EP1737478A2 - Compositions and methods for controlling insects related to the octopamine receptor - Google Patents
Compositions and methods for controlling insects related to the octopamine receptorInfo
- Publication number
- EP1737478A2 EP1737478A2 EP05728601A EP05728601A EP1737478A2 EP 1737478 A2 EP1737478 A2 EP 1737478A2 EP 05728601 A EP05728601 A EP 05728601A EP 05728601 A EP05728601 A EP 05728601A EP 1737478 A2 EP1737478 A2 EP 1737478A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- cells
- compounds
- compositions
- octopamine
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
- C07K14/43577—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from flies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
- C07K14/43577—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from flies
- C07K14/43581—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from flies from Drosophila
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5082—Supracellular entities, e.g. tissue, organisms
- G01N33/5085—Supracellular entities, e.g. tissue, organisms of invertebrates
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5082—Supracellular entities, e.g. tissue, organisms
- G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/94—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving narcotics or drugs or pharmaceuticals, neurotransmitters or associated receptors
- G01N33/9406—Neurotransmitters
- G01N33/9413—Dopamine
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
Definitions
- the present invention relates to compounds, compositions and method for controlling insects.
- OA Octopamine
- GPCRs G-protein coupled receptors
- a GPCR When a GPCR is activated, depending on its type and the protein to which it binds, changes in intracellular concentrations of cAMP, Ca 2+ or both often take place. Since changes in intracellular levels of cAMP or Ca 2+ are the most commonly found cellular responses to biogenic amine treatments (e.g., serotonin, dopamine, octopamine, etc.), they are used to functionally classify receptor subtypes. As a result of GPCR activation, intracellular cAMP levels can either be elevated or reduced. The cellular response strictly relies on the specificity of interactioxi between the receptor and the G protein (See e.g.. Gudermann T, Kalkbrenner F, Schultz G- .
- G protein inhibitory G protein
- Interaction of AC with activated G ⁇ i subunits most likely competes with binding of activated Gas subunits and thtereby interferes with AC activation.
- Another pathway that is activated by several biogenic amine receptors results in a rise of intracellular Ca 2+ levels.
- the amine-activated receptor binds to G protei ⁇ s of the Gq/o family (See e.g., supra, Gudermann et al., 1996 and Gudermann et al., 1997).
- Tlx e activated G ⁇ q/o subunits bind to and stimulate phospholipase C (PLC) activity.
- PLC phospholipase C
- the enzyme hydrolyzes a membrane-bound substrate, phosphatidylinositol 4,5-bisphosphate which gives rise to two second messengers IP3 and DAG. After binding of IP3 to its receptors, the calcium channel pore is opened and Ca 2+ is released into the cytoplasm.
- Ca 2+ ions play a vital role in the regulation of many cellular functions by binding to members of large family of Ca 2+ -bindix g proteins and/or directly controlling enzymatic or ion channel activities. Multiple insect species have been utilized to understand the biological functions arid pharmacological characteristics of octopamine receptors .
- octopamine has been found to activate adenylate cyclase in certain cells in this species. Furthermore, octopamine has been found to increase inositol triphosphates in certain cells in this species.
- Formamidine-like chemicals have been found to be octopaminergic agonists and inhibit the uptake of sodium-sensitive octopamine in certain insects; for example, the formamidine pesticides chlordimeform and demethylchloridimeform were found to target the octopamine signaling pathway in certain invertebrates, including Periplaneta americana .
- Identifying plant essential oils and combinations thereof, having insect-controlling activity is particularly desirable given that many such compounds do not produce unwanted or harmful affects on humans, other animal species, and certain plants.
- identifying the most effective plant essential oils and combinations thereof requires random selection and use of tedious screening methods, which, given the vast number of plant essential oils and possible combinations thereof, is a substantially impossible task.
- the present invention addresses the above identified problems, and others, by providing a screening method for identifying compounds and compositions that are effective insect control agents; a screening method for identifying compounds and compositions that are effective species-specific insect control agents; compounds and compositions isolated from the screening methods; cell lines expressing an octopamine receptor; and isolated nucleic acid molecule sequences.
- Figure 1A is an alignment of the nucleic acid sequence and the translated amino acid sequence from Pa oa,, of SEQ ID NO: 1 and SEQ ID NO: 2;
- Figure IB is the nucleic acid sequence from Pa oai of SEQ ID NO: 1, with the seven putative transmembrane domains (TM) overlined and numbered 1 through 7, the stop codons (SC) underlined, and the initiation codon (M) underlined;
- Figure 2 is an alignment of the translated amino acid sequences of Pa oaj of SEQ ID NO: 2 and OAMB of SEQ ID NO: 3, with the seven putative transmembrane domains (TM) overlined and numbered 1 through 7;
- Figure 3A is saturation binding curve of J H-yohimbine to Pa oaj, where total binding is designated by the squares, nonspecific binding is designated by the triangle, and specific binding is designated by the inverted triangle;
- Figure 3B is saturation binding curve of 3 H-yohimbine to OA
- the present invention includes: a screening method for identifying compounds and compositions that are effective insect control agents; a screening method for identifying compounds and compositions that are effective species-specific insect control agents; compounds and compositions isolated from the screening methods; transfected cell lines; and isolated nucleic acid molecule sequences.
