EP1774008A2 - Inducible gene expression - Google Patents

Abstract

The invention relates to vector constructs for an HIV-specific gene therapy. The expression of transgenes is coupled with an infection of the cell with HIV while the transcription of the transgene is controlled by a transcription control region derived from HIV. In addition, the transgene is improved with regard to RNA stability and expression efficiency by modifying the nucleotide sequence.

Description

 Inducible gene expression

description

The present invention relates to a method for inducible gene expression in which a target nucleic acid sequence to be expressed is modified at the nucleic acid level such that an increase in expression is achieved, and the nucleic acid sequence modified in this way is expressed under the control of an inducible transcription control sequence.

Various viruses rely on active export of their incompletely spliced transcripts from the nucleus of the infected host cell. This can be done either by using a cis-RNA signal within the viral transcripts (constitutive transport elements) or by using viral proteins.

Cis-active transport elements are used, for example, by MPMV-CTE (Mason-Pfizer Monkey Virus Constituent Transport Element), SRV-CTE (Simian Retrovirus Constituent Transport Element), Hepatitis B Virus PRE (Post-Transcriptional Regulatory Element) and HSV (Herpes Simplex Virus) ( used within the TK (thymidine kinase) gene). These RNA elements recruit cellular factors and export pathways to allow for the nuclear export of viral transcripts.

Alternatively, nuclear export may also be mediated via an export factor that specifically binds to a target sequence within the viral transcripts and transports them into the cytoplasm in association with cellular factors. For example, Ad-5 (adenovirus 5) transcripts using the 34K and E4orf6 proteins, EBV (Epstein-Barr virus) transcripts using the EB2 protein, herpesvirus Saimiri transcripts using the ORF57 gene product, HSV transcripts using the ICP 27 protein, HTLV-I and II (human T-cell Leukemia Virus I and II) transcripts using the Rex proteins, EIAV (Equine Infectious Anaemia Virus), SIV (simian immunodeficiency virus), and HIV-1 and HIV-2 (human immunodeficiency virus 1 and 2) transcripts using the Rev proteins.

The best-studied HIV-1 Rev-mediated nuclear export is later HIV-1 transcripts. Like all lentiviruses, HIV-1 relies on activating multiple genes from only one proviral template and expressing them in a timed sequence. By alternative splicing events as well as further regulatory mechanisms taking place on RNA level different genes from only one ~ 9 kb primary transcript are generated. These viral transcripts can be divided into 3 classes due to their size: ~ 9 kb unspliced (gag, pol), ~ 4 kb single spliced (env, vif, vpr, vpu) and ~ 2 kb multiply spliced {rev, tat, nef) RNAs.

In addition to the occurrence of incomplete to multiple spliced transcripts, a temporal sequence in the expression of these different RNA species can be observed. Thus, only the multiply spliced ~ 2 kb RNAs, and their gene products Rev, Tat and Nef are detectable in the cytoplasm of the infected cells in the early phase of replication. Only delayed in time do the (~ 9 kb) and simply (~ 4 kb) spliced transcripts and their gene products Gag, Pol, and Env appear.

However, in cells infected with viral mutants lacking an active Rev protein, the single and unspliced transcripts can never be detected in the cytoplasm. The un- and simply spliced transcripts then accumulate in the nucleus, and the late structural proteins (Gag, Env) and enzymes (Pol) they are able to translate can not be formed. The viral Rev protein is thus essentially involved in the time-regulated expression of the viral genes.

HIV-1 Rev, as well as the RNA transport molecules listed above Shuttle proteins that transport viral RNAs from the nucleus into the cytoplasm through interaction with an RNA target located within viral transcripts. In essence, HIV-1 Rev specifically binds to its RNA target RRE, the "rev-responsive element". This 351 nucleotide (nt) long region is located within the Env reading frame and thus part of all un-spliced and single-spliced transcripts. Subsequently, this ribonucleoprotein (RNP) complex is exported from the nucleus through interaction with cellular factors. This requires a C-terminal leucine-rich sequence that, as a nuclear export sequence (NES), mediates nuclear translocation of the Rev protein using cellular mechanisms (Pollard et al., 1998).

The reason why the late transcripts remain in the nucleus in the absence of Rev is still controversial, which is a necessary prerequisite for the Rev dependence and thus the time-regulated expression of gag, pol, and env. In principle, two alternative conceptions of nuclear retention later dominate transcripts.

It is believed that a cellular transcript can not leave the cell nucleus until the splicing process is complete, or all active splice sites have been removed from the primary transcript. The late viral transcripts are intron-containing, incompletely spliced pre-mRNAs that are transported into the cytoplasm using Rev and RRE. Therefore, the influence of the cellular splicing machinery on the nuclear retention of late transcripts was studied early on (Mikaelian et al., 1996) (Kjems et al., 1991; Kjems et al., 1993; Chang et al., 1989; Powell et al. , Lu et al., 1990; O'Reilly et al., 1995). Due to the presence of different active splice sites, the splicing process for HIV-1 transcripts seems to be suboptimal. Therefore, it has been hypothesized by several groups that Rev enables the export of transcripts that are inefficient within the splicing machinery through training Splice complexes are recorded.

In contrast, it has been shown that the late HIV-1 genes, such as env, remain repressed in their expression, even in the absence of active splice sites, and thus the influence of the splicing machinery seems to be more indirect (Nasioulas et al., 1994). , Therefore, so-called inhibitory sequences (INS) or cis-active repressor elements (CRS) have been postulated within the reading frame which adversely affect expression (Nasioulas et al., 1994, Olsen et al., 1992, Schwartz et al., 1992b Maldarelli et al., 1991). However, these repressor sequences located within the coding mRNA do not share a common sequence motif, such as the AUUUA instability motif within the 3 ^' UTR of the unstable GM-CSF mRNA (Chen et al., 1995), but fall only by their consistently high A / U salary on. Thus, fusion of the postulated INS-containing fragments from reading frames of later genes (such as gag and env) to a CAT reporter system resulted in reduced reporter activity (Cochrane et al., 1991, Rosen et al., 1988). This reduction in expression of gag and pol was partially reversed by multiple silent point mutations within the wobble positions (Schwartz et al., 1992a; Schneider et al., 1997). Thus, the un-spliced and single-spliced HIV-1 mRNAs appear to possess cis-active repressor elements that are either removed by multiple splicing or overcome by a Rev / RRE-mediated nuclear export.

An elegant method to circumvent the Rev dependence of HIV transcripts was developed by Schwartz and Schneider, as previously mentioned, in the form of a partial change in the reading frame of HIV genes. A consistent continuation of this concept led to the synthesis of a codon-optimized HIV gag-po / gene using synthetic oligonucleotides (Wagner et al., 2000, Graf et al., 2000). This form of adaptation of G / C content and codon usage to that of mammalian cells allowed for a constitutive synthesis of the gag pole. Polyprotein in mammalian cells in large quantities. The underlying mechanism of this decoupling of protein synthesis from the Rev dependence is an altered nuclear export of the mRNA. While the HIV wild-type RNA relies on an alternative export pathway, characterized by the Crm1 protein, dependent on the HIV shuttle protein Rev, the synthetic mRNA is constitutively transported into the cytoplasm on the regular nuclear export pathway for cellular mRNAs. This constitutive expression of HIV proteins opens new avenues for HIV therapy at the genetic level.

The publication by Graf et al. (2000), however, does not disclose a method for transactivatable inducible gene expression.

Like the publication by Graf et al. DE 1 053 781 A1 also deals with RNA export from the cell nucleus to the cytoplasm. This patent application is concerned with making reporter genes dependent on Rev in order to control the expression of the reporter gene via nuclear export.

Since Rev / RRE dependence places some restrictions on the development of HIV-based vectors, Kotsopoulou et al. (2000) a codon-optimized HIV-1 gag-po / gene. This gene was inserted into a mammalian expression vector and examined for dependence on Rev. However, the authors did not use transactive factor-inducible promoters. An inventive method is therefore not disclosed.

