturated fatty acids and / or the proportion of esterified polyunsaturated fatty acids produced by the process can be increased. Advantageously, the process according to the invention increases the pool of esterified polyunsaturated fatty acids in the transgenic organisms.

If microorganisms are used as organisms in the process according to the invention, they are grown or grown, depending on the host organism, in a manner known to the person skilled in the art. Microorganisms are usually in a liquid medium containing a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese, magnesium salts and optionally vitamins, at temperatures between 0 ⁰ C and 100 ⁰ C, preferably between 10 ⁰ C to 60 ⁰ C attracted under oxygen fumigation. In this case, the pH of the nutrient fluid can be kept at a fixed value, that is regulated during the cultivation or not. The cultivation can be batchwise, semi-batch wise or continuous. Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously. The polyunsaturated fatty acids prepared can be isolated from the organisms by methods known to those skilled in the art as described above. For example, extraction, distillation, crystallization, optionally salt precipitation and / or chromatography. The organisms can be opened up for this purpose yet advantageous.

The method according to the invention, when the host organisms are microorganisms, is particularly advantageous at a temperature between 0 ° C to 95 °, preferably between 10 ° C to 85 ° C, more preferably between 15 ° C to 75 ° C preferably carried out between 15 ° C to 45 ° C.

The pH is advantageously maintained between pH 4 and 12, preferably between pH 6 and 9, more preferably between pH 7 and 8.

The process according to the invention can be operated batchwise, semi-batchwise or continuously. A summary of known cultivation methods can be found in the textbook by Chmiel (Bioprozesstechnik 1. Introduction to Bioprocessing Methods). technique (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (bioreactors and peripheral facilities (Vieweg Verlag, Braunschweig / Wiesbaden, 1994)).

The culture medium to be used must suitably satisfy the requirements of the respective strains. Descriptions of culture media of various microorganisms are included in the Manual of Methods for General Bacteriology of the American Society of Bacteriology (Washington D.C. ₁ USA, 1981).

As described above, these media which can be used according to the invention usually comprise one or more carbon sources, nitrogen sources, inorganic salts, vitamins and / or trace elements.

Preferred carbon sources are sugars, such as mono-, di- or polysaccharides. Examples of very good carbon sources are glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose. Sugar can also be added to the media via complex compounds, such as molasses, or other by-products of sugar refining. It may also be advantageous to add mixtures of different carbon sources. Other possible sources of carbon are oils and fats, e.g. Soybean oil, sunflower oil, peanut oil and / or coconut fat, fatty acids such as e.g. Palmitic acid, stearic acid and / or linoleic acid, alcohols and / or polyhydric alcohols such. Glycerol, methanol and / or ethanol and / or organic acids such as e.g. Acetic acid and / or lactic acid.

Nitrogen sources are usually organic or inorganic nitrogen compounds or materials containing these compounds. Exemplary nitrogen sources include ammonia in liquid or gaseous form or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or complex nitrogen sources such as corn steep liquor, soybean meal, soy protein, yeast extract, meat extract and others. The nitrogen sources can be used singly or as a mixture.

Inorganic salt compounds which may be included in the media include the chloride, phosphorus or sulfate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron.

As the sulfur source for the production of sulfur-containing fine chemicals, in particular methionine, inorganic sulfur-containing compounds such as sulfates, sulfites, dithionites, tetrathionates, thiosulfates, sulfides but also organic sulfur compounds, such as mercaptans and thiols can be used.

Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the phosphorus source. Chelating agents can be added to the medium to keep the metal ions in solution. Particularly suitable chelating agents include dihydroxyphenols, such as catechol or protocatechuate, or organic acids, such as citric acid.

The fermentation media used according to the invention for the cultivation of microorganisms usually also contain other growth factors, such as vitamins or growth promoters, which include, for example, biotin, riboflavin, thiamine, folic acid, nicotinic acid, panthogenate and pyridoxine. Growth factors and salts are often derived from complex media components, such as yeast extract, molasses, corn steep liquor, and the like. In addition, suitable precursors can be added to the culture medium. The exact composition of the media compounds will depend heavily on the particular experiment and will be decided on a case by case basis. Information about the media optimization is available from the textbook "Applied Microbiol Physiology, A Practical Approach" (ed. P. M. Rhodes, P. F. Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 963577 3). Growth media may also be obtained from commercial suppliers, such as standard 1 (Merck) or BHI (Brain Heart Infusion, DIFCO) and the like.

All media components are sterilized either by heat (20 min at 1, 5 bar and 121 ⁰ C) or by sterile filtration. The components can either be sterilized together or, if necessary, sterilized separately. All media components may be present at the beginning of the culture or added randomly or batchwise, as desired.

The temperature of the culture is usually between 15 ° C and 45 ° C, preferably at 25 ° C to 40 ⁰ C and can be kept constant or changed during the experiment. The pH of the medium should be in the range of 5 to 8.5, preferably 7.0. The pH for cultivation can be controlled during cultivation by addition of basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water or acidic compounds such as phosphoric acid or sulfuric acid. To control the foaming anti-foaming agents such. As fatty acid polyglycol, are used. To maintain the stability of plasmids, the medium can be suitably selected substances such. As antibiotics, are added. In order to maintain aerobic conditions, oxygen or oxygen-containing gas mixtures, such as ambient air, are introduced into the culture. The temperature of the culture is normally from 20 ⁰ C to 45 ⁰ C and preferably at 25 ° C to 40 ⁰ C. The culture is continued until a maximum of the desired product has formed. This goal is usually reached within 10 hours to 160 hours.

The fermentation broths thus obtained, in particular containing polyunsaturated fatty acids, usually have a dry matter content of 7.5 to 25% by weight.

The fermentation broth can then be further processed. Depending on the requirement, the biomass can be wholly or partly by separation methods, such. As centrifugation, filtration, decantation or a combination of these methods removed from the fermentation broth or left completely in it. Advantageously, the biomass is worked up after separation.

The fermentation broth can also without cell separation with known methods such. B. with the aid of a rotary evaporator, thin film evaporator, falling film evaporator, by reverse osmosis, or by nanofiltration, thickened or concentrated. This concentrated fermentation broth may eventually be worked up to recover the fatty acids contained therein.

The fatty acids obtained in the process are also suitable as starting material for the chemical synthesis of further products of value. They may be used, for example, in combination with each other or solely for the manufacture of pharmaceuticals, foods, animal feed or cosmetics.

A further subject of the invention are isolated nucleic acid sequences which code for polypeptides with Δ-6-desaturase activity selected from the group: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 13, b) nucleic acid sequences resulting from the degenerate genetic code or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 13 which code for polypeptides having at least 40% homology at the amino acid level with SEQ ID NO: 14 and a Δ- derivative of the amino acid sequence shown in SEQ ID NO: 14. Having 6-desaturase activity.

A further subject of the invention are isolated nucleic acid sequences which code for polypeptides with Δ5-desaturase activity, selected from the group: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 9 or SEQ ID NO: 11, b) nucleic acid sequences which can be derived as the result of the degenerate genetic code from the amino acid sequence shown in SEQ ID NO: 10 or in SEQ ID NO: 12, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 9 or in SEQ ID NO: 11, which code for polypeptides having at least 40% homology at the amino acid level with SEQ ID NO: 10 or in SEQ ID NO: 12 and have a Δ-5-desaturase activity. A further subject of the invention are isolated nucleic acid sequences which code for polypeptides with Δ-4-desaturase activity selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 7, b) nucleic acid sequences resulting from the degenerate genetic code or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 7, which code for polypeptides having at least 40% homology at the amino acid level with SEQ ID NO: 8 and a Δ-4- Have desaturase activity. A further subject of the invention are isolated nucleic acid sequences which code for polypeptides with Δ-12-desaturase activity, selected from the group: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 15, b) nucleic acid sequences resulting from the degenerate genetic code derive from the amino acid sequence shown in SEQ ID NO: 16, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 15 which encode polypeptides having at least 50% homology at the amino acid level with SEQ ID NO: 16 and a Δ- Have 12-desaturase activity.

A further subject of the invention are gene constructs which contain the nucleic acid sequences according to the invention SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15, wherein the nucleic acid is functional with one or more regulatory signals connected is. In addition, other biosynthesis genes of the fatty acid or lipid metabolism selected from the group acyl-CoA dehydrogenase (s), acyl-ACP [acyl carrier protein] desaturase (s), acyl-ACP-thioesteraseCn), fatty acid acyl transferase (n), acyl-CoA: lysophospholipid acyltransferase (s), fatty acid synthase (s), fatty acid hydroxylase (s), acetyl coenzyme A carboxylase (s), acyl coenzyme A oxidase (s) , Fatty acid desaturase (s), fatty acid acetylenases, lipoxygenases, triacylglycerol lipases, allene oxide synthases, hydroperoxide lyases or fatty acid elongase (s) may be present in the gene construct. In addition, biosynthesis genes of the fatty acid or lipid metabolism selected from the group of Δ4-desaturase, Δ5-desaturase, Δ6-desaturase, Δ9-desaturase, Δ12-desaturase or Δ6-elongase are advantageously also contained ,

Advantageously, all the nucleic acid sequences used in the method according to the invention are derived from a eukaryotic organism such as a plant, a microorganism or an animal. Preferably, the nucleic acid sequences are from the order Salmoniformes, algae such as Mantoniella or Ostreococcus, fungi such as the genus Phytophtora or diatoms such as the genera Thalassiosira or Crypthecodinium.

The nucleic acid sequences used in the method, which are proteins for Δ-4-desaturase, Δ-5-desaturase, Δ-6-desaturase, Δ-9-desaturase, Δ-12-desaturase, Δ-5-Eloπgase - or Δ 6 -ongase activity, are advantageously alone or preferably in combination in an expression cassette (= nucleic acid construct), which allows expression of the nucleic acids in an organism advantageously a plant or a microorganism introduced. There may be more than one nucleic acid sequence of an enzymatic activity, e.g. a Δ-12-desaturase, Δ-4-desaturase, Δ-5-desaturase, Δ-6-desaturase, Δ-5 elongase and / or Δ-6 elongase.

For introduction, the nucleic acids used in the method are advantageously subjected to amplification and ligation in a known manner. Preferably, the procedure is based on the protocol of Pfu DNA polymerase or a Pfu / Taq DNA. Polymerasegemisches ago. The primers are selected on the basis of the sequence to be amplified. Conveniently, the primers should be chosen so that the amplificate comprises the entire codogenic sequence from the start to the stop codon. Following amplification, the amplificate is conveniently analyzed. For example, the analysis can be carried out after gel electrophoretic separation in terms of quality and quantity. Subsequently, the amplificate can after a

Standard protocol be cleaned (eg Qiagen). An aliquot of the purified amplificate is then available for subsequent cloning. Suitable cloning vectors are generally known to the person skilled in the art. These include, in particular, vectors which can be replicated in microbial systems, ie in particular vectors which ensure efficient cloning in yeasts or fungi, and which enable stable transformation of plants. In particular, various suitable for T-DNA-mediated transformation, binary and co-integrated vector systems. Such vector systems are usually characterized in that they contain at least the vir genes required for the Agrobacterium-mediated transformation as well as the T-DNA limiting sequences (T-DNA border). Preferably, these vector systems also include other cis-regulatory regions, such as promoters and terminators and / or selection markers, with which appropriately transformed organisms can be identified. Whereas in co-integrated vector systems vir genes and T-DNA sequences are located on the same vector, binary systems are based on at least two vectors, one of them vir genes, but no T-DNA and a second T-DNA, but no carries vir gene. As a result, the latter vectors are relatively small, easy to manipulate and replicate in both E.coli and Agrobacterium. These binary vectors include vectors of the series pBIB-HYG, pPZP, pBecks, pGreen. Bin19, pBI101, pBinAR, pGPTV and pCAMBIA are preferably used according to the invention. For a review of binary vectors and their use, see Hellens et al, Trends in Plant Science (2000) 5, 446-451. For the vector preparation, the vectors can first be linearized with restriction endonuclease (s) and then enzymatically modified in a suitable manner become. The vector is then purified and an aliquot used for cloning. In cloning, the enzymatically cut and if necessary purified amplicon is cloned with similarly prepared vector fragments using ligase. In this case, a particular nucleic acid construct or vector or plasmid construct can have one or more codogenic gene segments.

Preferably, the codogenic gene segments in these constructs are functionally linked to regulatory sequences. The regulatory sequences include, in particular, plant sequences such as the promoters and terminators described above. The constructs can advantageously be stably propagated in microorganisms, in particular Escherichia coli and Agrobacterium tumefaciens, under selective conditions and enable a transfer of heterologous DNA into plants or microorganisms.

With the advantageous use of cloning vectors, the nucleic acids used in the method, the inventive nucleic acids and nucleic acid constructs can be introduced into organisms such as microorganisms or advantageously plants and thus used in plant transformation, such as those published in and cited therein Molecular Biology and Biotechnology (CRC Press, Boca Raton, Florida), Chapter 6/7, pp. 71-119 (1993); F. F. White, Vectors for Gene Transfer to Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, eds .: Kung and R. Wu, Academic Press, 1993, 15-38; Genes Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, eds. Kung and R. Wu, Academic Press (1993), 128-143; Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225)). The nucleic acids used in the method, the inventive nucleic acids and nucleic acid constructs and / or vectors can thus be used advantageously for the genetic modification of a broad spectrum of organisms to plants, so that they become better and / or more efficient producers of PUFAs.

There are a number of mechanisms by which a change in the Δ-12-desaturase, Δ-5-elongase, Δ-6 elongase, Δ-5-desaturase, Δ-4-desaturase and / or Δ 6-desaturase protein and the other proteins used in the method, such as the Δ12-desaturase, Δ6-desaturase, Δ6-elongase, Δ5-desaturase or Δ4-desaturase proteins is possible, so that the yield, production and / or efficiency of the production of the advantageous polyunsaturated fatty acids in a plant preferably in an oil crop or a microorganism due to this altered protein can be directly influenced. The number or activity of Δ12-desaturase, Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase or Δ4-desaturase proteins or genes can be increased so that larger amounts of the gene products and thus ultimately larger amounts of the compounds of general formula I are produced. Also, a de novo synthesis in an organism lacking the activity and ability to biosynthesize the compounds before introducing the gene (s) of interest is possible. The same applies to the combination with other desaturases or elongases or other enzymes from the fatty acid and lipid metabolism. Also the use different divergent, ie different sequences on DNA sequence level may be advantageous or the use of promoters for gene expression, which allows a different time gene expression, for example, depending on the degree of ripeness of a seed or oil-speichemden tissue. By introducing a Δ12-desaturase, Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase and / or Δ4-desaturase gene into one Organism alone or in combination with other genes in a cell can not only increase the biosynthetic flux to the final product, but also increase the corresponding TYi acylglycerin composition or created de novo. Likewise, the number or activity of other genes necessary for the import of nutrients necessary for the biosynthesis of one or more fatty acids, oils, polar and / or neutral lipids may be increased, such that the concentration of these precursors, cofactors or intermediates within the cells or within the storage compartment, thereby further increasing the ability of the cells to produce PUFAs, as described below. By optimizing the activity or increasing the number of one or more Δ12-desaturase, Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase or Δ-4- Desaturase genes involved in the biosynthesis of these compounds or by disrupting the activity of one or more genes involved in the degradation of these compounds may allow the yield, production and / or efficiency of fatty acid and fatty acid production To increase lipid molecules from organisms and advantageously from plants.