- the present invention includes: an isolated nucleic acid molecule sequence which encodes a protein that binds a biogenic amine, resulting in changes in intracellular concentrations of cAMP, Ca 2+ , or both, having a nucleotide sequence of SEQ ID NO: 1, or a fragment or derivative thereof and/or having an amino acid sequence of SEQ ID NO: 2, or a fragment or derivative thereof; an isolated nucleic acid molecule of having at least about 30% similarity to the nucleotide sequence of SEQ ID NO: 1 , wherein the isolated nucleic acid molecule encodes a protein, resulting in changes in intracellular concentrations of cAMP, Ca 2+ , or both; an isolated nucleic acid molecule of having at least about 30% similarity to the nucleotide sequence of SEQ ID NO: 1, wherein the molecule encodes an octopamine receptor or a protein having an amino acid sequence of SEQ ID NO: 2, or a fragment or derivative thereof; and an isolated nucleic acid molecule having a nucleo
- SEQ ID NO: 1 and SEQ ID NO: 2 are shown in alignment in Figure 1A and SEQ ID NO: 1 is also provided in Figure 1 B.
- Fragments and derivatives of the sequences shall include transmembrane domains (TM) 3, 5 and 6. Fragments and derivatives of the sequences may exclude, for example, portions upstream of TM 1, portions upstream of TM 2, or portions downstream of TM 7.
- the present invention also includes: a strain of cells including a DNA vector having a nucleic acid sequence of SEQ ID NO:l; a strain of cells expressing an octopamine receptor cloned from an insect species of interest; a strain of cells expressing an octopamine receptor cloned from Periplaneta Americana (Pa oai); a strain of cells expressing a protein having an amino acid sequence of SEQ ID NO: 2, or fragments or derivatives thereof, wherein the fragments or derivatives thereof bind octopamine; a strain of cells expressing an octopamine receptor cloned from Drosophila melanogaster (OAMB); a strain of cells expressing a protein having an amino acid sequence of SEQ ID NO: 3, or fragments or derivatives thereof, wherein the fragments or derivatives thereof bind octopamine.
- a strain of cells including a DNA vector having a nucleic acid sequence of SEQ ID NO:l; a strain of cells
- the transfected cells may be mammalian cells or insect cells; for example, they may be African green monkey kidney COS-7 cells (COS-7 cells) or human embryonic kidney-293 cells (HEK-293 cells).
- the present invention also includes a screening method of using a cell line expressing an octopamine receptor to identify compounds and compositions that are effective insect control agents.
- the octopamine receptor expressed by the cell line may be Pa oai ; or have an amino acid sequence of SEQ ID NO: 2, or fragments or derivatives thereof, wherein the fragments or derivatives thereof bind octopamine.
- the present invention also includes a method of using multiple cell lines, wherein the cell lines are transfected with octopamine receptors from different insect species of interest, to identify compounds and compositions that are effective species-specific insect control agents.
- a cell line expressing Pa oai and a cell line expressing OAMB could be used to screen compounds and compositions having insect control activity which is specific to Periplaneta Americana or to Drosophila melanogaster.
- the present invention also includes compounds and compositions having the ability to control target insects, which compounds and/or compositions are identified using the screening methods of the present invention.
- These compounds and/or compositions may include compounds that are general regarded as safe (GRAS compounds) meaning that they do not produce unwanted or harmful affects on humans and other non-target animal species and that they are exempt from the Environmental Protection Agency's (EPA) pesticide registration requirements.
- the compounds and/or compositions of the present invention include certain plant essential oils identified using the screening methods of the present invention.
- the compounds and compositions of the present invention control insects by targeting an octopamine receptor, resulting in a disruptive change in the intracellular levels of cAMP, Ca 2+ or both.
- insect has been and shall be used through out this application; however, it should be understood that the term insect refers, not only to insects, but also to arachnids, larvae, and like invertebrates.
- insect control shall refer to repelling or killing an insect.
- the present invention is further illustrated by the following specific but non-limiting examples.
- the underlined sequence corresponds to the TM regions .
- the TM VI oligonucleotide contains a HindlH site and the TM VII oligonucleotide contains a Not 1 / site flanking the TM sequences .
- Total R ⁇ A from the heads of mixed sex adult American cockroaches that have the antennae excised is prepared by ultracentrifugation through cesium chloride, as described in Chirgwin et al, 18 Biochemistry 5294-5299 (1979), and is reverse transcribed into cD ⁇ A using random hexamers and murine leukemia virus reverse transcriptase (Applied Biosystems, Foster City, CA) .
- PCR polymerase chain reaction
- AmpliTaq polymerase Applied Biosystems
- TM VI and VII oligonucleotides at final concentrations of about 5 ⁇ M.
- the reaction conditions are about 95 ° C, about 5 min for about one cycle; about 95 ° C, about 45 s, about 40 ° C, about 2 min, about 72 ° C, about 30 s for about three cycles; about 95 ° C, about 45 s, about 55 C, about 2 min; about 72 ° C, about 30 s for about 37 cycles; and about 72 " C, about 10 min for about one cycle .
- Products are digested with Hindlll and Noll and ligated into pBK-RSV (Stratagene, La Jolla, CA) . Inserts are sequenced and compared to known genes by searching the NCBI database with the Blast program.
- RACE 5' and 3' rapid amplification of cDNA ends
- Poly(A) RNA is prepared from total RNA isolated from the head of Periplaneta americana using an oligo-dT column as per the manufacturer's protocol (Amersham Biosciences, Piscataway, NJ) .
- the poly(A) RNA is used as template in the RACE reverse transcription reaction for production of 5' and 3' RACE cDNA as per the manufacturer's instructions .
- the gene specific oligonucleotides used for the RACE PCR are 5' RACE oligonucleotide 5'CAGTAGCCCAGCCAGAAGAGGACGGAGAAG3' (SEQ ID NO: 6), and 3' RACE oligonucleotide 5 'GCTGGCTGCCGTTCTTCACCATGTACCTGG3' (SEQ ID NO: 7) .
