EP1789549A1 - Method for treating synovial sarcoma using sirna for fzd10 - Google Patents

Method for treating synovial sarcoma using sirna for fzd10

Info

Publication number
EP1789549A1
EP1789549A1 EP05766513A EP05766513A EP1789549A1 EP 1789549 A1 EP1789549 A1 EP 1789549A1 EP 05766513 A EP05766513 A EP 05766513A EP 05766513 A EP05766513 A EP 05766513A EP 1789549 A1 EP1789549 A1 EP 1789549A1
Authority
EP
European Patent Office
Prior art keywords
fzdlo
double
seq
stranded rna
rna molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP05766513A
Other languages
German (de)
French (fr)
Inventor
Yusuke The University of Tokyo NAKAMURA
Toyomasa The University of Tokyo KATAGIRI
Chikako The University of Tokyo FUKUKAWA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oncotherapy Science Inc
Original Assignee
Oncotherapy Science Inc
University of Tokyo NUC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncotherapy Science Inc, University of Tokyo NUC filed Critical Oncotherapy Science Inc
Publication of EP1789549A1 publication Critical patent/EP1789549A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed

Definitions

  • the invention relates to a method for inhibiting or reducing an expression of FZDlO gene. Also, the present invention relates to a method for treating and/or preventing FZDIO-associated disease in a subject, particularly synovial sarcoma, colorectal cancer, gastric cancer, chronic myeloid leukemia, and acute myeloid leukemia. Furthermore, the present invention relates to a pharmaceutical composition comprising a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO.
  • Frizzled homologue 10 is a member of Frizzled family, which is a receptor of Wnt signaling. We previously reported that FZDlO was significantly overexpressed in synovial sarcoma (SS) (Nagayama S, et al. (2002). Cancer Res, 62:5859-5866; WO2004/020668).
  • the present invention provides a method for inhibiting or reducing an expression of FZDlO gene in a cell or tissue in vitro, in vivo or ex vivo, comprising introducing into the cell or tissue a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, wherein the double-stranded RNA molecule for FZDlO comprises a nucleotide sequence targeted to the 10 to 100 continuous nucleotides, preferably 10 to 50 continuous nucleotides, more preferably 10 to 30 continuous nucleotides of SEQ ID NO: 1.
  • the double-stranded RNA molecule for FZDlO may comprise a short nucleotide sequence as a short-interfering RNA (siRNA).
  • siRNA short-interfering RNA
  • the double-stranded RNA molecule comprises a nucleotide sequence targeted to nucleotides nos. 1481 to 1499 (SEQ ID No. S) or nucleotides nos. 1595 to 1613 (SEQ ID No.6) of SEQ ID No I .
  • the double-stranded RNA molecule for FZDlO can be expressed by the expression vector having the sequence of SEQ ID Nos. 7, 8, 9, or 10.
  • the present invention provides a method for preventing or treating synovial sarcoma in a subject, comprising administering therapeutically effective amount of a double-stranded RNA for FZDlO or an expression vector capable of expressing a double-stranded RNA for FZDlO to the subject.
  • the present inventors found that the FZDlO protein can bind to importin- ⁇ . Therefore, a compound that inhibits an interaction or binding between FZDlO protein and importin- ⁇ may affect in development of synovial sarcoma.
  • the present invention provides a method for screening for a compound that inhibits an interaction and/or binding between FZDlO protein and importin- ⁇ protein, comprising: (a) contacting FZD 10 protein or a partial peptide thereof and importin- ⁇ protein or a partial peptide thereof in the presence of a test sample; and
  • the present invention provides a method for screening for a compound that can be used for treating or preventing synovial sarcoma, comprising:
  • Figs. IA to 1C show growth-inhibitory effects of small-interfering RNAs (siRNAs) designed to reduce expression of FZDlO in SS cell line, SYO-I.
  • siRNAs small-interfering RNAs
  • A Semi-quantitative RT-PCR showing suppression of endogenous expression of FZDlO in SYO-I cell. ⁇ 2MG was used as an internal control. Expression of FZD9 is not affected by these siRNAs.
  • B MTT Assay of SYO-I cells transfected with psiU6BX3.0 vectors. A549 cell, in which undetectable FZDlO expression is observed, is an "off-target" control shows no growth-effect with these siRNAs.
  • FIG. 2A Colony-formation assay demonstrating a decrease in the numbers of colonies by knock-down of FZDlO expression in SYO-I cell.
  • A549 cell line is an "off-target" control.
  • Figs. 2A to 2C show that FZDlO can form homo-oligomer.
  • FIG. 2A to 2C show that FZDlO can form homo-oligomer.
  • FIG. 2A to 2C show that FZDlO can form homo-oligomer.
  • FIG. 2A to 2C show that FZDlO can form homo-oligomer.
  • FIG. 2A to 2C show that FZDlO can form homo-oligomer.
  • FIG. 2A to 2C show that FZDlO can form homo-oligomer.
  • Immunoprecipitates were analyzed by western blotting with ⁇ -HA and ⁇ -myc antibodies.
  • C Cytoplasmic region of FZDlO is not involved in oligomerization. Lysates from untransfected COS-7 cells or expressing HA-FLAG-FZD 10, HA-FLAG-FZDIO ⁇ C(l-578), HA-FLAG-FZD 10 AC(I -525) and FZDIO-myc/His were immunoprecipitated with ⁇ -HA F-7 antibody. Immunoprecipitates were analyzed by western blotting with ⁇ -HA F-7 and ⁇ -myc 9E10 antibodies. Figs.
  • FIG. 3A to 3C show TAP system purification of FZDlO and FZDIO-binding proteins.
  • A Schematic diagram of FZDlO-TAP and control TAP.
  • B TAP-purification of FZDlO identifies a new complex. Lysates from SNU-C5 cells expressing either control TAP or FZDlO-TAP were subjected to TAP system purification. Silver stained gel shows the proteins identified.
  • C The interaction between FZDlO and importin- ⁇ is also shown by co-immunoprecipitation.
  • Lysates from untransfected COS-7 cells or expressing either importin ⁇ -3XFLAG or FZDIO-myc/His, or both of them were immunoprecipitated with ⁇ -myc 9E10 antibody. Immunoprecipitates were analyzed by Western blotting with ⁇ -FLAG M2 and ⁇ -myc 9E10 antibodies.
  • Frizzled homologue 10 is a member of Frizzled family, which is a receptor of Wnt signaling.
  • RNA interference is known as a cellular event in which mRNA from an endogenous gene is degraded by introducing a double-stranded RNA (dsRNA) that has the sequence complementary to the sequence of the endogenous gene.
  • the present invention provides a method for inhibiting or reducing an expression of FZDlO gene in a cell or tissue in vitro, in vivo or ex vivo, comprising introducing into the cell or tissue a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, wherein the double-stranded RNA molecule for FZDlO comprises a nucleotide sequence targeted to the 10 to 100 continuous nucleotides, preferably 10 to 50 continuous nucleotides, more preferably 10 to 30 continuous nucleotides of SEQ ID NO: 1.
  • the double-stranded RNA molecule for FZDlO may comprise a short nucleotide sequence as a short-interfering RNA (siRNA).
  • the double-stranded RNA molecule comprises a nucleotide sequence targeted to nucleotides nos. 1481 to 1499 (SEQ ID No. 5) or nucleotides nos. 1595 to 1613 (SEQ ID No. 6) of SEQ DD No.l.
  • the double-stranded RNA molecule for FZDlO can be expressed by the expression vector having the sequence of SEQ ID Nos. 7, 8, 9, or 10 as indicated below.
  • the expression vector having the sequence of SEQ ID Nos. 7, 8, 9, or 10 may be useful in the method of the present invention.
  • the present invention provides a method for preventing or treating synovial sarcoma in a subject, comprising administering therapeutically effective amount of a double-stranded RNA for FZDlO or an expression vector capable of expressing a double-stranded RNA for FZDlO to the subject.