The expression of anti-HIV genes in cells can be efficiently utilized for intracellular inhibition of HIV replication (Bunnell et al., 1998). In the meantime, a whole range of HIV gene therapy strategies have been developed, ranging from antisense constructs and RNA decoys via specific RNA-degrading ribozymes and RNA interference to transdominant-negative HIV-derived proteins. Beside these Intracellular inhibitors that specifically interfere with HIV replication may also prevent the re-infection of cells or the spread of progeny viruses as part of gene therapy. Various approaches are concerned with the expression of secretable anti-HIV proteins, immunostimulating or unspecific antiviral factors, and not least with the expression of cytotoxic factors after infection (for review, see Mautino et al., 2002).

In addition to these more unspecific inhibition strategies, viral replication can be accomplished by preventing virus release in a very specific manner, using HIV-derived protein derivatives. Deletions in the gag mediate a transdominant negative (TDN) effect on the neoplasm and release of progeny viruses (Poblotzki et al., 1993, Trono et al., 1989, Smythe et al., 1994, Furuta et al., 1997). These deletions are located in p17MA, in the transition region of p17MA / p24CA and in the C-terminal domain of p24CA. The exact mechanism of action of the transdominant-negative effect has not been elucidated. However, some evidence points to an influence of the reduced cyclophilin A binding capacity of the mutant p24CA (Chiu et al., 2002) and altered membrane targeting, from the plasma membrane to the ER membrane, in deletions in p17MA (Facke et al., 1993; Gallina et al., 1994; Ono et al., 2004). Since Gag is a very highly multimerizing polyprotein and exact assembly is necessary for the correct formation of HIV particles (WiIk et al., 2001), it is obvious that TDN Gag deletion derivatives with functional assembly domain (C-terminal domain of the p24CA) directly interfere with the assembly of HIV capsids by binding to wild-type Gag proteins and thus have been shown to inhibit HIV replication.

The last strategy, however, has some problems with constitutive protein expression. Thus, expression of the foreign gene may lead to cell toxicity, dysregulation of cellular functions, down-regulation of transcription, and, in the case of HIV derived protein, lead to an undesired immune response (Smythe et al., 1994). To circumvent this problem, different strategies are pursued to make the expression of the transgene dependent on HIV infection.

In several approaches, Tat, Rev, and Tat / Rev-dependent expression were studied, and in part the inhibition of HIV proliferation in vitro was described (Caruso et al., 1992, Harrison et al., 1992, Liu et al. , 1994). Consistently, the expression of thymidine kinase (Marcello et al., 1998) and interferon α2 (Ragheb et al., 1999) could be increased by a factor of 5 and 4, respectively, and by a factor of 3.3 and <2, respectively, by Rev , In contrast, the combined addition of Tat and Rev led to very different results: the expression of thymidine kinase was increased by a factor of 7, while for interferon α2 an increase in expression by a factor of> 300 was indicated. For HIV-1 TDN Gag derivatives, a marked Rev-mediated induction of protein synthesis (with low basal activity) was shown, which was associated with a substantial inhibition of HIV replication (up to 94%) (Smythe et al., 1994; Furuta et al., 1997). For the combination of Tat- and Rev-dependent expression of TDN Gag, a significantly increased protein synthesis could also be achieved by cotransfection of tat and rev expression plasmids (Ding et al., 2002, Cara et al., 1998). Here, however, it was shown that the inhibition of HIV replication was only partial (Cara et al., 1998) and only increased to a high level by combination with various inhibitory strategies (Ding et al., 2002, Cara et al., 1998). , In contrast, LTR / Tat-inducible expression of suicide genes such as TK resulted in multiple inhibition of virus replication (Marcello et al., 1998, Miyake et al., 2001, Ragheb et al., 1999).

Concerning basal activity, it has consistently been shown that dependence on Rev does not result in absolute inhibition of protein synthesis. Rev influences the export of RNA from the nucleus and is only associated with the corresponding cis-active Retention sequences (INS, see above) and a cis-standing recognition sequence (RRE) functional. Isolated gag genes, which are reduced in size (and thus also in size), are efficiently transcribed under a correspondingly active promoter (eg CMV) and it seems likely that some of the RNA will enter the cytoplasm without the assistance of the Rev and is translated.

There is no uniform data for the regulation by LTR / Tat. Most reports have described basal activity of the genes under LTR control (Caruso et al., 1992, Ding et al., 2002, Muratori et al., 2002, Cara et al., 1998). Possible explanations of this expression in the absence of Tat are activation of the LTR promoter by TNFα, which has been secreted from the corresponding transduced cells (Muratori et al., 2002) or elements of the vector construct derived from HIV (Miyake et al. 2001).

The length of the LTR used can also have an influence on the regulation. Thus, with a minimal LTR, a complete shutdown of transcription was detected in the absence of Tat (Miyake et al., 2001), thus a "dense" inducible promoter described.

For HIV-dependent transgene expression, therefore, the LTR / Tat system appears to be the more consistent switch module. Also because an induction by Rev is followed by action, which can lead to an initial virus multiplication, just before the inhibition can take effect through the transgene. Inter alia, the observed incomplete inhibition of replication after Rev induction is explained (Smythe et al., 1994).

However, in contrast to suicide genes, Tat-inducible expression of transdominant negative (TDN) Gag derivatives has not yet been shown to sufficiently inhibit HIV replication (see above). There are several explanations for this deficiency: i) The TDN effect correlates with the amount of TDN protein, ie a certain limit must be exceeded in order to achieve an effective intervention. The amount of protein is, however, largely dependent on the promoter activity. This is relatively low compared to highly active viral promoters (eg CMV, SV40) in the HIV-1 LTR, so may not be sufficient.

ii) The TDN derivatives used so far are derived from the HIV-1 wild-type genome, thus contain INS motifs and are therefore dependent on a Rev-mediated nuclear export. As described above, therefore, the actual inhibitory effect is only with the presence of REV in the nucleus, whereby the first HIV transcripts unhindered enter the cytoplasm and can complete the replication. Therefore, it is not surprising that a combination of both regulatory systems leads to a very inefficient inhibition of HIV replication (Cara et al.,

1998).

Besides the LTR-tat system, many other inducible viral promoters are known. Other inducible expression systems are also known in the art. Often, however, an inducible system can not achieve the desired level of gene expression. Therefore, it was an object of the present invention to provide an improved method for inducible gene expression.

This object is achieved by a method for inducible gene expression, comprising

(i) providing a target nucleic acid sequence to be expressed, (ii) modifying the target nucleic acid sequence to be expressed such that an increase in expression is achieved,

(iii) operatively linking the modified target nucleic acid sequence to an inducible transcriptional control sequence, (iv) expressing the modified target nucleic acid sequence in one suitable expression system by a transactive factor.

Surprisingly, it has been shown that the inducible expression of a gene to be expressed in a target nucleic acid sequence to be expressed (hereinafter transgene) can be significantly improved if, on the one hand, its nucleic acid-modified sequence to increase gene expression and on the other hand, the target nucleic acid under the control of a a transcript factor inducible transcriptional control sequence is expressed.

Inducible gene expression is e.g. is essential in the use of toxic gene products and has significant advantages over other constitutive expression in other therapeutically useful genes:

An uninfected cell is not stressed in its physiological performance by a high expression of additional factors under stress.

- Non-specific or unforeseeable interactions of the gene products could lead to physiological modifications, such as activation, proliferation or the like, also in neighboring cells, in tissues or in the whole organism. HIV-derived proteins are recognized by immune cells in the environment of HIV infection and the corresponding protein-expressing cells are eliminated.

- In the case of toxic factors, constitutive production must be avoided.

A transcriptional control sequence is a nucleic acid sequence that enables expression of a nucleic acid sequence operatively associated therewith, particularly a gene. It may be a promoter, in addition, the transcriptional control sequence may also include other elements, such as enhancers and the like. Preferably, the inducible transcriptional control sequence is an inducible promoter. In principle, any inducible promoter system is suitable, which in the state the technique is known. For example, a natural or artificial inducible promoter can be used, for example, a tetracycline-inducible promoter (Tet on / Tet off system). Furthermore, however, an inducible viral promoter can also be used.

The transcriptional control sequence is induced by a transactive factor. The transactive factor is a factor that acts in trans and has an impact on transcription. This is preferably a transcription factor. Most preferably, the transactive factor is a viral transactivating factor.

Preferably, the inducible transcriptional control sequence is inducible by a viral transactive factor. A viral inducible

Transcriptional control sequence inducible by a viral transactive factor can be derived from any virus.

