EP1815011A1 - Method of diagnosis/prognosis of human chronic lymphocytic leukemia comprising the profiling of lpl/adam genes - Google Patents
Method of diagnosis/prognosis of human chronic lymphocytic leukemia comprising the profiling of lpl/adam genesInfo
- Publication number
- EP1815011A1 EP1815011A1 EP05797387A EP05797387A EP1815011A1 EP 1815011 A1 EP1815011 A1 EP 1815011A1 EP 05797387 A EP05797387 A EP 05797387A EP 05797387 A EP05797387 A EP 05797387A EP 1815011 A1 EP1815011 A1 EP 1815011A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- subject
- lpl
- adam29
- cells
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the present invention provides methods of diagnosis and prognosis of human chronic lymphocytic leukemia (CLL) in a patient in need thereof.
- CLL chronic lymphocytic leukemia
- the methods of the present invention involve measuring the expression profile of two known genes: LPL and ADAM29; and determining the ratio of their expression to diagnose the presence of CLL or to prognose the likelihood of developing CLL, an aggressive or a stable form of the disease or the symptoms consistent with CLL.
- CLL Chronic lymphocytic leukemia
- the classical Rai'or Binet 2 staging systems have allocated CLL cases into three major risk groups (low [stage 0 in Rai's and stage A in Binet's classification system], inter ⁇ mediate [stages I and II in Rai's and stage B in Binet's classification system], and high [stage III and IV in Rai's and stage C in Binet's classification system]), according to tumor burden and the presence of anemia and thrombocytopenia.
- These staging systems have provided a basis for therapeutic stratification.
- Asymptomatic patients with a low tumor burden (Binet stage A) do not benefit from treatment with chlorambucil. However, the disease in half of these patients will progress and both staging systems fail to initially identify such patients.
- CD23 5 and thymidine kinase 4 ' 6 are essentially indicators of disease activity and/or load, although some can anticipate disease progression .
- Phenotypic expression of CD38 has been associated with aggressive disease 8 , but the threshold level for positive cases, if it exists at all, remains a matter of debate.
- 9'11 Genomic aberrations correlate well with either good (isolated 13q " ) or poor (17p " ; Up " ) prognosis in CLL ' 2 ' 13 , though their occurrence as a second malignant hit cannot be definitely excluded.
- IgVH immunoglobulin heavy chain variable
- CD38 was the first candidate proposed to replace IgVH sequencing, 8 with positive and negative cases corresponding respectively to UM and MT patients, but finally demonstrated insufficient specificity (about 30% discordance for each group). 11 In addition, its expression can vary during the course of disease. l Surprisingly, recent reports indicated that ZAP -70 mRNA, normally expressed in T and NK lymphocytes, is also transcribed in CLL B-cells lacking IgVH mutations. 18 ' 19 Two further series have confirmed these findings at the protein level, • suggesting a pivotal role for ZAP-70 in prediction of Ig VH mutational status. There is however some controversy to whether ZAP-70 is really a good surrogate marker since two recent reports failed to demonstrate a significant concordance between its expression and the degree of somatic mutation in the IgVH genes. '
- RQ-PCR real-time quantitative polymerase chain reaction
- LPL lipoprotein lipase
- SPG20 spartin
- ADAM29 disintegrin and metalloproteinase 29
- NRIPl nuclear receptor-interacting protein 1
- the gene expression level is determined by measuring mRNA, cDNA or protein expression level.
- B-cells may be obtained from any source that contains the same, including: peripheral mono ⁇ nuclear blood cells, tissues naturally bearing B-cells such as backbone, ganglions, spleen, mucosa, and skin, or tissues in which B-cells do not naturally reside, such as a tissue has been infiltrated by malignant (tumor) cells.
- an object of the present invention includes a method of identifying a subject with a significant probability of having chronic lymphocytic leukemia in a subject in need thereof by determining the gene expression levels of LPL and ADAM29 in a sample containing mRNA and designating the subject as having a significant probability of having chronic lymphocytic leukemia when expression of at least one of LPL and ADAM29 is detected in said sample.
- the sample containing mRNA may be either cellular (e.g., a peripheral blood) or previously extracted (e.g., a mRNA bank).
- Yet another object of the present invention is to provide a method of classifying IgVH mutational status of a subject having chronic lymphocytic leukemia by performing a competitive multiplex PCR assay to determine the preferential expression of LPL and ADAM29.
- Still another object of the present invention is to provide a prognostic method to determine event free survival of a subject having chronic lymphocytic leukemia.
- the present invention provides a method of allowing accurate estimation of the prognosis in a patient having chronic lymphocytic leukemia, by designating the subject as having a significant probability of having an aggressive form of the disease if there is overexpression of the LPL gene or an indolent form of the disease if there is overexpression of AD AM29 gene.
- Figure 1 Flow cytometry analysis of ZAP-70 expression.
- A The lymphocyte population was first gated (region Rl) on forward and side scatter histogram (left).
- the CLL cells (CD- 19+) were then selected (gate R2), as well as the T cell (CD3+) and NK (CD-56+) populations (gate R3), as shown on right side histogram.
- B and (D) Biparametric plots of ZAP-70 or isotype-match control antibody (CD 14) expression on different cell populations.
- the level of expression of ZAP-70 on T and NK cells served to determine a threshold, which was then used to quantify its expression on B cells (right plots). Left plots show the absence of fixation of the isotype-match control antibody on lymphocytes.