  • the method of the present invention can be performed ex vivo ⁇ e.g., by culturing the cell derived from a subject with the dsRNA or expression vector) or, alternatively, in vivo (e.g., by administering the dsRNA or expression vector to a subject).
  • the dsRN A can be delivered to a target location (such as a cancerous cell) by a variety of known administration methods.
  • the dsRNA can be delivered using an expression vector capable of expressing the dsRNA.
  • an expression vector that can be used in the present invention include, but are not limited to, adenovirus, herpes virus, vaccinia virus, and RNA viruses such as retrovirus.
  • a macromolecular complex, a nano-capsule, a microsphere, beads, oil-in-water type emulsion, micelle, mixed micelle, and liposome may be used as a delivery system.
  • the dsRNA or expression vector may be directly administered by intravenous injection (including continuous infusion), intramuscular injection, intraperitoneal injection, and subcutaneous injection, or via other route of administration.
  • the dsRNA or expression vector may be introduced into a cell or tissue obtained from a subject and then the cell may be administered to the subject (ex vivo method).
  • the introduction of the dsRNA or expression vector into the cell or tissue may be carried out by a conventional gene-introducing method such as, for example, a calcium phosphate method, a DEAE dextran method, electroporation, or lipofection.
  • the administration of the cell or tissue in which the dsRNA is expressed may also be carried out in the same manner as in the case of the direct administering of the dsRNA or expression vector.
  • the dosage of dsRNA or expression vector administered may vary depending on age, sex, symptoms, administration routes, administration frequency, and dosage form. However, a conventional method in the relevant art may be appropriately selected and used.
  • the present invention provides a composition comprising a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, and a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier such as excipient, disintegrant, lubricant, surfactant, dispersing agent, buffering agent, preservative, solubilizer, antiseptic agent, stabilizing agent, and isotonizing agent.
  • a compound that inhibits an interaction or binding between FZDlO protein and importin- ⁇ may affect in development of synovial sarcoma.
  • the present invention provides a method for screening for a compound that inhibits an interaction and/or binding between FZDlO protein and importin- ⁇ protein, comprising:
  • FZDlO protein The amino acid sequence of FZDlO protein is shown in SEQ ID No.2 (GenBank Accession No.BAA84093).
  • the amino acid sequence of importin- ⁇ protein is shown in SEQ ID No.4 (GenBank Accession No.NM_002265; PDB ID No. IQGK-A).
  • a compound screened by the above method can be used for treating or preventing synovial sarcoma.
  • the present invention provides a method for screening for a compound that can be used for treating or preventing synovial sarcoma, comprising:
  • Test sample may include, but not limited to, proteins, peptides, non-peptide compound, synthetic compound, fermented product, and natural extract including cellular extract. Also, test sample may be a chemical library or peptide library. Detection of an interaction or a formation of binding between FZDlO and importin- ⁇ can be carried out according to the conventional methods known in the art.
  • the present invention provides a composition for treating or preventing synovial sarcoma, wherein the composition comprises a pharmaceutically effective amount of the compound obtained by any of screening method described above as an active ingredient, and a pharmaceutically acceptable carrier.
  • the invention encompasses pharmaceutical or therapeutic compositions containing one or more therapeutic compounds described herein.
  • Such therapeutic compound includes, but not limited to, a double-stranded RNA as described herein.
  • Pharmaceutical formulations may include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral (including intramuscular, sub-cutaneous and intravenous) administration, or for administration by inhalation or insufflation.
  • the formulations may, where appropriate, be conveniently presented in discrete dosage units and may be prepared by any of the methods well known in the art of pharmacy. All such pharmacy methods include the steps of bringing into association the active compound with liquid carriers or finely divided solid carriers or both as needed and then, if necessary, shaping the product into the desired formulation.
  • compositions suitable for oral administration may conveniently be presented as discrete units, such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; or as a solution, a suspension or as an emulsion.
  • the active ingredient may also be presented as a bolus electuary or paste, and be in a pure form, i. e. , without a carrier.
  • Tablets and capsules for oral administration may contain conventional excipients such as binding agents, fillers, lubricants, disintegrant or wetting agents.
  • a tablet may be made by compression or molding, optionally with one or more formulational ingredients.
  • Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art. Oral fluid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives.
  • the tablets may optionally be formulated so as to provide slow or controlled release of the active ingredient therein.
  • Formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
  • the formulations may be presented in unit dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline water-for-injection, immediately prior to use. Alternatively, the formulations may be presented for continuous infusion.
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
  • Formulations for rectal administration may be presented as a suppository with the usual carriers such as cocoa butter or polyethylene glycol.
  • Formulations for topical administration in the mouth include lozenges, comprising the active ingredient in a flavored base such as sucrose and acacia or tragacanth, and pastilles comprising the active ingredient in a base such as gelatin and glycerin or sucrose and acacia.
  • the compounds of the invention may be used as a liquid spray or dispersible powder or in the form of drops. Drops may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents or suspending agents. Liquid sprays are conveniently delivered from pressurized packs.
  • the compounds are conveniently delivered from an insufflator, nebulizer, pressurized packs or other convenient means of delivering an aerosol spray.
  • Pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • the compounds may take the form of a dry powder composition, for example, a powder mix of the compound and a suitable powder base such as lactose or starch.
  • a powder mix of the compound and a suitable powder base such as lactose or starch.
  • the powder composition may be presented in unit dosage form, in, for example, capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflators.
  • compositions adapted to give sustained release of the active ingredient, may be employed.
  • the pharmaceutical compositions may also contain other active ingredients such as antimicrobial agents, immunosuppressants or preservatives.
  • formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example, those suitable for oral administration may include flavoring agents.
  • Preferred unit dosage formulations are those containing an effective dose, as recited below, or an appropriate fraction thereof, of the active ingredient.
