EP1781269A2 - IgE-RETARGETING, FUNCTION-ALTERING MOLECULES (ERFAM) FOR TREATMENT OF ALLERGIC DISEASES - Google Patents

IgE-RETARGETING, FUNCTION-ALTERING MOLECULES (ERFAM) FOR TREATMENT OF ALLERGIC DISEASES

Info

Publication number
EP1781269A2
EP1781269A2 EP05821176A EP05821176A EP1781269A2 EP 1781269 A2 EP1781269 A2 EP 1781269A2 EP 05821176 A EP05821176 A EP 05821176A EP 05821176 A EP05821176 A EP 05821176A EP 1781269 A2 EP1781269 A2 EP 1781269A2
Authority
EP
European Patent Office
Prior art keywords
erfam
ige
antibody
composition
binds
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP05821176A
Other languages
German (de)
French (fr)
Inventor
G. Dr. Paediatric Allergy & Immunology LACK
V. Dr. Imperial College London TURCANU
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
St Mary's Hospital NHS Trust
Ip2ipo Innovations Ltd
Original Assignee
St Mary's Hospital NHS Trust
Imperial College Innovations Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by St Mary's Hospital NHS Trust, Imperial College Innovations Ltd filed Critical St Mary's Hospital NHS Trust
Publication of EP1781269A2 publication Critical patent/EP1781269A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/42Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against immunoglobulins
    • C07K16/4283Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an allotypic or isotypic determinant on Ig
    • C07K16/4291Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an allotypic or isotypic determinant on Ig against IgE
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/283Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against Fc-receptors, e.g. CD16, CD32, CD64
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/16Aptamers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3513Protein; Peptide

