Classifications

• • C—CHEMISTRY; METALLURGY
  • C40—COMBINATORIAL TECHNOLOGY
  • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
  • C40B40/00—Libraries per se, e.g. arrays, mixtures
  • C40B40/02—Libraries contained in or displayed by microorganisms, e.g. bacteria or animal cells; Libraries contained in or displayed by vectors, e.g. plasmids; Libraries containing only microorganisms or vectors
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
  • C07K14/70503—Immunoglobulin superfamily
  • C07K14/7051—T-cell receptor (TcR)-CD3 complex
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/1034—Isolating an individual clone by screening libraries
  • C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/1034—Isolating an individual clone by screening libraries
  • C12N15/1041—Ribosome/Polysome display, e.g. SPERT, ARM
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
  • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
  • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
  • G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
  • G01N2333/7051—T-cell receptor (TcR)-CD3 complex
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
  • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
  • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
  • G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
  • G01N2333/70539—MHC-molecules, e.g. HLA-molecules

Definitions

• the invention relates to a diverse library of nucleoproteins each displaying on its surface a polypeptide comprising a native TCR ⁇ variable domain sequence or native TCR ⁇ variable domain sequence, in which library the diversity resides in the variety of native TCR ⁇ variable domain or native TCR ⁇ variable domain sequences displayed.
• a library is usefule for identifying a ligand or ligands of a target peptide-MHC (pMHC) complex or CD 1 -antigen.
• WO 99/60120 TCRs mediate the recognition of specific Major Histocompatibihty Complex (MHC)-peptide complexes by T cells and, as such, are essential to the functioning of the cellular arm of the immune system.
• MHC Major Histocompatibihty Complex
• Antibodies and TCRs are the only two types of molecules which recognise antigens in a specific maimer, and thus the TCR is the only receptor for particular peptide antigens presented in MHC, the alien peptide often being the only sign of an abnormality within a cell.
• T cell recognition occurs when a T-cell and an antigen-presenting cell
• APC antigen-specific TCRs with pMHC complexes.
• the native TCR is a heterodimeric cell surface protein of the immunoglobulin superfamily which is associated with invariant proteins of the CD3 complex involved in mediating signal transduction.
• TCRs exist in ⁇ and ⁇ forms, which are structurally similar but have quite distinct anatomical locations and probably functions.
• the MHC class I and class II ligands are also immunoglobulin superfamily proteins but are specialised for antigen presentation, with a highly polymorphic peptide binding site which enables them to present a diverse array of short peptide fragments at the APC cell surface. Two further classes of proteins are known to be capable of functioning as TCR ligands.
• CD1 antigens are MHC class I-related molecules whose genes are located on a different chromosome from the classical MHC class I and class II antigens.
• CD1 molecules are capable of presenting peptide and non-peptide (e.g. lipid, glycolipid) moieties to T cells in a manner analogous to conventional class I and class II-MHC- pep complexes. See, for example (Barclay et al, (1997) The Leucocyte Antigen Factsbook 2 nd Edition, Academic Press) and (Bauer (1997) Eur J Immunol 27 (6) 1366-1373))
• Bacterial superantigens are soluble toxins which are capable of binding both class II MHC molecules and a subset of TCRs. (Fraser (1989) Nature 339
• the extracellular portion of native heterodimeric ⁇ and ⁇ TCRs consist of two polypeptides each of which has a membrane-proximal constant domain, and a membrane-distal variable domain.
• Each of the constant and variable domains includes an intra-chain disulfide bond.
• the variable domains contain the highly polymorphic loops analogous to the complementarity determining regions (CDRs) of antibodies.
• TCR variable domain sequences is generated via somatic rearrangement of linked variable (V), diversity (D), joining (J), and constant genes
• ⁇ and ⁇ chain polypeptides are formed by rearranged V-J-C regions, whereas ⁇ and ⁇ chains consist of V-D-J-C regions.
• the extracellular constant domain has a membrane proximal region and an immunoglobulin region.
• TRAC and TRDC single ⁇ and ⁇ chain constant domains
• TRBCl and TRBC2 LMGT nomenclature
• TCR extracellular domains The extent of each of the TCR extracellular domains is somewhat variable. However, a person skilled in the art can readily determine the position of the domain boundaries using a reference such as The T Cell Receptor Facts Book, Lefranc & Lefranc, Publ. Academic Press 2001.
• TCRs The production of recombinant TCRs is beneficial as these provide soluble TCR analogues suitable for the following purposes: • Studying the TCR / ligand interactions (e.g. pMHC for ⁇ TCRs) • Screening for inhibitors of TCR-associated interactions • Providing the basis for potential therapeutics
• Single-chain TCRs are artificial constructs consisting of a single amino acid strand, which like native heterodimeric TCRs bind to MHC-peptide complexes.
• TCRs can be recognised by TCR-specific antibodies, none were shown to recognise its native ligand at anything other than relatively high concentrations and/or were not stable.
• a soluble TCR which is correctly folded so that it is capable of recognising its native ligand, is stable over a period of time, and can be produced in reasonable quantities.
• This TCR comprises a TCR ⁇ or ⁇ chain extracellular domain dimerised to a TCR ⁇ or ⁇ chain extracellular domain respectively, by means of a pair of C-terminal dimerisation peptides, such as leucine zippers.
• This strategy of producing TCRs is generally applicable to all TCRs.
• Such particles may serve as purification aids for the peptide or polypeptide (since the particles carrying the peptide or polypeptide may be separated from unwanted contaminants by sedimentation or other methods). They may also serve as particulate vaccines, the immune response to the surface displayed peptide or polypeptide being stimulated by the particulate presentation.
• Protein p24 of the yeast retrotransposon, and the hepatitis B surface coat protein are examples of proteins which self assemble into particles. Fusion of the peptide or polypeptide of interest to these particle-forming proteins is a recognised way of presenting the peptide or polypeptide on the surface of the resultant particles.