- 5' RACE and 3' RACE polymerase chain reactions are each about 50 ⁇ l and consist of about 2.5 ⁇ l of the respective cDNA reaction, about 0.2 ⁇ M of the gene specific oligonucleotide and the additional RACE components including Advantage 2 polymerase as per the manufacturer (Clontech) .
- the cycling conditions for the 5' RACE are about 95 ° C, about 1 min for about one cycle; about 94 C, about 20 s, about 72 C, about 3 min for about five cycles; about 94 C, about 20 s, about 70 ° C, about 10 s, about 72 C, about 3 min for about five cycles; about 94 C, about 20 s, about 68 ° C, about 10 s, about 72 ° C, about 3 min for about 32 cycles; and about 72 ° C, about 10 min for about one cycle .
- An approximately 1.9 kb product is gel purified and further, amplified using the same oligonucleotides, Advantage 2 polymerase and cycling parameters of about 95 ° C, about 3 min for about one cycle; about 94 ° C, about 20 s, about 68 ° C, about 10 s, about 72 ° C, about 3 min for about 35 cycles; and about 72 ° C, about 10 min for about one cycle .
- the product is A-tailed by precipitating with ethanol, resuspending in 1 x PCR Buffer II (Applied Biosystems), 2 mM MgCl 2 , 1 inM dATP and 0.05 U AmpliTaq per ⁇ l and incubating at about 72 ° C for about 15 min .
- the PCR product is ligated into pBK-RSV (Stratagene) that has been digested with Smal and T-tailed using dTTP and AmpliTaq .
- the insert is sequenced on both strands by automated fluorescent DNA sequencing (Vanderbilt Cancer Center).
- the cycling conditions for the 3' RACE reaction are about 95 C, about 1 min for about one cycle; about 94 ° C, about 5 s, about 72 C, about 3 min for about five cycles; about 94 ° C, about 5 s, about 70 C, about 10 s, about 72 C, about 3 min for about five cycles; about 94 C, about 5 s, about 68 ° C, about 10 s, about 72 C, about 3 min for about 32 cycles; and about 72 ° C, about 10 min for about one cycle
- the product of this reaction is A-tailed, subcloned and sequenced as for the 5' RACE product.
- Oligonucleotides used to amplify the open reading frame are a sense oligonucleotide 5' CAGGAATTCATGAGGGACGGGGTTATGAACGCTAG 3 ' (SEQ ID NO: 8), and an antisense oligonucleotide 5' GCTTCTAGATCACCTGGAGTCCGATCCATCGTTG 3' (SEQ ID NO: 9) Sequences corresponding to the open reading frame are underlined.
- the sense oligonucleotide contains an EcoRI restriction site and the antisense oligonucleotide an Xbal restriction site These oligonucleotides are used in a polymerase chain reaction that included the 5 'RACE cD A as template and VENT polymerase (New England Biolabs, Beverly, MA).
- pAc-Pa oai For mammalian cell expression, a Kozak sequence is inserted using a sense oligonucleotide 5'ACAGAATTCGCCACCATGAGGGACGGGGTTATGAACGCTAG 3' (SEQ ID NO: 10) and an internal antisense oligonucleotide that contains an Xlwl 5" TTGACGGCGCTCGAGGACGTC 3' (SEQ ID NO: 11) The sense oligonucleotide contains an EcoRI site These oligonucleotides are used in a polymerase chain reaction that includes pAc-Pa oai as template and VENT polymerase The product is inserted at EcoRI and Xltol sites into pAc- Pa o
- Oligonucleotides designed to amplify the open reading frame of Drosophila melanogaster OAMB consist of the sense oligonucleotide 5' CAGGAATTCGCCACCATGAATGAAACAGAGTGCGAGGATCTC 3' (SEQ ID NO: 12) and the antisense oligonucleotide 5' AATGCGGCCGCTCAGCTGAAGTCCACGCCCTCG 3' (SEQ ID NO: 13) Sequences corresponding to the open reading frame are underlined A Kozak sequence is included in the sense oligonucleotide In addition, the 5' oligonucleotide includes an EcoRI restriction site and the 3" oligonucleotide a Notl site For a
- Cycling conditions are about 95 C, about 5 min for about one cycle; about 95 ° C, about 30 s and about 70 ° C, about 1.5 min for about 40 cycles; and about 70 ° C, about 10 min for about one cycle .
- the product is digested with EcoRI and Notl, ligated into pCDNA3 and sequenced on both strands by automated fluorescent DNA sequencing (Vanderbilt Cancer Center).
- a polymerase chain reaction with degenerate oligonucleotides corresponding to regions of TM VI and TM VII of previously identified octopamine receptors is used to isolate an approximately 101 nucleotide fragment of cDTMA from the head of Periplaneta americana .
- This cDNA fragment is used to design gene specific oligonucleotides to amplify the full-length cDNA of the corresponding gene by RACE. This method generates overlapping 5' and 3 1 segments that include the original cDNA fragment from TM VI to TM VII indicating these segments originate from the same cDNA .
- the cDNA includes an approximately 1887 nucleotide open reading frame and 5' and 3' untranslated regions (Genbank accession number is AY333178) .
- the predicted initiation codon is preceded by an in-frame stop codon, indicating that the 5' end of the open reading frame is included in the cDNA and that the encoded protein will be full length .
- This cDNA and encoded protein are designated Pa oai.
