EP1789549A1

EP1789549A1 - Method for treating synovial sarcoma using sirna for fzd10

Info

Publication number: EP1789549A1
Application number: EP05766513A
Authority: EP
Inventors: Yusuke The University of Tokyo NAKAMURA; Toyomasa The University of Tokyo KATAGIRI; Chikako The University of Tokyo FUKUKAWA
Original assignee: Oncotherapy Science Inc; University of Tokyo NUC
Current assignee: Oncotherapy Science Inc
Priority date: 2004-08-05
Filing date: 2005-07-14
Publication date: 2007-05-30
Also published as: WO2006013733A1; CN1993466A; JP2008509076A

Abstract

A method for inhibiting or reducing an expression of FZD10 gene is provided. Also, a method for treating and/or preventing FZD10-associated disease in a subject is provided. Further provided is a pharmaceutical composition comprising an double-stranded RNA molecule for FZD10 or an expression vector capable of expressing a double-stranded RNA molecule for FZD10.

Description

INSCRIPTION

Method for Treating Synovial Sarcoma Using siRNA for FZDlO

CROSS-REFERENCE TO RELATED APPLICATION This application claims priority on U. S. Provisional Application 60/598,834 filed on

August 5, 2004. The entire contents of the above application are hereby incorporated by reference in their entirety.

FIELD OF THE INVENTION The invention relates to a method for inhibiting or reducing an expression of FZDlO gene. Also, the present invention relates to a method for treating and/or preventing FZDIO-associated disease in a subject, particularly synovial sarcoma, colorectal cancer, gastric cancer, chronic myeloid leukemia, and acute myeloid leukemia. Furthermore, the present invention relates to a pharmaceutical composition comprising a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO.

BACKGROUND OF THE INVENTION

Frizzled homologue 10 (FZDlO) is a member of Frizzled family, which is a receptor of Wnt signaling. We previously reported that FZDlO was significantly overexpressed in synovial sarcoma (SS) (Nagayama S, et al. (2002). Cancer Res, 62:5859-5866; WO2004/020668).

Although expression of FZDlO has been demonstrated to be up-regulated in primary colorectal cancer (Terasaki, H. et al., Lit JMoI Med. 9: 107-12., 2002) and primary gastric cancer (Kirikoshi, H. et al, Int J Oncol. 19: 767-71., 2001) as well as SS, the cellular function and involvement of FZDlO in carcinogenesis of SS is still unknown.

SUMMARY OF THE INVENTION

As described hereinbelow, we demonstrated that knockdown of the expression of FZD 10 gene via RNA interference resulted in the growth suppression of SS cells, indicating that FZDlO plays an important role in the cell growth of SS. Also, we identified a nuclear-import protein, importin-β as an FZDIO-binding protein.

So, in one aspect, the present invention provides a method for inhibiting or reducing an expression of FZDlO gene in a cell or tissue in vitro, in vivo or ex vivo, comprising introducing into the cell or tissue a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, wherein the double-stranded RNA molecule for FZDlO comprises a nucleotide sequence targeted to the 10 to 100 continuous nucleotides, preferably 10 to 50 continuous nucleotides, more preferably 10 to 30 continuous nucleotides of SEQ ID NO: 1. Preferably, the double-stranded RNA molecule for FZDlO may comprise a short nucleotide sequence as a short-interfering RNA (siRNA). For example, the double-stranded RNA molecule comprises a nucleotide sequence targeted to nucleotides nos. 1481 to 1499 (SEQ ID No. S) or nucleotides nos. 1595 to 1613 (SEQ ID No.6) of SEQ ID No I . More specifically, the double-stranded RNA molecule for FZDlO can be expressed by the expression vector having the sequence of SEQ ID Nos. 7, 8, 9, or 10. In other aspect, the present invention provides a method for preventing or treating synovial sarcoma in a subject, comprising administering therapeutically effective amount of a double-stranded RNA for FZDlO or an expression vector capable of expressing a double-stranded RNA for FZDlO to the subject.

In addition, the present inventors found that the FZDlO protein can bind to importin-β. Therefore, a compound that inhibits an interaction or binding between FZDlO protein and importin-β may affect in development of synovial sarcoma.

In one aspect, the present invention provides a method for screening for a compound that inhibits an interaction and/or binding between FZDlO protein and importin-β protein, comprising: (a) contacting FZD 10 protein or a partial peptide thereof and importin-β protein or a partial peptide thereof in the presence of a test sample; and

(b) detecting an interaction or a formation of binding between FZDlO protein and importin-β protein.