• particle display methods have primarily been used to identify proteins with desirable properties such as enhanced expression yields, binding and/or stability characteristics. These methods involve creating a diverse pool or 'library' of proteins or polypeptides expressed on the surface of nucleoprotein particles. These particles have two key features, firstly each particle presents a single variant protein or polypeptide, and secondly the genetic material encoding the expressed protein or polypeptide is associated with that of the particle. This library is then subjected to one or more rounds of selection. For example, this may consist of contacting a ligand with a particle-display library of mutated receptors and identifying which mutated receptors bind the ligand with the highest affinity. Once the selection process has been completed the receptor or receptors with the desired properties can be isolated, and their genetic material can be amplified in order to allow the receptors to be sequenced.
• All in-vivo display methods rely on a step in which the library, usually encoded in or with the genetic nucleic acid of a replicable particle such as a plasmid or phage replicon is transformed into cells to allow expression of the proteins or polypeptides.
• a replicable particle such as a plasmid or phage replicon
• In-vivo display methods include cell-surface display methods in which a plasmid is introduced into the host cell encoding a fusion protein consisting of the protein or polypeptide of interest fused to a cell surface protein or polypeptide. The expression of this fusion protein leads to the protein or polypeptide of interest being displayed on the surface of the cell. The cells displaying these proteins or polypeptides of interest can then be subjected to a selection process such as FACS and the plasmids obtained from the selected cell or cells can be isolated and sequenced.
• a selection process such as FACS
• In-vitro display methods are based on the use of ribosomes to translate libraries of mRNA into a diverse array of protein or polypeptide variants.
• the linkage between the proteins or polypeptides formed and the mRNA encoding these molecules is maintained by one of two methods.
• Conventional ribosome display utilises mRNA sequences that encode a short (typically 40-100 amino acid ) linker sequence and the protein or polypeptide to be displayed.
• the linker sequence allow the displayed protein or polypeptide sufficient space to re-fold without being sterically hindered by the ribosome.
• the mRNA sequence lacks a 'stop' codon, this ensures that the expressed protein or polypeptide and the RNA remain attached to the ribosome particle.
• the related mRNA display method is based on the preparation of mRNA sequences encoding the protein or polypeptide of interest and DNA linkers carrying a puromycin moiety. As soon as the ribosome reaches the mRNA/DNA junction translation is stalled and the puromycin forms a covalent linkage to the ribosome.
• the phage display technique which is based on the ability of bacteriophage particles to express a heterologous peptide or polypeptide fused to their surface proteins. (Smith (1985) Science 217 1315-1317). The procedure is quite general, and well understood in the art for the display of polypeptide monomers. However, in the case of polypeptides that in their native form associate as dimers, only the phage display of antibodies appears to have been thoroughly investigated.
• Method A by inserting into a vector (phagemid) DNA encoding the heterologous peptide or polypeptide fused to the DNA encoding a bacteriophage coat protein.
• the expression of phage particles displaying the heterologous peptide or polypeptide is then carried out by transfecting bacterial cells with the phagemid, and then infecting the transformed cells with a 'helper phage'.
• the helper phage acts as a source of the phage proteins not encoded by the phagemid required to produce a functional phage particle.
• Method B by inserting DNA encoding the heterologous peptide or polypeptide into a complete phage genome fused to the DNA encoding a bacteriophage coat protein.
• the expression of phage particles displaying the heterologous peptide or polypeptide is then carried out by infecting bacterial cells with the phage genome.
• a variation on (Method B) the involves adding a DNA sequence encoding a nucleotide binding domain to the DNA in the phage genome encoding the heterologous peptide be displayed, and further adding the corresponding nucleotide binding site to the phage genome. This causes the heterologous peptide to become directly attached to the phage genome. This peptide/genome complex is then packaged into a phage particle which displays the heterologous peptide. This method is fully described in WO 99/11785. The phage particles can then be recovered and used to study the binding characteristics of the heterologous peptide or polypeptide.
• phagemid or phage DNA can be recovered from the peptide- or polypeptide-displaying phage particle, and this DNA can be replicated via PCR.
• the PCR product can be used to sequence the heterologous peptide or polypeptide displayed by a given phage particle.
• a third phage display method (Method C) relies on the fact that heterologous polypeptides having a cysteine residue at a desired location can be expressed in a soluble form by a phagemid or phage genome, and caused to associate with a modified phage surface protein also having a cysteine residue at a surface exposed position, via the formation of a disulphide linkage between the two cysteines.
• WO 01/ 05950 details the use of this alternative linkage method for the expression of single-chain antibody- derived pep tides.
• TCRs Native TCR's are heterodimers which have lengthy fransmembrane domains which are essential to maintain their stability as functional dimers. As discussed above, TCRs are useful for research and therapeutic purposes in their soluble forms so display of the insoluble native form has little utility. There have been a number of publications relating to various means of TCR display which are summarised below:
• WO 99/18129 contains the statement: "DNA constructs encoding the sc-TCR fusion proteins can be used to make a bacteriophage display library in accordance with methods described in pending U.S. application Serial No. 08/813.781 filed on March 7, 1997, the disclosure of which is incorporated herein by reference.”, but no actual description of such display is included in this application. However, The inventors of this application published a paper (Weidanz (1998) J Immunol Methods 221 59-76) that demonstrates the display of two murine scTCRs on phage particles.
• WO 01/62908 discloses methods for the phage display of scTCRs and scTCR/ Ig fusion proteins. However, the functionality (specific pMHC binding) of the constructs disclosed was not assessed.
• a retrovirus-mediated method for the display of diverse TCR libraries on the surface of immature T cells has been demonstrated for a murine TCR.