- the light and dark gray histograms correspond to B and NK cell staining respectively.
- the black overlaid histogram shows the absence of fixation of the isotype-match control antibody on lymphocytes.
- Expression of ZAP-70 on CD3+ CD56+ cells (Ml) served to determine the percentage of CLL cells that were positive for ZAP-70.
- the percentage of B cells expressing ZAP-70 is indicated.
- (B) and (C) panels illustrate a ZAP-70 negative CLL case, while panels (D) and (E) show a ZAP-70 positive case.
- B, B cell; T, T cell; NK, natural killer; IC isotype-matched control.
- L/A ratio or ZAP-70 expression (A) Event-free survival probabilities for the total population. (B) Event free survival probabilities for stage A patients. (C) Overall survival probabilities for stage B and C patients.
- LPL and ADAM29 transcripts were amplified simultaneously, the PCR products were then separated by electrophoresis on agarose gel and visualised under UV illumination after ethidium bromide staining. Amplification of the GAPDH gene from the same transcripts served as control of cDNA integrity.
- MWM indicates molecular weight marker, MT, mutated; UM, unmutated; B, purified B cells from a healthy individual; T, Jurkatt T-cell line.
- CLL patients expressing mutated (MT) IgVH genes display good prognosis when compared to patients expressing unmutated (UM) IgVH genes.
- MT mutated
- UM unmutated
- ZAP-70 has been shown to be overexpressed in patients displaying UM IgVH genes.
- the speculation that ZAP-70 gene expression could differentiate MT from UM CLLs has emerged from microarray experiments, 18 ' 19 and was further confirmed at the protein level by flow cytometry.
- 20 ' 21 In the examples of the present invention, the present inventors evaluated ZAP-70 expression in CLL cases.
- the threshold value which best correlated with the IgVH mutational status was found to be 20%, similar to that described by Crespo et al., 20 but higher than that used by Orchard et al. (10%).
- the present inventors have monitored the expression levels of these genes on a large series of CLL patients and evaluated the correlation with the IgVH mutational status and clinical outcome.
- Both LPL and ADAM29 were found to correlate better with the IgVH mutational status than SPG20 and NRIPl. Even better results were obtained when combining LPL and ADAM29 by a simple ratio of their normalized expression values, reaching 90% concordance.
- the L/A ratio thus constitutes a suitable surrogate marker of the Ig VH mutational status in CLL.
- LPL is a heparin-releasable enzyme bound to glycosaminoglycan components of the capillary endothelium, and is particularly abundant in muscle, adipose tissue and macrophages.
- LPL mediates the hydrolysis of triacylglycerol component of circulating chylomicrons and very low- density lipoproteins. It plays a central role in lipid metabolism and transport. 29 ' 30 Mutations in the LPL gene are frequently associated with dyslipidemia and athero- sclerosis. 29 ' 31 In line with the present inventors findings on normal cells, other ban ⁇ gators have failed to detect LPL expression in normal purified B and T lymphocytes. 32 However, they found that it was expressed and secreted by NK cells, where it was shown to modulate their cytotoxic activity. Reasons for its high expression in UM CLL B-cells are unknown.
- the present invention also embraces the following LPL and ADAM29 gene sequences. - LPL : Hs. 180878 (UniGene)
- Primers that may be used to amplify these sequences include: LPL (CS)s CAGATGCCCTACAAAGTCTTCC (SEQ ID NO: 29) LPL (CS)as GCCACGGTGCCATACAGAGAAA (SEQ ID NO: 30) ADAM29 (CS)s GGCAACCCACCAATAACTAAAT (SEQ ID NO: 31)
- an in vitro method of identifying a subject with a significant probability of having chronic lymphocytic leukemia in a subject in need thereof by: obtaining a specimen from said subject, wherein said specimen comprises at least one of peripheral mononuclear blood cells (PBMC), tissue containing B-cells, and extracted B cells; determining the gene expression levels of LPL and ADAM29 in said specimen; designating said subject as having a significant probability of having chronic lymphocytic leukemia if said determining evidences expression of at least one of LPL and ADAM29 in said specimen.
- PBMC peripheral mononuclear blood cells
- B-cells may be obtained from any source that contains the same, including: peripheral mononuclear blood cells, tissues naturally bearing B-cells such as backbone, ganglions, spleen, mucosa, and skin, or tissues in which B-cells do not naturally reside, such as a tissue has been infiltrated by malignant (tumor) cells.
- an embodiment of the present invention includes an in vitro method of identifying a subject with a significant probability of having chronic lymphocytic leukemia in a subject in need thereof, by obtaining a sample containing mRNA, wherein said sample contains at least one selected from the group consisting of extracted mRNA, peripheral mononuclear blood cells (PBMC), tissue containing B-cells, and extracted B cells; determining the gene expression levels of LPL and ADAM29 in said sample; designating said subject as having a significant probability of having chronic lymphocytic leukemia if said determining evidences expression of at least one of LPL and ADAM29 in said sample.
- PBMC peripheral mononuclear blood cells
- the present invention may be utilized to detect leukemias in patients in which all the other common leukemia markers are "silent." In these particular cases, the ratio L/A will become the only available diagnostic method. As such, the present invention embraces a general diagnostic method comprising identifying a subject having a significant probability of having chronic lymphocytic leukemia comprising deter ⁇ mining the L/A ratio in a sample obtained from said subject by the methods described herein.