- the open reading frame encodes a protein of approximately 628 amino acids with a predicted molecular mass of about 68,642 Da . Hydropathy analysis by the method described in Kyte et al, J. Mol. Biol.
- Pa oai is most closely related to OAMB, an octopamine receptor from the fruit fly Drosophila melanogaster and to Lym- oai , an octopamine receptor from the pond snail Lymnaea stagnalis). Sequence similarity is also detected with vertebrate ⁇ lA adrenergic receptors and invertebrate tyramine receptors . Protein alignment indicates Pa oai is about 51% identical to OAMB, 37% identical to Lym oai, and about 27% identical to both the insect tyramine receptors Tyr-Loc from Locusta migratoria and Tyr-Dro from Drosophila melanogaster .
- CELL CULTUREAND TRANSFECTION OF CELLS Cell culture reagents may be obtained from Sigma-Aldrich (St . Louis, MO), or as otherwise indicated, African green monkey kidney COS-7 cells and human embryonic kidney (HEK)-293 cells are obtained from American Type Culture Collection (Manassas, VA) .
- COS-7 cells are grown in Dulbecco's modified Eagle's medium (about 4.5 g glucose/1) and about 10% fetal bovine serum.
- HEK-293 cells are grown in Dulbecco's modified Eagle's medium (about lg glucose/1), about 5% fetal bovine serum and about 5% newborn calf serum Both types of media are supplemented with about 100 U penicillin G/ml, about 100 ⁇ g streptomycin/ml and about 0.25 ⁇ g amphotericin B/ml) except during Lipofectamine 2000 transfections.
- Lipofectamine 2000 and Opti-MEM I media may be obtained from Invitrogen Life Technologies (Carlsbad, CA).
- COS-7 cells are transiently transfected using Lipofectamine 2000 .
- Cells are plated at about 1.5 x 10 6 cells per dish (about 55 cm 2 ) in about 10 ml growth medium without antibiotics the day before transfection. For each dish, about 30 ⁇ l Lipofectamine 2000 in about 1 ml Opti-MEM I medium is mixed with about 12 ⁇ g plasmid DNA in about 1 ml Opti- MEM I medium and added to the cells after an approximately 20 min incubation at room temperature . The cells are harvested for membrane preparation 24 h following transfection.
- HEK-293 cells For stable transfections of HEK-293 cells, about 1 x 10 6 cells in about 2.5 ml growth media without antibiotics are plated into dishes (about 10 cm") the day before transfection, For transfection, about 10 ⁇ l Lipofectamine 2000 is added to about 250 ⁇ l Opti-MEM I medium . This is mixed with about 4 ⁇ g plasmid DNA in about 250 pi OptiMEM I medium . After an approximately 20 min incubation at room temperature, the approximately 500 ⁇ l of solution is added to cells in a single dish . Cells are split about 24 h after transfection into growth media containing about 0.8 mg G418 sulfate/ml (Mediatech Inc., Heradon, VA) .
- Clonal lines are selected and assayed for receptor expression with whole cell binding by incubating about 500,000 cells in about 1 ml phosphate buffered saline (PBS; 137 mMNaCl, 2.7 mM KC1, 10 mM Na 2 HP0 , 1.4 mM KH 2 P0 4 (pH 7.4)) with about 2 nM 3 H-yohimbine for about 30 min at about 27 ° C . Cells are pelleted by centrifugation, washed with PBS, and then transferred to scintillation vials . Nonspecific binding is determined by including about 50 ⁇ M phentolamine in the binding reaction.
- PBS phosphate buffered saline
- Antagonists and biogenic amines are obtained from Sigma- Aldrich (St Louis, MO).
- Octopamine is the mixed isomeric form DL-octopamine 3 H-yohimbine is obtained from Perkin Elmer Life Sciences (Boston, MA)
- Radioligand binding is performed with about 7.5-15 ⁇ g membrane protein in about 250 ⁇ l binding buffer for about 30 min at about 27 ° C while shaking at about 100 rpm
- Reactions are terminated by addition of about 3 ml ice cold binding buffer and filtered over GF/C filters (Whatman International, Maidstone, England) that have been soaked for about 30 min in about 0.3% polyethylenimine (Sigma-Aldrich) Filters are rinsed again with about 3 ml binding buffer
- a range of 3 H-yohimbine is used from about 0.5 to 50 nM, and about 50 ⁇ M phentolamine is used as a competitor to determine nonspecific binding
- Pa oaj is expressed in COS-7 cells by transient transfection. Membrane fractions are analyzed to determine total, nonspecific and specific binding of H-yohimbine, as shown in Figure 3A. The K d and B max for specific binding are determined to be about 28.4 nM and about 11.8 pmol/mg protein, respectively. Membrane fractions from COS-7 cells transiently transfected with empty pCDNA3 do not demonstrate specific binding. The high affinity binding of 3 H-yohimbine by Pa oai indicate that this is a suitable ligand to be used for competition binding experiments.
- the octopamine receptor OAMB from Drosophila melanogaster is amplified by the polymerase chain reaction. Saturation binding analysis with 3 H-yohimbine is performed with OAMB expressed in COS-7 cells, as shown in Figure 3B. The K d and B max are determined to be about 43.0 nM and about 8.04 pmol/mg, respectively. Competitive binding with various biogenic amines is utilized to determine the affinities for potential natural ligands of Pa oai. Referring now to Table A, below, DL-Octopamine has the lowest Kj (about 13.3 ⁇ M) for Pa oai followed by tyramine (about 31.0 ⁇ M).
- the decreasing order of affinity for the biogenic amines is octopamine > tyramine > dopamine > serotonin.
- the binding affinities for octopamine and tyramine are determined for this receptor.