  • the compositions may be administered orally or via injection at a dose of from about 0.1 to about 250 mg/kg per day.
  • the dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day.
  • Tablets or other unit dosage forms of presentation provided in discrete units may conveniently contain an amount which is effective at such dosage or as a multiple of the same, for instance, units containing about 5 mg to about 500 mg, usually from about 100 mg to about 500 mg.
  • the pharmaceutical composition preferably is administered orally or by injection
  • the precise amount administered to a subject will be the responsibility of the attendant physician.
  • the dose employed will depend upon a number of factors, including the age and sex of the subject, the precise disorder being treated, and its severity. Also the route of administration may vary depending upon the condition and its severity.
  • Example 1 The present invention will be further illustrated by the following non-limiting examples: Example 1
  • siRNAs specific to FZDlO under the control of the U6 promoter (psiU6BX-FZD10).
  • siRNAs psiU6BX-FZD10B and C were constructed according to FZDlO ORF sequence.
  • snRNA U6 gene was reported to be transcribed by RNA polymerase III, which produces the short transcripts with uridines at the 3' end, we amplified the genomic fragment of snRNA U6 gene containing its promoter region by PCR using a set of primers,
  • the Bam ⁇ l, Xhol digested fragment containing the snRNA U6 gene was purified and cloned into nucleotide 1257 to 56 fragment of pcDNA3.1(+) plasmid, which was amplified by PCR with a set of primer, 5'-TGCGGATCCAGAGCAGATTGTACTGAGAGT-S' (SEQ ID NO.13) and 5'- CTCTATCTC GAGTGAGGCGGAAAGAACCA-S ' (SEQ ID No.14).
  • the ligated DNA was used as a template for PCR with primers, 5 ' -TTTAAGCTTGAAGACTATTTTTACATCAGGTTGTTT TTCT-3' (SEQ ID No.15) and 5 ' -TTTAAGCTTGAAGAC ACGGTGTTTCGTCCTTTCCAC A-3 ' (SEQ ID No.16) (underlines indicate HindHl site).
  • the product was digested with Hin ⁇ ill, which was subsequently self-ligated to produce psiU6BX3.0 vector plasmid.
  • PCR product was cloned into pcDNA3.1-myc/His vector (Invitrogen), and then the inserted FZDlO cDNA with myc/His-tag was further subcloned into pCAGGS/neo expression vector.
  • an internal-tagged HA-FLAG-FZDl OFL (residue 1-581; SEQ ID No.2), expression plasmid constructs were generated from the cloned full-length FZDlO cDNA by PCR amplification with following primer combinations:
  • FZD10-nt652 5'-AAGTCGACTACTGGAGCCGCGAGGACAAG-S' (SEQ ID NO.21)
  • FZD10 ⁇ C2 (residues 1-525) expression plasmid constructs were generated and C-terminal portion (residues 218-each end) of each construct was generated by the forward primer (FZD10-nt652) and the following reverse primers, respectively;
  • Plasmids expressing siRNAs specific to FZDlO were prepared by cloning the double- stranded oligonucleotides into psiU6BX3.0 vector (Table 1).
  • the target sequences for siRNA in each plasmid are shown in Table 2.
  • the complementary oligonucleotides were each phosphorylated by incubation with T4-polynucleotide kinase at 37 °C for 30 min, followed by boiling and cooling down to room temperature slowly to anneal the two oligonucleotides. Each product was ligated into psiU6BX3.0 to construct an FZDlO-siRNA expression vector.
  • Table 1 Sequences of specific double- stranded oligonucleotides inserted into siRNA expression vector psi-U6BX-FZD20-B
  • FZDlO constructs Two FZDlO constructs, HA-FLAG-FZD 10 (described below) and FZDIO-myc-His (prepared in Example 1; Fig. 2A) were co-transfected into COS-7 cell and were performed co-immunoprecipitation using ⁇ -HA antibody.
  • HA-FLAG-FZD 10 For the construction of HA-FLAG-FZD 10, a following set of oligonucleotides, 5 ' -ACGTGTCGACTACCCATACGACGTCCCAGACTACGCTATGGACTACAAGG ACGACGATGACAAGCTCGAGATGC-3' (SEQ ID No.37) (underline indicates Sail site) and 5'-GCATCTCGAGCTTGTCATCGTCGTCCTTGTAGTCCATAGCGTAGTC TGGGACGTCGTATGGGTAGTCGACACGT-S' (SEQ ID NO.38) (underline indicates Xfjol site) was annealed and digested with SaK and Xhol to generate the HA-FLAG tag.
  • 5 ' -ACGTGTCGACTACCCATACGACGTCCCAGACTACGCTATGGACTACAAGG ACGACGATGACAAGCTCGAGATGC-3' (underline indicates Sail site)
  • residues 1-217 and 218-sto ⁇ codon (or C-terminal deletion) fragments were individually PCR-amplified. PCR products were digested with Sail and Xtiol, and ligated sequentially into pCAGGS/neo expression vector. The HA-FLAG tag fragment digested with SaIL and Xhol was ligated between nt651 and nt652 in frame.
  • COS-7 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics. FuGENE ⁇ (Roche) was used for transfection of COS-7 cells. The transfected cells were used 48-72h after transfection.
  • Transfected COS-7 cells were washed twice with cold PBS(-) and lysed in IPP buffer. The cell lysate was incubated with anti-HA F7 antibody (Santa Cruz) and protein G-sepharose (Sigma). Bound proteins were washed five times with IP buffer and eluted with SDS-sample buffer. Eluted proteins were analyzed by 10% SDS-PAGE. Proteins were electrophorestically transferred to nitrocellulose membranes (Amersham Biosciences). The membranes were incubated with anti-myc 9E10 monoclonal antibody, anti-FLAG M2 antibody or anti-HA F7 antibody followed by horseradish peroxidase-conjugated secondary antibody (Amersham Biosciences). Bound secondary antibodies were visualized by ECLTM Western blotting detection reagents (Amersham Biosciences).
  • HA-FLAG-FZD 10 As shown in Fig. 2B, upper panel, immunoprecipitated HA-FLAG-FZD 10 seemed to appear as multiple bands that were once or twice the predicted molecular mass and the highest band was stacked at the top of the running gel for SDS-PAGE, suggesting that FZDlO are able to form oligomers. Furthermore, using a ⁇ -HA antibody to pull down HA-FLAG-FZD 10 resulted in co-immunoprecipitation of FZDlO-myc-His (Fig.
  • FZDlO contains two motifs, KTxxxW (Umbhauer M, et al. (2000). EMBO J. 19:4944-4954), which is located at two amino acids after the seventh transmembrane domain, and TCV motifs at the predicted C-terminal which are thought to be important for protein-protein interaction.
  • Fig. 2A To examine the involvement of these motifs in oligomerization, we designed two C-terminal deleted constructs (Fig. 2A) whether they can form oligomers. As shown in Fig. 2C, pull down with ⁇ -HA antibody resulted in co-immunoprecipitation of FZD10-myc-His, suggesting that C-terminus motifs of FZDlO might be not involved in oligomerization.
  • TAP Tandem affinity purification-system purification was performed according to previous report (Rigaut G, et al. (1999). Nat Biotechnol, 17:1030-1032). Briefly, pCAGGS/neo-FZDIO-TAP or pCAGGS/neo-TAP as control were transfected to SNU-C5 cells.
  • TAP expression vector For construct of TAP expression vector, cDNA for the TAP tag sequence, consisting of immunoglobulin G-binding domain and calmodulin-binding peptide separated with the cleavage site of Tabacco each virus protease (TEV) with SaH at 3' end was PCR-amplified according to standard protocols (Fig. 3A). First, TAP tag sequence mentioned above was cloned into pcDNA-3.1(+)-myc-His expression vector. Next, pcDNA-3.1(+)-myc-His-TAP was digested with Xhol and Sail and resulted myc-His-TAP fragment was inserted into pCAGGS/neo vector.
  • the FZDlO ORF cDNA was subcloned into pCAGGS-myc-His-TAP/neo expression vector.
  • Colon cancer cell line, SNU-C5 was maintained in RPMI1640 medium supplemented with 10% fetal bovine serum and antibiotics. FuGENE ⁇ (Roche) was used for transfection of SNU-C5 cells.
  • COS-7 cells (Fig.3C).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