- the term "significant probability” in the phrase “having a significant probability of having chronic lymphocytic leukemia” is defined as being greater 80%, preferably greater than 85%, more preferably greater than 90%, most preferably greater than 95% chance that said subject has CLL.
- ADAM29 in either PBMC or B cells low levels of LPL in B cells, corresponding to no less than 85.7% accuracy in CLL diagnosis, and all pre-diagnosed CLL patients expressed LPL or ADAM29 in either PBMC or B cells, corresponding to an accuracy in the overall population of greater than 99%.
- the phrase "aggressive form of chronic lymphocytic leukemia” means that subjects present, in addition to an abnormal hemogram, clinical symptoms such as an important tumor mass and/or cytopenia such as anemia or trombopenia.
- the phrase "indolent form of chronic lymphocytic leukaemia” means that subjects present an anormal hemogram; however, do not present any clinical symptom normally associated with the disease. At this stage, the disease is only detectable by labs means.
- the phrase "subject in need thereof is defined as a subject that is suspected of having CLL or has been independently (e.g., by conventional CLL diagnostic methods) diagnosed as suffering from CLL.
- the present invention may be extended to routine preventative medical practices.
- the present invention may be used with "healthy" subjects as a part of a routine physical examination.
- the term "subject” is defined as including any animal that expresses LPL and ADAM29. In a preferred embodiment the "subject” is a human. Further, it should be noted that the term “patient” is used herein interchangeably with the term “subject.” In view of the fact that CLL has been found to occur in bovine, the present invention may find applica ⁇ tion in animals that possess both an LPL gene and an ADAM29 gene.
- the term "specimen” is defined as being any extracted biologi ⁇ cal material in which cellular material of blood is likely to be found.
- sample is defined as being any biological material naturally occurring or extracted in which cellular or genetic (i.e., mRNA) is contained. In an embodiment of the present invention, these terms refer to peripheral blood samples, tissue containing B cell, or extracted B cells.
- the specimen or sample may be used in a crude form, a preserved form (i.e., includes additional additives commonly added to preserve the integrity of the cellular material under envi- ronmental stress, such as freezing), a partially purified form, a purified form (e.g., isolated cellular material), or any other common preparatory form.
- a preserved form i.e., includes additional additives commonly added to preserve the integrity of the cellular material under envi- ronmental stress, such as freezing
- a partially purified form e.g., isolated cellular material
- any other common preparatory form e.g., isolated cellular material
- Gene expression may be determined by any quantitative, semi-quantitative or qualita ⁇ tive method including PCR methods.
- Specific PCR methods that are suitable for use in the present invention include real-time PCR (RQ-PCR) multiplex-PCR and fluores- cent MX-PCR. It is also understood that microarray techniques may be employed to provide quantitative values for gene expression. Protein expression is preferentially determined by flow cytometry.
- Protein quantification may be also accomplished by using directly or indirectly labelled polyclonal or mono ⁇ clonal antibodies specifically directed against each of one expressed protein LPL or ADAM29.
- Labelled proteins could be detected directly on cells either by cytometric techniques (cell-shorter techniques, cellular suspensions, etc.) or by histochemical techniques (fixed cells, solid or semi-solid tissues). Cells could be previously perme- abilized to allow the introduction into the B-cell cytoplasma of the appropriate anti ⁇ body. Also labelled proteins may be extracted outside the cells and analyzed by Western blot techniques, after migration of the cell extracts on Polyacrylamide gels (PAGE-SDS).
- the present invention also contemplates methods in which relative expression levels are determined for LPL and ADAM29.
- LPL linear low-density lipoprotein
- ADAM29 a simple electrophoretic technique in which PCR products are separated by electrophoreses and the relative intensities of the bands corresponding to LPL (approximately 410bp for humans) and ADAM29 (approximately 445bp for humans) is determined.
- Such a technique is readily amendable to RQ-PCR and multiplex PCR platforms.
- the gene expression level of LPL and ADAM29 is preferably a normalized gene expression, which is preferably obtained by RQ-PCR (real-time polymerase chain reaction) using the Light Cycler System (Roche Molecular Biochemicals, Mannheim, Germany) and the SYBR Green I dye.
- RQ-PCR real-time polymerase chain reaction
- the Light Cycler System Roche Molecular Biochemicals, Mannheim, Germany
- SYBR Green I dye SYBR Green I dye
- primers are designed to be specific for the gene of interest and RQ-PCR is performed with a predetermined quantity (e.g., 100-150 ng) of reverse transcribed total RNA (cDNA) for a time and under conditions suitable for amplifying the gene of interest from the reverse transcribed total RNA (cDNA).
- a predetermined quantity e.g., 100-150 ng
- the conditions may entail: 10 minutes at 95°C for initial denaturation, then 40 cycles of 10 seconds at 95°C, 5 seconds at 62°C and 17 seconds at 72°C.
- the specificity of the amplified products is then preferably verified by analysis of their respective melting curves.
- the results may be validated.
- Estimation of the quality of cDNA for each sample is preferably obtained by quantification of an endogenous reference.
- the endogenous reference is the glyceraldehyde-3 -phosphate dehydrogenase (GAPDH).
