EP1811031A1 - Methode zur Auswahl eines Peptids oder Polypeptids das an ein Zielmolekül bindet - Google Patents

Methode zur Auswahl eines Peptids oder Polypeptids das an ein Zielmolekül bindet Download PDF

Info

Publication number
EP1811031A1
EP1811031A1 EP06290126A EP06290126A EP1811031A1 EP 1811031 A1 EP1811031 A1 EP 1811031A1 EP 06290126 A EP06290126 A EP 06290126A EP 06290126 A EP06290126 A EP 06290126A EP 1811031 A1 EP1811031 A1 EP 1811031A1
Authority
EP
European Patent Office
Prior art keywords
virus
protein
viruses
vector
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06290126A
Other languages
English (en)
French (fr)
Inventor
Philippe Lieudit Coteau de Fonbazi Mondon
Olivier Dubreuil
Marie-Julie Carles
Abdelhakim Kharrat
Patrick Brune
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
MilleGen SA
Original Assignee
MilleGen SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MilleGen SA filed Critical MilleGen SA
Priority to EP06290126A priority Critical patent/EP1811031A1/de
Priority to EP07713016A priority patent/EP1974033A2/de
Priority to US12/161,028 priority patent/US20100273669A1/en
Priority to PCT/IB2007/000128 priority patent/WO2007083226A2/en
Publication of EP1811031A1 publication Critical patent/EP1811031A1/de
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1055—Protein x Protein interaction, e.g. two hybrid selection
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/735—Fusion polypeptide containing domain for protein-protein interaction containing a domain for self-assembly, e.g. a viral coat protein (includes phage display)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/90—Fusion polypeptide containing a motif for post-translational modification
    • C07K2319/92—Fusion polypeptide containing a motif for post-translational modification containing an intein ("protein splicing")domain