A method for inhibiting or reducing an expression of FZD10 gene is provided. Also, a method for treating and/or preventing FZD10-associated disease in a subject is provided. Further provided is a pharmaceutical composition comprising an double-stranded RNA molecule for FZD10 or an expression vector capable of expressing a double-stranded RNA molecule for FZD10.

Description

INSCRIPTION
Method for Treating Synovial Sarcoma Using siRNA for FZDlO
CROSS-REFERENCE TO RELATED APPLICATION This application claims priority on U. S. Provisional Application 60/598,834 filed on
August 5, 2004. The entire contents of the above application are hereby incorporated by reference in their entirety.
FIELD OF THE INVENTION The invention relates to a method for inhibiting or reducing an expression of FZDlO gene. Also, the present invention relates to a method for treating and/or preventing FZDIO-associated disease in a subject, particularly synovial sarcoma, colorectal cancer, gastric cancer, chronic myeloid leukemia, and acute myeloid leukemia. Furthermore, the present invention relates to a pharmaceutical composition comprising a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO.
BACKGROUND OF THE INVENTION
Frizzled homologue 10 (FZDlO) is a member of Frizzled family, which is a receptor of Wnt signaling. We previously reported that FZDlO was significantly overexpressed in synovial sarcoma (SS) (Nagayama S, et al. (2002). Cancer Res, 62:5859-5866; WO2004/020668).
Although expression of FZDlO has been demonstrated to be up-regulated in primary colorectal cancer (Terasaki, H. et al., Lit JMoI Med. 9: 107-12., 2002) and primary gastric cancer (Kirikoshi, H. et al, Int J Oncol. 19: 767-71., 2001) as well as SS, the cellular function and involvement of FZDlO in carcinogenesis of SS is still unknown.
SUMMARY OF THE INVENTION
As described hereinbelow, we demonstrated that knockdown of the expression of FZD 10 gene via RNA interference resulted in the growth suppression of SS cells, indicating that FZDlO plays an important role in the cell growth of SS. Also, we identified a nuclear-import protein, importin-β as an FZDIO-binding protein.
So, in one aspect, the present invention provides a method for inhibiting or reducing an expression of FZDlO gene in a cell or tissue in vitro, in vivo or ex vivo, comprising introducing into the cell or tissue a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, wherein the double-stranded RNA molecule for FZDlO comprises a nucleotide sequence targeted to the 10 to 100 continuous nucleotides, preferably 10 to 50 continuous nucleotides, more preferably 10 to 30 continuous nucleotides of SEQ ID NO: 1. Preferably, the double-stranded RNA molecule for FZDlO may comprise a short nucleotide sequence as a short-interfering RNA (siRNA). For example, the double-stranded RNA molecule comprises a nucleotide sequence targeted to nucleotides nos. 1481 to 1499 (SEQ ID No. S) or nucleotides nos. 1595 to 1613 (SEQ ID No.6) of SEQ ID No I . More specifically, the double-stranded RNA molecule for FZDlO can be expressed by the expression vector having the sequence of SEQ ID Nos. 7, 8, 9, or 10. In other aspect, the present invention provides a method for preventing or treating synovial sarcoma in a subject, comprising administering therapeutically effective amount of a double-stranded RNA for FZDlO or an expression vector capable of expressing a double-stranded RNA for FZDlO to the subject.
In addition, the present inventors found that the FZDlO protein can bind to importin-β. Therefore, a compound that inhibits an interaction or binding between FZDlO protein and importin-β may affect in development of synovial sarcoma.
In one aspect, the present invention provides a method for screening for a compound that inhibits an interaction and/or binding between FZDlO protein and importin-β protein, comprising: (a) contacting FZD 10 protein or a partial peptide thereof and importin-β protein or a partial peptide thereof in the presence of a test sample; and
(b) detecting an interaction or a formation of binding between FZDlO protein and importin-β protein.
Further in one aspect, the present invention provides a method for screening for a compound that can be used for treating or preventing synovial sarcoma, comprising:
(a) contacting FZDlO protein or a partial peptide thereof and importin-β protein or a partial peptide thereof in the presence of a test sample; and
(b) detecting an interaction or a formation of binding between FZDlO protein and importin-β protein. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
Figs. IA to 1C show growth-inhibitory effects of small-interfering RNAs (siRNAs) designed to reduce expression of FZDlO in SS cell line, SYO-I. (A) Semi-quantitative RT-PCR showing suppression of endogenous expression of FZDlO in SYO-I cell. β2MG was used as an internal control. Expression of FZD9 is not affected by these siRNAs. (B) MTT Assay of SYO-I cells transfected with psiU6BX3.0 vectors. A549 cell, in which undetectable FZDlO expression is observed, is an "off-target" control shows no growth-effect with these siRNAs. (C) Colony-formation assay demonstrating a decrease in the numbers of colonies by knock-down of FZDlO expression in SYO-I cell. A549 cell line is an "off-target" control. Figs. 2A to 2C show that FZDlO can form homo-oligomer. (A) Schematic diagram of FZDlO constructs. 7TM; seven-transmembrane domain. (B) Co-immunoprecipitation of FZDlO with itself. Lysates from un-transfected COS-7 cells or expressing HA-FLAG-FZD 10 and FZDIO-myc/His were immunoprecipitated with α-HA antibody. Immunoprecipitates were analyzed by western blotting with α-HA and α-myc antibodies. (C) Cytoplasmic region of FZDlO is not involved in oligomerization. Lysates from untransfected COS-7 cells or expressing HA-FLAG-FZD 10, HA-FLAG-FZDIO ΔC(l-578), HA-FLAG-FZD 10 AC(I -525) and FZDIO-myc/His were immunoprecipitated with α-HA F-7 antibody. Immunoprecipitates were analyzed by western blotting with α-HA F-7 and α-myc 9E10 antibodies. Figs. 3A to 3C show TAP system purification of FZDlO and FZDIO-binding proteins. (A) Schematic diagram of FZDlO-TAP and control TAP. (B) TAP-purification of FZDlO identifies a new complex. Lysates from SNU-C5 cells expressing either control TAP or FZDlO-TAP were subjected to TAP system purification. Silver stained gel shows the proteins identified. (C) The interaction between FZDlO and importin-β is also shown by co-immunoprecipitation. Lysates from untransfected COS-7 cells or expressing either importinβ-3XFLAG or FZDIO-myc/His, or both of them were immunoprecipitated with α-myc 9E10 antibody. Immunoprecipitates were analyzed by Western blotting with α-FLAG M2 and α-myc 9E10 antibodies.
DETAILED DESCRIPTION AND PREFERRED EMBODIMENTS OF THE PRESENT INVENTION Frizzled homologue 10 (FZDlO) is a member of Frizzled family, which is a receptor of Wnt signaling. As described hereinbelow, we demonstrated that knockdown of the expression of FZDlO gene via RNA interference resulted in the growth suppression of SS cells, indicating that FZDlO plays an important role in the cell growth of SS. RNA interference is known as a cellular event in which mRNA from an endogenous gene is degraded by introducing a double-stranded RNA (dsRNA) that has the sequence complementary to the sequence of the endogenous gene. As a result, the expression of a target gene can be inhibited or reduced. This event is reported in, for example, Elbashir, SM. et al, Nature 411, 494-498, 2001; Hannon, GJ., Nature 418, 244-251, 2002 (review); Shinagawa, T. et al, Genes Dev. 17: 1340-1345 2003; International Patent Publication Nos. WO99/32619 and WO99/61613.
We successfully designed dsRNA molecules which effectively inhibit or reduce the expression of FZDlO gene via RNA interference. So, in one embodiment, the present invention provides a method for inhibiting or reducing an expression of FZDlO gene in a cell or tissue in vitro, in vivo or ex vivo, comprising introducing into the cell or tissue a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, wherein the double-stranded RNA molecule for FZDlO comprises a nucleotide sequence targeted to the 10 to 100 continuous nucleotides, preferably 10 to 50 continuous nucleotides, more preferably 10 to 30 continuous nucleotides of SEQ ID NO: 1. Preferably, the double-stranded RNA molecule for FZDlO may comprise a short nucleotide sequence as a short-interfering RNA (siRNA). For example, the double-stranded RNA molecule comprises a nucleotide sequence targeted to nucleotides nos. 1481 to 1499 (SEQ ID No. 5) or nucleotides nos. 1595 to 1613 (SEQ ID No. 6) of SEQ DD No.l. More specifically, the double-stranded RNA molecule for FZDlO can be expressed by the expression vector having the sequence of SEQ ID Nos. 7, 8, 9, or 10 as indicated below. Also, the expression vector having the sequence of SEQ ID Nos. 7, 8, 9, or 10 may be useful in the method of the present invention.
Sequence Seq ID No.
5 ' - CACCAACGCTGGACTGCCTGATGTTCAAGAGACATCAGGCAGTCCAGCGTT -3 ' 7