Preferably, sequences of retroviruses, HCV (hepatitis C

Virus), HBV (hepatitis B virus), HSV (herpes simplex virus), EBV (Epstein-Barr virus), SV40 (simian virus 40), AAV (adeno-associated virus),

Adenovirus, papillomavirus or Ebola virus. The transactive factors used herein are accordingly, e.g. selected from, but not limited to, the following viral factors: NS5A

(HCV), HBX (HBV), VP16 / ICP4 (EBV), EBNA1 / Rta (EBV), ART (HHV8), Large T antigen (SV40), Rep78 / 68 (AAV), E1A (adenovirus), E2

(Papilloma virus) and VP30 (Ebola virus).

As an inducible transcription control sequence inducible by a viral transactive factor, a retroviral LTR promoter or a functional subsequence thereof is preferably used. Preferably, therefore, the transactive factor is a retroviral Tat or Tax protein. The LTR promoter may be selected from the LTRs of HIV-1, HIV-2, SIV ₁ HTLV and other related retroviruses, the LTR promoters exhibit. In particular, antiviral promoters are preferred, especially those of HIV.

A transactive factor in the sense of the present invention is thus a factor which exerts an influence on the transcription in trans, preferably in that the transactive factor interacts with the inducible transcriptional control sequence. An example of such a transactive factor is thus the Tat protein already mentioned above.

To improve gene expression, the target nucleic acid sequence to be expressed is modified. This is done at the nucleic acid level and preferably so that the corresponding amino acid sequence is not or substantially not changed. If the amino acid sequence is changed in the modification of the nucleic acid sequence to increase gene expression, this should have no influence on the function of the resulting protein.

The modification of the target nucleic acid sequence to increase gene expression can be performed in a number of ways.

On the one hand, it is possible to adapt the codon usage of the transgene to the expression system used. A eukaryotic expression system, particularly one based on mammalians, is preferred, in particular these are mammalian cells, preferably human cells. Therefore, the codon usage of the transgene is preferably adapted to the codon usage of mammalian cells, more preferably that of human cells.

Modified target nucleic acid sequences suitable for gene therapy, for example, can be generated, for example, by choosing the codon distribution as occurs in exported cellular mRNA. Preferably, a codon choice should be used here, as in most or secondarily mammalian cells More preferably, codon selection is adapted to that of actively expressed mammalian genes. (Ausubel et al., 1994). Preferably, the nucleic acid sequence is modified using Gene Optimizer technology (German patent application DE 102 60 805.9, PCT / EP03 / 14850) for optimal expression in mammals.

Instead of or in addition to adjusting the codon choice, it is also possible to optimize the GC content. Preferably, this is achieved by adjusting the GC content of the transgene as accurately as possible to the GC content of the expression system used. In this case, preferably the degeneration of the genetic code is utilized, so that the change of the nucleic acid sequence for the purpose of increasing the GC content does not lead to a change in the amino acid sequence. The optimal percentage of G and C nucleotides in a sequence to be expressed, as already mentioned, depends on the particular organism or cells in which the sequence is to be expressed. For example, the optimal GC content of nucleic acids in mammalian cells is about 50%. There are already reference documents in which the skilled person can look up the optimal GC content for different organisms or cells. The regularly updated Codon Usage Database at www.Kazusa.or.jp/codon/ by Y. Nakamura at the Kazusa DNA Research Institute exists , see also Nakamura, Y. et al. (2000) Nucl. Acids Res. 28, 292. It is then no problem for a person skilled in the art to optimize the nucleic acid sequence of the target nucleic acid to be expressed in terms of GC content.

The optimization of the GC content or the adaptation of the codon usage is preferably carried out by silent mutations or by mutations which do not influence the activity of the protein encoded by the transgene. The codon usage need not necessarily be adjusted if the GC content of said gene is already over 50%. Genes with wild-type codon usage can be made from long oligonucleotides by stepwise PCR, as indicated in the example. Another way to modify the target nucleic acid sequence to be expressed for the purpose of enhancing expression is to either deliberately eliminate motifs that adversely affect transcription rather than the above or in addition thereto. This includes, for example, the deletion of nucleic acid motifs such as poly-A sequences and the like, which may already be known to the person skilled in the art. Other such negative expression influencing motifs include RNA instability motifs, adenine-rich motifs, recognition motifs for endonucleases, motifs that influence RNA secondary structure, and the like.

The target nucleic acid sequence to be expressed preferably encodes a therapeutic and / or diagnostic protein. For example, such a protein may be selected from toxic gene products, suicide factors, apoptosis-inducing proteins, messengers, transactivators, regulatory proteins, transdominant-negative proteins, cytokines, chemokines, etc. Specific examples are interferon α, SDF-I RANTES ₁ MIP1α, TNF, and interleukins especially the interleukins 2, 6, 10, 12, 15 and 28. Preferably, the target nucleic acid sequence to be expressed encodes a gene which, when activated by the LTR / Tat system, eg after activation by HIV infection, produces proteins which are suitable to induce the natural defense mechanisms of neighboring cells or to prevent infection by HIV by binding to the corresponding receptors. In HIV, these are in particular the receptors CD4, CCR5 or CXCR4.

Further examples are enzymes such as thymidine kinase, cytosine deaminase, purine nucleoside phosphorylase, carboxypeptidase, carboxylesterase, nitroreductase, peroxidase, xanthine-guanine phosphoribosyltransferase, glycosidase, thymidine phosphorylase and the like. The method is particularly suitable for the expression of toxic gene products, eg thymidine kinase from herpesviruses, nucleases or apoptosis-inducing proteins (eg FAS / FAS ligand, caspases etc.). In addition to caspases, TNF-related apoptosis-inducing ligand (TRAIL), protein kinase C (PKC), tumor necrosis factor (TNF), apoptosis-inducing factor (AIF) and the like are also suitable. In this case, after infection with HIV, the expression of genes would be induced which damage cells and thus prevent the new production and distribution of progeny viruses.

Furthermore, the transgene may be a regulator gene which, after its induced expression in a cell as a molecular switch molecule, switches the expression of other genes on or off. As such regulatory gene, for example, a gene coding for a transcription factor can be used. Of course, these applications are not limited to the infection with HIV, the skilled person is able to use appropriate systems for other infections.

Preferably, the transgene is a viral gene.

Furthermore, the target nucleic acid sequence to be expressed may also be a gene for a transdominant-negative (TDN) protein. Preferably, this is a viral TDN protein, preferably a retroviral, most preferably a lentiviral.

In particular, lentiviral TDN proteins are suitable here, for example derivatives of Pr55 ^9a9 , Gp41, Gp120, Rev, protease, integrase, reverse transcriptase, Nef, Vpr, Vpv or any other lentivirus protein which is suitable for the replication cycle of lentiviruses, in particular HIV interruption or to prevent the release / detachment of virus particles.

Preferably, HIV-1 gag (group-specific antigen) becomes transgenic the codon choice being adapted to the choice of codons as found in human genes.

Particularly preferred is a gag gene containing further deletions. This can increase the TDN effect. These are preferably further deletions in the p24 region or one or more assembly domains.

For example, the amino acid sequence of the gag gene product was transformed into a synthetic gag-encoding reading frame using the

Codon selection of human genes, back translated. This "syngag" called

Reading frame was then constructed using long oligonucleotides and a stepwise PCR as a fully synthetic reading frame.

Subsequently, the syngag reading frame was cloned into an expression vector. The syngag vector produced proved to be completely independent of the presence of the Rev protein, an RRE sequence, a 5 ^' untranslated region (UTR), or the expression of the HIV gag

Splices. The initial gag gene, which in its codon selection the

In contrast, HIV-1 wild-type gene (wtgag) was found to be dependent on Rev, RRE and the 5 ^' UTR including splice donor

(Graf et al., 2000).

Furthermore, the invention therefore preferably relates to a method for the expression of transdominant negative (TDN) lentivirus proteins in eukaryotic cells, comprising:

(a) introducing a vector comprising a target nucleic acid sequence to be expressed which encodes a TDN lentivirus protein and whose codon usage is adapted to that of mammals, and a lentivirus Tat protein inducible promoter sequence operably linked to the target nucleic acid sequence, into a eukaryotic

Cell,

(b) providing the Tat protein such that expression of the target nucleic acid sequence is induced. Surprisingly, despite the limitation mentioned above, LTR / Tat system can be used if, as described above, expression of the TDN derivative is independent of Rev / RRE. In the present invention this is accomplished by the adaptation of codon usage to that of mammalian cells.