Definitions

  • the invention relates to molecules that bind to IgE antibodies and convert them into allergen-dependent inhibitors of allergy. Such molecules are useful, e.g., for the treatment of allergy and other IgE related diseases.
  • An allergy is characterized by the production of IgE type antibodies that are specific for certain antigens (allergens), which trigger the immune response. Once these allergens enter the body, the presence of specific IgE triggers allergic reactions.
  • IgE antigens
  • the biology of IgE and its role in allergic diseases has been reviewed. See, e.g., Gould et ah, Annual Rev Immunol 2003, 21 :579-628.
  • IgE triggers allergic reactions when allergens enter the body because IgE establishes a link between the respective allergen and the triggering mechanism represented by the activation apparatus of allergy-effector cells. IgE establishes this link due to its bi-functional binding characteristics: at one end it has two allergen-specific binding sites (F antigen binding - Fab), while at the other end it binds to high-affinity IgE receptors (Fc ⁇ RI) with its constant binding site (Fc).
  • F antigen binding - Fab allergen-specific binding sites
  • Fc ⁇ RI high-affinity IgE receptors
  • Fc ⁇ RI molecules are themselves bi-functional molecules: their extracellular region binds IgE while their intracellular region contains activating sites that can trigger the activation signaling cascade.
  • a low-affinity IgE receptor (Fc ⁇ RII/CD23) may also be involved in allergy.
  • Altering Molecule (ERFAM) construct having the formula A'-B', wherein A' represents a moiety that binds an IgE and B' represents a moiety that binds an inhibitory receptor. In some embodiments, A' and B' are operably linked.
  • the ERFAM has the formula A'-X-B', wherein: A' represents a moiety that binds an IgE; X represents a linker moiety; and B' represents a moiety that binds an inhibitory receptor; wherein A'-X-B' are operably linked.
  • ERFAM constructs are useful for treating IgE related diseases and disorders, including allergic reactions to at least one allergen.
  • ERFAM binds to IgE and transforms it into an inhibitor of allergy.
  • ERFAM specifically recognizes and binds at least one, at least two, or at least three or more epitopes. This is also referred to as being at least monospecific, at least bispecific, or at least multi-specific.
  • the A' and B' portions of the ERFAM construct provide the first and second specificities.
  • a first specificity is for IgE and a second specificity is functionally equivalent for the Fc portion of an IgG4 antibody.
  • an at least bispecific ERFAM composition includes a first portion comprising an anti-IgE antibody moiety of IgG4 isotype, wherein said composition binds to at least one epitope comprising IgE but does not cross-link cell-bound IgE.
  • a first specificity is for IgE and a second specificity is for binding to an inhibitory cell surface receptor.
  • a specific alternative bispecific ERFAM composition includes a structure that recognizes and binds to an inhibitory cell surface receptor selected from the group consisting of an immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing receptor and an apoptosis-inducing receptor.
  • ITIM immunoreceptor tyrosine-based inhibitory motif
  • the invention encompasses an EKFAM molecule that contains an allergen-specific IgG4 antibody.
  • at least one A' moiety or at least one B 1 moiety is a cyclic peptide that spontaneously linearizes only when bound to IgE.
  • the cyclic peptide specifically binds an IgE molecule in order to linearize.
  • an ERFAM molecule containing the at lease one IgE specific cyclic peptide binds Fc ⁇ R or a corresponding inhibitory receptor after the cyclic peptide linearizes after binding IgE.
  • linker X that operationally link at least one A' moiety to at least one B' moiety are encompassed by the formula A'-X-B 1 .
  • the linker X comprises a polyethylene glycol ("PEG") linker.
  • Other linker X compositions include at least one amino acid, a polypeptide, or any other chemical moiety known in the art that can operably link at least two polypeptide moieties.
  • the linker X composition is non-immunogenic.
  • ERFAM composition containing a PEG linker X the ERFAM has a prolonged circulating half-life in the body.
  • ERFAM containing a PEG linker X has a decreased immunogenicity.
  • the ERFAM composition is in a pharmaceutical carrier. In a preferred embodiment, a therapeutically effective amount of ERFAM is provided.
  • a kit containing at least one ERFAM composition in a container is also provided.
  • the invention also provides methods of using an ERFAM composition.
  • the method includes administering a therapeutically effective dose of an ERFAM molecule to a subject in need thereof for modulating the effects of an IgE related hypersensitivity reaction.
  • the method of use is for treating allergies.
  • the ERFAM molecule being administered contains an allergen-specific IgG4 antibody portion.
  • At least one method of producing an ERFAM molecule comprises producing an ERFAM molecule and purifying it away from impurities.
  • all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the case of conflict, the present specification, including definitions, will control. In. addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent Jfrom the following detailed description and claims.
  • FIG. 1 is a representation of the design and mode of action of IgIE Retargeting Function- Altering Molecules (ERFAM).
  • ERFAM IgIE Retargeting Function- Altering Molecules
  • FIG. 2 is a bar graph demonstrating inhibition of basophil activation using exemplary ERFAMs of the invention.
  • FIG. 3 is a bar graph demonstrating inhibition of basophil activation using exemplary ERFAMs of the invention.
  • FIG.4 is a bar graph demonstrating inhibition of basophil activa_tion using exemplary ERFAMs of the invention.
  • IgE- Retargeting Function-Altering Molecules EFAM
  • ERFAM binding is provided in FIG. 1.
  • ERFA-M binds to the Fc region of IgE.
  • other molecules are blocked from interacting with the Fc region of IgE, such that it interferes with IgE binding to the IgE receptors (Fc ⁇ RI and Fc ⁇ RII).
  • ERFAM provides a second binding site that is specific for receptors having different functions. A first binding by ERFAM to IgE and a second binding by ERFAM to the receptor having different functions thus transforms IgE into an allergy-inhibiting antibody.
  • IgE is generally allergen-specific
  • the binding of circulating and mast-cell bound IgE will allow for the inhibition of IgE mediated immune responses to allergen without interfering with responses to other antigens.
  • ERFAM binding of ERFAM to IgE is not specific to any one allergen of interest. ERFAM can bind any IgE. Therefore, unlike allergen-specific immunotherapy and other known anti-allergy therapies used to induce tolerance, ERFAM is an effective therapeutic for inducing anergy against any of the wide spectrum of allergens to which a patient has an allergen-specific IgE-mediated allergic response.
  • ERFAMs induce the generation of allergen-dependent inhibitors that are active only when allergen will also be administered. This allows for an effective control of allergy therapy and avoid secondary effects.
  • SIT is aimed at inducing the production of inhibitory IgG antibodies.
  • Administration of ERFAM therefore by-pass, e.g., SIT, by transforming the existing pathogenic IgE that trigger allergic reactions directly into anti-allergic IgG-like allergy inhibitors.
  • ERFAMs do not pose pro-allergic risks because they do not involve allergen administration and do not cross-link Fc ⁇ RI.
  • an ERFAM is not immunotherapeutic by itself.
  • ERFAM molecules when bound to IgE, confer to IgE the functional attributes of allergy-inhibiting antibodies such as IgG4.
  • the molecule is a monoclonal IgG4 antibody that binds to IgE.
  • ERFAM is a multifunctional non-anaphylactic molec ⁇ le that contains an IgE-binding site and a binding site for the receptor(s) that bind to an inhibitory receptor, such as IgG4.
  • the ERFAM also contains a 'linker' component. This linker component is useful, e.g., for prolongation of the ERFAM sexum half-life).
  • the ERFAM molecule is alternatively represented by the formula A'-B', where A' represents a first functional element ⁇ e.g., the IgE binding site) and B' represents a second functional element (e.g., the binding site for at least one inhibitory receptor).
  • the ERFAM molecule is alternatively represented by the formula A'-X-B', where A' represents a first functional element (e.g., the IgE binding site), X represents the linker component, and B' represents a second functional element (e.g., the binding site for at least one inhibitory receptor).
  • an ERFAM molecule is a smaller bifunctional molecule containing an IgE-binding site (a first function) and a site that has similar functional binding properties as the Fc portion of IgG4 antibodies (a second function). These two sites are linked directly or indirectly through a third part that confer desirable pharmacological and immunological properties to the molecule.
  • Bifunctional molecules are disclosed, e.g., in PCT publications WO 96/40788, WO 98/09638, WO 02/088312 and WO 02/102320.
  • an ERFAM molecule is a bifunctional molecule characterized as having:
  • a first binding site, i.e., the IgE-binding sites, of these molecules is an anti-IgE antibody preferably but not exclusively of IgG4 isotype, or a fragment thereof or a peptide or a peptidomimetic molecule or an oligonucleotide that bind to IgE;
  • a second binding site i.e., the IgG4-binding site or its equivalent, wherein the site has similar functional binding properties as the Fc portion of IgG4 antibodies.
  • this is an IgG4 antibody or an Fc fragment thereof or an anti-Fc ⁇ R antibody or a peptide or a peptidomimetic molecule or an oligonucleotide aptamer, all of which have similar effects as IgG4 binding to its receptors.
  • the receptor portion making up the second site preferably is an immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing inhibitory receptor-targeted molecule.
  • ITIMs contain the consensus sequence ⁇ ILV ⁇ -x-x-Y-x- ⁇ LV ⁇ (SEQ ID NO: 3) in the cytoplasmic tail of inhibitory receptors.
  • linker operably linking the first and second binding sites.
  • the linker may have one or more functions, including increasing ERFAM serum half life, decreasing degradation, and optimizing stereochemistry.
  • This intermediary part binds the above sites and confers desirable pharmacological and immunological properties to the molecule is a polyethylene glycol (PEG) moiety or a functionally equivalent molecule.
  • ERFAM contains the sequences of IgE binding polypeptides known in the art.
  • IgE-binding site component of ERFAM peptides include the following:
  • antibodies including but not limited to E25 (Novartis, patented), TNX-901 (Tanox, WO 92/17207) or other IgE-binding antibodies described herein;
  • peptides including but not limited to peptides disclosed in WO 98/04718 (ME Digan) and WO 99/05271 (Gould et ah), and any other function IgE-binding peptide sequence, whether it be naturally occurring or synthetic, and which contain L- or D-amino acids, and may contain post-translational modifications such as glycosylation, phosphorylation, myristoylation, or the like;
  • Peptide mimetics including but not limited to, e.g., tetracyclic compounds (see, e.g., US patent 5,965,605).
  • Publications reporting anti-IgE non-stimulatory antibodies include, but are not limited to, PCT publications WO 92/17207, WO 92/21031, WO 99/38531, WO 00/16804 and WO 02/079257, plus U.S. Patent No. US 6,329,509, etc.
  • soluble Fc ⁇ RI receptors and their derivatives that bind to IgE, e.g., through the Fc ⁇ RI alpha-chain fragment include U.S. Patent No. 6,090,384, and PCT publications WO 98/04718 and WO 99/05271.
  • WO 98/04718 (ME Digan) describes Fc ⁇ RI alpha-chain fragment that binds to IgE fused to human serum albumin, and have prolonged lifetime in the circulation and lower risk of secondary reactions.
  • Publications that report peptides or other compounds that inhibit IgE binding to its receptor include, but are not limited to, US patent no. 5,965,605 to Cheng et al. and Heska, reporting inhibition of IgE-binding to its receptor by tetracyclic chemical compounds; Helm et al., 1997 Allergy 52: 1155-1169; McDonnell et al, 1996 Nature Struct Biol 3: 419-425; Iwasaki et al, 2002 Biochem Biophys Res Comm. 293: 542-548.; and Wiegand et al, 1996 J Immunol 157: 221-230.
  • aptamers and other chemical moieties that specifically bind IgE can be used in generating the ERFAM molecules.
  • novel IgE-binding structures are discovered using classical methods including, but not limited to, monoclonal antibodies, phage display, and/or aptamer technology.
  • the first and second functional ERFAM components are joined directly to each other by covalent bonding.
  • the first and second functional ERFAM components are joined indirectly through a linker ⁇ e.g., glycol, polypeptide sequence, resin, carbohydrate, polymer, or sugar groups as described below).
  • the conjugated complex in the presence or absence of the linker is preferably non-immunogenic.
  • Linker molecules such as polyethylene glycol (or other structures and chemical moieties), where present, provide a 'skeleton' on which IgE-binding sites can be operably linked to the inhibitory receptor binding component to create a final ERFAM molecule.
  • Contemplated functions of a linker component are to increase serum half-life of an ERFAM molecule, decrease degradation, increase size, and/or modify the steric relationship between the ERFAM components. For example, by increasing the size of ERFAM, the linkers prevent its rapid renal excretion and prolong its circulatory half-life or confer other advantageous pharmacokinetic properties.
  • PEGylation methods for altering the pharmacodynamic properties of drugs are known to those skilled in the art, and are contemplated as part of the present invention.
  • PEG polymers arebranched or unbranched, and included are PEG polymers made up of a single PEG subunit or multiple PEG subunits.
  • linkers are operably linked in- frame to a polypeptide sequence, such as a flexible hinge.
  • linker moieties and methods of producing the same are known in the art and generally include, e.g., chemical linker, polymer, peptide, polypeptide, sugars, rigid bead, synthetic cleavable moiety, carbohydrates and glycerol, and more specifically may include biotin, streptavidin, cytokine, antibody hinge region, Ficoll, polyethylene glycol (PEG), methoxypolyethylene glycol (MPEG), polyethylene glycol-diacid, PEG monoamine, MPEG monoamine, MPEG hydrazide, MPEG imidazole, methoxypolypropylene glycol, copolymers of polyethylene glycol and methoxypolypropylene glycol, dextran, and polylactic-polyglycolic acid.
  • PEG polyethylene glycol
  • MPEG methoxypolyethylene glycol
  • MPEG polyethylene glycol-diacid
  • MPEG monoamine MPEG monoamine
  • MPEG hydrazide MPEG imidazole
  • the linker additionally may act as a spacer.
  • a spacer is of any suitable desired length, including about 10-20 ran, about 20-40 nm, about 40-60 nm, about 60-100 nm, about 100 nm or more, such as about 500 nm or more up to about 1 ⁇ m or more.
  • the ERFAM molecules of the present invention contain inhibitory receptor binding molecules that interact with inhibitory receptors.
  • Inhibitory receptor binding molecules include peptides and fragments of antibody Fc regions).
  • IgG4 antibodies or Fc ⁇ fragments thereof are used.
  • binding to Fc ⁇ R is ensured by antibodies against Fc ⁇ R, (such as antibodies against Fc ⁇ RIIb) or fragments thereof, peptides or aptamers with equivalent binding properties.
  • Fc ⁇ R- targeted therapies are known in the art.
  • Fc ⁇ R and Fc ⁇ R-targeted molecules are disclosed in, e.g., US 4,954,617 (MW Fanger et al., disclosing monoclonal antibodies to Fc receptors for IgG on human mononuclear phagocytes); US 6,365,161 (Yashwant et al., disclosing therapeutic compounds containing of anti-Fc receptor binding agents); and PCT publication WO 96/08512 (PM Hogarth et al, disclosing polypeptides with Fc binding ability).
  • the ERFAM binds to an inimunoreceptor tyrosine-based inhibitory motif (ITIM)-containing inhibitory receptor.
  • the (ITIM)-containing inhibitory receptor is present on the surface of any immune-related cell.
  • immune-related cells include basophils, mast cells, B cells, platelets, and antigen presenting cells (APCs).
  • APCs include dendritic cells, macrophages, and monocytes.
  • the ITIM-containing receptor is present on the surface of a basophil or mast cell.
  • An exemplary (ITIM)-containing inhibitory receptor is CD31, also known as PECAM-I (Platelet/endothelial cell adhesion molecule 1) which is present on basophils (See, Fureder et al , Allergy. 1994; 49: 861 -5). It has been demonstrated that CD31 cross-linking inhibits platelet activation at least in part due to inhibition of signaling from the collagen glycoprotein VI receptor. (See, Newman et al, Blood. 2001 97(8): 2351-7). CD31 also inhibits antigen-receptors on B lymphocytes via the CD31 ITIM (See, Wilkinson et al, Blood. 2002; 100(1): 184-93).
  • Another exemplary (ITIM)-containing inhibitory receptor is CD32B (also known as
  • CD32B is the receptor for the Fc fragment of IgG, low affinity lib; (Accession NP_003992.2).
  • ITIM-containing receptors are known in the art and include, but are not limited to, PCT publications WO 96/40788 (PM Guyre and M Fanger); WO 98/09638 (Kate et al. , demonstrating cross-linking gp49B 1 with Fc ⁇ RI receptors); WO 02/088317 (Saxon et al, demonstrating cross-linking Fc ⁇ RIIb with Fc ⁇ RI receptors); WO 02/102320 (An et al, demonstrating cross-linking Fc ⁇ RIIb with Fc ⁇ RI receptors); and Daeron et al, 1995, J Clin Invest 95: 577-585.
  • ITIM-containing receptors can be identified based on the presence of ITIMs. These mofits can be identified by methods known in the art (See, Staub et al, Cellular Signaling 2004, 16:435-456).
  • Basophils and mast cells contain a plurality of ITIM-containing inhibitory receptors.
  • the present invention provides for the administration of two or more ERFAM molecules that target separate to a subject.
  • the ERFAM molecules are provided consecutively or concurrently. Thus a stronger inhibitory effect is achieved by synergistic actions among the plurality of ERFAMs.
  • ERFAM may contain a cyclic peptide that spontaneously linearizes ("de-cycle") only when bound to IgE. In this model, only then does ERFAM subsequently become able to bind Fc ⁇ R or the corresponding inhibitory receptor. This will avoid the "blocking" of Fc ⁇ R by non-IgE bound ERFAM.
  • Synthetic cyclic peptides that inhibit the interaction between IgE and its high affinity receptor Fc ⁇ RI are known in the art.
  • the peptides are cyclized by disulphide bond formation between terminal cysteine residues.
  • the cyclic peptides are L-amino acid peptides and/or are a retro-enantiomeric D-amino acid peptides.
  • the ERFAM molecules of the present invention contain apoptosis- inducing receptor binding molecules that interact with apoptosis-inducing receptors.
  • Apoptosis-inducing receptors are known in the art, including TNF-related apoptosis- inducing ligand receptor 2, TRAIL receptor 2,TNFRl , Fas, DR3 , and AIR/LARD. [VICTOR: Please provide any additional information you have on this class of apoptosis-inducing receptors]
  • ERFAM features An ERFAM molecule will contain one or more of the following features.
  • an ERFAM is a cyclic peptide that spontaneously 'de-cycles' only if bound to IgE and only subsequently become able to bind Fc ⁇ R. This avoids having Fc ⁇ R being 'blocked' by non-IgE bound ERFAM.
  • ERFAM does not need to be allergen-tailored: since it is the pre-existing IgE that accounts for the allergen specificity, ERFAM is effective for all IgE-mediated allergies, regardless of the allergen. In fact, the causal allergen need not even be identified; the only diagnostic procedure is to confirm that the allergy is caused by IgE - i.e. IgE levels are raised.
  • ERFAM does not need to be patient-tailored: the IgE-Fc is relatively constant and eventual polymorphisms does not affect its binding to ERFAM. However, if such a polymorphism prevent a particular IgE from being bound by ERFAM, then that IgE also is unable to bind to its natural ligand - the high affinity Fc ⁇ RI - so no allergic reactions result.
  • Fc ⁇ R may also contain polymorphisms.
  • the ERFAM prove more effective where the second functional component is made up of a peptide, aptamer and/or monoclonal antibody directed to such a polymorphic receptor, as compared to an ERFAM containing an IgG4 Fc portion.
  • ERFAM is fast-acting: allergy symptoms will disappear within hours or days of treatment because the ERFAM-bound IgE /IgE ratio rises in a treated subject.
  • ERFAM is used in anaphylaxis and in asthma attacks to stop allergen-induced degranulation of mast cells.
  • An ERFAM formulation is administered on its own or in combination with an antihistamine.
  • ERFAM-bound IgE is the dominant allergen-specific antibody in circulation, its half- life preferably match that of natural IgG4. Moreover, pharmacokinetic properties of ERFAM are altered using PEGylation or other modifications.
  • T cells are generally immunomodulated by repeated exposure to allergens in order to ensure natural production of IgG4 that replace allergen-specific IgE production. Treatment methods for long term induction of allergen tolerance can be used in conjunction with one or more treatments with ERFAM.
  • ERFAM are not vaccines, and do not involve gene vaccinations or other problematic drugs. In fact ERFAM simply transforms the subject's own 'pathogenic' IgE into 'naturally-existing' protective IgG4-like antibodies.
  • ERPAM molecules are distinct from other molecules that treat allergic diseases because their anti-allergic activity is triggered by both specific IgE and allergen, thus causing co-clustering of inhibitory and activating receptors. Unless both specific IgE and allergen are present, the molecule does not have anti-allergic activity. Continued naturally-occurring exposure will thus result in long-term tolerance. No other molecule designed to treat allergic disease has such an activity that depends upon the presence of the specific allergen.
  • ERFAM activity is quantitated using assays well known to those in the art.
  • ERFAM activity can be quantitated by measuring ERFAM binding to an IgE.
  • ERFAM activity can be quantitated by measuring ERFAM binding to an inhibitory receptor or an activity or the inhibitory receptor.
  • ERFAM activity is tested in an in vitro system by assessing the capacity of the ERFAM to inhibit allergen-dependent, IgE-mediated human basophil activation.
  • This in vitro model system is well known in the art to reproduce the events that occur in vivo during an allergic reaction.
  • basophils are purified from blood, such as by using the basophil isolation kit available from Milteny Biotec (Bergisch Gladbach, Germany, catalog number 130-053-401).
  • basophils are purified from allergic donors, they are used in an assay without further treatments. Alternately, if basophils are purified from the blood of non-allergic individuals, they are sensitized by incubation in the presence of allergen-specific IgE antibodies that are either purified or contained in the plasma of allergic donors.
  • Basophils are incubated with ERFAM, again in the presence of allergen-specific IgE antibodies that are either purified or contained in the plasma of allergic donors.
  • ERFAM binds to IgE in the plasma and to Fc ⁇ R on basophils.
  • Allergen is added to the basophil preparation and activation / degranulation is measured by quantifying histamine release using commercially available ELISA (Basotest (r) from Orpegen Pharma, Heidelberg, Germany or other histamine ELISAs: catalog number #409010 from Neogen or #RDI- RE59201 from Research Diagnostics Inc or #2015 from Immunotech) or radioimmunoassays.
  • basophil activation is assessed by flow cytometry. In this system, ERFAM efficiency is determined by its capacity to inhibit basophil degranulation.
  • antibody refers to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen.
  • Ig immunoglobulin
  • Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, F a b, F a t > ' and F ⁇ y) 2 fragments, and a F a b expression library.
  • antibody molecules obtained from humans relates to any of the classes IgG, IgM, IgA, IgE and IgD, which differ from one another by the nature of the heavy chain present in the molecule.
  • the light chain is a kappa chain or a lambda chain.
  • Reference herein to antibodies includes a reference to all such classes, subclasses and types of human antibody species.
  • epitope includes any protein determinant capable of specific binding to an immunoglobulin or T-cell receptor.
  • Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
  • a polypeptide or a fragment thereof comprises at least one antigenic epitope.
  • an anti-IgE antibody of the present invention will specifically bind to IgE where the equilibrium binding constant (KD) is ⁇ l ⁇ M, preferably ⁇ 100 nM, more preferably ⁇ 10 nM, and most preferably ⁇ 100 pM to about 1 pM, as measured by assays such as radioligand binding assays or similar assays known to those skilled in the art.
  • KD equilibrium binding constant
  • the terms "antigen”, “antigenic”, “allergen” and “allergenic” as used herein are meant to describe a substance that induces an immune response when presented to immune cells of an organism.
  • An antigen may comprise a single immunogenic epitope, or a multiplicity of immunogenic epitopes recognized by a B-cell receptor ⁇ i.e., antibody on the membrane of the B cell) or a T-cell receptor.
  • B-cell receptor i.e., antibody on the membrane of the B cell
  • T-cell receptor i.e., antibody on the membrane of the B cell
  • these terms refer to any substance capable of eliciting an immune response, e.g., peanut allergen, cat dander, and the like, as well as haptens that are rendered antigenic under suitable conditions known to those of skill in the art.
  • a construct of the invention, or a derivative, fragment, analog, homolog or ortholog thereof, is utilized as a tolerogen in the generation of an immune reaction that immunospecif ⁇ cally bind allergenic components.
  • ERFAM will indirectly bind an allergen when it is bound to an allergen-specific IgE antibody.
  • the present invention includes the use of polyclonal antibodies, monoclonal antibodies, humanized antibodies (or human antibodies) F ab Fragments (and single chain antibodies), bispecific antibodies (which are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens), and heteroconjugate antibodies (antibodies are composed of two covalently joined antibodies).
  • the present invention also includes the modification of the antibody with respect to effector function, so as to enhance, e.g., the effectiveness of the antibody in treating allergies.
  • the invention also pertains to imrnunoconjugates comprising an antibody conjugated of the formula A'-B' or A'-X-B'. Conjugates made up of the A' and B' moieties are constructed using a variety of bifunctional protein-coupling agents such as
  • N-succinimidyl-3-(2-pyridyldithiol) propionate SPDP
  • iminothiolane I
  • bifunctional derivatives of imidoesters such as dimethyl adipimidate HCL
  • active esters such as disuccinimidyl suberate
  • aldehydes such as gluteraldehyde
  • bis-azido compounds such as bis (p-azidobenzoyl) hexanediamine
  • bis-diazonium derivatives such as bis-(p-diazoniumbenzoyl)-ethylenediamine
  • diisocyanates such as tolyene 2,6-diisocyanate
  • bis-active fluorine compounds such as l,5-difluoro-2,4-dinitrobenzene.
  • an ERFAM construct can be prepared as described in Vitetta et al, Science, 238: 1098 (1987).
  • ERFAMs are used in methods known within the art relating to the localization and/or quantitation of the protein ⁇ e.g., for use in measuring levels of the protein within appropriate physiological samples, for use in diagnostic methods, for use in imaging, and the like).
  • antibodies against the IgE or inhibitory receptors, proteins, or derivatives, fragments, analogs or homologs thereof, that contain the antigen binding domain are utilized as pharmacologically-active compounds.
  • detection can be facilitated by coupling (i.e.., physically linking) the antibody to a detectable substance.
  • detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, ⁇ -galactosidase, or acetylcholinesterase;
  • suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin;
  • suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin;
  • an example of a luminescent material includes luminol;
  • examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125 1, 131 1, 35 S or 3 H.
  • ERFAM Therapeutics include horseradish peroxidase, alkaline phosphatase, ⁇ -galactosidase, or acetylcholinesterase;
  • ERFAM constructs of the invention including polyclonal, monoclonal, humanized and fully human antibodies, are contemplated as therapeutic agents. Such agents are generally employed to treat or prevent a disease or pathology in a subject. A preferred use is to treat allergen-mediated allergic response.
  • An antibody preparation is administered to the subject and will generally have an effect due to its binding with the target(s). Such an effect is one of two kinds, depending on the specific nature of the interaction between the given antibody molecule and the target antigen in question. In the first instance, administration of the antibody may abrogate or inhibit the binding of Fc ⁇ RI with the IgE antibodies to which it naturally binds.
  • the ERFAM molecule " binds to the IgE Fc domain and blocks the IgE binding by the alpha subunit site of the Fc ⁇ RI.
  • the ERFAM molecule reduces the cascade response induced by crosslinking of mast cell bound IgE.
  • the effect is one in which the ERFAM molecule elicits a physiological result by virtue of binding to an effector binding site that induces suppression of the allergic response.
  • One contemplated mechanism, to which the inventors do not wish to be bound, is that the IgG4 portion of the ERFAM molecule recruits inhibitory subunits to the Fc receptor complex, thereby mediating a cascade leading to inhibition rather than activation of the stimulated immune cell to which it binds.
  • a therapeutically effective amount of an antibody relates generally to the amount needed to achieve a therapeutic objective.
  • the amount required to be administered will furthermore depends on the binding affinity of the ERFAM molecule for its specific antigen/receptors, and will also depend on the rate at which an administered ERFAM molecule is depleted from the serum volume of the subject to which it was administered.
  • Common ranges for therapeutically effective dosing of an antibody or antibody fragment are, by way of nonlimiting example, from about 0.1 mg/kg body weight to about 50 mg/kg body weight.