Definitions

  • the present invention relates to phage display.
  • DNA recombination and genetic engineering techniques make it possible today to modify the structure of recombinant proteins or antibodies and evolve their functions. This is made possible by the contribution of modifications on the DNA sequence of a gene encoding for the aforementioned protein. These modifications corresponding to the creation of mutations can be carried out in a site directed or completely random way (for review see 1-3) and generate mutant libraries. The screening of these libraries allows selection of mutants presenting the required function.
  • One of the recent applications is the generation of recombinant antibody libraries. Libraries are generated starting from mRNA extracted from B cells, (from diverse lymphoid sources, taken among healthy subjects or patients suffering from various diseases) by PCR-based or similar cloning technology (4-6).
  • VH and VL variable domains of immunoglobulins can be optimised in term of diversity by the random incorporation of mutations on the heavy chains (VH) and light chains (VL) variable domains of immunoglobulins.
  • Antibody libraries can be expressed as variable fragments (VH, VL, scFv or Fab). VH and VL variable domains of the antibody are responsible for the recognition and the binding to the antigen. Genetic engineering of this region helps the optimization of the immunologicals properties such as affinity, stability and specificity of an antibody for an antigen (7,8). The same approach is considered for the constant region (Fc region) of an antibody which carries binding epitope for many receptors, like effector cells of the immune system (for review see 9 and references therein).
  • Recombinant antibody libraries are of very significant size and very powerful selection tools are required in order to isolate the antibody of interest.
  • Many of the selection platforms used today (bacterial, yeast and phage display) share four key steps: generation of genotypic diversity, coupling genotype to phenotype, application of selective pressure and amplification.
  • Systems used today work on the basis of antibody expression (VH, VL, Fab or scFv fragment) on the surface of a cellular (bacterium, yeasts) or viral (phage) system.
  • Phage display is the most popular system for antibody library screening (10) and relies on a strong binding of the antibody to the antigen which also makes it well suited to affinity maturation.
  • This method relates to the recovery of the infectious character of a phage displaying on its surface recombinant antibody fragment.
  • the interaction between the antibody displayed on the phage surface and its ligand allows the restoration of the phage infecting ability. Indeed, this interaction occurs with the bringing together of two fragments of a viral coat protein (e.g. the minor coat protein pIII) which is essential to the phage infecting ability.
  • a viral coat protein e.g. the minor coat protein pIII
  • this approach also suffers from several disadvantages.
  • the infecting ability of the phage depends on strength of the interaction between the displayed protein and the ligand. Consequently, only strong or very strong affinity interactions will be able to keep together the two viral coat infectious protein fragments and restore the infecting ability of the phage.
  • Mutants having a moderate to strong affinity, but being able to be the subject of an improvement during an additional mutagenesis-selection cycle will not be selected.
  • selection of an antibody with strong affinity to the antigen generally requires generation of different large size libraries and several mutagenesis-screening cycles to increase the success rate.
  • an important part of the ligand fused to the fragment of the viral coat protein remains free. During the selection step, this fusion molecule can bind to the host cells likely to be infected by the phages. Hence a competition with the phages with restored infecting ability takes place.
  • the present invention provides a versatile and sensitive method for selecting a peptide or polypeptide which binds to a target.
  • the invention is based on protein trans-splicing and phage display.
  • Protein splicing is defined as the excision of an intervening sequence (the INTEIN) from a protein precursor and the concomitant ligation of the flanking protein fragments (the EXTEINS) to form a mature protein (extein) and the free intein.
  • the intein plus the first C-extein residue (called the +1 amino acid) contain sufficient information to mediate splicing of the intein out of the protein precursor and ligation of the exteins to form a mature protein.
  • Intein-mediated protein splicing results in a native peptide bond between the ligated exteins. It is now known that inteins incorporated into non-native precursors can also cause protein-splicing and excision of the inteins. In addition, an N-terminal intein fragment in a fusion protein and a C-terminal intein fragment in another fusion protein, when brought into contact with each other, can bring about trans-splicing between the two fusion proteins.
  • the protein splicing feature is used in vitro to transform a non-infectious virus into an infectious virus, thereby allowing the selection of a positive interaction of a peptide or polypeptide with a target.
  • the present invention ensures a positive selection of the peptides or polypeptides of interest.
  • the present invention allows the selection of peptides or polypeptides with a good specificity for a target and permits the improvement of their affinity for the target by successive mutagenesis rounds.
  • the present invention is therefore well-suited to affinity maturation of antibodies in multiple rounds of mutation and selection.
  • the present invention provides a kit for selecting a peptide or polypeptide which binds to a target.
  • the kit comprises:
  • kit further comprises said host cell.
  • Said host cell can be for example a prokaryote host cell and more particularly a bacterial host cell.
  • C can, for example, be selected from the group consisting of an antigen, an antibody, a nucleotide sequence, a receptor.
  • the three different components X, I 1 , Z of the chimeric polypeptide of formula X-I 1 -Z can be directly linked or linked via a spacer comprised of a peptide of 1 to 20 amino acids.
  • the three different components A, I 2 , C of the adapter molecule can be directly linked or linked via a spacer comprised of a peptide of 1 to 20 amino acids.
  • the components can be linked together by using an appropriate chemical linking agent.
  • the virus to be used in the present invention can be any virus or viral vector.
  • the virus is a filamentous bacteriophage.
  • said filamentous bacteriophage can be selected from the group consisting of Ff filamentous phage, lambda and T7.
  • said filamentous bacteriophage is a Ff filamentous bacteriophage selected from the group consisting of fd, M13 and fl.
  • Z which is a protein or a peptide present at the surface of the virus.
  • Z can be, depending on the virus used, a viral coat protein, a protein of the envelope of the virus, a protein of the capsid or a fragment thereof.
  • Molecule A can be selected from the group consisting of an antibody, a viral coat protein, a protein of the envelope of the virus, a protein of the capsid and fragment thereof.