- the K, (mean ⁇ standard deviation) of octopamine and tyramine for OAMB are about 8.20 ⁇ 2.60 ⁇ M and about 33.8 ⁇ 7.93 ⁇ M, respectively. These values are similar to those obtained for Pa oai.
- the affinity of octopamine is about 2.3-fold higher than tyramine for Pa oai, and for OAMB, the affinity of octopamine is about 4.1 -fold higher than tyramine, indicating that octopamine is the likely endogenous ligand for Pa oai.
- antagonists may be used to analyze the effects of octopamine on adenylate cyclase activity in the brain, ventral nerve cord and hemocytes of Periplaneta americana.
- a pharmacological profile is developed for Pa oai using these , antagonists.
- the profile of the antagonists is chlorpromazine > phentolamine > mianserin > metoclopramide.
- Pa oai The Pa oai cDNA of 2268 bp which includes an 1887 nucleotide open reading frame and 5' and 3' untranslated regions is set forth in Figures 1A, IB and SEQ ID NO: 1. With reference to Figure IB, the predicted initiation codon (M) is preceded by an in-frame stop codon (SC). This indicates that the 5' end of the open reading frame is included in the cDNA and that the encoded protein would be full length.
- TMs transmembrane domains
- Cells are incubated with about 70% ethanol for a-hout 1 h at about -20 ° C
- the cellular debris is centrifuged and then the supernatant is removed and lyophilized to dryness .
- the amount of cAMP in the extract is determined by using a cAMP binding protein from the 5 H-cAMP Biotrak assay system (Amersham Biosciences) as per the manufacturer's instructions.
- the cells are incubated with about 20 ⁇ 1 V 1 BAPTA/AM (Calbiochem Biochemicals, La Jolla, CA) for about 10 min before the addition of the test reagents.
- Octopamine has been demonstrated to increase levels of the second messenger cAMP in brain, thoracic ganglion and hemocytes from Periplaneta americana .
- HEK-293 cells are stably transfected with pCDNA3-Pa oai or pCDNA3 without an insert as a control
- neither DL-octopamine nor tyramine at concentrations up to about 100 ⁇ M has significant effects on cAMP levels .
- a clone transfected with pCDNA3-Pa oai having a high specific binding to 3 H-yohimbine is selected for second messenger analysis. Both octopamine and tyramine are able to increase the levels of cAMP in these cells in a dose dependent manner, as shown in Figure 6 .
- the EC 50 S for the octopamine and tyramine mediated increases in cAMP are about 1.62 and 97.7 ⁇ M, respectively (p ⁇ 0.05) .
- Octopamine is more potent than tyramine in the cAMP response as a statistically significant increase in cAMP over the basal level (about 0.48 pmol cAMP) is first detected with about 10 nM octopamine (about 1.2 pmol cAMP) (p ⁇ 0.05) .
- the cAMP concentration with about 10 nM tyramine is about 0.50 pmol cAMP, and therefore not statistically significant from the basal level (p > 0.05).
- a concentration of about 1 ⁇ M tyramine results in an increase in cAMP to about 1.2 pmol .
- octopamine leads to an approximately 911-fold increase in cAMP compared to an approximately 215-fold increase for about 100 ⁇ M tyramine . Since these assays are performed in the presence of the phosphodiesterase inhibitor IB MX, the increases in cAMP is determined to be through activation of adenylate cyclase. As such, it appears that the Pa oai receptor is an octopamine receptor, the Pa oai receptor may be targeted to effect a disruptive change in intracellular levels of cAMP, controlled targeting of the receptor allows for insect control, and the cell lines stably expressing the Pa oai receptor may be used to screen compounds and compositions for insect control activity. B.
- HEK- 293 cells are plated in 1 mL media with 0.8 mg G418/ ⁇ nL into multi-dishes (4.5 cm2).
- the media is aspirated and 1 mL PBS with 3O0 ⁇ M IBMX and the test reagent is added.
- Cells are incubated at 37°C for 20 min, and the PBS is then aspirated.
- Cells are incubated with 70% ethanol for 1 hour at -20°C. The cellular debris is centrifuged and then the supernatant is removed and lyophilized to dryness.
- the amount of cAJVD? in the extract is determined by using a cAMP binding protein from the 3 H-cAMP Biotrak assay system (Amersham Biosciences, Piscataway, NJ) as per the manufacturer's instructions.
- a cAMP binding protein from the 3 H-cAMP Biotrak assay system (Amersham Biosciences, Piscataway, NJ) as per the manufacturer's instructions.
- To determine Ca 2+ levels in the cells HEK-293 cells are washed once with Hank's balanced salt solution (137 mM NaCl, 5.4 mM KC1, 0.3 mM Na 2 HP0 4 , 0.4 mM KH 2 P0 4 , 4.2 mM NaHC0 3 , 1 mM CaCl 2 , 1 mM MgS0 4 , and 5.6 m t glucose (pH 7.4)) (HBSS) .
- Hank's balanced salt solution 137 mM NaCl, 5.4 mM KC1,
- Cells are collected by scraping and are suspended at about 750,000 cells/ml in HBSS with about 5 ⁇ M Fura-2 AM (Sigma-Aldrich). Cells are incubated at abo t 37 C for about 1 h in the dark, centrifuged, suspended in HBSS at about 750,000 cells/ml and used for calcium measurements A spectrofluoremeter with Felix software from Photon Technology International (Lawrenceville, NJ) is used for the fluorescence measurements and data- collection.
