EP1737478A2 - Compositions and methods for controlling insects related to the octopamine receptor - Google Patents

Compositions and methods for controlling insects related to the octopamine receptor

Info

Publication number
EP1737478A2
EP1737478A2 EP05728601A EP05728601A EP1737478A2 EP 1737478 A2 EP1737478 A2 EP 1737478A2 EP 05728601 A EP05728601 A EP 05728601A EP 05728601 A EP05728601 A EP 05728601A EP 1737478 A2 EP1737478 A2 EP 1737478A2
Authority
EP
European Patent Office
Prior art keywords
cells
compounds
compositions
octopamine
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP05728601A
Other languages
German (de)
French (fr)
Other versions
EP1737478A4 (en
Inventor
Essam Enan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tyratech Inc
Original Assignee
Vanderbilt University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vanderbilt University filed Critical Vanderbilt University
Publication of EP1737478A2 publication Critical patent/EP1737478A2/en
Publication of EP1737478A4 publication Critical patent/EP1737478A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • C07K14/43577Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from flies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • C07K14/43577Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from flies
    • C07K14/43581Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from flies from Drosophila
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082Supracellular entities, e.g. tissue, organisms
    • G01N33/5085Supracellular entities, e.g. tissue, organisms of invertebrates
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082Supracellular entities, e.g. tissue, organisms
    • G01N33/5088Supracellular entities, e.g. tissue, organisms of vertebrates
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/94Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving narcotics or drugs or pharmaceuticals, neurotransmitters or associated receptors
    • G01N33/9406Neurotransmitters
    • G01N33/9413Dopamine
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value

Definitions

  • the present invention relates to compounds, compositions and method for controlling insects.
  • OA Octopamine
  • GPCRs G-protein coupled receptors
  • a GPCR When a GPCR is activated, depending on its type and the protein to which it binds, changes in intracellular concentrations of cAMP, Ca 2+ or both often take place. Since changes in intracellular levels of cAMP or Ca 2+ are the most commonly found cellular responses to biogenic amine treatments (e.g., serotonin, dopamine, octopamine, etc.), they are used to functionally classify receptor subtypes. As a result of GPCR activation, intracellular cAMP levels can either be elevated or reduced. The cellular response strictly relies on the specificity of interactioxi between the receptor and the G protein (See e.g.. Gudermann T, Kalkbrenner F, Schultz G- .
  • G protein inhibitory G protein
  • Interaction of AC with activated G ⁇ i subunits most likely competes with binding of activated Gas subunits and thtereby interferes with AC activation.
  • Another pathway that is activated by several biogenic amine receptors results in a rise of intracellular Ca 2+ levels.
  • the amine-activated receptor binds to G protei ⁇ s of the Gq/o family (See e.g., supra, Gudermann et al., 1996 and Gudermann et al., 1997).
  • Tlx e activated G ⁇ q/o subunits bind to and stimulate phospholipase C (PLC) activity.
  • PLC phospholipase C
  • the enzyme hydrolyzes a membrane-bound substrate, phosphatidylinositol 4,5-bisphosphate which gives rise to two second messengers IP3 and DAG. After binding of IP3 to its receptors, the calcium channel pore is opened and Ca 2+ is released into the cytoplasm.
  • Ca 2+ ions play a vital role in the regulation of many cellular functions by binding to members of large family of Ca 2+ -bindix g proteins and/or directly controlling enzymatic or ion channel activities. Multiple insect species have been utilized to understand the biological functions arid pharmacological characteristics of octopamine receptors .
  • octopamine has been found to activate adenylate cyclase in certain cells in this species. Furthermore, octopamine has been found to increase inositol triphosphates in certain cells in this species.
  • Formamidine-like chemicals have been found to be octopaminergic agonists and inhibit the uptake of sodium-sensitive octopamine in certain insects; for example, the formamidine pesticides chlordimeform and demethylchloridimeform were found to target the octopamine signaling pathway in certain invertebrates, including Periplaneta americana .
  • Identifying plant essential oils and combinations thereof, having insect-controlling activity is particularly desirable given that many such compounds do not produce unwanted or harmful affects on humans, other animal species, and certain plants.
  • identifying the most effective plant essential oils and combinations thereof requires random selection and use of tedious screening methods, which, given the vast number of plant essential oils and possible combinations thereof, is a substantially impossible task.