5'- AAAAAACGCTGGACTGCCTGATGTCTCTTGAACATCAGGCAGTCCAGCGTT -3' 8
5'- CACCGACTCTGCAGTCCTGGCAGTTCAAGAGACTGCCAGGACTGCAGAGTC -3' 9
5'- AAAAGACTCTGCAGTCCTGGCAGTCTCTTGAACTGCCAGGACTGCAGAGTC -3' 10
The specific sequences to FZDlO are underlined.
Further, as described above, FZDlO is significantly overexpressed in synovial sarcoma (SS), and the growth of SS cells is suppressed by inhibiting or reducing the expression of FZDlO. Therefore, in an alternative embodiment, the present invention provides a method for preventing or treating synovial sarcoma in a subject, comprising administering therapeutically effective amount of a double-stranded RNA for FZDlO or an expression vector capable of expressing a double-stranded RNA for FZDlO to the subject. The method of the present invention can be performed ex vivo {e.g., by culturing the cell derived from a subject with the dsRNA or expression vector) or, alternatively, in vivo (e.g., by administering the dsRNA or expression vector to a subject).
The dsRN A can be delivered to a target location (such as a cancerous cell) by a variety of known administration methods. For example, the dsRNA can be delivered using an expression vector capable of expressing the dsRNA. Examples of an expression vector that can be used in the present invention include, but are not limited to, adenovirus, herpes virus, vaccinia virus, and RNA viruses such as retrovirus.
Other examples of the gene delivery system that can be used for administering the dsRNA to the target tissue or cell include a colloidal dispersion system, a liposome-induced system, and an artificial virus envelope. Specifically, a macromolecular complex, a nano-capsule, a microsphere, beads, oil-in-water type emulsion, micelle, mixed micelle, and liposome, for example, may be used as a delivery system.
The dsRNA or expression vector may be directly administered by intravenous injection (including continuous infusion), intramuscular injection, intraperitoneal injection, and subcutaneous injection, or via other route of administration.
Alternatively, the dsRNA or expression vector may be introduced into a cell or tissue obtained from a subject and then the cell may be administered to the subject (ex vivo method). The introduction of the dsRNA or expression vector into the cell or tissue may be carried out by a conventional gene-introducing method such as, for example, a calcium phosphate method, a DEAE dextran method, electroporation, or lipofection. The administration of the cell or tissue in which the dsRNA is expressed may also be carried out in the same manner as in the case of the direct administering of the dsRNA or expression vector.
The dosage of dsRNA or expression vector administered may vary depending on age, sex, symptoms, administration routes, administration frequency, and dosage form. However, a conventional method in the relevant art may be appropriately selected and used.
In the other embodiment, the present invention provides a composition comprising a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, and a pharmaceutically acceptable carrier. Various types of compositions may be formulated in a conventional manner by appropriately selecting pharmaceutically acceptable carriers that are typically used for the formulation of preparations, such as excipient, disintegrant, lubricant, surfactant, dispersing agent, buffering agent, preservative, solubilizer, antiseptic agent, stabilizing agent, and isotonizing agent.
Further, in order to understand the mechanism of tumorigenesis of SS via overexpression of FZDlO, we applied to identify the novel FZDIO-binding proteins by IP-MS method. Strikingly, we isolated nuclear-import protein, importin-β as an FZDIO-binding protein. We demonstrated that FZDlO protein localized to nucleus and cytoplasmic apparatus by immunohistochemistry (unpublished data). Therefore, FZDlO protein might function in nuclei except for the function as membranous protein.
Therefore, a compound that inhibits an interaction or binding between FZDlO protein and importin-β may affect in development of synovial sarcoma. In one embodiment, the present invention provides a method for screening for a compound that inhibits an interaction and/or binding between FZDlO protein and importin-β protein, comprising:
(a) contacting FZDlO protein or a partial peptide thereof and importin-β protein or a partial peptide thereof in the presence of a test sample; and (b) detecting an interaction or a formation of binding between FZDlO protein and importin-β protein.
The amino acid sequence of FZDlO protein is shown in SEQ ID No.2 (GenBank Accession No.BAA84093). The amino acid sequence of importin-β protein is shown in SEQ ID No.4 (GenBank Accession No.NM_002265; PDB ID No. IQGK-A). A compound screened by the above method can be used for treating or preventing synovial sarcoma.
In the other embodiment, the present invention provides a method for screening for a compound that can be used for treating or preventing synovial sarcoma, comprising:
(a) contacting FZDlO protein or a partial peptide thereof and importin-β protein or a partial peptide thereof in the presence of a test sample; and
(b) detecting an interaction or a formation of binding between FZDlO protein and importin-β protein.
Test sample may include, but not limited to, proteins, peptides, non-peptide compound, synthetic compound, fermented product, and natural extract including cellular extract. Also, test sample may be a chemical library or peptide library. Detection of an interaction or a formation of binding between FZDlO and importin-β can be carried out according to the conventional methods known in the art.
In a further embodiment, the present invention provides a composition for treating or preventing synovial sarcoma, wherein the composition comprises a pharmaceutically effective amount of the compound obtained by any of screening method described above as an active ingredient, and a pharmaceutically acceptable carrier.
In another aspect, the invention encompasses pharmaceutical or therapeutic compositions containing one or more therapeutic compounds described herein. Such therapeutic compound includes, but not limited to, a double-stranded RNA as described herein. Pharmaceutical formulations may include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral (including intramuscular, sub-cutaneous and intravenous) administration, or for administration by inhalation or insufflation. The formulations may, where appropriate, be conveniently presented in discrete dosage units and may be prepared by any of the methods well known in the art of pharmacy. All such pharmacy methods include the steps of bringing into association the active compound with liquid carriers or finely divided solid carriers or both as needed and then, if necessary, shaping the product into the desired formulation.
Pharmaceutical formulations suitable for oral administration may conveniently be presented as discrete units, such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; or as a solution, a suspension or as an emulsion. The active ingredient may also be presented as a bolus electuary or paste, and be in a pure form, i. e. , without a carrier. Tablets and capsules for oral administration may contain conventional excipients such as binding agents, fillers, lubricants, disintegrant or wetting agents. A tablet may be made by compression or molding, optionally with one or more formulational ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art. Oral fluid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives. The tablets may optionally be formulated so as to provide slow or controlled release of the active ingredient therein.
Formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline water-for-injection, immediately prior to use. Alternatively, the formulations may be presented for continuous infusion. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
Formulations for rectal administration may be presented as a suppository with the usual carriers such as cocoa butter or polyethylene glycol. Formulations for topical administration in the mouth, for example buccally or sublingually, include lozenges, comprising the active ingredient in a flavored base such as sucrose and acacia or tragacanth, and pastilles comprising the active ingredient in a base such as gelatin and glycerin or sucrose and acacia. For intra-nasal administration the compounds of the invention may be used as a liquid spray or dispersible powder or in the form of drops. Drops may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents or suspending agents. Liquid sprays are conveniently delivered from pressurized packs.
For administration by inhalation, the compounds are conveniently delivered from an insufflator, nebulizer, pressurized packs or other convenient means of delivering an aerosol spray. Pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount.