• the library of mutated TCRs displayed of the surface of the immature T cells was screened by flow cytometry using pMHC teframers, and this lead to the identification TCR variants that were either specific for the cognate pMHC, or a variant thereof. (Helmut et al, (2000) PNAS 97 (26) 14578-14583)
• the inventors' co-pending application (PCT/GB2003/04636) is appended hereto as Appendix A.
• This co-pending application is based in part on the finding that functional single chain and dimeric TCRs can be expressed as surface fusions to nucleoprotein particles, and makes available nucleoprotein particles displaying alpha/beta-analogue and gamma delta-analogue scTCR and dTCR constructs.
• the nucleoprotein particles on which the TCRs are displayed are preferably phage particles but also include self- aggregating particle-forming proteins, virus-derived and ribosome particles.
• nucleoprotein particle-displayed TCRs are useful for purification and screening purposes, particularly as a diverse library of particle displayed TCRs for biopanning to identify TCRs with desirable characteristics such as high affinity for the target MHC- peptide complex.
• particle-displayed scTCRs may be useful for identification of the desired TCR, but that information may be better applied to the construction of analogous dimeric TCRs for ultimate use in therapy.
• the invention also includes high affinity TCRs identifiable by these methods.
• the displayed TCRs comprise native variable domains attached to the nucleoprotein of choice, which is preferably a ribosome or phage particle, and most preferably a phage particle.
• the present invention make available for the first time libraries containing a diverse array of native TCR variable domains displayed on the surface of nucleoproteins.
• the present invention also provides methods using said libraries for the isolation of a ligand or ligands of a target peptide-MHC (pMHC) complex or CD 1 -antigen complex.
• pMHC target peptide-MHC
• the first step in the production of a diverse library comprising native TCR ⁇ and/or native TCR ⁇ variable domains is the isolation of DNA encoding a range of native TCR variable domains.
• suitable primers for this isolation step can be prepared by reference to the sequences of the V ⁇ genes and C ⁇ gene of TCR ⁇ chains, and the V ⁇ genes and C ⁇ genes of TCR ⁇ chain respectively.
• the gene sequence of all known TCR C and V genes can be found in The T Cell
• peripheral blood mononucleate cells PBMCs
• cDNA is then prepared from the PMBCs and used as the template for polymerase chain reaction (PCR)-based amplification of the TCR variable domains.
• PCR polymerase chain reaction
• the isolated PCR products comprising the variable domain Open Reading Frames (ORFs) are then cloned into expression systems that allow the gene product of the various variable genes to be expressed in a functional form on the surface of a nucleoprotein. Appendix A hereto describes such expression systems and methods.
• the invention provides a diverse library of nucleoproteins each displaying on its surface a polypeptide comprising a native TCR variable domain sequence or native TCR ⁇ variable domain sequence, in which library the diversity resides in the variety of native TCR ⁇ variable domain or native TCR ⁇ variable domain sequences displayed.
• nucleoproteins are phage or ribosome particles.
• Appendix A appended hereto provides a detailed description of the methods required to display single-chain TCRs (scTCRs) on ribosomes.
• At least some of the displayed polypeptides comprise a native TCR ⁇ variable domain sequence located N-terminal to part of a TCR ⁇ chain which includes all or part of a TCR ⁇ constant domain sequence except the transmembrane domain thereof.
• At least some of the displayed polypeptides comprise a native TCR ⁇ variable domain sequence located N-terminal to part of a TCR ⁇ chain which includes all or part of a TCR ⁇ constant domain sequence except the transmembrane domain thereof.
• phage particles displaying a murine TCR ⁇ chain in the absence of the respective TCR ⁇ chain to a peptide immobilised in microtitre wells that the complete TCR would normally respond to when there were presented by the murine Class I MHC I-A d .
• the present invention provides the first indication that a phage particle displaying a polypeptide comprising a TCR ⁇ or ⁇ variable domain, absent an associated second TCR variable domain can bind a pMHC.
• a first displayed polypeptide comprising the native TCR ⁇ variable domain sequence or native TCR ⁇ variable domain sequence is associated with a second polypeptide comprising a native TCR variable domain sequence located N-terminal to part of a TCR chain which includes all or part of a TCR constant domain sequence except the transmembrane domain thereof, said association being maintained at least in part by a disulfide bond which has no equivalent in native ⁇ T cell receptors between introduced cysteine residues in the
• TCR constant domain sequences of the first and second polypeptides are identical to the first and second polypeptides.
• first and second polypeptides are linked by a disulfide bond between cysteine residues substituted for Thr 48 of exon 1 of TRAC*01 and Ser 57 of exon 1 of TRBC1*01 or TRBC2*01 or the non-human equivalent thereof.
• a further embodiment of the invention is provided by phage particles or ribosomes on which the first displayed polypeptide is linked by a peptide bond at its C-terminus to a surface exposed amino acid residue of the phage particle or ribosome.
• the TCR libraries described above are suitable for the identification of pMHC or CDl-antigen ligands.
• the presence and/or expression level of certain pMHC on the surface of a given cell is related to the disease-state of that cell.
• certain cancers express the NY-ESO-1 protein and this leads to MHC molecules on the surface of such cancer cells presenting peptides derived from the NY-ESO-1 protein.
• the SLLMWITQC-HLA-A*0201 complex is an example of such a cancer-related pMHC which is expressed by NY-ESO-l + cancer cells.
• the isolation of ligands, such as TCRs, which bind to these disease and cancer-related pMHC molecules provides a basis for targeting moieties capable of delivering therapeutic and/or diagnostic agents agents to the diseased or cancerous cells.
• One embodiment of the invention provides a method of identifying a ligand or ligands of a target peptide-MHC (pMHC) complex or CDl-antigen, which method comprises
• step (f) selecting one or more TCRs having the desired affinity and/or off-rate determined in step (b) or optional step (e) as the desired ligand(s).
• a specific embodiment of the invention is provided wherein (a) above involves contacting several members of a library of the invention in parallel with an antigen- presenting cell which presents the target pMHC or CDl-antigen and identifying members which bind to the cell-presented target pMHC or CDl-antigen.
• a further specific embodiment of the invention is provided a method comprising the following steps prior to step (a) (i) several members of the library are contacted in parallel with an antigen- presenting cell which does not present the target pMHC or CDl-antigen