- Octopamine has been demonstrated to modulate; intracellular calcium levels in cultured hemocytes of Malacosoma disstria. Also, in hemocytes from Periplaneta americana, octopamine lead to an increase in inositol triphosphate which likely will lead to increases in calcium in these cells as well . The ability of both octopamine and tyramine to modulate calcium levels in the HEK- 293 clone expressing Pa oai is determined. Neither about 10 ⁇ M octopamine nor about 10 ⁇ M tyramine modulates intracellular calcium levels in control HEK-293 cells transfected with pCDNA3 lacking an insert.
- the Pa oai receptor is an octopamine receptor
- the Pa oai receptor may be targeted to effect a disruptive change in intracellular levels of Ca 2+ , controlled targe-ting of the receptor allows for insect control, and the cell lines stably expressing the Pa oai recepto may be used to screen compounds and compositions for insect control activity.
- Octopamine is found to increase both cAMP and calcium in HEK-293 cells expressing Pa oai and the calcium increase is detected immediately upon octopamine addition. As such, tine possibility that calcium is leading to a secondary increase in cAMP levels in the cells expressing Pa oai is tested.
- the intracellular calcium chelator BAPTA/AM is used. BAPTA/AM at a out 20 ⁇ M is found to inhibit the increase in fi-ee intracellular calcium when about 1 ⁇ M octopamine is added to the Pa oai -expressing cells .
- Octopamine-mediated changes in cAMP levels are compared in the absence and presence of about 20 ⁇ M BAPTA/AM.
- cAMP levels following treatment with either about 100 nM or about 1 ⁇ M octopamine, as well as basal cAMP levels are not foun d to be statistically different, whether in the absence or presence of about 20 ⁇ M BAPTA/AM, as shown in Figure 8.
- COS-7 cells expressing Pa oai and octopamine receptor' (OAMB) from Drosophila melanogaster are performed. See Bischof and Enan, 2004, Insect Biochem. Mol. Biol. 34. pp. 511-521, which is incorporated herein by this reference.
- the data shown in Table B demonstrates that the affinity of Pa oai to the radioligand is about 1.5 fold higher than OAMB. Radioligand binding using 3 H- yohimbine is performed on membranes expressing either either Pa oai or OAMT3.
- K d and B max a range of 3 H-yohimbine is used from 0.5 to 50 n M, and 50 ⁇ M phentolamine is used as a competitor to determine nonspecific binding.
- Kj of octopamine 4 nM 3 H-yohimbine is used with a concentration range of octopanx ine that gives from 0 to 100%) competition.
- OA (10 ⁇ M) increases the level of cAMP in HEK-293 cells permanently expressing either OAMB or Pa oai.
- OA (10 ⁇ M) increases the level [Ca 2+ ] ⁇ in HEK-293 cells permanently expressing either OAMB or Pa oai, where HEK-293 cells expressing either receptor are incubated for 30s before the addition of 10 ⁇ M octopamine (OA).
- the arrow in the figures indicates addition of the amine.
- the fluorescence ratio determined from excitation with 340 and 380 run is plotted to indicate changes in [Ca 2+ ]j levels. These increases are mediated through the OAR as judged by the insignificant changes in cAMP level and [Ca 2+ ]j in cells transfected with an empty vector then treated with 10 ⁇ M OA (data not shown).
- EXAMPLE 5 EFFECTS OF TREAMENT WITH PLANT ESSENTIAL OILS ON CELLS EXPRESSING THE OCTOPAMINE RECEPTOR
- membranes isolated from COS-7 cells expressing the receptor are used for receptor binding studies and HEK-293 cells are used for cAMP and [Ca 2+ ] ⁇ studies.
- Plant essential oils including: jc-cymene [methyl(l-methylethyl)benzene], eugenol [2-methoxy-4-(2- propenyl)phenol], trans-anethole [l-methoxy-4-(l-propenyl)benzene], cinnamic alcohol [3- phenyl-2-propen-l-ol], -terpineol [p-menth-l-en-8-ol], methyl salicylate [2-hydroxybenzoic acid methyl ester], 2-phenylethyl propionate, and geraniol [3,7-dimethyl-2,6-octadien-l-ol], are obtained from City Chemical (West Haven, CT) and tested for insect control activity. The chemical structures of these compounds are set forth in Figure 11.
- A. RECEPTOR BINDING ACTIVITY The binding activity of 3 H-yohimbine to membranes expressing Pa oai or OAMB is performed in the presence and absence of three structurally related plant essential oil monoterpenoids, which are selected based on their insecticidal activity, the absence or presence and location of the hydroxyl group and a spacing group within the molecule.
- Membrane protein (10 ⁇ ig) expressing Pa oai is incubated with 4 nM 3 H-yohimbine in the presence and absence of 50 ⁇ M of the test chemical.
- the specific activity is calculated as the difference between counts in the presence and absence of test chemical.
- Specific binding is calculated by determining nonspecific binding with 50 ⁇ M tested plant essential oils and subtracting nonspecific binding from total binding.
- FIG. 13 depicts the effect of certain plant essential oils on cAMP levels in HEK-293 cells expressing either Pa oai or OAMB.
- HEK-293 cells stably expressing either receptor are treated with 300 ⁇ tM IB MX and the effect of tested plant essential oils (50 ⁇ M) on basal cAMP levels is measured.
- Eugenol (50 ⁇ M) significantly decreases the cAMP level (24%) in cells expressing Pa oai but slightly decreased cAMP level in cells expressing OAMB.
- a 22% increase in cAMP level in cells expressing OAMB is found in response to treatment with (50 ⁇ M) trans-anethole. Cinnamic alcohol (50 ⁇ M) induces slight increase in cAMP level in both cell models.