  • the present invention addresses the above identified problems, and others, by providing a screening method for identifying compounds and compositions that are effective insect control agents; a screening method for identifying compounds and compositions that are effective species-specific insect control agents; compounds and compositions isolated from the screening methods; cell lines expressing an octopamine receptor; and isolated nucleic acid molecule sequences.
  • Figure 1A is an alignment of the nucleic acid sequence and the translated amino acid sequence from Pa oa,, of SEQ ID NO: 1 and SEQ ID NO: 2;
  • Figure IB is the nucleic acid sequence from Pa oai of SEQ ID NO: 1, with the seven putative transmembrane domains (TM) overlined and numbered 1 through 7, the stop codons (SC) underlined, and the initiation codon (M) underlined;
  • Figure 2 is an alignment of the translated amino acid sequences of Pa oaj of SEQ ID NO: 2 and OAMB of SEQ ID NO: 3, with the seven putative transmembrane domains (TM) overlined and numbered 1 through 7;
  • Figure 3A is saturation binding curve of J H-yohimbine to Pa oaj, where total binding is designated by the squares, nonspecific binding is designated by the triangle, and specific binding is designated by the inverted triangle;
  • Figure 3B is saturation binding curve of 3 H-yohimbine to OA
  • the present invention includes: a screening method for identifying compounds and compositions that are effective insect control agents; a screening method for identifying compounds and compositions that are effective species-specific insect control agents; compounds and compositions isolated from the screening methods; transfected cell lines; and isolated nucleic acid molecule sequences.
  • the present invention includes: an isolated nucleic acid molecule sequence which encodes a protein that binds a biogenic amine, resulting in changes in intracellular concentrations of cAMP, Ca 2+ , or both, having a nucleotide sequence of SEQ ID NO: 1, or a fragment or derivative thereof and/or having an amino acid sequence of SEQ ID NO: 2, or a fragment or derivative thereof; an isolated nucleic acid molecule of having at least about 30% similarity to the nucleotide sequence of SEQ ID NO: 1 , wherein the isolated nucleic acid molecule encodes a protein, resulting in changes in intracellular concentrations of cAMP, Ca 2+ , or both; an isolated nucleic acid molecule of having at least about 30% similarity to the nucleotide sequence of SEQ ID NO: 1, wherein the molecule encodes an octopamine receptor or a protein having an amino acid sequence of SEQ ID NO: 2, or a fragment or derivative thereof; and an isolated nucleic acid molecule having a nucleo
  • SEQ ID NO: 1 and SEQ ID NO: 2 are shown in alignment in Figure 1A and SEQ ID NO: 1 is also provided in Figure 1 B.
  • Fragments and derivatives of the sequences shall include transmembrane domains (TM) 3, 5 and 6. Fragments and derivatives of the sequences may exclude, for example, portions upstream of TM 1, portions upstream of TM 2, or portions downstream of TM 7.
  • the present invention also includes: a strain of cells including a DNA vector having a nucleic acid sequence of SEQ ID NO:l; a strain of cells expressing an octopamine receptor cloned from an insect species of interest; a strain of cells expressing an octopamine receptor cloned from Periplaneta Americana (Pa oai); a strain of cells expressing a protein having an amino acid sequence of SEQ ID NO: 2, or fragments or derivatives thereof, wherein the fragments or derivatives thereof bind octopamine; a strain of cells expressing an octopamine receptor cloned from Drosophila melanogaster (OAMB); a strain of cells expressing a protein having an amino acid sequence of SEQ ID NO: 3, or fragments or derivatives thereof, wherein the fragments or derivatives thereof bind octopamine.
  • a strain of cells including a DNA vector having a nucleic acid sequence of SEQ ID NO:l; a strain of cells
  • the transfected cells may be mammalian cells or insect cells; for example, they may be African green monkey kidney COS-7 cells (COS-7 cells) or human embryonic kidney-293 cells (HEK-293 cells).
  • the present invention also includes a screening method of using a cell line expressing an octopamine receptor to identify compounds and compositions that are effective insect control agents.
  • the octopamine receptor expressed by the cell line may be Pa oai ; or have an amino acid sequence of SEQ ID NO: 2, or fragments or derivatives thereof, wherein the fragments or derivatives thereof bind octopamine.
  • the present invention also includes a method of using multiple cell lines, wherein the cell lines are transfected with octopamine receptors from different insect species of interest, to identify compounds and compositions that are effective species-specific insect control agents.