Further in one aspect, the present invention provides a method for screening for a compound that can be used for treating or preventing synovial sarcoma, comprising:

(a) contacting FZDlO protein or a partial peptide thereof and importin-β protein or a partial peptide thereof in the presence of a test sample; and

(b) detecting an interaction or a formation of binding between FZDlO protein and importin-β protein. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.

BRIEF DESCRIPTION OF THE DRAWINGS

Figs. IA to 1C show growth-inhibitory effects of small-interfering RNAs (siRNAs) designed to reduce expression of FZDlO in SS cell line, SYO-I. (A) Semi-quantitative RT-PCR showing suppression of endogenous expression of FZDlO in SYO-I cell. β2MG was used as an internal control. Expression of FZD9 is not affected by these siRNAs. (B) MTT Assay of SYO-I cells transfected with psiU6BX3.0 vectors. A549 cell, in which undetectable FZDlO expression is observed, is an "off-target" control shows no growth-effect with these siRNAs. (C) Colony-formation assay demonstrating a decrease in the numbers of colonies by knock-down of FZDlO expression in SYO-I cell. A549 cell line is an "off-target" control. Figs. 2A to 2C show that FZDlO can form homo-oligomer. (A) Schematic diagram of FZDlO constructs. 7TM; seven-transmembrane domain. (B) Co-immunoprecipitation of FZDlO with itself. Lysates from un-transfected COS-7 cells or expressing HA-FLAG-FZD 10 and FZDIO-myc/His were immunoprecipitated with α-HA antibody. Immunoprecipitates were analyzed by western blotting with α-HA and α-myc antibodies. (C) Cytoplasmic region of FZDlO is not involved in oligomerization. Lysates from untransfected COS-7 cells or expressing HA-FLAG-FZD 10, HA-FLAG-FZDIO ΔC(l-578), HA-FLAG-FZD 10 AC(I -525) and FZDIO-myc/His were immunoprecipitated with α-HA F-7 antibody. Immunoprecipitates were analyzed by western blotting with α-HA F-7 and α-myc 9E10 antibodies. Figs. 3A to 3C show TAP system purification of FZDlO and FZDIO-binding proteins. (A) Schematic diagram of FZDlO-TAP and control TAP. (B) TAP-purification of FZDlO identifies a new complex. Lysates from SNU-C5 cells expressing either control TAP or FZDlO-TAP were subjected to TAP system purification. Silver stained gel shows the proteins identified. (C) The interaction between FZDlO and importin-β is also shown by co-immunoprecipitation. Lysates from untransfected COS-7 cells or expressing either importinβ-3XFLAG or FZDIO-myc/His, or both of them were immunoprecipitated with α-myc 9E10 antibody. Immunoprecipitates were analyzed by Western blotting with α-FLAG M2 and α-myc 9E10 antibodies.

DETAILED DESCRIPTION AND PREFERRED EMBODIMENTS OF THE PRESENT INVENTION Frizzled homologue 10 (FZDlO) is a member of Frizzled family, which is a receptor of Wnt signaling. As described hereinbelow, we demonstrated that knockdown of the expression of FZDlO gene via RNA interference resulted in the growth suppression of SS cells, indicating that FZDlO plays an important role in the cell growth of SS. RNA interference is known as a cellular event in which mRNA from an endogenous gene is degraded by introducing a double-stranded RNA (dsRNA) that has the sequence complementary to the sequence of the endogenous gene. As a result, the expression of a target gene can be inhibited or reduced. This event is reported in, for example, Elbashir, SM. et al, Nature 411, 494-498, 2001; Hannon, GJ., Nature 418, 244-251, 2002 (review); Shinagawa, T. et al, Genes Dev. 17: 1340-1345 2003; International Patent Publication Nos. WO99/32619 and WO99/61613.

We successfully designed dsRNA molecules which effectively inhibit or reduce the expression of FZDlO gene via RNA interference. So, in one embodiment, the present invention provides a method for inhibiting or reducing an expression of FZDlO gene in a cell or tissue in vitro, in vivo or ex vivo, comprising introducing into the cell or tissue a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, wherein the double-stranded RNA molecule for FZDlO comprises a nucleotide sequence targeted to the 10 to 100 continuous nucleotides, preferably 10 to 50 continuous nucleotides, more preferably 10 to 30 continuous nucleotides of SEQ ID NO: 1. Preferably, the double-stranded RNA molecule for FZDlO may comprise a short nucleotide sequence as a short-interfering RNA (siRNA). For example, the double-stranded RNA molecule comprises a nucleotide sequence targeted to nucleotides nos. 1481 to 1499 (SEQ ID No. 5) or nucleotides nos. 1595 to 1613 (SEQ ID No. 6) of SEQ DD No.l. More specifically, the double-stranded RNA molecule for FZDlO can be expressed by the expression vector having the sequence of SEQ ID Nos. 7, 8, 9, or 10 as indicated below. Also, the expression vector having the sequence of SEQ ID Nos. 7, 8, 9, or 10 may be useful in the method of the present invention.