  • Z is the C-terminal part of a surface protein of a virus which is required by said virus for the infection of a host cell and A is the N-terminal part of said surface protein.
  • said surface protein can be selected from the group consisting of protein III (pIII) or protein VIII (pVIII).
  • pIII of bacteriophage M13 comprises three domains of 68 (N1), 131 (N2) and 150 (CT) amino acids.
  • pIII can be easily engineered in two pieces A and Z: the N-terminal part comprising domains N1 and N2: A and the C-terminal part comprising domain CT: Z.
  • a phage only expressing at its surface the C-terminal part of pIII can not infect its traditional host cell. Infecting ability is restored when the N-terminal part of pill is linked the C-terminal part of pill.
  • X is an immunoglobulin, or a member of the immunoglobulin super-family, or any fragment thereof.
  • immunoglobulin includes members of the classes IgA, IgD, IgE, IgG, and IgM.
  • immunoglobulin super-family refers to all proteins which share structural characteristics with the immunoglobulins, including, for example, the T-cell receptor, or any of the molecules CD2, CD4, CD8 etc.
  • fragments which can be generated from these molecules such as Fv (a complex of the two variable regions of the molecule), single chain Fv (an Fv complex in which the component chains are joined by a linker molecule), Fab, F(ab') 2 or an immunoglobulin domain, such as the constant fragment (Fc), the variable heavy chain domain (VH) or the variable light chain domain VL.
  • Protein splicing permits the translation of an interaction event into a detectable signal through the reconstitution of a functional protein such as EGFP in E coli and yeast, and firefly luciferase in mammalian cells (see 23, 25-27 and EP1229330 ).
  • a protein is split into two fragments and each half is fused to either the N-terminal or C-terminal fragments of an intein.
  • Some inteins like the cis-splicing VMA intein from Saccharomyces cerevisiae have been engineered to be split in two fragments (N- and C-intein) to produce in vivo trans-spliced recombinant proteins (20).
  • N-intein or C-intein alone is incapable of catalyzing protein splicing.
  • the N-intein and a C-intein, fused respectively to two interacting proteins are in close proximity, they are capable of catalyzing protein trans-splicing. Since the initial discovery of the VMA1 intein (14, 15), inteins have been identified in bacteria, archea and eukaryotic unicellular organisms (see The Intein Database and Registry http://www.neb.com/neb/inteins.html ).
  • an N-terminal Splicing Region a central Homing Endonuclease Region or a small central Linker Region
  • a C-terminal Splicing Region a C-terminal Splicing Region.
  • inteins as small as 134 amino acids can splice out of precursor proteins.
  • the discovery of mini-inteins and mutational analysis have indicated that the residues responsible for protein splicing are present in the N-terminal Splicing Region and the C-terminal Splicing Region (including the +1 amino acid in the C-extein).
  • Several conserved motifs have been observed by comparing intein amino acid sequences.
  • the N-terminal Splicing Region is about 100 amino acids and begins at the intein N-terminus and ends shortly after Block B.
  • the intein C-terminal Splicing Region is usually less than 50 amino acids and includes Blocks F and G.
  • the N-terminal Splicing Region and the C-terminal Splicing Region form a single structural domain, which is conserved in all inteins studied to date.
  • Mini-inteins are usually about 130-200 amino acids. However, most inteins are greater than 300 amino acids, while the Pab RFC-2 intein is 608 amino acids.
  • intein Blocks B and F that includes intein Blocks C, D, E, and H homing endonuclease motifs.
  • the consensus sequence for blocks A, B, F and G is indicated below. Although no single residue is invariant, the Ser and Cys in Block A, the His in Block B, the His, Asn and Ser/Cys/Thr in Block G are the most conserved residues in the splicing motifs. Any member of an amino acid group may be present in the remaining positions, even when a specific predominant residue is indicated.
  • the upper case letters represent the standard single letter amino acid code for the most common amino acid at this position and lower case letters represent amino acid groups: x: any residue; x 1 : C, S or T; h: hydrophobic residues: G,A,V,L,I,M; p: polar residues: S,C,T; a: acidic residues: D or E; r: aromatic residues: F,Y,W)
  • the intein is selected from the group consisting of DnaE, Ctr VMA, Mtu recA and Tac VMA.
  • Z is linked to the C-terminus of I 1 and I 1 comprises block F and block G and molecule A is linked to the N-terminus of I 2 and I 2 comprises block A and block B.
  • Z is linked to the N-terminus of I 1 and I 1 comprises block A and block B and molecule A is linked to the C-terminus of I 2 and I 2 comprises block F and block G.
  • the present invention relates to the virus comprising a nucleotide sequence encoding X and displaying on its surface a chimeric polypeptide of formula X-I 1 -Z as described in the above mentioned kit.
  • the present invention relates to a library of viruses comprising a nucleotide sequence encoding X and displaying on its surface a chimeric polypeptide of formula X-I 1 -Z as described in the above mentioned kit.
  • the present invention relates to the adapter molecule of formula A-I 2 -C as described in the above mentioned kit.
  • the present invention relates to a vector comprising a nucleotide sequence encoding I 1 -Z, wherein the vector is capable of being packaged into a virus and wherein the vector comprises a cloning site which enables the introduction of a nucleotide sequence encoding a peptide or polypeptide X in such a way that the chimeric polypeptide X-I 1 -Z is displayed at the surface of said virus when said vector is packaged.
  • the vector is a phagemid.
  • the present invention relates to a vector comprising a nucleotide sequence encoding X-I 1 -Z, wherein the vector is capable of being packaged into a virus and wherein X-I 1 -Z is displayed at the surface of said virus when said vector is packaged.
  • the present invention relates to a library of vectors comprising a nucleotide sequence encoding X-I 1 -Z, wherein the vector is capable of being packaged into a virus and wherein X-I 1 -Z is displayed at the surface of said virus when said vector is packaged.
  • the present invention relates to an expression vector comprising a nucleotide sequence encoding A-I 2 , wherein said expression vector comprises a cloning site which enables the introduction of a nucleotide sequence encoding a target peptide or polypeptide C in such a way that a chimeric polypeptide of formula A-I 2 -C can be expressed in a host cell.
  • this expression vector can be used for the production of the adapter molecule.
  • the present invention relates to a kit comprising:
  • the present invention relates to a method for producing a virus as described above comprising the step of genetically modifying a virus in such a way that when the virus is assembled the chimeric polypeptide of formula X-I 1 -Z is displayed on the surface of the virus.
  • the step of genetically modifying the virus can be performed by using the vector described above.