  • a cell line expressing Pa oai and a cell line expressing OAMB could be used to screen compounds and compositions having insect control activity which is specific to Periplaneta Americana or to Drosophila melanogaster.
  • the present invention also includes compounds and compositions having the ability to control target insects, which compounds and/or compositions are identified using the screening methods of the present invention.
  • These compounds and/or compositions may include compounds that are general regarded as safe (GRAS compounds) meaning that they do not produce unwanted or harmful affects on humans and other non-target animal species and that they are exempt from the Environmental Protection Agency's (EPA) pesticide registration requirements.
  • the compounds and/or compositions of the present invention include certain plant essential oils identified using the screening methods of the present invention.
  • the compounds and compositions of the present invention control insects by targeting an octopamine receptor, resulting in a disruptive change in the intracellular levels of cAMP, Ca 2+ or both.
  • insect has been and shall be used through out this application; however, it should be understood that the term insect refers, not only to insects, but also to arachnids, larvae, and like invertebrates.
  • insect control shall refer to repelling or killing an insect.
  • the present invention is further illustrated by the following specific but non-limiting examples.
  • the underlined sequence corresponds to the TM regions .
  • the TM VI oligonucleotide contains a HindlH site and the TM VII oligonucleotide contains a Not 1 / site flanking the TM sequences .
  • Total R ⁇ A from the heads of mixed sex adult American cockroaches that have the antennae excised is prepared by ultracentrifugation through cesium chloride, as described in Chirgwin et al, 18 Biochemistry 5294-5299 (1979), and is reverse transcribed into cD ⁇ A using random hexamers and murine leukemia virus reverse transcriptase (Applied Biosystems, Foster City, CA) .
  • PCR polymerase chain reaction
  • AmpliTaq polymerase Applied Biosystems
  • TM VI and VII oligonucleotides at final concentrations of about 5 ⁇ M.
  • the reaction conditions are about 95 ° C, about 5 min for about one cycle; about 95 ° C, about 45 s, about 40 ° C, about 2 min, about 72 ° C, about 30 s for about three cycles; about 95 ° C, about 45 s, about 55 C, about 2 min; about 72 ° C, about 30 s for about 37 cycles; and about 72 " C, about 10 min for about one cycle .
  • Products are digested with Hindlll and Noll and ligated into pBK-RSV (Stratagene, La Jolla, CA) . Inserts are sequenced and compared to known genes by searching the NCBI database with the Blast program.
  • RACE 5' and 3' rapid amplification of cDNA ends
  • Poly(A) RNA is prepared from total RNA isolated from the head of Periplaneta americana using an oligo-dT column as per the manufacturer's protocol (Amersham Biosciences, Piscataway, NJ) .
  • the poly(A) RNA is used as template in the RACE reverse transcription reaction for production of 5' and 3' RACE cDNA as per the manufacturer's instructions .
  • the gene specific oligonucleotides used for the RACE PCR are 5' RACE oligonucleotide 5'CAGTAGCCCAGCCAGAAGAGGACGGAGAAG3' (SEQ ID NO: 6), and 3' RACE oligonucleotide 5 'GCTGGCTGCCGTTCTTCACCATGTACCTGG3' (SEQ ID NO: 7) .
  • 5' RACE and 3' RACE polymerase chain reactions are each about 50 ⁇ l and consist of about 2.5 ⁇ l of the respective cDNA reaction, about 0.2 ⁇ M of the gene specific oligonucleotide and the additional RACE components including Advantage 2 polymerase as per the manufacturer (Clontech) .
  • the cycling conditions for the 5' RACE are about 95 ° C, about 1 min for about one cycle; about 94 C, about 20 s, about 72 C, about 3 min for about five cycles; about 94 C, about 20 s, about 70 ° C, about 10 s, about 72 C, about 3 min for about five cycles; about 94 C, about 20 s, about 68 ° C, about 10 s, about 72 ° C, about 3 min for about 32 cycles; and about 72 ° C, about 10 min for about one cycle .
  • An approximately 1.9 kb product is gel purified and further, amplified using the same oligonucleotides, Advantage 2 polymerase and cycling parameters of about 95 ° C, about 3 min for about one cycle; about 94 ° C, about 20 s, about 68 ° C, about 10 s, about 72 ° C, about 3 min for about 35 cycles; and about 72 ° C, about 10 min for about one cycle .