Alternatively, for administration by inhalation or insufflation, the compounds may take the form of a dry powder composition, for example, a powder mix of the compound and a suitable powder base such as lactose or starch. The powder composition may be presented in unit dosage form, in, for example, capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflators.
When desired, the above-described formulations, adapted to give sustained release of the active ingredient, may be employed. The pharmaceutical compositions may also contain other active ingredients such as antimicrobial agents, immunosuppressants or preservatives.
It should be understood that in addition to the ingredients particularly mentioned above, the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example, those suitable for oral administration may include flavoring agents.
Preferred unit dosage formulations are those containing an effective dose, as recited below, or an appropriate fraction thereof, of the active ingredient.
For each of the aforementioned conditions, the compositions may be administered orally or via injection at a dose of from about 0.1 to about 250 mg/kg per day. The dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day. Tablets or other unit dosage forms of presentation provided in discrete units may conveniently contain an amount which is effective at such dosage or as a multiple of the same, for instance, units containing about 5 mg to about 500 mg, usually from about 100 mg to about 500 mg. The pharmaceutical composition preferably is administered orally or by injection
(intravenous or subcutaneous), and the precise amount administered to a subject will be the responsibility of the attendant physician. However, the dose employed will depend upon a number of factors, including the age and sex of the subject, the precise disorder being treated, and its severity. Also the route of administration may vary depending upon the condition and its severity.
EXAMPLES:
The present invention will be further illustrated by the following non-limiting examples: Example 1
Construction of siRNA expression vector
To investigate the cellular function of FZDlO, we constructed plasmids expressing siRNAs specific to FZDlO under the control of the U6 promoter (psiU6BX-FZD10). Two siRNAs (psiU6BX-FZD10B and C) were constructed according to FZDlO ORF sequence.
(1) Construction of siRNA expression vector, psiU6X3.0
Since snRNA U6 gene was reported to be transcribed by RNA polymerase III, which produces the short transcripts with uridines at the 3' end, we amplified the genomic fragment of snRNA U6 gene containing its promoter region by PCR using a set of primers,
5'-GGGGATCAGCGTTTGAGTAA-S' (SEQ ID No.11), and 5'-TAGGCCC CACCTCCTTCTAT-3' (SEQ ID No.12) and human placental DNA as a template. The product was purified and cloned into pCR plasmid vector using a TA cloning kit according to the supplier's protocol (Invitrogen). The BamΗl, Xhol digested fragment containing the snRNA U6 gene was purified and cloned into nucleotide 1257 to 56 fragment of pcDNA3.1(+) plasmid, which was amplified by PCR with a set of primer, 5'-TGCGGATCCAGAGCAGATTGTACTGAGAGT-S' (SEQ ID NO.13) and 5'- CTCTATCTC GAGTGAGGCGGAAAGAACCA-S ' (SEQ ID No.14). The ligated DNA was used as a template for PCR with primers, 5 ' -TTTAAGCTTGAAGACTATTTTTACATCAGGTTGTTT TTCT-3' (SEQ ID No.15) and 5 ' -TTTAAGCTTGAAGAC ACGGTGTTTCGTCCTTTCCAC A-3 ' (SEQ ID No.16) (underlines indicate HindHl site). The product was digested with Hinάill, which was subsequently self-ligated to produce psiU6BX3.0 vector plasmid.
(2) Plasmids construction To construct the myc/His-tagged full-length FZDlO expression vectors, we firstly
PCR-amplified the entire coding sequence of the FZDlO (SEQ ID No.l) using a human placenta cDNA library as template with following primers:
5'-CCGGAATTCCAGACCGTGCATCATGCAGCGCCCGGGCCCCCGCCT-S' (SEQ
ID No.17) (underline indicates EcoRl site) and 5'-AAAAAGCTTCACGCAGGTGGGCGACTG-S' (SEQ ID No.18) (underline indicates
Hindm site).
After digestion of EcoRl and Hindlll, PCR product was cloned into pcDNA3.1-myc/His vector (Invitrogen), and then the inserted FZDlO cDNA with myc/His-tag was further subcloned into pCAGGS/neo expression vector. Next, an internal-tagged HA-FLAG-FZDl OFL (residue 1-581; SEQ ID No.2), expression plasmid constructs were generated from the cloned full-length FZDlO cDNA by PCR amplification with following primer combinations:
FZDlO-ATG, 5 ' -AAGTCGAC ACC ATGC AGCGCCCGGGCCCC-3 ' (SEQ ID No.19)
(underline indicates Sail site) and FZD10-nt651, 5'-TCTCGAGGACATCCACGCCGGGCGTG-S' (SEQ ID NO.20)
(underline indicates Xltόl site) for N-terminal portion of FZDlO (1-217 amino-acids of SEQ ID No.2);
FZD10-nt652, 5'-AAGTCGACTACTGGAGCCGCGAGGACAAG-S' (SEQ ID NO.21)
(underline indicates Sail site) and FZDlO-TGA, 5'-AACTCGAGTCACACGCAGGTGGGCGACT-S' (SEQ ID NO.22)
(underline indicates Xliόl site) for C-terminal portion of FZDlO (218-581 amino-acids of SEQ ID No.2).
The N-terminal portion (residues 1-217) of FZD10ΔC1 (residues 1-578) and
FZD10ΔC2 (residues 1-525) expression plasmid constructs were generated and C-terminal portion (residues 218-each end) of each construct was generated by the forward primer (FZD10-nt652) and the following reverse primers, respectively;
FZD10ΔCl(l-578), 5'-AACTCGAGTCAGGGCGACTGGGCAGGGATCT-S' (SEQ ID
No.23) (underline indicates Xhol site) and
FZD10ΔC2(l-525), 5'-AACTCGAGTCAGGAGGTCCAAATCCACATCCC-S' (SEQ ID
No.24) (the underline indicates Xhol site).
Plasmids expressing siRNAs specific to FZDlO were prepared by cloning the double- stranded oligonucleotides into psiU6BX3.0 vector (Table 1). The target sequences for siRNA in each plasmid are shown in Table 2. The complementary oligonucleotides were each phosphorylated by incubation with T4-polynucleotide kinase at 37 °C for 30 min, followed by boiling and cooling down to room temperature slowly to anneal the two oligonucleotides. Each product was ligated into psiU6BX3.0 to construct an FZDlO-siRNA expression vector.
Table 1: Sequences of specific double- stranded oligonucleotides inserted into siRNA expression vector psi-U6BX-FZD20-B
5'- CACCAACGCTGGACTGCCTGATGTTCAAGAGACATCAGGCAGTCCAGCGTT -3' 7
5'- AAAAAACGCTGGACTGCCTGATGTCTCTTGAACATCAGGCAGTCCAGCGTT -3' 8 psi-U6BX-FZD10-C
5'- CACCGACTCTGCAGTCCTGGCAGTTCAAGAGACTGCCAGGACTGCAGAGTC -3' 9
5'- AAAAGACTCTGCAGTCCTGGCAGTCTCTTGAACTGCCAGGACTGCAGAGTC -3' 10 psi-\J6BX-EGFP
5 ' - CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTC -3 ' 25
5'- AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCTGCTTC -3 ' 26 psi-U6BX-£wc
5'- CACCGTGCGCTGCTGGTGCCAACTTCAAGAGAGTTGGCACCAGCAGCGCAC -3' 27
5'- AAAAGTGCGCTGCTGGTGCCAACTCTCTTGAAGTTGGCACCAGCAGCGCAC -3' 28
The specific sequences to FZDlO are underlined. Table 2: Target sequences for siRNA Seq ID No. psi-U6BX-FZDI0-B
5 ' - AACGCTGGACTGCCTGATG -3 ' 5 psi~U6BX-FZD10-C
5 ' - GACTCTGCAGTCCTGGCAG -3 ' 6 psi~\J6BX-EGFP
5'- GAAGCAGCACGACTTCTTC -S' 29 psi-TJ6BX-Z,Hc
5'- GTGCGCTGCTGGTGCCAAC -3' 30
Example 2
Effect of FZDlO-siRNAs on growth of synovial sarcoma cell lines
We transfected the plasmids prepared in Example 1 into synovial sarcoma cell line, SYO-I, and examined the expression level of FZDlO by semi-quantitative RT-PCR. Also, we conducted cell growth assay to confirm the cell growth inhibition. (1) Semi-quantitative RT-PCR SYO-I cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics. Cell line Nucleofector™ kit V (Amaxa Biosystems, Cologne, Germany) was used for transfection of SYO-I cells. The transfected cells were assayed 48-72h after transfection.
Total RNA was extracted from transfected cell using TRIZOL reagent (Invitrogen) according to manufacturer's protocol. Extracted RNA was treated with DNase I (Roche
Diagnostics, Mannheim, Germany) and reverse-transcribed to single-stranded cDNAs using oligo(dT)).2-i8 primer with Superscript II reverse transcriptase (Invitrogen). PCR amplification was performed using the cDNAs as templates and primers as follows:
5'-TATCGGGCTCTTCTCTGTGC-S ' (SEQ ID NO.31) and 5'-GACTGGGCAGGGATCTCATA-S ' (SEQ ID No.32) for FZDlO,
5'-CTGCACGCTGGTCTTCCTCT-S ' (SEQ ID NO.33) and 5'-CCGATCTTGACCATGAGCTTC-S ' (SEQ ID NO.34) for FZD9, 5'-TTAGCTGTGCTCGCGCTACT-S ' (SEQ ID NO.35) and 5'-TCACATGGTTCACACGGCAG-S ' (SEQ ID NO.36) for β2MG.
As a result, the two siRNA constructs, FZDlO (si-B and -C)-specific siRNAs significantly suppressed expression, compared with control (psiU6BX-LUC or -EGFP), while expression of FZD9, which has the highest similarity to FZDlO among Frizzled family genes, was not affected by these siRNAs (Fig. IA).