• step (ii) members identified in step (i) as not binding to the antigen presenting cell are used as the several members of the library referred to in step (a).
• steps (i) and (ii) are useful in that they provide an initial check on the specificity of the library members selected by the screening method. This may result in the elimination of some cross-reactive library members that could have been selected as "hits" absent steps (i) and (ii).
• a further specific embodiment of the invention is provided wherein the antigen- presenting cell which presents the target pMHC or CDl-antigen is caused to present said target pMHC or CDl-antigen by peptide-pulsing or antigen-pulsing.
• the antigen- presenting cell which presents the target pMHC or CDl-antigen is a non-peptide- pulsed antigen presenting cell. Any disease-related or cancerous antigen-presenting cell may be used in this regard.
• the above methods and nucleoprotein library of the invention enable identification of ⁇ dTCRs, TCR ⁇ -chains, TCR ⁇ -chains, TCR ⁇ homodimers and/or TCR ⁇ homodimers that will bind to the target pMHC or CDl-antigen
• a suitable method for determining the affinity and/or off-rate for the target pMHC is/are determination by Surface Plasmon Resonance.
• Example 5 herein provides a detailed description of how such measurements are carried out.
• TCR polypeptides comprise a first polypeptide wherein a sequence corresponding to a TCR ⁇ chain variable domain sequence is fused to the N terminus of a sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence, and a second polypeptide wherein a sequence corresponding to a TCR ⁇ chain variable domain sequence fused to the N terminus a sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence, the first and second polypeptides being linked by a disulfide bond which has no equivalent in native ⁇ T cell receptors, and wherein one of said first or second polypeptides is linked by a peptide bond at its C-terminus to a surface exposed amino acid residue of the phage particle.
• the first and second TCR polypeptides are linked by a disulfide bond between cysteine residues substituted for Thr 48 of exon 1 of TRAC*01 and Ser 57 of exon 1 of TRBC1*01 or TRBC2*01 or the non-human equivalent thereof, and one of said first or second polypeptides are linked by a peptide bond at its C-terminus to a surface exposed amino acid residue of the phage particle.
• LMGT ImMunoGeneTics
• the phage-displayed ⁇ scTCRpolypeptide may be, for example, one which has a first segment constituted by an amino acid sequence corresponding to a TCR ⁇ variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence, a second segment constituted by an amino acid sequence corresponding to a TCR ⁇ chain variable domain fused to the N terminus of an amino acid sequence corresponding to TCR ⁇ chain constant domain extracellular sequence, a linker sequence linking the C terminus of the first segment to the N terminus of the second segment, or vice versa, and a disulfide bond between the first and second chains, said disulfide bond being one which has no equivalent in native ⁇ T cell receptors.
• the displayed scTCR polypeptide may be one which has a first segment constituted by an amino acid sequence corresponding to a TCR ⁇ chain variable domain a second segment constituted by an amino acid sequence corresponding to a TCR ⁇ chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence, and a linker sequence linking the C terminus of the first segment to the N terminus of the second segment, or
• first segment constituted by an amino acid sequence corresponding to a TCR ⁇ chain variable domain
• second segment constituted by an amino acid sequence corresponding to a TCR ⁇ chain variable domain sequence fused to the N terminus of an amino acid sequence corresponding to a TCR ⁇ chain constant domain extracellular sequence
• linker sequence linking the C terminus of the first segment to the N terminus of the second segment
• the constant domain extracellular sequences present in the displayed scTCR polypeptides or dTCR polypeptides preferably correspond to those of a human TCR, as do the variable domain sequences.
• the correspondence between such sequences need not be 1 : 1 on an amino acid level.
• N- or C-truncation, and/or amino acid deletion and/or substitution relative to the corresponding human TCR sequences are acceptable.
• the constant domain extracellular sequences present in the first and second segments are not directly involved in contacts with the ligand to which the scTCR or dTCR binds, they may be shorter than, or may contain substitutions or deletions relative to, extracellular constant domain sequences of native
• the constant domain extracellular sequence present in one of the displayed dTCR polypeptide pair, or in the first segment of a displayed scTCR polypeptide may include a sequence corresponding to the extracellular constant Ig domain of a TCR ⁇ chain, and/or the constant domain extracellular sequence present in the other member of the pair or second segment may include a sequence corresponding to the extracellular constant Ig domain of a TCR ⁇ chain.
• one member of the displayed dTCR polypeptide pair, or the first segment of the displayed scTCR polypeptide corresponds to substantially all the variable domain of a TCR ⁇ chain fused to the N terminus of substantially all the extracellular domain of the constant domain of an TCR ⁇ chain; and/or the other member of the pair or second segment corresponds to substantially all the variable domain of a TCR ⁇ chain fused to the N terminus of substantially all the extracellular domain of the constant domain of a TCR ⁇ chain.
• the constant domain extracellular sequences present in the displayed dTCR polypeptide pair, or first and second segments of the displayed scTCR polypeptide correspond to the constant domains of the ⁇ and ⁇ chains of a native TCR truncated at their C termini such that the cysteine residues which form the native inter-chain disulfide bond of the TCR are excluded.
• those cysteine residues may be substituted by another amino acid residue such as serine or alanine, so that the native disulfide bond is deleted.
• the native TCR ⁇ chain contains an unpaired cysteine residue and that residue may be deleted from, or replaced by a non-cysteine residue in, the ⁇ sequence of the scTCR of the invention.
• the TCR ⁇ and ⁇ chain variable domain sequences present in the displayed dTCR polypeptide pair, or first and second segments of the displayed scTCR polypeptide may together correspond to the functional variable domain of a first TCR, and the TCR ⁇ and ⁇ chain constant domain extracellular sequences present in the dTCR polypeptide pair or first and second . segments of the scTCR polypeptide may correspond to those of a second TCR, the first and second TCRs being from the same species.