In the combination of LTR and synthetic HIV reading frames, early expression of the TDN gene - in an early stage of HIV infection - combines with efficient nuclear export (plus RNA stabilization) and protein biosynthesis, before HIV ones Structural and thus target proteins are produced. Overall, this combination provides i) a high amount of TDN protein with ii) a kinetically favorable expression course and iii) a very efficient inducibility.

In contrast to the methods described so far, i) the inducibility of expression is limited to the presence of Tat, thus avoiding the need for the HIV RRE / Rev in the transfer construct, and ii) ensuring the Rev independence of the transcript by appropriate codon selection for the transfer construct ,

The transcriptional control sequence is preferably positioned to the transgene analogously to the natural occurrence.

The induction of the promoter is carried out by a lentiviral Tat protein, preferably by the HIV Tat protein, which acts as a trans-active factor. This allows induction of the promoter by infection of the cell containing the vector with a lentivirus, particularly HIV, to occur by itself. For the purposes of this application, such a trans-acting factor means both a single protein and a protein complex.

The stabilization of the RNA and the improvement of the Kemexport properties as well as the independence of protein production from an RRE / Rev interaction (in the case of HIV-derived proteins) can be achieved, for example, by a corresponding codon selection, taking into account RNA stability-influencing motifs.

Furthermore, the invention relates to a nucleic acid vector comprising:

(a) a target nucleic acid sequence to be expressed,

(b) a transcriptional control sequence inducible by a transactive factor, preferably by a viral transactivator, in operative association with the expression to be expressed

Target nucleic acid sequence, wherein the sequence according to (a) is modified at the nucleic acid level so that an increase in expression is achieved.

A nucleic acid vector in this context is understood as meaning a nucleic acid construct which is suitable for expression of a target nucleic acid sequence contained therein in a suitable expression system, e.g. a cell, an organism or an in vitro system, and comprising at least one target nucleic acid sequence to be expressed and an inducible transcriptional control sequence operably linked thereto. Such a vector may contain other coding sequences, e.g. Selection marker genes and the like. The person skilled in the art is able to use the target nucleic acid sequence to be expressed in conjunction with its transcription control sequence in a suitable commercially available plasmid vector or the like or else a self-engineered one.

The target nucleic acid sequence to be expressed and the inducible transcription control sequence can also be selected here as described above. The modification of the sequence can also be carried out as explained above. A preferred embodiment relates to vectors that can be used in HIV gene therapy and are characterized in that they encode a therapeutic gene that is expressed after infection of the cell with HIV. The transcription of corresponding genes is controlled by the HIV-specific LTR ("long terminal repeat") region and takes place only in the presence of the HIV Tat protein, whereby synthetic, adapted to the expression in human cells reading frame for the therapeutic Genes may be used to enhance gene expression, particularly RNA stability and RNA nuclear export, which may be directed against different steps in the HIV replication cycle and intervene with cell infection, replication of HIV, or propagation of progeny viruses.

The vector according to the invention may additionally contain a further transgene, which preferably codes for a therapeutic, gene therapeutic and / or diagnostic protein. This further transgene may also be under the control of an LTR promoter, e.g. the same promoter as the sequence according to (a). Or it may be controlled by a separate promoter, which may be constitutive or inducible.

The vector may be, for example, viral (eg adeno-associated viruses, adenoviruses, retroviruses, herpesviruses, alphaviruses, etc.) or bacterial origin or a plasmid. Most preferably, the inducible transcriptional control sequence is selected such that expression of the foreign gene is dependent on the presence of the HIV-1 Tat protein. If the Tat transactivation is successfully reconstituted, preferably an increase in expression of the Tat-dependent gene should be at least 3-fold, preferably 5-fold, more preferably 10-fold or more. Preferably, the vector comprises a sequence according to SEQ ID NO. 1, 16 or 17.

The present invention further provides modified target nucleic acid sequences which, when in operative

Linkage with a suitable inducible

Transcriptional control sequence, causing increased gene expression. Preferably, these are modified

Target nucleic acid sequences selected from the sequences given in this invention in the Examples and Sequence Listing. Most preferably, the modified target nucleic acid sequences are selected from the following sequences: SEQ ID NO. 1, 16 and 17.

Yet another subject of the present invention are cells, preferably eukaryotic cells, more preferably mammalian cells, most preferably human cells infected with a nucleic acid or a nucleic acid

Vector, as described above, wherein the nucleic acid is present in a transcriptional form. The nucleic acid or the vector may for example be episomal or stably integrated into the chromosome. There may be one or more copies in the cell.

The present invention also relates to pharmaceutical compositions based on the vectors and modified lentiviruses and cells disclosed herein. The medicaments according to the invention are suitable as therapeutic and diagnostic applications, in particular they are suitable for the diagnosis, prevention or therapy of virus-associated diseases or / and tumor diseases. For these applications, e.g. the target nucleic acid sequence to be expressed is in particular a suicide gene or the like.

For example, the drugs can be used for therapy, preferably for the treatment of antiviral infections, eg HIV and SIV, in particular HIV-1 and HIV-2. The expert is capable of the Promoter sequence to adapt to the system in which the expression is to take place. Thus, antiviral infections can now be controlled by treating infected individuals in vitro, ex vivo and of course in vivo, eg by introducing the nucleic acids or vectors according to the invention into PMLs from these patients or in T cells in different stages of differentiation or stem cells.

The invention will be explained in more detail by the following figures and examples.

Pictures and sequences

Figure 1 shows schematically all the gag-encoding constructs produced.

FIG. 2 shows the results of the expression of various gag coding constructs in H1299 cells.

Figure 2A shows an HIV-1 p24-specific Western blot of transfected cells.

Figure 2B shows a p24 EL I SA test.

FIG. 3 shows the results of the expression of wild-type gag expressing constructs in the presence and absence of Tat and / or Rev.

Figure 3A shows an HIV-1 p24-specific Western blot of transfected cells.

Figure 3B an ELISA test.

Figure 4 shows the effect of the transdominant gag negative proteins on the release of HIV particles. Figure 4A shows percent inhibition of particle release according to a p24 ELISA assay.

Figure 4B shows the percent inhibition of the infectivity of released virus particles.

Figure 5 shows the percent inhibition of viral particle release formed in the presence of trans-dominant negative gag constructs with further deletions in p24.

Figure 5A shows the percent release inhibition.

Figure 5B shows the inhibition of infectivity in percent.

Figure 6 shows the sequences of TDsyngag and TDwtgag and a sequence comparison between TDwtgag and TDsyngag.

Figure 7 shows the nucleic acid sequences of TDsyngag delta 2 and TDsyngag delta 2 delta p7.

SEQ ID no. Figure 1 shows the nucleic acid sequence of TDsyngag.

SEQ ID no. Figure 2 shows the amino acid sequence of TDsyngag.

SEQ ID no. Figure 3 shows the nucleic acid sequence of TDwtgag.

SEQ ID no. 4 shows the amino acid sequence of TDwtgag.

SEQ ID no. Figures 5 to 15 show different oligonucleotides.

SEQ ID no. Figure 16 shows the nucleic acid sequence of TDsyngag delta 2. SEQ ID no. 17 shows the amino acid sequence of TDsyngag delta 2.

SEQ ID no. Figure 18 shows the nucleic acid sequence of TDsyngag delta 2 delta P7.

SEQ ID no. Figure 19 shows the amino acid sequence of TDsyngag delta 2 delta P7.

Examples

example 1

Production of independent, fact-dependent, rev-dependent and

Tat and Rev dependent gag gender derivatives

HIV-1 transdominant negative (TDN) Gag derivatives were prepared as constitutively, Tat, Rev or Tat / Rev dependent gene constructs. Rev dependence was achieved by using HIV wild-type (wt) gene sequences, including the 5 ^' untranslated region (UTR), in conjunction with the HIV Rev responsive element (RRE). Rev independence was made possible by synthetic, GC-rich gene sequences, with the encoded amino acid sequence being identical for both constructs. Dependence on Tat was achieved by using HIV-1 LTR as a transcriptional control. In contrast, for constitutive transcription, the CMV promoter / enhancer was used. By appropriate combination of the elements, a constitutive expression (CMV-syngag), an action-dependent (LTR-syngag), a rev dependent (CMV-UTR-wtgag-RRE) and a Tat- and Rev-dependent (LTR-UTR) wtgag-RRE) expression of identical (at the protein level) TDN gag derivatives.