Sequence Seq ID No.

5 ' - CACCAACGCTGGACTGCCTGATGTTCAAGAGACATCAGGCAGTCCAGCGTT -3 ' 7

5'- AAAAAACGCTGGACTGCCTGATGTCTCTTGAACATCAGGCAGTCCAGCGTT -3' 8

5'- CACCGACTCTGCAGTCCTGGCAGTTCAAGAGACTGCCAGGACTGCAGAGTC -3' 9

5'- AAAAGACTCTGCAGTCCTGGCAGTCTCTTGAACTGCCAGGACTGCAGAGTC -3' 10

The specific sequences to FZDlO are underlined.

Further, as described above, FZDlO is significantly overexpressed in synovial sarcoma (SS), and the growth of SS cells is suppressed by inhibiting or reducing the expression of FZDlO. Therefore, in an alternative embodiment, the present invention provides a method for preventing or treating synovial sarcoma in a subject, comprising administering therapeutically effective amount of a double-stranded RNA for FZDlO or an expression vector capable of expressing a double-stranded RNA for FZDlO to the subject. The method of the present invention can be performed ex vivo {e.g., by culturing the cell derived from a subject with the dsRNA or expression vector) or, alternatively, in vivo (e.g., by administering the dsRNA or expression vector to a subject).

The dsRN A can be delivered to a target location (such as a cancerous cell) by a variety of known administration methods. For example, the dsRNA can be delivered using an expression vector capable of expressing the dsRNA. Examples of an expression vector that can be used in the present invention include, but are not limited to, adenovirus, herpes virus, vaccinia virus, and RNA viruses such as retrovirus.

Other examples of the gene delivery system that can be used for administering the dsRNA to the target tissue or cell include a colloidal dispersion system, a liposome-induced system, and an artificial virus envelope. Specifically, a macromolecular complex, a nano-capsule, a microsphere, beads, oil-in-water type emulsion, micelle, mixed micelle, and liposome, for example, may be used as a delivery system.

The dsRNA or expression vector may be directly administered by intravenous injection (including continuous infusion), intramuscular injection, intraperitoneal injection, and subcutaneous injection, or via other route of administration.

Alternatively, the dsRNA or expression vector may be introduced into a cell or tissue obtained from a subject and then the cell may be administered to the subject (ex vivo method). The introduction of the dsRNA or expression vector into the cell or tissue may be carried out by a conventional gene-introducing method such as, for example, a calcium phosphate method, a DEAE dextran method, electroporation, or lipofection. The administration of the cell or tissue in which the dsRNA is expressed may also be carried out in the same manner as in the case of the direct administering of the dsRNA or expression vector.

The dosage of dsRNA or expression vector administered may vary depending on age, sex, symptoms, administration routes, administration frequency, and dosage form. However, a conventional method in the relevant art may be appropriately selected and used.

In the other embodiment, the present invention provides a composition comprising a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, and a pharmaceutically acceptable carrier. Various types of compositions may be formulated in a conventional manner by appropriately selecting pharmaceutically acceptable carriers that are typically used for the formulation of preparations, such as excipient, disintegrant, lubricant, surfactant, dispersing agent, buffering agent, preservative, solubilizer, antiseptic agent, stabilizing agent, and isotonizing agent.

Further, in order to understand the mechanism of tumorigenesis of SS via overexpression of FZDlO, we applied to identify the novel FZDIO-binding proteins by IP-MS method. Strikingly, we isolated nuclear-import protein, importin-β as an FZDIO-binding protein. We demonstrated that FZDlO protein localized to nucleus and cytoplasmic apparatus by immunohistochemistry (unpublished data). Therefore, FZDlO protein might function in nuclei except for the function as membranous protein.

Therefore, a compound that inhibits an interaction or binding between FZDlO protein and importin-β may affect in development of synovial sarcoma. In one embodiment, the present invention provides a method for screening for a compound that inhibits an interaction and/or binding between FZDlO protein and importin-β protein, comprising:

(a) contacting FZDlO protein or a partial peptide thereof and importin-β protein or a partial peptide thereof in the presence of a test sample; and (b) detecting an interaction or a formation of binding between FZDlO protein and importin-β protein.