- Figures 14A-14F depict the effect of cinnamic alcohol ( Figures 14A and 14B), eugenol ( Figures 14C and 14D), and t-anethole ( Figures 14E and 14F) on intracellular calcium [Ca 2+ ]j levels in HEK-293 cells either transfected with Pa oai or OAMB.
- HEK-293 cells are incubated for 30s before the addition of 25 ⁇ M tested agents.
- the arrow in the figures indicates addition of tested agents.
- the fluorescence ratio determined from excitation with 340 ran and 380 nm is plotted to indicate transient increase in [Ca 2+ ]j levels.
- trans- anethole does not have a significant effect on binding to OAMB while eugenol and cinnamic alcohol do (Figure 12), only trans-anethole increases cAMP level (Figure 13) and [Ca 2" ' " ]j ( Figures 14A-14F) through OAMB.
- EXAMPLE 6 TOXICITY TESTING AGAINST CERTAIN INSECT SPECIES Toxicity bioassay against the wild type Drosophila melanogaster fly and American cockroach is performed to address insect species specificity in response to certain plant essential oils and to determine whether the cellular changes in Pa oai and OAMB cell models in response to treatment with tested essential oils correlate with their insecticidal activity.
- Drosophila melanogaster wild type strain is purchased from Carolina Biological Supply
- Plant essential oils including: ⁇ -cymene [methyl(l-methylethyl)benzene], eugenol [2- m.ethoxy-4-(2-propenyl)phenol], trans-anethole [l-methoxy-4-(l-propenyl)benzene], cinnamic alcohol [3-phenyl-2-propen-l-ol], ⁇ -terpineol [p-menth-l-en-8-ol], methyl salicylate [2- hydroxybenzoic acid methyl ester], 2-phenylethyl propionate, and geraniol [3,7-dimethyI-2,6- octadien-1-ol], are obtained from City Chemical (West Haven, CT) and tested for insect control activity.
- ⁇ -cymene methyl(l-methylethyl)benzene]
- eugenol 2- m.ethoxy-4-(2-propenyl)phenol
- FIG. 1 The chemical structures of these compounds are set forth in Figure 1 1.
- Acetonic solutions of plant essential oils are prepared and different concentrations of each, that give from 10% - 100% mortality, are applied by topical application. Controls are treated with the same volume (0.5 ⁇ l/insect) of acetone. Replicates, with 5 insects per replicate, are used for each concentration. The mortality is calculated 24 hours after treatment. Data are subjected to probit analysis to determine LD50 value for each compound. See Finney, 1971, Probit Analysis, 3 rd Ed., Cambridge University Press, London, pg. 333.
- octopamine/octopamine receptor (OA/OAR) system is involved in the toxicity of tested plant essential oils
- octopamine synthesis mutant (iav) Drosophila melanogaster strain is topically treated with a dose equivalent to the determined LD 50 for wild type strain.
- the LD50 values of eight monoterpenoid plant essential oils p-cymene, eugenol, trans-anethole, cinnamic alcohol, ⁇ -terpineol, methyl salicylate, phenylethyl propionate, and geraniol
- Controls are treated with the same volume (0.5 ⁇ l/fly) of acetone. The mortality is calculated 24 hour after treatment. Multiple replicates and 5 flies per replicate are used for the bioassay of each chemical. Data are subjected to probit analysis to determine LDso value for each chemical. See Finney, 1971.
- LD 50 1.65 ⁇ g/fly
- Eugenol is about 2-fold and about 27-fold more toxic against American cockroach than cinnamic alcohol and trans-anethole, respectively.
- the toxicity data demonstrates significant differences between the toxicity of the tested chemicals against each insect (Table C).
- the toxicity data also demonstrates differences between the two insects in response to each chemical.
- the toxicity data against wild type and octopamine mutant (iav) fruit fly suggests that the toxicity of cinnamic alcohol, eugenol and trans-anethol is mediated through octopamine/octopamine receptors system.
- certain other plant essential oils tested against both strains of fruit fly only the toxicity of 2-phenylethyl propionate is mediated through octopamine receptors.