- GAPDH gene has been used in the present invention as a housekeeping gene, but normalization may also be performed by using any other housekeeping gene. Examples of genes that are suitable for use as normalization genes in quantitative PCR techniques include, but are not limited to:
- the gene copy number is preferably calculated using a standard curve generated from serially diluted (10-fold dilutions from 10 6 to 10 2 copies) plasmids containing the respective sequence verified insert (LPL, ADAM29, Housekeeping gene, etc.). Results are expressed as the ratio of mean of gene copy number / mean GAPDH copy number x 100 (used herein as "normalized gene expression").
- gene expression level preferably means that the expression level has been quantitatively determined and is normalized. To facilitate gene expression level determination, it is preferred that total cellular RNA is extracted from the sample from the subject under study and that the corresponding cDNA be synthesized to serve as a PCR template.
- a microarray study by the present inventors showed overexpression of LPL and ADAM29 genes among UM and MT CLLs, respectively.
- the present inventors quantified expression of LPL and ADAM29 genes by RQ-PCR, and ZAP-70 protein by flow-cytometry in a cohort of 127 CLL patients, and evaluated the correlations with the IgVH mutational status and clinical outcome.
- Combining LPL and ADAM29 mRNA quantifications by a simple 1 to 1 ratio (L/A ratio) provided a 90% concor ⁇ dance rate with the IgVH mutational status.
- an in vitro method of classifying IgVH mutational status of a subject having chronic lymphocytic leukemia by, after obtaining a sample containing mRNA from said subject (preferably a peripheral blood sample, a tissue sample, or extracted B cells from said subject or pre- extracted mRNA from said subject); said method comprises: determining the gene expression levels of LPL and ADAM29 in said sample; evaluating the LPLIADAM29 gene expression ratio; and classifying the IgVH gene as: mutated if the LPLIADAM29 ratio is less than one, or unmutated if the LPLIADAM29 ratio is greater than or equal to one.
- the subject in need of classifying IgVH mutational status may be either a subject that has been diagnosed by conventional methods as having CLL or may be a subject that has been identified as having a significant probability of having CLL by the method described hereinabove.
- the L/A ratio or ZAP-70 (described in the art previously) would be used independently as surrogate marker of the mutational status, it may lead to an inappro- priate classification of a small fraction of patients, which may be problematic in a risk-adapted therapeutic attitude. Therefore, in an embodiment of the present inven ⁇ tion, the present inventors therefore combined both markers, which resulted in a much closer correlation with the IgVH mutational status.
- the ZAP-70 expression level may be determined as described previously 20 ' 21 or by the method detailed in the Examples of the present specification.
- the ZAP-70 expression level is then used in the context of the present invention to validate the IgVH mutational status classified by the L/A ratio.
- the validation method is conducted by: determining the percentage of CD3+ CD56+ cells present. in a specimen from the subject classified by L/A ratio that are positive for ZAP-70 intracellular expression; and classifying the IgVH gene sequence as: mutated if the percentage of CD19+CD3- CD56-cells present in said specimen that are positive for ZAP-70 intracellular expression is less than 20%, or unmutated if the percentage of CD19+CD3- CD56- cells present in said specimen that are positive for ZAP-70 intracellular expression is greater than or equal to 20%.
- validation of the IgVH mutational status determined by L/A ratio and/or ZAP-70 expression can be enhanced by direct determination of the IgVH mutational status by standard sequencing protocols. Additionally, in the event that L/A ratio and ZAP-70 expression give rise to discordant results, it is preferred that the IgVH mutational status be directly determined by standard sequencing protocols. Therefore, the following general method is contemplated for direct determination of the Ig VH mutational status by sequencing the IgVH genes: sequencing the IgVH genes; comparing the determined IgVH gene sequences to the closest germline counterpart; and classifying the IgVH gene sequences as: mutated if their homology determined by said comparing is less than
- the present inventors have developed a simple and inexpensive way to assess simultaneous expression of LPL and ADAM29 by a multiplex RT-PCR technique. Keeping in mind that some cases will appear as doublets (6% of cases) and so will not be informative, the simplicity of the assay should permit that it is performed in most laboratories. In the Examples of the present invention, the present inventors demonstrate that the L/A ratio was at least as performant as the IgVH muta ⁇ tional status in predicting clinical outcome. Thus, this simple determination of LPL and ADAM29 expression would be much more cost effective than Ig sequencing.
- the electrophoretic classification method of IgVH mutational status of a subject having chronic lympho ⁇ cytic leukemia is conducted by: after obtaining a sample containing mRNA (preferably a peripheral blood sample, a tissue sample, or extracted B cells from said subject or pre- extracted mRNA) from said subject; performing a competitive multiplex PCR assay in the presence of PCR primers for LPL and ADAM29, wherein said PCR primers are SEQ ID NO:3, SEQ ID NO: 4, SEQ ID NO:5, and SEQ ID NO:6, separating the PCR amplification product; and classifying the Ig VH mutational status by determining the relative intensities of the bands corresponding to 410bp and 445bp, wherein the 410bp band corresponds to LPL and the 445bp band corresponds to ADAM29; and wherein when the intensity of the band at 410bp is greater than the intensity of the band at 445bp or when there is only a single band
- the present invention contemplates coupling the aforementioned method with direct IgVH mutational status classification by IgVH genes sequencing or quantitative L/A determination (with or without ZAP-70 expression analysis).
- the described method may be performed by using other primers that have been selected for their hybridization to LPL or ADAM29 and, thus, the resultant band's size could be different.
- the size of the appropriate primers could varied from 50 to 1000 bp, preferably 50 to 500 bp, more preferably, 75 to 205 bp, depending on the conditions of the hybridization (i.e., stringent conditions), temperature, number of cycles as well as the nature of the buffer.