The reading frame of the HIV-1 group-specific antigen (gag) (GenBank Accession Number: M15654.1 HIVBH102, nucleotides 112-1650, reference: Ratner L ₁ Haseltine W, Patarca R, Livak KJ ₁ Starcich B, Josephs SF ₁ Doran ER, Rafalski JA, Whitehom EA ₁ Builder K, et al. Complete nucleotide seqence of the AIDS virus, HTLV-III. Nature. 1985 Jan 24-30; 313 (6000): 277-84) should be synthesized using a codon choice as found in human cells. For this purpose, the amino acid sequence of the Gag protein (corresponding to GenBank accession number: M15654 JIVBH102, nucleotides 112-1408) was translated into a corresponding nucleotide sequence with a deletion of nt 304-489. An appropriate software package (GeneOptimizer) was used for codon optimization and optimization of the RNA sequence. For the subcloning and for adding further sequence elements within untranslated regions further restriction sites were added. The nucleic acid sequence, including the interfaces, is shown in SEQ ID NO. 1 indicated.

This sequence was prepared as a fully synthetic gene using synthetic oligonucleotides according to a method already described (Zolotukhin et al., 1996).

Figure 6 shows a comparison of the nucleic acid sequences of TDsyngag (codon selection derived from mammalian genes) and TDwtgag (codon selection derived from HIV structural genes). The TDGag-encoding DNA fragment ("TDsyngag") so prepared was amplified using the

Interfaces EcoRI and Xho I into the expression vector pcDNA3.1 (+)

(Invitrogen) under the transcriptional control of cytomegalovirus (CMV) early promoter / enhancer ("pc-CMV-TDsyngag").

To prepare an analogous, but in its Kodonwahl the HIV wild-type corresponding expression plasmid, the coding region of the HIV-1 gag, including the 5 ^' untranslated region (UTR), subcloned and the conditions for a Rev-mediated nuclear export to add to the wtgag coding region an RNA target sequence (RRE) (Graf et al., 2000). This target sequence interacts at the RNA level with a viral nuclear export protein (in the case of HIV-1 Rev protein) and cellular nuclear export proteins.

To ensure protein level adaptation, the wild-type construct was C-terminally shortened by introducing two consecutive stop codons in the gag reading frame (codons for 372F and 373L were mutated). The mutations were introduced by site-directed mutagenesis kit (Stratagene) using oligonucleotides gag-stop1 and gag-stop2. The resulting construct was named pc-CMV-UTR-wtgag-RRE. Using the oligonucleotides DeM and Del2, a deletion from nt 304 to nt 489 was inserted in this construct analogously to TDsyngag (pc-UTR-TDwtgag-RRE). The coding sequence is shown in SEQ ID no. 3 indicated.

The coding sequences were placed under the transcriptional control of the HIV promoter to achieve Tat dependence of the Gag protein derivative. The HIV-1 Long Terminal Repeat (LTR) contains such a promoter. This region was amplified by PCR using oligonucleotides ItM and Itr2 from HIV-1 proviral DNA (HX10 see (Ratner et al., 1987)), and using the Mfu \ and EcoR \ cleavage sites directly 5 ^'in front of the ATG of the gag. cloned coded reading frame in the pc-CMV TDsyngag, wherein the CMV promoter was replaced by the LTR. For the replacement of the promoter in the wtgag construct, parts of the HIV genome were amplified using the oligonucleotides Itr1 and Itr3 in a PCR reaction and using the Mlu \ and C / al cleavage sites the CMV promoter in the pc-CMV-UTR- TDwtgag-RRE construct replaced. The natural reading frame of the HIV-Provirus (with the order LTR, UTR, gag) was restored. The resulting constructs were hereafter referred to as "pc-LTR-TDsyngag" and "pc-LTR-UTR-TDwtgag-RRE", respectively.

Figure 1 shows all the Gag-encoding constructs shown schematically. Example 2

The expression of the TDgag constructs can be controlled by HIV regulatory proteins

All cell culture products were from Life Technologies (Karlsruhe). All mammalian cell lines were cultured at 37 ^° C. and 5% CO ₂ . Human lung carcinoma cell line H1299 was transfected into Dulbecco's Modified Eagle Medium (DMEM) with L-glutamine, D-glucose (4.5 mg / ml), sodium pyruvate, 10% inactivated fetal bovine serum, penicillin (100 U / ml) and streptomycin (100 μg / ml). The cells were subcultured after reaching confluency in the ratio 1:10.

1 × 10 ⁶ cells were seeded in petri dishes (diameter: 100 mm) and 24 h later by calcium phosphate coprecipitation (Graham et al., 1973) with 30 ug TDgag plasmids and 15 ug pc-tat (Tat expression plasmid) or pc- rev (Rev expression plasmid) or pcDNA 3.1 vector (reference plasmid). For cotransfections of gag, tat and rev, 15 μg of plasmid were used. Cells and culture supernatants were harvested 48 hours after transfection. The transfected cells were washed twice with ice-cold PBS (10 mM Na ₂ HPO ₄ , 1.8 mM KH ₂ PO ₄ , 137 mM NaCl, 2.7 mM KCl), scraped off in ice-cold PBS, centrifuged at 300 × g for 10 min Lysis buffer (50 mM Tris-HCl, pH 8.0, 0.5% Triton X-100 (w / v)) for 30 min on ice. Insoluble constituents of the cell lysate were centrifuged off for 30 minutes at 10,000 × g and 4 ° C. The total protein amount of the supernatant was determined by the Bio-Rad Protein Assay (Bio-Rad, Munich) according to the manufacturer's instructions.

The samples were mixed with the same volume of 2-fold sample buffer (Laemmli, 1970) and heated to 95 ⁰ C for 5 min. 50 μg total protein from cell lysates were separated on a 12.5% SDS / polyacrylamide gel (Laemmli, 1970), electrotransferred to a nitrocellulose membrane and with the monoclonal antibody p ²⁴ -spezifιschen 13-5 (Wolf et al., 1990) analyzes and detects coupled by means of a secondary, AP (alkaline phosphatase) antibodies and by chromogenic staining detected (Fig. 2A).

In addition, the cell lysates were quantified in a commercially available p24 ELISA test (NEN). 1 μg of the cell lysate was evaluated according to the manufacturer's instructions and the total concentration of HIV-1 p24 was determined (FIG. 2B).

H1299 cells were transiently transfected with the gag constructs. The expression obtained was analyzed in the presence and absence of Tat or Rev (Figure 2). For the pc-CMV TDsyngag, constitutive expression of the TDgag was detected independently of Tat or Rev (Figure 2A, lanes 2 and 2B, 2). The expression of the TDgag for the pc-CMV-UTR-TDwtgag-RRE construct by Rev could be increased by a factor of 7 (Figure 2A, lanes 3 and 4 and 2B 3 and 4) and for the pc-LTR-TDsyngag construct Cotransfection of pc-tat increased by a factor of 2.5 (Figure 2A ₁ lanes 5 and 6 and 2B, 5 and 6). The basal activity of the TDgag expression was slightly lower for the pc-LTR-TDsyngag construct compared to pc-CMV-UTR-TDwtgag-RRE, but significantly reduced for both constructs compared to the pc-CMV-TDsyngag and only slightly above the negative control (about factor 2.5 for pc-CMV-UTR-TDwtgag-RRE and 1.5 for pc-LTR-TDsyngag, Fig. 2B). The gene product of pc-LTR-UTR-TDwtgag-RRE could not be detected by these methods. The deletion in the gag leads to a reduced recognition by the monoclonal antibody and, in conjunction with a strongly restricted expression, the achieved TDgag amounts are insufficient for detection by antibodies. Therefore, the Tat and Rev dependence in a reference construct (complete wtgag sequence) was investigated. This construct (pc-LTR-UTR-wtgag-RRE) was dependent on both Tat and Rev. Tat alone led to an increase in expression by a factor of 4, Rev alone by a factor of 16 and the combination of Tat and Rev by a factor of 47 (Fig. 3).