The amino acid sequence of FZDlO protein is shown in SEQ ID No.2 (GenBank Accession No.BAA84093). The amino acid sequence of importin-β protein is shown in SEQ ID No.4 (GenBank Accession No.NM_002265; PDB ID No. IQGK-A). A compound screened by the above method can be used for treating or preventing synovial sarcoma.

In the other embodiment, the present invention provides a method for screening for a compound that can be used for treating or preventing synovial sarcoma, comprising:

Test sample may include, but not limited to, proteins, peptides, non-peptide compound, synthetic compound, fermented product, and natural extract including cellular extract. Also, test sample may be a chemical library or peptide library. Detection of an interaction or a formation of binding between FZDlO and importin-β can be carried out according to the conventional methods known in the art.

In a further embodiment, the present invention provides a composition for treating or preventing synovial sarcoma, wherein the composition comprises a pharmaceutically effective amount of the compound obtained by any of screening method described above as an active ingredient, and a pharmaceutically acceptable carrier.

In another aspect, the invention encompasses pharmaceutical or therapeutic compositions containing one or more therapeutic compounds described herein. Such therapeutic compound includes, but not limited to, a double-stranded RNA as described herein. Pharmaceutical formulations may include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral (including intramuscular, sub-cutaneous and intravenous) administration, or for administration by inhalation or insufflation. The formulations may, where appropriate, be conveniently presented in discrete dosage units and may be prepared by any of the methods well known in the art of pharmacy. All such pharmacy methods include the steps of bringing into association the active compound with liquid carriers or finely divided solid carriers or both as needed and then, if necessary, shaping the product into the desired formulation.

Pharmaceutical formulations suitable for oral administration may conveniently be presented as discrete units, such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; or as a solution, a suspension or as an emulsion. The active ingredient may also be presented as a bolus electuary or paste, and be in a pure form, i. e. , without a carrier. Tablets and capsules for oral administration may contain conventional excipients such as binding agents, fillers, lubricants, disintegrant or wetting agents. A tablet may be made by compression or molding, optionally with one or more formulational ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art. Oral fluid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives. The tablets may optionally be formulated so as to provide slow or controlled release of the active ingredient therein.

Formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline water-for-injection, immediately prior to use. Alternatively, the formulations may be presented for continuous infusion. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.

Formulations for rectal administration may be presented as a suppository with the usual carriers such as cocoa butter or polyethylene glycol. Formulations for topical administration in the mouth, for example buccally or sublingually, include lozenges, comprising the active ingredient in a flavored base such as sucrose and acacia or tragacanth, and pastilles comprising the active ingredient in a base such as gelatin and glycerin or sucrose and acacia. For intra-nasal administration the compounds of the invention may be used as a liquid spray or dispersible powder or in the form of drops. Drops may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents or suspending agents. Liquid sprays are conveniently delivered from pressurized packs.

For administration by inhalation, the compounds are conveniently delivered from an insufflator, nebulizer, pressurized packs or other convenient means of delivering an aerosol spray. Pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount.

Alternatively, for administration by inhalation or insufflation, the compounds may take the form of a dry powder composition, for example, a powder mix of the compound and a suitable powder base such as lactose or starch. The powder composition may be presented in unit dosage form, in, for example, capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflators.

When desired, the above-described formulations, adapted to give sustained release of the active ingredient, may be employed. The pharmaceutical compositions may also contain other active ingredients such as antimicrobial agents, immunosuppressants or preservatives.

It should be understood that in addition to the ingredients particularly mentioned above, the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example, those suitable for oral administration may include flavoring agents.

Preferred unit dosage formulations are those containing an effective dose, as recited below, or an appropriate fraction thereof, of the active ingredient.

For each of the aforementioned conditions, the compositions may be administered orally or via injection at a dose of from about 0.1 to about 250 mg/kg per day. The dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day. Tablets or other unit dosage forms of presentation provided in discrete units may conveniently contain an amount which is effective at such dosage or as a multiple of the same, for instance, units containing about 5 mg to about 500 mg, usually from about 100 mg to about 500 mg. The pharmaceutical composition preferably is administered orally or by injection

(intravenous or subcutaneous), and the precise amount administered to a subject will be the responsibility of the attendant physician. However, the dose employed will depend upon a number of factors, including the age and sex of the subject, the precise disorder being treated, and its severity. Also the route of administration may vary depending upon the condition and its severity.