  • Common dosing frequencies may range, for example, from twice daily to once a week.
  • the ERFAM molecule bolus is administered in a single inject, followed by treatment with SIT to induce permanent tolerance without the risk of adverse side effects such as anaphylactic shock.
  • Pharmaceutical Compositions Antibody constructs of the invention, as well as related molecules easily identified by those skilled in the art, can be administered for the treatment of various disorders in the form of pharmaceutical compositions. Principles and considerations involved in preparing such compositions, as well as guidance in the choice of components are provided, for example, in REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY 19th ed. (Alfonso R. Gennaro, et al., editors) Mack Pub. Co., Easton, Pa. 1995; DRUG ABSORPTION
  • Peptides comprising the ERFAM construct can be synthesized chemically and/or produced by recombinant DNA technology. See, e.g., Marasco et al., Proc. Natl. Acad. Sci. USA, 90: 7889-7893 (1993).
  • the formulation can contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
  • the composition can comprise an agent that enhances its function, such as, for example, IL-2, IFN- ⁇ , IL-IO and/or TGF- ⁇ , or an agent that binds and/or sequesters IL-4 or IL-13.
  • Such molecules are suitably present in combination and in amounts that are effective for the purpose intended.
  • the active ingredients can be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and polymethylmethacrylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles, and nanocapsules) or in macroemulsions .
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles, and nanocapsules
  • the formulations to be used for in vivo administration are sterile. This is readily accomplished by filtration through sterile filtration membranes.
  • sustained-release preparations can be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No.
  • copolymers of L-glutamic acid and ⁇ ethyl-L-glutamate non-degradable ethylene- vinyl acetate
  • degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT TM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate)
  • poly-D-(-)-3-hydroxybutyric acid While polymers such as ethylene- vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods.
  • compositions suitable for administration can be incorporated into pharmaceutical compositions suitable for administration.
  • compositions typically comprise the ERFAM construct and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text in the field, which is incorporated herein by reference.
  • Such carriers or diluents include, but are not limited to, water, saline, finger's solutions, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
  • a pharmaceutical composition is formulated to be compatible with its intended route of administration.
  • routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • the pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor EL TM (BASF, Parsippany, NJ.) or phosphate buffered saline (PBS).
  • the composition isterile and fluid to the extent that easy syringeability exists. It is stable under the conditions of manufacture and storage and is preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the ERFAM construct in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch
  • a lubricant such as magnesium stearate or Sterotes
  • a glidant such as colloidal silicon dioxide
  • the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the dosage unit forms are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
  • the pharmaceutical composition can be included in a container, pack, kit or dispenser together with instructions for administration.
  • ERFAM is packaged in a kit with an antihistamine.
  • an ERFAM formulation contains an antihistamine.
  • an ERFAM formulation is administered prior to or shortly after exposure of a subject to an allergen.
  • An ERFAM formulation containing an antihistamine can be packaged for over-the-counter use by allergic subjects to suppress anaphylactic responses.
  • Chemically modified (e.g., polymer-conjugated) ERFAM constructs are prepared by one of skill in the art based upon the present disclosure.
  • the chemical moieties most suitable for addition to a ERFAM constructs include water soluble polymers.
  • a water soluble polymer is advantageous because the protein to which it is attached does not precipitate in an aqueous environment, such as a physiological environment.
  • the polymer is pharmaceutically acceptable for the preparation of a therapeutic product or composition. If desired, a single polymer molecule is employed for conjugation with a ERFAM constructs, although it is also contemplated that more than one polymer molecule can be attached as well.
  • two, three or four polymer molecules are employed for conjugation; more preferably, three polymer molecules are employed for conjugation, e.g., the first and second polymer molecules are conjugated at each N-terminal amino acid of the ERFAM construct, and the third polymer molecule is conjugated at an internal amino acid (i.e., a non-terminal amino acid).
  • Conjugated ERFAM compositions have utility in both in vivo as well as non-m vivo applications. Additionally, it is recognized that the conjugating polymer may utilize any other groups, moieties, or other conjugated species, as appropriate to the end use application.
  • the polymer may contain any functionality, repeating groups, linkages, or other constituent structures that do not preclude the efficacy of the conjugated ERFAM composition for its intended purpose.
  • the desired polymer based on such considerations as whether the polymer/protein conjugate is used therapeutically, and if so, the desired dosage, circulation time, resistance to proteolysis, and other considerations.
  • the effectiveness of the derivatization is ascertained by administering the derivative, in the desired form (e.g., by osmotic pump, or by injection or infusion, or, further formulated for oral, pulmonary or other delivery routes), and determining its effectiveness.
  • Suitable water soluble polymers include, but are not limited to, polyethylene glycol, copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1, 3-dioxolane, poly-l,3,6-trioxane, ethylene/maleic anhydride copolymer, polyamino acids (either homopolymers or random copolymers), and dextran or poly(n-vinyl pyrrolidone)polyethylene glycol, propropylene glycol homopolymers, polypropylene oxide/ethylene oxide co-polymers, polyoxyethylated polyols (e.g., glycerol), polyvinyl alcohol, and mixtures thereof.
  • Polyethylene glycol propionaldehyde may have advantages in manufacturing due to its stability in water.
  • the polymer is of any suitable molecular weight, and is branched or unbranched.
  • the preferred molecular weight is between about 2 kDa and about 100 kDa, for ease in handling and manufacturing (as used herein, the term “about” means that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight).
  • Other sizes are used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired; the effects, if any, on biological activity; the ease in handling; the degree or lack of antigenicity and other known effects of polyethylene glycol on a therapeutic protein or variant).
  • the preferred molecular weight is about 10 kDa.
  • polymer molecules so attached may vary, and one skilled in the art is able to ascertain the effect on function.
  • One may mono- derivatize, or may provide for a di-, tri-, terra- or some combination of derivatization, with the same or different chemical moieties (e.g., polymers, such as different weights of polyethylene glycols).
  • chemical moieties e.g., polymers, such as different weights of polyethylene glycols.
  • the proportion of polymer molecules to protein (or polypeptide) molecules will vary, as will their concentrations in the reaction mixture.
  • the optimum ratio in terms of efficiency of reaction in that there is no excess unreacted protein or polymer is determined by factors such as the desired degree of derivatization (e.g., mono, di-, tri-, etc.), the molecular weight of the polymer selected, whether the polymer is branched or unbranched, and the reaction conditions.
  • the polyethylene glycol molecules are attached to the protein with consideration of effects on functional or antigenic domains of the protein.
  • attachment methods available to those skilled in the art. See, e.g., EP 0 401384 (coupling PEG to G-CSF); Malik et ah, Exp. Hematol. 20: 1028- 1035, 1992 (reporting pegylation of GM-CSF using tresyl chloride).
  • polyethylene glycol is covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group.
  • Reactive groups are those to which an activated polyethylene glycol molecule are bound.
  • the amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residue.
  • Those having a free carboxyl group may include aspartic acid residues, glutamic acid residues, and the C-terminal amino acid residue.
  • Sulfhydrl groups may also be used as a reactive group for attaching the polyethylene glycol molecule(s).
  • attachment at an amino group such as attachment at the N- terminus or lysine group is preferred. Attachment at residues important for receptor binding is avoided if receptor binding is desired.
  • polyethylene glycol as an illustration of the present ERFAM compositions, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein.
  • the method of obtaining the N-terminally pegylated preparation i.e., separating this moiety from other monopegylated moieties if necessary
  • Selective N-terminal chemical modification is accomplished by reductive alkylation, which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein.
  • substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.
  • the water soluble polymer is of the type described above, and has a single reactive aldehyde for coupling to the protein.
  • the present invention includes use of ERFAM which are prokaryote- expressed, eukaryote-expressed, or synthetic.
  • Pegylation is carried out by any of the pegylation reactions known in the art. See, e.g., Focus on Growth Factors, 3 (2): 4-10, 1992; EP 0 154 316; EP 0 401 384; and the other publications cited herein that relate to pegylation.
  • the pegylation is carried out via an acylation reaction or an alkylation reaction with a reactive polyethylene glycol molecule (or an analogous reactive water-soluble polymer).
  • Pegylation by acylation generally involves reacting an active ester derivative of polyethylene glycol (PEG). Any known or subsequently discovered reactive PEG molecule is used to carry out the pegylation.
  • a preferred activated PEG ester is PEG esterified to N- hydroxysuccinimide (NHS).
  • NHS N- hydroxysuccinimide
  • acylation includes without limitation the following types of linkages between the therapeutic protein and a water soluble polymer such as PEG: amide, carbamate, urethane, and the like. See, Bioconjugate Chem. 5: 133-140, 1994. Reaction conditions are selected from any of those known in the pegylation art or those subsequently developed, but avoid conditions such as temperature, solvent, and pH that inactivate the ERFAM construct to be polymer-conjugated.
  • Pegylation by acylation will generally result in a poly-pegylated ERFAM product.
  • the connecting linkage is an amide.
  • the resulting product is substantially only ⁇ e.g., > 95%) mono, di- or tri-pegylated.
  • some species with higher degrees of pegylation are formed in amounts depending on the specific reaction conditions used.
  • more purified pegylated species are separated from the mixture, such as unreacted species, by standard purification techniques, including, among others, dialysis, salting-out, ultrafiltration, ion- exchange chromatography, gel filtration chromatography and electrophoresis.
  • Pegylation by alkylation generally involves reacting a terminal aldehyde derivative of PEG with ERFAM in the presence of a reducing agent. Pegylation by alkylation can also result in poly-pegylated ERFAM products. In addition, one can manipulate the reaction conditions to favor pegylation substantially only at the ⁇ -amino group of the N- terminus of ERFAM ⁇ i.e., a mono-pegylated protein). In either case of monopegylation or polypegylation, the PEG groups can be attached to the protein via a -CH2-NH- group. With particular reference to the -CH2- group, this type of linkage is referred to herein as an "alkyl" linkage.
  • Derivatization via reductive alkylation to produce a monopegylated product exploits differential reactivity of different types of primary amino groups (lysine versus the N- terminal) available for derivatization.
  • the reaction is performed at a pH that allows one to take advantage of the pKa differences between the e-amino groups of the lysine residues and that of the a-amino group of the N-terminal residue of the protein.
  • a water soluble polymer that contains a reactive group such as an aldehyde is controlled: the conjugation with the polymer takes place predominantly at the N-terminus of the protein and no significant modification of other reactive groups, such as the lysine side chain amino groups, occurs.
  • the polymer molecules used in both the acylation and alkylation approaches are selected from among water soluble polymers as described above.
  • the polymer selected is modified to have a single reactive group, such as an active ester for acylation or an aldehyde for alkylation, so that the degree of polymerization is controlled as provided for in the present methods.
  • An exemplary reactive PEG aldehyde is polyethylene glycol propionaldehyde, which is water stable, or mono Cl-ClO alkoxy or aryloxy derivatives thereof ⁇ see, U.S. Patent 5,252,714).
  • the polymer is branched or unbranched.
  • the polymer(s) selected have a single reactive ester group.
  • the polymer(s) selected have a single reactive aldehyde group.
  • the water soluble polymer will not be selected from naturally-occurring glycosyl residues since these are usually made more conveniently by mammalian recombinant expression systems.
  • the polymer is of any molecular weight, and is branched or unbranched.
  • polyethylene glycol is meant to encompass any of the forms of PEG that have been used to derivatize other proteins, such as mono-(Cl-ClO) alkoxy- or aryloxy- polyethylene glycol.
  • chemical derivatization is performed under any suitable condition used to react a biologically active substance with an activated polymer molecule.
  • Methods for preparing a pegylated ERFAM will generally comprise the steps of (a) reacting a ERFAM protein or polypeptide with polyethylene glycol (such as a reactive ester or aldehyde derivative of PEG) under conditions whereby the molecule becomes attached to one or more PEG groups, and (b) obtaining the reaction product(s).
  • polyethylene glycol such as a reactive ester or aldehyde derivative of PEG
  • the optimal reaction conditions for the acylation reactions are determined case- by-case based on known parameters and the desired result. For example, the larger the ratio of PEG: protein, the greater the percentage of poly-pegylated product.
  • Reductive alkylation to produce a substantially homogeneous population of mono- polymer/ ERFAM will generally comprise the steps of: (a) reacting a ERFAM protein or polypeptide with a reactive PEG molecule under reductive alkylation conditions, at a pH suitable to permit selective modification of the a-amino group at the amino terminus of ERFAM; and (b) obtaining the reaction product(s).
  • the pH also affects the ratio of polymer to protein to be used. In general, if the pH is lower, a larger excess of polymer to protein is desired (i.e., the less reactive the N-terminal a-amino group, the more polymer needed to achieve optimal conditions). If the pH is higher, the polymer: protein ratio need not be as large (i.e., more reactive groups are available, so fewer polymer molecules are needed). For purposes of the present invention, the pH will generally fall within the range of 3-9, preferably 3-6. Another important consideration is the molecular weight of the polymer. In general, the higher the molecular weight of the polymer, the fewer polymer molecules are attached to the protein. Similarly, branching of the polymer is taken into account when optimizing these parameters.
  • the preferred average molecular weight is about 2 kDa to about 100 kDa.
  • the preferred average molecular weight is about 5 kDa to about 50 kDa, such as about 10 kDa.
  • the ERFAM is linked to the polymer via a terminal reactive group on the polypeptide.
  • ERFAM are linked via the side chain amino group of an internal lysine residue, e.g., a lysine residue introduced into the amino acid sequence of a naturally occurring subunit utilized in constructing the ERFAM molecule.
  • conjugations can also be branched from the non terminal reactive groups.
  • the polymer with the reactive group(s) is designated herein as "activated polymer".
  • the reactive group selectively reacts with free amino or other reactive groups on the protein. Attachment may occur in the activated polymer at any available ERFAM amino group such as the alpha amino groups or the epsilon amino groups o>f a lysine residue or residues introduced into the amino acid sequence of a ERFAM polypeptide subunit or variant thereof.
  • Free carboxylic groups suitably activated carbonyl groups, hydroxyl, guanidyl, imidazole, oxidized carbohydrate moieties and mercapto groups of the ERFAM (if available) can also be used as attachment sites.
  • the final amount is a balance between maximizing the extent of the reaction while minimizing noon-specific modifications of the product and, at the same time, defining chemistries that will maintain optimum activity, while at the same time optimizing, if possible, the half-life of the protein.
  • at least about 50% of the biological activity of the protein is retained, and in other embodiments, nearly 100% is retained.
  • the polymer can be coupled to the ERFAM polypeptide using methods known in the art.
  • the polyalkylene glycol moiety is coupled to a lysine group of the ERFAM or variant ERFAM.
  • Linkage to the lysine group can be performed with a N-hydroxylsuccinimide (NHS) active ester such a.s PEG succinimidyl succinate (SS-PEG) and succinimidyl propionate (SPA-PEG).
  • Suitable polyalkylene glycol moieties include, e.g. t carboxymethyl-NHS, norleucine-NHS, SC-PEG, tresylate, aldehyde, epoxide, carbonylimidazole, and PNP carbonate.
  • ERFAM may contain a tag, e.g., a tag that can subsequently be released by proteolysis, such as a histidine tag ⁇ i.e. 10 histidines) separated by an enterokinase cleavage site.
  • the lysine moiety can be selectively modified " by first reacting a his-tag variant with a low molecular weight linker such as Traut's reagent (Pierce) which will react with both the lysine and N-terminus, and then releasing the his tag.
  • the polypeptide will then contain a free SH group that can be selectively modified with a PEG containing a thiol reactive head group such as a maleimide group, a vinylsulfone group, a haloacetate group, or a free or protected SH.
  • Traut's reagent can be replaced with any linker that will set up a specific site for
  • the polyalkylene glycol moiety is coupled to a cysteine group of ERFAM or variant ERFAM construct.
  • Coupling can be effected using, e.g., a maleimide group, a vinylsulfone group, a haloacetate group, and a thiol group.
  • the polymer-conjugated ERFAM in the composition has a longer serum half-life relative to the half-life of the variant polypeptide in the absence of the polymer.
  • the polymer-conjugated ERFAM in the composition binds GFR, activates RET, normalizes pathological changes of a neuron, or enhances survival of a neuron, or performs a combination of these physiological functions.
  • the composition is provided as a stable, aqueously soluble polymer-conjugated ERFAM or variant polymer-conjugated ERFAM coupled to a polyethylene glycol moiety.
  • the ERFAM or variant ERFAM construct is coupled to the polyethylene glycol moiety by a labile bond.
  • the labile bond can be cleaved in, e.g., biochemical hydrolysis, proteolysis, or sulfhydryl cleavage.
  • the bond can be cleaved under in vivo (physiological) conditions.
  • reaction parameters such as solvent, reaction times, temperatures, etc., and means of purification of products, can be determined by those skilled in the art.
  • Variant ERFAM can be isolated using methods known in the art.
  • Naturally occurring ERFAM subunits can be isolated from immune cells, hybridomas, or tissue sources by an appropriate purification scheme using standard protein purification techniques.
  • variant ERFAM can be synthesized chemically using standard peptide synthesis techniques. The synthesis of short amino acid sequences is well established in the peptide art. See, e.g., Stewart, et al, SOLID PHASE PEPTIDE SYNTHESIS (2d ed., 1984).
  • ERFAM constructs are produced by recombinant DNA techniques.
  • a nucleic acid molecule encoding an ERFAM construct can be inserted into a vector, e.g., an expression vector, and the nucleic acid can be introduced into a cell.
  • Suitable cells include, e.g., mammalian cells (such as human cells or Chinese hamster ovary cells), fungal cells, yeast cells, insect cells, and bacterial cells.
  • the cell When expressed in a recombinant cell, the cell can be cultured under conditions allowing for expression of an ERFAM construct.
  • the ERFAM construct can be recovered from a cell suspension if desired.
  • “recovered” means that the variant polypeptide is removed from those components of a cell or culture medium in which it is present prior to the recovery process.
  • the recovery process may include one or more refolding or purification steps.
  • ERFAM constructs can be constructed using any of several methods known in the art.
  • One such method is site-directed mutagenesis, in which a specific nucleotide (or, if desired a small number of specific nucleotides) is changed in order to change a single amino acid (or, if desired, a small number of predetermined amino acid residues) in the encoded ERFAM construct.
  • site-directed mutagenesis is a routine and widely-used technique.
  • many site-directed mutagenesis kits are commercially available.
  • One such kit is the "Transformer Site Directed Mutagenesis Kit" sold by Clontech Laboratories (Palo Alto, Calif.).
  • polymer-conjugated ERFAM constructs can be provided as a fusion protein.
  • Fusion polypeptide derivatives of proteins also include various structural forms of the primary protein that retain biological activity.
  • fusion refers to a co- linear, covalent linkage of two or more proteins or fragments thereof via their individual peptide backbones, such as through genetic expression of a polynucleotide molecule encoding those proteins in the same reading frame (i.e., "in frame”). It is preferred that the proteins or fragments thereof are from different sources.
  • some fusion proteins include a variant ERFAM construct or fragment covalently linked to a second moiety that is not a variant ERFAM.
  • the second moiety is derived from a polypeptide that exists as a monomer, and is sufficient to confer enhanced solubility and/or bioavailability properties on the ERFAM construct.
  • compositions containing polymer-conjugated ERFAM are provided.
  • a pharmaceutical composition including a modified ERFAM construct of the present invention.
  • a "pharmaceutical composition” as used herein is defined as comprising a ERFAM construct or conjugate of the invention, dispersed in a physiologically acceptable vehicle, optionally containing one or more other physiologically compatible ingredients.
  • the pharmaceutical composition thus may contain an excipient such as water, one or more minerals, sugars, detergents, and one or more carriers such as an inert protein (e.g., heparin or albumin).
  • the ERFAM construct is administered per se as well as in the form of pharmaceutically acceptable esters, salts, and other physiologically functional derivatives thereof.
  • a modified ERFAM construct is utilized together with one or more pharmaceutically acceptable carrier(s) and optionally any other therapeutic ingredients.
  • the carrier(s) is pharmaceutically acceptable in the sense of being compatible with the other ingredients of the formulation and not unduly deleterious to the recipient thereof.
  • the ERFAM construct is provided in an amount effective to achieve a desired pharmacological effect or medically beneficial effect, as described herein, and in a quantity appropriate to achieve the desired bioavailable in vivo dose or concentration.
  • the formulations include those suitable for parenteral as well as non parenteral administration, and specific administration modalities include oral, rectal, buccal, topical, nasal, ophthalmic, subcutaneous, intramuscular, intravenous, transdermal, intrathecal, intra ⁇ articular, intra-arterial, sub-arachnoid, bronchial, lymphatic, vaginal, and intra-uterine administration.
  • Formulations suitable for aerosol and parenteral administration, both locally and systemically, are preferred.
  • the formulation advantageously is administered orally, bronchially, or parenterally.
  • the formulation is advantageously administered orally, rectally, or bronchially.
  • it is administered nasally or bronchially, via nebulization of the powder in a carrier gas, to form a gaseous dispersion of the powder that is inspired by the patient from a breathing circuit comprising a suitable nebulizer device.
  • formulations comprising the proteins of the present invention may conveniently be presented in unit dosage forms and are prepared by any of the methods well known in the art of pharmacy. Such methods generally include the step of bringing the active ingredient(s) into association with a carrier that constitutes one or more accessory ingredients.
  • the formulations are prepared by uniformly and intimately bringing the active ingredient(s) into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product into dosage forms of the desired formulation.
  • Formulations of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets, tablets, or lozenges, each containing a predetermined amount of the active ingredient as a powder or granules; or a suspension in an aqueous liquor or a non-aqueous liquid, such as a syrup, an elixir, an emulsion, or a draught.
  • Formulations suitable for parenteral administration conveniently comprise a sterile aqueous preparation of the active conjugate, which can be isotonic with the blood of the recipient (e.g., physiological saline solution).
  • Such formulations may include suspending agents and thickening agents or other microparticulate systems which are designed to target the compound to blood components or one or more organs.
  • the formulations may be presented in unit-dose or multi-dose form.
  • Nasal spray formulations comprise purified aqueous solutions of the active conjugate with preservative agents and isotonic agents. Such formulations can be adjusted to a pH and isotonic state compatible with the nasal mucus membranes.
  • Formulations for rectal administration may be presented as a suppository with a suitable carrier such as cocoa butter, hydrogenated fats, or hydrogenated fatty carboxylic acid.
  • Ophthalmic formulations such as eye drops are prepared by a similar method to the nasal spray, except that the pH and isotonic factors can be adjusted to match that of the eye.
  • Topical formulations comprise the conjugates dissolved or suspended in one or more media, such as mineral oil, petroleum, polyhydroxy alcohols, or other bases used for topical pharmaceutical formulations.
  • the formulations of this invention may further include one or more accessory ingredient(s) selected from diluents, buffers, flavoring agents, disintegrants, surface active agents, thickeners, lubricants, preservatives (including antioxidants), and the like.
  • accessory ingredient(s) selected from diluents, buffers, flavoring agents, disintegrants, surface active agents, thickeners, lubricants, preservatives (including antioxidants), and the like.
  • the present invention includes the provision of suitable fusion proteins for in vitro stabilization of a ERFAM construct in solution, as an illustrative application of the invention.
  • the fusion proteins may be employed for example to increase the resistance to enzymatic degradation of the polypeptide portion of ERFAM construct and provides a means of improving shelf life, room temperature stability, and the like. It is understood that the foregoing considerations apply also to the ERFAM construct-serum albumin fusion proteins (including the human/humanized ERFAM construct-human serum albumin fusion protein) of the invention.
  • the polymer-conjugated ERFAM constructs may be used for treating or alleviating a pathology of a living animal body, preferably of a mammal, more preferably a primate including a human, which disorder or disease is responsive to the activity of immunosuppressor-type activity.
  • a preferred pathology is that of an inappropriate allergic response in a subject.
  • Kits (phage and respectively oligonucleotide libraries) are also commercially available from many companies and are currently widely used in research.
  • ERPAM allergen-specific IgG4
  • IgE-mediated allergy is administered to patients having IgE-mediated allergy, either during an allergic reaction for acute therapy or outside such a reaction.
  • a therapeutically effective dose is easily determined by those skilled in the art, where the endpoint is the drastic reduction or elimination of allergic response in the patient being treated.
  • ERFAM allergy-inhibitory effect is determined by skin prick test to the suspected allergen or by allergen-induced basophil degranulation (using peripheral blood). If allergic reactions are indeed decreased, allergen is administered under EKFAM cover in order to induce immune tolerance and permanently cure allergy.
  • EXAMPLE 1 ERFAM obtained by coupling an anti IgE antibody with an IgG4 antibody.
  • An anti-IgE rabbit polyclonal antibody was purchased from Washington Biotechnology Inc (Simpsonville, MD) that was obtained by immunizing rabbits with the peptide GVSAYLSRP SPFDLFIRKSPTITCL (SEQ ID NO: 1) representing the amino acid residues 335-359 localized within the C ⁇ 3 domain of the human IgE heavy chain sequence, as published by KJ Dorrington and HH Bennich (Structure-function relationships in human immunoglobulin E) Immunological Reviews 1978, 41 :3-26.
  • the antibody was affinity- purified from rabbit serum using the biotinylated target peptide (synthetized by Sigma- Genosys) bound to an AffinityPakTM Immobilized Avidin Column (Pierce), further concentrated using a Sartorius concentrator (MWCO 100,000).
  • the antibody concentration was determined using the BCA protein assay system from Pierce.
  • a human IgG4 antibody affinity purified from human myeloma serum was purchased from Sigma (catalog number 1-4683).