- the artisan would be able to readily identify other suitable primers for both genes.
- stringent conditions or “stringent hybridization conditions” include reference to conditions under which a polynucleotide will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complemen ⁇ tary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing).
- stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 3O 0 C for short probes (e.g., 10 to 50 nucleotides) and at least about 6O 0 C for long probes (e.g., greater than 50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary moderate stringency condi ⁇ tions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37 0 C, and a wash in 0.5X to IX SSC at 55 to 6O 0 C.
- Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37 0 C, and a wash in 0.1X SSC at 60 to 65°C. Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution.
- Tm can be approximated from the equation of Meinkoth and Wahl, Anal.
- Tm 81.5°C.+16.6 (log M)+0.41 (%GC)-0.61 (% form)-500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
- the Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe.
- Tm is reduced by about I 0 C for each 1% of mismatching; thus, Tm, hybridiza ⁇ tion and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with approximately 90% identity are sought, the Tm can be decreased 10 0 C. Generally, stringent conditions are selected to be about 5 0 C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH.
- Tm thermal melting point
- the electrophoretic classification method of IgVH mutational status of a subject having chronic lymphocytic leukemia is conducted by: after obtaining a sample containing mRNA (preferably a peripheral blood sample, a tissue sample, or extracted B cells from said subject or pre- extracted mRNA) from said subject; performing a competitive multiplex PCR assay in the presence of PCR primers for LPL and ADAM29, wherein said PCR primers are selected such that the size differences between the bands corresponding to LPL and ADAM29 are resolvable by electrophoresis, separating the PCR amplification product; and classifying the Ig VH mutational status by determining the relative intensities of the bands corresponding to LPL and ADAM29 , wherein when the intensity of the band corresponding to LPL is greater than the intensity of the band corresponding to ADAM29 or when there is only a single band corresponding to LPL then the IgVH mutational status is classified as being unmutated;
- mRNA preferably a peripheral blood sample, a
- the present inventors evaluated the ability of the L/A ratio and ZAP-70 expression to predict clinical outcome.
- both parameters as well as the Ig VH mutational status, correlated with event free survival (EFS) in the whole population.
- EFS event free survival
- ZAP-70 was no longer selected.
- EFS event free survival
- the IgVH UM status became a significant risk factor only after adjustment on sex and age in multivariate analysis.
- ZAP-70 expression had no prognostic value in this group of patients.
- the availability of biological prognostic indicators such as the L/A ratio for stage B and C CLL cases may therefore be of great importance for future risk-adapted treatments.
- the present invention provides a method of allowing accurate estimation of the prognosis in a patient having chronic lymphocytic leukemia, by designating the subject as having a significant probability of having an aggressive form of the disease if there is overexpression of the LPL gene or an indolent form of the disease if there is overexpression of ADAM29 gene.
- the present invention provides an in vitro method of distinguishing in a subject in need thereof between whether said subject has an aggressive form of chronic lymphocytic leukemia or an indolent form of chronic lymphocytic leukemia comprising after obtaining a specimen from said subject; determining the gene expression levels of LPL and ADAM29 in said specimen; designating the subject as having a significant probability of having an aggressive form of chronic lymphocytic leukemia if the LPL gene is overexpressed; or an indolent form of chronic lymphocytic leukemia if the ADAM29 gene is overexpressed.
- gene expression of LPL and/or ADAM29 is considered to be overexpressed when expression in the subject is compared to the expression level of the respective gene in a normal "healthy" person. For instance, the absence of LPL expression in normal subjects is well-known.
- overexpres ⁇ sion is determined on the basis of comparison to a reference (i.e., household gene), for example GAPDH.
- GAPDH Using GAPDH, overexpression is considered: a ratio LPL/GAPDH >1.0 and a ratio of ADAM29/GAPDH >2.8, more prefereably a ratio of ADAM29/GAPDH >3.0.
- the present invention demonstrates that LPL and ADAM29 expression levels correlate with the mutational profile of IgVH genes as well, if not better, than ZAP-70, and is useful to classify the IgVH mutational status of a subject having CLL.
- Combination of the L/A ratio with ZAP-70 expression provides an accurate prediction of the IgVH mutational status in 80% of CLL cases, thus rendering sequencing unnecessary in these patients.
- the L/A ratio is a prognostic indicator which appears to outmatch ZAP-70 in terms of survival prediction for advanced CLL cases.
- kits suitable for detecting includes “diagnosing and/or prognosing" lymphocytic leukemia (preferably chronic lymphocytic leukemia).
- detecting includes “diagnosing and/or prognosing" lymphocytic leukemia (preferably chronic lymphocytic leukemia).
- a kit would contain primers that hybridize to and/or facilitate amplification of the LPL and/or the ADAM29 genes, and at least one housekeeping gene.
- the present invention contemplates packaging of the present kit such that the primers for the LPL gene and the ADAM29 gene are in the same or different vial (or tube).
- the housekeeping gene may admixed with either the LPL gene or the ADAM29 gene or may be in its own independent tube.
- kits that may also be contained in the kit (admixed with one or more of the other components or individually packaged) of the present invention include primers specific for the selected housekeeping gene and reagents (including dNTPs) for amplification.
- reagents including dNTPs
- the components therein may be in an aqueous, non-aqueous, dry or crystalline state, or may be admixed with a suitable pharmaceutically acceptable carrier.