  • the present invention relates to a method for producing a library of viruses as described above comprising the steps of:
  • the libraries result from the construction of nucleotide sequences repertories, nucleotide sequences characterised in that they are different by at least one change.
  • the generation of the variant nucleotide sequences encoding X may be performed by site-directed mutagenesis, preferentially by random mutagenesis. Random mutagenesis can be performed by using a mutase, Pol beta for example (see W00238756 ).
  • the present invention relates to a method for selecting a peptide or polypeptide X which binds to a target C or a nucleotide sequence encoding X comprising the steps of:
  • step a) and before step b) the adapter molecules not having interacted with the viruses are removed.
  • the present invention relates to a method for producing a peptide or polypeptide X which binds to a target C comprising the steps of:
  • Figures 1-2, 4-5 illustrate different constructs that allow expression of different fusion proteins used in the examples.
  • Figure 3 shows the type of ImmunoAssay used in the example to demonstrate the formation of a covalent link between two protein parts.
  • Figure 6 shows the different Intein motifs.
  • Figure 7 is a schematic diagram summarizing the present invention, in which Binder is X, CVDE is I 1 , CTg3p is Z, NTg3p is A, NVDE is I 2 and target is C.
  • the intein used was a yeast VMA1-derived intein (VDE or PI-SceI) cloned in a pGEX vector: pGEX-VDE.
  • the protein III (abbreviated as pIII, gIIIp or g3p) of bacteriophage M13 consists of three domains of 68 (N1), 131 (N2) and 150 (CT) amino acids, connected by glycine-rich linker of 18 (G1) and 39 (G2) amino acids.
  • the gene of protein III (gene III) of bacteriophage M13 was PCR amplified and cloned in a pSK vector: pSK-GIII.
  • Site directed mutagenesis was used to introduce SphI and AgeI restriction sites in the glycine-rich linker G2 of gene III using the primer pair: 5'-GGCGGTTCTGAGGGTGGCGCATGCGAGGGAGGCGGCGGTTCCGG-3' (SEQ ID N°:5) and 5'-CCGGAACCGCCTCCCTCGCATGCGCCCACCCTCAGAACCGCC-3' (SEQ ID N°:6) and the primer pair 5'-GAGGGAGGCGGTACCGGTGGTGGCTCTGG-3' (SEQ ID N°:7) and 5'-CCAGAGCCACCACCGGTACCGCCTCCCTC-3' (SEQ ID N°:8), respectively.
  • N-VDE amino acids 1 to 187
  • N-VDE amino acids 1 to 187
  • 5'-GCATGCTTTGCCAAGGGTACCAATG-3' SEQ ID N°:9
  • 5'-CTCGAGTGTGCCGTTGCCGTTGTTTCTGTCATTCTCATAAAGAATTGGAGCG-3' SEQ ID N°: 10.
  • C-VDE amino acids 388 to 455
  • the C-terminal domain (C-VDE: amino acids 388 to 455) of the VDE was amplified using the primer pair CTCGAGAGAAACAACGGCAACGGGAACGGCACAGGAGATGTTTTGCTTAACGT (SEQ ID N°: 11) and ACCGGTACCGCCTCCCTCGCAATTGTGGACGACAACCTGGGATCC (SEQ ID N°:12) which allows to add Xho I and Age I restriction sites at the two extremities of the C-VDE and a linker at the N-terminal part of the C-VDE.
  • N-terminal and the C- terminal domains of the VDE amplified from the plasmid pGEX-NVDE were then cloned into the Sph I - Age I restriction sites of the gene III to obtain the vector pNTg3p-VDE-CTg3p ( Figure 1A) with the fusion protein: NTg3p (N1-N2 of pIII)-NVDE-linker-C-VDE-CTgIIIp).
  • the C-VDE and CT of pIII (CTg3p) fusion protein was PCR amplified from the vector pNg3p-VDE-CTg3p using the primer pair 5'-ATAAGAATGCGGCCGCATAGAGAAACAACGGCAACGGGAACGG-3' (SEQ ID N°:13) and TAATACGACTCACTATAGGG (SEQ ID N°:14), which allows to replace Xho I by Not I at the N-terminal and cloned between the Not I and Cla I restriction sites of the vector pSK-GIII in fusion with a signal sequence pelB and under the control of a Lac promoter to generate the phagemid pCVDE-CTg3p ( Figure 1B).
  • the Nl-N2 domain of the gene III was PCR amplified from the vector pNP3-VDE-CP3 using the primer pair 5'-CCATGGCTGAAACTGTTGAAAGTTGTTTAGC-3' (SEQ ID N°:15) and 5'-CTCGAGGCATGCGCCACCCTCAGAACC-3' (SEQ ID N°:16) which allows to add Nco I in 5' and Xho I in 3' and cloned in the Nco I and Xho I restriction sites of the pGEX vector to generate the control plasmid pGEX-NTg3p ( Figure 1C).
  • the N1-N2-NVDE fusion protein gene was PCR amplified from the vector pNTg3p-VDE-CTg3p using the primer pair 5'-CCATGGCTGAAACTGTTGAAAGTTGTTTAGC-3' (SEQ ID N°:17) and 5'-CTCGAGTGTGCCGTTGCCGTTGTTTCTGTCATTCTCATAAAGAATTGGAGCG-3' (SEQ ID N°:18) in order to insert Nco I in 5' and cloned in the Nco I and Xho I restriction sites of the pGEX vector providing the plasmid pGEX-NTg3p-NVDE ( Figure 1D).
  • the N1-N2-NVDE fusion protein gene was PCR amplified from the vector pGEX-NTg3p-NVDE using the primer pair 5'-TATAGTATGAGCTCGCCATGGCTGAAACTGTTGAAAGTTG-3' (SEQ ID N°:19) and 5'-TATATAGAATTCTCACTTCTTCTCGAGTGTGCCGTTCCCGTT-3' (SEQ ID N°:20) in order to insert Sac I in 5'end and Eco RI, and 2 codons for lysine in 3'end and cloned in the Sac I and Eco RI restriction sites of the expression pMG20 vector (MilleGen) providing the plasmid pMG20-NTg3p-NVDE_K.
  • Example 2 Reconstitution of the two portions of the gene III protein via protein-target interaction of a phage displaying an anti N-VEGF antibody and the N portion of the VEGF.
  • the retrotranscript of the VH and VL genes of the hybridoma VEBA76.50 were PCR amplified and a single chain antibody Fv fragment (scFv) having the structure VH-VL was cloned into the vector pCR4-topoTA (Invitrogen).
  • the VEBA76.50 scFV was digested with NcoI and NotI and cloned into the phagemid pCextein-CTg3p digested with the same enzymes giving the phagemid pCVDE-CTg3p-VEBA76.50 ( Figure 2A).
  • This phagemid encodes the VEBA76.50 scFv as an N-terminal fusion of C-terminal domain of the intein (CVDE) and the C-terminal domain of the pIII.
  • Phage particles displaying the scFv on their surfaces were produced in the E. coli XL1blue harbouring the plasmid pCVDE-CTg3p-VEBA76.50 and co-infected with the hyperphage M13KO7 ⁇ pIII (Progen). The phages were then prepared according to standard methods (28).
  • the N portion of the VEGF was PCR amplified from the vector pGEX_NVEGF using the primer pair 5'-CTCGAGCGGCGGCGGACAGTGGACGCG-3' (SEQ ID N°:21) and 5'-GCGGCCGCTTACCGGGCCAGGGCCTGGGGAGC-3' (SEQ ID N°:22) was cloned into the vector pCR4-Topo.
  • the NVEGF was digested with Xho I and Not I and cloned into the pGEX-NTg3p-NVDE digested with the same enzymes, giving the vector pNTg3p-NVDE-NVEGF ( Figure 2B).
  • the target fusion complex NTg3p-NVDE-NVEGF produced in E coli strain BL21(DE3) are purified using a glutatione chromatography according to standard methods (28).
  • a competitive ELISA was done to evaluate the binding of the phage particules to the target fusion complex.
  • the protocole was the same as described previously but in this case the wells were coated with the target complex fusion (GST-NTg3p-NVDE-NVEGF).
  • the phage displaying the antibody fusion complex binds specifically the N terminal part of the VEGF of the target fusion complex.
  • This assay requires different steps as described as follow: i) the fusion target complex NTg3p-NVDE-NVEGF was coated to a 96-wells microtiter plate, ii) different dilutions in the splicing buffer of the phage fusion anti-body displaying VEBA76.50-CVDE-CTg3p were added and incubated 5h (or overnight) at 24°C, iii)after three washes, the non covalently link scFv fusion phages were released by the addition of a dissociating agent (HCl) and were removed by a subsequently step of washing, iv) despite the treatment with dissociating agent, the covalent bound scFv fusion phages due to trans-splicing event with the target fusion complex immobilised on the microtiter plate were not released and were revealed with an anti-fd phage antibody peroxidase conjugate as described before. Phages displaying the same fusion protein without the