  • An ERFAM compound was produced by cross-linking the two antibodies using the Controlled protein-protein cross-linking kit from Pierce (23456).
  • dimethyl formamide 500 microliters dimethyl formamide were added to dissolve 2mg N- succinimidyl S-acetylthioacetate (SATA), then 28 microliters (representing a 10 fold molar excess) were added to 2ml of the the anti-IgE antibody (3mg/ml in PBS-EDTA) and incubated for 30 min at room temperature in order to add sulfhydryl groups to the molecule.
  • 5mg hydroxylamine HCl were then dissolved in 100 microliters of conjugation buffer (from the kit) and added to the SATA-modified anti-IgE antibody in order to de-protect the latent sulfhydryl groups during a further 2h incubation.
  • Non-reacted compounds were then removed using a Sartorius concentrator (MWCO 100,000).
  • concentration of the sulfhydryl-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
  • the affinity purified human IgG4 antibody was maleimide-activated using reagents from the same kit. 2mg sulfo-succinimidyl 4-[N-maleimidomethyl]cyclohexane-l- carboxylate (sulfo-SMCC) were dissolved in 2ml PBS then 10 microliters (a 10 fold molar excess) were added to 500 microliters human IgG4 antibody (lmg/ml in PBS).
  • the non-reacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000).
  • the concentration of the maleimide-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
  • Equal volumes of 2mg/ml sulfhydryl-activated anti-IgE antibody and maleimide- activated human IgG4 antibody were mixed and incubated for 60 minutes at room temperature, then were diluted in PBS to 10ml and washed using a Sartorius concentrator (MWCO 100,000).
  • the ERFAM concentration was assessed using the BCA protein assay kit and the final concentration was adjusted at 2mg/ml.
  • the ERFAM was split in two aliquots, then to one aliquot 20 microliters of an 0.5mg/ml PBS solution of the GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) peptide were added in order to block the binding site of the anti-IgE antibody while to the other aliquot an equal volume of PBS was added.
  • the ERFAM was stored at 4°C at least 24h before use.
  • Peripheral blood mononuclear cells were separated from blood by centrifugation over a Histopaque-1077 (Sigma C-8889) layer. Further, polymorphonuclear basophil cells (PB) were isolated using magnetic beads (the Basophil isolation kit, catalog 130-053-401 from Miltenyi Biotech). The IgE molecules attached to the PB were stripped by incubation for 3.5 minutes at room temperature in lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9) as described by Kleine et al, Int Arch Allergy Immunol. 2001; 126(4):277-85.
  • lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9
  • the PB were then sensitized to NP by incubation in AIM V cell serum-free culture medium in the presence of NP-specif ⁇ c chimaeric IgE antibody-containing cell culture supernatant and interleukin 3 (2ng/ml) as described by Shreffler et al, J Allergy Clin Immunol. 2004; 113(4):776-82.
  • peripheral blood mononuclear cells were then resuspended (50,000 in 0.1 ml in AIM V cell culture medium per well in 96-well plates) and cultured overnight in the presence of 50microliters AIM V-dialysed NP-specific chimaeric IgE antibody-containing cell culture supernatant (in order to sensitise them to NP) and 20 microliters of the 2mg/ml ERFAM solution (antiIgE-IgG4) or an equal volume of the ERFAM solution that was preincubated with the blocking peptide.
  • NP-(6)-bovine serum albumin (lmg/ml) were added to the each well and further incubated for 15 minutes at 37°C.
  • the supernatants were collected and frozen at -2O 0 C in order to measure histamine release later, while the cells were transferred to 5ml FACS tubes and washed with 4ml phosphate buffered saline containing 1% fetal calf serum and 0.1% sodium azide.
  • the PB were then stained in order to determine their activation which is measured by assessing their cell surface expression of the activation marker CD203c as described by Boumiza et al, Clin Exp Allergy. 2003; 33(2): 259-65.
  • the PB were stained with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), anti-MHCH-biotin (Ancelll31-O3O) with Streptavidin-peridinin- clorophyll-protein complex (Becton Dickinson 554064) and anti-CD45 APC (Becton Dickinson 555485) for 30 minutes at room temperature. Unbound antibodies were then washed and the PB analysed by flow cytometry using a FACS Calibur instrument.
  • EXAMPLE 2 ERFAM obtained by coupling an IgE-binding oligonucleotide with an anti-Fc ⁇ R antibody.
  • GGGGCACGTTTATCCGTCCCTCCTAGTGGCGTGCCCC-3' (SEQ ID NO: 2) was purchased from MWG Biotech (Ebersberg, Germany). The 5' end was modified by the introduction of a thiol group attached to the oligonucleotide by a spacer containing 6 carbon atoms.
  • the IgE-binding properties of this oligonucleotide have been reported by Wiegand TW, Williams PB, Dreskin SC, Jouvin MH, Kinet JP, Tasset D. (High-affinity oligonucleotide ligands to human IgE inhibit binding to Fc epsilon receptor I), J Immunol. 1996; 157(1): 221-30.
  • An affinity purified anti-human CD32-B goat polyclonal antibody was purchased from Santa-Cruz Biotechnology Inc. (sc-13271) as well as the corresponding blocking peptide that prevents the anti-human CD32-B antibody to bind to CD32-B (catalog number SC-13271P, also from Santa-Cruz Biotechnology Inc).
  • the ERFAM compound was produced by cross-linking the two oligonucleotides to the anti-human CD32-B antibody by using the Controlled protein-protein cross-linking kit from Pierce (23456).
  • the affinity purified anti-human CD32-B antibody was maleimide- activated using reagents from the same kit. 2mg sulfo-succinimidyl 4-[N- maleimidomethyl]cyclohexane-l-carboxylate (sulfo-SMCC) were dissolved in 2ml PBS then 3 microliters (a 10 fold molar excess) were added to 150 microliters anti-human CD32- B antibody (lmg/ml in PBS).
  • the non-reacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000).
  • the concentration of the maleimide-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
  • Equal volumes of 2mg/ml sulfhydryl-containing IgE-binding oligonucleotides and maleimide-activated anti-CD32-B antibody were mixed and incubated for 60 minutes at room temperature, then were diluted in PBS to 10ml and washed using a Sartorius concentrator (MWCO 100,000). Their concentration was assessed using the BCA protein assay kit and the final concentration was adjusted at 2mg/ml, then the resulting compound was split into two aliquots.
  • Peripheral blood mononuclear cells were separated from blood by centrifugation over a Histopaque-1077 (Sigma C-8889) layer. Further, polymorphonuclear basophil cells (PB) were isolated using magnetic beads (the Basophil isolation kit, catalog 130-053-401 from Miltenyi Biotech). The IgE molecules attached to the PB were stripped by incubation for 3.5 minutes at room temperature in lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9) as described by Kleine et al, Int Arch Allergy Immunol. 2001 ; 126(4): 277-85.
  • lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9
  • the PB were then sensitized to NP by incubation in AIM V cell serum-free culture medium in the presence of NP-specific chimaeric IgE antibody-containing cell culture supernatant and interleukin 3 (2ng/ml) as described by Shreffler et al, J Allergy Clin Immunol. 2004; 113(4): 776-82.
  • peripheral blood mononuclear cells were then resuspended (50,000 in 0.1 ml in AIM V cell culture medium per well in 96-well plates) and were cultured overnight in the presence of 50microliters AIM V-dialysed NP-specific chimaeric IgE antibody-containing cell culture supernatant (in order to sensitise them to NP) and 20 microliters of the 2mg/ml ERFAM solution (IgE-binding oligonucleotide - anti-CD32-B) or an equal volume of the ERFAM solution that was preincubated with the blocking peptide.
  • ERFAM solution IgE-binding oligonucleotide - anti-CD32-B
  • NP-(6)-bovine serum albumin (lmg/ml) were added to the each well and further incubated for 15 minutes at 37°C.
  • the supernatants were collected and frozen at -20 0 C in order to measure histamine release later, while the cells were transferred to 5ml FACS tubes and washed with 4ml phosphate buffered saline containing 1% fetal calf serum and 0.1% sodium azide.
  • the PB were then stained in order to determine their activation which is measured by assessing their cell surface expression of the activation marker CD203c as described by Boumi.za R, Monneret G, Forissier MF, Savoye J, Gutowski MC, Powell WS, Bienvenu J. (Marked improvement of the basophil activation test by detecting CD203c instead of CD63) , Clin Exp Allergy. 2003; 33(2): 259- 65.
  • the PB were stained with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), anti-MHCII-biotin (Ancelll3 1-030) with Streptavidin-peridinin- clorophyll-protein complex (Becton Dickinson 554064) and anti-CD45 APC (Becton Dickinson 555485) for 30 minutes at room temperatuie. Unbound antibodies were then washed and the PB analysed by flow cytometry using a FACS Calibur instrument.
  • ERFAM IgE-binding oligonucleotide - anti-CD32-B
  • Basophil activation expressed as the percentage of IgE+ cells that express CD203c
  • Bars represent average values + standard deviations of triplicate measurements.
  • EXAMPLE 3 ERFAM obtained by coupling an anti IgE antibody with an anti- Fc ⁇ R antibody and to polyethylene glycol.
  • An anti-IgE rabbit polyclonal antibody was purchased from Washington
  • Biotechnology Inc (Simpsonville, MD) that was obtained by immunizing rabbits with the peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) representing the amino acid residues 335-359 localized within the C ⁇ 3 domain of the human IgE heavy chain sequence, as published by KJ Do ⁇ ington and HH Bennich (St ⁇ icture-function relationships in human immunoglobulin E) Immunological Reviews 1978, 41 :3-26.
  • the antibody was affinity- purified from rabbit serum using the biotinylated target peptide (synthesized by Sigma- Genosys) bound to an AffinityPakTM Immobilized Ax ⁇ din Column (Pierce), further concentrated using a Sartorius concentrator (MWCO 100,000).
  • the antibody concentration was determined using the BCA protein assay system from Pierce.
  • An affinity purified anti- human CD32-B goat polyclonal antibody was purchased from Santa-Cruz Biotechnology Inc. (sc-13271), as well as the corresponding blocking peptide that prevents the anti-human CD32-B antibody to bind to CD32-B (catalog number sc-13271P, also from Santa-Cruz Biotechnology Inc).
  • the ERFAM compound was produced by cross-linking the anti-IgE antibody to the anti-human CD32-B antibody by using the Controlled protein-protein cross-linking kit from Pierce (23456). To the cross-linked antibodies, activated polyethylene glycol (molecular weight 20,000 daltons) was added in order to produce a molecule that has additional biological properties (be less immunogenic and have a longer half-life in the circulation).
  • the affinity purified anti-human CD32-B antibody was maleimide-activated using reagents from the same kit.
  • 2mg sulfo-succinimidyl 4-[N- maleimidomethyljcyclohexane-l-carboxylate (sulfo-SMCC) were dissolved in 2ml PBS then 3 microliters (a 10 fold molar excess) were added to 150 microliters anti-human CD32- B antibody (lmg/ml in PBS). After 30min incubation, the non-reacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000). The concentration of the maleimide-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
  • Equal volumes of 2mg/ml sulfhydryl-containing anti-IgE antibody and maleimide- activated anti-CD32-B antibody were mixed and incubated for 60 minutes at room temperature, then were diluted in sodium borate buffer 1OmM, pH 8.5 to 10ml and washed using a Sartorius concentrator (MWCO 100,000). Their concentration was assessed using the BCA protein assay kit and the final concentration was adjusted at 2mg/ml.
  • Polyethylene glycol (PEG, Fluka, catalog number 95172) was activated as described by Beauchamp CO, Gonias SL, Menapace DP, Pizzo SV.
  • the mixture was incubated in a shaking water bath at 37°C for 2h, then it was dialysed against 2 x 100ml PBS, then 2x against 100ml sodium borate buffer 1OmM, pH 8.5, using a MicroKros dialysis system from NBS-Biologicals (catalog number X-I lS-100).
  • 0.1ml of ERFAM and 0.1ml of activated PEG both compounds dissolved in sodium borate buffer 1OmM, pH 8.5 were then mixed and incubated for 48h at 4°C.
  • the buffer was replaced by dialysis against PBS (2 x 50ml, 6h each dialysis round) using the Slide-a-Lyzer Mini-dialysis unite (MWCO 3,500 daltons from Pierce, catalog number 69550), then the PEGylated ERFAM was split into two aliquots. To one aliquot 20 microliters of an 0.5mg/ml PBS solution of the peptide to which the anti-CD32-B antibody was raised were added in order to block the binding site of the anti-CD32-B antibody while to the other aliquot an equal volume of PBS was added. The ERFAM was stored at 4°C at least 24h before use.
  • PB polymorphonuclear basophil cells
  • the IgE molecules attached to the PB were stripped by incubation for 3.5 minutes at room temperature in lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9) as described by Kleine Budde I, de Heer PG, van der Zee JS, Aalberse RC (The stripped basophil histamine release bioassay as a tool for the detection of allergen-specific IgE in serum), Int Arch Allergy Immunol. 2001; 126(4): 277-85.
  • the PB were then sensitized to NP by incubation in AIM V cell serum-free ⁇ xlture medium in the presence of NP-specific chimaeric IgE antibody-containing cell culture supernatant and interleukin 3 (2ng/ml) as described by Shreffler WG, Beyer K, Chu TH, Burks AW, Sampson HA. (Microarray immunoassay: association of clinical history, in vitro IgE function, and heterogeneity of allergenic peanut epitopes), J Allergy Clin. Immunol. 2004; 113(4): 776-82.
  • peripheral blood mononuclear cells were then resuspended (50,000 in 0.1 ml in AIM V cell culture medium per well in 96-well plates) and were cultured overnight in the presence of 50microliters AIM V-dialysed NP-specific chimaeric IgE antibody- containing cell culture supernatant (in order to sensitise the ⁇ n to NP) and 20 microliters of the 2mg/ml ERFAM solution (antilgE antibody- PEG - anti-CD32-B) or an equal volume of the ERFAM solution that was preincubated with the blocking peptide.
  • NP-(6)-bovine serum albumin (lmg/ml) were added to the each well and further incubated for 15 minutes at 37°C.
  • the supernatants were collected and frozen at -20 0 C in order to measure histamine release later, while the cells were transferred to 5ml FACS tubes and washed with 4ml phosphate buffered saline containing 1% fetal calf serum and 0.1% sodium azide.
  • the PB were then stained in order to determine their activation which is measured by assessing their cell surface expression of the activation marker CD203c as described by Boumiza R, Monneret G, Forissier MF, Savoye J, Gutowski MC, Powell WS, Bienvenu J.
  • the PB were stained with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), anti-MHCII-biotin (Ancelll31-030) with Streptavidin-peridinin- clorophyll-protein complex (Becton Dickinson 554064) and anti-CD45 APC (Becton Dickinson 555485) for 30 minutes at room temperature. Unbound antibodies were then washed and the PB analysed by flow cytometry using a FACS Calibur instrument.
  • ERFAM antilgE antibody - PEG - anti-CD32-B
  • Basophil activation expressed as the percentage of IgE+ cells that express CD203c
  • Bars represent average values + standard deviations of triplicate measurements.
  • the antilgE antibody - PEG - anti-CD32-B ERFAM was found to inhibit 95.2% ⁇ 0.68% of basophil activation and the inhibitory activity was lost if the ERFAM was pre-incubated with the blocking peptide to which the anti-CD32-B antibody was raised.
  • EXAMPLE 4 ERFAM obtained by coupling IgE-binding components (anti ⁇ lgE or fragments thereof, peptides or oligonucleotides) with an anti-Fc ⁇ R antibody (or an Fab fragment thereof).
  • An anti-IgE rabbit polyclonal antibody was purchased from Washington Biotechnology Inc (Simpsonville, MD) that was obtained by immunizing rabbits with the peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) representing the amino acid residues 335-359 localized within the C ⁇ 3 domain of the human IgE heavy chain sequence, as published by KJ Dorrington and HH Bennich (Structure-function relationships in human immunoglobulin E) Immunological Reviews 1978, 41:3-26.
  • the antibody was affinity- purified from rabbit serum using the biotinylated target peptide (synthetized by Sigma- Genosys) bound to an AffinityPakTM Immobilized Avidin Column (Pierce), further concentrated using a Sartorius concentrator (MWCO 100,000). The antibody concentration was determined using the BCA protein assay system from Pierce. An affinity purified anti- human CD32-B goat polyclonal antibody was purchased from Santa-Cruz Biotechnology Inc. (sc-13271). The ERFAM compound was produced by cross-linking the two antibodies using the Controlled protein-protein cross-linking kit from Pierce (23456).
  • the affinity purified anti-human CD32-B antibody was maleimide-activated using reagents from the same kit.
  • 2mg sulfo-succinimidyl 4-[N-maleimidomethyl]cyclohexane-l- carboxylate (sulfo-SMCC) were dissolved in 2ml PBS then 3 microliters (a 10 fold molar excess) were added to 150 microliters anti-human CD32-B antibody (lmg/ml in PBS). After 30min incubation, the non-reacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000).
  • the concentration of the maleimide-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
  • Equal volumes of 2mg/ml sulfhydryl-activated anti-IgE antibody and maleimide- activated anti-CD32-B antibody were mixed and incubated for 60 minutes at room temperature, then the resulting compound was split into two aliquots To one aliquot 20 microliters of an 0.5mg/ml PBS solution of the GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) peptide were added in order to block the binding site of the anti-IgE antibody while to the other aliquot an equal volume of PBS was added.
  • the ERFAM was stored at 4°C at least 24h before use.
  • PB polymorphonuclear basophil cells
  • the IgE molecules attached to the PB were stripped by incubation for 3.5 minutes at room temperature in lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9).
  • the peripheral blood mononuclear cells were then resuspended (50,000 in 0.1 ml in AIM V cell culture medium per well in 96-well plates) and were cultured overnight in the presence of 50microliters AIM V-dialysed NP-specific chimaeric IgE antibody-containing cell culture supernatant (in order to sensitise them to NP) and 20 microliters of the 2mg/ml EKFAM solution (anti-IgE*anti-CD32-B) or an equal volume of the ERFAM solution that was preincubated with the blocking peptide.
  • NP-(6)-bovine serum albumin (lmg/ml) were added to the each well and further incubated for 15 minutes at 37°C.
  • the supernatants were collected and frozen at -20 0 C in order to measure histamine release later, while the cells were transferred to 5ml FACS tubes and washed with 4ml phosphate buffered saline containing 1% fetal calf serum and 0.1% sodium azide.
  • the PB were then stained with anti—
  • IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), anti-MHCII-biotin.
  • EXAMPLE 5 ERFAM-equivalent represented by allergen-specific IgG4 antibodies that also exert allergy-inhibitory effects. Allergen-specific IgG4 is separated from plasma on an affinity column, e.g., a
  • HiTrap NHS-activated HP column from Amersham Biosciences (Little Chalfont, UK, catalog number #17-0716-01), with anti-human IgG4 antibodies from Sigma-Aldrich (Poole, UK). Eluted IgG4 is then added to IgE-sensitized basophils and the capacity of allergen-specific IgG4 to inhibit IgE-mediated basophil degranulation is determined as previously described.
  • EXAMPLE 6 ERFAM obtained by coupling IgE-binding components (anti- IgE or fragments thereof, peptides or oligonucleotides) with an anti-CD31 antibody or an Fab fragment thereof.
  • IgE-binding components anti- IgE or fragments thereof, peptides or oligonucleotides
  • An anti-IgE rabbit polyclonal antibody was purchased from Washington
  • Biotechnology rnc (Simpsonville, MD) that was obtained by immunizing rabbits with the peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) representing the amino acid residues 335-359 localized within the C ⁇ 3 domain of the human IgE heavy chain sequence, as published by KJ Dorrington and HH Bennich (Structure-function relationships in human immunoglobulin E) Immunological Reviews 1978, 41 :3-26.
  • the antibody was affinity- purified from rabbit serum using the biotinylated target peptide (synthetized by Sigma- Genosys) bound to an AffinityPakTM Immobilized Avidin Column (Pierce), further concentrated using a Sartorius concentrator (MWCO 100,000).
  • the antibody concentration was determined using the BCA protein assay system from Pierce.
  • An affinity purified mouse anti-human CD31 monoclonal antibody was purchased from Serotec (MCA 1738).
  • the ERFAM compound was produced by cross-linking the two antibodies using the Controlled protein-protein cross-linking kit from Pierce (23456).
  • the affinity purified anti-human CD31 antibody was maleimide-activated using reagents from the same kit.
  • 2mg sulfo-succinimidyl 4-[N-maleimidomethyl]cyclohexane-l- carboxylate (sulfo-SMCC) were dissolved in 2ml PBS then 3 microliters (a 10 fold molar excess) were added to 150 microliters anti-human CD32-B antibody (lmg/ml in PBS). After 30min incubation, the non-reacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000).
  • the concentration of the maleimide-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
  • Equal volumes of 2mg/ml sulfhydryl-activated anti-IgE antibody and maleimide- activated anti-CD31 antibody were mixed and incubated for 60 minutes at room temperature, then the resulting compound was split into two aliquots To one aliquot 20 microliters of an 0.5mg/ml PBS solution of the GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) peptide were added in order to block the binding site of the anti-IgE antibody while to the other aliquot an equal volume of PBS was added.
  • the ERFAM was stored at 4°C at least 24h before use.
  • PB polymorphonuclear basophil cells
  • the IgE molecules attached to the PB were stripped by incubation for 3.5 minutes at room temperature in lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9).
  • the peripheral blood mononuclear cells were then resuspended (50,000 in 0.1 ml in AIM V cell culture medium per well in 96-well plates) and were cultured overnight in the presence of 50microliters AIM V-dialysed NP-specific chimaeric IgE antibody-containing cell culture supernatant (in order to sensitise them to NP) and 20 microliters of the 2mg/ml ERFAM solution (anti-IgE anti-CD31) or an equal volume of the ERFAM solution that was preincubated with the blocking peptide.
  • NP-(6)-bovine serum albumin (lmg/ml in PBS) were added to the each well and further incubated for 15 minutes at 37°C.
  • the supernatants were collected and frozen at -2O 0 C in order to measure histamine release later, while the cells were transferred to 5ml FACS tubes and washed with 4ml phosphate buffered saline containing 1% fetal calf serum and 0.1% sodium azide.
  • the PB were then stained with anti- IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), anti-MHCII-biotin (Ancelll31-030) with Streptavidin-peridinin-clorophyll-protein complex (Becton Dickinson 554064) and anti-CD45 APC (Becton Dickinson 555485) for 30 minutes at room temperature. Unbound antibodies were then washed and the PB analysed by flow cytometry using a FACS Calibur instrument.
  • EXAMPLE 7 Effect of a mixture of an ERFAM obtained by coupling IgE- binding components (anti-IgE or fragments thereof, peptides or oligonucleotides) with an anti- anti-Fc ⁇ R antibody or an Fab fragment thereof and another ERFAM obtained by coupling IgE-binding components (anti-IgE or fragments thereof, peptides or oligonucleotides) with an anti-CD31 antibody or an Fab fragment thereof.
  • the two ERFAM molecules antiIgE-anti-CD32B and antiIgE-antiCD31 were produced as previously described. In order to test them, 20 microliters of each of them were added to the PB as described and the resulting inhibitory effect was assessed.
  • EXAMPLE 8 ERFAM obtained by coupling an anti-IgE antibody with a Fab fragment of an anti-Fc ⁇ R antibody.
  • An anti-IgE rabbit polyclonal antibody was purchased from Washington Biotechnology Inc (Simpsonville, MD) that was obtained by immunizing rabbits with the peptide GVSAYLSRP SPFDLFIRKSPTITCL representing the aminoacid residues 335-359 localized within the C ⁇ 3 domain of the human IgE heavy chain sequence, as published by KJ Dorrington and HH Bennich (Structure-function relationships in human immunoglobulin E) Immunological Reviews 1978, 41:3-26.
  • the antibody was affinity-purified from rabbit serum using the biotinylated target peptide (synthetized by Sigma-Genosys) bound to an Aff ⁇ nityPakTM Immobilized Avidin Column (Pierce), further concentrated using a Sartorius concentrator (MWCO 100,000). The antibody concentration was determined using the BCA protein assay system from Pierce. An affinity purified anti-human CD32-B goat polyclonal antibody was purchased from Santa-Cruz Biotechnology Inc. (sc-13271). This antibody was digested with papain using the ImmunoPure Fab preparation kit from Pierce (catalogue number 44885).
  • 12 ml of a digestion buffer was prepared by dissolving 42mg cysteine HCl in 12 ml phosphate buffer pH 10 (both reagents were from the kit).
  • 0.2ml papain slurry were transferred to an Eppendorf 1.5ml tube and washed 3 times with ImI digestion buffer (30 seconds centrifugation at 100Og).
  • the buffer was then removed and 100 microliters of anti-CD32B and 100 microliters buffer were added.
  • the Eppendorf was incubated for 16h in a shaking water bath at 37 0 C, then it was again centrifuged and the supernatant containing the digested antibody was collected.
  • the supernatant was then transferred to another Eppendorf 1.5ml tube and mixed with 0.2ml immobilized protein A (from the Immunopure Protein A antibody purification kit, Pierce, catalogue number 44667) and further incubated for 30 minutes at room temperature.
  • the supernatant containing the Fab fragments was collected by centrifugation and dialysed against 2x50ml PBS, 6h each, using a Slide-a-Lyzer MicroDialysis unit from Pierce (catalogue number 69550).
  • the resulting Fab solution was concentrated using the Slide-a-Lyzer concentration solution (Pierce catalogue number 66528).
  • the final Fab concentration was measured using the BCA assay from Pierce (catalogue number 23225) and adjusted to 0.5mg/ml with PBS, pH 7.4.
  • the ERFAM compound was produced by cross-linking the antibody with the Fab fragment using the Controlled protein-protein cross-linking kit from Pierce (23456). Briefly, 500 microliters dimethyl formamide were added to dissolve 2mg N- succinimidyl S-acetylthioacetate (SATA), then 28 microliters (representing a 10 fold molar excess) were added to 2ml of the the anti-IgE antibody (3mg/ml in PBS-EDTA) and incubated for 30 min at room temperature in order to add sulfhydryl groups to the molecule.
  • SATA N- succinimidyl S-acetylthioacetate
  • 5mg hydroxylamine HCl were then dissolved in 100 microliters of conjugation buffer (from the kit) and added to the SATA-modified anti-IgE antibody in order to de-protect the latent sulfhydryl groups during a further 2h incubation. Non-reacted compounds were then removed using a Sartorius concentrator (MWCO 100,000). The concentration of the sulfhydryl-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS. The Fab fragment of the anti-human CD32-B antibody was maleimide-activated using reagents from the same kit.
  • sulfo-SMCC 2mg sulfo-succinimidyl 4-[N- maleimidomethyl]cyclohexane-l-carboxylate (sulfo-SMCC) were dissolved in 2ml PBS then 2 microliters (a 10 fold molar excess) were added to 50 microliters anti-human CD32- B antibody (0.5mg/ml in PBS). After 30min incubation, the non-reacted sulfo-SMCC was removed using a Slide-a-Lyzer MicroDialysis unit from Pierce (catalogue number 69550).
  • Equal volumes of 0.5mg/ml sulfhydryl-activated anti-IgE antibody and maleimide- activated Fab fragment of the anti-human CD32-B antibody were mixed and incubated for 60 minutes at room temperature, then the resulting compound was split into two aliquots To one aliquot 20 microliters of an 0.5mg/ml PBS solution of the GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) peptide were added in order to block the binding site of the anti-IgE antibody while to the other aliquot an equal volume of PBS was added.
  • the ERFAM was stored at 4 0 C at least 24h before use.
  • PB polymorphonuclear basophil cells
  • the IgE molecules attached to the PB were stripped by incubation for 3.5 minutes at room temperature in lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9).
  • the peripheral blood mononuclear cells were then resuspended (50,000 in 0.1 ml in AIM V cell culture medium per well in 96-well plates) and were cultured overnight in the presence of 50microliters AIM V-dialysed NP-specific chimaeric IgE antibody-containing cell culture supernatant (in order to sensitise them to NP) and 20 microliters of the 2mg/ml ERFAM solution (anti-IgE bound to the Fab fragment of the anti-human CD32-B antibody) or an equal volume of the ERFAM solution that was preincubated with the blocking peptide.
  • NP-(6)-bovine serum albumin (lmg/ml) were added to the each well and further incubated for 15 minutes at 37°C.
  • the supernatants were collected and frozen at -2O 0 C in order to measure histamine release later, while the cells were transferred to 5ml FACS tubes and washed with 4ml phosphate buffered saline containing 1% foetal calf serum and 0.1% sodium azide.
  • the PB were then stained with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), anti-MHCII- biotin (Ancelll31-030) with Streptavidin-peridinin-clorophyll-protein complex (Becton Dickinson 554064) and anti-CD45 APC (Becton Dickinson 555485) for 30 minutes at room temperature. Unbound antibodies were then washed and the PB analysed by flow cytometry using a FACS Calibur instrument.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Wood Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Pulmonology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention provides an IgE-Retargeting, Function-Altering Molecules (ERFAM) construct of the formula A'-B', wherein A' represents a moiety that binds an IgE and B' represents a moiety that binds an inhibitory receptor; or a construct of the formula A'-X-B', wherein A' represents a moiety that binds an IgE, X represents a linker moiety, B' represents a moiety that binds an inhibitory receptor. Also provided are their methods of use in treating IgE-related disorders, e.g., allergy.