The isolated nucleic acid molecules used in the method of the invention encode proteins or parts thereof, wherein the proteins or the single protein or parts thereof contain an amino acid sequence sufficiently homologous to an amino acid sequence represented in the sequences SEQ ID NO: 2, SEQ ID NO 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 or SEQ ID NO: 16, so that the proteins or parts thereof still one Δ12-desaturase, Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase or Δ4-desaturase activity. Preferably, the proteins or portions thereof encoded by the nucleic acid molecule (s) still have their essential enzymatic activity and the ability to metabolically metabolize compounds or to transport molecules necessary to build cell membranes or lipid bodies in organisms in organisms to participate through these membranes. Advantageously, the proteins encoded by the nucleic acid molecules are at least about 40%, preferably at least about 50% or 60%, and more preferably at least about 70%, 80% or 90%, and most preferably at least about 85%, 86%, 87 %, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to those shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 or SEQ ID NO: 16 shown amino acid sequences. For the purposes of the invention is meant homology or homologous, identical or identical. The homology was calculated over the entire amino acid or nucleic acid sequence range. For the comparison of different sequences, a number of programs that are based on different algorithms are available to the person skilled in the art. The algorithms of Needleman and Wunsch or Smith and Waterman provide particularly reliable results. For the sequence comparisons the program PiIeUp was used (J. Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48: 443-453 (1970) and Smith and Waterman (Adv. Appl. Math. 2: 482-489 (1981)], which are described in the GCG Software Packet [Genetics Computer Group, 575 Science Drive, Madison , Wisconsin, USA 53711 (1991)]. The percent sequence homology values given above were determined using the GAP program over the entire sequence range with the following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10,000, and Average Mismatch: 0.000 These settings were always used as default settings for sequence comparisons unless otherwise specified.

Significant enzymatic activity of the Δ-12-desaturase, Δ-6-desaturase, Δ-6 elongase, Δ-5-desaturase, Δ-5 elongase or Δ-4-desaturase used in the method according to the invention is understood to mean that they are opposite to those represented by the sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 and their derivatives encoded proteins / enzymes by comparison still have at least one enzymatic activity of at least 10%, preferably 20%, more preferably 30% and very particularly 40% and thus the metabolism of the structure of fatty acids, fatty acid esters such as diacylglycerides and / or triacylglycerides in an organism can advantageously participate in a plant or plant cell necessary compounds or in the transport of molecules via membranes, wherein C ₁₈ , C ₂₀ or C ₂₂ carbon chains in the fatty acid molecule having double bonds to at least two, preferably three, four, fo five or six digits are meant.

Nucleic acids useful in the method are derived from bacteria, fungi, diatoms, animals such as Caenorhabditis or Oncorhynchus or plants such as algae or mosses such as the genera Shewanella, Physcomitrella, Thraustochytrium, Fusarium, Phytophthora, Ceratodon, Mantoniella, Ostreococcus, Isochrysis, Aleurita, Muscarioides, Mortierella , Borago, Phaeodactylum, Crypthecodinium, especially of the genera and species Oncorhynchus mykiss, Thalassiosira pseudonona, Mantoniella squamata, Ostreococcus sp., Ostreococcus tauri, Euglena gracilis, Physcomitrella patens, Phytophthora infestans, Fusarium graminaeum, Cryptocodinium cohnii, Ceratodon purpureus, Isochrysis galbana, Aleurita farinosa, Thraustochytrium sp., Muscarioides viallii, Mortierella alpina, Borago officinalis, Phaeodactylum tricornutum, Caenorhabditis elegans, or more particularly from Oncorhynchus mykiss, Thalassiosira pseudonona or Crypthecodinium cohnii.

Alternatively, nucleotide sequences may be used in the method according to the invention which are suitable for a Δ12-desaturase, Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase or Δ4-desaturase and which are linked to a nucleotide sequence as in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 are shown to hybridize advantageously under stringent conditions. The nucleic acid sequences used in the method are advantageously introduced into an expression cassette which enables expression of the nucleic acids in organisms such as microorganisms or plants.

The nucleic acid sequences encoding Δ-12-desaturase, Δ-6-desaturase, Δ-6 elongase, Δ-5-desaturase, Δ-5 elongase or Δ-4-desaturase are thereby amplified with one or more regulatory signals advantageously for

Increase in gene expression functionally linked. These regulatory sequences are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is expressed and / or overexpressed only after induction, or that it is expressed and / or overexpressed immediately. For example, these regulatory sequences are sequences that bind to the inducers or repressors and thus regulate the expression of the nucleic acid. In addition to these new regulatory sequences or instead of these sequences, the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically altered so that natural regulation is eliminated and expression of genes increased. However, the expression cassette (= expression construct = gene construct) can also have a simpler structure, ie no additional regulatory signals were inserted before the nucleic acid sequence or its derivatives and the natural promoter with its regulation was not removed. Instead, the natural regulatory sequence has been mutated to no longer regulate and / or increase gene expression. These modified promoters can be brought in the form of partial sequences (= promoter with parts of the nucleic acid sequences according to the invention) alone before the natural gene for increasing the activity. In addition, the gene construct may advantageously also contain one or more so-called enhancer sequences functionally linked to the promoter, which allow increased expression of the nucleic acid sequence. Additional advantageous sequences can also be inserted at the 3 'end of the DNA sequences, such as further regulatory elements or terminators. The Δ12-desaturase, Δ4-desaturase, Δ5-desaturase, Δ6-desaturase, Δ5-elongase and / or Δ6-elongase genes may be present in one or more copies in the expression cassette (= gene construct) may be included. Advantageously, only one copy of the genes is present in the expression cassette. This gene construct or gene constructs can be expressed together in the host organism. In this case, the gene construct or the gene constructs can be inserted in one or more vectors and be present freely in the cell or else in the

Be inserted genome. It is advantageous for the insertion of additional genes in the host genome when the genes to be expressed are present together in a gene construct. _^

42

The regulatory sequences or factors can, as described above, preferably positively influence the gene expression of the introduced genes and thereby increase them. Thus, enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers. In addition, however, an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.

A further embodiment of the invention is one or more gene constructs which contain one or more sequences represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 or its derivatives are defined and for polypeptides according to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 or SEQ ID NO: 16. The abovementioned Δ-12-desaturase, Δ-6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase or Δ4-desaturase proteins advantageously lead to desaturation or Elongierung of fatty acids, wherein the substrate advantageously one, two, three, four, five or six double bonds and advantageously has 18, 20 or 22 carbon atoms in the fatty acid molecule. The same applies to their homologs, derivatives or analogs which are operably linked to one or more regulatory signals, advantageously to increase gene expression.

Advantageous regulatory sequences for the novel process are, for example, in promoters, such as the cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, laclq, T7, T5 , T3, gal, trc, ara, SP6, λ-PR or λ-PL promoter and are advantageously used in Gram-negative bacteria. Further advantageous regulatory sequences are, for example, in the Gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFa, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH or in the plant promoters CaMV / 35S [ Franck et al., Cell 21 (1980) 285-294], PRP1 [Ward et al., Plant. Biol. 22 (1993)], SSU, OCS, Iib4, usp, STLS1, B33, nos or in the ubiquitin or phaseolin promoter. Also advantageous in this context are inducible promoters, such as those described in EP-A-0 388 186

(Benzylsulfonamide inducible), Plant J. 2, 1992: 397-404 (Gatz et al., Tetracycline inducible), EP-AO 335 528 (abzisinic inducible) or WO 93/21334 (ethanol or cyclohexenol inducible) described promoters. Further suitable plant promoters are the promoter of cytosolic FBPase or the potato ST LSI promoter (Stockhaus et al., EMBO J. 8, 1989, 2445), the glycine max phosphoribosyl pyrophosphatamidotransferase promoter (Genbank Accession No. U87999) or the nodia-specific promoter described in EP-A-0 249 676. Particularly advantageous promoters are promoters which allow expression in tissues involved in fatty acid biosynthesis. Very particularly advantageous are seed-specific promoters, such as the USP

Promoter but also other promoters such as the LeB4, DC3, phaseolin or napin promoter. Further particularly advantageous promoters are seed-specific promoters which can be used for monocotyledonous or dicotyledonous plants and in US Pat. No. 5,608,152 (rapeseed napin promoter), WO 98/45461 (oleosin promoter from Arobidopsis), US Pat. No. 5,504,200 (Phaseolin promoter from Phaseolus vulgaris), WO 91/13980 (Bce4 promoter from Brassica), von Baeumlein et al , Plant J., 2, 2, 1992: 233-239 (LeB4 promoter from a legume), these promoters being suitable for dicotyledons. The following promoters are suitable, for example, for barley monocotylone lpt-2 or lpt-1 promoter (WO 95/15389 and WO 95/23230), barley hordein promoter and other suitable promoters described in WO 99/16890.

It is possible in principle to use all natural promoters with their regulatory sequences, such as those mentioned above, for the new method. It is also possible and advantageous to use, in addition or alone, synthetic promoters, especially if they mediate seed-specific expression, e.g. described in WO 99/16890.

In order to achieve a particularly high content of PUFAs, especially in transgenic plants, the PUFA biosynthesis genes should advantageously be seed-specifically expressed in oilseeds. For this purpose, seed-specific promoters can be used, or such promoters that are active in the embryo and / or in the endosperm. In principle, seed-specific promoters can be isolated from both dicotolydone and monocotolydonous plants. Preferred preferred promoters are listed below: USP (= unknown seed protein) and Vicilin (Vicia faba) [Baumlein et al., Mol. Gen Genet, 1991, 225 (3)], Napin (rapeseed) [US Pat. No. 5,608,152], acyl Carrier protein (rapeseed) [US 5,315,001 and WO 92/18634], oleosin (Arabidopsis thaliana) [WO 98/45461 and WO 93/20216], phaseolin (Phaseolus vulgaris) [US 5,504,200], Bce4 [WO 91/13980] , Legumes B4 (LegB4 promoter) [Bäumlein et al., Plant J., 2,2, 1992], Lpt2 and lpt1 (barley) [WO 95/15389 u. WO95 / 23230], seed-specific promoters from rice, maize and the like. Wheat [WO 99/16890], Amy32b, Amy 6-6 and Aleurain [US 5,677,474], Bce4 (rape) [US 5,530,149], glycinin (soybean) [EP 571 741], phospholene-pyruvate carboxylase (soybean) [JP 06/62870], ADR12-2 (soybean) [WO 98/08962], isocitrate lyase (rapeseed) [US 5,689,040] or α-amylase (barley) [EP 781 849]. Plant gene expression can also be achieved via a chemically inducible

Promoter facilitate (see a review in Gatz 1997, Annu Rev. Plant Physiol Plant Mol. Biol., 48: 89-108). Chemically inducible promoters are particularly useful when it is desired that gene expression be in a time-specific manner. Examples of such promoters are a salicylic acid-inducible promoter (WO 95/19443), a tetracycline-inducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an ethanol-inducible promoter.

In order to ensure stable integration of the biosynthesis genes into the transgenic plant over several generations, each of the nucleic acids used in the method, which is responsible for Δ-12-desaturase, Δ-6-desaturase, Δ6-elongase, Δ5-desaturase, Δ-5 elongase and / or Δ-4-desaturase are expressed under the control of its own preferred a different promoter, as Repetitive sequence motifs can lead to instability of the T-DNA or to recombination events. The expression cassette is advantageously constructed in such a way that a promoter is followed by a suitable interface for insertion of the nucleic acid to be expressed, advantageously followed by a terminator behind the polylinker in a polylinker. This sequence is repeated several times, preferably three, four or five times, so that up to five genes can be brought together in one construct and thus introduced into the transgenic plant for expression. Advantageously, the sequence is repeated up to three times. The nucleic acid sequences are inserted for expression via the appropriate interface, for example in the polylinker behind the promoter. Advantageously, each nucleic acid sequence has its own promoter and optionally its own terminator. Such advantageous constructs are disclosed for example in DE 10102337 or DE 10102338. However, it is also possible to insert several nucleic acid sequences behind a promoter and possibly in front of a terminator. In this case, the insertion site or the sequence of the inserted nucleic acids in the expression cassette is not of decisive importance, that is to say a nucleic acid sequence can be inserted at the first or last position in the cassette, without this significantly influencing the expression. It is advantageous to use different promoters, for example the USP, LegB4 or DC3 promoter and different terminators, in the expression cassette. But it is also possible to use only one type of promoter in the cassette. However, this can lead to unwanted recombination events.

As described above, transcription of the introduced genes should be advantageously aborted by suitable terminators at the 3 'end of the introduced biosynthetic genes (beyond the stop codon). It can be used here e.g. the OCS1 terminator. As for the promoters, different terminator sequences should be used for each gene.

The gene construct may, as described above, also include other genes to be introduced into the organisms. It is possible and beneficial to regulate genes in the host organisms, such as genes for inducers, repressors or

Enzyme, which engage by their enzyme activity in the regulation of one or more genes of a biosynthetic pathway, introduce and express therein. These genes may be of heterologous or homologous origin. Furthermore, further biosynthesis genes of the fatty acid or lipid metabolism can advantageously be contained in the nucleic acid construct or gene construct, or else these genes can be located on a further or several further nucleic acid constructs. Advantageously, as biosynthesis genes of the fatty acid or lipid metabolism, a gene selected from the group acyl-CoA-dehydrogenase (s), acyl-ACP [= acyl carrier protein] - desaturase (s), acyl-ACP-thioesterase (s), fatty acid Acyltransferase (s), acyl CoA: lysophospholipid acyltransferase (s), fatty acid synthase (s), fatty acid

Hydroxylase (s), Acetyl Coenzyme A Carboxylase (s), Acyl Coenzyme A Oxidase (s), Fatty Acid Desaturase (s), Fatty Acid Acetylenase (s), Lipoxygenase (s), Triacylglycerol Lipase (s) , Allene oxide synthase (s), hydroperoxide lyase (s) or fatty acid elongase (s) or their combinations used. Particularly advantageous nucleic acid sequences are biosynthesis genes of the fatty acid or lipid metabolism selected from the group of acyl-CoA: lysophospholipid acyltransferase, Δ-4-desaturase, Δ-5-desaturase, Δ-6-desaturase, Δ-9-desaturase, Δ-12 Desaturase, Δ-5 elongase and / or Δ-6 elongase.