- the components of the kit are present in a non-aqueous, dry, or crystalline state, it is preferred that the kit further contain an additional vial or tube that contains a suitable diluent, which will provide the user with the appropriate concentration of the components for use in the methods of the present invention.
- the kit will contain instructions for using of the components contained in the kit in the methods of the present inven ⁇ tion, as included; such instructions can be in the form of printed, electronic, visual, and/or audio instructions.
- PBMC peripheral mononuclear blood cells
- the IgVH gene sequences were determined as previously described. 25 Briefly, amplification of Ig heavy chain variable regions by PCR was performed on DNA from leukemic cells with consensus primers for the VH framework region 1 and JH genes as previously described or following the BIOMED-2 protocols. Purified PCR products were sequenced either directly or after a cloning procedure using an automated DNA sequencer.
- RNA isolation and cDNA synthesis- Total cellular RNA was extracted using the RNeasy kit (Qiagen, Courtaboeuf, France) following supplier's instructions. The integrity of RNA was assessed by visualization of the 18S and 28S RNA species upon electrophoresis in agarose gel after ethidium bromide staining. First strand cDNA was synthesized from 2 ⁇ g of total RNA, using Superscript II reverse transcriptase (Invitrogen, Cergy-Pontoise, France) and oligodT or random hexamer primers.
- RQ-PCR real-time polymerase chain reaction
- cDNA reversly transcribed total RNA
- the specificity of the amplified products was verified by analysis of their respective melting curves as provided by the Light Cycler software. AU reactions were performed in duplicate and each PCR run also included the 5 points of the calibration curve and a no-template control. Estimation of the quality of cDNA for each sample was performed by quantification of an endogenous reference, the glyceraldehyde-3 -phosphate dehydrogenase (GAPDH). The gene copy number was calculated with a standard curve generated from serially diluted (10-fold dilutions from 10 to 10 copies) plasmids containing the respective sequence (LPL, ADAM29 or Housekeeping gene) verified insert. Results were expressed as the ratio of mean of gene copy number / mean GAPDH copy number x 100 (used herein as "normalized gene expression"). Multiplex RT-PCR-
- the present inventors also evaluated the relative expression of LPL and ADAM29 by multiplex RT-PCR, using the same primers than those for RQ-PCR (Table 1). Different concentrations of primers, MgCl 2 and dNTP were first evaluated. Optimized PCR conditions were obtained with primers at the final concentrations of 0.5 ⁇ M for LPL and 0.25 ⁇ M for ADAM29, 1.5 mM MgCl 2 and 200 ⁇ M dNTP. Amplifications were performed using 100 ng cDNA and included an initial denaturation step at 94°C for 5 minutes, followed by 29 cycles of 30 seconds at 95°C, 20 seconds at 62°C and 30 seconds at 72°C.
- primers can be fluorescent labeled primers and the resultant
- PCR products can be analyzed on polyacrylamide gel electrophoresis (GenScan). L/A ration can be determined by measuring and comparing the corresponding surfaces under the curves, after scan.
- GAPDH forward GGTGCTGAGTATGTCGTGGA SEQ ID NO: 1
- GAPDH reverse ATGCCAGTGAGCTTCCGTT SEQ ID NO:2
- ADAM29 forward TCTTATGTGGGCTGGTGGATCC (SEQ ID NO:5)
- ADAM29 reverse GACCTAGATGATGAGCCACTGC (SEQ ID NO:6)
- Flow-cytometric analysis of ZAP-70 intracellular expression was performed using the method described by Crespo et al. 20 with some minor modifications. Thawed mononuclear cells were fixed in 2% paraformaldehyde and were subsequently permeabilized by incubation with phosphate-buffered saline containing 0.1% saponin (Sigma, Saint-Quentin Favallier, France) and 0.5% bovine serum albumin.
- dx ⁇ x-ZAP-70 antibody clone 2F3.2, Upstate, Lake Placid, NY, USA
- irrelevant isotype-matched anti- CD 14 monoclonal antibodies DakoCytomation, Trappes, France.
- FITC fluorescein isothiocyanate
- PC5 phycoerythrin-cyanin 5
- APC allophycocyanin
- Samples including at least 10 4 cells were further analysed with a flow cytometer (FACSCalibur, BD Biosciences) and the use of CellQuest Pro software (BD Biosciences). Lymphocyte cells were first selected on size structure characteristics, and then gated on B cells (CD19+, gate R2) and T and NK cells (CD3+ CD56+, gate R3). Biparametric dot plot graphs were obtained separately for cells that were stained for respectively CD3, CD56 and ZAP-70, or CD19 and ZAP-70, or CD3, CD56 and CD 14 (negative control). In those plots as well as in monoparametric histograms, ZAP-70 expression on CD3+ CD56+ cells served to determine the percentage of CLL cells that were positive for ZAP-70.
- Threshold values that could best discriminate MT from UM cases were first determined by plotting expression values against IgVH percentage of germline homology, and then further refined by calculating Youden's index and validity index (the percentage of correctly classified cases). Thereafter the performance indexes including sensitivity, specificity, positive and negative predictive values were determined.
- stage B and C Since CLL-related deaths were mainly observed in stage B and C (only 4 cases in stage A), while disease progression was the most frequent event for stage A patients, the present inventors evaluated event-free survival, from diagnosis to date of disease progression or CLL-related death or last follow-up visit, for the whole cohort and stage A patients. Overall survival was calculated only for stage B and C patients. Survival analyses were performed using the Kaplan-Meier method. Statistical significance of associations between individual variables and survival was calculated by the log-rank test.