EXAMPLES:

The present invention will be further illustrated by the following non-limiting examples: Example 1

Construction of siRNA expression vector

To investigate the cellular function of FZDlO, we constructed plasmids expressing siRNAs specific to FZDlO under the control of the U6 promoter (psiU6BX-FZD10). Two siRNAs (psiU6BX-FZD10B and C) were constructed according to FZDlO ORF sequence.

(1) Construction of siRNA expression vector, psiU6X3.0

Since snRNA U6 gene was reported to be transcribed by RNA polymerase III, which produces the short transcripts with uridines at the 3' end, we amplified the genomic fragment of snRNA U6 gene containing its promoter region by PCR using a set of primers,

5'-GGGGATCAGCGTTTGAGTAA-S' (SEQ ID No.11), and 5'-TAGGCCC CACCTCCTTCTAT-3' (SEQ ID No.12) and human placental DNA as a template. The product was purified and cloned into pCR plasmid vector using a TA cloning kit according to the supplier's protocol (Invitrogen). The BamΗl, Xhol digested fragment containing the snRNA U6 gene was purified and cloned into nucleotide 1257 to 56 fragment of pcDNA3.1(+) plasmid, which was amplified by PCR with a set of primer, 5'-TGCGGATCCAGAGCAGATTGTACTGAGAGT-S' (SEQ ID NO.13) and 5'- CTCTATCTC GAGTGAGGCGGAAAGAACCA-S ' (SEQ ID No.14). The ligated DNA was used as a template for PCR with primers, 5 ' -TTTAAGCTTGAAGACTATTTTTACATCAGGTTGTTT TTCT-3' (SEQ ID No.15) and 5 ' -TTTAAGCTTGAAGAC ACGGTGTTTCGTCCTTTCCAC A-3 ' (SEQ ID No.16) (underlines indicate HindHl site). The product was digested with Hinάill, which was subsequently self-ligated to produce psiU6BX3.0 vector plasmid.

(2) Plasmids construction To construct the myc/His-tagged full-length FZDlO expression vectors, we firstly

PCR-amplified the entire coding sequence of the FZDlO (SEQ ID No.l) using a human placenta cDNA library as template with following primers:

5'-CCGGAATTCCAGACCGTGCATCATGCAGCGCCCGGGCCCCCGCCT-S' (SEQ

ID No.17) (underline indicates EcoRl site) and 5'-AAAAAGCTTCACGCAGGTGGGCGACTG-S' (SEQ ID No.18) (underline indicates

Hindm site).

After digestion of EcoRl and Hindlll, PCR product was cloned into pcDNA3.1-myc/His vector (Invitrogen), and then the inserted FZDlO cDNA with myc/His-tag was further subcloned into pCAGGS/neo expression vector. Next, an internal-tagged HA-FLAG-FZDl OFL (residue 1-581; SEQ ID No.2), expression plasmid constructs were generated from the cloned full-length FZDlO cDNA by PCR amplification with following primer combinations:

FZDlO-ATG, 5 ' -AAGTCGAC ACC ATGC AGCGCCCGGGCCCC-3 ' (SEQ ID No.19)

(underline indicates Sail site) and FZD10-nt651, 5'-TCTCGAGGACATCCACGCCGGGCGTG-S' (SEQ ID NO.20)

(underline indicates Xltόl site) for N-terminal portion of FZDlO (1-217 amino-acids of SEQ ID No.2);

FZD10-nt652, 5'-AAGTCGACTACTGGAGCCGCGAGGACAAG-S' (SEQ ID NO.21)

(underline indicates Sail site) and FZDlO-TGA, 5'-AACTCGAGTCACACGCAGGTGGGCGACT-S' (SEQ ID NO.22)

(underline indicates Xliόl site) for C-terminal portion of FZDlO (218-581 amino-acids of SEQ ID No.2).

The N-terminal portion (residues 1-217) of FZD10ΔC1 (residues 1-578) and

FZD10ΔC2 (residues 1-525) expression plasmid constructs were generated and C-terminal portion (residues 218-each end) of each construct was generated by the forward primer (FZD10-nt652) and the following reverse primers, respectively;

FZD10ΔCl(l-578), 5'-AACTCGAGTCAGGGCGACTGGGCAGGGATCT-S' (SEQ ID

No.23) (underline indicates Xhol site) and

FZD10ΔC2(l-525), 5'-AACTCGAGTCAGGAGGTCCAAATCCACATCCC-S' (SEQ ID

No.24) (the underline indicates Xhol site).