The abovementioned nucleic acids or genes can be cloned in combination with other elongases and desaturases in expression cassettes, such as those mentioned above, and used to transform plants using Agrobacterium. The regulatory sequences or factors can, as described above, preferably positively influence the gene expression of the introduced genes and thereby increase them. Thus, enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers. In addition, however, an enhancement of the translation is possible by, for example, the stability of the mRNA is improved. The expression cassettes can in principle be used directly for introduction into the plant or else introduced into a vector.

These advantageous vectors, preferably expression vectors, contain the nucleic acids used in the method which are useful for Δ12-desaturase, Δ6-desaturase, Δ6-elongase, Δ5-desaturases, Δ5-elongase or Δ-4 Or a nucleic acid construct containing the nucleic acid used alone or in combination with other fatty acid or lipid metabolism biosynthesis genes such as the acyl-CoAl-lysophospholipid acyltransferases, Δ-4-desaturases, Δ-5-desaturases, Δ-6-desaturases, Δ-9-desaturases, Δ-12-desaturases, ω3-desaturases, Δ-5-elongases and / or Δ-6-elongases. As used herein, the term "vector" refers to a nucleic acid molecule that can transport another nucleic acid to which it is attached. One type of vector is a "plasmid," which is a circular double-stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, where additional DNA segments can be ligated into the viral genome. Certain vectors may autonomously replicate in a host cell into which they have been introduced (eg bacterial vectors of bacterial origin of replication). Other vectors are advantageously integrated into the genome of a host cell upon introduction into the host cell and thereby replicated together with the host genome. In addition, certain vectors may direct the expression of genes to which they are operably linked. These vectors are referred to herein as "expression vectors". Usually, expression vectors suitable for recombinant DNA techniques are in the form of plasmids. In the present specification, "plasmid" and "vector" can be used interchangeably because the plasmid is the most commonly used vector form. However, the invention is intended to encompass these other forms of expression vectors, such as viral vectors that perform similar functions. Furthermore, the term vector is also intended to mean other vectors which are known to the person skilled in the art, such as phages, viruses, such as SV40, CMV, TMV, transposons, IS elements, phasmids, phagemids, cosmids, linear or circular DNA.

The recombinant expression vectors advantageously used in the method comprise the below-described nucleic acids or the above-described gene construct in a form suitable for expression of the nucleic acids used in a host cell, which means that the recombinant expression vectors comprise one or more regulatory sequences selected on the basis of For expression to be used host cells, which is operably linked to the nucleic acid sequence to be expressed comprises. In a recombinant expression vector, "operably linked" means that the nucleotide sequence of interest is bound to the regulatory sequence (s) such that expression of the nucleotide sequence is possible and they are linked to each other such that both sequences fulfill the predicted function ascribed to the sequence (eg in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" is intended to mean promoters,

Enhancers and other expression control elements (e.g., polyadenylation signals). These regulatory sequences are e.g. in Goeddel: Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990), or see: Gruber and Crosby, in: Methods in Plant Molecular Biology and Biotechnolgy, CRC Press, Boca Raton, Florida, Eds .: Glick and Thompson, chapters 7, 89-108, including references therein. Regulatory sequences include those that direct the constitutive expression of a nucleotide sequence in many types of host cells and those that direct the direct expression of the nucleotide sequence only in certain host cells under certain conditions. One skilled in the art will appreciate that the design of the expression vector may depend on factors such as the selection of the host cell to be transformed, the level of expression of the desired protein, etc.

The recombinant expression vectors used can be used to express Δ-12-desaturases, Δ-6-desaturases, Δ-6 elongases, Δ-5-desaturases, Δ-5 elongases and / or Δ-4-desaturases in prokaryotic or eukaryotic cells be designed. This is advantageous because often intermediate steps of the vector construction are carried out for simplicity in microorganisms. For example, the Δ12-desaturase, Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase and / or Δ-4-desaturase genes can be expressed in bacterial cells Insect cells (using baculovirus expression vectors), yeast and other fungal cells (see Romanos, MA, et al., 1992, Foreign gene expression in yeast: a review, Yeast 8: 423-488, van den Hondel, CAMJJ, et al. (1991) "Heterologous gene expression in filamentous fungi", in: More Gene Manipulations in Fungi, JW Bennet & LL Lasure, eds., Pp. 396-428: Academic Press: San Diego, and van Hondel, CAMJJ, & Punt, PJ. (1991) Gene transfer systems and vector development for filamentous fungi, Applied Molecular Genetics of Fungi, Peberdy, JF, et al., Eds., pp. 1-28, Cambridge University Press: Cambridge), algae (Falciatore et al., 1999, Marine Biotechnology.1, 3: 239-251), ciliates of the types: Holotrichia, Peritrichia, Spirotrichia, Suctoria, Tetrahymena, Paramecium, Colpidium, Glaucoma, Platyophrya, Potomacus, Desaturaseudocohnilembus, Euplotes, Engelmanieila and Stylonychia, in particular of the genus Stylonychia lemnae, with vectors according to a transformation method as described in WO 98/01572, and preferably in cells of multicellular plants (See Schmidt, R. and Willmitzer, L. (1988) "High efficiency Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana leaf and cotyledon explants" Plant Cell Rep. 583-586; Plant Molecular Biology and Biotechnology, C Press, Boca Raton , Florida, Chapter 6/7, pp. 71-119 (1993); FF White, B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, ed. Kung and R. Wu, Academic Press (1993), 128-43, Potrykus, Annu., Rev. Plant Physiol, Plant Molec Biol, 42 (1991), 205-225 (and references cited therein)). Suitable host cells are further discussed in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). The recombinant expression vector may alternatively be transcribed and translated in vitro using, for example, T7 promoter regulatory sequences and T7 polymerase.

The expression of proteins in prokaryotes is mostly carried out with vectors containing constitutive or inducible promoters which direct the expression of fusion or non-fusion proteins. Typical fusion expression vectors include i.a. pGEX (Pharmacia Biotech Inc., Smith, DB, and Johnson, KS (1988) Gene 67: 31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ), in which glutathione-S Transferase (GST), maltose E-binding protein or protein A is fused to the recombinant target protein.

Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al. (1988) Gene 69: 301-315) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60 -89). Target gene expression from the pTrc vector is based on transcription by host RNA polymerase from a hybrid trp-lac fusion promoter. Target gene expression from the pET 11d vector is based on transcription from a T7 gn10-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gn1). This viral polymerase is provided by the host strains BL21 (DE3) or HMS174 (DE3) from a resident λ prophage harboring a T7 gn1 gene under the transcriptional control of the lacUV 5 promoter. Other suitable vectors in prokaryotic organisms are known to the person skilled in the art, these vectors are, for example, in E. coli pLG338, pACYC184, the pBR series, such as pBR322, the pUC series, such as pUC18 or pUC19, the M113mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, plN-111113-B1, λgt11 or pBdCI, in Streptomyces plJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667. In another embodiment, the expression vector is a yeast expression vector. Examples of vectors for expression in the yeast S. cerevisiae include pYeDesaturased (Baldari et al. (1987) Embo J. 6: 229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30: 933-943), pJRY88 (Schultz et al. (1987) Gene 54: 113-123) and pYES2 (Invitrogen Corporation, San Diego, CA). Vectors and methods for constructing vectors suitable for use in other fungi, such as filamentous fungi, include those described in detail in: van den Hondel, CAMJJ, & Punt, PJ. (1991) "Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, JF Peberdy et al., Eds., Pp. 1-28, Cambridge University Press: Cambridge, or in: More Gene Manipulations in Fungi [JW Bennet & LL Lasure, eds., Pp. 396-428: Acadic Press: San Diego] Other suitable yeast vectors are, for example, pAG-1, YEp6, YEp13 or pEMBLYe23.

Alternatively, Δ-12-desaturase, Δ-6-desaturase, Δ-6 elongase, Δ-5-desaturase, Δ-5 elongase and / or Δ-4-desaturase can be expressed in insect cells using baculovirus expression vectors , Baculovirus vectors available for expression of proteins in cultured insect cells (eg, Sf9 cells) include the pAc series (Smith et al (1983) Mol. Cell Bio! 3: 2156-2165) and the pVL Series (Lucklow and Summers (1989) Virology 170: 31-39). The above vectors provide only a brief overview of possible suitable vectors. Other plasmids are known in the art and are described, for example, in: Cloning Vectors (Eds. Pouwels, P.H., et al., Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). For other suitable expression systems for prokaryotic and eukaryotic cells, see Chapters 16 and 17 of Sambrook, J., Fritsch, EF, and Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd Ed., CoId Spring Harbor Laboratory, ColD Spring Harbor Laboratory Press, CoId Spring Harbor, NY, 1989.

In a further embodiment of the method, Δ-12-desaturase, Δ-6-desaturase, Δ-6 elongase, Δ-5-desaturase, Δ-5 elongase and / or Δ-4-desaturase can be produced in unicellular plant cells (such as Algae), see Falciatore et al., 1999, Marine Biotechnology 1 (3): 239-251 and references cited therein, and plant cells from higher plants (eg, spermatophytes, such as crops) are expressed. Examples of plant expression vectors include those described in detail in: Becker, D., Kemper, E., Schell, J., and Masterson, R. (1992) "New plant binary vectors with selectable markers located proximal to the left Border ", Plant Mol. Biol. 20: 1195-1197; and Bevan, MW (1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acids Res. 12: 8711-8721; Vectors for Gene Transfer to Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, eds .: Kung and R. Wu, Academic Press, 1993, pp. 15-38. A plant expression cassette preferably contains regulatory sequences that can control gene expression in plant cells and are functional so that each sequence can fulfill its function, such as termination of transcription, for example, polyadenylation signals. Preferred polyadenylation signals are those derived from Agrobacterium tumefaciens T-DNA, such as the gene 3 of the Ti plasmid pTiACHδ known as octopine synthase (Gielen et al., EMBO J. 3 (1984) 835ff.) Or functional equivalents thereof, but also all other terminators functionally active in plants are suitable.

Because plant gene expression is very often not limited to transcriptional levels, a plant expression cassette preferably contains other operably linked sequences, such as translation enhancers, e.g., the overdrive sequence containing the 5'-untranslated tobacco mosaic virus leader sequence, which is the protein / RNA ratio increases (Gallie et al., 1987, Nucl. Acids Research 15: 8693-8711).

Plant gene expression, as described above, must be operably linked to a suitable promoter that performs gene expression in a timely, cell or tissue-specific manner. Useful promoters are constitutive promoters (Benfey et al., EMBO J. 8 (1989) 2195-2202), such as those derived from plant viruses, such as 35S CAMV (Franck et al., Cell 21 (1980) 285-294), 19S CaMV (see also US 5352605 and WO 84/02913) or plant promoters, such as the Rubisco small subunit described in US 4,962,028. Other preferred sequences for use in the functional compound in plant gene expression cassettes are targeting sequences necessary to direct the gene product into its corresponding cell compartment (see review in Kermode, Crit., Plant, 15, 4 (1996) 285) -423 and references cited therein), for example, in the vacuole, the nucleus, all kinds of plastids, such as amyloplasts, chloroplasts, chromoplasts, the extracellular space, the

Mitochondria, the endoplasmic reticulum, oil bodies, peroxisomes and other compartments of plant cells.

Plant gene expression can also be facilitated by a chemically inducible promoter as described above (see review in Gatz 1997, Annu Rev. Plant Physiol Plant Mol. Biol., 48: 89-108). Chemically inducible promoters are particularly useful when it is desired that gene expression be in a time-specific manner. Examples of such promoters are a salicylic acid-inducible promoter (WO 95/19443), a tetracycline-inducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an ethanol-inducible promoter. Promoters which react to biotic or abiotic stress conditions are also suitable promoters, for example the pathogen-induced PRP1 gene promoter (Ward et al., Plant Mol. Biol. 22 (1993) 361-366), the heat-inducible hsp80 promoter Tomato (US 5,187,267), the potato inducible alpha-amylase promoter (WO 96/12814) or the wound inducible pinll promoter (EP-A-0 375 091). In particular, those promoters which induce gene expression in tissues and organs in which the fatty acid, lipid and oil biosynthesis take place are preferred in sperm cells such as the cells of the endosperm and the developing embryo. Suitable promoters are the rapeseed napin promoter (US Pat. No. 5,608,152), the Vicia faba USP promoter (Baeumlein et al., Mol Gen Genet.

1991, 225 (3): 459-67), the Arabidopsis oleosin promoter (WO 98/45461), the phaseolin promoter from Phaseolus vulgaris (US 5,504,200), the Brassica Bce4 promoter (WO 91/13980) or the legumin B4 promoter (LeB4, Baeumlein et al.

1992, Plant Journal, 2 (2): 233-9) as well as promoters which induce seed specific expression in monocotyledonous plants such as maize, barley, wheat, rye, rice, etc. Suitable noteworthy promoters are the lpt2 or Ipt1 gene promoter from barley (WO 95/15389 and WO 95/23230) or those described in WO 99/16890 (promoters from the barley hordein gene, the rice glutelin gene , the rice oryzin gene, the rice prolamin gene, the wheat gliadin gene, the wheat glutelin gene, the maize zein gene, the oat glutelin gene, the sorghum kasirin gene, the rye secalin gene).

In particular, multiparallel expression of Δ-12-desaturase, Δ-6-desaturase, Δ-6 elongase, Δ-5-desaturase, Δ-5 elongase and / or Δ-4-desaturase used in the method may be desired. The introduction of such expression cassettes can be carried out via a simultaneous transformation of a plurality of individual expression constructs or preferably by combining a plurality of expression cassettes on a construct. It is also possible to transform a plurality of vectors each having a plurality of expression cassettes and to transfer them to the host cell.