- Example 1 Patients ' character istics-
- Table 2 summarizes the 127 patients' characteristics: Table 2: Clinical and biological characteristics of patients
- IgVH genes UM 27 (31%) 17 (59%) 9 (82%) 26 (65%) 53 (42%)
- UM indicates unmutated; MT, mutated; L/A, LPLIADAM29; NA, not applicable.
- Example 2 LPL and ADAM29 are better surrogate markers for LgVH mutational status than SPG20 and NRIPl-
- UM indicates unmutated; MT, mutated; PPV, positive predictive value; NPV 3 negative predictive value.
- LPL/ADAM29 LPL/ADAM29
- the present inventors investigated whether a combination of the most discriminating parameters by a simple 1 to 1 LPL/ADAM29 (LIA) ratio could improve their individual predictive potential for mutational status. With a calculated threshold of 1 , the L/A ratio displayed better sensitivity and specificity than each marker taken individually. Positive predictive value (PPV) was 91% for UM cases and negative predictive value (NPV) was 86% for MT patients, providing a better performance than each individual marker (Table 3). Thus the L/A ratio constituted the best marker reflecting the mutational status of Ig VH genes in this cohort of 71 CLL patients, with a concordance rate of 89%.
- LPL and ADAM29 appeared to better reflect the IgVH mutational status, the present inventors evaluated the reproducibility of their quantification by RQ-PCR. This was done by comparing results obtained from replicate samples for 4 patients, 2 overexpressing LPL and 2 overexpressing ADAM29. For each patient, 4 replicates were analyzed during the same reaction run (intra-run variability), and this was repeated on 3 different days (inter-run variability). The overall variability of these 12 replicates is shown in Table 4. Of note, intra-run variability was always smaller than overall variability, with CV being less than 0.5% for LPL and less than 1.1% for ADAM29 (data not shown).
- ADAM29 was not detected in PBMC from 4 healthy individuals, nor in purified B cells from 3 additional healthy donors. Similar results were obtained with LPL except for 1 of the
- Example 5 UA ratio predicts the IgVH mutational status at least as well as ZAP-70- Results obtained with the initial CLL series led us to compare LPL and
- LPL and ADAM29 values were available for 119 patients, whereas ZAP-70 could be determined for 101 patients and all three parameters for 93 patients. Threshold values were determined and found to be identical to those of the first cohort.
- the L/A ratio once again provided a better concordance (90%) with IgVH mutational status than LPL (76%) or ADAM29 (82%) taken individually (Table 5).
- ZAP-70 expression was measured by flow cytometry in leukemic B cells in comparison with that of the patients' T and NK cells (Figure 1). A cut-off value at 20% positivity was found to provide the best correlation with IgVH genes ( Figure 2). Fifty patients (50%) had MT IgVH genes and were ZAP-70 negative while 35 displayed UM IgVH genes (35%) and were ZAP-70 positive. Concordance rate with IgVH mutational status was 84%, thus slightly lower than that obtained with the L/A ratio (Table 5, above). Table 5: Correlation of LPL, ADAM29 gene expression and ZAP-70 protein expression with Ig VH mutational status
- Example 6 Combination of ZAP-70 and L/ A ratio determination provides almost perfect prediction of IgVH mutational status-
- Table 6 Groups of CLL patients according to L/A ratio and ZAP-70 expression
- Positivity or negativity for ZAP-70 refers to expression values > 20% or ⁇ 20% respectively.
- Positivity or negativity for L/A ratio refers to expression values > 1 or ⁇ 1 respectively. Abbreviations are explained in Table 2.
- Example 7 The L/A ratio is a predictor of survival in CLL-
- EFS Median event free survival
- Model 2 including L/A ratio and ZAP -70
- Example 8 Determination of the LPL and ADAM29 gene expression by a simple qualitative multiplex PCR assay-
- Chronic lymphocytic leukemia B cells express restricted sets of mutated and unmutated antigen receptors. J Clin Invest.