  • the product is A-tailed by precipitating with ethanol, resuspending in 1 x PCR Buffer II (Applied Biosystems), 2 mM MgCl 2 , 1 inM dATP and 0.05 U AmpliTaq per ⁇ l and incubating at about 72 ° C for about 15 min .
  • the PCR product is ligated into pBK-RSV (Stratagene) that has been digested with Smal and T-tailed using dTTP and AmpliTaq .
  • the insert is sequenced on both strands by automated fluorescent DNA sequencing (Vanderbilt Cancer Center).
  • the cycling conditions for the 3' RACE reaction are about 95 C, about 1 min for about one cycle; about 94 ° C, about 5 s, about 72 C, about 3 min for about five cycles; about 94 ° C, about 5 s, about 70 C, about 10 s, about 72 C, about 3 min for about five cycles; about 94 C, about 5 s, about 68 ° C, about 10 s, about 72 C, about 3 min for about 32 cycles; and about 72 ° C, about 10 min for about one cycle
  • the product of this reaction is A-tailed, subcloned and sequenced as for the 5' RACE product.
  • Oligonucleotides used to amplify the open reading frame are a sense oligonucleotide 5' CAGGAATTCATGAGGGACGGGGTTATGAACGCTAG 3 ' (SEQ ID NO: 8), and an antisense oligonucleotide 5' GCTTCTAGATCACCTGGAGTCCGATCCATCGTTG 3' (SEQ ID NO: 9) Sequences corresponding to the open reading frame are underlined.
  • the sense oligonucleotide contains an EcoRI restriction site and the antisense oligonucleotide an Xbal restriction site These oligonucleotides are used in a polymerase chain reaction that included the 5 'RACE cD A as template and VENT polymerase (New England Biolabs, Beverly, MA).
  • pAc-Pa oai For mammalian cell expression, a Kozak sequence is inserted using a sense oligonucleotide 5'ACAGAATTCGCCACCATGAGGGACGGGGTTATGAACGCTAG 3' (SEQ ID NO: 10) and an internal antisense oligonucleotide that contains an Xlwl 5" TTGACGGCGCTCGAGGACGTC 3' (SEQ ID NO: 11) The sense oligonucleotide contains an EcoRI site These oligonucleotides are used in a polymerase chain reaction that includes pAc-Pa oai as template and VENT polymerase The product is inserted at EcoRI and Xltol sites into pAc- Pa o
  • Oligonucleotides designed to amplify the open reading frame of Drosophila melanogaster OAMB consist of the sense oligonucleotide 5' CAGGAATTCGCCACCATGAATGAAACAGAGTGCGAGGATCTC 3' (SEQ ID NO: 12) and the antisense oligonucleotide 5' AATGCGGCCGCTCAGCTGAAGTCCACGCCCTCG 3' (SEQ ID NO: 13) Sequences corresponding to the open reading frame are underlined A Kozak sequence is included in the sense oligonucleotide In addition, the 5' oligonucleotide includes an EcoRI restriction site and the 3" oligonucleotide a Notl site For a
  • Cycling conditions are about 95 C, about 5 min for about one cycle; about 95 ° C, about 30 s and about 70 ° C, about 1.5 min for about 40 cycles; and about 70 ° C, about 10 min for about one cycle .
  • the product is digested with EcoRI and Notl, ligated into pCDNA3 and sequenced on both strands by automated fluorescent DNA sequencing (Vanderbilt Cancer Center).
  • a polymerase chain reaction with degenerate oligonucleotides corresponding to regions of TM VI and TM VII of previously identified octopamine receptors is used to isolate an approximately 101 nucleotide fragment of cDTMA from the head of Periplaneta americana .
  • This cDNA fragment is used to design gene specific oligonucleotides to amplify the full-length cDNA of the corresponding gene by RACE. This method generates overlapping 5' and 3 1 segments that include the original cDNA fragment from TM VI to TM VII indicating these segments originate from the same cDNA .
  • the cDNA includes an approximately 1887 nucleotide open reading frame and 5' and 3' untranslated regions (Genbank accession number is AY333178) .
  • the predicted initiation codon is preceded by an in-frame stop codon, indicating that the 5' end of the open reading frame is included in the cDNA and that the encoded protein will be full length .
  • This cDNA and encoded protein are designated Pa oai.
  • the open reading frame encodes a protein of approximately 628 amino acids with a predicted molecular mass of about 68,642 Da . Hydropathy analysis by the method described in Kyte et al, J. Mol. Biol.