• the a and ⁇ chain variable domain sequences present in dTCR polypeptide pair, or first and second segments of the scTCR polypeptide may correspond to those of a first human TCR
• the ⁇ and ⁇ chain constant domain extracellular sequences may correspond to those of a second human TCR.
• A6 Tax sTCR constant domain extracellular sequences can be used as a framework onto which heterologous ⁇ and ⁇ variable domains can be fused.
• the TCR ⁇ and ⁇ chain variable domain sequences present in the displayed dTCR polypeptide pair or first and second segments of the displayed scTCR polypeptide may together correspond to the functional variable domain of a first human TCR, and the TCR ⁇ and ⁇ chain constant domain extracellular sequences present in the dTCR polypeptide pair or first and second segments of the scTCR polypeptide may correspond to those of a second non- human TCR,
• the ⁇ and ⁇ chain variable domain sequences present dTCR polypeptide pair or first and second segments of the scTCR polypeptide may correspond to those of a first human TCR, and the ⁇ and ⁇ chain constant domain extracellular sequences may correspond to those of a second non-human TCR.
• murine TCR constant domain extracellular sequences can be used as a framework onto which heterologous human ⁇ and ⁇ TCR variable domains can be fused.
• a linker sequence links the first and second TCR segments, to form a single polypeptide strand.
• the linker sequence may, for example, have the formula -P-AA-P- wherein P is proline and AA represents an amino acid sequence wherein the amino acids are glycine and serine.
• the first and second segments are preferably paired so that the variable domain sequences thereof are orientated for such binding.
• the linker should have sufficient length to span the distance between the C temiinus of the first segment and the N terminus of the second segment, or vice versa.
• excessive linker length should preferably be avoided, in case the end of the linker at the N-terminal variable domain sequence blocks or reduces bonding of the scTCR to the target ligand.
• the constant domain extracellular sequences present in the first and second segments correspond to the constant domains of the ⁇ and ⁇ chains of a native TCR truncated at their C termini such that the cysteine residues which form the native interchain disulfide bond of the TCR are excluded, and the linker sequence links the C terminus of the first segment to the N terminus of the second segment.
• the linker sequence may consist of, for example, from 26 to 41 amino acids, preferably 29, 30, 31 or 32 amino acids, or 33, 34, 35 or 36 amino acids.
• Particular linkers have the formula -PGGG-(SGGGG) 5 -P- (SEQ LD NO: 1) and -PGGG-
• a principle characterising feature of the preferred dTCR polypeptides and scTCR polypeptides displayed by nucleoproteins of the present invention is a disulfide bond between the constant domain extracellular sequences of the dTCR polypeptide pair or first and second segments of the scTCR polypeptide. That bond may correspond to the native inter-chain disulfide bond present in native dimeric ⁇ TCRs, or may have no counterpart in native TCRs, being between cysteines specifically incorporated into the constant domain extracellular sequences of dTCR polypeptide pair or first and second segments of the scTCR polypeptide. In some cases, both a native and a non-native disulfide bond may be desirable.
• WO 03/020763 provides a detailed description of the methods required to introduce the specified non-native disulfide interchain bond and alternative residues between which it may be sited.
• Required to prepare a diverse library of polypeptides comprising native TCR ⁇ and/or ⁇ variable domains are nucleic acids encoding (a) one chain or both chains of a dTCR polypeptide pair fused to a nucleic acid sequence encoding a protein capable of forming part of the surface of a nucleoprotein particle; or (b) nucleic acid encoding a scTCR polypeptide fused to a nucleic acid sequence encoding a protein capable of forming part of the surface of a nucleoprotein particle.
• host cells may be used transformed with an expression vector comprising nucleic acid encoding (a) or (b).
• the expression system comprises phagemid or phage genome vectors expressing nucleic acids (a) or (b).
• these phagemid or phage genome vectors is (are) those which encode bacteriophage gill or gVIII coat proteins.
• Transformed cells are incubated to allow the expression of nucleoprotein particles displaying the polypeptides comprising native TCR ⁇ and/or native TCR ⁇ variable domains. These particles can then be used in assays to identify TCR variants which bind to a given pMHC or CDl-antigen complex with the desired affinity and or off- rate characteristics. Any particles that possess the desired characteristics under investigation can then be isolated. The DNA encoding these TCRs can then be amplified by PCR and the sequence determined.
• Correct pairing of scTCR polypeptide variable domain sequences after expression is preferably assisted by an introduced disulfide bond in the extracellular constant domain of the scTCR.
• the novel disulfide bond is believed to provide extra stability to the scTCR during the folding process and thereby facilitating correct pairing of the first and second segments.
• one of the dTCR polypeptide pair is expressed as if it were eventually to be displayed as a monomeric polypeptide on the phage, and the other of the dTCR polypeptide pair is co-expressed in the same host cell.
• the phage particle self assembles, the two polypeptides self associate for display as a dimer on the phage.
• correct folding during association of the polypeptide pair is assisted by a disulfide bond between the constant sequences. Further details of a procedure for phage display of a dTCR having an interchain disulfide bond appear in the Examples contained within Appendix A.
• the phage displaying the first chain of the dTCR may be expressed first, and the second chain polypeptide may be contacted with the expressed phage in a subsequent step, for association as a functional dTCR on the phage surface.
• RNA polymerase RNA polymerase
• the mRNA sequences can then be ligated to a DNA sequence comprising a puromycin binding site.
• ribosomes in-vitro under conditions allowing the translation of the scTCR polypeptide or the first polypeptide of the dTCR polypeptide pair.
• the second of the polypeptide pairs is separately expressed and contacted with the ribosome-displayed first polypeptide, for association between the two, preferably assisted by the formation of the disulphide bond between constant domains.
• mRNA encoding both chains of the dTCR polypeptide may be contacted with ribosomes in-vitro under conditions allowing the translation of the TCR chains such that a ribosome displaying a dTCR polypeptide pair is formed.
• scTCR- or dTCR-disp laying ribosomes can then used for screening or in assays to identify desired ligands. Any particles that display desired ligands can then be isolated.