Example 3

The TDgag constructs have a trans-dominant negative effect on HIV particle release

H1299 cells were transiently transfected with combinations of plasmids as described in Example 1. For transfection, 15 μg HX10 proviral DNA and 30 μg each of the TDgag constructs or 30 μg pcDNA3.1 were used as control for uninhibited replication. After 48 h, the cell culture supernatants were harvested, cell components were sedimented by centrifugation (10 min at 10,000 xg) and the supernatants were incubated with 10% of a Triton x 100 solution (5%) for lysis of the HIV particles in the supernatant at RT for 15 min. The treated supernatants were used in appropriate dilutions in a p24 ELISA test (NEN) and the amount of p24 quantified. The reduction of the p24 amount correlates directly with an inhibition of particle release after transfection with an HIV-provirus. The determined p24 levels were set in relation to the control (cotransfection with pcDNA3.1, uninhibited) and percent inhibition calculated. For each combination at least 6 independent approaches were tested.

As can be seen in Figure 4A, all the TDgag constructs tested resulted in a significant inhibition of particle release. The TDsyngag (TDsg) constructs had a very high inhibition, independent of the upstream promoter. In contrast, the inhibitory effect of the TDwtgag (TDwtg) constructs was dependent on the promoter region. The inhibition of particle release was significantly higher under a CMV promoter control than under the HIV LTR promoter.

Example 4

The TDgag constructs have a trans-dominant negative effect on HIV infectivity H 1299 cells were transfected with plasmid combinations as described under Example 3, and the supernatants were harvested after 48 h and purified. To check the influence of the TDgag constructs on the release of infectious progeny viruses, the conditioned cell culture supernatants were checked in a corresponding indicator cell line (MAGI) (Kimpton et al., 1992).

The eukaryotic MAGI (multinuclear activation of a galactosidase indicator) cells is an indicator cell line that has a

Contains reporter gene cassette which can be induced by HIV infection. The MAGI cells were provided by the UK Medical Research Council (MRC). In this cassette the viral LTR (long terminal repeat) promoter precedes the E. coli β-galactosidase gene (lacZ). The expression of the lacZ is therefore dependent on the transcriptional activity of the LTR

Promoter dependent on the viral act.

For the infection, 3 × 10 ⁴ cells per 300 μl of medium (in 48-well plates) were seeded the day before. After harvesting the transfected H1299 cell supernatants, the Magi cells were infected with 100 μl of supernatant per batch and cultured for 48 h.

To evaluate the infectivity, the medium was aspirated and the wells were washed with PBS. The monolayers were fixed with 200 .mu.l fixing solution (1% formaldehyde, 0.2% glutaraldehyde in PBS) and washed again with PBS after incubation for 5 min at room temperature. Subsequently, 200 μl of staining solution (16 mg of X-GaI in 4 ml of DMSO, ad 40 ml of PBS, addition of 400 μl of K-ferricyanide (400 mM), 400 μl of K-ferrocyamide (400 mM) and 80 μl of MgCl ₂ (1 M )) on the cells. The incubation was carried out at 37 ^° C. for between 15 minutes and 3 hours. The blue cells were counted by light microscopy.

The inhibition was determined as reduction of blue cells and in relation to the number of blue cells in the positive control indicated as percent inhibition of infectivity. In essence, the results correlate with the particle release inhibition data (Figure 4B). Nearly complete inhibition was demonstrated for the pc-CMV-TDsyngag, pc-LTR-TDsyngag, and pc-CMV-UTR-TDwtgag-RRE constructs, while the pc-LTR-UTR-TDwtgag-RRE construct caused approximately 50% inhibition (FIG. Shown are the results of an exemplary experiment from two independent approaches, Figure 4B).

Example 5

Transdominant negative effect of Tat-dependent TDgag derivatives with a further deletion in p24

Starting from the constructs pc-CMV-TDsyngag, pc-LTR-TDsyngag, pc-CMV-UTR-TDwtgag-RRE and pc-LTR-UTR-TDwtgag-RRE was established by the

Use of the oligonucleotides Del3 and Del4 (syngag) and Del5 and Del6

(wtgag) introduced another deletion into the gag reading frame. These

Deletion concerns amino acids 230 to 300, an area in which very many

CTL epitopes were identified. The expression of the corresponding TDN Gag derivative after transfection of H 1299 cells with the newly formed constructs pc-CMV-TDsyngagd2, pc-LTR-TDsyngagd2, pc-

CMV-UTR-TDwtgagd2-RRE and pc-LTR-UTR-TDwtgagd2-RRE

(schematic overview see Fig. 1) could not be detected because the modifications affect the affinity of the available gag-specific antibodies and were detected in Western blot or p24 ELISA specific signals.

As described under 3., H1299 cells were transfected to check the TDN effect with combinations of HX10 (15 ug) and TDsyngagd2 or pcDNA3.1 (each 30 ug plasmid DNA) and the supernatants, as described under 3., in p24 -ELISA and, as described under 4., evaluated by means of the MAGI cells. Inhibition of particle release (results of the p24 ELISA evaluation, Fig. 5A, at least 6 independent approaches) and the infectivity of progeny viruses (results of the MAGI evaluation, Fig. 5B, two independent approaches) was demonstrated for all constructs used. The order of inhibitory effects (particulate release) here is pc-CMV-TDsyngagd2 (98.45%)> pc-LTR-TDsyngagd2 (97.49%)> pc-CMV-UTR-TDwtgagd2-RRE (80.99%)> pc -LTR-UTR-TDwtgagd2-RRE (73.69%) and thus essentially corresponds to the results of the TDgag experiments. Again, the synthetic reading frames obviously show superiority in inhibition in particle release. In contrast, the reduction of infectious progeny viruses was comparable in this experimental approach (Figure 5B). In a direct comparison of the Rev dependence with the Tat dependence, there are clear advantages for the synthetic LTR combination LTR.

Table 1: Oligonucleotides used

^' Designation Sequence 5' - 3 'SEQ ID NO

Dell TAAAGCTTCCTTGGTGTC 5

Del2 TTCAGCCCAGAAGTAATACC 6

Del3 TACAAGACCCTGCGCGCCGAGCAGGCC 7

Del4 CTCCCTCATCTGGCCGGGGGCGATGGG 8

Del5 TTCTCTCATCTGGCCTGGTGCAATAGG 9

De! 6 TATAAAACTCTAAGAGCCGAGCAAGCT 10

Gag-slop1 GGAAGGCCAGATCTTCCCTCATTAATTAGCCTGTCTCTCAGTAC 11

Gag-stop2 GTACTGAGAGACAGGCTAATTAATGAGGGAAGATCTGCCTTCC 12

Itr1 ATTGTCGACACGCGTTGGAAGGGCTAATTCACTCC 13

Itr2 ATTGAATTCCTCTCTCCTTCTAGCCTC. 14

Itr3 GCTTGCCCATACTATATG 15 literature

Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (1994). Percentage of Codon Synonomous Usage and Frequency of Codon Occurrence in Various Organisms, Current Protocols in Molecular Biology 2, A1.8-A1.9

Bunnell, B.A. and Morgan, R.A. (1998) Gene Therapy for Infectious Diseases, Clin. Microbiol.Rev. 11, 42-56

Cara, A., Rybak, S.M., Newton, D.L., Crowley, R., Rottschafer, S.E., Reitz, M.S., Jr. and Gusella, G.L. (1998) Inhibition of HIV-1 replication by combined expression of gag dominant negative mutant and a human ribonuclease in a tightly controlled HIV-1 inducible vector, Gene Ther. 5, 65-75

Caruso, M. and Klatzmann, D. (1992) Selective killing of CD4 + cells harboring a human immunodeficiency virus-inducible suicide gene viral spread in an infected cell population, Proc. Natl. Acad. Be. USA 89, 182-186

Chang, D.D. and Sharp, P.A. (1989) Regulation by HIV Rev., pp. 59, 789-795

Chen, C.Y., Xu, N. and Shyu, A.B. (1995) mRNA decay mediated by two distinctions AU-rich elements from c-fos and granulocyte-macrophage colony-stimulating factor transcripts: different deadenylation kinetics and uncoupling from translation, Mol. Cell Biol. 15, 5777-5788