  • Pa oai is most closely related to OAMB, an octopamine receptor from the fruit fly Drosophila melanogaster and to Lym- oai , an octopamine receptor from the pond snail Lymnaea stagnalis). Sequence similarity is also detected with vertebrate ⁇ lA adrenergic receptors and invertebrate tyramine receptors . Protein alignment indicates Pa oai is about 51% identical to OAMB, 37% identical to Lym oai, and about 27% identical to both the insect tyramine receptors Tyr-Loc from Locusta migratoria and Tyr-Dro from Drosophila melanogaster .
  • CELL CULTUREAND TRANSFECTION OF CELLS Cell culture reagents may be obtained from Sigma-Aldrich (St . Louis, MO), or as otherwise indicated, African green monkey kidney COS-7 cells and human embryonic kidney (HEK)-293 cells are obtained from American Type Culture Collection (Manassas, VA) .
  • COS-7 cells are grown in Dulbecco's modified Eagle's medium (about 4.5 g glucose/1) and about 10% fetal bovine serum.
  • HEK-293 cells are grown in Dulbecco's modified Eagle's medium (about lg glucose/1), about 5% fetal bovine serum and about 5% newborn calf serum Both types of media are supplemented with about 100 U penicillin G/ml, about 100 ⁇ g streptomycin/ml and about 0.25 ⁇ g amphotericin B/ml) except during Lipofectamine 2000 transfections.
  • Lipofectamine 2000 and Opti-MEM I media may be obtained from Invitrogen Life Technologies (Carlsbad, CA).
  • COS-7 cells are transiently transfected using Lipofectamine 2000 .
  • Cells are plated at about 1.5 x 10 6 cells per dish (about 55 cm 2 ) in about 10 ml growth medium without antibiotics the day before transfection. For each dish, about 30 ⁇ l Lipofectamine 2000 in about 1 ml Opti-MEM I medium is mixed with about 12 ⁇ g plasmid DNA in about 1 ml Opti- MEM I medium and added to the cells after an approximately 20 min incubation at room temperature . The cells are harvested for membrane preparation 24 h following transfection.
  • HEK-293 cells For stable transfections of HEK-293 cells, about 1 x 10 6 cells in about 2.5 ml growth media without antibiotics are plated into dishes (about 10 cm") the day before transfection, For transfection, about 10 ⁇ l Lipofectamine 2000 is added to about 250 ⁇ l Opti-MEM I medium . This is mixed with about 4 ⁇ g plasmid DNA in about 250 pi OptiMEM I medium . After an approximately 20 min incubation at room temperature, the approximately 500 ⁇ l of solution is added to cells in a single dish . Cells are split about 24 h after transfection into growth media containing about 0.8 mg G418 sulfate/ml (Mediatech Inc., Heradon, VA) .
  • Clonal lines are selected and assayed for receptor expression with whole cell binding by incubating about 500,000 cells in about 1 ml phosphate buffered saline (PBS; 137 mMNaCl, 2.7 mM KC1, 10 mM Na 2 HP0 , 1.4 mM KH 2 P0 4 (pH 7.4)) with about 2 nM 3 H-yohimbine for about 30 min at about 27 ° C . Cells are pelleted by centrifugation, washed with PBS, and then transferred to scintillation vials . Nonspecific binding is determined by including about 50 ⁇ M phentolamine in the binding reaction.
  • PBS phosphate buffered saline
  • Antagonists and biogenic amines are obtained from Sigma- Aldrich (St Louis, MO).
  • Octopamine is the mixed isomeric form DL-octopamine 3 H-yohimbine is obtained from Perkin Elmer Life Sciences (Boston, MA)
  • Radioligand binding is performed with about 7.5-15 ⁇ g membrane protein in about 250 ⁇ l binding buffer for about 30 min at about 27 ° C while shaking at about 100 rpm
  • Reactions are terminated by addition of about 3 ml ice cold binding buffer and filtered over GF/C filters (Whatman International, Maidstone, England) that have been soaked for about 30 min in about 0.3% polyethylenimine (Sigma-Aldrich) Filters are rinsed again with about 3 ml binding buffer
  • a range of 3 H-yohimbine is used from about 0.5 to 50 nM, and about 50 ⁇ M phentolamine is used as a competitor to determine nonspecific binding
  • Pa oaj is expressed in COS-7 cells by transient transfection. Membrane fractions are analyzed to determine total, nonspecific and specific binding of H-yohimbine, as shown in Figure 3A. The K d and B max for specific binding are determined to be about 28.4 nM and about 11.8 pmol/mg protein, respectively. Membrane fractions from COS-7 cells transiently transfected with empty pCDNA3 do not demonstrate specific binding. The high affinity binding of 3 H-yohimbine by Pa oai indicate that this is a suitable ligand to be used for competition binding experiments.