• the mRNA encoding these TCRs can then converted to the complementary DNA sequences using reverse transcriptase. This DNA can then be amplified by PCR and the sequence determined.
• scTCR polypeptides or dTCR polypeptide pairs of the present invention may be displayed on nucleoprotein particles, for example phage particles, preferably filamentous phage particles, by, for example, the following two means:
• the C-terminus of one member of the dTCR polypeptide pair, or the C-terminus of the scTCR polypeptide, or the C-terminus of a short peptide linker attached to the C- terminus of either, can be directly linked by a peptide bond to a surface exposed residue of the nucleoprotein particle.
• the said surface exposed residue is preferably at the N-terminus of the gene product of bacteriophage gene III or gene VIII;
• the C-terminus of one member of the dTCR polypeptide pair, or the C-terminus of the scTCR polypeptide, or the C-terminus of a short peptide linker attached to the C- terminus of either, is linked by a disulfide bond to a surface exposed cysteine residue of the nucleoprotein particle via an introduced cysteine residue.
• the said surface exposed residue is again preferably at the N-terminus of the gene product of bacteriophage gene III or gene VIII.
• Ml 3 and fl are examples of bacteriophages that express gene III and gene VIII gene products.
• nucleic acid encoding the TCR may be fused to nucleic acid encoding the particle forming protein or a surface protein of the replicable particle such as a phage or cell.
• RNA may be translated by ribosome such that the TCR remains fused to the ribosome particle, hi the case of a dTCR, nucleic acid encoding one chain of the TCR may be fused to nucleic acid encoding the particle forming protein or a cell surface protein of the replicable particle such as a phage or cell, and the second chain of the TCR polypeptide pair may be allowed to associate with the resultant expressed particle displaying the first chain.
• Proper functional association of the two chains may be assisted by the presence of cysteines in the constant domain of the two chains which are capable of forming an interchain disulfide bond, as more fully discussed below.
• a ligand (which preferably is constituted by constant and variable sequences corresponding to human sequences) isolated by the method of the invention may be provided in substantially pure form, or as a purified or isolated preparation. For example, it may be provided in a form which is substantially free of other proteins.
• the invention also provides a method for obtaining a ligand selected by the method of this invention, which method comprises incubating a host cell comprising nucleic acid encoding that ligand, or of the individual polypeptides of the pair comprising the ligand, under conditions causing expression of the ligand or ligand component, and then purifying said ligand or hgand component.
• dTCR polypeptide hgands can then be formed by refolding the purified ligand components as described in Example 4.
• Preferred features of each aspect of the invention are as for each of the other aspects mutatis mutandis.
• the prior art documents mentioned herein are incorporated to the fullest extent permitted by law.
• Figure 1 details the DNA sequence of the pEX922_lG4 plasmid.
• Figure 2 is a plasmid map of pEX922_lG4
• V ⁇ and V ⁇ non-immunised native chain repertoire could be amplified by PCR from cDNA template prepared from total RNA isolated from the peripheral blood cells of 20 healthy individuals with serological specificity for HLA-A2. Pooled V ⁇ and pooled V ⁇ amplification products were subjected to a second round of PCR using common flanking primers in order to introduce sufficiently long constant domain tags. Separate V ⁇ and V ⁇ fragment pools comprising highly diverse native TCR V ⁇ and V ⁇ DNA sequences with a portion of the corresponding constant domain DNA fused at the 3 ' ends thereof were thus generated.
• PBMC samples stored in liquid nitrogen were gently thawed and cells were pelleted in a microfuge at 2000rpm for 2 min. Supernatants were removed and Total RNA was isolated from cell pellets using QIAshredder spin modules and an RNeasy kit (Qiagen) with adherence to the manufacturers guidelines. The total RNA from each PBMC sample was recovered in 50 ⁇ l of RNAse free water and it's integrity checked by agarose gel electrophoresis.
• RNA from each of 20 samples was pooled (5 ⁇ l per sample) and cDNA was synthesised as follows: A reaction containing 20 ⁇ l 0.5 ⁇ g/ ⁇ l oligo(dT) 12-18 (Invitrogen), lOO ⁇ l pooled RNA, 40 ⁇ l dNTPs (5mM each dNTP; Abgene) and 80 ⁇ l sterile water was set up on ice prior to being heated to 65°C for 5 min. The reaction was rapidly chilled on ice and the contents collected by brief centrifugation before adding 80 ⁇ l 5 x first strand synthesis buffer, 40 ⁇ l 0.1M DTT, and 20 ⁇ l sterile water.
• the solution was mixed by gentle pipetting and incubated at 42°C for 2 min prior to the addition of 20 ⁇ l Superscript II reverse transcriptase (Invitrogen).
• the cDNA synthesis reaction was mixed by gentle pipetting and allowed to proceed for lhr at
• PCR1 Amplification of V and V ⁇ native sequences from cDNA: In order to amplify individual V ⁇ and V ⁇ class repertoires from cDNA, discrete PCR reactions were assembled as follows: 39 ⁇ l water, 5 ⁇ l Expand polymerase buffer 2 (Roche), 2 ⁇ l dNTPs (20mM combined stock; Abgene), l ⁇ l TRAV_R or TRBV_R reverse primer (lO ⁇ M stock), l ⁇ l class-specific forward primer (lO ⁇ M stock), l ⁇ l cDNA, and l ⁇ l Expand DNA polymerase (Roche) to give a total volume of 50 ⁇ l.
• PCR cycling was as follows: 94°C for 2 min followed by 35 cycles of 94°C for 15 sec, 55°C for 30 sec, 72°C for 45 sec + 1 sec/cycle. A final extension of 10 min at 72°C was allowed.
• the 43 V ⁇ class-specific PCR reactions were pooled as were the 37 V ⁇ (37) and electrophoresed through a preparative 1.5% agarose gel. Bands of the correct size were excised and gel purified using a Qiagen MinElute kit.
• PCR2 Nested tag modification of Va and V ⁇ products from PCR1:
• the existing terminal tags Prior to splicing of the V ⁇ and V ⁇ products from PCR1, the existing terminal tags were modified by limited PCR cycling in order to generate ends that would allow the complementary annealing of a vector-encoded joining fragment.
• the reactions were assembled as follows: 39.5 ⁇ l water, 5 ⁇ l pfu turbo polymerase lOx buffer (Stratagene), 2 ⁇ l dNTPs (20mM combined stock; Abgene), l ⁇ l TRAVFE or TRBVSF forward primer (lO ⁇ M stock), l ⁇ l TRAVSR or TRBV_R reverse primers (lO ⁇ M stock), l ⁇ l
• V ⁇ or V ⁇ amplicons from PCR1 and 0.5 ⁇ l pfu Turbo DNA polymerase (Stratagene) to give a total volume of 50 ⁇ l.
• PCR cycling was as follows: 94°C for 2 min followed by 20 cycles of 94°C for 15 sec, 55°C for 45 sec, 72°C for 45 sec. A final extension of 10 min at 72°C was allowed.