Description

IgE-Retargeting, Function-Altering Molecules (ERFAM) for Treatment of
Allergic Diseases
FIELD OF THE INVENTION The invention relates to molecules that bind to IgE antibodies and convert them into allergen-dependent inhibitors of allergy. Such molecules are useful, e.g., for the treatment of allergy and other IgE related diseases.
BACKGROUND OF THE INVENTION More than 500 million individuals suffer from allergies worldwide and the prevalence of allergies is rapidly increasing, affecting predominantly children and young people. The annual medical costs caused by allergies are above £1 billion in the UK and more than $10 billion in the US, but the total costs for the society are clearly much higher. An allergy is characterized by the production of IgE type antibodies that are specific for certain antigens (allergens), which trigger the immune response. Once these allergens enter the body, the presence of specific IgE triggers allergic reactions. The biology of IgE and its role in allergic diseases has been reviewed. See, e.g., Gould et ah, Annual Rev Immunol 2003, 21 :579-628. IgE triggers allergic reactions when allergens enter the body because IgE establishes a link between the respective allergen and the triggering mechanism represented by the activation apparatus of allergy-effector cells. IgE establishes this link due to its bi-functional binding characteristics: at one end it has two allergen-specific binding sites (F antigen binding - Fab), while at the other end it binds to high-affinity IgE receptors (FcεRI) with its constant binding site (Fc).
FcεRI molecules are themselves bi-functional molecules: their extracellular region binds IgE while their intracellular region contains activating sites that can trigger the activation signaling cascade. A low-affinity IgE receptor (FcεRII/CD23) may also be involved in allergy.
Other studies addressed the induction and role of IgG antibodies during allergen- specific immunotherapy (SIT). It was shown that while SIT leads to an increase of pathogenic IgE, it also leads to an even higher raise in the levels of IgG and IgG4. See, e.g., review by DK Ledford in: ALLERGENS AND ALLERGEN IMMUNOTHERAPY, RF Lockley and SC Bukantz Eds., Marcel Dekker 1999, pp.359-371. This was further documented by using the in vivo skin prick test titration, which demonstrated that the amount of allergen-specific IgG induced after SIT is correlated with a decrease in skin reaction. See, e.g., Witteman et ah, 1996 International Archives of Allergy and Immunology 109: 369-375. Indeed, clinical reactivity to allergen decreases within weeks of starting rush immunotherapy when allergen- specific IgE levels are still high but specific IgG4 has increased. See, e.g., Lack et al. Journal of Allergy and Clinical Immunology 99: 530-538, 1997.
SUMMARY OF THE INVENTION Included within the scope of this invention is at least one IgE-Retargeting, Function-
Altering Molecule (ERFAM) construct having the formula A'-B', wherein A' represents a moiety that binds an IgE and B' represents a moiety that binds an inhibitory receptor. In some embodiments, A' and B' are operably linked. Alternatively, the ERFAM has the formula A'-X-B', wherein: A' represents a moiety that binds an IgE; X represents a linker moiety; and B' represents a moiety that binds an inhibitory receptor; wherein A'-X-B' are operably linked. ERFAM constructs are useful for treating IgE related diseases and disorders, including allergic reactions to at least one allergen. In one embodiment of the invention, ERFAM binds to IgE and transforms it into an inhibitor of allergy. In various embodiments, ERFAM specifically recognizes and binds at least one, at least two, or at least three or more epitopes. This is also referred to as being at least monospecific, at least bispecific, or at least multi-specific. In a specific embodiment, the A' and B' portions of the ERFAM construct provide the first and second specificities. In a related embodiment wherein ERFAM is at least bispecific, a first specificity is for IgE and a second specificity is functionally equivalent for the Fc portion of an IgG4 antibody. In a related embodiment, an at least bispecific ERFAM composition includes a first portion comprising an anti-IgE antibody moiety of IgG4 isotype, wherein said composition binds to at least one epitope comprising IgE but does not cross-link cell-bound IgE.
In an alternative embodiment wherein ERFAM is at least bispecific, a first specificity is for IgE and a second specificity is for binding to an inhibitory cell surface receptor. A specific alternative bispecific ERFAM composition includes a structure that recognizes and binds to an inhibitory cell surface receptor selected from the group consisting of an immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing receptor and an apoptosis-inducing receptor.
In a specific embodiment, the invention encompasses an EKFAM molecule that contains an allergen-specific IgG4 antibody. In a variant embodiment, at least one A' moiety or at least one B1 moiety is a cyclic peptide that spontaneously linearizes only when bound to IgE. In this embodiment, the cyclic peptide specifically binds an IgE molecule in order to linearize. In a more specific embodiment, an ERFAM molecule containing the at lease one IgE specific cyclic peptide binds FcγR or a corresponding inhibitory receptor after the cyclic peptide linearizes after binding IgE. Various linkers X that operationally link at least one A' moiety to at least one B' moiety are encompassed by the formula A'-X-B1. In a specific embodiment, the linker X comprises a polyethylene glycol ("PEG") linker. Other linker X compositions include at least one amino acid, a polypeptide, or any other chemical moiety known in the art that can operably link at least two polypeptide moieties. In a preferred embodiment, the linker X composition is non-immunogenic. In an ERFAM composition containing a PEG linker X, the ERFAM has a prolonged circulating half-life in the body. In a related embodiment, ERFAM containing a PEG linker X has a decreased immunogenicity.
In certain embodiments, the ERFAM composition is in a pharmaceutical carrier. In a preferred embodiment, a therapeutically effective amount of ERFAM is provided. A kit containing at least one ERFAM composition in a container is also provided.
The invention also provides methods of using an ERFAM composition. In one embodiment, the method includes administering a therapeutically effective dose of an ERFAM molecule to a subject in need thereof for modulating the effects of an IgE related hypersensitivity reaction. In a specific embodiment, the method of use is for treating allergies. In a preferred embodiment, the ERFAM molecule being administered contains an allergen-specific IgG4 antibody portion.
Finally, at least one method of producing an ERFAM molecule is provided, wherein the method comprises producing an ERFAM molecule and purifying it away from impurities. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the case of conflict, the present specification, including definitions, will control. In. addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent Jfrom the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a representation of the design and mode of action of IgIE Retargeting Function- Altering Molecules (ERFAM). Such molecules bind to IgE in its Fc region and as a consequence interfere with IgE binding to the IgE receptors (FcεRI and FcεRII). At the same time, ERFAM provide a different binding site that is specific for receptors having different functions and thus transforms IgE into an allergy-inhibiting antibody. When antigen reaches an immune effector cell (for example a mast cell or a B cell) that has both FcεRI-bound IgE and IgE bound to an inhibitory receptor (for example PcγRIIb) due to ERFAM-dependent retargeting, the crosslmking of FcεRI with FcγRIIb will lead to the inhibition of allergy effector activation.
FIG. 2 is a bar graph demonstrating inhibition of basophil activation using exemplary ERFAMs of the invention. FIG. 3 is a bar graph demonstrating inhibition of basophil activation using exemplary ERFAMs of the invention.
FIG.4 is a bar graph demonstrating inhibition of basophil activa_tion using exemplary ERFAMs of the invention.
DETAILED DESCRIPTION
ERFAM Constructs of the Invention
Provided are constructs that convert IgE antibodies into allergerx-specific inhibitors of allergy. Several types of such inhibitors are described herein and are xeferred to as IgE- Retargeting Function-Altering Molecules (ERFAM).
An illustration of ERFAM binding is provided in FIG. 1. ERFA-M binds to the Fc region of IgE. As a consequence of ERFAM-binding, other molecules are blocked from interacting with the Fc region of IgE, such that it interferes with IgE binding to the IgE receptors (FcεRI and FcεRII). At the same time, ERFAM provides a second binding site that is specific for receptors having different functions. A first binding by ERFAM to IgE and a second binding by ERFAM to the receptor having different functions thus transforms IgE into an allergy-inhibiting antibody.
Since IgE is generally allergen-specific, the binding of circulating and mast-cell bound IgE will allow for the inhibition of IgE mediated immune responses to allergen without interfering with responses to other antigens.
In addition, binding of ERFAM to IgE is not specific to any one allergen of interest. ERFAM can bind any IgE. Therefore, unlike allergen-specific immunotherapy and other known anti-allergy therapies used to induce tolerance, ERFAM is an effective therapeutic for inducing anergy against any of the wide spectrum of allergens to which a patient has an allergen-specific IgE-mediated allergic response.
Preferably, ERFAMs induce the generation of allergen-dependent inhibitors that are active only when allergen will also be administered. This allows for an effective control of allergy therapy and avoid secondary effects.
SIT is aimed at inducing the production of inhibitory IgG antibodies. Administration of ERFAM therefore by-pass, e.g., SIT, by transforming the existing pathogenic IgE that trigger allergic reactions directly into anti-allergic IgG-like allergy inhibitors. ERFAMs do not pose pro-allergic risks because they do not involve allergen administration and do not cross-link FcεRI. However, an ERFAM is not immunotherapeutic by itself.
In some embodiments ERFAM molecules, when bound to IgE, confer to IgE the functional attributes of allergy-inhibiting antibodies such as IgG4. In one embodiment, the molecule is a monoclonal IgG4 antibody that binds to IgE. In some embodiments, ERFAM is a multifunctional non-anaphylactic molecαle that contains an IgE-binding site and a binding site for the receptor(s) that bind to an inhibitory receptor, such as IgG4. In certain embodiments the ERFAM also contains a 'linker' component. This linker component is useful, e.g., for prolongation of the ERFAM sexum half-life). The ERFAM molecule is alternatively represented by the formula A'-B', where A' represents a first functional element {e.g., the IgE binding site) and B' represents a second functional element (e.g., the binding site for at least one inhibitory receptor). Alternatively, the ERFAM molecule is alternatively represented by the formula A'-X-B', where A' represents a first functional element (e.g., the IgE binding site), X represents the linker component, and B' represents a second functional element (e.g., the binding site for at least one inhibitory receptor).
In other embodiments, an ERFAM molecule is a smaller bifunctional molecule containing an IgE-binding site (a first function) and a site that has similar functional binding properties as the Fc portion of IgG4 antibodies (a second function). These two sites are linked directly or indirectly through a third part that confer desirable pharmacological and immunological properties to the molecule. Bifunctional molecules are disclosed, e.g., in PCT publications WO 96/40788, WO 98/09638, WO 02/088312 and WO 02/102320.
Thus, in preferred embodiments, an ERFAM molecule is a bifunctional molecule characterized as having:
(1) a first binding site, i.e., the IgE-binding sites, of these molecules is an anti-IgE antibody preferably but not exclusively of IgG4 isotype, or a fragment thereof or a peptide or a peptidomimetic molecule or an oligonucleotide that bind to IgE;
(2) a second binding site, i.e., the IgG4-binding site or its equivalent, wherein the site has similar functional binding properties as the Fc portion of IgG4 antibodies. In various embodiments, this is an IgG4 antibody or an Fc fragment thereof or an anti-FcγR antibody or a peptide or a peptidomimetic molecule or an oligonucleotide aptamer, all of which have similar effects as IgG4 binding to its receptors. Where applicable, the receptor portion making up the second site preferably is an immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing inhibitory receptor-targeted molecule. Generally, ITIMs contain the consensus sequence {ILV}-x-x-Y-x-{LV} (SEQ ID NO: 3) in the cytoplasmic tail of inhibitory receptors.
(3) an optional linker moiety operably linking the first and second binding sites. The linker may have one or more functions, including increasing ERFAM serum half life, decreasing degradation, and optimizing stereochemistry. This intermediary part binds the above sites and confers desirable pharmacological and immunological properties to the molecule is a polyethylene glycol (PEG) moiety or a functionally equivalent molecule.
An equivalent embodiment is represented by allergen-specific IgG4 antibodies that is administered to allergic patients in order to obtain similar effects. The individual components of the ERFAM molecule are described more fully below. IgE binding component of ERFAM
In certain embodiments, ERFAM contains the sequences of IgE binding polypeptides known in the art.
Known IgE-binding site component of ERFAM peptides, antibodies, aptamers, other chemical entities, and their equivalents, include the following:
(a) antibodies: including but not limited to E25 (Novartis, patented), TNX-901 (Tanox, WO 92/17207) or other IgE-binding antibodies described herein;
(b) peptides: including but not limited to peptides disclosed in WO 98/04718 (ME Digan) and WO 99/05271 (Gould et ah), and any other function IgE-binding peptide sequence, whether it be naturally occurring or synthetic, and which contain L- or D-amino acids, and may contain post-translational modifications such as glycosylation, phosphorylation, myristoylation, or the like;
(c) aptamers: including but not limited to the oligonucleotides that bind to human IgE with high affinities and high specificity, described in J Immunol 157: 221-230, 1996), i.e., a 2'-NH2 RNA group A ligand represented by the 35-nucleotide truncate IGELl .2 (gggaggacgaugcgg; SEQ ID NO: I)(Ka = 30 nM) or a ssDNA group ligand represented by the 37-nucleotide truncate DI 7.4 (ggggcacgtttatccgtccctcctagtggcgtgcccc; SEQ ID NO:2) (Kd = 1OnM), which competitively inhibit the interaction of human IgE with FclεRI and block IgE-mediated serotonin release from cells triggered with IgE-specific antigens or anti- IgE antibodies; and
(d) Peptide mimetics: including but not limited to, e.g., tetracyclic compounds (see, e.g., US patent 5,965,605).
It is contemplated that these known IgE binding moieties are used in the present invention, or novel moieties having a similar or equivalent function are generated by those skilled in the art. These and other publications listed herein are contemplated as part of the invention. All publications referenced herein are incorporated by reference in their entirety.
Publications reporting anti-IgE non-stimulatory antibodies include, but are not limited to, PCT publications WO 92/17207, WO 92/21031, WO 99/38531, WO 00/16804 and WO 02/079257, plus U.S. Patent No. US 6,329,509, etc. Alternatively, soluble FcεRI receptors and their derivatives that bind to IgE, e.g., through the FcεRI alpha-chain fragment, include U.S. Patent No. 6,090,384, and PCT publications WO 98/04718 and WO 99/05271. In particular, WO 98/04718 (ME Digan) describes FcεRI alpha-chain fragment that binds to IgE fused to human serum albumin, and have prolonged lifetime in the circulation and lower risk of secondary reactions.
Publications that report peptides or other compounds that inhibit IgE binding to its receptor include, but are not limited to, US patent no. 5,965,605 to Cheng et al. and Heska, reporting inhibition of IgE-binding to its receptor by tetracyclic chemical compounds; Helm et al., 1997 Allergy 52: 1155-1169; McDonnell et al, 1996 Nature Struct Biol 3: 419-425; Iwasaki et al, 2002 Biochem Biophys Res Comm. 293: 542-548.; and Wiegand et al, 1996 J Immunol 157: 221-230.
Additional art-known aptamers and other chemical moieties that specifically bind IgE can be used in generating the ERFAM molecules. Alternately, novel IgE-binding structures are discovered using classical methods including, but not limited to, monoclonal antibodies, phage display, and/or aptamer technology.
Linker component of ERFAM
The first and second functional ERFAM components are joined directly to each other by covalent bonding. Alternatively, the first and second functional ERFAM components are joined indirectly through a linker {e.g., glycol, polypeptide sequence, resin, carbohydrate, polymer, or sugar groups as described below). The conjugated complex in the presence or absence of the linker is preferably non-immunogenic.
Linker molecules such as polyethylene glycol (or other structures and chemical moieties), where present, provide a 'skeleton' on which IgE-binding sites can be operably linked to the inhibitory receptor binding component to create a final ERFAM molecule. Contemplated functions of a linker component are to increase serum half-life of an ERFAM molecule, decrease degradation, increase size, and/or modify the steric relationship between the ERFAM components. For example, by increasing the size of ERFAM, the linkers prevent its rapid renal excretion and prolong its circulatory half-life or confer other advantageous pharmacokinetic properties. w PEGylation methods for altering the pharmacodynamic properties of drugs are known to those skilled in the art, and are contemplated as part of the present invention. PEG polymers arebranched or unbranched, and included are PEG polymers made up of a single PEG subunit or multiple PEG subunits. Alternatively, linkers are operably linked in- frame to a polypeptide sequence, such as a flexible hinge. Other linker moieties and methods of producing the same are known in the art and generally include, e.g., chemical linker, polymer, peptide, polypeptide, sugars, rigid bead, synthetic cleavable moiety, carbohydrates and glycerol, and more specifically may include biotin, streptavidin, cytokine, antibody hinge region, Ficoll, polyethylene glycol (PEG), methoxypolyethylene glycol (MPEG), polyethylene glycol-diacid, PEG monoamine, MPEG monoamine, MPEG hydrazide, MPEG imidazole, methoxypolypropylene glycol, copolymers of polyethylene glycol and methoxypolypropylene glycol, dextran, and polylactic-polyglycolic acid. See, e.g., US patent nos. 6,309,633, 6,552,167, 6,541,610 and 6,592,847Conjugation of polypeptides to low molecular weight compounds (e.g., aminolethicin, fatty acids, vitamin B 12, and glycosides) are also known in the art. See, e.g., R. Igarishi et al., "Proceed. Intern. Symp. Control. ReI. Bioact. Materials, 17, 366, (1990); T. Taniguchi et al. Ibid 19, 104, (1992); G. J. Russel-Jones, Ibid, 19, 102, (1992); M. Baudys et al., Ibid, 19, 210, (1992)). The linker molecule ismonovalent, divalent or multivalent.
The linker additionally may act as a spacer. A spacer is of any suitable desired length, including about 10-20 ran, about 20-40 nm, about 40-60 nm, about 60-100 nm, about 100 nm or more, such as about 500 nm or more up to about 1 μm or more.
Inhibitory receptor-binding component of ERFAM
In embodiments, the ERFAM molecules of the present invention contain inhibitory receptor binding molecules that interact with inhibitory receptors. Inhibitory receptor binding molecules include peptides and fragments of antibody Fc regions). In some embodiments of ERFAM, IgG4 antibodies or Fcγ fragments thereof are used. Alternately, binding to FcγR is ensured by antibodies against FcγR, (such as antibodies against FcγRIIb) or fragments thereof, peptides or aptamers with equivalent binding properties. FcγR- targeted therapies are known in the art. FcγR and FcγR-targeted molecules (antibodies, bi- functional antibodies, peptides) are disclosed in, e.g., US 4,954,617 (MW Fanger et al., disclosing monoclonal antibodies to Fc receptors for IgG on human mononuclear phagocytes); US 6,365,161 (Yashwant et al., disclosing therapeutic compounds containing of anti-Fc receptor binding agents); and PCT publication WO 96/08512 (PM Hogarth et al, disclosing polypeptides with Fc binding ability).
In a preferred embodiment, the ERFAM binds to an inimunoreceptor tyrosine-based inhibitory motif (ITIM)-containing inhibitory receptor. The (ITIM)-containing inhibitory receptor is present on the surface of any immune-related cell. Non-limiting examples of immune-related cells include basophils, mast cells, B cells, platelets, and antigen presenting cells (APCs). APCs include dendritic cells, macrophages, and monocytes. Preferably, the ITIM-containing receptor is present on the surface of a basophil or mast cell. An exemplary (ITIM)-containing inhibitory receptor is CD31, also known as PECAM-I (Platelet/endothelial cell adhesion molecule 1) which is present on basophils (See, Fureder et al , Allergy. 1994; 49: 861 -5). It has been demonstrated that CD31 cross-linking inhibits platelet activation at least in part due to inhibition of signaling from the collagen glycoprotein VI receptor. (See, Newman et al, Blood. 2001 97(8): 2351-7). CD31 also inhibits antigen-receptors on B lymphocytes via the CD31 ITIM (See, Wilkinson et al, Blood. 2002; 100(1): 184-93). Another exemplary (ITIM)-containing inhibitory receptor is CD32B (also known as
FcγRIIb). CD32B is the receptor for the Fc fragment of IgG, low affinity lib; (Accession NP_003992.2).
Other ITIM-containing receptors are known in the art and include, but are not limited to, PCT publications WO 96/40788 (PM Guyre and M Fanger); WO 98/09638 (Kate et al. , demonstrating cross-linking gp49B 1 with FcεRI receptors); WO 02/088317 (Saxon et al, demonstrating cross-linking FcγRIIb with FcεRI receptors); WO 02/102320 (An et al, demonstrating cross-linking FcγRIIb with FcεRI receptors); and Daeron et al, 1995, J Clin Invest 95: 577-585. ITIM-containing receptors can be identified based on the presence of ITIMs. These mofits can be identified by methods known in the art (See, Staub et al, Cellular Signaling 2004, 16:435-456).
Basophils and mast cells contain a plurality of ITIM-containing inhibitory receptors. The present invention provides for the administration of two or more ERFAM molecules that target separate to a subject. The ERFAM molecules are provided consecutively or concurrently. Thus a stronger inhibitory effect is achieved by synergistic actions among the plurality of ERFAMs.
In a specific patient population, it is desirable to minimize the effect of ERFAM binding alone to the IgG4 receptor, or the ITIM/inhibitory receptor bound or targeted by the second functional ERFAM moiety. Therefore, ERFAM may contain a cyclic peptide that spontaneously linearizes ("de-cycle") only when bound to IgE. In this model, only then does ERFAM subsequently become able to bind FcγR or the corresponding inhibitory receptor. This will avoid the "blocking" of FcγR by non-IgE bound ERFAM. Synthetic cyclic peptides that inhibit the interaction between IgE and its high affinity receptor FcεRI are known in the art. See, e.g., McDonnel et al, 1996 Nat Struct Biol 3: 419-425. Similar methodologies can be used to generate cyclic peptides that linearize only when bound to IgE. In one embodiment, the peptides are cyclized by disulphide bond formation between terminal cysteine residues. In variant embodiments, the cyclic peptides are L-amino acid peptides and/or are a retro-enantiomeric D-amino acid peptides.
Apoptosis-inducing receptor-binding component of ERFAM
In embodiments, the ERFAM molecules of the present invention contain apoptosis- inducing receptor binding molecules that interact with apoptosis-inducing receptors. Apoptosis-inducing receptors are known in the art, including TNF-related apoptosis- inducing ligand receptor 2, TRAIL receptor 2,TNFRl , Fas, DR3 , and AIR/LARD. [VICTOR: Please provide any additional information you have on this class of apoptosis-inducing receptors]
ERFAM features An ERFAM molecule will contain one or more of the following features.
• Safety: no allergen is initially given so there is a reduced risk of anaphylaxis. Therefore a hospital environment for administration is generally not required.
• Efficiency: treated allergy patients are able to freely eat food allergens or be exposed to environmental allergens without any symptom of anaphylaxis, asthma, rhinitis etc. once the level of ERFAM-modified IgE antibodies (IgG4-like antibodies) that are bound on mast cells reaches an 'inhibitory' ratio to bound unmodified IgE. In fact IgE levels in the blood drop rapidly because IgE is turned into 'IgG4-like' antibodies by ERFAM.
• ERFAM effect is limited to the allergen: since the only targeted antibody is IgE, there is no interference with antibody immune response to other antigens. However, in some cases the effect of binding ERFAM alone to IgG4 receptors might be significant. Therefore, in one embodiment an ERFAM is a cyclic peptide that spontaneously 'de-cycles' only if bound to IgE and only subsequently become able to bind FcγR. This avoids having FcγR being 'blocked' by non-IgE bound ERFAM.
• ERFAM does not need to be allergen-tailored: since it is the pre-existing IgE that accounts for the allergen specificity, ERFAM is effective for all IgE-mediated allergies, regardless of the allergen. In fact, the causal allergen need not even be identified; the only diagnostic procedure is to confirm that the allergy is caused by IgE - i.e. IgE levels are raised.
• ERFAM does not need to be patient-tailored: the IgE-Fc is relatively constant and eventual polymorphisms does not affect its binding to ERFAM. However, if such a polymorphism prevent a particular IgE from being bound by ERFAM, then that IgE also is unable to bind to its natural ligand - the high affinity FcεRI - so no allergic reactions result. In addition, FcγR may also contain polymorphisms. For this situation, the ERFAM prove more effective where the second functional component is made up of a peptide, aptamer and/or monoclonal antibody directed to such a polymorphic receptor, as compared to an ERFAM containing an IgG4 Fc portion.
• ERFAM is fast-acting: allergy symptoms will disappear within hours or days of treatment because the ERFAM-bound IgE /IgE ratio rises in a treated subject. In one embodiment, ERFAM is used in anaphylaxis and in asthma attacks to stop allergen-induced degranulation of mast cells. An ERFAM formulation is administered on its own or in combination with an antihistamine.
• Requirement for only a short course of treatment: a few doses over a limited period of time are sufficient. This eliminates long-term daily or seasonal administrations. Once ERFAM-bound IgE is the dominant allergen-specific antibody in circulation, its half- life preferably match that of natural IgG4. Moreover, pharmacokinetic properties of ERFAM are altered using PEGylation or other modifications.
• Permanent (long-term) effect: i.e., no allergy recurrences. Once there is little to no risk for anaphylaxis due to the presence of ERFAM-modified IgE, T cells are generally immunomodulated by repeated exposure to allergens in order to ensure natural production of IgG4 that replace allergen-specific IgE production. Treatment methods for long term induction of allergen tolerance can be used in conjunction with one or more treatments with ERFAM.
• Easily acceptable: ERFAM are not vaccines, and do not involve gene vaccinations or other problematic drugs. In fact ERFAM simply transforms the subject's own 'pathogenic' IgE into 'naturally-existing' protective IgG4-like antibodies. • Lower cost: Peptides are generally smaller than antibodies, with molecular weights of a few thousands of daltons depending on length, as compared with 150,000 for monoclonal IgG antibodies. This allows for large economies of scale. First, while a therapeutic dose of antibodies is mg/kg, an equivalent dose of peptides is micrograms/kg. Second, peptide synthesis is generally less expensive than antibody production. Additionally, peptide synthesis is relatively easy and requires less sophisticated devices than generation of antibodies, such as monoclonal antibodies.
• Activity depends upon presence of allergen: ERPAM molecules are distinct from other molecules that treat allergic diseases because their anti-allergic activity is triggered by both specific IgE and allergen, thus causing co-clustering of inhibitory and activating receptors. Unless both specific IgE and allergen are present, the molecule does not have anti-allergic activity. Continued naturally-occurring exposure will thus result in long-term tolerance. No other molecule designed to treat allergic disease has such an activity that depends upon the presence of the specific allergen.
Quantitation of ERFAM activity
ERFAM activity is quantitated using assays well known to those in the art.For example, ERFAM activity can be quantitated by measuring ERFAM binding to an IgE. Alternatively, ERFAM activity can be quantitated by measuring ERFAM binding to an inhibitory receptor or an activity or the inhibitory receptor. There are also assays that measure downstream affects of ERFAM activity.
In embodiments of the invention, ERFAM activity is tested in an in vitro system by assessing the capacity of the ERFAM to inhibit allergen-dependent, IgE-mediated human basophil activation. This in vitro model system is well known in the art to reproduce the events that occur in vivo during an allergic reaction.
In on system, basophils are purified from blood, such as by using the basophil isolation kit available from Milteny Biotec (Bergisch Gladbach, Germany, catalog number 130-053-401).
If basophils are purified from allergic donors, they are used in an assay without further treatments. Alternately, if basophils are purified from the blood of non-allergic individuals, they are sensitized by incubation in the presence of allergen-specific IgE antibodies that are either purified or contained in the plasma of allergic donors.
Basophils are incubated with ERFAM, again in the presence of allergen-specific IgE antibodies that are either purified or contained in the plasma of allergic donors. During this step, ERFAM binds to IgE in the plasma and to FcγR on basophils. Allergen is added to the basophil preparation and activation / degranulation is measured by quantifying histamine release using commercially available ELISA (Basotest(r) from Orpegen Pharma, Heidelberg, Germany or other histamine ELISAs: catalog number #409010 from Neogen or #RDI- RE59201 from Research Diagnostics Inc or #2015 from Immunotech) or radioimmunoassays. Alternately, basophil activation is assessed by flow cytometry. In this system, ERFAM efficiency is determined by its capacity to inhibit basophil degranulation.
Antibody Component
The term "antibody" as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab, Fat>' and F^y)2 fragments, and a Fab expression library. In general, antibody molecules obtained from humans relates to any of the classes IgG, IgM, IgA, IgE and IgD, which differ from one another by the nature of the heavy chain present in the molecule. Certain classes have subclasses as well, such as IgG1, IgG2, IgG3, IgG4, and others. Furthermore, in humans, the light chain is a kappa chain or a lambda chain. Reference herein to antibodies includes a reference to all such classes, subclasses and types of human antibody species.
The term "epitope" includes any protein determinant capable of specific binding to an immunoglobulin or T-cell receptor. Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. A polypeptide or a fragment thereof comprises at least one antigenic epitope. For instance, an anti-IgE antibody of the present invention will specifically bind to IgE where the equilibrium binding constant (KD) is ≤l μM, preferably < 100 nM, more preferably < 10 nM, and most preferably < 100 pM to about 1 pM, as measured by assays such as radioligand binding assays or similar assays known to those skilled in the art. The terms "antigen", "antigenic", "allergen" and "allergenic" as used herein are meant to describe a substance that induces an immune response when presented to immune cells of an organism. An antigen may comprise a single immunogenic epitope, or a multiplicity of immunogenic epitopes recognized by a B-cell receptor {i.e., antibody on the membrane of the B cell) or a T-cell receptor. Thus, as used herein, these terms refer to any substance capable of eliciting an immune response, e.g., peanut allergen, cat dander, and the like, as well as haptens that are rendered antigenic under suitable conditions known to those of skill in the art.
A construct of the invention, or a derivative, fragment, analog, homolog or ortholog thereof, is utilized as a tolerogen in the generation of an immune reaction that immunospecifϊcally bind allergenic components. For example, ERFAM will indirectly bind an allergen when it is bound to an allergen-specific IgE antibody.
Various procedures known within the art are used for the production of polyclonal or monoclonal antibodies directed against an IgE of the invention, or against derivatives, fragments, analogs homologs or orthologs thereof. See, e.g., ANTIBODIES: A LABORATORY MANUAL, Harlow E, and Lane D, 1988, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, incorporated herein by reference.
The present invention includes the use of polyclonal antibodies, monoclonal antibodies, humanized antibodies (or human antibodies) Fab Fragments (and single chain antibodies), bispecific antibodies (which are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens), and heteroconjugate antibodies (antibodies are composed of two covalently joined antibodies). The present invention also includes the modification of the antibody with respect to effector function, so as to enhance, e.g., the effectiveness of the antibody in treating allergies. The invention also pertains to imrnunoconjugates comprising an antibody conjugated of the formula A'-B' or A'-X-B'. Conjugates made up of the A' and B' moieties are constructed using a variety of bifunctional protein-coupling agents such as
N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as gluteraldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active fluorine compounds (such as l,5-difluoro-2,4-dinitrobenzene). For example, an ERFAM construct can be prepared as described in Vitetta et al, Science, 238: 1098 (1987).
Diagnostic Applications of ERFAMs
ERFAMs are used in methods known within the art relating to the localization and/or quantitation of the protein {e.g., for use in measuring levels of the protein within appropriate physiological samples, for use in diagnostic methods, for use in imaging, and the like). In a given embodiment, antibodies against the IgE or inhibitory receptors, proteins, or derivatives, fragments, analogs or homologs thereof, that contain the antigen binding domain, are utilized as pharmacologically-active compounds. For example, when used for imaging, detection can be facilitated by coupling (i.e.., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 1251, 1311, 35S or 3H. ERFAM Therapeutics
ERFAM constructs of the invention, including polyclonal, monoclonal, humanized and fully human antibodies, are contemplated as therapeutic agents. Such agents are generally employed to treat or prevent a disease or pathology in a subject. A preferred use is to treat allergen-mediated allergic response. An antibody preparation is administered to the subject and will generally have an effect due to its binding with the target(s). Such an effect is one of two kinds, depending on the specific nature of the interaction between the given antibody molecule and the target antigen in question. In the first instance, administration of the antibody may abrogate or inhibit the binding of FcεRI with the IgE antibodies to which it naturally binds. In this case, the ERFAM molecule "binds to the IgE Fc domain and blocks the IgE binding by the alpha subunit site of the FcεRI. Thus the ERFAM molecule reduces the cascade response induced by crosslinking of mast cell bound IgE.