Also particularly suitable are promoters which induce plastid-specific expression, since plastids are the compartment in which the precursors as well as some end products of lipid biosynthesis are synthesized. Suitable promoters, such as the viral RNA polymerase promoter, are described in WO 95/16783 and WO 97/06250, and the Arabidopsis clpP promoter described in WO 99/46394. Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection", conjugation and transduction are intended to encompass a variety of methods known in the art for introducing foreign nucleic acid (eg DNA) into a host cell, including calcium phosphate or calcium chloride coprecipitation, DEAE- Dextran-mediated transfection, lipofection, natural competence, chemically mediated transfer, electroporation or particle bombardment. Suitable methods for transforming or transfecting host cells, including plant cells, can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd ed., CoId Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, ColD Spring Harbor, NY, 1989) and other laboratory manuals, such as Methods in Molecular Biology, 1995, Vol. 44 , Agrobacterium protocols, Eds: Gartland and Davey, Humana Press, Totowa, New Jersey. Host cells which are suitable in principle for receiving the nucleic acid according to the invention, the gene product according to the invention or the vector according to the invention are all prokaryotic or eukaryotic organisms. The host organisms which are advantageously used are microorganisms, such as fungi or yeasts or plant cells, preferably plants or parts thereof. Fungi, yeasts or plants are preferably used, more preferably plants, most preferably plants such as oilseed crops containing high levels of lipid compounds such as rapeseed, evening primrose, hemp, Diestel, peanut, canola, flax, soy, safflower, sunflower, borage , or plants such as corn, wheat, rye, oats, triticale, rice, barley, cotton, cassava, pepper, tagetes, solanaceae plants, such as

Potato, tobacco, aubergine and tomato, Vicia species, pea, alfalfa, bush plants (coffee, cocoa, tea), Salix species, trees (oil plan, coconut) and perennial grasses and forage crops. Particularly preferred plants according to the invention are oil crop plants, such as soybean, peanut, rapeseed, canola, flax, hemp, evening primrose, sunflower, safflower, trees (oil palm, coconut).

Further subjects of the invention are the nucleic acid sequences enumerated below which code for Δ-6-desaturases, Δ-5-desaturases, Δ-4-desaturases or Δ-12-desaturases.

Isolated nucleic acid sequences encoding polypeptides having Δ-6 desaturase activity selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 13, b) nucleic acid sequences resulting from the degenerate genetic code of the sequence shown in SEQ Or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 13, which code for polypeptides having at least 40% homology at the amino acid level with SEQ ID NO: 14 and have a Δ6-desaturase activity.

Isolated nucleic acid sequences encoding polypeptides having Δ5-desaturase activity selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 9 or SEQ ID NO: 11, b) nucleic acid sequences resulting as the result of degenerate genetic code derived from the amino acid sequence shown in SEQ ID NO: 10 or in SEQ ID NO: 12, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 9 or in SEQ ID NO: 11, which code for polypeptides having at least 40% homology at the amino acid level with SEQ ID NO: 10 or SEQ ID NO: 12 and a Δ- 5- have desaturase activity. Isolated nucleic acid sequences encoding polypeptides having Δ-4-desaturase activity selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 7, b) nucleic acid sequences resulting from the degenerate genetic code of the sequence shown in SEQ Or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 7, which code for polypeptides having at least 40% homology at the amino acid level with SEQ ID NO: 8 and have a Δ6-desaturase activity.

Isolated nucleic acid sequences encoding polypeptides having Δ12-desaturase activity selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 15, b) nucleic acid sequences resulting from the degenerate genetic code of the sequence shown in SEQ Or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 15, which code for polypeptides having at least 50% homology at the amino acid level with SEQ ID NO: 16 and have a Δ-12 desaturase activity.

The above-mentioned nucleic acids of the present invention are derived from organisms such as non-human animals, ciliates, fungi, plants such as algae or dinoflagellates which can synthesize PUFAs.

The isolated above-mentioned nucleic acid sequences advantageously originate from the order Salmoniformes, the diatom genus Thalassiosira or Crythecodinium or from the family Prasinophyceae such as the genus Ostreococcus or Pythiaceae such as the genus Phytophtora. The articles of the invention also include, as described above, isolated nucleic acid sequence encoding polypeptides having Δ-12-desaturases, Δ-4-desaturases, Δ-5-desaturases and Δ-6-desaturases, the Δ. Coding sequences encoded by these nucleic acid sequences -12-desaturases, Δ-4-desaturases, Δ-5-desaturases or Δ-6-desaturases C ₁₈ , C ₂ o and C ₂₂ fatty acids having one, two, three, four or five double bonds and advantageously polyunsaturated Ci ₈ -fatty acids with one, two or three double bonds such as C18: 1 ^Δ9 , C18: 2 ^{Δ9 12} or C18: 3 ^{Δ9 12 / l5} , polyunsaturated C ₂₀ -fatty acids having three or four double bonds such as _C 2 _{0: 3} ^{Δ8, ii, i4} _{or C} 2 _{0: 4} ^{Δ8, ii, i4, i} 7 _{or menf acn} unsaturated C ₂₂ fatty acids having four or five double bonds as C22: 4 ^Δ7 ' ¹⁰ ' ^{13 '16} or C22: 5 ^Δ7 ' ^{10 '13 16} ' ¹⁹ implement. Advantageously, the fatty acids in the phospholipids or CoA fatty acid esters are desatured, advantageously into the CoA fatty acid ester.

The term "nucleic acid (molecule)" as used herein also comprises, in an advantageous embodiment, the untranslated sequence located at the 3 'and 5' end of the coding gene region: at least 500, preferably 200, more preferably 100 nucleotides of the sequence upstream of the 5 'end of the coding region and at least 100, preferably 50, more preferably 20 nucleotides of the sequence downstream of the 3' end of the coding gene region. An "isolated" nucleic acid molecule is separated from other nucleic acid molecules present in the natural source of the nucleic acid. An "isolated" nucleic acid preferably does not have sequences that naturally flank the nucleic acid in the genomic DNA of the organism from which the nucleic acid is derived (e.g., sequences located at the 5 'and 3' ends of the nucleic acid). For example, in various embodiments, the isolated Δ12-desaturase, Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase or Δ-4-desaturase molecule may be less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in the genomic DNA of the cell from which the nucleic acid is derived.

The nucleic acid molecules used in the method, for example a nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 or a part thereof can be isolated using standard molecular biology techniques and the sequence information provided herein. Also, by comparison algorithms, for example, a homologous sequence or homologous, conserved sequence regions at the DNA or amino acid level can be identified. These may be used as a hybridization probe as well as standard hybridization techniques (such as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., CoId Spring Harbor Laboratory, ColD Spring Harbor Laboratory Press, ColD Spring Harbor, NY, 1989) Isolation of other useful in the process of nucleic acid sequences can be used. In addition, a nucleic acid molecule comprising a complete sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO 13 or SEQ ID NO: 15 or a part thereof, by polymerase chain reaction, using oligonucleotide primers based on this sequence or parts thereof (eg, a nucleic acid molecule comprising the complete sequence or a part thereof, by polymerase chain reaction isolated using oligonucleotide primers prepared on the basis of this same sequence). For example, mRNA can be isolated from cells (eg by the guanidinium thiocyanate extraction method of Chirgwin et al. (1979) Biochemistry 18: 5294-5299) and cDNA by reverse transcriptase (eg Moloney MLV). Reverse transcriptase, available from Gibco / BRL, Bethesda, MD, or AMV reverse transcriptase, available from Seikagaku America, Inc., St. Petersburg, FL). Synthetic oligonucleotide primers for polymerase chain reaction amplification can be prepared on the basis of one of the sequences shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 or using the sequences shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO : 12, SEQ ID NO: 14 or SEQ ID NO: 16 create amino acid sequences shown. A nucleic acid of the invention may be amplified using cDNA or alternatively genomic DNA as a template and suitable oligonucleotide primers according to standard PCR amplification techniques. The thus amplified nucleic acid can be cloned into a suitable vector and characterized by DNA sequence analysis. Oligonucleotides corresponding to a desaturase nucleotide sequence can be prepared by standard synthetic methods, for example, with an automated DNA synthesizer.

Homologs of the Δ12-desaturase, Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase or Δ4-desaturase nucleic acid sequences of the sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 means for example allelic variants with at least about 40 or 50%, preferably at least about 60 or 70%, more preferably at least about 70 or 80%, 90% or 95% ^■, and even more preferably at least about 85%, 86%, 87%, 88%, 89% , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to each other in SEQ ID NO: 1, SEQ ID NO: 3 , SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 shown nucleotide sequences or their homologs, derivatives or analogs or parts thereof. Furthermore, isolated nucleic acid molecules of a nucleotide sequence which correspond to one of the amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 hybridize or a part thereof hybridized, for example, under stringent conditions. A part according to the invention is understood to mean that at least 25 base pairs (= bp), 50 bp, 75 bp, 100 bp, 125 bp or 150 bp, preferably at least 175 bp, 200 bp, 225 bp, 250 bp, 275 bp or 300 bp, more preferably 350 bp, 400 bp, 450 bp, 500 bp or more base pairs are used for the hybridization. It may also be advantageous to use the overall sequence. In particular, allelic variants include functional variants which are obtained by deletion, insertion or substitution of nucleotides from / in which is shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15, but the intention is that the enzyme activity of the resulting synthesized proteins is advantageously retained for the insertion of one or more genes , Proteins which still possess the enzymatic activity of Δ12-desaturase, Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase or Δ4-desaturase, ie their Activity is substantially not reduced, means proteins with at least 10%, preferably 20%, more preferably 30%, most preferably 40% of the original enzyme activity compared to that represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 encoded protein. Homology was calculated over the entire amino acid or nucleic acid sequence range. For the comparison of different sequences, a number of programs that are based on different algorithms are available to the person skilled in the art. The algorithms of Needleman and Wunsch or Smith and Waterman provide particularly reliable results. For the sequence comparisons the program PiIeUp was used (J. Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS ₁ 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48: 443-453 (1970) and Smith and Waterman (Adv. Appl. Math. 2: 482-489 (1981)], which are described in the GCG Software Packet [Genetic Computer Group, 575 Science Drive , Madison, Wisconsin, USA, 53711 (1991)]. The percent sequence homology values given above were determined using the GAP program over the entire sequence range with the following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10,000, and Average Mismatch: 0.000, which were always used for sequence comparisons unless otherwise specified as the default settings.

Homologs of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 for example, also bacterial, fungal and plant homologs, truncated sequences, single-stranded DNA or RNA of the coding and non-coding DNA sequence.

Homologs of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 also derivatives, such as, for example, promoter variants. The promoters upstream of the indicated nucleotide sequences may be modified by one or more nucleotide exchanges, insertions, and / or deletions, without, however, interfering with the functionality or activity of the promoters. It is also possible that the activity of the promoters is increased by modification of their sequence or that they are completely replaced by more active promoters, even from heterologous organisms.

The aforementioned nucleic acids and protein molecules having Δ12-desaturase, Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase and / or Δ-4-desaturase activity , which are involved in the metabolism of lipids and fatty acids, PUFA cofactors and enzymes or in the transport of lipophilic compounds via membranes, are advantageously used in the method according to the invention for modulating the production of PUFAs in transgenic organisms in plants such as corn, wheat, rye, oats, Triticale, rice, barley, soybean, peanut, cotton, linum species such as oil or fiber kidney, Brassica species such as oilseed rape, canola and turnip rape, pepper, sunflower, borage, evening primrose and Tagetes, Solanacaen plants such as

Potato, tobacco, eggplant and tomato, Vicia species, pea, manioc, alfalfa, bush plants (coffee, cocoa, tea), Salix species, trees (oil palm, coconut) and permanent grasses and forage crops, either directly (eg, when overexpression or optimization of a fatty acid biosynthesis protein has a direct impact on the yield, production, and / or efficiency of fatty acid production from modified organisms), and / or may have a indirect effect , which nevertheless increase the yield, production and / or

Efficiency of the production of the PUFAs or a decrease of undesired compounds leads (eg if the modulation of the metabolism of lipids and fatty acids, cofactors and enzymes leads to changes in the yield, production and / or efficiency of the production or the composition of the desired compounds within the cells in turn, may affect the production of one or more fatty acids).

The combination of different precursor molecules and biosynthetic enzymes leads to the production of various fatty acid molecules, which has a decisive effect on the composition of the lipids. Since polyunsaturated fatty acids (= PUFAs) are not only simply incorporated in triacylglycerol but also in membrane lipids.

Particularly suitable for the production of PUFAs _1, for example stearidonic acid, eicosapentaenoic acid and docosahexaenoic acid, are Brasicaceae, boraginaceous plants, primulas or linaceae. Particularly advantageous is Lein (Linum usitatissimum) for the production of PUFAS with the nucleic acid sequences of the invention advantageously, as described, in combination with other desaturases and elongases.

The lipid synthesis can be divided into two sections: the synthesis of fatty acids and their attachment to sn-glycerol-3-phosphate and the addition or modification of a polar head group. Common lipids used in membranes include phospholipids, glycolipids, sphingolipids and phosphoglycerides. Fatty acid synthesis begins with the conversion of acetyl-CoA into malonyl-CoA by the acetyl-CoA carboxylase or into acetyl-ACP by the acetyl transacylase. After a condensation reaction, these two product molecules together form acetoacetyl-ACP, which is converted via a series of condensation, reduction and dehydration reactions, so that a saturated fatty acid molecule with the desired chain length is obtained. The production of unsaturated fatty acids from these molecules is catalyzed by specific desaturases, either aerobically by molecular oxygen or anaerobically (for fatty acid synthesis in microorganisms see FC Neidhardt et al., (1996) E. coli and Salmonella ASM Press: Washington, D C ₁ pp. 612-636 and references therein; Lengeier et al. (Eds) (1999) Biology of Procaryotes, Thieme: Stuttgart, New York, and the references therein, and Magnuson, K., et al (1993) Microbiological Reviews 57: 522-542 and the references contained therein). The fatty acids thus bound to phospholipids must then be converted again for the further elongations from the phospholipids into the fatty acid CoA ester pool. This is facilitated by acyl-CoA: lysophospholipid acyltransferases. Furthermore ^• these enzymes can the elongated fatty acids from the CoA esters to the Transmitted phospholipids. This reaction sequence can optionally be run through several times.

Precursors for the PUFA biosynthesis are, for example, oleic acid, linoleic acid and linolenic acid. These C ₁₈ -carbon fatty acids must be extended to C ₂ o and C ₂₂ in order to obtain fatty acids of the eicosa- and docosa-chain type. Arachidonic acid, eicosapentaenoic acid, docosapentaenoic acid or docosahexaenoic acid can be used with the aid of the desaturases used in the process, such as Δ-12, Δ-4-, Δ-5- and Δ-6-desaturases and / or Δ-5-, Δ-6-elongases advantageously eicosapentaenoic acid and / or docosahexaenoic acid are prepared and then used for various purposes in food, feed, cosmetic or pharmaceutical applications. C ₂ - and / or C ₂₂ -fatty acids having at least two, preferably at least three, four, five or six double bonds in the fatty acid molecule, preferably C ₂₀ - or C ₂₂ -fatty acids with advantageously four, five or six double bonds in the Fatty acid molecule can be produced. The desaturation can take place before or after elongation of the corresponding fatty acid. Thus, the products of desaturase activities and possible further desaturation and elongation result in preferred PUFAs having a higher degree of desaturation, including a further elongation of C ₂ O to C ₂₂ fatty acids, to fatty acids such as γ-linolenic acid, dihomo-γ-linolenic acid, arachidonic acid , Stearidonic acid, eicosatetraenoic acid or eicosapentaenoic acid. Substrates of the desaturases used and

Elongases in the process according to the invention are C ₁₆ , C ₁₈ or C ₂₀ fatty acids, for example linoleic acid, γ-linolenic acid, α-linolenic acid, dihomo-γ-linolenic acid, eicosatetraenoic acid or stearidonic acid. Preferred substrates are linoleic acid, γ-linolenic acid and / or α-linolenic acid, dihomo-γ-linolenic acid or arachidonic acid, eicosatetraenoic acid or eicosapentaenoic acid. The synthesized C ₂₀ - or C ₂₂ - fatty acids having at least two, three, four, five or six double bonds in the fatty acid in the process according to the invention in the form of the free fatty acid or in the form of their esters, for example in the form of their glycerides.