• the end modified V ⁇ and V ⁇ PCR reactions were electrophoresed through a preparative 1.5% agarose gel. Bands of the correct size were excised and gel purified using a Qiagen MinElute kit.
• PCR3 Generation of the vector-encoded joining fragment:
• the template for the reaction was pEX922_lG4 (FIG 1) containing irrelevant TCR alpha and beta chain DNA sequences. These sequences contain codons encoding the cysteine residues required for eventual formation of an introduced disulfide bond between constant domains of a soluble heterodimeric TCR (as described in, for example WO 03/020763)
• a fragment of plasmid pEX922_lG4 (shown in bold in FIG 1) comprising the sequence separating the V ⁇ domain from the start of the V ⁇ chain, and comprising the introduced TCR ⁇ chain cysteine codon referred to above (both introduced cysteine codon are shown highlighted in FIG 1) was amplified by limited PCR.
• the reaction was assembled as follows: 39.5 ⁇ l water, 5 ⁇ l pfu turbo polymerase lOx buffer (Stratagene), 2 ⁇ l dNTPs (20mM combined stock; Abgene), l ⁇ l TRAVSF forward primer (lO ⁇ M stock), l ⁇ l FABlink_R reverse primer (lO ⁇ M stock), l ⁇ l pEX922_lG4 vector template, and 0.5 ⁇ l pfu Turbo DNA polymerase (Stratagene) to give a total volume of 50 ⁇ l.
• PCR cycling was as follows: 94°C for 2 min followed by 20 cycles of
• the modified V ⁇ and V ⁇ fragments were randomly annealed to either end of the joining fragment prepared in PCR3 and were spliced in an overlap extension reaction by limited PCR cycling.
• the unit reaction was assembled as follows: 39.5 ⁇ l water,
• 5G1 pfu turbo polymerase lOx buffer (Stratagene), 2 ⁇ l dNTPs (20mM combined stock; Abgene), l ⁇ l TRAVFE forward primer (lO ⁇ M stock), l ⁇ l TRBV_R reverse primer (lO ⁇ M stock), l ⁇ l each of modified V ⁇ , V ⁇ , and joining fragment (lOng of each fragment), and 0.5 ⁇ l pfu Turbo DNA polymerase (Stratagene) to give a total volume of 50 ⁇ l. Multiple reactions were performed in parallel. PCR cycling was as follows: 94°C for 2 min followed by 20 cycles of 94°C for 30 sec, 59°C for 45 sec, 72°C for 90 sec. A final extension of 10 min at 72°C was allowed. The spliced V ⁇ and V ⁇ fragments reactions were electrophoresed through a preparative 1.0% agarose gel. A Band of the correct size was excised and gel purified using a Qiagen MinElute kit.
• the spliced and purified products of PCR4 were digested with Nco I and BspEI (restriction sites included in the V ⁇ forward primers used for PCRl and the TRB V_R V ⁇ constant domain primer) and ligated into a derivative of the pEX922_lG4 phage display vector (containing an engineered BspE I site in the V ⁇ constant domain sequence, and digested with the same) containing an irrelevant TCR V ⁇ and V ⁇ open reading frame, thus resulting in the substitution of the irrelevant sequence with a large and diverse population of randomly paired native chain sequences. Ligations were carried out at a 3:1 insert to vector ratio using T4 DNA ligase according to standard protocols.
• the ligated DNA was electroporated into TGI cells following concentration and desalting on Qiagen MinElute columns.
• Electroporation was performed according to the protocols provided by the commercial supplier of the cells (Stratagene) and using ratios of approximately l ⁇ g DNA per 50 ⁇ l electrocompetent cells. A total of ⁇ 20 ⁇ g of ligated DNA was electroporated.
• V ⁇ Tagged Forward Primer Set (all in the 5 '-3' direction)
• AV 13 (a) aaatactcagccggccatggcccag gagaatgtggagcagcatccttc AVI 3(b) aaatactcagccggccatggcccag gagagtgtggcgctgcatcttcc
• V ⁇ Tagged Forward Primer Set (all in the 5 '-3 ' direction):
• TRAV_R 5 Alpha Chain Constant Domain Reverse Primer: TRAV_R 5 '-attagtcttgaatttcgaatctctcagctggtacacggcMgggtcagg-3 '
• TRB V_R 5 -attcgtatagtttgcggccgctccggagtgcacctccttcccattcaccc-3 '
• V ⁇ Fragment Adaptor Forward Primer V ⁇ Fragment Adaptor Forward Primer
• TRBVSF 5 '-cctttctattctcacagcgcgcag-3 '
• Example 2 Isolation of TCRs that bind to a given target peptide-MHC complexe from a diverse phage library displaying native TCR variable domains
• TCRs that bind to a target peptide-MHC complex from the diverse phage library displaying native TCR variable domains described above was carried out as follows. The initial panning was carried utilising the selection of phage particles (prepared as described above) displaying native TCR variable domains.
• Streptavidin-coated paramagnetic beads (Roche) were pre-washed according to manufacturer's protocols. Phage particles, displaying native TCR variable domains at a concentration of 10 12 to 10 13 cfu in 3% powdered milk- PBS, were pre-mixed with biotinylated SLLMWITQC-HLA-A*0201 at a concentration of 500nM for all three rounds of selection carried out.
• the mixture of native TCR variable domain-displaying phage particles and SLLMW ⁇ TQC-HLA-A*0201 complex was incubated for one hour at room temperature with gentle rotation, and the native TCR variable domain- displaying phage particles bound to SLLMWITQC-HLA-A*0201 Phage biotynlated HLA complexes were rescued for 5 minutes with 100 ml of streptavidin-coated (Roche) magnetic beads which had been blocked with de-biotynalyted 3% Milk powder PBS. After capture of the phage particles, the beads were washed a total of six times (three times in PBS-0.1 % tween20 and three times in PBS) using a Dynal magnetic particle concentrator.
• SLLMWITQC-HLA-A*0201 complex plates and used to inoculate 100 ⁇ l of 2TYAG in a 96-well microtiter plate.
• the culture was incubated at 30°C with shaking overnight.
• 100 ⁇ l of 2TYAG was then sub-inoculated with 2 to 5 ⁇ l of the overnight cultures, and incubated at 30°C with shaking for 2 to 3 hours or until the culture became cloudy.
• helper phage the culture was infected with 100 ⁇ l of 2TYAG containing 5 x 10 9 pfu helper phages, and incubated at 37°C for 60 minutes.
• Phage clones which bound to the SLLMWITQC-HLA-A*0201 complex were found during the ELISA screening as determined by their strong ELISA signals (OD 600 0.3- 1) relative to control wells (OD 600 0.05). This therefore demonstrates that TCRs with the desired specificity had been isolated from said library.
• Such an approach allows one to isolate TCRs from a phage display library that are capable of binding to any peptide-MHC or CDl-antigen.
• the general approach involves phagemid DNA encoding the identified TCR being isolated from the relevant E.coli cells using a Mini- Prep kit (Quiagen, UK). PCR amplification can be carried out using the phagemid
• the PCR product is then digested with appropriate restriction enzymes and cloned into an E. coli expression vector with corresponding insertion sites.
• the amplified TCR a and ⁇ chain DNA sequences (which include, as described above, codons encoding the cysteines required to form the introduced constant domain interchain disulfide bond) are then used to produce a soluble TCR as described in WO 03/020763. Briefly, the two chains are expressed as inclusion bodies in separate E.coli cultures. The inclusion bodies are then isolated, de-natured and re-folded together in vitro.