- the octopamine receptor mediates the insecticidal properties of cinnamic alcohol, eugenol, trans-anethole and 2-phenylethyl propionate and, in part, the toxicity of ⁇ -terpineol against Drosophila melanogaster fly. Furthermore, it appears that the presence of an electronegative group such as hydroxyl group, and different spacing groups, may be required for the insecticidal activity of plant essential oils through octopamine receptor. * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Insects & Arthropods (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Toxicology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Endocrinology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US55496804P | 2004-03-19 | 2004-03-19 | |
| PCT/US2005/009223 WO2005092016A2 (en) | 2004-03-19 | 2005-03-21 | Compositions and methods for controlling insects related to the octopamine receptor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1737478A2 true EP1737478A2 (en) | 2007-01-03 |
| EP1737478A4 EP1737478A4 (en) | 2008-09-03 |
Family
ID=35056738
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP05728601A Withdrawn EP1737478A4 (en) | 2004-03-19 | 2005-03-21 | Compositions and methods for controlling insects related to the octopamine receptor |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP1737478A4 (en) |
| AU (1) | AU2005226676B2 (en) |
| CA (1) | CA2563886A1 (en) |
| NZ (1) | NZ550426A (en) |
| WO (1) | WO2005092016A2 (en) |
| ZA (1) | ZA200608396B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7622269B2 (en) | 2004-03-19 | 2009-11-24 | Tyratech, Inc. | Methods of screening tyramine- and octopamine-expressing cells for compounds and compositions having potential insect control activity |
| EP1624881A4 (en) | 2003-04-24 | 2010-01-06 | Tyratech Inc | Compositions and methods for controlling insects |
| EP2043620B1 (en) | 2006-06-27 | 2017-05-03 | Tyratech, Inc. | Compositions for use in treating a parasitic infections in a mammalian subject |
| CN101489377A (en) | 2006-07-17 | 2009-07-22 | 蒂拉德克公司 | Compositions and methods for controlling insects |
| EP2077724A2 (en) * | 2007-01-16 | 2009-07-15 | Tyratech, Inc. | Pest control compositions and methods |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5344776A (en) * | 1991-03-28 | 1994-09-06 | The United States Of America As Represented By The Department Of Health And Human Services | DNA encoding an insect octopamine receptor |
| WO1999021891A1 (en) * | 1997-10-27 | 1999-05-06 | Baylor College Of Medicine | Invertebrate octopamine receptor |
| WO2001018201A1 (en) * | 1999-09-09 | 2001-03-15 | Ecosmart Technologies, Inc. | Pesticidal activity of plant essential oils and their constituents |
-
2005
- 2005-03-21 EP EP05728601A patent/EP1737478A4/en not_active Withdrawn
- 2005-03-21 NZ NZ550426A patent/NZ550426A/en unknown
- 2005-03-21 AU AU2005226676A patent/AU2005226676B2/en not_active Expired - Fee Related
- 2005-03-21 WO PCT/US2005/009223 patent/WO2005092016A2/en not_active Ceased
- 2005-03-21 CA CA002563886A patent/CA2563886A1/en not_active Abandoned
-
2006
- 2006-10-06 ZA ZA200608396A patent/ZA200608396B/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| AU2005226676A1 (en) | 2005-10-06 |
| EP1737478A4 (en) | 2008-09-03 |
| ZA200608396B (en) | 2009-02-25 |
| WO2005092016A3 (en) | 2006-03-23 |
| WO2005092016A2 (en) | 2005-10-06 |
| AU2005226676B2 (en) | 2009-07-30 |
| NZ550426A (en) | 2009-05-31 |
| CA2563886A1 (en) | 2005-10-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Enan | Molecular response of Drosophila melanogaster tyramine receptor cascade to plant essential oils | |
| US7622269B2 (en) | Methods of screening tyramine- and octopamine-expressing cells for compounds and compositions having potential insect control activity | |
| Ohta et al. | B96Bom encodes a Bombyx mori tyramine receptor negatively coupled to adenylate cyclase | |
| Enan | Molecular and pharmacological analysis of an octopamine receptor from American cockroach and fruit fly in response to plant essential oils | |
| Qi et al. | A new Drosophila octopamine receptor responds to serotonin | |
| Balfanz et al. | A family of octapamine receptors that specifically induce cyclic AMP production or Ca2+ release in Drosophila melanogaster | |
| Blenau et al. | Characterization of a dopamine D1 receptor from Apis mellifera: cloning, functional expression, pharmacology, and mRNA localization in the brain | |
| US20110003317A1 (en) | Methods of screening compounds for insect-control activity involving the tyramine receptor | |
| Xia et al. | A new family of insect muscarinic acetylcholine receptors | |
| Wu et al. | Molecular cloning and pharmacological characterisation of a tyramine receptor from the rice stem borer, Chilo suppressalis (Walker) | |
| Jiang et al. | Functional characterization of five different PRXamide receptors of the red flour beetle Tribolium castaneum with peptidomimetics and identification of agonists and antagonists | |
| Hull et al. | Identification of the western tarnished plant bug (Lygus hesperus) olfactory co‐receptor Orco: expression profile and confirmation of atypical membrane topology | |
| Wolff et al. | Characterization and comparative pharmacological studies of a functional γ-aminobutyric acid (GABA) receptor cloned from the tobacco budworm, Heliothis virescens (Noctuidae: Lepidoptera) | |
| Wang et al. | Functional characterization of sex pheromone neurons and receptors in the armyworm, Mythimna separata (Walker) | |
| EP2971060A1 (en) | Methods for identifying arthropod repellents based on modulation of ionotropic receptors, and compounds and compositions identified thereby | |
| AU2005226676B2 (en) | Compositions and methods for controlling insects related to the octopamine receptor | |
| US20040213771A1 (en) | Targets and screens for agents useful in controlling parasitic nematodes | |
| Hariton-Shalev et al. | Structural and functional differences between pheromonotropic and melanotropic PK/PBAN receptors | |
| WO2007121512A1 (en) | Insect olfactory receptors | |
| Shalev et al. | Pheromonotropic and melanotropic PK/PBAN receptors: Differential ligand–receptor interactions | |
| WO1999021891A1 (en) | Invertebrate octopamine receptor | |
| Xiong et al. | Pharmacological characterization of the 5-HT1A receptor of Bombyx mori and its role in locomotion | |
| Hull et al. | Sex pheromone production in the silkworm, Bombyx mori, is mediated by store-operated Ca2+ channels | |
| EP3433265B1 (en) | Pheromonal receptor of spodoptera littoralis and identification of natural ligand of said receptor and uses thereof | |
| CA2616144A1 (en) | Insect olfactory receptors and ligands therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20061005 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR |
|
| DAX | Request for extension of the european patent (deleted) | ||
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: TYRATECH, LLC |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20080731 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: G01N 33/50 20060101ALI20080725BHEP Ipc: C07K 14/435 20060101AFI20080725BHEP |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: TYRATECH, INC. |
|
| 17Q | First examination report despatched |
Effective date: 20090331 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20091013 |