The term "glyceride" is understood to mean a glycerol esterified with one, two or three carboxylic acid residues (mono-, di- or triglyceride). By "glyceride" is also meant a mixture of different glycerides. The glyceride or glyceride mixture may contain other additives, e.g. contain free fatty acids, antioxidants, proteins, carbohydrates, vitamins and / or other substances.

A "glyceride" in the sense of the method according to the invention is also understood to mean derivatives derived from glycerol. In addition to the fatty acid glycerides described above, these also include glycerophospholipids and glyceroglycolipids. The glycerophospholipids, such as lecithin (phosphatidylcholine), cardiolipin, phosphatidylglycerol, phosphatidylserine and alkylacylglycerophospholipids, may be mentioned by way of example here. Furthermore, fatty acids must then be transported to various modification sites and incorporated into the triacylglycerol storage lipid. Another important Step in the lipid synthesis is the transfer of fatty acids to the polar head groups, for example by glycerol-fatty acid acyltransferase (see Frentzen, 1998, Lipid, 100 (4-5): 161-166).

For publications on plant fatty acid biosynthesis, desaturation, lipid metabolism and membrane transport of fatty compounds, beta oxidation, fatty acid modification and cofactors, triacylglycerol storage and assembly, including references therein, see the following articles: Kinney, 1997, Genetic Engineering, eds .: JK Setlow, 19: 149-166; Ohlrogge and Browse, 1995, Plant Cell 7: 957-970; Shanklin and Cahoon, 1998, Annu. Rev. Plant Physiol. Plant Mol. Biol. 49: 611-641; Voelker, 1996, Genetic Engineering, eds .: JK Setlow, 18: 111-13; Gerhardt, 1992, Prog. Lipid R. 31: 397-417; Gühnemann-Schäfer & Kindl, 1995, Biochim. Biophys Acta 1256: 181-186; Kunau et al., 1995, Prog. Lipid Res. 34: 267-342; Stymne et al., 1993, in: Biochemistry and Molecular Biology of Membrane and Storage Lipids of Plants, eds .: Murata and Somerville, Rockville, American Society of Plant Physiologists, 150-158, Murphy & Ross 1998, Plant Journal. 13 (1): 1-16.

The PUFAs produced in the process comprise a group of molecules that are no longer able to synthesize, and therefore need to take up, higher animals, or that can no longer sufficiently produce higher animals themselves, and thus have to additionally take up, even though they are readily synthesized by other organisms, such as bacteria For example, cats can no longer synthesize arachidonic acid.

In the context of the invention, phospholipids are to be understood as meaning phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol and / or phosphatidylinositol, advantageously phosphatidylcholine. The terms production or productivity are known in the art and include the concentration of the fermentation product (compounds of formula I) formed in a given period of time and fermentation volume (eg, kg of product per hour per liter). It also includes productivity within a plant cell or plant, that is, the content of the desired fatty acids produced in the process based on the content of all fatty acids in that cell or plant. The term efficiency of production includes the time required to reach a certain amount of production (eg, how long the cell needs to set up a specific throughput rate of a fine chemical). The term yield or product / carbon yield is known in the art and includes the efficiency of converting the carbon source into the product (ie, the fine chemical). This is usually expressed, for example, as kg of product per kg of carbon source. By increasing the yield or production of the compound, the amount of the recovered molecules or molecules of this compound obtained in a given amount of culture is increased over a fixed period of time. The terms biosynthesis or biosynthetic pathway are known in the art and include the synthesis of a compound, preferably an organic compound. bond, through a cell of interconnects, for example in a multi-step and highly regulated process. The terms degradation or degradation pathway are well known in the art and involve the cleavage of a compound, preferably an organic compound, by a cell into degradation products (more generally, smaller or less complex molecules), for example in a multi-step and highly regulated process. The term metabolism is known in the art and includes the entirety of the biochemical reactions that take place in an organism. The metabolism of a particular compound (eg the metabolism of a fatty acid) then comprises the entirety of the biosynthesis, modification and degradation pathways of this compound in the cell which affect this compound.

In a further embodiment, derivatives of the nucleic acid molecule according to the invention encoded in SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 encode proteins with at least 40%, advantageously approximately 50 or 60%, preferably at least about 60 or 70%, and more preferably at least about 70 or 80%, 80 to 90%, 90 to 95%, and most preferably at least about 96%, 97%, 98%, 99% or more homology (= identity) to a complete amino acid sequence of SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 or SEQ ID NO: 16. The homology was over the entire amino acid or Nucleic acid sequence range calculated. For the comparison of sequences the program PiIeUp was used (J. Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch Biol. 48: 443-453 (1970) and Smith and Waterman (Adv. Appl. Math. 2: 482-489 (1981)], which are described in the GCG Software Packet [Genetic Computer Group, 575 Science Drive, Madison, Wisconsin, USA, 53711 (1991)]. The percent sequence homology values given above were determined using the BestFit program over the entire sequence range with the following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10,000 and Average Mismatch: 0.000, which were always used for sequence comparisons unless otherwise stated The invention also includes nucleic acid molecules which differ from any of the amino acid molecules shown in SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 shown nucleotide sequences (and parts thereof) due to the degenerate differing genetic codes and thus encode the same Δ-12-desaturase, Δ-6-desaturase, Δ-5-desaturase or Δ-4-desaturase as that derived from those shown in SEQ ID NO: 7, SEQ ID NO: 9 , SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 is encoded.

In addition to the Δ-12-desaturases shown in SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15, Δ-6-desaturases, Δ-5 Those skilled in the art will recognize that desaturases or Δ-4-desaturases exhibit DNA sequence polymorphisms leading to changes in the Δ-12 desaturase amino acid sequences, Δ-6.

Desaturase, Δ-5-desaturase and / or Δ-4-desaturase can exist within a population. These genetic polymorphisms in Δ12-desaturase, Δ-6 Desaturase, Δ-5-desaturase and / or Δ-4-desaturase genes may exist between individuals within a population due to natural variation. These natural variants usually cause a variance of 1 to 5% in the nucleotide sequence of the Δ12-desaturase, Δ6-desaturase, Δ5-desaturase and / or Δ4-desaturase gene. All and all of these nucleotide variations and resulting amino acid polymorphisms in Δ12-desaturase, Δ6-desaturase, Δ5-desaturase and / or Δ4-desaturase are the result of natural variation and do not alter the functional activity of are intended to be included within the scope of the invention. Nucleic acid molecules which are advantageous for the process according to the invention can be prepared on the basis of their homology to the Δ-12-desaturase, Δ-5-elongase, Δ-6-desaturase, Δ-5-desaturase, Δ-4-desaturase and / or Δ-6 elongase nucleic acids using the sequences or a portion thereof as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions. For example, isolated nucleic acid molecules which are at least 15 nucleotides long and can be used under stringent conditions with the nucleic acid molecules which have a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 comprise hybridizing. Nucleic acids of at least 25, 50, 100, 250 or more nucleotides may also be used. The term "hybridized under stringent conditions" as used herein is intended to describe hybridization and washing conditions under which nucleotide sequences that are at least 60% homologous to one another usually remain hybridized to one another. The conditions are preferably such that sequences that are at least about 65%, more preferably at least about 70%, and even more preferably at least about 75% or more homologous, are usually hybridized to each other. These stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6. A preferred, non-limiting example of stringent hybridization conditions are hybridizations in 6x sodium chloride / sodium citrate (SSC) at about 45 ° C, followed by one or more washes in 0.2x SSC, 0.1%. SDS at 50 to 65 ^° C. It is known to the person skilled in the art that these hybridization conditions differ depending on the type of nucleic acid and, for example, if organic solvents are present, with regard to the temperature and the concentration of the buffer. The temperature differs, for example under "standard hybridization conditions" depending on the type of nucleic acid between 42 ° C and 58 ° C in aqueous buffer with a concentration of 0.1 to 5 x SSC (pH 7.2). If organic solvent is present in the above buffer, for example 50% formamide, the temperature is about 42 ° C under standard conditions. Preferably, the hybridization conditions for DNA: DNA hybrids are, for example, 0.1 x SSC and 20 ⁰ C to 45 ° C, preferably between 30 ⁰ C and 45 ° C. Preferably, the hybridization conditions for DNA: RNA hybrids are, for example, 0.1 x SSC and 30 ⁰ C to 55 ° C, preferably between 45 ° C and 55 ° C. The above-mentioned hybridization sierungsstemperaturen are determined, for example, for a nucleic acid having about 100 bp (= base pairs) in length and a G + C content of 50% in the absence of formamide. Those skilled in the art will understand how to obtain the required hybridization conditions from textbooks such as the aforementioned or the following textbooks, Sambrook et al., "Molecular Cloning", CoId Spring Harbor Laboratory, 1989; Harnes and Higgins (Eds.) 1985, Nucleic Acids Hybridization: A Practical Approach, IRL Press at Oxford University Press, Oxford; Brown (ed.) 1991, Essential Molecular Biology: A Practical Approach, IRL Press at Oxford University Press, Oxford. To determine the percent homology (= identity) of two amino acid sequences (eg one of the sequences of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 or SEQ ID NO: 16) or of two nucleic acids (eg SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15), the sequences are written one below the other for the purpose of optimal comparison (eg, gaps may be inserted into the sequence of a protein or nucleic acid for optimal alignment) the other protein or nucleic acid). The amino acid residues or nucleotides at the corresponding amino acid positions or nucleotide positions are then compared. If a position in one sequence is occupied by the same amino acid residue or nucleotide as the corresponding site in the other sequence, then the molecules are homologous at that position (ie, amino acid or nucleic acid "homology" as used herein corresponds to amino acid The percentage homology between the two sequences is a function of the number of identical positions common to the sequences (ie% homology = number of identical positions / total number of positions x 100) Homology and identity are thus to be regarded as synonymous The programs or algorithms used are described above.

An isolated nucleic acid molecule which encodes a Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ4-desaturase, Δ5-elongase and / or Δ6-elongase resulting in a protein sequence SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 or SEQ ID NO: 16 is homologous can be prepared by introducing one or more nucleotide substitutions, additions or deletions into a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations may be included in any of the sequences of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 by standard techniques such as site-specific mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made on one or more of the predicted nonessential amino acid residues. In a "conservative amino acid substitution", the amino acid residue is challenged exchanged an amino acid residue with a similar side chain. In the art, families of amino acid residues have been defined with similar side chains. These families include amino acids with basic side chains (eg, lysine, arginine, histidine), acidic side chains (eg, aspartic acid, glutamic acid), uncharged polar side chains (eg, glycine, asparagine, glutamine, serine, threonine, tyrosine,

Cysteine), non-polar side chains, (eg alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (eg threonine, valine, isoleucine) and aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine) , A predicted nonessential amino acid residue in a Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ4-desaturase, Δ5-elongase or Δ6-elongase is thus preferably replaced by a different amino acid residue exchanged from the same side chain family. Alternatively, in another embodiment, the mutations may be randomized over all or part of the Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ4-desaturase, Δ5-elongase or Δ-6. Elongase coding sequence can be introduced, eg by saturation mutagenesis, and the resulting mutants can be prepared according to the herein described Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ4-desaturase, Δ5-elongase or Δ 6 elongase activity to identify mutants carrying the Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ4-desaturase, Δ5-elongase or Δ6-elongase activity. After mutagenesis one of

Sequences SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 may be the coded protein can be recombinantly expressed, and the activity of the protein can be eg be determined using the tests described herein. Further subjects of the invention are transgenic non-human organisms which contain the inventive nucleic acids SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 or SEQ ID NO: 15 or a gene construct or a vector, containing these nucleic acid sequences according to the invention. Advantageously, the non-human organism is a microorganism, a non-human animal or a plant, more preferably a plant.

This invention is further illustrated by the following examples, which should not be construed as limiting. The contents of all references cited in this patent application, patent applications, patents, and published patent applications are incorporated herein by reference. Examples

Example 1 General Cloning Methods

The cloning methods such as restriction cleavage, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linkage of DNA fragments, transformation of Escherichia coli cells, culture of bacteria and sequence analysis of recombinant DNA were as in Sambrook et al. (1989) (CoId Spring Harbor Laboratory Press: ISBN 0-87969-309-6).

Example 2 Sequence Analysis of Recombinant DNA

The sequencing of recombinant DNA molecules was carried out with a laser fluorescence DNA sequencer from ABI according to the method of Sanger (Sanger et al. (1977) Proc. Natl. Acad. See, USA74, 5463-5467). Fragments resulting from a polymerase chain reaction were sequenced and checked to avoid polymerase errors in constructs to be expressed.

Example 3: Lipid Extraction from Yeasts and Seeds: The effect of genetic modification in plants, fungi, algae, ciliates or on the production of a desired compound (such as a fatty acid) can be determined by subjecting the modified microorganisms or modified plant under suitable conditions ( as described above) and the medium and / or cellular components are assayed for increased production of the desired product (ie, lipids or a fatty acid). These analytical techniques are well known to those skilled in the art and include spectroscopy, thin layer chromatography, staining methods of various types, enzymatic and microbiological methods, and analytical chromatography such as high performance liquid chromatography (see, for example, Ullman, Encyclopedia of Industrial Chemistry, Vol. A2, pp. 89-90 and p. 443-613, VCH: Weinheim (1985); Fallon, A., et al.

(1987) "Applications of HPLC in Biochemistry" in: Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 17; Rehm et al. (1993) Biotechnology, Vol. 3, Chapter III: "Product Recovery and Purification", pp. 469-714, VCH: Weinheim; Belter, P.A., et al.