Chiu, HC, Wang, FD, Yao, SY and Wang, CT. (2002) Effects of gag mutations on human immunodeficiency virus type 1 particle assembly, processing, and cyclophilin A incorporation, J. Med. Viral. 68, 156-163 Cochrane, AW, Jones, KS, Beidas, S., Dillon, PJ, Skalka, AM and Rosen, CA. Human immunodeficiency virus structural gene expression, J. Viral (1991). 65, 5305-5313

Ding, SF, Lombardi, R., Nazari, R. and Joshi, S. (2002) A combination anti-HIV gene therapy approach using a single transcription unit that expresses antisense, decoy, and sense RNAs, and trans-dominant negative mutant gag and env proteins, front biosci. 7, a15-a28

Facke, M., Janetzko, A., Shoeman, R.L. and Krausslich, H.G. (1993) A large deletion in the matrix domain of the human immunodeficiency virus gag gene redirect virus particle assembly from the plasma membrane to the endoplasmic reticulum, J. Viral. 67, 4972-4980

Furuta, RA, Shimano, R., Ogasawara, T., Inubushi, R., Amano, K., Akari, H., Hatanaka, M., Kawamura, M. and Adachi, A. (1997) HIV-1 capsid mutants inhibit the replication of wild-type virus at both early and late infection phases, FEBS Lett. 415, 231-234

Gallina, A., Mantoan, G., Rindi, G. and Milanesi, G. (1994) Influence of MA intemal sequences, but not the myristylated N-terminus sequence, on the budding site of HIV-1 Gag protein, Biochem , Biophys. Res. Commun. 204, 1031-1038

Graf, M., Bojak, A., Demi, L., Bieler, K., Wolf, H. and Wagner, R. (2000). Concerted action of multiple cis -acting sequences is required for the development of human immunodeficiency virus type 1 gene expression [In Process Citation], J. Viral. 74, 10822-10826

Graham, FL and van der Eb ₁ AJ. (1973) Transformation of rat cells by DNA of human adenovirus 5, Virology 54, 536-539 Harrison, GS, Long, CJ, Maxwell, F., Glode, LM. and Maxwell, LH. (1992) Inhibition of HIV production in cells containing an integrated, HIV-regulated diphtheria toxin A chain gene,. AIDS Res. Hum. Retroviruses 8, 39-45

Kimpton, J. and Emerman, M. (1992) J. Viral. Detection of replication-competent and pseudotyped human immunodeficiency virus with a sensitive cell line based on the activation of an integrated beta-galactosidase gene. 66, 2232-2239

Kjems, J., Brown, M., Chang, D.D. and Sharp, P.A. (1991) Structural analysis of the interaction between the human immunodeficiency virus Rev protein and the Rev response element, Proc. Natl. Acad. Be. USA 88, 683-687

Kjems, J. and Sharp, P.A. (1993) The basic domain of human immunodeficiency virus type 1 specifically blocks the entry of U4 / U6.U5 small nuclear ribonucleoprotein into spliceosome assembly, J. Viral. 67, 4769-4776

Kotsopoulou E., Kim VN, Kingsman AJ, Kingsman SM, Mitrophanous KA (2000) A Rev-Independent Human Immunodeficiency Virus Type (1) (HIV-i) -based Vector That Exploits a Condon-Optimized HIV-1 gag-pol Gene , J. Viral. 74, No. 10, 4839-4852

Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4, .Nature 227, 680-685

Liu, J., Woffendin, C, Yang, Z.Y. and navel, GJ. (1994) Regulated expression of a dominant negative form of HIV resistance replication resistance in T cells, Gene Ther 1, 32-37

Lu, XB, Heimer, J., Rekosh, D. and Hammarskjold, ML (1990) U1 small nuclear RNA plays a direct role in the formation of a rev- regulated human immunodeficiency virus env mRNA that remains unspliced, Proc. Natl. Acad. Be. USA 87, 7598-7602

Maldarelli, F., Martin, M.A. and Strebel, K. (1991) Identification of posttranscriptionally active inhibitory sequences in human immunodeficiency virus type 1 RNA: novel level of gene regulation, J. Virol. 65, 5732-5743

Marcello, A. and Giaretta, I. (1998) Inducible expression of herpes simplex virus thymidine kinase from a bicistronic HIV1 vector, Res. Virol. 149, 419-431

Mautino, M.R. and Morgan, R.A. (2002) Gene therapy of HIV-1 infection using lentiviral vectors expressing anti-HIV-1 genes, AIDS Patient.Care STDS. 16, 11-26

Mikaelian, L, War, M., Gait, MJ. and Kam, J. (1996) Interactions of INS (CRS) elements and the splicing machinery regulate the production of Rev- answering mRNAs, J. Mol. Biol. 257, 246-264

Miyake, K., lijima, O., Suzuki, N., Matsukura, M. and Shimada, T. (2001) Selective killing of human immunodeficiency virus-infected cells by targeted gene transfer and inducible gene expression using a recombinant human immunodeficiency virus vector, Hum. Gene Ther. 12, 227-233

Muratori, C, Schiavoni, I., Melucci-Vigo, G., Olivetta, E., Santarcangelo, A.C., Pugliese, K., Verani, P. and Federico, M. (2002) Inducible expression of the deltaNGFr / F12Nef fusion protein as a new tool for anti-human immunodeficiency virus type 1 gene therapy, Hum. Gene Ther. 13, 1751-1766

Nasioulas, G., Zolotukhin, AS, Tabernero, C, Solomin, L., Cunningham, CP, Pavlakis, GN and Felber, BK (1994) Elements distinet from human Immunodeficiency virus type 1 splice Sites are responsible for the viral dependency of mRNA, J. Virol. 68, 2986-2993

O ¹ ReNIy, MM, McNaIIy, MT. and Beemon, KL (1995) Two strong 5 'splice sites and competing, suboptimal 3' splice sites involved in alternative splicing of human immunodeficiency virus type 1 RNA, Virology 213, 373-385

Olsen, H.S., Cochrane, A.W. and Rosen, C. (1992) Interaction of cellular factors with intragenic cis-acting repressive sequences in the HIV genome, Virology 191, 709-715

Ono, A. and Freed, E.O. (2004) Cell-type-dependent targeting of human immunodeficiency virus type 1 assembly to the plasma membrane and the multivesicular body, J. Virol. 78, 1552-1563

Pollard, V.W. and Malim, M.H. (1998) The HIV-1 Rev protein [In Process Citation], Annu. Rev. Microbiol. 52: 491-532, 491-532

Powell, D.M., Amaral, M.C., Wu, J.Y., Maniatis, T. and Greene, W.C. (Rev. 1997) HIV Rev-dependent binding of SF2 / ASF to the Rev Response Element: Possible Role in Rev-mediated Inhibition of HIV RNA splicing, Proc. Natl. Acad. Be. USA 94, 973-978

Ragheb, J.A., Couture, L., Müllen, C, Ridgway, A. and Morgan, R.A. (1999) Inhibition of human immunodeficiency virus type 1 by Tat / Rev-regulated expression of cytosine deaminase, interferon alpha2, or diphtheria toxin compared with inhibition by transdominant Rev, Hum. Gene Ther. 10, 103-112

Ratner, L., Fisher, A., Jagodzinski, LL, Mitsuya, H., Liou, RS, Gallo, RC and Wong Staal, F. (1987) Complete nucleotide sequences of functional clones of the AIDS virus, AIDS Res. Hum , Retroviruses 3, 57-69 Rosen, CA ₁ Terwilliger, E., Dayton, A., Sodroski, JG and Haseltine, WA (1988) irritagenic cis-acting gene gene-responsive sequences of the human immunodeficiency virus, Proc. Natl. Acad. Be. USA 85, 2071-2075

Schneider, R., Campbell, M., Nasioulas, G., Felber, B.K. and Pavlakis, G.N. (1997) Inactivation of the human immunodeficiency virus type 1 inhibitory elements allows Rev-independent expression of Gag and Gag / protease and particle formation, J. Virol. 71, 4892-4903

Schwartz, S., Campbell, M., Nasioulas, G., Harrison, J., Felber, B.K. and Pavlakis, G.N. (1992a) Mutational inactivation of an inhibitory sequence in human immunodeficiency virus type 1 results in Rev-independent gag expression, J. Viral. 66, 7176-7182