• a surface plasmon resonance biosensor (Biacore 3000TM ) can be used to analyse the binding of an sTCR to its peptide-MHC ligand. This is facilitated by producing single pMHC complexes (described below) which are immobilised to a streptavidin-coated binding surface in a semi-oriented fashion, allowing efficient testing of the binding of a soluble T-cell receptor to up to four different pMHC (immobilised on separate flow cells) simultaneously. Manual injection of HLA complex allows the precise level of immobilised class I molecules to be manipulated easily.
• Biotinylated soluble peptide-MHC molecules are refolded in vitro from bacterially- expressed inclusion bodies containing the constituent subunit proteins and synthetic peptide, followed by purification and in vitro enzymatic biotinylation (O'Callaghan et al. (1999) Anal. Biochem. 266: 9-15). Heavy chain was expressed with a C-terminal biotinylation tag which replaces the transmembrane and cytoplasmic domains of the protein in an appropriate construct. Inclusion body expression levels of ⁇ 75 mg litre bacterial culture were obtained. The MHC light-chain or ⁇ 2-microglobulin was also expressed as inclusion bodies in E.coli from an appropriate construct, at a level of ⁇ 500 mg/litre bacterial culture.
• E. coli cells are lysed and inclusion bodies are purified to approximately 80% purity.
• Protein from inclusion bodies was denatured in 6 M guanidine-HCl, 50 mM Tris pH 8.1, 100 mM NaCl, 10 mM DTT, 10 mM EDTA, and are refolded at a concentration of 30 mg/litre heavy chain, 30 mg/litre ⁇ 2m into 0.4 M L-Arginine-HCl, 100 mM Tris pH 8.1, 3.7 mM cystamine, 6.6 mM ⁇ -cysteamine, 4 mg/ml of the peptide required to be loaded by the MHC molecule, by addition of a single pulse of denatured protein into refold buffer at ⁇ 5°C Refolding is allowed to reach completion at 4°C for at least 1 hour.
• Buffer is exchanged by dialysis in 10 volumes of 10 mM Tris pH 8.1. Two changes of buffer may be necessary to reduce the ionic strength of the solution sufficiently.
• the protein solution is then filtered through a 1.5 ⁇ m cellulose acetate filter and loaded onto a POROS 50HQ anion exchange column (8 ml bed volume). Protein is eluted with a linear 0-500 mM NaCl gradient. Peptide-MHC complex elutes at approximately 250 mM NaCl, and peak fractions are collected, a cocktail of protease inhibitors (Calbiochem) was added and the fractions were chilled on ice.
• Biotinylation tagged pMHC molecules are buffer exchanged into 10 mM Tris pH 8.1, 5 mM NaCl using a Pharmacia fast desalting column equilibrated in the same buffer. Immediately upon elution, the protein-containing fractions are chilled on ice and protease inhibitor cocktail (Calbiochem) was added. Biotinylation reagents are then added: 1 mM biotin, 5 mM ATP (buffered to pH 8), 7.5 mM MgC12, and 5 ⁇ g/ml BirA enzyme (purified according to O'Callaghan et al. (1999) Anal Biochem. 266: 9- 15). The mixture is then allowed to incubate at room temperature overnight.
• biotinylated peptide-MHC molecules are purified using gel filtration chromatography.
• a Pharmacia Superdex 75 HR 10/30 column is pre-equilibrated with filtered PBS and 1 ml of the biotinylation reaction mixture is loaded and the column is developed with PBS at 0.5 ml/min.
• Fractions containing biotinylated peptide-MHC are pooled, chilled on ice, and protease inhibitor cocktail is added. Protein concentration is determined using a Coomassie-binding assay (PerBio) and aliquots of biotinylated pHLA-A*0201 molecules are stored frozen at -20°C. Streptavidin is immobilised by standard amine coupling methods.
• Such immobilised complexes are capable of binding both T-cell receptors and the coreceptor CD8 ⁇ , both of which may be injected in the soluble phase. Specific binding of TCR is obtained even at low concentrations (at least 40 ⁇ g/ml), implying the TCR is relatively stable.
• the pMHC binding properties of sTCR are observed to be qualitatively and quantitatively similar if sTCR is used either in the soluble or immobilised phase. This is a control for partial activity of soluble species and also suggests that biotinylated pMHC complexes are biologically as active as non- biotinylated complexes.
• the interactions between the isolated TCRs containing a novel inter-chain bond and its ligand/ MHC complex or an irrelevant HLA-peptide combination, the production of which is described above, can be analysed on a Biacore 3000TM surface plasmon resonance (SPR) biosensor.
• SPR measures changes in refractive index expressed in response units (RU) near a sensor surface within a small flow cell, a principle that can be used to detect receptor ligand interactions and to analyse their affinity and kinetic parameters.
• the probe flow cells are prepared by immobilising the individual HLA- peptide complexes in separate flow cells via binding between the biotin cross linked onto ⁇ 2m and streptavidin which have been chemically cross linked to the activated surface of the flow cells.
• the assay can be performed by passing sTCR over the surfaces of the different flow cells at a constant flow rate, measuring the SPR response in doing so.
• Serial dilutions of the TCRs are prepared and injected at constant flow rate of 5 ⁇ l min-1 over two different flow cells; one coated with ⁇ 1000 RU of the target peptide- MHC complex, the second coated with -1000 RU of non-specific HLA-A2 -peptide complex.
• Response is normalised for each concentration using the measurement from the control cell. Normalised data response is plotted versus concentration of TCR sample and fitted to a hyperbola in order to calculate the equilibrium binding constant, K D - (Price & Dwek, Principles and Problems in Physical Chemistry for Biochemists
• K D was determined by experimentally measuring the dissociation rate constant, kd, and the association rate constant, ka.
• the equilibrium constant K D is calculated as kd/ka.
• TCR is injected over two different cells one coated with -300 RU of the target peptide-MHC complex, the second coated with -300 RU of non-specific HLA-A2 - peptide complex.
• Flow rate is set at 50 ⁇ l/min. Typically 250 ⁇ l of TCR at -3 ⁇ M concentration was injected. Buffer is then flowed over until the response had returned to baseline.
• Kinetic parameters are calculated using Biaevaluation software. The dissociation phase is also fitted to a single exponential decay equation enabling calculation of half-life.

Applications Claiming Priority (2)

Publications (1)

Family

ID=32671107

Family Applications (1)

Country Status (3)

Families Citing this family (16)

Citations (1)

Family Cites Families (7)

• 2004
  • 2004-05-26 GB GB0411771A patent/GB0411771D0/en not_active Ceased
• 2005
  • 2005-05-18 WO PCT/GB2005/001948 patent/WO2005116074A2/en not_active Application Discontinuation
  • 2005-05-18 EP EP05745014A patent/EP1781702A2/de not_active Withdrawn

Patent Citations (1)

Also Published As

Similar Documents

Legal Events