(2) Cell growth assays To confirm the cell growth inhibition with FZDlO-specific siRNAs, we performed colony-formation and MTT assays, respectively. SYO-I cells were transfected as described in (1) above. Lung cancer cell line, A549 cells were maintained in RPMI1640 medium supplemented with 10% fetal bovine serum and antibiotics. FuGENEό (Roche) was used for transfection of A549 cells. SYO-I and A549 cells transfected with psiU6-FZD10, psiU6-luc or psiU6-EGFP plasmids were maintained in media containing appropriate concentrations of Geneticin for 13 days. The cells were fixed with 4% paraformaldehyde and stained with Giemsa solution. Additionally, cell viability was measured by MTT assay using Cell-counting kit8 (Dojindo) as described (Shimokawa T et al. (2003). Cancer Res, 63, 6116-20). As a result, introduction of FZDlO siRNA constructs suppressed growth of SYO-I, consisting with the result of above reduced expression of this gene (Figs. IB and 1C). Furthermore, the growth of A549 cell which shows undetectable expression of FZDlO was not affected, indicating that no "off-target" effect occurred by these siRNAs. Each result was verified by three independent experiments. Thus, our findings suggest that FZDlO has a significant function in the cell growth of the synovial sarcoma.
Example 3 Formation of FZDlO homodimer
Since FZDl, a member of frizzled family, was reported to form oligomers (Kaykas
A, et al. (2004). Nat. Cell Biol. 6:52-8), we examined whether FZDlO is also able to oligomerize with immunoprecipitation. Two FZDlO constructs, HA-FLAG-FZD 10 (described below) and FZDIO-myc-His (prepared in Example 1; Fig. 2A) were co-transfected into COS-7 cell and were performed co-immunoprecipitation using α-HA antibody.
For the construction of HA-FLAG-FZD 10, a following set of oligonucleotides, 5 ' -ACGTGTCGACTACCCATACGACGTCCCAGACTACGCTATGGACTACAAGG ACGACGATGACAAGCTCGAGATGC-3' (SEQ ID No.37) (underline indicates Sail site) and 5'-GCATCTCGAGCTTGTCATCGTCGTCCTTGTAGTCCATAGCGTAGTC TGGGACGTCGTATGGGTAGTCGACACGT-S' (SEQ ID NO.38) (underline indicates Xfjol site) was annealed and digested with SaK and Xhol to generate the HA-FLAG tag. Firstly, residues 1-217 and 218-stoρ codon (or C-terminal deletion) fragments were individually PCR-amplified. PCR products were digested with Sail and Xtiol, and ligated sequentially into pCAGGS/neo expression vector. The HA-FLAG tag fragment digested with SaIL and Xhol was ligated between nt651 and nt652 in frame. COS-7 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics. FuGENEό (Roche) was used for transfection of COS-7 cells. The transfected cells were used 48-72h after transfection.
Transfected COS-7 cells were washed twice with cold PBS(-) and lysed in IPP buffer. The cell lysate was incubated with anti-HA F7 antibody (Santa Cruz) and protein G-sepharose (Sigma). Bound proteins were washed five times with IP buffer and eluted with SDS-sample buffer. Eluted proteins were analyzed by 10% SDS-PAGE. Proteins were electrophorestically transferred to nitrocellulose membranes (Amersham Biosciences). The membranes were incubated with anti-myc 9E10 monoclonal antibody, anti-FLAG M2 antibody or anti-HA F7 antibody followed by horseradish peroxidase-conjugated secondary antibody (Amersham Biosciences). Bound secondary antibodies were visualized by ECL™ Western blotting detection reagents (Amersham Biosciences).
As shown in Fig. 2B, upper panel, immunoprecipitated HA-FLAG-FZD 10 seemed to appear as multiple bands that were once or twice the predicted molecular mass and the highest band was stacked at the top of the running gel for SDS-PAGE, suggesting that FZDlO are able to form oligomers. Furthermore, using a α-HA antibody to pull down HA-FLAG-FZD 10 resulted in co-immunoprecipitation of FZDlO-myc-His (Fig. 2B, lower panel), indicating that FZDlO can form homo-oligomer, and are not co-immunoprecipitated when Iy sates from the cell transfected HA-FLAG-FZD 10 or FZDIO-myc are mixed before immunoprecipitation, indicating that oligomerization occurs in living cell (data not shown). FZDlO contains two motifs, KTxxxW (Umbhauer M, et al. (2000). EMBO J. 19:4944-4954), which is located at two amino acids after the seventh transmembrane domain, and TCV motifs at the predicted C-terminal which are thought to be important for protein-protein interaction. To examine the involvement of these motifs in oligomerization, we designed two C-terminal deleted constructs (Fig. 2A) whether they can form oligomers. As shown in Fig. 2C, pull down with α-HA antibody resulted in co-immunoprecipitation of FZD10-myc-His, suggesting that C-terminus motifs of FZDlO might be not involved in oligomerization.
Example 4 Interaction with importin-β To further investigate the functions of FZDlO protein via interacting proteins, we performed TAP-system purification methods.
TAP (Tandem affinity purification)-system purification was performed according to previous report (Rigaut G, et al. (1999). Nat Biotechnol, 17:1030-1032). Briefly, pCAGGS/neo-FZDIO-TAP or pCAGGS/neo-TAP as control were transfected to SNU-C5 cells.
For construct of TAP expression vector, cDNA for the TAP tag sequence, consisting of immunoglobulin G-binding domain and calmodulin-binding peptide separated with the cleavage site of Tabacco each virus protease (TEV) with SaH at 3' end was PCR-amplified according to standard protocols (Fig. 3A). First, TAP tag sequence mentioned above was cloned into pcDNA-3.1(+)-myc-His expression vector. Next, pcDNA-3.1(+)-myc-His-TAP was digested with Xhol and Sail and resulted myc-His-TAP fragment was inserted into pCAGGS/neo vector. The FZDlO ORF cDNA was subcloned into pCAGGS-myc-His-TAP/neo expression vector. Colon cancer cell line, SNU-C5 was maintained in RPMI1640 medium supplemented with 10% fetal bovine serum and antibiotics. FuGENEό (Roche) was used for transfection of SNU-C5 cells.
72 hours after transfection, cells were lysed with IPP buffer (1OmM Tris-HCl
[pH8.0], 0.1% NP-40, 15OmM NaCl, ImM NaF, containing Protease Inhibitor Cocktail Setπi (Calbiochem)). The insoluble fraction was removed and supernatant was incubated with IgG-sepharose (Amersham Biosciences). The bound protein was incubated with TEV protease (Invitrogen) at 4 0C for overnight and eluted protein was further incubated with
Calmodulin Affinity resin (Stratagene) with ImM CaCl2. Finally, bound protein was eluted with ImM EGTA and subjected to 12% SDS-PAGE. Proteins were visualized by silver staining using Silver Stain "Daiichi" (Daiichi Pure Chemicals). The protein bands that were differential with the control TAP were excised from the gel and MALDI-TOF MS analysis was custom-operated by Aproscience Co. (Tokushima, Japan).
When we transfected FZDlO-TAP and TAP vector as control were overexpressed in
SNU-C5 cells (Fig. 3B), we identified importin-β as a candidate interacting protein to FZDlO. We further confirmed that FZDlO could co-immunoprecipitate with importin-β in
COS-7 cells (Fig.3C).
While the invention has been described in detail with reference to certain preferred embodiments, it is appreciated that many variations and modifications may be made by those skilled in the art within the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A method for inhibiting or reducing an expression of FZDlO gene in a cell or tissue in vitro, in vivo or ex vivo, comprising introducing into the cell or tissue a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, wherein the double-stranded RNA molecule for FZDlO comprises a nucleotide sequence targeted to at least 10 continuous nucleotides of SEQ ID NO: 1.
2. The method of claim 1, wherein the double-stranded RNA molecule for
FZDlO is a short-interfering RNA (siRNA).
3. The method of claim 1 or 2, wherein the double- stranded RNA molecule comprises a nucleotide sequence targeted to nucleotides nos. 1481 to 1499 (SEQ ID No. 5) or nucleotides nos. 1595 to 1613 (SEQ ID No.6) of SEQ ID No.l.
4. The method of claim 1 or 2, wherein the double- stranded RNA molecule for FZD 10 is expressed by the expression vector having the sequence of SEQ ID Nos. 7, 8, 9, or 10.
5. A method for preventing or treating a disease that is associated with Frizzled homologue 10 (FZDlO) in a subject, comprising administering therapeutically effective amount of a double-stranded RNA for FZDlO or an expression vector capable of expressing a double-stranded RNA for FZDlO to the subject.
6. The method of claim 5, wherein the double-stranded RNA molecule for FZDlO is a short-interfering RNA (siRNA).
7. The method of claim 5 or 6, wherein the double-stranded RNA molecule comprises a nucleotide sequence targeted to nucleotides nos. 1481 to 1499 (SEQ ID No. 5) or nucleotides nos. 1595 to 1613 (SEQ ID No.6) of SEQ ID No.l.
8. The method of claim 5 or 6, wherein the expression vector comprises the sequence of SEQ ID Nos. 7, 8, 9, or 10.
9. The method of any one of claims 5 to 8, wherein the disease which is associated with FZD 10 is selected from the group consisting of synovial sarcoma, colorectal cancer, gastric cancer, chronic myeloid leukemia, and acute myeloid leukemia.
10. A pharmaceutical composition comprising a double-stranded RNA molecule for FZDlO or an expression vector capable of expressing a double-stranded RNA molecule for FZDlO, and a pharmaceutically acceptable carrier.
EP05766513A 2004-08-05 2005-07-14 Method for treating synovial sarcoma using sirna for fzd10 Withdrawn EP1789549A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US59883404P 2004-08-05 2004-08-05
PCT/JP2005/013444 WO2006013733A1 (en) 2004-08-05 2005-07-14 Method for treating synovial sarcoma using sirna for fzd10