Alternatively, the effect is one in which the ERFAM molecule elicits a physiological result by virtue of binding to an effector binding site that induces suppression of the allergic response. One contemplated mechanism, to which the inventors do not wish to be bound, is that the IgG4 portion of the ERFAM molecule recruits inhibitory subunits to the Fc receptor complex, thereby mediating a cascade leading to inhibition rather than activation of the stimulated immune cell to which it binds.
A therapeutically effective amount of an antibody relates generally to the amount needed to achieve a therapeutic objective. The amount required to be administered will furthermore depends on the binding affinity of the ERFAM molecule for its specific antigen/receptors, and will also depend on the rate at which an administered ERFAM molecule is depleted from the serum volume of the subject to which it was administered. Common ranges for therapeutically effective dosing of an antibody or antibody fragment are, by way of nonlimiting example, from about 0.1 mg/kg body weight to about 50 mg/kg body weight. Common dosing frequencies may range, for example, from twice daily to once a week. In a preferred embodiment, the ERFAM molecule bolus is administered in a single inject, followed by treatment with SIT to induce permanent tolerance without the risk of adverse side effects such as anaphylactic shock. Pharmaceutical Compositions Antibody constructs of the invention, as well as related molecules easily identified by those skilled in the art, can be administered for the treatment of various disorders in the form of pharmaceutical compositions. Principles and considerations involved in preparing such compositions, as well as guidance in the choice of components are provided, for example, in REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY 19th ed. (Alfonso R. Gennaro, et al., editors) Mack Pub. Co., Easton, Pa. 1995; DRUG ABSORPTION
ENHANCEMENT: CONCEPTS, POSSIBILITIES, LIMITATIONS, AND TRENDS, by Haxwood Academic Publishers, Langhorne, Pa., 1994; and PEPTIDE AND PROTEIN DRUG DELIVERY (Advances In Parenteral Sciences, Vol. 4), 1991, M. Dekker, New York.
Peptides comprising the ERFAM construct can be synthesized chemically and/or produced by recombinant DNA technology. See, e.g., Marasco et al., Proc. Natl. Acad. Sci. USA, 90: 7889-7893 (1993). The formulation can contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition can comprise an agent that enhances its function, such as, for example, IL-2, IFN-γ, IL-IO and/or TGF-β, or an agent that binds and/or sequesters IL-4 or IL-13. Such molecules are suitably present in combination and in amounts that are effective for the purpose intended. The active ingredients can be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and polymethylmethacrylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles, and nanocapsules) or in macroemulsions .
The formulations to be used for in vivo administration are sterile. This is readily accomplished by filtration through sterile filtration membranes.
Sustained-release preparations can be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and γ ethyl-L-glutamate, non-degradable ethylene- vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT ™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such as ethylene- vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods.
The ERFAM construct of the invention, and derivatives, fragments, analogs and homologs thereof, can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the ERFAM construct and a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text in the field, which is incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, saline, finger's solutions, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
A pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL (BASF, Parsippany, NJ.) or phosphate buffered saline (PBS). In all cases, the composition isterile and fluid to the extent that easy syringeability exists. It is stable under the conditions of manufacture and storage and is preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating the ERFAM construct in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
It is advantageous to formulate ERFAM compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
The pharmaceutical composition can be included in a container, pack, kit or dispenser together with instructions for administration. In one embodiment, ERFAM is packaged in a kit with an antihistamine. In another embodiment, an ERFAM formulation contains an antihistamine. Ideally, an ERFAM formulation is administered prior to or shortly after exposure of a subject to an allergen. An ERFAM formulation containing an antihistamine can be packaged for over-the-counter use by allergic subjects to suppress anaphylactic responses. Polymer-conjugated and therapeutic ERFAM constructs
Chemically modified (e.g., polymer-conjugated) ERFAM constructs are prepared by one of skill in the art based upon the present disclosure. The chemical moieties most suitable for addition to a ERFAM constructs (as referred to as "derivatization" of the ERFAM constructs) include water soluble polymers. A water soluble polymer is advantageous because the protein to which it is attached does not precipitate in an aqueous environment, such as a physiological environment. In some embodiments, the polymer is pharmaceutically acceptable for the preparation of a therapeutic product or composition. If desired, a single polymer molecule is employed for conjugation with a ERFAM constructs, although it is also contemplated that more than one polymer molecule can be attached as well. In some embodiments, two, three or four polymer molecules are employed for conjugation; more preferably, three polymer molecules are employed for conjugation, e.g., the first and second polymer molecules are conjugated at each N-terminal amino acid of the ERFAM construct, and the third polymer molecule is conjugated at an internal amino acid (i.e., a non-terminal amino acid). Conjugated ERFAM compositions have utility in both in vivo as well as non-m vivo applications. Additionally, it is recognized that the conjugating polymer may utilize any other groups, moieties, or other conjugated species, as appropriate to the end use application. By way of example, it is useful in some applications to covalently bond to the polymer a functional moiety imparting UV-degradation resistance, or antioxidation, or sustained serum retention, or other properties or characteristics to the polymer. As a further example, it is advantageous in some applications to functionalize the polymer to render it reactive or cross-linkable in character, to enhance various properties or characteristics of the overall conjugated material. Accordingly, the polymer may contain any functionality, repeating groups, linkages, or other constituent structures that do not preclude the efficacy of the conjugated ERFAM composition for its intended purpose. One skilled in the art will be able to select the desired polymer based on such considerations as whether the polymer/protein conjugate is used therapeutically, and if so, the desired dosage, circulation time, resistance to proteolysis, and other considerations. The effectiveness of the derivatization is ascertained by administering the derivative, in the desired form (e.g., by osmotic pump, or by injection or infusion, or, further formulated for oral, pulmonary or other delivery routes), and determining its effectiveness.
Suitable water soluble polymers include, but are not limited to, polyethylene glycol, copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1, 3-dioxolane, poly-l,3,6-trioxane, ethylene/maleic anhydride copolymer, polyamino acids (either homopolymers or random copolymers), and dextran or poly(n-vinyl pyrrolidone)polyethylene glycol, propropylene glycol homopolymers, polypropylene oxide/ethylene oxide co-polymers, polyoxyethylated polyols (e.g., glycerol), polyvinyl alcohol, and mixtures thereof. Polyethylene glycol propionaldehyde may have advantages in manufacturing due to its stability in water.
The polymer is of any suitable molecular weight, and is branched or unbranched. For polyethylene glycol (PEG), the preferred molecular weight is between about 2 kDa and about 100 kDa, for ease in handling and manufacturing (as used herein, the term "about" means that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight). Other sizes are used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired; the effects, if any, on biological activity; the ease in handling; the degree or lack of antigenicity and other known effects of polyethylene glycol on a therapeutic protein or variant). In some embodiments, the preferred molecular weight is about 10 kDa. The number of polymer molecules so attached may vary, and one skilled in the art is able to ascertain the effect on function. One may mono- derivatize, or may provide for a di-, tri-, terra- or some combination of derivatization, with the same or different chemical moieties (e.g., polymers, such as different weights of polyethylene glycols). The proportion of polymer molecules to protein (or polypeptide) molecules will vary, as will their concentrations in the reaction mixture. In general, the optimum ratio (in terms of efficiency of reaction in that there is no excess unreacted protein or polymer) is determined by factors such as the desired degree of derivatization (e.g., mono, di-, tri-, etc.), the molecular weight of the polymer selected, whether the polymer is branched or unbranched, and the reaction conditions.
In an embodiment, the polyethylene glycol molecules (or other chemical moieties) are attached to the protein with consideration of effects on functional or antigenic domains of the protein. There are a number of attachment methods available to those skilled in the art. See, e.g., EP 0 401384 (coupling PEG to G-CSF); Malik et ah, Exp. Hematol. 20: 1028- 1035, 1992 (reporting pegylation of GM-CSF using tresyl chloride).
For example, polyethylene glycol is covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule are bound. The amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residue. Those having a free carboxyl group may include aspartic acid residues, glutamic acid residues, and the C-terminal amino acid residue. Sulfhydrl groups may also be used as a reactive group for attaching the polyethylene glycol molecule(s). For therapeutic purposes, in some embodiments attachment at an amino group, such as attachment at the N- terminus or lysine group is preferred. Attachment at residues important for receptor binding is avoided if receptor binding is desired.
One may specifically desire an N-terminal chemically modified protein. Using polyethylene glycol as an illustration of the present ERFAM compositions, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein. The method of obtaining the N-terminally pegylated preparation (i.e., separating this moiety from other monopegylated moieties if necessary) is by purification of the N-terminally pegylated material from a population of pegylated protein molecules. Selective N-terminal chemical modification is accomplished by reductive alkylation, which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved. For example, one may selectively N- terminally pegylate the protein by performing the reaction at a pH which allows one to take advantage of the pKa differences between the epsilon- amino group (e-amino group) of the lysine residues and that of the alpha-amino group (a- amino group) of the N-terminal residue of the protein. By such selective derivatization, attachment of a water soluble polymer to a protein is controlled: the conjugation with the polymer takes place predominantly at the N-terminus of the protein and no significant modification of other reactive groups, such as the lysine side chain amino groups, occurs.
Using reductive alkylation, the water soluble polymer is of the type described above, and has a single reactive aldehyde for coupling to the protein. Polyethylene glycol propionaldehyde, containing a single reactive aldehyde, is used.
The present invention includes use of ERFAM which are prokaryote- expressed, eukaryote-expressed, or synthetic.
Pegylation is carried out by any of the pegylation reactions known in the art. See, e.g., Focus on Growth Factors, 3 (2): 4-10, 1992; EP 0 154 316; EP 0 401 384; and the other publications cited herein that relate to pegylation. The pegylation is carried out via an acylation reaction or an alkylation reaction with a reactive polyethylene glycol molecule (or an analogous reactive water-soluble polymer).
Pegylation by acylation generally involves reacting an active ester derivative of polyethylene glycol (PEG). Any known or subsequently discovered reactive PEG molecule is used to carry out the pegylation. A preferred activated PEG ester is PEG esterified to N- hydroxysuccinimide (NHS). As used herein, the term "acylation" includes without limitation the following types of linkages between the therapeutic protein and a water soluble polymer such as PEG: amide, carbamate, urethane, and the like. See, Bioconjugate Chem. 5: 133-140, 1994. Reaction conditions are selected from any of those known in the pegylation art or those subsequently developed, but avoid conditions such as temperature, solvent, and pH that inactivate the ERFAM construct to be polymer-conjugated.
Pegylation by acylation will generally result in a poly-pegylated ERFAM product. In some embodiments the connecting linkage is an amide. Also, in some embodiments, the resulting product is substantially only {e.g., > 95%) mono, di- or tri-pegylated. However, some species with higher degrees of pegylation are formed in amounts depending on the specific reaction conditions used. If desired, more purified pegylated species are separated from the mixture, such as unreacted species, by standard purification techniques, including, among others, dialysis, salting-out, ultrafiltration, ion- exchange chromatography, gel filtration chromatography and electrophoresis.
Pegylation by alkylation generally involves reacting a terminal aldehyde derivative of PEG with ERFAM in the presence of a reducing agent. Pegylation by alkylation can also result in poly-pegylated ERFAM products. In addition, one can manipulate the reaction conditions to favor pegylation substantially only at the α-amino group of the N- terminus of ERFAM {i.e., a mono-pegylated protein). In either case of monopegylation or polypegylation, the PEG groups can be attached to the protein via a -CH2-NH- group. With particular reference to the -CH2- group, this type of linkage is referred to herein as an "alkyl" linkage.
Derivatization via reductive alkylation to produce a monopegylated product exploits differential reactivity of different types of primary amino groups (lysine versus the N- terminal) available for derivatization. The reaction is performed at a pH that allows one to take advantage of the pKa differences between the e-amino groups of the lysine residues and that of the a-amino group of the N-terminal residue of the protein. By such selective derivatization, attachment of a water soluble polymer that contains a reactive group such as an aldehyde, to a protein is controlled: the conjugation with the polymer takes place predominantly at the N-terminus of the protein and no significant modification of other reactive groups, such as the lysine side chain amino groups, occurs. The polymer molecules used in both the acylation and alkylation approaches are selected from among water soluble polymers as described above. The polymer selected is modified to have a single reactive group, such as an active ester for acylation or an aldehyde for alkylation, so that the degree of polymerization is controlled as provided for in the present methods. An exemplary reactive PEG aldehyde is polyethylene glycol propionaldehyde, which is water stable, or mono Cl-ClO alkoxy or aryloxy derivatives thereof {see, U.S. Patent 5,252,714). The polymer is branched or unbranched. For the acylation reactions, the polymer(s) selected have a single reactive ester group. For the present reductive alkylation, the polymer(s) selected have a single reactive aldehyde group. Generally, the water soluble polymer will not be selected from naturally-occurring glycosyl residues since these are usually made more conveniently by mammalian recombinant expression systems. The polymer is of any molecular weight, and is branched or unbranched. An exemplary water-soluble polymer for use herein is polyethylene glycol. As used herein, polyethylene glycol is meant to encompass any of the forms of PEG that have been used to derivatize other proteins, such as mono-(Cl-ClO) alkoxy- or aryloxy- polyethylene glycol. In general, chemical derivatization is performed under any suitable condition used to react a biologically active substance with an activated polymer molecule. Methods for preparing a pegylated ERFAM will generally comprise the steps of (a) reacting a ERFAM protein or polypeptide with polyethylene glycol (such as a reactive ester or aldehyde derivative of PEG) under conditions whereby the molecule becomes attached to one or more PEG groups, and (b) obtaining the reaction product(s). In general, the optimal reaction conditions for the acylation reactions are determined case- by-case based on known parameters and the desired result. For example, the larger the ratio of PEG: protein, the greater the percentage of poly-pegylated product.
Reductive alkylation to produce a substantially homogeneous population of mono- polymer/ ERFAM will generally comprise the steps of: (a) reacting a ERFAM protein or polypeptide with a reactive PEG molecule under reductive alkylation conditions, at a pH suitable to permit selective modification of the a-amino group at the amino terminus of ERFAM; and (b) obtaining the reaction product(s).
The pH also affects the ratio of polymer to protein to be used. In general, if the pH is lower, a larger excess of polymer to protein is desired (i.e., the less reactive the N-terminal a-amino group, the more polymer needed to achieve optimal conditions). If the pH is higher, the polymer: protein ratio need not be as large (i.e., more reactive groups are available, so fewer polymer molecules are needed). For purposes of the present invention, the pH will generally fall within the range of 3-9, preferably 3-6. Another important consideration is the molecular weight of the polymer. In general, the higher the molecular weight of the polymer, the fewer polymer molecules are attached to the protein. Similarly, branching of the polymer is taken into account when optimizing these parameters. Generally, the higher the molecular weight (or the more branches) the higher the polymer: protein ratio. In general, for the pegylation reactions contemplated herein, the preferred average molecular weight is about 2 kDa to about 100 kDa. The preferred average molecular weight is about 5 kDa to about 50 kDa, such as about 10 kDa. In some embodiments, the ERFAM is linked to the polymer via a terminal reactive group on the polypeptide. Alternatively, or in addition, ERFAM are linked via the side chain amino group of an internal lysine residue, e.g., a lysine residue introduced into the amino acid sequence of a naturally occurring subunit utilized in constructing the ERFAM molecule. Thus, conjugations can also be branched from the non terminal reactive groups. The polymer with the reactive group(s) is designated herein as "activated polymer". The reactive group selectively reacts with free amino or other reactive groups on the protein. Attachment may occur in the activated polymer at any available ERFAM amino group such as the alpha amino groups or the epsilon amino groups o>f a lysine residue or residues introduced into the amino acid sequence of a ERFAM polypeptide subunit or variant thereof. Free carboxylic groups, suitably activated carbonyl groups, hydroxyl, guanidyl, imidazole, oxidized carbohydrate moieties and mercapto groups of the ERFAM (if available) can also be used as attachment sites.
Generally from about 1.0 to about 10 moles of activated polymer per mole of protein, depending on protein concentration, is employed. The final amount is a balance between maximizing the extent of the reaction while minimizing noon-specific modifications of the product and, at the same time, defining chemistries that will maintain optimum activity, while at the same time optimizing, if possible, the half-life of the protein. In some embodiments, at least about 50% of the biological activity of the protein is retained, and in other embodiments, nearly 100% is retained.
The polymer can be coupled to the ERFAM polypeptide using methods known in the art. For example, in some embodiments, the polyalkylene glycol moiety is coupled to a lysine group of the ERFAM or variant ERFAM. Linkage to the lysine group can be performed with a N-hydroxylsuccinimide (NHS) active ester such a.s PEG succinimidyl succinate (SS-PEG) and succinimidyl propionate (SPA-PEG). Suitable polyalkylene glycol moieties include, e.g. t carboxymethyl-NHS, norleucine-NHS, SC-PEG, tresylate, aldehyde, epoxide, carbonylimidazole, and PNP carbonate.
Additional amine reactive PEG linkers can be substituted fox the succinimidyl moiety. These include, e.g. isothiocyanates, nitrophenylcarbonates-, epoxides, and benzotriazole carbonates. Conditions are in some embodiments chosen to maximize the selectivity and extent or reaction. If desired, ERFAM may contain a tag, e.g., a tag that can subsequently be released by proteolysis, such as a histidine tag {i.e. 10 histidines) separated by an enterokinase cleavage site. Thus, the lysine moiety can be selectively modified "by first reacting a his-tag variant with a low molecular weight linker such as Traut's reagent (Pierce) which will react with both the lysine and N-terminus, and then releasing the his tag. The polypeptide will then contain a free SH group that can be selectively modified with a PEG containing a thiol reactive head group such as a maleimide group, a vinylsulfone group, a haloacetate group, or a free or protected SH. Traut's reagent can be replaced with any linker that will set up a specific site for
PEG attachment. By way of example, Traut's reagent is replaced with SPDP, SMPT, SATA, or SATP (all available from Pierce). Similarly one reacts the pxotein with an amine reactive linker that inserts a maleimide (for example, SMCC, AMAS9 BMPS, MBS, EMCS, SMPB, SMPH, KMUS, or GMBS), a haloacetate group (e.g., SBAP, SIA, SIAB), or a vinylsulfone group and react the resulting product with a PEG that contains a free SH. The only limitation to the size of the linker that is employed is that it cannot block the subsequent removal of the N-terminal tag.
Thus, in other embodiments, the polyalkylene glycol moiety is coupled to a cysteine group of ERFAM or variant ERFAM construct. Coupling can be effected using, e.g., a maleimide group, a vinylsulfone group, a haloacetate group, and a thiol group.
In some embodiments, the polymer-conjugated ERFAM in the composition has a longer serum half-life relative to the half-life of the variant polypeptide in the absence of the polymer. Alternatively, or in addition, the polymer-conjugated ERFAM in the composition binds GFR, activates RET, normalizes pathological changes of a neuron, or enhances survival of a neuron, or performs a combination of these physiological functions.
In some embodiments, the composition is provided as a stable, aqueously soluble polymer-conjugated ERFAM or variant polymer-conjugated ERFAM coupled to a polyethylene glycol moiety. If desired, the ERFAM or variant ERFAM construct is coupled to the polyethylene glycol moiety by a labile bond. The labile bond can be cleaved in, e.g., biochemical hydrolysis, proteolysis, or sulfhydryl cleavage. For example, the bond can be cleaved under in vivo (physiological) conditions.
Other reaction parameters, such as solvent, reaction times, temperatures, etc., and means of purification of products, can be determined by those skilled in the art.
Synthesis and Isolation of ERFAM constructs
Variant ERFAM can be isolated using methods known in the art. Naturally occurring ERFAM subunits can be isolated from immune cells, hybridomas, or tissue sources by an appropriate purification scheme using standard protein purification techniques. Alternatively, variant ERFAM can be synthesized chemically using standard peptide synthesis techniques. The synthesis of short amino acid sequences is well established in the peptide art. See, e.g., Stewart, et al, SOLID PHASE PEPTIDE SYNTHESIS (2d ed., 1984). In another embodiment, ERFAM constructs are produced by recombinant DNA techniques. For example, a nucleic acid molecule encoding an ERFAM construct, wherein the linker moiety is a polypeptide linker, can be inserted into a vector, e.g., an expression vector, and the nucleic acid can be introduced into a cell. Suitable cells include, e.g., mammalian cells (such as human cells or Chinese hamster ovary cells), fungal cells, yeast cells, insect cells, and bacterial cells. When expressed in a recombinant cell, the cell can be cultured under conditions allowing for expression of an ERFAM construct. The ERFAM construct can be recovered from a cell suspension if desired. As used herein, "recovered" means that the variant polypeptide is removed from those components of a cell or culture medium in which it is present prior to the recovery process. The recovery process may include one or more refolding or purification steps.
ERFAM constructs can be constructed using any of several methods known in the art. One such method is site-directed mutagenesis, in which a specific nucleotide (or, if desired a small number of specific nucleotides) is changed in order to change a single amino acid (or, if desired, a small number of predetermined amino acid residues) in the encoded ERFAM construct. Those skilled in the art recognize that site-directed mutagenesis is a routine and widely-used technique. In fact, many site-directed mutagenesis kits are commercially available. One such kit is the "Transformer Site Directed Mutagenesis Kit" sold by Clontech Laboratories (Palo Alto, Calif.).
Practice of the present invention will employ, unless indicated otherwise, conventional techniques of cell biology, cell culture, molecular biology, microbiology, recombinant DNA, protein chemistry, and immunology, which are within the skill of the art. Such techniques are described in the literature. See, for example, Molecular Cloning: A Laboratory Manual, 2nd edition (Sambrook, Fritsch and Maniatis, eds.), Cold Spring Harbor Laboratory Press, 1989; DNA Cloning, Volumes I and II (D.N. Glover, ed), 1985; Oligonucleotide Synthesis, (MJ. Gait, ed.), 1984; U.S. Patent No. 4,683,195 (Mullis et al.,); Nucleic Acid Hybridization (B.D. Haines and SJ. Higgins, eds.), 1984; Transcription and Translation (B.D. Hames and SJ. Higgins, eds.), 1984; Culture of Animal Cells (R.I. Freshney, ed). Alan R. Liss, Inc., 1987; Immobilized Cells and Enzymes, IRL Press, 1986; A Practical Guide to Molecular Cloning (B. Perbal), 1984; Methods in Enzymology, Volumes 154 and 155 (Wu et al., eds), Academic Press, New York; Gene Transfer Vectors for Mammalian Cells (J.H. Miller and M.P. Calos, eds.), 1987, Cold Spring Harbor Laboratory; Immunochemical Methods in Cell and Molecular Biology (Mayer and Walker, eds.), Academic Press, London, 1987; Handbook of Experiment Immunology, Volumes I-IV (D.M. Weir and CC. Blackwell, eds.), 1986; Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, 1986.
Polymer-conjugated ERFAM constructs If desired, the polymer-conjugated ERFAM constructs can be provided as a fusion protein. Fusion polypeptide derivatives of proteins also include various structural forms of the primary protein that retain biological activity. As used herein "fusion" refers to a co- linear, covalent linkage of two or more proteins or fragments thereof via their individual peptide backbones, such as through genetic expression of a polynucleotide molecule encoding those proteins in the same reading frame (i.e., "in frame"). It is preferred that the proteins or fragments thereof are from different sources. Thus, some fusion proteins include a variant ERFAM construct or fragment covalently linked to a second moiety that is not a variant ERFAM. In some embodiments, the second moiety is derived from a polypeptide that exists as a monomer, and is sufficient to confer enhanced solubility and/or bioavailability properties on the ERFAM construct.
Pharmaceutical compositions containing polymer-conjugated ERFAM
Also provided is a pharmaceutical composition including a modified ERFAM construct of the present invention. A "pharmaceutical composition" as used herein is defined as comprising a ERFAM construct or conjugate of the invention, dispersed in a physiologically acceptable vehicle, optionally containing one or more other physiologically compatible ingredients. The pharmaceutical composition thus may contain an excipient such as water, one or more minerals, sugars, detergents, and one or more carriers such as an inert protein (e.g., heparin or albumin). The ERFAM construct is administered per se as well as in the form of pharmaceutically acceptable esters, salts, and other physiologically functional derivatives thereof. In such pharmaceutical and medicament formulations, a modified ERFAM construct is is utilized together with one or more pharmaceutically acceptable carrier(s) and optionally any other therapeutic ingredients.
The carrier(s) is pharmaceutically acceptable in the sense of being compatible with the other ingredients of the formulation and not unduly deleterious to the recipient thereof. The ERFAM construct is provided in an amount effective to achieve a desired pharmacological effect or medically beneficial effect, as described herein, and in a quantity appropriate to achieve the desired bioavailable in vivo dose or concentration.
The formulations include those suitable for parenteral as well as non parenteral administration, and specific administration modalities include oral, rectal, buccal, topical, nasal, ophthalmic, subcutaneous, intramuscular, intravenous, transdermal, intrathecal, intra¬ articular, intra-arterial, sub-arachnoid, bronchial, lymphatic, vaginal, and intra-uterine administration. Formulations suitable for aerosol and parenteral administration, both locally and systemically, are preferred.
When the ERFAM construct is utilized in a formulation comprising a liquid solution, the formulation advantageously is administered orally, bronchially, or parenterally. When the ERFAM construct is employed in a liquid suspension formulation or as a powder in a biocompatible carrier formulation, the formulation is advantageously administered orally, rectally, or bronchially. Alternatively, it is administered nasally or bronchially, via nebulization of the powder in a carrier gas, to form a gaseous dispersion of the powder that is inspired by the patient from a breathing circuit comprising a suitable nebulizer device.
The formulations comprising the proteins of the present invention may conveniently be presented in unit dosage forms and are prepared by any of the methods well known in the art of pharmacy. Such methods generally include the step of bringing the active ingredient(s) into association with a carrier that constitutes one or more accessory ingredients.
Typically, the formulations are prepared by uniformly and intimately bringing the active ingredient(s) into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product into dosage forms of the desired formulation. Formulations of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets, tablets, or lozenges, each containing a predetermined amount of the active ingredient as a powder or granules; or a suspension in an aqueous liquor or a non-aqueous liquid, such as a syrup, an elixir, an emulsion, or a draught.
Formulations suitable for parenteral administration conveniently comprise a sterile aqueous preparation of the active conjugate, which can be isotonic with the blood of the recipient (e.g., physiological saline solution). Such formulations may include suspending agents and thickening agents or other microparticulate systems which are designed to target the compound to blood components or one or more organs. The formulations may be presented in unit-dose or multi-dose form.
Nasal spray formulations comprise purified aqueous solutions of the active conjugate with preservative agents and isotonic agents. Such formulations can be adjusted to a pH and isotonic state compatible with the nasal mucus membranes.
Formulations for rectal administration may be presented as a suppository with a suitable carrier such as cocoa butter, hydrogenated fats, or hydrogenated fatty carboxylic acid. Ophthalmic formulations such as eye drops are prepared by a similar method to the nasal spray, except that the pH and isotonic factors can be adjusted to match that of the eye.
Topical formulations comprise the conjugates dissolved or suspended in one or more media, such as mineral oil, petroleum, polyhydroxy alcohols, or other bases used for topical pharmaceutical formulations.
In addition to the aforementioned ingredients, the formulations of this invention may further include one or more accessory ingredient(s) selected from diluents, buffers, flavoring agents, disintegrants, surface active agents, thickeners, lubricants, preservatives (including antioxidants), and the like. The foregoing considerations apply also to the ERFAM fusion proteins (e.g., ERFAM-HSA fusions).
Accordingly, the present invention includes the provision of suitable fusion proteins for in vitro stabilization of a ERFAM construct in solution, as an illustrative application of the invention. The fusion proteins may be employed for example to increase the resistance to enzymatic degradation of the polypeptide portion of ERFAM construct and provides a means of improving shelf life, room temperature stability, and the like. It is understood that the foregoing considerations apply also to the ERFAM construct-serum albumin fusion proteins (including the human/humanized ERFAM construct-human serum albumin fusion protein) of the invention. Methods of treatment
The polymer-conjugated ERFAM constructs, as well as variant polymer-conjugated ERPAM constructs and truncated polymer-conjugated ERFAM constructs may be used for treating or alleviating a pathology of a living animal body, preferably of a mammal, more preferably a primate including a human, which disorder or disease is responsive to the activity of immunosuppressor-type activity. A preferred pathology is that of an inappropriate allergic response in a subject.
Methods of generating active molecules:
The production of peptide ligands by phage display (WO 90/ 02809) and generation of aptamers (WO 92/14843) have been previously described.
Kits (phage and respectively oligonucleotide libraries) are also commercially available from many companies and are currently widely used in research.
Methods of allergy treatment using ERFAM or IgG4
ERPAM (or allergen-specific IgG4) is administered to patients having IgE-mediated allergy, either during an allergic reaction for acute therapy or outside such a reaction. A therapeutically effective dose is easily determined by those skilled in the art, where the endpoint is the drastic reduction or elimination of allergic response in the patient being treated. After an appropriate period of time (e.g. next day), ERFAM allergy-inhibitory effect is determined by skin prick test to the suspected allergen or by allergen-induced basophil degranulation (using peripheral blood). If allergic reactions are indeed decreased, allergen is administered under EKFAM cover in order to induce immune tolerance and permanently cure allergy.
The invention is further described in the following examples, which do not limit the scope described in the claims.
EXAMPLES
The following examples illustrate by way of non-limiting example various aspects of the invention.