  • Example 3 Reconstitution of the two portions of the gene III protein via protein-target interaction of a phage displaying a peptide anti-RhoB (R3) and the RhoB protein.
  • a peptide anti-RhoB was isolated from a highly diversify antibody library (MutalBank-Millegen) through a screening against RhoB protein.
  • the peptide R3 (25 aa) has a specific affinity against the protein RhoB.
  • the peptide R3 was PCR amplified with the primers pair 5'-GCAGCCCCATAAACACACAGTATGT-3' (SEQ ID N°:23) and 5'-ATATATATGCGGCCGCCTTATCGTCATCGTCGTACAGATCTGAACCGCCTCCACCAC TCCGCTCGAGGAGATGGATTGTAGCGCTTATCATC-3' (SEQ ID N°:24) in order to insert NotII, a GS linker, a TAG (Xpress) in 3' and cloned in the BglII and NotI restriction site of the phagemid pCextein-CTg3p-hinge-Fc to obtain pCVDE-CTg3p-R3 ( Figure 4).
  • Phage particles were produced in the E . coli XL1blue harbouring the pCVDE-CTg3p-R3 and co-infected with the hyperphage M13KO7 ⁇ pIII (Progen) .
  • the phages were then prepared according to standard methods.
  • the phages displaying on their surface the fusion protein R3-CVDE-CTg3p that specifically recognised RhoB protein was checked by ELISA.
  • RhoB gene was PCR amplified from the vector pIRES-puro-HA-RhoB (29) using the primer pair 5'-TATAGGTCGACATGGCTTACCCATACGATGTTCCAGA-3' (SEQ ID N°:25) and 5'- TATATATCTAGATAGCACCTTGCAGCAGTTGATGCA-3' (SEQ ID N°:26) and was cloned into the vector pCR4-topoTA (Invitrogen).
  • the plasmid pCR4-topoTA-RhoB was digested with SalI and EcoRI and the insert was cloned in the XhoI and EcoRI restriction sites of the plasmid pMG20-NTg3p-Nextein_K to obtain pMG20-Nl-N2-Nextein_RhoB.
  • the fusion protein NTg3p-NVDE_RhoB was expressed in E. coli strain BL21DE3 and purified by Ni-NTA chromatography according to standard methods (28).
  • R3-CVDE-CTg3p fusion phages were incubated with the target complex NTg3p-NVDE_RhoB in the splicing buffer 18h at 24°C. This mixture was added to an excess of E . coli XL1blue cells and after incubation at 37°C, aliquots were plated on 2YT-agar containing 100 ⁇ g/ml of ampicillin, 0.5% glucose. Phages recovering infecting ability were counted as colony forming units after overnight incubation at 37°C.
  • Example 4 Reconstitution of the two portions of the gene III protein via protein-target interaction of a phage displaying a hinge-Fc fragment and the protein A from Staphylococcus aureus.
  • the fragment hinge-Fc (aa: 216-447) of a human IgG1 has been amplified from the clone pBHuC ⁇ 1 (30) with the primer pair 5'-ATATATATAGCCATGGCGGGGGGTTCTCACCACCATCACCACCACGGGAGATCTGGA TCCGAGCCCAAATCTTGTGA-3' (SEQ ID N°:27) and 5'-GCTAGTCAGTGCGGCCGCGAATTCTTTACCCGGAGACAGGGAGAG-3' (SEQ ID N°:28) in order to insert NcoI, a strech of six histidines and BglII in 5' and NotI in 3'.
  • the PCR product was digested and cloned in the NcoI and NotI restriction sites of the phagemid pCVDE-CTg3p vector providing the phagemid pCVDE-CTg3p-hinge-Fc ( Figure 5).
  • Phage particles displaying the fusion complex hinge-Fc CVDE-CTg3p on their surface were generated in the E. coli XL1blue harbouring the pCextein-CTg3p-hinge-Fc phagemid through a co-infection with the hyperphage M13KO7 ⁇ pIII (Progen).
  • the phages were then prepared according to standard methods.
  • N1-N2-NVDE_K and coupling to protein A (spA).
  • the fusion protein NTg3p-Nextein_K was expressed using the plasmid pMG20-Nl-N2-NVDE_K in E. coli strain BL21DE3 and purified by Ni-NTA chromatography according to standard methods.
  • NTg3p-Nextein_K was coupled with Protein A in molar ratio 1/1 on free primary amine (Lysin lateral chain) by the water soluble homo bifunctional glutaraldehyde.
  • Coupling product was subjected to an IMAC purification procedure on a NiNTA Agarose resin (Qiagen) followed by a size exclusion gel chromatography (Amersham). The resulting complex was analysed by SDS PAGE and western blot.
  • the hinge-Fc-CVDE-CTg3p fusion phage were incubated with the target complex N1-N2-NVDE_hinge_Fc in the splicing buffer 18h at 24°C. This mixture was added to an excess of E . coli XL1blue cells and after incubation at 37°C, aliquots were plated on 2YT-agar containing 100 ⁇ g/ml of ampicillin, 0.5% glucose. Phages recovering infecting ability were counted as colony forming units after incubation overnight at 37°C.
  • Example 5 Reconstitution of the two portions of pIII via protein-target interaction of a phage displaying a VH anti-Klip1 antibody and the Klip1 protein.
  • a domain of variable heavy chain was isolated from a highly diversify antibody library (MutalBank-Millegen) through a screening against Klip-1 extracellular fragment.
  • the VH-4K has a specific affinity against the Klip-1 extracellular fragment.
  • the antibody fragment VH-4K was PCR amplified with the primers pair 5'-GCAGCCCCATAAACACACAGTATGT-3' (SEQ ID N°:29) and 5'-ATATATATATGCGGCCGCGAATTCGAAGATCCGCCGCCAC-3' (SEQ ID N°:30) in order to insert NotI in 3' and cloned in the BglII and NotI restriction site of the phagemid pCVDE-CTg3p-hinge-Fc to replace the hinge-Fc with VH-4k to obtain pCVDE-CTg3p-VH-4k.
  • Phage particles displaying the fusion complex VH-4k-CVDE-CTg3p on their surface were produced in the E . coli XL1blue harbouring pCVDE-CTg3p-VH-4k and co-infected with the hyperphage M13KO7 ⁇ pIII (Progen). The phages were then prepared according to standard methods and the affinity to Klip1 protein was checked by ELISA.
  • Klip-1 extracellular fragment was PCR amplified from the vector pQE-31 (31) using the primer pair 5'-TATATACTCGAGGAAGAAAACATCCAGGGCGGAG-3' (SEQ ID N°:31) and 5'-TATATATCTAGAAGGTCCATAGAGTTCACCTG-3' (SEQ ID N°:32) was cloned into the vector pCR4-topoTA (Invitrogen). Klip-1 was removed from plasmid pCR4-topoTA-Klip-1 and cloned in the XhoI and EcoRI restriction sites of the plasmid pMG20-NTg3p-NVDE_K to obtain pMG20-NTg3p-NVDE_Klip1.
  • the fusion protein NTg3p-NVDE_Klip1 was expressed in E . coli strain BL21DE3 and purified by Ni-NTA chromatography according to standard methods (28).
  • VH-4k-CVDE-CTg3p fusion phage were incubated with the target complex NTg3p-NVDE_Klip1 in the splicing buffer 18h at 24°C. This mixture was added to an excess of E . coli XL1blue cells and after incubation at 37°C, aliquots were plated on 2YT-agar containing 100 ⁇ g/ml of ampicillin, 0.5% glucose. Phages recovering infecting ability were counted as colony forming units after incubation overnight at 37°C.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
EP06290126A 2006-01-18 2006-01-18 Methode zur Auswahl eines Peptids oder Polypeptids das an ein Zielmolekül bindet Withdrawn EP1811031A1 (de)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP06290126A EP1811031A1 (de) 2006-01-18 2006-01-18 Methode zur Auswahl eines Peptids oder Polypeptids das an ein Zielmolekül bindet
EP07713016A EP1974033A2 (de) 2006-01-18 2007-01-18 Verfahren zur auswahl eines an ein zielmolekül bindenden peptids oder polypeptids
US12/161,028 US20100273669A1 (en) 2006-01-18 2007-01-18 Method for selecting a peptide or polypeptide which binds to a target
PCT/IB2007/000128 WO2007083226A2 (en) 2006-01-18 2007-01-18 Method for selecting a peptide or polypeptide which binds to a target molecule