Plasmids expressing siRNAs specific to FZDlO were prepared by cloning the double- stranded oligonucleotides into psiU6BX3.0 vector (Table 1). The target sequences for siRNA in each plasmid are shown in Table 2. The complementary oligonucleotides were each phosphorylated by incubation with T4-polynucleotide kinase at 37 °C for 30 min, followed by boiling and cooling down to room temperature slowly to anneal the two oligonucleotides. Each product was ligated into psiU6BX3.0 to construct an FZDlO-siRNA expression vector.

Table 1: Sequences of specific double- stranded oligonucleotides inserted into siRNA expression vector psi-U6BX-FZD20-B

5'- CACCAACGCTGGACTGCCTGATGTTCAAGAGACATCAGGCAGTCCAGCGTT -3' 7

5'- AAAAAACGCTGGACTGCCTGATGTCTCTTGAACATCAGGCAGTCCAGCGTT -3' 8 psi-U6BX-FZD10-C

5'- CACCGACTCTGCAGTCCTGGCAGTTCAAGAGACTGCCAGGACTGCAGAGTC -3' 9

5'- AAAAGACTCTGCAGTCCTGGCAGTCTCTTGAACTGCCAGGACTGCAGAGTC -3' 10 psi-\J6BX-EGFP

5 ' - CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTC -3 ' 25

5'- AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCTGCTTC -3 ' 26 psi-U6BX-£wc

5'- CACCGTGCGCTGCTGGTGCCAACTTCAAGAGAGTTGGCACCAGCAGCGCAC -3' 27

5'- AAAAGTGCGCTGCTGGTGCCAACTCTCTTGAAGTTGGCACCAGCAGCGCAC -3' 28

The specific sequences to FZDlO are underlined. Table 2: Target sequences for siRNA Seq ID No. psi-U6BX-FZDI0-B

5 ' - AACGCTGGACTGCCTGATG -3 ' 5 psi~U6BX-FZD10-C

5 ' - GACTCTGCAGTCCTGGCAG -3 ' 6 psi~\J6BX-EGFP

5'- GAAGCAGCACGACTTCTTC -S' 29 psi-TJ6BX-Z,Hc

5'- GTGCGCTGCTGGTGCCAAC -3' 30

Example 2

Effect of FZDlO-siRNAs on growth of synovial sarcoma cell lines

We transfected the plasmids prepared in Example 1 into synovial sarcoma cell line, SYO-I, and examined the expression level of FZDlO by semi-quantitative RT-PCR. Also, we conducted cell growth assay to confirm the cell growth inhibition. (1) Semi-quantitative RT-PCR SYO-I cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics. Cell line Nucleofector™ kit V (Amaxa Biosystems, Cologne, Germany) was used for transfection of SYO-I cells. The transfected cells were assayed 48-72h after transfection.

Total RNA was extracted from transfected cell using TRIZOL reagent (Invitrogen) according to manufacturer's protocol. Extracted RNA was treated with DNase I (Roche

Diagnostics, Mannheim, Germany) and reverse-transcribed to single-stranded cDNAs using oligo(dT)).2-i8 primer with Superscript II reverse transcriptase (Invitrogen). PCR amplification was performed using the cDNAs as templates and primers as follows:

5'-TATCGGGCTCTTCTCTGTGC-S ' (SEQ ID NO.31) and 5'-GACTGGGCAGGGATCTCATA-S ' (SEQ ID No.32) for FZDlO,

5'-CTGCACGCTGGTCTTCCTCT-S ' (SEQ ID NO.33) and 5'-CCGATCTTGACCATGAGCTTC-S ' (SEQ ID NO.34) for FZD9, 5'-TTAGCTGTGCTCGCGCTACT-S ' (SEQ ID NO.35) and 5'-TCACATGGTTCACACGGCAG-S ' (SEQ ID NO.36) for β2MG.

As a result, the two siRNA constructs, FZDlO (si-B and -C)-specific siRNAs significantly suppressed expression, compared with control (psiU6BX-LUC or -EGFP), while expression of FZD9, which has the highest similarity to FZDlO among Frizzled family genes, was not affected by these siRNAs (Fig. IA).