Schwartz, S., Felber, B.K. and Pavlakis, G.N. (1992b) Distinct RNA sequences in the gag region of human immunodeficiency virus type 1 decrease RNA stability and inhibition expression in the absence of Rev protein, J. Virol. 66, 150-159

Smythe, JA, Sun, D., Thomson, M., Markham, P.D., Reitz, M.S., Jr., Gallo, R.C. and Lisziewicz, J. (1994) A Rev-inducible mutant gag geneably transferred into T lymphocytes: an approach to gene therapy against human immunodeficiency virus type 1 infection, Proc. Natl. Acad. Be. USA 91, 3657-3661

Trono, D., Feinberg, M.B. and Baltimore, D. (1989) HIV-1 gag mutants can dominantly interfere with the replication of the wild-type virus, Cell 59, 113-120

von Poblotzki, A., Wagner, R., Low, M., Wanner, G., Wolf, H. and Modrow, S. (1993) Identification of a region in the Pr55gag-polyprotein essential for HIV-1 particle formation, Virology 193, 981-985 Wagner, R., Graf, M., Bieler, K., Wolf, H., Grunwald, T., Foley, P. and Uberla, K. (2000) Rev-independent expression of synthetic gag-pol genes of human immunodeficiency virus type 1 and simian immunodeficiency virus: implications for the safety of lentiviral vectors [in process citation], Hum Gene Ther 11, 2403-2413

WiIk ₁ T., Gross, I., Gowen, BE, Rutten, T., de Haas, F., Welker, R., Krausslich, HG, Boulanger, P. and Füller, SD (2001) Organization of immature human immunodeficiency virus type 1, J. Virol. 75, 759-771

Wolf, H., Modrow, S., Soutschek, E., Motz, M., Grunow, R. and Döbl, H. (1990). Production, mapping and biological characterization of monoclonal antibodies to the core protein (p24) of the human immunodeficiency virus type 1, AIFO 1, 24-29

Zolotukhin, S., Potter, M., Hauswirth, W.W., Guy, J. and Muzyczka, N. (1996) A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells, J. Virol. 70, 4646-4654

Claims

claims

A method for improved inducible gene expression comprising (i) providing a target nucleic acid sequence to be expressed, (ii) modifying the target nucleic acid sequence to be expressed so as to increase expression, (iii) operably linking the modified target nucleic acid sequence to an inducible transcriptional control sequence,

(iv) expressing the modified target nucleic acid sequence in a suitable expression system by a transactive factor.

2. The method of claim 1, wherein for the inducible transcription control sequence an inducible natural viral

Promoter or an inducible artificial promoter is used.

3. The method according to claim 1 or 2, wherein the inducible transcription control sequence is selected from viral transcription control sequences, in particular from the following

Viruses: retroviruses, HCV, HBV, HSV, EBV, SV40, AAV ₁ adenovirus, papillomavirus, Ebola virus.

4. The method according to any one of the preceding claims, wherein an inducible transcription control sequence is used, which is inducible by a retroviral Tat or Tax protein as a transactive factor.

5. The method according to any one of the preceding claims, wherein the codon use of the target nucleic acid sequence to be expressed on the

Expression system is adjusted.

The method of claim 5, wherein the codon usage is adapted to that of mammals.

The method of claim 6, wherein the codon usage is adapted to that of humans.

8. The method according to any one of the preceding claims, wherein the GC content of the target nucleic acid sequence to be expressed is adapted to that of the expression system.

The method of claim 8, wherein the GC content of the target nucleic acid sequence to be expressed is optimized for that of mammals.

10. The method according to any one of the preceding claims, wherein in the target nucleic acid sequence to be expressed negative transcription-influencing motifs are eliminated.

11. The method according to any one of the preceding claims, wherein the modification of the target nucleic acid sequence to be expressed in

Essentially without changing the corresponding amino acid sequence is performed.

12. The method according to any one of the preceding claims, wherein a target nucleic acid sequence to be expressed is used which codes for a therapeutic and / or diagnostic protein.

13. The method of claim 12, wherein the therapeutic and / or diagnostic protein is selected from toxic gene products, suicide factors, apoptosis-inducing proteins, messengers, transactivators, regulatory proteins, transdominant negative proteins, cytokines, chemokines, interleukins, interferon α, RANTES, MIP1α, TNF, thymidine kinases, nucleases, FAS, FAS ligand, Caspases and transcription factors.

14. The method according to any one of the preceding claims, wherein a target nucleic acid sequence to be expressed is used which codes for a viral transdominant-negative (TDN) protein.

15. The method of claim 14, wherein a target nucleic acid sequence to be expressed is used which codes for a retroviral TDN protein.

16. The method of claim 15, wherein a target nucleic acid sequence to be expressed is used which is representative of a TDN lentivirus protein selected from the group consisting of Gag, Env, Tat, Rev, Nef, Vpr, Vpv, reverse transcriptase, protease and integrase, coded.

17. The method according to any one of the preceding claims for the expression of transdominant-negative (TDN) lentivirus proteins in eukaryotic cells, comprising:

(a) introducing a vector comprising a target nucleic acid sequence to be expressed which encodes a TDN lentivirus protein and whose codon usage is adapted to that of mammals, and a lentivirus Tat protein inducible promoter sequence operably linked to the target nucleic acid sequence eukaryotic cell, (b) providing the Tat protein, allowing expression of the

Target nucleic acid sequence is induced.

18. Nucleic acid vector comprising:

(a) a target nucleic acid sequence to be expressed, (b) a trans-factor inducible

A transcriptional control sequence operably linked to the target nucleic acid sequence to be expressed, wherein the sequence of (a) is modified at the nucleic acid level is that an increase in expression is achieved.

19. The vector of claim 18, wherein the sequence according to (a) is modified so that the corresponding amino acid sequence is not changed.

The vector of claim 18 or 19, wherein the codon usage of the sequence according to (a) is adapted to that of mammals.

The vector of any one of claims 18 to 20, wherein the sequence of (a) is modified such that the GC content is optimized for that of mammals.

22. The vector of claim 21, wherein the sequence according to (a) is modified such that the GC content is optimized for that of humans.

23. A vector according to any one of claims 18 to 22, wherein the sequence according to (a) for a therapeutic protein and / or diagnostic protein and / or trans-dominant negative (TDN) virus protein, in particular a TDN lentivirus protein encoded.

24. The vector of claim 23, wherein the diagnostic and / or therapeutic protein is selected from toxic gene products, suicide factors, apoptosis-inducing proteins, messengers, transactivators, regulatory proteins, transdominant negative proteins, cytokines, chemokines, interleukins, interferon α,

RANTES, MIP1α, TNF, thymidine kinases, nucleases, FAS, FAS ligand, caspases and transcription factors.

25. The vector of claim 23, wherein the TDN virus protein is selected from the group consisting of Gag, Env, Tat, Rev, Nef, Vpv, Vpu,

Reverse transcriptase, protease and integrase.

The vector of claim 25, wherein the TDN lentivirus protein is the Gag protein.

27. A vector according to claim 25 or 26, wherein the TDN lentivirus protein is a Gag protein with deletions in the p24 region.

28. The vector according to any one of the preceding claims 18 to 27, wherein the sequence according to (a) comprises the sequence of SEQ ID NO: 1, 16 and 18.

29. A vector according to any one of the preceding claims 18 to 28, wherein the promoter sequence is a lentiviral LTR sequence or a functional subsequence thereof.

A modified lentivirus comprising a modified genome containing one or more silent mutations in protein coding regions that adapt the codon usage to that of mammals.

31. A cell containing a vector or a modified lentivirus according to any one of claims 18 to 30.

32. A pharmaceutical composition comprising as active ingredient a vector, a modified lentivirus or a cell according to any one of claims 18 to 31.

33. Use of a vector and / or a modified lentivirus and / or a cell according to one of claims 18 to 31 for

Preparation of a medicament for gene therapy and / or diagnostics.

34. Use according to claim 33 for gene therapy and / or diagnosis in retroviral infections.

35. Use according to claim 33 for the treatment and / or diagnosis of antiviral infections.

36. Use according to claim 33 for the treatment and / or diagnosis of HIV infection.

37. Use according to claim 33 for the ex vivo transduction of PMLs from persons infected with HIV.