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
EP06290126A EP1811031A1 (de) 2006-01-18 2006-01-18 Methode zur Auswahl eines Peptids oder Polypeptids das an ein Zielmolekül bindet

Publications (1)

Publication Number Publication Date
EP1811031A1 true EP1811031A1 (de) 2007-07-25

Family

ID=36121394

Family Applications (2)

Application Number Title Priority Date Filing Date
EP06290126A Withdrawn EP1811031A1 (de) 2006-01-18 2006-01-18 Methode zur Auswahl eines Peptids oder Polypeptids das an ein Zielmolekül bindet
EP07713016A Withdrawn EP1974033A2 (de) 2006-01-18 2007-01-18 Verfahren zur auswahl eines an ein zielmolekül bindenden peptids oder polypeptids

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP07713016A Withdrawn EP1974033A2 (de) 2006-01-18 2007-01-18 Verfahren zur auswahl eines an ein zielmolekül bindenden peptids oder polypeptids

Country Status (3)

Country Link
US (1) US20100273669A1 (de)
EP (2) EP1811031A1 (de)
WO (1) WO2007083226A2 (de)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2106446A1 (de) * 2007-01-10 2009-10-07 University of Saskatchewan Stabilisierung cyclischer peptidstrukturen

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0614989A1 (de) 1993-02-17 1994-09-14 MorphoSys AG Verfahren für in vivo Selektion von Ligandenbindende Proteine
US5834247A (en) * 1992-12-09 1998-11-10 New England Biolabs, Inc. Modified proteins comprising controllable intervening protein sequences or their elements methods of producing same and methods for purification of a target protein comprised by a modified protein
EP1191105A1 (de) 2000-09-25 2002-03-27 Galapagos Genomics B.V. Gentransfervektoren mit einer Gewebsspezifität für T-Lymphozyten
WO2002038756A1 (fr) 2000-11-08 2002-05-16 Millegen Utilisation d'adn polymerase mutagene pour la creation de mutations aleatoires
WO2002046208A2 (en) * 2000-11-01 2002-06-13 Elusys Therapeutics, Inc. Method of producing biospecific molecules by protein trans-splicing
EP1229330A1 (de) 2000-07-26 2002-08-07 Japan Science and Technology Corporation Sonde zum analysieren von protein-protein-wechselwirkungen und entsprechendes verfahren dafür
WO2004029245A1 (en) * 2002-09-27 2004-04-08 Ctt Cancer Targeting Technologies Oy Method for designing peptides
WO2005040333A2 (en) 2003-10-24 2005-05-06 National Research Council Of Canada Ligand-pseudoreceptor system for generation of adenoviral vectors with altered tropism