Publications (1)

Publication Number Publication Date
EP1789549A1 true EP1789549A1 (en) 2007-05-30

Family

ID=35276076

Family Applications (1)

Application Number Title Priority Date Filing Date
EP05766513A Withdrawn EP1789549A1 (en) 2004-08-05 2005-07-14 Method for treating synovial sarcoma using sirna for fzd10

Country Status (4)

Country Link
EP (1) EP1789549A1 (en)
JP (1) JP2008509076A (en)
CN (1) CN1993466A (en)
WO (1) WO2006013733A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2044123B1 (en) 2006-06-21 2013-03-13 Oncotherapy Science, Inc. Tumor-targeting monoclonal antibodies to fzd10 and uses thereof
JP6155255B2 (en) * 2012-04-17 2017-06-28 Hoya株式会社 FZD10 binding peptide
TWI762516B (en) 2016-10-06 2022-05-01 日商腫瘤療法 科學股份有限公司 Monoclonal antibodies against FZD10 and their uses

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003256079A1 (en) * 2002-08-30 2004-03-19 Japan As Represented By President Of The University Of Tokyo Method for treating synovial sarcoma

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2006013733A1 *

Also Published As

Publication number Publication date
WO2006013733A1 (en) 2006-02-09
CN1993466A (en) 2007-07-04
JP2008509076A (en) 2008-03-27

Similar Documents

Publication Publication Date Title
Masuyama et al. HM1. 24 is internalized from lipid rafts by clathrin-mediated endocytosis through interaction with α-adaptin
WO2008020596A2 (en) Treating or preventing cancers over-expressing reg4 or kiaa0101
JP6014904B2 (en) ERAP1-derived peptides and uses thereof
US20050042209A1 (en) MUC1 extracellular domain and cancer treatment compositions and methods derived therefrom
Kendirgi et al. An essential role for hGle1 nucleocytoplasmic shuttling in mRNA export
Yang et al. TRAF4 enhances oral squamous cell carcinoma cell growth, invasion and migration by Wnt-β-catenin signaling pathway
WO2006031210A1 (en) Jabi as a prognostic marker and a therapeutic target for human cancer
US20080063638A1 (en) Mitotic kinesin-like protein-1, MKLP1, and uses therof priority
CN101528926A (en) Treating or preventing cancers over-expressing REG4 or KIAA0101
Xu et al. 14-kDa phosphohistidine phosphatase and its role in human lung cancer cell migration and invasion
KR20090024656A (en) Use of TRM72 as a target for muscle and heart enhancers
EP2229946B1 (en) Use of the growth-stimulating protein KIAA1524
EP2723350B1 (en) New uses of nanog inhibitors and related methods
JP2010523081A (en) Screening method targeting CDCA8-AURKB complex and method for treating NSCLC
WO2006013733A1 (en) Method for treating synovial sarcoma using sirna for fzd10
EP2108701A1 (en) Methods involving MS4A12 and agents targeting MS4A12 for therapy, diagnosis and testing
KR101367832B1 (en) Use of Hades as a target for tumor suppressor
EP2471918A1 (en) Screening method
US8088913B2 (en) Compositions and methods for therapy and diagnosis of cancer
CN101142233A (en) Reagents that inhibit the cathelin-like protein hCAP18/LL-17
WO2005014637A1 (en) Apoptosis inhibitors
CA2773614A1 (en) Method of treating cancer by inhibiting trim59 expression or activity
CN101479385A (en) Inhibitors of HCAP18/LL-37 for use in the treatment of breast cancer
Cai et al. Effects of RNAi-mediated gene silencing of LRIG3 expression on cell cycle and survival of glioma cells
CN101478988A (en) Combination therapy product and uses thereof

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20070208

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

RIN1 Information on inventor provided before grant (corrected)

Inventor name: NAKAMURA, YUSUKE,THE UNIVERSITY OF TOKYO

Inventor name: FUKUKAWA, CHIKAKO,C/O ONCOTHERAPY SCIENCE, INC.

Inventor name: KATAGIRI, TOYOMASA,THE UNIVERSITY OF TOKYO

DAX Request for extension of the european patent (deleted)
RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: ONCOTHERAPY SCIENCE, INC.

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20080708