EXAMPLE 1: ERFAM obtained by coupling an anti IgE antibody with an IgG4 antibody. An anti-IgE rabbit polyclonal antibody was purchased from Washington Biotechnology Inc (Simpsonville, MD) that was obtained by immunizing rabbits with the peptide GVSAYLSRP SPFDLFIRKSPTITCL (SEQ ID NO: 1) representing the amino acid residues 335-359 localized within the Cε3 domain of the human IgE heavy chain sequence, as published by KJ Dorrington and HH Bennich (Structure-function relationships in human immunoglobulin E) Immunological Reviews 1978, 41 :3-26. The antibody was affinity- purified from rabbit serum using the biotinylated target peptide (synthetized by Sigma- Genosys) bound to an AffinityPak™ Immobilized Avidin Column (Pierce), further concentrated using a Sartorius concentrator (MWCO 100,000). The antibody concentration was determined using the BCA protein assay system from Pierce. A human IgG4 antibody (affinity purified from human myeloma serum) was purchased from Sigma (catalog number 1-4683). An ERFAM compound was produced by cross-linking the two antibodies using the Controlled protein-protein cross-linking kit from Pierce (23456). Briefly, 500 microliters dimethyl formamide were added to dissolve 2mg N- succinimidyl S-acetylthioacetate (SATA), then 28 microliters (representing a 10 fold molar excess) were added to 2ml of the the anti-IgE antibody (3mg/ml in PBS-EDTA) and incubated for 30 min at room temperature in order to add sulfhydryl groups to the molecule. 5mg hydroxylamine HCl were then dissolved in 100 microliters of conjugation buffer (from the kit) and added to the SATA-modified anti-IgE antibody in order to de-protect the latent sulfhydryl groups during a further 2h incubation. Non-reacted compounds were then removed using a Sartorius concentrator (MWCO 100,000). The concentration of the sulfhydryl-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS. The affinity purified human IgG4 antibody was maleimide-activated using reagents from the same kit. 2mg sulfo-succinimidyl 4-[N-maleimidomethyl]cyclohexane-l- carboxylate (sulfo-SMCC) were dissolved in 2ml PBS then 10 microliters (a 10 fold molar excess) were added to 500 microliters human IgG4 antibody (lmg/ml in PBS). After 30min incubation, the non-reacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000). The concentration of the maleimide-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
Equal volumes of 2mg/ml sulfhydryl-activated anti-IgE antibody and maleimide- activated human IgG4 antibody were mixed and incubated for 60 minutes at room temperature, then were diluted in PBS to 10ml and washed using a Sartorius concentrator (MWCO 100,000). The ERFAM concentration was assessed using the BCA protein assay kit and the final concentration was adjusted at 2mg/ml. The ERFAM was split in two aliquots, then to one aliquot 20 microliters of an 0.5mg/ml PBS solution of the GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) peptide were added in order to block the binding site of the anti-IgE antibody while to the other aliquot an equal volume of PBS was added. The ERFAM was stored at 4°C at least 24h before use.
Peripheral blood mononuclear cells were separated from blood by centrifugation over a Histopaque-1077 (Sigma C-8889) layer. Further, polymorphonuclear basophil cells (PB) were isolated using magnetic beads (the Basophil isolation kit, catalog 130-053-401 from Miltenyi Biotech). The IgE molecules attached to the PB were stripped by incubation for 3.5 minutes at room temperature in lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9) as described by Kleine et al, Int Arch Allergy Immunol. 2001; 126(4):277-85. The PB were then sensitized to NP by incubation in AIM V cell serum-free culture medium in the presence of NP-specifϊc chimaeric IgE antibody-containing cell culture supernatant and interleukin 3 (2ng/ml) as described by Shreffler et al, J Allergy Clin Immunol. 2004; 113(4):776-82.
The peripheral blood mononuclear cells were then resuspended (50,000 in 0.1 ml in AIM V cell culture medium per well in 96-well plates) and cultured overnight in the presence of 50microliters AIM V-dialysed NP-specific chimaeric IgE antibody-containing cell culture supernatant (in order to sensitise them to NP) and 20 microliters of the 2mg/ml ERFAM solution (antiIgE-IgG4) or an equal volume of the ERFAM solution that was preincubated with the blocking peptide.
The following day, 20 microliters of NP-(6)-bovine serum albumin (lmg/ml) were added to the each well and further incubated for 15 minutes at 37°C. The supernatants were collected and frozen at -2O0C in order to measure histamine release later, while the cells were transferred to 5ml FACS tubes and washed with 4ml phosphate buffered saline containing 1% fetal calf serum and 0.1% sodium azide. The PB were then stained in order to determine their activation which is measured by assessing their cell surface expression of the activation marker CD203c as described by Boumiza et al, Clin Exp Allergy. 2003; 33(2): 259-65. The PB were stained with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), anti-MHCH-biotin (Ancelll31-O3O) with Streptavidin-peridinin- clorophyll-protein complex (Becton Dickinson 554064) and anti-CD45 APC (Becton Dickinson 555485) for 30 minutes at room temperature. Unbound antibodies were then washed and the PB analysed by flow cytometry using a FACS Calibur instrument.
The results shown in Figure 2 demonstrate that ERFAM (antiIgE-IgG4) inhibits basophil activation (expressed as the percentage of IgE+ cells that express CD203c) while the peptide-blocked ERFAM had a reduced inhibitor effect. Bars represent average values + standard deviations of triplicate measurements. The antiIgE-IgG4 ERFAM was found to inhibit 93.95% ± 0.61% of basophil activation and the inhibitory activity was lost if the ERFAM was pre-incubated with the blocking peptide to which the anti-IgE was raised.
EXAMPLE 2: ERFAM obtained by coupling an IgE-binding oligonucleotide with an anti-FcγR antibody.
The IgE-binding oligonucleotide 5'-
GGGGCACGTTTATCCGTCCCTCCTAGTGGCGTGCCCC-3' (SEQ ID NO: 2) was purchased from MWG Biotech (Ebersberg, Germany). The 5' end was modified by the introduction of a thiol group attached to the oligonucleotide by a spacer containing 6 carbon atoms. The IgE-binding properties of this oligonucleotide have been reported by Wiegand TW, Williams PB, Dreskin SC, Jouvin MH, Kinet JP, Tasset D. (High-affinity oligonucleotide ligands to human IgE inhibit binding to Fc epsilon receptor I), J Immunol. 1996; 157(1): 221-30. An affinity purified anti-human CD32-B goat polyclonal antibody was purchased from Santa-Cruz Biotechnology Inc. (sc-13271) as well as the corresponding blocking peptide that prevents the anti-human CD32-B antibody to bind to CD32-B (catalog number SC-13271P, also from Santa-Cruz Biotechnology Inc).
The ERFAM compound was produced by cross-linking the two oligonucleotides to the anti-human CD32-B antibody by using the Controlled protein-protein cross-linking kit from Pierce (23456). The affinity purified anti-human CD32-B antibody was maleimide- activated using reagents from the same kit. 2mg sulfo-succinimidyl 4-[N- maleimidomethyl]cyclohexane-l-carboxylate (sulfo-SMCC) were dissolved in 2ml PBS then 3 microliters (a 10 fold molar excess) were added to 150 microliters anti-human CD32- B antibody (lmg/ml in PBS). After 30min incubation, the non-reacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000). The concentration of the maleimide-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
Equal volumes of 2mg/ml sulfhydryl-containing IgE-binding oligonucleotides and maleimide-activated anti-CD32-B antibody were mixed and incubated for 60 minutes at room temperature, then were diluted in PBS to 10ml and washed using a Sartorius concentrator (MWCO 100,000). Their concentration was assessed using the BCA protein assay kit and the final concentration was adjusted at 2mg/ml, then the resulting compound was split into two aliquots. To one aliquot 20 microliters of an 0.5mg/ml PBS solution of the peptide to which the anti-CD32-B antibody was raised were added in order to block the binding site of the anti-CD32-B antibody while to the other aliquot an equal volume of PBS was added. The ERFAM was stored at 4°C at least 24h before use.
Peripheral blood mononuclear cells were separated from blood by centrifugation over a Histopaque-1077 (Sigma C-8889) layer. Further, polymorphonuclear basophil cells (PB) were isolated using magnetic beads (the Basophil isolation kit, catalog 130-053-401 from Miltenyi Biotech). The IgE molecules attached to the PB were stripped by incubation for 3.5 minutes at room temperature in lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9) as described by Kleine et al, Int Arch Allergy Immunol. 2001 ; 126(4): 277-85. The PB were then sensitized to NP by incubation in AIM V cell serum-free culture medium in the presence of NP-specific chimaeric IgE antibody-containing cell culture supernatant and interleukin 3 (2ng/ml) as described by Shreffler et al, J Allergy Clin Immunol. 2004; 113(4): 776-82.
The peripheral blood mononuclear cells were then resuspended (50,000 in 0.1 ml in AIM V cell culture medium per well in 96-well plates) and were cultured overnight in the presence of 50microliters AIM V-dialysed NP-specific chimaeric IgE antibody-containing cell culture supernatant (in order to sensitise them to NP) and 20 microliters of the 2mg/ml ERFAM solution (IgE-binding oligonucleotide - anti-CD32-B) or an equal volume of the ERFAM solution that was preincubated with the blocking peptide.
The following day, 20 microliters of NP-(6)-bovine serum albumin (lmg/ml) were added to the each well and further incubated for 15 minutes at 37°C. The supernatants were collected and frozen at -200C in order to measure histamine release later, while the cells were transferred to 5ml FACS tubes and washed with 4ml phosphate buffered saline containing 1% fetal calf serum and 0.1% sodium azide. The PB were then stained in order to determine their activation which is measured by assessing their cell surface expression of the activation marker CD203c as described by Boumi.za R, Monneret G, Forissier MF, Savoye J, Gutowski MC, Powell WS, Bienvenu J. (Marked improvement of the basophil activation test by detecting CD203c instead of CD63) , Clin Exp Allergy. 2003; 33(2): 259- 65. The PB were stained with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), anti-MHCII-biotin (Ancelll3 1-030) with Streptavidin-peridinin- clorophyll-protein complex (Becton Dickinson 554064) and anti-CD45 APC (Becton Dickinson 555485) for 30 minutes at room temperatuie. Unbound antibodies were then washed and the PB analysed by flow cytometry using a FACS Calibur instrument. The results shown in Figure 2 demonstrate that ERFAM (IgE-binding oligonucleotide - anti-CD32-B) inhibits basophil activation (expressed as the percentage of IgE+ cells that express CD203c) while the peptide-blocked ERFAM had a reduced inhibitor effect. Bars represent average values + standard deviations of triplicate measurements. The IgE-binding oligonucleotide - anti-CD32-B ERFAM Λvas found to inhibit 95.79% ± 0.51% of basophil activation and the inhibitory activity was reduced to 34.88% ± 1.98% if the ERFAM was pre-incubated with the blocking peptide to which the anti-CD32-B antibody was raised.
EXAMPLE 3: ERFAM obtained by coupling an anti IgE antibody with an anti- FcγR antibody and to polyethylene glycol. An anti-IgE rabbit polyclonal antibody was purchased from Washington
Biotechnology Inc (Simpsonville, MD) that was obtained by immunizing rabbits with the peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) representing the amino acid residues 335-359 localized within the Cε3 domain of the human IgE heavy chain sequence, as published by KJ Doπington and HH Bennich (Stαicture-function relationships in human immunoglobulin E) Immunological Reviews 1978, 41 :3-26. The antibody was affinity- purified from rabbit serum using the biotinylated target peptide (synthesized by Sigma- Genosys) bound to an AffinityPak™ Immobilized Axάdin Column (Pierce), further concentrated using a Sartorius concentrator (MWCO 100,000). The antibody concentration was determined using the BCA protein assay system from Pierce. An affinity purified anti- human CD32-B goat polyclonal antibody was purchased from Santa-Cruz Biotechnology Inc. (sc-13271), as well as the corresponding blocking peptide that prevents the anti-human CD32-B antibody to bind to CD32-B (catalog number sc-13271P, also from Santa-Cruz Biotechnology Inc).
The ERFAM compound was produced by cross-linking the anti-IgE antibody to the anti-human CD32-B antibody by using the Controlled protein-protein cross-linking kit from Pierce (23456). To the cross-linked antibodies, activated polyethylene glycol (molecular weight 20,000 daltons) was added in order to produce a molecule that has additional biological properties (be less immunogenic and have a longer half-life in the circulation).
Initially, the affinity purified anti-human CD32-B antibody was maleimide-activated using reagents from the same kit. 2mg sulfo-succinimidyl 4-[N- maleimidomethyljcyclohexane-l-carboxylate (sulfo-SMCC) were dissolved in 2ml PBS then 3 microliters (a 10 fold molar excess) were added to 150 microliters anti-human CD32- B antibody (lmg/ml in PBS). After 30min incubation, the non-reacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000). The concentration of the maleimide-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
Equal volumes of 2mg/ml sulfhydryl-containing anti-IgE antibody and maleimide- activated anti-CD32-B antibody were mixed and incubated for 60 minutes at room temperature, then were diluted in sodium borate buffer 1OmM, pH 8.5 to 10ml and washed using a Sartorius concentrator (MWCO 100,000). Their concentration was assessed using the BCA protein assay kit and the final concentration was adjusted at 2mg/ml. Polyethylene glycol (PEG, Fluka, catalog number 95172) was activated as described by Beauchamp CO, Gonias SL, Menapace DP, Pizzo SV. (A new procedure for the synthesis of polyethylene glycol-protein adducts; effects on function, receptor recognition., and clearance of superoxide dismutase, lactoferrin, and alpha 2-macroglobulin.) Anal Biochem. 1983; 131(1): 25-33. Briefly, PEG was dissolved at a final concentration of 5OmM in dioxane (Sigma Aldrich, catalog number 27,053-9) by heating at 370C, then 1,1'- carbonyldiimidazole (Fluka, catalog number 21860) was added to a final concentration of 0.5M. The mixture was incubated in a shaking water bath at 37°C for 2h, then it was dialysed against 2 x 100ml PBS, then 2x against 100ml sodium borate buffer 1OmM, pH 8.5, using a MicroKros dialysis system from NBS-Biologicals (catalog number X-I lS-100). 0.1ml of ERFAM and 0.1ml of activated PEG (both compounds dissolved in sodium borate buffer 1OmM, pH 8.5) were then mixed and incubated for 48h at 4°C. The buffer was replaced by dialysis against PBS (2 x 50ml, 6h each dialysis round) using the Slide-a-Lyzer Mini-dialysis unite (MWCO 3,500 daltons from Pierce, catalog number 69550), then the PEGylated ERFAM was split into two aliquots. To one aliquot 20 microliters of an 0.5mg/ml PBS solution of the peptide to which the anti-CD32-B antibody was raised were added in order to block the binding site of the anti-CD32-B antibody while to the other aliquot an equal volume of PBS was added. The ERFAM was stored at 4°C at least 24h before use.
Peripheral blood mononuclear cells were separated from blood by centrifugation over a Histopaque-1077 (Sigma C-8889) layer. Further, polymorphonuclear basophil cells (PB) were isolated using magnetic beads (the Basophil isolation kit, catalog 130-053-401 from Miltenyi Biotech).
The IgE molecules attached to the PB were stripped by incubation for 3.5 minutes at room temperature in lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9) as described by Kleine Budde I, de Heer PG, van der Zee JS, Aalberse RC (The stripped basophil histamine release bioassay as a tool for the detection of allergen-specific IgE in serum), Int Arch Allergy Immunol. 2001; 126(4): 277-85. The PB were then sensitized to NP by incubation in AIM V cell serum-free αxlture medium in the presence of NP-specific chimaeric IgE antibody-containing cell culture supernatant and interleukin 3 (2ng/ml) as described by Shreffler WG, Beyer K, Chu TH, Burks AW, Sampson HA. (Microarray immunoassay: association of clinical history, in vitro IgE function, and heterogeneity of allergenic peanut epitopes), J Allergy Clin. Immunol. 2004; 113(4): 776-82.
Thus, the peripheral blood mononuclear cells were then resuspended (50,000 in 0.1 ml in AIM V cell culture medium per well in 96-well plates) and were cultured overnight in the presence of 50microliters AIM V-dialysed NP-specific chimaeric IgE antibody- containing cell culture supernatant (in order to sensitise theαn to NP) and 20 microliters of the 2mg/ml ERFAM solution (antilgE antibody- PEG - anti-CD32-B) or an equal volume of the ERFAM solution that was preincubated with the blocking peptide.
The following day, 20 microliters of NP-(6)-bovine serum albumin (lmg/ml) were added to the each well and further incubated for 15 minutes at 37°C. The supernatants were collected and frozen at -200C in order to measure histamine release later, while the cells were transferred to 5ml FACS tubes and washed with 4ml phosphate buffered saline containing 1% fetal calf serum and 0.1% sodium azide. The PB were then stained in order to determine their activation which is measured by assessing their cell surface expression of the activation marker CD203c as described by Boumiza R, Monneret G, Forissier MF, Savoye J, Gutowski MC, Powell WS, Bienvenu J. (Marked improvement of the basophil activation test by detecting CD203c instead of CD63), Clin Exp Allergy. 2003; 33(2): 259- 65. The PB were stained with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), anti-MHCII-biotin (Ancelll31-030) with Streptavidin-peridinin- clorophyll-protein complex (Becton Dickinson 554064) and anti-CD45 APC (Becton Dickinson 555485) for 30 minutes at room temperature. Unbound antibodies were then washed and the PB analysed by flow cytometry using a FACS Calibur instrument.
The results shown in Figure 2 demonstrate that ERFAM (antilgE antibody - PEG - anti-CD32-B) inhibits basophil activation (expressed as the percentage of IgE+ cells that express CD203c) while the peptide-blocked ERFAM had a reduced inhibitor effect. Bars represent average values + standard deviations of triplicate measurements. The antilgE antibody - PEG - anti-CD32-B ERFAM was found to inhibit 95.2% ± 0.68% of basophil activation and the inhibitory activity was lost if the ERFAM was pre-incubated with the blocking peptide to which the anti-CD32-B antibody was raised.
EXAMPLE 4: ERFAM obtained by coupling IgE-binding components (anti¬ lgE or fragments thereof, peptides or oligonucleotides) with an anti-FcγR antibody (or an Fab fragment thereof).
An anti-IgE rabbit polyclonal antibody was purchased from Washington Biotechnology Inc (Simpsonville, MD) that was obtained by immunizing rabbits with the peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) representing the amino acid residues 335-359 localized within the Cε3 domain of the human IgE heavy chain sequence, as published by KJ Dorrington and HH Bennich (Structure-function relationships in human immunoglobulin E) Immunological Reviews 1978, 41:3-26. The antibody was affinity- purified from rabbit serum using the biotinylated target peptide (synthetized by Sigma- Genosys) bound to an AffinityPak™ Immobilized Avidin Column (Pierce), further concentrated using a Sartorius concentrator (MWCO 100,000). The antibody concentration was determined using the BCA protein assay system from Pierce. An affinity purified anti- human CD32-B goat polyclonal antibody was purchased from Santa-Cruz Biotechnology Inc. (sc-13271). The ERFAM compound was produced by cross-linking the two antibodies using the Controlled protein-protein cross-linking kit from Pierce (23456).
Briefly, 500 microliters dimethyl formamide were added to dissolve 2mg N- succinimidyl S-acetylthioacetate (SATA), then 28 microliters (representing a 10 fold molar excess) were added to 2ml of the the anti-IgE antibody (3mg/ml in PBS-EDTA) and incubated for 30 min at room temperature in order to add sulfhydryl groups to the molecule. 5mg hydroxy lamine HCl were then dissolved in 100 microliters of conjugation buffer (from the kit) and added to the SATA-modifϊed anti-IgE antibody in order to de-protect the latent sulfhydryl groups during a further 2h incubation. Non-reacted compounds were then removed using a Sartorius concentrator (MWCO 100,000). The concentration of the sulfhydryl-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
The affinity purified anti-human CD32-B antibody was maleimide-activated using reagents from the same kit. 2mg sulfo-succinimidyl 4-[N-maleimidomethyl]cyclohexane-l- carboxylate (sulfo-SMCC) were dissolved in 2ml PBS then 3 microliters (a 10 fold molar excess) were added to 150 microliters anti-human CD32-B antibody (lmg/ml in PBS). After 30min incubation, the non-reacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000). The concentration of the maleimide-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
Equal volumes of 2mg/ml sulfhydryl-activated anti-IgE antibody and maleimide- activated anti-CD32-B antibody were mixed and incubated for 60 minutes at room temperature, then the resulting compound was split into two aliquots To one aliquot 20 microliters of an 0.5mg/ml PBS solution of the GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) peptide were added in order to block the binding site of the anti-IgE antibody while to the other aliquot an equal volume of PBS was added. The ERFAM was stored at 4°C at least 24h before use.
Peripheral blood mononuclear cells were separated from blood by centrifugation over a Histopaque-1077 (Sigma C-8889) layer. Further, polymorphonuclear basophil cells (PB) were isolated using magnetic beads (the Basophil isolation kit, catalog 130-053-401 from Miltenyi Biotech).
The IgE molecules attached to the PB were stripped by incubation for 3.5 minutes at room temperature in lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9). The peripheral blood mononuclear cells were then resuspended (50,000 in 0.1 ml in AIM V cell culture medium per well in 96-well plates) and were cultured overnight in the presence of 50microliters AIM V-dialysed NP-specific chimaeric IgE antibody-containing cell culture supernatant (in order to sensitise them to NP) and 20 microliters of the 2mg/ml EKFAM solution (anti-IgE*anti-CD32-B) or an equal volume of the ERFAM solution that was preincubated with the blocking peptide.
The following day, 20 microliters of NP-(6)-bovine serum albumin (lmg/ml) were added to the each well and further incubated for 15 minutes at 37°C. The supernatants were collected and frozen at -200C in order to measure histamine release later, while the cells were transferred to 5ml FACS tubes and washed with 4ml phosphate buffered saline containing 1% fetal calf serum and 0.1% sodium azide. The PB were then stained with anti—
IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), anti-MHCII-biotin.
(Ancelll31-030) with Streptavidin-peridinin-clorophyll-protein complex (Becton Dickinson 554064) and anti-CD45 APC (Becton Dickinson 555485) for 30 minutes at room temperature. Unbound antibodies were then washed and the PB analysed by flow cytometry using a FACS Calibur instrument.
The results shown in Figure 3 demonstrate that ERFAM (anti-IgE operably linked to anti-CD32-B) inhibits basophil activation (expressed as the percentage of IgE+ cells that express CD203c) while the peptide-blocked ERFAM had a reduced inhibitor effect. Bars represent average values + standard deviations of triplicate measurements.
EXAMPLE 5: ERFAM-equivalent represented by allergen-specific IgG4 antibodies that also exert allergy-inhibitory effects. Allergen-specific IgG4 is separated from plasma on an affinity column, e.g., a
HiTrap NHS-activated HP column from Amersham Biosciences (Little Chalfont, UK, catalog number #17-0716-01), with anti-human IgG4 antibodies from Sigma-Aldrich (Poole, UK). Eluted IgG4 is then added to IgE-sensitized basophils and the capacity of allergen-specific IgG4 to inhibit IgE-mediated basophil degranulation is determined as previously described.
EXAMPLE 6: ERFAM obtained by coupling IgE-binding components (anti- IgE or fragments thereof, peptides or oligonucleotides) with an anti-CD31 antibody or an Fab fragment thereof. An anti-IgE rabbit polyclonal antibody was purchased from Washington
Biotechnology rnc (Simpsonville, MD) that was obtained by immunizing rabbits with the peptide GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) representing the amino acid residues 335-359 localized within the Cε3 domain of the human IgE heavy chain sequence, as published by KJ Dorrington and HH Bennich (Structure-function relationships in human immunoglobulin E) Immunological Reviews 1978, 41 :3-26. The antibody was affinity- purified from rabbit serum using the biotinylated target peptide (synthetized by Sigma- Genosys) bound to an AffinityPak™ Immobilized Avidin Column (Pierce), further concentrated using a Sartorius concentrator (MWCO 100,000). The antibody concentration was determined using the BCA protein assay system from Pierce. An affinity purified mouse anti-human CD31 monoclonal antibody was purchased from Serotec (MCA 1738). The ERFAM compound was produced by cross-linking the two antibodies using the Controlled protein-protein cross-linking kit from Pierce (23456).
Briefly, 500 microliters dimethyl formamide were added to dissolve 2mg N- succinimidyl S-acetylthioacetate (SATA), then 28 microliters (representing a 10 fold molar excess) were added to 2ml of the the anti-IgE antibody (3mg/ml in PBS-EDTA) and incubated for 30 min at room temperature in order to add sulfhydryl groups to the molecule. 5mg hydroxylamine HCl were then dissolved in 100 microliters of conjugation buffer (from the kit) and added to the SATA-modifϊed anti-IgE antibody in order to de-protect the latent sulfhydryl groups during a further 2h incubation. Non-reacted compounds were then removed using a Sartorius concentrator (MWCO 100,000). The concentration of the sulfhydryl-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
The affinity purified anti-human CD31 antibody was maleimide-activated using reagents from the same kit. 2mg sulfo-succinimidyl 4-[N-maleimidomethyl]cyclohexane-l- carboxylate (sulfo-SMCC) were dissolved in 2ml PBS then 3 microliters (a 10 fold molar excess) were added to 150 microliters anti-human CD32-B antibody (lmg/ml in PBS). After 30min incubation, the non-reacted sulfo-SMCC was removed using a Sartorius concentrator (MWCO 100,000). The concentration of the maleimide-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS.
Equal volumes of 2mg/ml sulfhydryl-activated anti-IgE antibody and maleimide- activated anti-CD31 antibody were mixed and incubated for 60 minutes at room temperature, then the resulting compound was split into two aliquots To one aliquot 20 microliters of an 0.5mg/ml PBS solution of the GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) peptide were added in order to block the binding site of the anti-IgE antibody while to the other aliquot an equal volume of PBS was added. The ERFAM was stored at 4°C at least 24h before use.
Peripheral blood mononuclear cells were separated from blood by centrifugation over a Histopaque-1077 (Sigma C-8889) layer. Further, polymorphonuclear basophil cells (PB) were isolated using magnetic beads (the Basophil isolation kit, catalog 130-053-401 from Miltenyi Biotech).
The IgE molecules attached to the PB were stripped by incubation for 3.5 minutes at room temperature in lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9). The peripheral blood mononuclear cells were then resuspended (50,000 in 0.1 ml in AIM V cell culture medium per well in 96-well plates) and were cultured overnight in the presence of 50microliters AIM V-dialysed NP-specific chimaeric IgE antibody-containing cell culture supernatant (in order to sensitise them to NP) and 20 microliters of the 2mg/ml ERFAM solution (anti-IgE anti-CD31) or an equal volume of the ERFAM solution that was preincubated with the blocking peptide. The following day, 20 microliters of NP-(6)-bovine serum albumin (lmg/ml in PBS) were added to the each well and further incubated for 15 minutes at 37°C. The supernatants were collected and frozen at -2O0C in order to measure histamine release later, while the cells were transferred to 5ml FACS tubes and washed with 4ml phosphate buffered saline containing 1% fetal calf serum and 0.1% sodium azide. The PB were then stained with anti- IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), anti-MHCII-biotin (Ancelll31-030) with Streptavidin-peridinin-clorophyll-protein complex (Becton Dickinson 554064) and anti-CD45 APC (Becton Dickinson 555485) for 30 minutes at room temperature. Unbound antibodies were then washed and the PB analysed by flow cytometry using a FACS Calibur instrument. The results shown in Figure 3 demonstrate that ERFAM (antiIgE-antiCD31) inhibits basophil activation (expressed as the percentage of IgE+ cells that express CD203c) while the peptide-blocked ERFAM had a reduced inhibitor effect. Bars represent average values + standard deviations of triplicate measurements.
EXAMPLE 7: Effect of a mixture of an ERFAM obtained by coupling IgE- binding components (anti-IgE or fragments thereof, peptides or oligonucleotides) with an anti- anti-FcγR antibody or an Fab fragment thereof and another ERFAM obtained by coupling IgE-binding components (anti-IgE or fragments thereof, peptides or oligonucleotides) with an anti-CD31 antibody or an Fab fragment thereof.
The two ERFAM molecules antiIgE-anti-CD32B and antiIgE-antiCD31 were produced as previously described. In order to test them, 20 microliters of each of them were added to the PB as described and the resulting inhibitory effect was assessed.
EXAMPLE 8: ERFAM obtained by coupling an anti-IgE antibody with a Fab fragment of an anti-FcγR antibody.
An anti-IgE rabbit polyclonal antibody was purchased from Washington Biotechnology Inc (Simpsonville, MD) that was obtained by immunizing rabbits with the peptide GVSAYLSRP SPFDLFIRKSPTITCL representing the aminoacid residues 335-359 localized within the Cε3 domain of the human IgE heavy chain sequence, as published by KJ Dorrington and HH Bennich (Structure-function relationships in human immunoglobulin E) Immunological Reviews 1978, 41:3-26. The antibody was affinity-purified from rabbit serum using the biotinylated target peptide (synthetized by Sigma-Genosys) bound to an AffϊnityPak™ Immobilized Avidin Column (Pierce), further concentrated using a Sartorius concentrator (MWCO 100,000). The antibody concentration was determined using the BCA protein assay system from Pierce. An affinity purified anti-human CD32-B goat polyclonal antibody was purchased from Santa-Cruz Biotechnology Inc. (sc-13271). This antibody was digested with papain using the ImmunoPure Fab preparation kit from Pierce (catalogue number 44885). Briefly, 12 ml of a digestion buffer was prepared by dissolving 42mg cysteine HCl in 12 ml phosphate buffer pH 10 (both reagents were from the kit). 0.2ml papain slurry were transferred to an Eppendorf 1.5ml tube and washed 3 times with ImI digestion buffer (30 seconds centrifugation at 100Og). The buffer was then removed and 100 microliters of anti-CD32B and 100 microliters buffer were added. The Eppendorf was incubated for 16h in a shaking water bath at 370C, then it was again centrifuged and the supernatant containing the digested antibody was collected. The supernatant was then transferred to another Eppendorf 1.5ml tube and mixed with 0.2ml immobilized protein A (from the Immunopure Protein A antibody purification kit, Pierce, catalogue number 44667) and further incubated for 30 minutes at room temperature. The supernatant containing the Fab fragments was collected by centrifugation and dialysed against 2x50ml PBS, 6h each, using a Slide-a-Lyzer MicroDialysis unit from Pierce (catalogue number 69550). The resulting Fab solution was concentrated using the Slide-a-Lyzer concentration solution (Pierce catalogue number 66528). The final Fab concentration was measured using the BCA assay from Pierce (catalogue number 23225) and adjusted to 0.5mg/ml with PBS, pH 7.4. The ERFAM compound was produced by cross-linking the antibody with the Fab fragment using the Controlled protein-protein cross-linking kit from Pierce (23456). Briefly, 500 microliters dimethyl formamide were added to dissolve 2mg N- succinimidyl S-acetylthioacetate (SATA), then 28 microliters (representing a 10 fold molar excess) were added to 2ml of the the anti-IgE antibody (3mg/ml in PBS-EDTA) and incubated for 30 min at room temperature in order to add sulfhydryl groups to the molecule. 5mg hydroxylamine HCl were then dissolved in 100 microliters of conjugation buffer (from the kit) and added to the SATA-modified anti-IgE antibody in order to de-protect the latent sulfhydryl groups during a further 2h incubation. Non-reacted compounds were then removed using a Sartorius concentrator (MWCO 100,000). The concentration of the sulfhydryl-activated antibody was determined using the BCA protein assay kit from Pierce and adjusted to 2mg/ml in PBS. The Fab fragment of the anti-human CD32-B antibody was maleimide-activated using reagents from the same kit. 2mg sulfo-succinimidyl 4-[N- maleimidomethyl]cyclohexane-l-carboxylate (sulfo-SMCC) were dissolved in 2ml PBS then 2 microliters (a 10 fold molar excess) were added to 50 microliters anti-human CD32- B antibody (0.5mg/ml in PBS). After 30min incubation, the non-reacted sulfo-SMCC was removed using a Slide-a-Lyzer MicroDialysis unit from Pierce (catalogue number 69550). Equal volumes of 0.5mg/ml sulfhydryl-activated anti-IgE antibody and maleimide- activated Fab fragment of the anti-human CD32-B antibody were mixed and incubated for 60 minutes at room temperature, then the resulting compound was split into two aliquots To one aliquot 20 microliters of an 0.5mg/ml PBS solution of the GVSAYLSRPSPFDLFIRKSPTITCL (SEQ ID NO: 1) peptide were added in order to block the binding site of the anti-IgE antibody while to the other aliquot an equal volume of PBS was added. The ERFAM was stored at 40C at least 24h before use.
Peripheral blood mononuclear cells were separated from blood by centrifugation over a Histopaque-1077 (Sigma C-8889) layer. Further, polymorphonuclear basophil cells (PB) were isolated using magnetic beads (the Basophil isolation kit, catalogue 130-053-401 from Miltenyi Biotech).
The IgE molecules attached to the PB were stripped by incubation for 3.5 minutes at room temperature in lactic acid buffer (13.4mM lactic acid, 14OmM NaCl, 5mM KCl, pH 3.9). The peripheral blood mononuclear cells were then resuspended (50,000 in 0.1 ml in AIM V cell culture medium per well in 96-well plates) and were cultured overnight in the presence of 50microliters AIM V-dialysed NP-specific chimaeric IgE antibody-containing cell culture supernatant (in order to sensitise them to NP) and 20 microliters of the 2mg/ml ERFAM solution (anti-IgE bound to the Fab fragment of the anti-human CD32-B antibody) or an equal volume of the ERFAM solution that was preincubated with the blocking peptide.
The following day, 20 microliters of NP-(6)-bovine serum albumin (lmg/ml) were added to the each well and further incubated for 15 minutes at 37°C. The supernatants were collected and frozen at -2O0C in order to measure histamine release later, while the cells were transferred to 5ml FACS tubes and washed with 4ml phosphate buffered saline containing 1% foetal calf serum and 0.1% sodium azide. The PB were then stained with anti-IgE FITC (Serotec STAR96F), anti-CD203c PE (Immunotech IM3575), anti-MHCII- biotin (Ancelll31-030) with Streptavidin-peridinin-clorophyll-protein complex (Becton Dickinson 554064) and anti-CD45 APC (Becton Dickinson 555485) for 30 minutes at room temperature. Unbound antibodies were then washed and the PB analysed by flow cytometry using a FACS Calibur instrument.
The results shown in Figure 4 demonstrate that ERFAM (anti-IgE bound to the Fab fragment of the anti-human CD32-B antibody) inhibits basophil activation (expressed as the percentage of IgE+ cells that express CD203c) while the peptide-blocked ERFAM had a reduced inhibitor effect. Bars represent average values + standard deviations of triplicate measurements. The anti-IgE bound to the Fab fragment of the anti-human CD32-B antibody ERFAM was found to inhibit 87.38% ± 1.55% of basophil activation and the inhibitory activity was decreased to 30.89% ± 2.42% if the ERFAM was pre-incubated with the blocking peptide to which the anti-IgE was raised.
EQUIVALENTS
Although particular embodiments have been disclosed herein in detail, this has been done by way of example for purposes of illustration only, and is not intended to be limiting with respect to the precise form of the disclosed invention or to the scope of the appended claims that follow. In particular, it is contemplated by the inventors that various substitutions, alterations, and modifications may be made to the invention without departing from the spirit and scope of the invention as defined by the claims. Various alterations and modifications are believed to be a matter of routine for a person of ordinary skill in the art with knowledge of the embodiments described herein. Other aspects, advantages, and modifications considered to be within the scope of the following claims.