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5834247A (en) * 1992-12-09 1998-11-10 New England Biolabs, Inc. Modified proteins comprising controllable intervening protein sequences or their elements methods of producing same and methods for purification of a target protein comprised by a modified protein
EP0614989A1 (de) 1993-02-17 1994-09-14 MorphoSys AG Verfahren für in vivo Selektion von Ligandenbindende Proteine
EP1229330A1 (de) 2000-07-26 2002-08-07 Japan Science and Technology Corporation Sonde zum analysieren von protein-protein-wechselwirkungen und entsprechendes verfahren dafür
EP1191105A1 (de) 2000-09-25 2002-03-27 Galapagos Genomics B.V. Gentransfervektoren mit einer Gewebsspezifität für T-Lymphozyten
WO2002046208A2 (en) * 2000-11-01 2002-06-13 Elusys Therapeutics, Inc. Method of producing biospecific molecules by protein trans-splicing
WO2002038756A1 (fr) 2000-11-08 2002-05-16 Millegen Utilisation d'adn polymerase mutagene pour la creation de mutations aleatoires
WO2004029245A1 (en) * 2002-09-27 2004-04-08 Ctt Cancer Targeting Technologies Oy Method for designing peptides
WO2005040333A2 (en) 2003-10-24 2005-05-06 National Research Council Of Canada Ligand-pseudoreceptor system for generation of adenoviral vectors with altered tropism

Non-Patent Citations (34)

* Cited by examiner, † Cited by third party
Title
"MOLECULAR CLONING, A LABORATORY MANUAL", COLD SPRING HARBOR LABORATORY PRESS
BARON R ET AL.: "RhoB prenylation is driven by the three carboxyl-terminal amino acids of the protein: Evidenced in vivo by an anti-farnesyl cysteine antibody", PROC NATL ACAD SCI U S A., vol. 97, 2000, pages 11626 - 11631, XP002411044, DOI: doi:10.1073/pnas.97.21.11626
BJORKLUND M ET AL: "Use of intein-directed biosynthesis to improve serum stability and bioactivity of a gelatinase inhibitory peptide", COMBINATORIAL CHEMISTRY AND HIGH THROUGHPUT SCREENING, HILVERSUM, NL, vol. 6, 2003, pages 29 - 35, XP002984195, ISSN: 1386-2073 *
CARTER P: "Improving the efficacy of the antibody-based cancer therapies", NATURE, vol. 1, 2001, pages 118 - 129, XP009033015, DOI: doi:10.1038/35101072
CHONG S; XU MQ: "Protein splicing of the Saccharomyces cerevisiae VMA Intein without the endonuclease motifs", J BIOL CHEM, vol. 272, 1997, pages 15587 - 15590
EVANS TC; BENNER J; XU MQ: "The cyclisation and polymerisation of bacterially expressed proteins using modified self-splicing inteins", J BIOL CHEM, vol. 274, 1999, pages 18359 - 18363
GRAM H ET AL.: "in vitro selection and affinity maturation of antibodies from a naive combinatorial immunoglobulin library", PROC. NATL. ACAD. SCI., vol. 89, 1992, pages 3576 - 3580, XP000384398, DOI: doi:10.1073/pnas.89.8.3576
HITARA: "Molecular structure of a gene, VMA1, encoding the catalytic subunit of H+- translocating adenosine triphosphatase from vacuolar membranes of Saccharomyces cerevisiae", J BIOL CHEM, vol. 265, 1990, pages 6726 - 6733
HUSE, WD: "Generation of a large combinatorial library of the immunoglobulin repertoire in phage lambda", SCIENCE, vol. 246, 1989, pages 1275 - 1281, XP000083689, DOI: doi:10.1126/science.2531466
JUNG S ET AL: "Selectively infective phage (SIP) technology: scope and limitations", JOURNAL OF IMMUNOLOGICAL METHODS, ELSEVIER SCIENCE PUBLISHERS B.V.,AMSTERDAM, NL, vol. 231, no. 1-2, 10 December 1999 (1999-12-10), pages 93 - 104, XP004187637, ISSN: 0022-1759 *
KANE: "Protein splicing converts the yeast TFP1 gene product to the 69 kD subunit of the vacuolar H+-adenosine triphosphate", SCIENCE, vol. 250, 1990, pages 651 - 657, XP001157367, DOI: doi:10.1126/science.2146742
KREBBER C ET AL., A METHOD FOR IN VITRO SELECTION OF LIGAND- BINDING PROTEINS, 1994
KREBBER C ET AL.: "Co-selection of cognate antibody-antigen pairs by selectivity-infective phages", FEBS LETTERS, vol. 377, 1995, pages 227 - 231, XP002033347, DOI: doi:10.1016/0014-5793(95)01348-2
KREBBER C ET AL.: "Selectively infective phage (SIP) : A mechanistic dissection of a novel in vivo selection for protein-ligand interactions", J. MOL. BIOL., vol. 268, 1997, pages 607 - 618, XP002151869, DOI: doi:10.1006/jmbi.1997.0981
LEW BM; MILLS KV; PAULUS H: "Protein splicing in vitro with semisynthetic two-component minimal intein", J BIOL CHEM, vol. 273, 1998, pages 15887 - 15890, XP002287186, DOI: doi:10.1074/jbc.273.26.15887
LING M; ROBINSON BH: "Approaches to mutagenesis: an overview", ANAL. BIOCHEM., vol. 254, 1997, pages 157 - 178, XP000955621, DOI: doi:10.1006/abio.1997.2428
MARKS JD ET AL.: "By passing immunization: building high affinity human antibodies by chain shuffling", BIOTECHNOLOGY, vol. 10, 1992, pages 779 - 783, XP002917376, DOI: doi:10.1038/nbt0792-779
MINSHULL J; STEMMER WPC: "Protein evolution by molecular breeding", CURR. OPIN. CHEM. BIOL., vol. 3, 1999, pages 284 - 290
MONDON P ET AL: "Technologies of recombinant human antibodies", BIOFUTUR 2005 FRANCE, no. 258, 2005, pages 34 - 40, XP009065012, ISSN: 0294-3506 *
MOOTZ HD ET AL.: "Conditional protein splicing: A new tool to control protein structure and function in vitro and in vivo", J AM CHEM SOC, vol. 125, 2003, pages 10561 - 10569
ORLANDI R ET AL., CLONING IMMUNOGLOBULIN VARIABLE DOMAINS FOR EXPRESSION BY THE POLYMERASE CHAIN REACTION, vol. 86, 1989, pages 3833 - 3837
OTOMO T ET AL.: "Improved segmental isotope labeling of proteins and application to a larger protein", J BIOMOL NMR., vol. 14, 1999, pages 105 - 14, XP055096683, DOI: doi:10.1023/A:1008308128050
OZAWA T: "A fluorescent indicator for detecting protein-protein interaction in vivo based on protein splicing", ANAL CHEM, vol. 72, 2000, pages 5151 - 5157
OZAWA T; UMEZAWA Y: "Detection of protein- protein interactions in vivo based on protein splicing", CURR OPIN CHEM BIOL, vol. 5, 2001, pages 578 - 583, XP002377401, DOI: doi:10.1016/S1367-5931(00)00244-1
PIETROKOVSKI S: "Conserved sequence features of inteins (protein introns) and their use in identifying new inteins and related proteins", PROTEIN SCI., vol. 3, 1994, pages 2340 - 2350
POUL MA ET AL.: "Design of cassette baculovirus vectors for the production of therapeutic antibodies in insect cells", IMMUNOTECHNOLOGY, vol. 1, 1995, pages 189 - 196, XP004052721, DOI: doi:10.1016/1380-2933(95)00019-4
PROST S ET AL.: "Characterization of a Novel Hematopoietic Marker Expressed from Early Embryonic Hematopoietic Stem Cells to Adult Mature Lineages", BLOOD CELLS MOL DIS., vol. 29, 2002, pages 236 - 48
SCANDALIS A; ENCELL LP; LOEB LA: "Creating novel enzymes by applied molecular evolution", CHEM. BIOL., vol. 4, 1997, pages 889 - 898, XP026916281, DOI: doi:10.1016/S1074-5521(97)90297-0
SCHOONBROODT, S: "Oligonucleotide- assisted cleavage and ligation: a novel directional DNA cloning technology to capture cDNAs. Application in the construction of a immune antibody phage display library", NUCLEIC ACIDS RES., vol. 33, 2005, pages E81, XP002581479, DOI: doi:10.1093/nar/gni080
SHI J; MUIR TW: "Development of a tandem protein trans-splicing system based on native and engineered split inteins", J AM CHEM SOC, vol. 127, 2005, pages 6198 - 6206, XP055052473, DOI: doi:10.1021/ja042287w
SMITH GP: "Filamentous fusion phage: novel expression vectors that display on the virion surface", SCIENCE, vol. 228, 1985, pages 1315, XP002464311, DOI: doi:10.1126/science.4001944
WU H; HU Z; LUI XQ: "Protein trans-splicing by a split intein encoded in a split DnaE gene of Synechocystis sp. PCC6803", PROC. NATL. ACAD. SCI., vol. 95, 1998, pages 9226 - 9231, XP002928540, DOI: doi:10.1073/pnas.95.16.9226
XU MQ; EVANS TC: "Recent advances in protein splicing: manipulating proteins in vitro and in vivo", CURR OPIN CHEM BIOL, vol. 16, 2005, pages 440 - 446
ZHANG A ET AL.: "Construction of a mini-intein fusion system to allow both direct monitoring of soluble protein expression and rapid purification of target proteins", GENE, vol. 275, 2001, pages 241 - 252, XP004307847, DOI: doi:10.1016/S0378-1119(01)00663-1