- Vasconcelos Y, Davi F, Levy V, et al. Binet's staging system and VH genes are independent but complementary prognostic indicators in chronic lymphocytic leukemia. J Clin Oncol. 2003;21 :3928-3932
- ADAM gene family surface proteins with adhesion and protease activity.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA 2483284 CA2483284A1 (en) | 2004-11-08 | 2004-11-08 | Method of diagnosis/prognosis of human chronic lymphocytic leukemia comprising the profiling of lpl/adam genes |
US10/982,908 US7416851B2 (en) | 2004-11-08 | 2004-11-08 | Method of diagnosis/prognosis of human chronic lymphocytic leukemia comprising the profiling of LPL/ADAM genes |
PCT/IB2005/003656 WO2006048776A1 (en) | 2004-11-08 | 2005-11-08 | Method of diagnosis/prognosis of human chronic lymphocytic leukemia comprising the profiling of lpl/adam genes |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1815011A1 true EP1815011A1 (en) | 2007-08-08 |
Family
ID=38226716
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP05797387A Withdrawn EP1815011A1 (en) | 2004-11-08 | 2005-11-08 | Method of diagnosis/prognosis of human chronic lymphocytic leukemia comprising the profiling of lpl/adam genes |
Country Status (3)
Country | Link |
---|---|
EP (1) | EP1815011A1 (en) |
CA (1) | CA2586874A1 (en) |
WO (1) | WO2006048776A1 (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20080280297A1 (en) * | 2005-07-15 | 2008-11-13 | The Trustees Of Columbia University In The City Of | Compositions and Methods for Differential Diagnosis of Chronic Lymphocytic Leukemia |
EP2474627B1 (en) * | 2007-02-21 | 2015-05-20 | Oslo Universitetssykehus HF | New markers for cancer |
CZ301540B6 (en) * | 2008-05-30 | 2010-04-07 | Masarykova Univerzita | Method of determining prognosis of B-cell chronic lymphocytic leukemia |
CA2867522A1 (en) * | 2012-03-16 | 2013-09-19 | University Of Rochester | Methods of predicting clinical outcome of chronic lymphocytic leukemia |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7329502B2 (en) * | 2002-04-25 | 2008-02-12 | The United States Of America As Represented By The Department Of Health And Human Services | ZAP-70 expression as a marker for chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL) |
CA2506737C (en) * | 2002-11-19 | 2014-09-30 | H:S Rigshospitalet | Methods and kits for diagnosing and treating b-cell chronic lymphocytic leukemia (b-cll) |
-
2005
- 2005-11-08 EP EP05797387A patent/EP1815011A1/en not_active Withdrawn
- 2005-11-08 CA CA002586874A patent/CA2586874A1/en not_active Abandoned
- 2005-11-08 WO PCT/IB2005/003656 patent/WO2006048776A1/en active Application Filing
Non-Patent Citations (2)
Title |
---|
MALOUM KARIM ET AL: "IGHV gene mutational status and LPL/ADAM29 gene expression as clinical outcome predictors in CLL patients in remission following treatment with oral fludarabine plus cyclophosphamide.", ANNALS OF HEMATOLOGY DEC 2009 LNKD- PUBMED:19340428, vol. 88, no. 12, December 2009 (2009-12-01), pages 1215 - 1221, ISSN: 1432-0584 * |
See also references of WO2006048776A1 * |
Also Published As
Publication number | Publication date |
---|---|
WO2006048776A1 (en) | 2006-05-11 |
CA2586874A1 (en) | 2006-05-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7416851B2 (en) | Method of diagnosis/prognosis of human chronic lymphocytic leukemia comprising the profiling of LPL/ADAM genes | |
Oppezzo et al. | The LPL/ADAM29 expression ratio is a novel prognosis indicator in chronic lymphocytic leukemia | |
US10619211B2 (en) | Methods using DNA methylation for identifying a cell or a mixture of cells for prognosis and diagnosis of diseases, and for cell remediation therapies | |
US8349555B2 (en) | Methods and compositions for predicting death from cancer and prostate cancer survival using gene expression signatures | |
ES2636470T3 (en) | Gene expression markers to predict response to chemotherapy | |
US20200131586A1 (en) | Methods and compositions for diagnosing or detecting lung cancers | |
JP6049739B2 (en) | Marker genes for classification of prostate cancer | |
US20110159498A1 (en) | Methods, agents and kits for the detection of cancer | |
KR101566368B1 (en) | Urine gene expression ratios for detection of cancer | |
WO2014071279A2 (en) | Gene fusions and alternatively spliced junctions associated with breast cancer | |
US9790554B2 (en) | Complex sets of miRNAs as non-invasive biomarkers for kidney cancer | |
JP2011525106A (en) | Markers for diffuse B large cell lymphoma and methods of use thereof | |
US10793911B2 (en) | Host DNA as a biomarker of Crohn's disease | |
JP2017500887A (en) | Methods for monitoring, diagnosing, and screening for bladder cancer | |
JP2019537436A (en) | Postoperative prognosis or anticancer drug compatibility prediction system for patients with advanced gastric cancer | |
WO2006048776A1 (en) | Method of diagnosis/prognosis of human chronic lymphocytic leukemia comprising the profiling of lpl/adam genes | |
US20150045243A1 (en) | Mirnas as non-invasive biomarkers for diagnosis | |
WO2023034892A1 (en) | Assessment of melanoma therapy response | |
WO2019134994A1 (en) | Prognostic biomarkers for human papillomavirus positive cancers | |
CA3085464A1 (en) | Compositions and methods for diagnosing lung cancers using gene expression profiles | |
JPWO2015105190A1 (en) | Evaluation method for lymph node metastasis of endometrial cancer | |
US20120264633A1 (en) | Methods for detecting thrombocytosis using biomarkers | |
EP2607494A1 (en) | Biomarkers for lung cancer risk assessment | |
EP4396824A1 (en) | Assessment of melanoma therapy response | |
CN113322325A (en) | Application of gene group as detection index in oral squamous cell carcinoma diagnosis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20070605 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR |
|
RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: OPPEZO, PABLO Inventor name: VASCONCELOS PINHEIRO, YURI Inventor name: DAVI, FREDERIC Inventor name: DUMAS, GERARD Inventor name: SETTEGRANA, CATHERINE Inventor name: DIGHIERO, GUILLAUME |
|
17Q | First examination report despatched |
Effective date: 20071026 |
|
DAX | Request for extension of the european patent (deleted) | ||
REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 1106003 Country of ref document: HK |
|
GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20110309 |
|
REG | Reference to a national code |
Ref country code: HK Ref legal event code: WD Ref document number: 1106003 Country of ref document: HK |