(1988) Bioseparations: downstream processing for Biotechnology, John Wiley and Sons; Kennedy, J.F., and Cabral, J.M.S. (1992) Recovery processes for biological

Materials, John Wiley and Sons; Shaeiwitz, J.A., and Henry, J.D. (1988) Biochemical Separations, in: Ullmann's Encyclopedia of Industrial Chemistry, Vol. B3; Chapter 11, pp. 1-27, VCH: Weinheim; and Dechow, FJ. (1989) Separation and purification techniques in biotechnology, Noyes Publications). In addition to the above-mentioned methods, plant lipids derived from plant material as described by Cahoon et al. (1999) Proc. Natl. Acad. Be. USA 96 (22): 12935-12940, and Browse et al. (1986) Analytic Biochemistry 152: 141-145. Qualitative and quantitative lipid or fatty acid analysis is described in Christie, William W., Advances in Lipid Methodology, Ayr / Scotland: OiIy Press (Oli Press Lipid Library, 2); Christie, William W., Gas Chromatography and Lipids. A Practical Guide - Ayr, Scotland: OiIy Press, 1989, Repr. 1992, IX, 307 p. (OiIy Press Lipid Library, 1); Progress in Lipid Research, Oxford: Pergamon Press, 1 (1952) - 16 (1977) et al .: Progress in the Chemistry of Fats and Other Lipids CODES.

In addition to measuring the end product of the fermentation, it is also possible to analyze other components of the metabolic pathways involved in the production of the desired compound, such as intermediates and by-products, to determine the overall efficiency of production of the compound. The analytical methods include measurements of nutrient levels in the medium (eg, sugars, hydrocarbons, nitrogen sources, phosphate and other ions), measurements of biomass composition and growth, analysis of production of common biosynthetic pathway metabolites, and measurements of gases generated during fermentation. Standard methods for these measurements are in Applied Microbial Physiology; A Practical Approach, PM Rhodes and PF Stanbury, Eds., IRL Press, pp. 103-129; 131-163 and 165-192 (ISBN: 0199635773) and references cited therein.

One example is the analysis of fatty acids (abbreviations: FAME, fatty acid methyl ester, GC-MS, gas-liquid chromatography-mass spectrometry, TAG, triacylglycerol, TLC, thin-layer chromatography).

The unambiguous evidence for the presence of fatty acid products can be obtained by analysis of recombinant organisms by standard analytical methods: GC, GC-MS or TLC as variously described by Christie and the references therein (1997, in: Advances on Lipid Methodology, Fourth Edition. Christie, Oliver Press, Dundee, 119-169, 1998, Gas Chromatography Mass Spectrometry Method, Lipids 33: 343-353). The material to be analyzed can be prepared by ultrasonic treatment, grinding in the

Glass mill, liquid nitrogen and grinding or broken down by other applicable methods. The material must be centrifuged after rupture. The sediment is distilled in aqua. re-suspended, heated at 100 ^° C. for 10 minutes, cooled on ice and recentrifuged, followed by extraction into 0.5 M sulfuric acid in methanol with 2% dimethoxypropane for 1 hour at 90 ^° C., resulting in hydrolyzed oil and lipid compounds, which give transmethylated lipids. These fatty acid methyl ester are extracted in petroleum ether and finally subjected to GC analysis using a capillary column (Chrompack, WCOT Fused Silica, CP-Wax-52 CB, 25 mikrom, 0.32 mm) at a temperature gradient between 170 ⁰ C and 240 ° C for 20 min and 5 min at 240 ° C subjected. The identity of the resulting fatty acid methyl esters must be defined using standards available from commercial sources (ie Sigma).

Plant material is first mechanically homogenized by mortars to make it more accessible to extraction. The mixture is then heated for 10 min at 100 ⁰ C and sedimented again after cooling on ice. The cell pellet is hydrolyzed with 1 M methanolic sulfuric acid and 2% dimethoxypropane for 1 h at 90 ° C and transmethylated the lipids. The resulting fatty acid methyl esters (FAME) are extracted into petroleum ether. The extracted FAME are purified by gas chromatography using a capillary column (Chrompack, WCOT Fused silica, CP-Wax-52CB, 25 m, 0.32 mm) and a temperature gradient from 170 ° C to 240 ° C in 20 min and 5 min at 240 ° C analyzed. The identity of Fatty acid methyl ester is confirmed by comparison with corresponding FAME standards (Sigma). The identity and the position of the double bond can be further analyzed by GC-MS by suitable chemical derivatization of the FAME mixtures, for example to give 4,4-dimethoxoxazoline derivatives (Christie, 1998). Example 4: Cloning of genes from Ostreococcus tauri

By searching for conserved regions in the protein sequences in elongase genes, two sequences with corresponding motifs could be identified in an Ostreococcus tauri sequence database (genomic sequences). These are the following sequences:

OteloI has the highest similarity to an elongase from Danio rerio (GenBank AAN77156, about 26% identity), while OtElo2 bears the greatest similarity to the Physcomitella EIo (PSE) [ca. 36% identity] (alignments were performed with the tBLASTn algorithm (Altschul et al., J. Mol. Biol. 1990, 215: 403-410).

The cloning was carried out as follows: 40 ml of a Ostreococcus tauri culture in the stationary phase were collected by centrifugation and resuspended in 100 .mu.l double-distilled Aqua and stored at -20 ⁰ C. Based on the PCR method, the associated genomic DNAs were amplified. The appropriate primer pairs were selected to carry the yeast consensus sequence for high efficiency translation (Kozak, Cell 1986, 44: 283-292) adjacent to the start codon. The amplification of the OtEIo DNAs was carried out in each case with 1 μl of thawed cells, 200 μM dNTPs, 2.5 U day polymerase and 100 pmol of each primer in a total volume of 50 μl. The conditions for the PCR were as follows: first denaturation at 95 ° C for 5 minutes, followed by 30 cycles at 94 ° C for 30 seconds, 55 ° C for 1 minute and 72 ° C for 2 minutes and a final extension step at 72 ° C for 10 minutes.

Example 5 Cloning of Expression Plasmids for Heterologous Expression in Yeasts

To characterize the function of the elongases from Ostreococcus tauri, the open reading frames of the respective DNAs were cloned downstream of the galactose-inducible GAL1 promoter of pYES2.1Λ / 5-His-TOPO (Invitrogen) to give pOTE1 and pOTE2.

Saccharomyces cerev / s / ae strain 334 was transformed by electroporation (1500 V) with the vector pOTE1 and pOTE2, respectively. As a control, a yeast was used, which was transformed with the empty vector pYES2. The selection of the transfor- Yeasts were made on complete minimal medium (CMdum) agar plates with 2% glucose but without uracil. After selection, three transformants each were selected for further functional expression.

For the expression of the Ot elongases, first precultures each of 5 ml of CMdum liquid medium with 2% (w / v) raffinose but without uracil with the selected transformants were inoculated and incubated for 2 days at 30 ^° C., 200 rpm. 5 ml of CMdum liquid medium (without uracil) containing 2% raffinose and 300 μM of various fatty acids were then inoculated with the precultures to an OD ₆₀₀ of 0.05. Expression was induced by the addition of 2% (w / v) galactose. The cultures were incubated for a further 96 h at 20 ^° C.

Example 6: Cloning of expression plasmids for seed-specific expression in plants

For the transformation of plants another transformation vector based on pSUN-USP was generated. For this purpose, Notl interfaces were inserted at the 5 'and 3' end of the coding sequences by means of PCR. The corresponding primer sequences were derived from the 5 'and 3 regions of OtElOI and OtElo2.

Composition of the PCR approach (50 μl_):

5.00 μL template cDNA

5.00 μL 10x buffer (Advantage polymerase) + 25 mM MgCl ₂ 5.00 μL ₂ mM dNTP

1.25 μL per primer (10 pmol / μL) 0.50 μL Advantage polymerase

The Advantage polymerase from Clontech was used. Reaction conditions of the PCR: annealing temperature: 1 min 55 ^° C. Denaturation temperature: 1 min 94 ^° C. Elongation temperature: 2 min 72 ^° C. Number of cycles: 35

The PCR products were incubated for 16 h at 37 ⁰ C with the restriction enzyme Notl. The plant expression vector pSUN300-USP was incubated in the same way. Subsequently, the PCR products and the vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The purification of the DNA was carried out using Qiagen Gel Purification Kit according to the manufacturer. Subsequently, vector and PCR products were ligated. The Rapid Ligation Kit from Roche was used for this purpose. The resulting plasmids pSUN-OtELO1 and pSUN-OtELO2 were verified by sequencing. pSUN300 is a derivative of the plasmid pPZP (Hajdukiewicz P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25: 989-994). pSUN-USP was generated from pSUN300 by inserting into pSUN300 a USP promoter as an EcoRI fragment. The polyadenylation signal is that of the Ostreococcus gene from the A. tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu M. and Schell J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl Genet 1 (6), 499-511 (1982) The USP promoter corresponds nucleotides 1 to 684 (Genbank Accession X56240), wherein part of the non-coding region of the USP gene is contained in the promoter The 684 base pair promoter fragment was transfected via commercially available T7 standard primer (Stratagene) and with the aid of a synthesized primer PCR reaction amplified by standard methods (primer sequence: δ'-GTCGACCCGCGGACTAGTGGCCCTCTAGACCCGGGGGATCCGGATCTGCTGGCTATGAA-S ') The PCR fragment was rescored with EcoRI / SalI and inserted into the vector pSUN300 with OCS terminator to give the plasmid designated pSUN-USP .The K Onstrukt was used to transform Arabidopsis thaliana, rapeseed, tobacco and flaxseed.

Example 7: Expression of OtELOI and OtELO2 in Yeasts Yeasts transformed with the plasmids pYES3, pYES3-0tEL01 and pYES3-OtELO2 as in example 5 were analyzed as follows:

The yeast cells from the main cultures were (100 × g, 5 min, 20 ⁰ C) harvested by centrifugation and washed with 100 mM NaHCO _3, pH 8.0 to remove residual medium and fatty acids to be removed. From the yeast cell sediments, fatty acid methyl esters (FAMEs) were prepared by acid methanolysis. For this purpose, the cell sediments were incubated with 2 ml of 1N methanolic sulfuric acid and 2% (v / v) dimethoxypropane for 1 h at 80 ^° C. The extraction of the FAMES was carried out by extraction twice with petroleum ether (PE). To remove non-derivatized fatty acids, the organic phases were washed once each with 2 ml of 100 mM NaHCO ₃ , pH 8.0 and 2 ml of distilled water. washed. Subsequently, the PE phases were dried with Na ₂ SO ₄ , evaporated under argon and taken up in 100 μl of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 μm, Agilent) in a Hewlett-Packard 6850 gas chromatograph with flame ionization detector. The conditions for the GLC analysis were as follows: The oven temperature was programmed from 50 ° C to 250 ° C at a rate of 5 ° C / min and finally 10 min at 250 ° C (hold).

The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described, for example, in Napier and Michaelson, 2001, Lipids. 36 (8): 761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52 (360): 1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388 (2): 293-298 and Michaelson et al., 1998, FEBS Letters. 439 (3): 215-218. Example 8: Functional Characterization of OtELOI and OtELO2:

The substrate specificity of OtEIoI was determined after expression and feeding of various fatty acids (Table 2). The lined substrates can be detected in large quantities in all transgenic yeasts. The transgenic yeasts showed the synthesis of new fatty acids, the products of the OtEIoI reaction. This means that the gene OteloI could be functionally expressed.

Table 2 shows that OteloI has a narrow substrate specificity. The OteloI was able to elongate only the C20 fatty acids eicosapentaenoic acid (Figure 2) and arachidonic acid (Figure 3), but preferred the ω-3-desaturated eicosapentaenoic acid. Table 2:

Table 2 shows the substrate specificity of the elongase OteloI for C20 polyunsaturated fatty acids with a double bond in Δ5 position towards different fatty acids. The yeasts transformed with the vector pOTE1 were cultured in minimal medium in the presence of the indicated fatty acids. The synthesis of fatty acid methyl esters was carried out by acidic methanolysis of intact cells. Subsequently, the FAMEs were analyzed by GLC. Each value represents the mean value (n = 3) ± standard deviation.

The substrate specificity of OtElo2 (SEQ ID NO: 1) could be determined after expression and feeding of various fatty acids (Table 3). The lined substrates can be detected in large quantities in all transgenic yeasts. The transgenic yeasts showed the synthesis of new fatty acids, the products of the OtElo2 reaction. This means that the gene OtElo2 could be expressed functionally.

Table 3:

Table 3 shows the substrate specificity of the elongase OtElo2 towards different fatty acids. The yeasts transformed with the vector pOTE2 were cultured in minimal medium in the presence of the indicated fatty acids. The synthesis of fatty acid methyl esters was carried out by acidic methanolysis of intact cells. Subsequently, the FAMEs were analyzed by GLC. Each value represents the mean value (n = 3) ± standard deviation.

The enzymatic activity shown in Table 3 clearly shows that OtElo2 is a Δ6-elongase.

Example 9: Reconstitution of the Synthesis of DHA in Yeast

The reconstitution of the biosynthesis of DHA (22: 6 ω3) can be carried out starting from EPA (20: 5 ω3) or stearidonic acid (18: 4 ω3) by the coexpression of OtEIoI with the Δ-4-desaturase from Euglena gracilis or the Δ-5-desaturase from Phaeodactylum tricornutum and the Δ-4-desaturase from Euglena gracilis performed. For this purpose, the expression vectors pYes2-EgD4 and pESCLeu-PtD5 were further constructed. The o.g. Yeast strain already transformed with the pYes3-OtElo1 can then be further transformed with the pYes2-EgD4 or simultaneously with pYes2-EgD4 and pESCLeu-PtD5. The selection of the transformed yeasts can be performed on complete minimal medium agar plates with 2% glucose but without tryptophan and uracil in the case of the pYes3-OtElo / pYes2-EgD4 strain and without tryptophan, uracil and leucine in the case of the pYes3-OtElo / pYes2- EgD4 + pESCLeu-PtD5 strain. Expression is then induced by the addition of 2% (w / v) galactose. The cultures are then incubated for a further 120 h at 15 ° C.

Example 10 Generation of Transgenic Plants a) Generation of Transgenic Rape Plants (Modified by Moloney et al., 1992, Plant Cell Reports, 8: 238-242) The transgenic rape plants are grown using the binary vectors in Agrobacterium tumefaciens C58C1: pGV2260 or Escherichia coli (Deblaere et al., 1984, Nucl. Acids. Res. 13, 4777-4788). For the transformation of oilseed rape plants (Var Drakkar, NPZ Nordeutsche plant breeding, Hohenlieth, Germany), a 1:50 dilution of an overnight culture of a positively transformed agrobacterial colony in Murashige-Skoog medium (Murashige and Skoog 1962 Physiol., Plant 15, 473) with 3 % Sucrose (3MS medium). Petioles or hypocotyledons of freshly germinated sterile rape plants (each about 1 cm ² ) are incubated in a Petri dish with a 1:50 Agrobakterienverdünnung for 5-10 minutes. This is followed by a 3-day colncubation in darkness at 25 ° C on 3MS medium with 0.8% Bacto agar. Cultivation then takes 3 days with 16 hours of light / 8 hours of darkness. Weekly on MS medium containing 500 mg / l claforan (cefotaxime sodium), 50 mg / l kanamycin, 20 microM benzylaminopurine (BAP) is then further incubated with 1, 6 g / l glucose. Growing shoots are transferred to MS medium with 2% sucrose, 250 mg / L claforan and 0.8% Bacto agar. Formed after three weeks no roots, then 2-indolebutyric acid is added to the medium as growth hormone for rooting.