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2106446A1 (de) * 2007-01-10 2009-10-07 University of Saskatchewan Stabilisierung cyclischer peptidstrukturen
EP2106446A4 (de) * 2007-01-10 2010-06-16 Univ Saskatchewan Stabilisierung cyclischer peptidstrukturen

Also Published As

Publication number Publication date
US20100273669A1 (en) 2010-10-28
WO2007083226A2 (en) 2007-07-26
WO2007083226A8 (en) 2009-07-30
WO2007083226A3 (en) 2007-11-01
EP1974033A2 (de) 2008-10-01

Similar Documents

Publication Publication Date Title
CA2697282C (en) Pvii phage display
US7256038B2 (en) Polypeptide display libraries and methods of making and using thereof
Frei et al. Protein and antibody engineering by phage display
NO332949B1 (no) Fremgangsmate for fremstilling av et in vitro peptidekspresjonsbibliotek av DNA-bundne peptider
US20220090053A1 (en) Integrated system for library construction, affinity binder screening and expression thereof
JP2000505306A (ja) ２つまたはそれ以上の相互作用性（ポリ）ペプチドをコードする核酸配列の新規同定方法
CA2586028A1 (en) Ultra high throughput capture lift screening methods
US8969253B2 (en) Method for screening phage display libraries against each other
CA2840650C (en) Method of protein display
Crameri pJuFo: a phage surface display system for cloning genes based on protein-ligand interaction
US8946128B2 (en) Signal sequence-independent pIX phage display
JP4680506B2 (ja) アダプタ誘導型表示系
EP2364359A2 (de) Kompatible display-vektorsysteme
US20200140573A1 (en) Nucleic acid compositions, methods and kits for rapid pairing of affinity agents
EP1811031A1 (de) Methode zur Auswahl eines Peptids oder Polypeptids das an ein Zielmolekül bindet
EP3448873B1 (de) Manipulierte fha-domänen

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR MK YU

AKX Designation fees paid
REG Reference to a national code

Ref country code: DE

Ref legal event code: 8566

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20080128