(2) Cell growth assays To confirm the cell growth inhibition with FZDlO-specific siRNAs, we performed colony-formation and MTT assays, respectively. SYO-I cells were transfected as described in (1) above. Lung cancer cell line, A549 cells were maintained in RPMI1640 medium supplemented with 10% fetal bovine serum and antibiotics. FuGENEό (Roche) was used for transfection of A549 cells. SYO-I and A549 cells transfected with psiU6-FZD10, psiU6-luc or psiU6-EGFP plasmids were maintained in media containing appropriate concentrations of Geneticin for 13 days. The cells were fixed with 4% paraformaldehyde and stained with Giemsa solution. Additionally, cell viability was measured by MTT assay using Cell-counting kit8 (Dojindo) as described (Shimokawa T et al. (2003). Cancer Res, 63, 6116-20). As a result, introduction of FZDlO siRNA constructs suppressed growth of SYO-I, consisting with the result of above reduced expression of this gene (Figs. IB and 1C). Furthermore, the growth of A549 cell which shows undetectable expression of FZDlO was not affected, indicating that no "off-target" effect occurred by these siRNAs. Each result was verified by three independent experiments. Thus, our findings suggest that FZDlO has a significant function in the cell growth of the synovial sarcoma.

Example 3 Formation of FZDlO homodimer

Since FZDl, a member of frizzled family, was reported to form oligomers (Kaykas

A, et al. (2004). Nat. Cell Biol. 6:52-8), we examined whether FZDlO is also able to oligomerize with immunoprecipitation. Two FZDlO constructs, HA-FLAG-FZD 10 (described below) and FZDIO-myc-His (prepared in Example 1; Fig. 2A) were co-transfected into COS-7 cell and were performed co-immunoprecipitation using α-HA antibody.

For the construction of HA-FLAG-FZD 10, a following set of oligonucleotides, 5 ' -ACGTGTCGACTACCCATACGACGTCCCAGACTACGCTATGGACTACAAGG ACGACGATGACAAGCTCGAGATGC-3' (SEQ ID No.37) (underline indicates Sail site) and 5'-GCATCTCGAGCTTGTCATCGTCGTCCTTGTAGTCCATAGCGTAGTC TGGGACGTCGTATGGGTAGTCGACACGT-S' (SEQ ID NO.38) (underline indicates Xfjol site) was annealed and digested with SaK and Xhol to generate the HA-FLAG tag. Firstly, residues 1-217 and 218-stoρ codon (or C-terminal deletion) fragments were individually PCR-amplified. PCR products were digested with Sail and Xtiol, and ligated sequentially into pCAGGS/neo expression vector. The HA-FLAG tag fragment digested with SaIL and Xhol was ligated between nt651 and nt652 in frame. COS-7 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics. FuGENEό (Roche) was used for transfection of COS-7 cells. The transfected cells were used 48-72h after transfection.

Transfected COS-7 cells were washed twice with cold PBS(-) and lysed in IPP buffer. The cell lysate was incubated with anti-HA F7 antibody (Santa Cruz) and protein G-sepharose (Sigma). Bound proteins were washed five times with IP buffer and eluted with SDS-sample buffer. Eluted proteins were analyzed by 10% SDS-PAGE. Proteins were electrophorestically transferred to nitrocellulose membranes (Amersham Biosciences). The membranes were incubated with anti-myc 9E10 monoclonal antibody, anti-FLAG M2 antibody or anti-HA F7 antibody followed by horseradish peroxidase-conjugated secondary antibody (Amersham Biosciences). Bound secondary antibodies were visualized by ECL™ Western blotting detection reagents (Amersham Biosciences).

As shown in Fig. 2B, upper panel, immunoprecipitated HA-FLAG-FZD 10 seemed to appear as multiple bands that were once or twice the predicted molecular mass and the highest band was stacked at the top of the running gel for SDS-PAGE, suggesting that FZDlO are able to form oligomers. Furthermore, using a α-HA antibody to pull down HA-FLAG-FZD 10 resulted in co-immunoprecipitation of FZDlO-myc-His (Fig. 2B, lower panel), indicating that FZDlO can form homo-oligomer, and are not co-immunoprecipitated when Iy sates from the cell transfected HA-FLAG-FZD 10 or FZDIO-myc are mixed before immunoprecipitation, indicating that oligomerization occurs in living cell (data not shown). FZDlO contains two motifs, KTxxxW (Umbhauer M, et al. (2000). EMBO J. 19:4944-4954), which is located at two amino acids after the seventh transmembrane domain, and TCV motifs at the predicted C-terminal which are thought to be important for protein-protein interaction. To examine the involvement of these motifs in oligomerization, we designed two C-terminal deleted constructs (Fig. 2A) whether they can form oligomers. As shown in Fig. 2C, pull down with α-HA antibody resulted in co-immunoprecipitation of FZD10-myc-His, suggesting that C-terminus motifs of FZDlO might be not involved in oligomerization.

Example 4 Interaction with importin-β To further investigate the functions of FZDlO protein via interacting proteins, we performed TAP-system purification methods.