Regenerated shoots are obtained on 2MS medium with kanamycin and claforan, transferred into soil after rooting and grown in a climatic chamber or greenhouse after cultivation for two weeks, flowered, harvested mature seeds and for elongase expression such as Δ-5 elongase or Δ6-elongase activity by lipid analysis. Lines with elevated levels of C20 and C22 polyunsaturated fatty acids can thus be identified. b) Production of transgenic flax plants

The production of transgenic flax plants can be carried out, for example, according to the method of Bell et al., 1999, In Vitro Cell. Dev. Biol. Plant. 35 (6): 456-465 by means of particle bombartment. Agrobacteria-mediated transformations can be carried out, for example, according to Mlynarova et al. (1994), Plant Cell Report 13: 282-285. Example 11: Cloning of desaturase genes from Ostreococcus tauri

By searching for conserved regions in the protein sequences using conserved motifs (His-Boxes, Domergue et al., 2002, Eur. J. Biochem., 269, 4105-4113), five sequences with corresponding motifs in an Ostreococcus tauri sequence database (genomic sequences ) be identified. These are the following sequences:

The alignments for finding homologies of the individual genes were performed using the tBLASTn algorithm (Altschul et al., J. Mol. Biol. 1990, 215: 403-410). The cloning was as follows:

40 ml of an Ostreococcus tauri culture in the stationary phase were centrifuged off and resuspended in 100 .mu.l bidistilled water and stored at -20 ⁰ C. Based on the PCR method, the associated genomic DNAs were amplified. The appropriate primer pairs were selected to carry the yeast consensus sequence for high efficiency translation (Kozak, Cell 1986, 44: 283-292) adjacent to the start codon. Amplification of the OtDes DNAs was done with 1 μl of thawed cells, 200 μM dNTPs, 2.5 U Tag polymerase and 100 pmol of each primer in a total volume of 50 μl. The conditions for the PCR were as follows: first denaturation at 95 ° C for 5 minutes, followed by 30 cycles at 94 ⁰ C for 30 seconds, 55 ° C for 1 minute and 72 ° C for 2 minutes, and a final extension step at 72 ⁰ C for 10 minutes.

The following primers were used for the PCR:

OtD6.1 Forward: 5'ggtaccacataatgtgcgtggagacggaaaataacg3 'OtD6.1 Reverse: 5'ctcgagttacgccgtctttccggagtgttggcc3'

When comparing the amino acid sequence of Ot6.1 with sequences from databases (National Center for Biotechnology, NCBI) by BLAST (Altschul et al., J. Mol. Biol. 1990, 215: 403-410), it was found that the highest sequence similarity to a Δ5-desaturase from Thraustochytrium sp. present (Table 4, selection of desaturases). For the comparison, the program GAP of the aforementioned software was used.

Table 4: List of fatty acid desaturases with the highest sequence homologies to the Δ6-desaturase of Osterococcus.

Example: 12 Cloning of expression plasmids for heterologous expression in yeasts:

To characterize the function of the desaturase OtD6.1 (= Δ-6-desaturase) from Ostreococcus tauri, the open reading frame of the DNA was cloned downstream of the galactose-inducible GAL1 promoter of pYES2.1Λ / 5-His-TOPO (Invitrogen) the corresponding pYES2.1-OtD6.1 clone was obtained. In a corresponding manner, further desaturase genes from Ostreococcus can be cloned.

The Saccharomyces cerews / ^' ae strain 334 was transformed by electroporation (1500 V) with the vector pYES2.1-OtD6.1. As a control, a yeast was used, which was transformed with the empty vector pYES2. The selection of the transformed yeasts was carried out on complete minimal medium (CMdum) agar plates with 2% glucose, but without uracil. After selection, three transformants each were selected for further functional expression.

For the expression of the OtD6.1 desaturase, precultures from 5 ml of CMdum liquid medium containing 2% (w / v) raffinose but no uracil were first inoculated with the selected transformants and incubated for 2 days at 30 ^° C., 200 rpm. 5 ml of CMdum liquid medium (without uracil) containing 2% raffinose and 300 μM of various fatty acids were then inoculated with the precultures to an OD ₆₀₀ of 0.05. Expression was induced by the addition of 2% (w / v) galactose. The cultures were incubated for a further 96 h at 20 ^° C.

Example: 13 Cloning of expression plasmids for seed-specific expression in plants

For the transformation of plants another transformation vector based on pSUN-USP is generated. For this purpose, Notl interfaces are inserted at the 5 'and 3' end of the coding sequences by means of PCR. The corresponding primer sequences are derived from the 5'- and 3-region desaturases.

Composition of the PCR approach (50 μl_):

5.00 μL template cDNA 5.00 μL 10x buffer (Advantage polymerase) + 25 mM MgCl ₂ 5.00 μL ₂ mM dNTP 1.25 μL per primer (10 pmol / μL) 0.50 μL Advantage polymerase

The Advantage polymerase from Clontech was used. Reaction conditions of the PCR:

Annealing temperature: 1 min 55 ⁰ C denaturation temperature: 1 min 94 ⁰ C elongation temperature: 2 min 72 ⁰ C number of cycles: 35

The PCR products are incubated for 16 h at 37 ⁰ C with the restriction enzyme Notl. The plant expression vector pSUN300-USP is incubated in the same way. The PCR products and the vector are subsequently separated by agarose gel electrophoresis and the corresponding DNA fragments are excised. The DNA is purified using the Qiagen Gel Purification Kit according to the manufacturer's instructions. Subsequently, vector and PCR products are ligated. The Rapid Ligation Kit from Roche was used for this purpose. The resulting plasmids are verified by sequencing.

pSUN300 is a derivative of the plasmid pPZP (Hajdukiewicz P, Svab, Z ₁ Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation, Plant Mol Biol 25: 989-994). pSUN-USP was generated from pSUN300 by inserting into pSUN300 a USP promoter as an EcoRI fragment. The polyadenylation signal is that of the Ostreococcus gene from the A. tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve.H., Dhaese.P., Seurinck J., Lemmers, M., Van Montagu M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl Genet 1 (6), 499-511 (1982) The USP promoter corresponds nucleotides 1 to 684 (Genbank Accession X56240), wherein part of the non-coding region of the USP gene is contained in the promoter The 684 base pair promoter fragment was transfected via commercially available T7 standard primer (Stratagene) and with the aid of a synthesized primer PCR reaction amplified by standard methods (primer sequence: 5'-

GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCC GGATCTGCTGGCTATGAA-3 '). The PCR fragment was rescored with EcoRI / SalI and inserted into the vector pSUN300 with OCS terminator. The resulting plasmid was named pSUN-USP. The construct was used to transform Arabidopsis thaliana, rapeseed, tobacco and linseed.

Example: 14 Expression of OtDes6.1 in Yeasts

Yeasts transformed with the plasmids pYES2 and pYES2-OtDes6.1 as in Example 11 were analyzed as follows: The yeast cells from the main cultures were (100 × g, 5 min, 20 ⁰ C) harvested by centrifugation and washed with 100 mM NaHCO _3, pH 8.0 to remove residual medium and fatty acids to be removed. The yeast cell pellets were extracted with chloroform / methanol (1: 1) for 4 hours. The resulting organic phase was extracted with 0.45% NaCl, dried with Na ₂ SO ₄ and evaporated in vacuo. The lipid extract was purified by thin layer chromatography (horizontal tank,

Chloroform: methanol: acetic acid 65: 35: 8) are further separated into the lipid classes phosphatidylcholine (PC), phosphatidiylinositol (PI), phosphatidyserine (PS), phosphatidylethanolamine (PE) and neutral lipids (NL). The various split spots on the thin-layer plate were scraped off. For gas chromatographic analysis was

Fatty acid methyl ester (FAMEs) produced by acid methanolysis. For this purpose, the cell sediments were incubated with 2 ml of 1 N methanolic sulfuric acid and 2% (v / v) dimethoxypropane at 80 ^° C. for 1 h. The extraction of the FAMES was carried out by extraction twice with petroleum ether (PE). To remove non-derivatized fatty acids, the organic phases were washed once each with 2 ml of 100 mM NaHCO ₃ , pH 8.0 and 2 ml of distilled water. washed. Subsequently, the PE phases were dried with Na ₂ SO ₄ , evaporated under argon and taken up in 100 μl of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 μm, Agilent) in a Hewlett-Packard 6850 gas chromatograph with flame ionization detector. The conditions for the GLC analysis were as follows: The oven temperature was finally programmed from 50 ° C to 250 ⁰ C at a rate of 5 ° C / min and 10 min at 250 ° C (hold).

The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described, for example, in Napier and Michaelson, 2001, Lipids. 36 (8): 761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52 (360): 1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388 (2): 293-298 and Michaelson et al., 1998, FEBS Letters. 439 (3): 215-218.

For the extraction (Scherling et al., 1996, J Biol Chem 271, 22514-22521) of acyl-CoA esters, 4 ml of yeast culture (OD600 = 1.5) was used according to the method of FIG. Derivatization of the acyl-co-esters and their analysis by HPLC was performed as described in Larson TR and Graham IA, 2001 Plant J 25, 115-125.

Example: 15 Functional Characterization of Desaturases from Ostreococcus:

The substrate specificity of desaturases can be determined after expression in yeast (see examples cloning of desaturase genes, yeast expression) by feeding using various yeasts. Descriptions for the determination of the individual activities can be found in WO 93/11245 for Δ15 desaturases, WO 94/11516 for Δ12 desaturases, WO 93/06712, US 5,614,393, US 5614393, WO 96/21022, WO0021557 and WO 99/27111 for Δ6-desaturases, Qiu et al. 2001, J. Biol. Chem. 276, 31561-31566 for Δ4-desaturases, Hoπg et al. 2002, Lipids 37,863-868 for Δ5-desaturase.

Table 4 shows the substrate specificity of the desaturase OtDes6.1 versus various fatty acids. The substrate specificity of OtDes6.1 could be determined after expression and feeding of different fatty acids. The lined substrates can be detected in large quantities in all transgenic yeasts. The transgenic yeasts showed the synthesis of new fatty acids, the products of the OtDes6.2 reaction (Figure 4). This means that the gene OtDes6.1 could be expressed functionally.

Yeasts transformed with the vector pYES2-OtDes6.1 were cultured in minimal medium in the presence of the indicated fatty acids. The synthesis of fatty acid methyl esters was carried out by acidic methanolysis of intact cells. Subsequently, the FAMEs were analyzed by GLC. Each value represents the mean value (n = 3) ± standard deviation. The activity corresponds to the conversion rate calculated according to [substrate / (substrate + product) ^* 100].

Table 4 shows that the OtDes6.1 has a substrate specificity for linoleic and linolenic acid (18: 2 and 18: 3), since these fatty acids achieve the highest activities. The activity for oleic acid (18: 1) and palmitoleic acid (16: 1), however, is significantly lower. The preferred reaction of linoleic and linolenic acid shows the suitability of this desaturase for the production of polyunsaturated fatty acids.

FIG. 4 shows the conversion of linoleic acid by OtDes6.2. The analysis of the FAMEs was done by gas chromatography. The lined substrate (C18: 2) is converted to γ-C18: 3. Both starting material and the resulting product are marked by arrows.

Kinetic analysis of fatty acid changes in acyl-CoA esters and lipids from yeast cultures expressing OtDes6.1:

A culture of the yeast strain INVSd transformed with pYES-Ot6.1 (see Example 12) was incubated for 24 h at 30 ⁰ C in the presence of galactose. Subsequently 250 μM linoleic acid (18: 2Δ9,12) was added and yeast cells were removed at various times and analyzed (0 min, 5 min, 1 h, 4 h). The total fatty acid spectrum was analyzed by GC (FIG. 6, left) or the acyl-CoA esters by HPLC (FIG. 6, right).

It can be observed that the added fatty acid (18: 2Δ9,12) is already detectable at the first measuring point (5 min) both in the total lipids and in the acyl-CoA esters. Also at this early stage is already the product of the reaction of Ot6.1-desaturase in the acyl-CoA esters. This product remains quantitatively stable over time. In the total lipids, the product is clearly visible after 4 hours. The detection of the Acy-CoA ester

Product of Ot6.1-desaturase before the product can be detected in the total lipids, suggests that the desaturase used as a substrate CoA ester and not phospholipids.

FIG. 7 shows the reaction of linoleic acid (= LA) and α-linolenic acid (= ALA) in the presence of OtDes6.1 to form γ-linolenic acid (= GLA) or stearidonic acid (= STA) (FIGS. 5 A and C). 5 shows the reaction of linoleic acid (= LA) and α-linolenic acid (= ALA) in the presence of the Δ-6-desaturase OtDes6.1 together with the Δ-6 elongase PSE1 from Physcomitrella patens (Zank et al. Plant J. 31: 255-268) and Phaeodactylum tricomutum Δ5-desaturase PtD5 (Domergue et al., 2002, Eur. J. Biochem 269, 4105-4113) to dihomo-γ-linolenic acid (= DHGLA) and Arachidonic acid (= ARA, FIG. 5 B) or to dihomostearidonic acid (= DHSTA) or eicosapentaenoic acid (= EPA, FIG. 5 D). FIG. 5 clearly shows that the reaction products GLA and STA of Δ6-desaturase OtDes6.1 are almost quantitatively elongated to DHGLA or DHSTA in the presence of Δ6-elongase PSE1. The subsequent desaturation by the Δ-5-desaturase PtD5 also proceeds smoothly to ARA or EPA. Approximately 25-30% of the elongated gland product is desaturated (FIGS. 5 B and D). Table 5 gives an overview of the reconstitution of ARA or EPA. The total fatty acids were measured. Compared with phospholipid-dependent desaturases such as described in Domergue et al. 2002, Eur. J. Biochem. 269, 4105-4113, there is a clear increase (about 6-fold) of the final products ARA and EPA. Table 5: Reconstitution of the biosynthesis of PUFA in yeast.