Claims

We claim:
1. A composition comprising an IgE-Retargeting, Function- Altering Molecule (ERFAM) of the formula A' -B', wherein:
A' represents a moiety that binds an IgE; and B' represents a moiety that binds an inhibitory receptor, wherein A' and B' are operably linked.
2. The composition of claim 1 , further comprising a linker moiety operably linked to A' and B'.
3. The composition of claim 1 , wherein said composition is present in a multimeric complex comprising said IgE, said ERFAM and said inhibitory receptor.
4. The composition of claim 1, wherein said B' binds to an antigen bound by the Fc portion of an IgG4 antibody.
5. The composition of claim 1, wherein B' is an IgG4 isotype antibody.
6. The composition of claim 1 , wherein said composition does not cross-link cell- bound IgE.
7. The composition of claim 2, wherein the linker comprises a polyethylene glycol linker.
8. The composition of claim 2, wherein said ERFAM has a prolonged circulating half- life or a decreased immunogenicity as compared to said ERFAM not including said linker.
9. The composition of claim 1, wherein B' binds a receptor selected from the group consisting of an immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing receptor and an apoptosis-inducing receptor.
10. The composition of claim 9, wherein said (ITIM)-containing receptor is present on the surface of a cell selected from the group consisting of a basophil, a mast cell, a B cell, a platelet, and an antigen presenting cell.
11. The composition of claim 9, wherein said (ITIM)-containing receptor is CD31 or CD32B.
12. The composition of claim 1 , wherein A' or B' comprises a cyclic peptide that linearizes upon binding to IgE.
13. The composition of claim 1 , further comprising a pharmaceutical carrier.
14. A kit comprising the composition of claim 1.
15. A composition of the formula A' -B ' , wherein:
A' comprises an anti-IgE antibody or an anti-IgE binding fragment thereof; and B' comprises an antibody that binds to an (ITIM)-containing receptor, wherein A' and B' are operably linked.
16. The composition of claim 15, further comprising a linker moiety operably linked to A' and B'.
17. The composition of claim 15, wherein said (ITIM)-containing receptor is CD31 or CD32B.
18. A method of treating a subject suffering from an allergy, comprising administering to said subject a therapeutically effective dose of an ERFAM molecule of the formula A'- B', wherein:
A' comprises a moiety that binds an IgE; and B' comprises a moiety that binds an inhibitory receptor, wherein A' and B' are operably linked, thereby treating said subject suffering from said allergy.
19. The method of claim 18, wherein A' comprises an anti-Iglftantibody or an anti-IgE binding fragment thereof, and B' comprises an antibody that binds to an (ITIM)-containing receptor.
20. The method of claim 18, wherein the ERFAM molecule comprises an allergen- specific IgG4 antibody.
21. The composition of claim 18, further comprising a linker moiety operably linked to A' and B'.
22. A method of preventing or reducing an allergic reaction in a subject, comprising administering to said subject a therapeutically effective dose of an ERFAM molecule comprising an ERFAM molecule of the formula A'-B', wherein:
A' comprises a moiety that binds an IgE; and
B' comprises a moiety that binds an inhibitory receptor, wherein A' and B' are operably linked, prior to or concomitant with the exposure of said subject to an allergen, thereby preventing or reducing an allergic reaction in said subject.
23. The method of claim 22, wherein A' comprises an anti-IgE antibody or an anti-IgE binding fragment thereof, and B' comprises an antibody that binds to an (ITIM)-containing receptor.
24. The composition of claim 22, further comprising a linker moiety operably linked to A' and B'.
EP05821176A 2004-05-20 2005-05-19 IgE-RETARGETING, FUNCTION-ALTERING MOLECULES (ERFAM) FOR TREATMENT OF ALLERGIC DISEASES Withdrawn EP1781269A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US57282104P 2004-05-20 2004-05-20
PCT/IB2005/003950 WO2006048781A2 (en) 2004-05-20 2005-05-19 IgE-RETARGETING, FUNCTION-ALTERING MOLECULES (ERFAM) FOR TREATMENT OF ALLERGIC DISEASES

Publications (1)

Publication Number Publication Date
EP1781269A2 true EP1781269A2 (en) 2007-05-09

Family

ID=36319549

Family Applications (1)

Application Number Title Priority Date Filing Date
EP05821176A Withdrawn EP1781269A2 (en) 2004-05-20 2005-05-19 IgE-RETARGETING, FUNCTION-ALTERING MOLECULES (ERFAM) FOR TREATMENT OF ALLERGIC DISEASES

Country Status (6)

Country Link
EP (1) EP1781269A2 (en)
JP (1) JP2008513351A (en)
CN (1) CN101522714A (en)
AU (1) AU2005300261A1 (en)
CA (1) CA2566535A1 (en)
WO (1) WO2006048781A2 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BRPI0918670B8 (en) * 2008-09-17 2021-05-25 Xencor Inc antibody
GB201013989D0 (en) * 2010-08-20 2010-10-06 Univ Southampton Biological materials and methods of using the same
CN103175954A (en) * 2013-03-08 2013-06-26 北京海瑞祥天生物科技有限公司 Human IgE antibody detection kit, and making method and detection method thereof
CN103145832B (en) * 2013-03-21 2015-01-21 江南大学 Synthetic method of cephalosporin drugs general artificial antigen
WO2018089335A1 (en) 2016-11-09 2018-05-17 North Carolina State University Treatment of allergic diseases with chimeric protein
US12060437B2 (en) 2018-03-23 2024-08-13 North Carolina State University Methods and compositions for antibody to high affinity receptor for IgE
US20230173088A1 (en) * 2021-12-08 2023-06-08 IgGenix, Inc. Compositions and methods for treating and suppressing allergic responses

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MXPA03010037A (en) * 2001-05-01 2004-06-30 Univ California Fusion molecules and methods for treatment of immune diseases.
JP2004537991A (en) * 2001-06-15 2004-12-24 タノックス インコーポレーテッド Fcε fusion protein for treating allergy and asthma
US7488804B2 (en) * 2005-02-02 2009-02-10 The Regents Of The University Of California Modified fusion molecules for treatment of allergic disease

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2006048781A2 *

Also Published As

Publication number Publication date
CA2566535A1 (en) 2006-05-11
WO2006048781A3 (en) 2008-02-14
CN101522714A (en) 2009-09-02
JP2008513351A (en) 2008-05-01
WO2006048781A2 (en) 2006-05-11
AU2005300261A1 (en) 2006-05-11

Similar Documents

Publication Publication Date Title
JP7102496B2 (en) Use of modified Fc fragments in immunotherapy
TWI660972B (en) Anti-mcam antibodies and associated methods of use
US20250066476A1 (en) Multispecific heavy chain antibodies with modified heavy chain constant regions
EP1730194B1 (en) Bi-specific antibodies for targeting cells involved in allergic-type reactions, compositions and uses thereof
KR101529160B1 (en) ANTI-CεmX ANTIBODIES CAPABLE OF BINDING TO HUMAN mIgE ON B LYMPHOCYTES
ES3012536T3 (en) Antibody against repulsive guidance molecule b (rgmb)
JP2021100408A (en) Use of aptamer in treatment and/or diagnosis of autoimmune diseases
CN113710707A (en) Heavy chain antibodies binding to PSMA
JP2002531383A (en) Humanized antibody specific to human 4-1BB and pharmaceutical composition containing the same
JP6397938B2 (en) Humanized anti-IgE antibody that crosslinks with CD23 of B lymphocytes but does not sensitize mast cells
CN101400703A (en) domain antibody constructs
JP2010530357A (en) Antibodies that bind to both IL-17A and Il-17F and methods of using the same
EP1986690A2 (en) ANTI-FcRn ANTIBODIES FOR TREATEMENT OF AUTO/ALLO IMMUNE CONDITIONS
CN107249631A (en) The improved antibody of IL 6
WO2016155745A1 (en) Cross-reactive anti-pad antibodies
CN118119641A (en) Treatment of IGE-mediated diseases
EP1781269A2 (en) IgE-RETARGETING, FUNCTION-ALTERING MOLECULES (ERFAM) FOR TREATMENT OF ALLERGIC DISEASES
WO2022258045A1 (en) Bifunctional fusion protein molecule containing anti-human il-17 antibody and taci
CN112079922B (en) Anti-human p40 protein domain antibody and use thereof
JP2010524475A (en) Functional epitope of osteopontin, monoclonal antibody that specifically binds to it, and uses
AU2003299925B2 (en) KIM-1 antagonists and use to modulate immune system
WO2000023477A2 (en) Immunoglobulin variants
USRE42324E1 (en) Compound for treatment of allergy and asthma
JP2023542389A (en) Compounds for the prevention or treatment of autoantibody-mediated conditions
WO2024255683A1 (en) Anti-bdca2 antibody

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20061204

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR LV MK YU

DAX Request for extension of the european patent (deleted)
R17P Request for examination filed (corrected)

Effective date: 20061204

R17D Deferred search report published (corrected)

Effective date: 20080214

RIC1 Information provided on ipc code assigned before grant

Ipc: A61P 37/00 20060101ALI20080304BHEP

Ipc: A61K 39/395 20060101ALI20080304BHEP

Ipc: C07K 16/42 20060101ALI20080304BHEP

Ipc: C07K 16/28 20060101AFI20080304BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20081202