TAP (Tandem affinity purification)-system purification was performed according to previous report (Rigaut G, et al. (1999). Nat Biotechnol, 17:1030-1032). Briefly, pCAGGS/neo-FZDIO-TAP or pCAGGS/neo-TAP as control were transfected to SNU-C5 cells.

For construct of TAP expression vector, cDNA for the TAP tag sequence, consisting of immunoglobulin G-binding domain and calmodulin-binding peptide separated with the cleavage site of Tabacco each virus protease (TEV) with SaH at 3' end was PCR-amplified according to standard protocols (Fig. 3A). First, TAP tag sequence mentioned above was cloned into pcDNA-3.1(+)-myc-His expression vector. Next, pcDNA-3.1(+)-myc-His-TAP was digested with Xhol and Sail and resulted myc-His-TAP fragment was inserted into pCAGGS/neo vector. The FZDlO ORF cDNA was subcloned into pCAGGS-myc-His-TAP/neo expression vector. Colon cancer cell line, SNU-C5 was maintained in RPMI1640 medium supplemented with 10% fetal bovine serum and antibiotics. FuGENEό (Roche) was used for transfection of SNU-C5 cells.

72 hours after transfection, cells were lysed with IPP buffer (1OmM Tris-HCl

[pH8.0], 0.1% NP-40, 15OmM NaCl, ImM NaF, containing Protease Inhibitor Cocktail Setπi (Calbiochem)). The insoluble fraction was removed and supernatant was incubated with IgG-sepharose (Amersham Biosciences). The bound protein was incubated with TEV protease (Invitrogen) at 4 ⁰C for overnight and eluted protein was further incubated with

Calmodulin Affinity resin (Stratagene) with ImM CaCl₂. Finally, bound protein was eluted with ImM EGTA and subjected to 12% SDS-PAGE. Proteins were visualized by silver staining using Silver Stain "Daiichi" (Daiichi Pure Chemicals). The protein bands that were differential with the control TAP were excised from the gel and MALDI-TOF MS analysis was custom-operated by Aproscience Co. (Tokushima, Japan).

When we transfected FZDlO-TAP and TAP vector as control were overexpressed in

SNU-C5 cells (Fig. 3B), we identified importin-β as a candidate interacting protein to FZDlO. We further confirmed that FZDlO could co-immunoprecipitate with importin-β in

COS-7 cells (Fig.3C).

While the invention has been described in detail with reference to certain preferred embodiments, it is appreciated that many variations and modifications may be made by those skilled in the art within the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A method for inhibiting or reducing an expression of FZDlO gene in a cell or tissue in vitro, in vivo or ex vivo, comprising introducing into the cell or tissue a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, wherein the double-stranded RNA molecule for FZDlO comprises a nucleotide sequence targeted to at least 10 continuous nucleotides of SEQ ID NO: 1.

2. The method of claim 1, wherein the double-stranded RNA molecule for

FZDlO is a short-interfering RNA (siRNA).

3. The method of claim 1 or 2, wherein the double- stranded RNA molecule comprises a nucleotide sequence targeted to nucleotides nos. 1481 to 1499 (SEQ ID No. 5) or nucleotides nos. 1595 to 1613 (SEQ ID No.6) of SEQ ID No.l.

4. The method of claim 1 or 2, wherein the double- stranded RNA molecule for FZD 10 is expressed by the expression vector having the sequence of SEQ ID Nos. 7, 8, 9, or 10.

5. A method for preventing or treating a disease that is associated with Frizzled homologue 10 (FZDlO) in a subject, comprising administering therapeutically effective amount of a double-stranded RNA for FZDlO or an expression vector capable of expressing a double-stranded RNA for FZDlO to the subject.

6. The method of claim 5, wherein the double-stranded RNA molecule for FZDlO is a short-interfering RNA (siRNA).

7. The method of claim 5 or 6, wherein the double-stranded RNA molecule comprises a nucleotide sequence targeted to nucleotides nos. 1481 to 1499 (SEQ ID No. 5) or nucleotides nos. 1595 to 1613 (SEQ ID No.6) of SEQ ID No.l.

8. The method of claim 5 or 6, wherein the expression vector comprises the sequence of SEQ ID Nos. 7, 8, 9, or 10.

9. The method of any one of claims 5 to 8, wherein the disease which is associated with FZD 10 is selected from the group consisting of synovial sarcoma, colorectal cancer, gastric cancer, chronic myeloid leukemia, and acute myeloid leukemia.

10. A pharmaceutical composition comprising a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, and a pharmaceutically acceptable carrier.