The synthesis of isoARA (20: 4Δ8, 11, 14, 17) was also investigated in the CoA ester pool in a similar experiment as described above. For this, a yeast culture transformed with pYES-Ot6.1 and pLEU-PSE1 (described in Domergue et al., 2002, Eur. J. Biochem., 269, 4105-4113) was added and linolenic acid (18: 3Δ9, 12, 15) added. After various time points (0 min, 5 min, 1 h, 4 h) after addition, yeast cells were removed and the total lipids were analyzed by GC (FIG. 7, left) or the acyl-CoA esters by HPLC (FIG. 7, right ). It could be shown that both the products of Ot6.1 and the elongase PSE1 are already found in the acyl-CoA pool at the earliest stage. Since the acyl-CoA esters serve as substrate for elongases (Zank et al., 2002, Plant J, 31: 255-268), it can be shown that the Ot6.1 desaturase must also have the same substrate. FIG. 8 summarizes this result. While the distribution of the two acyl-CoA-dependent enzymes OtD6 and PSE1 is very homogeneous across the different lipid classes and positions, this is not the case for the phospholipid-dependent Δ5-desaturase from Phaeodactylum tricornutum. Here an accumulation in the sn-2 position of phosphatidylcholine can be demonstrated. As in Domergue et al. 2002, Eur. J. Biochem. 269, 4105-4113, the Δ5-desaturase has phosphatidylcholine as a substrate.

The following Table 6 gives an overview of the Montenal Ostreococcus Desaturases:

Example: 16 Cloning of expression plasmids for seed-specific expression in plants

For the transformation of plants another transformation vector based on pSUN-USP is generated. For this purpose Noti interfaces are inserted at the 5 'and 3' end of the coding sequences by means of PCR. The corresponding primer sequences are derived from the 5'- and 3-region desaturases. Composition of the PCR approach (50 μL):

5.00 μL template cDNA

5.00 μL 1X buffer (Advantage polymerase) + 25 mM MgCl ₂ 5.00 μL ₂ mM dNTP 1.25 μL per primer (10 pmol / μL) 0.50 μL Advantage polymerase

The Advantage polymerase from Clontech was used.

Reaction conditions of the PCR:

Annealing temperature: 1 min 55 ⁰ C denaturation temperature: 1 min 94 ⁰ C elongation temperature: 2 min 72 ⁰ C number of cycles: 35

The PCR products are incubated for 16 h at 37 ⁰ C with the restriction enzyme Notl. The plant expression vector pSUN300-USP is incubated in the same way. Subsequently, the PCR products and the vector are replaced by agarose

Separated gel electrophoresis and cut out the corresponding DNA fragments. The DNA is purified using the Qiagen Gel Purification Kit according to the manufacturer's instructions. Subsequently, vector and PCR products are ligated. The Rapid Ligation Kit from Roche was used for this purpose. The resulting plasmids are verified by sequencing.

pSUN300 is a derivative of the plasmid pPZP (Hajdukiewicz P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation, Plant Mol Biol 25: 989-994). pSUN-USP was generated from pSUN300 by inserting into pSUN300 a USP promoter as an EcoRI fragment. The polyadenylation signal is the OCS gene from the A. tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve.H., Dhaese.P., Seurinck J., Lemmers. M., Van Montagu M.M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl Genet 1 (6), 499-511 (1982) The USP promoter corresponds to the Nucleotides 1 to 684 (Genbank Accession X56240), wherein part of the non-coding region of the USP gene is contained in the promoter The 684 base pair promoter fragment was obtained by commercially available T7 standard primer (Stratagene) and by means of a synthesized primer via PCR Reaction amplified by standard methods (primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCCGGATCTGCTGGCTATGAA-S ¹ ). The PCR fragment was rescored with EcoRI / SalI and inserted into the vector pSUN300 with OCS terminator. The resulting plasmid was named pSUN-USP. The construct was used to transform Arabidopsis thaliana, rapeseed, tobacco and linseed.

Example: 17 Expression of Ostreococcus Desaturases in Yeasts

Yeasts which are transformed as described in Example 11 with the plasmids pYES2 and pYES2-Ostreococcus desaturases are analyzed as follows:

The yeast cells from the main cultures are (100 × g, 5 min, 20 ⁰ C) harvested by centrifugation and washed with 100 mM NaHCO _3, pH 8.0 to remove residual medium and fatty acids to be removed. From the yeast cell sediments, fatty acid methyl esters (FAMEs) are produced by acid methanolysis. For this purpose, the cell sediments are incubated with 2 ml of 1N methanolic sulfuric acid and 2% (v / v) dimethoxypropane for 1 h at 80 ^° C. The extraction of the FAMES was carried out by extraction twice with petroleum ether (PE). To remove non-derivatized fatty acids, the organic phases are each determined once with 2 ml of 100 mM NaHCO ₃ , pH 8.0 and 2 ml of distilled water. washed. Subsequently, the PE phases are dried with Na ₂ SO ₄ , evaporated under argon and taken up in 100 μl of PE. The samples are separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 μm, Agilent) in a Hewlett-Packard 6850 gas chromatograph with flame ionization detector. The conditions for the GLC analysis are as follows: The oven temperature is eventually programmed from 50 ⁰ C to 25O ⁰ C at a rate of 5 ° C / min and 10 min at 250 ° C (hold).

The signals are identified by comparison of the retention times with corresponding fatty acid standards (Sigma). The methodology is described, for example, in Napier and Michaelson, 2001, Lipids. 36 (8): 761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52 (360): 1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388 (2): 293-298 and Michaelson et al., 1998, FEBS Letters. 439 (3): 215-218.

Example: 18 Functional characterization of desaturases from Ostreococcus tauri: ''

The substrate specificity of desaturases can be determined after expression in yeast (see examples cloning of desaturase genes, yeast expression) by feeding using various yeasts. Descriptions for the determination of the individual activities can be found in WO 93/11245 for Δ15 desaturases, WO 94/11516 for Δ12 desaturases, WO 93/06712, US 5,614,393, US 5614393, WO 96/21022, WO0021557 and WO 99/27111 for Δ6-desaturases, Qiu et al. 2001, J. Biol. Chem. 276, 31561-31566 for Δ4-desaturases, Hong et al. 2002, Lipids 37,863-868 for Δ5-desaturases. The activity of the individual desaturases is calculated from the conversion rate according to the formula [substrate / (substrate + product) ^* 100].

equivalents:

The person skilled in the art will recognize or be able to ascertain many equivalents of the specific embodiments according to the invention described here, by merely specifying

Routine experiments used. These equivalents are intended to be encompassed by the claims.

Claims

claims

1. A process for the preparation of compounds of general formula I.

in transgenic organisms with a content of at least 1 wt .-% of these compounds based on the total lipid content of the transgenic organism, characterized in that it comprises the following steps: a) introducing at least one nucleic acid sequence into the organism, which for a Δ-6-desaturase And b) introduction of at least one nucleic acid sequence into the organism which codes for a Δ6-elongase activity, and c) introduction of at least one nucleic acid sequence into the organism which codes for a Δ5-desaturase activity, and d) introducing into the organism at least one nucleic acid sequence encoding Δ5-elongase activity, and e) introducing into the organism at least one nucleic acid sequence encoding a Δ4-desaturase activity, and wherein the variables and substituents in the formula I have the following meaning:

R ¹ = hydroxyl, coenzyme A (thioester), lyso-phosphatidylcholine, lyso-phosphatidylethanolamine, lyso-phosphatidylglycerol, lyso-diphosphatidylglycerol, lyso-phosphatidylserine, lyso-phosphatidylinositol, sphingobase, or a residue of the general Formula Il

R = hydrogen, lyso-phosphatidylcholine, lyso-phosphatidylethanolamine, lyso-phosphatidylglycerol, lyso-diphosphatidylglycerol, lyso

8 Fig. 16 Seq Phosphatidylserine, lyso-phosphatidylinositol or saturated or unsaturated C ₂ -C ₂₄ alkylcarbonyl,

R = hydrogen, saturated or unsaturated C ₂ -C ₂₄ -alkylcarbonyl-, or R ² or R ³ independently of one another a radical of general formula Ia:

n = 2, 3, 4, 5, 6, 7 or 9, m = 2, 3, 4, 5 or 6 and p = 0 or 3.

Process according to Claim 1, characterized in that the nucleic acid sequences which are suitable for polypeptides having Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase or Δ-4- Desaturase activity selected from the group consisting of: a) a nucleic acid sequence having the in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID SEQ ID NO: 11 or SEQ ID NO: 13, or b) nucleic acid sequences which, as a result of the degenerate genetic code, are different from those shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12 or SEQ ID NO: 14, or c) derivatives of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 or SEQ ID NO: 13 shown for polypeptides having at least 40% identity at the amino acid level with SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 SEQ ID NO: 12 or SEQ ID NO: 14 and have a Δ6-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase or Δ4-desaturase activity.

A method according to claim 1 or 2, characterized in that in addition to the organism a nucleic acid sequence is introduced which codes for polypeptides with Δ-12 desaturase activity, selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 15 shown sequence, or b) nucleic acid sequences which can be derived as a result of the degenerate genetic code of the amino acid sequence shown in SEQ ID NO: 16, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 15, which for polypeptides having at least 50% identity at the amino acid level

SEQ ID NO: 16 and have Δ-12 desaturase activity.

4. Process according to claims 1 to 3, characterized in that the

Substituents R ² or R ³ independently of one another are saturated or unsaturated C ₁₈ -C ₂₂ -alkylcarbonyl-. 5. Process according to claims 1 to 4, characterized in that the substituents R ² or R ³ independently of one another are unsaturated C ₁₈ -, C ₂₀ - or C ₂₂ -alkylcarbonyl having at least two double bonds.

6. Process according to claims 1 to 5, characterized in that the transgenic organism is a transgenic microorganism or a transgenic plant.

7. The method according to claims 1 to 6, characterized in that the transgenic organism is an oil-producing plant, a vegetable or ornamental plant.

8. Process according to claims 1 to 7, characterized in that the transgenic organism is a transgenic plant selected from the group of

Plant families: Adelotheciaceae, Anacardiaceae, Asteraceae, Apiaceae, Tuluaceae, Boraginaceae, Brassicaceae, Bromeliaceae, Caricaceae, Cannabaceae, Convolvulaceae, Chenopodiaceae, Crypthecodiniaceae, Cucurbitaceae, Ditrichaceae, Elaeagnaceae, Ericaceae, Euphorbiaceae, Fabaceae, Geraniaeae, Gramineae, Juglandaceae, Lauraceae, Leguminosae, Linaceae or

Prasinophyceae is.

9. Process according to claims 1 to 8, characterized in that the compounds of the general formula I are isolated from the organism in the form of their oils, lipids or free fatty acids. 10. The method according to claims 1 to 9, characterized in that the

Compounds of general formula I in a concentration of at least 5 wt .-% based on the total lipid content of the transgenic organism can be isolated.

11. Oil, lipids or fatty acids or a fraction thereof, prepared by the process according to any one of claims 1 to 10. 12. An oil, lipid or fatty acid composition comprising PUFAs prepared by a process according to any one of claims 1 to 10 and derived from transgenic plants.

13. A process for the preparation of oils, lipids or fatty acid compositions by mixing oil, lipids or fatty acids according to claim 11 or oil, lipid or fatty acid composition according to claim 12 with animal oils, lipids or fatty acids.

14. Use of oil, lipids or fatty acids according to claim 11 or oil, lipid or fatty acid composition according to claim 12 or oils, lipids or fatty acid compositions prepared according to claim 13 in

Food, food, cosmetics or pharmaceuticals.

15. Isolated nucleic acid sequences which code for polypeptides with Δ-6 desaturase activity, selected from the group: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 13, b) nucleic acid sequences that result as a result of the degenerate or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 13, which code for polypeptides having at least 40% homology at the amino acid level with SEQ ID NO: 14 and a Δ- Having 6-desaturase activity.

16. Isolated nucleic acid sequences which code for polypeptides with Δ-5-desaturase activity selected from the group: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 9 or in

SEQ ID NO: 11, b) nucleic acid sequences which can be derived as a result of the degenerate genetic code from the amino acid sequence shown in SEQ ID NO: 10 or SEQ ID NO: 12, or c) derivatives of SEQ ID NO: 9 or SEQ ID NO: 11, which encode polypeptides having at least 40% homology at the amino acid level with SEQ ID NO: 10 or in SEQ ID NO: 12 and have a Δ-5-desaturase activity.

17. Isolated nucleic acid sequences which code for polypeptides with Δ-4-desaturase activity, selected from the group: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 7, b) nucleic acid sequences which can be derived as a result of the degenerate genetic code from the amino acid sequence shown in SEQ ID NO: 8, or c) derivatives of SEQ ID NO: 7 encoding polypeptides having at least 40% homology at the amino acid level with SEQ ID NO: 8 and having a Δ-4-desaturase activity.

18. An isolated nucleic acid sequence encoding polypeptides having Δ12-desaturase activity selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 15, or b) nucleic acid sequences resulting from the degenerate genetic sequence Or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 15, which code for polypeptides having at least 50% identity at the amino acid level with SEQ ID NO: 16 and a Δ -12 desaturase activity.

The isolated nucleic acid sequence of claims 15 to 18, wherein the sequence is from an alga, a fungus, a microorganism, a plant or a non-human animal.

20. An isolated nucleic acid sequence according to claims 15 to 19, wherein the sequence is from the order Salmoniformes, the diatom species Thalasiosira or Crythecodinium or from the family of Prasinophyceae or Pythiaceae.

21. Amino acid sequence which is encoded by an isolated nucleic acid sequence according to any one of claims 15 to 20.

22. A gene construct containing an isolated nucleic acid according to any one of claims 15 to 20, wherein the nucleic acid is operably linked to one or more regulatory signals.

23. Gene construct according to claim 22, characterized in that the nucleic acid construct contains additional biosynthesis genes of the fatty acid or lipid metabolism selected from the group acyl-CoA dehydrogenase (s), acyl-ACP [= acyl carrier protein] desaturase ( n), acyl-ACP thioesterase (s), fatty acid acyltransferase (s), acyl CoA: lysophospholipid acyltransferase (s), fatty acid synthase (s), fatty acid hydroxylase (s), acetyl coenzyme ^

88

A-carboxylase (s), acyl-coenzyme A oxidase (s), fatty acid desaturase (s), fatty acid acetylenases, lipoxygenases, triacylglycerol lipases, allene oxide synthases, hydroperoxide lyases or fatty acid elongase (s).

24. Gene construct according to claim 22 or 23, characterized in that the nucleic acid construct additional biosynthesis genes of the fatty acid or

Lipid metabolism contains selected from the group of Δ-4-desaturase, Δ-5-desaturase, Δ-6-desaturase, Δ-9-desaturase, Δ-12-desaturase or Δ-6 elongase.

25. A vector containing a nucleic acid according to claims 15 to 20 or a gene construct according to claim 22 or 23.

26. Transgenic non-human organism containing at least one nucleic acid according to claims 15 to 20, a gene construct according to claim 22 or a vector according to claim 25.

The non-human transgenic organism of claim 26, wherein the organism is a microorganism, a non-human animal or a plant.

The non-human transgenic organism of claim 26 or 27, wherein the organism is a plant.