  • the octopamine receptor OAMB from Drosophila melanogaster is amplified by the polymerase chain reaction. Saturation binding analysis with 3 H-yohimbine is performed with OAMB expressed in COS-7 cells, as shown in Figure 3B. The K d and B max are determined to be about 43.0 nM and about 8.04 pmol/mg, respectively. Competitive binding with various biogenic amines is utilized to determine the affinities for potential natural ligands of Pa oai. Referring now to Table A, below, DL-Octopamine has the lowest Kj (about 13.3 ⁇ M) for Pa oai followed by tyramine (about 31.0 ⁇ M).
  • the decreasing order of affinity for the biogenic amines is octopamine > tyramine > dopamine > serotonin.
  • the binding affinities for octopamine and tyramine are determined for this receptor.
  • the K, (mean ⁇ standard deviation) of octopamine and tyramine for OAMB are about 8.20 ⁇ 2.60 ⁇ M and about 33.8 ⁇ 7.93 ⁇ M, respectively. These values are similar to those obtained for Pa oai.
  • the affinity of octopamine is about 2.3-fold higher than tyramine for Pa oai, and for OAMB, the affinity of octopamine is about 4.1 -fold higher than tyramine, indicating that octopamine is the likely endogenous ligand for Pa oai.
  • antagonists may be used to analyze the effects of octopamine on adenylate cyclase activity in the brain, ventral nerve cord and hemocytes of Periplaneta americana.
  • a pharmacological profile is developed for Pa oai using these , antagonists.
  • the profile of the antagonists is chlorpromazine > phentolamine > mianserin > metoclopramide.
  • Pa oai The Pa oai cDNA of 2268 bp which includes an 1887 nucleotide open reading frame and 5' and 3' untranslated regions is set forth in Figures 1A, IB and SEQ ID NO: 1. With reference to Figure IB, the predicted initiation codon (M) is preceded by an in-frame stop codon (SC). This indicates that the 5' end of the open reading frame is included in the cDNA and that the encoded protein would be full length.
  • TMs transmembrane domains
  • Cells are incubated with about 70% ethanol for a-hout 1 h at about -20 ° C
  • the cellular debris is centrifuged and then the supernatant is removed and lyophilized to dryness .
  • the amount of cAMP in the extract is determined by using a cAMP binding protein from the 5 H-cAMP Biotrak assay system (Amersham Biosciences) as per the manufacturer's instructions.
  • the cells are incubated with about 20 ⁇ 1 V 1 BAPTA/AM (Calbiochem Biochemicals, La Jolla, CA) for about 10 min before the addition of the test reagents.
  • Octopamine has been demonstrated to increase levels of the second messenger cAMP in brain, thoracic ganglion and hemocytes from Periplaneta americana .
  • HEK-293 cells are stably transfected with pCDNA3-Pa oai or pCDNA3 without an insert as a control
  • neither DL-octopamine nor tyramine at concentrations up to about 100 ⁇ M has significant effects on cAMP levels .
  • a clone transfected with pCDNA3-Pa oai having a high specific binding to 3 H-yohimbine is selected for second messenger analysis. Both octopamine and tyramine are able to increase the levels of cAMP in these cells in a dose dependent manner, as shown in Figure 6 .
  • the EC 50 S for the octopamine and tyramine mediated increases in cAMP are about 1.62 and 97.7 ⁇ M, respectively (p ⁇ 0.05) .
  • Octopamine is more potent than tyramine in the cAMP response as a statistically significant increase in cAMP over the basal level (about 0.48 pmol cAMP) is first detected with about 10 nM octopamine (about 1.2 pmol cAMP) (p ⁇ 0.05) .
  • the cAMP concentration with about 10 nM tyramine is about 0.50 pmol cAMP, and therefore not statistically significant from the basal level (p > 0.05).
  • a concentration of about 1 ⁇ M tyramine results in an increase in cAMP to about 1.2 pmol .
  • octopamine leads to an approximately 911-fold increase in cAMP compared to an approximately 215-fold increase for about 100 ⁇ M tyramine . Since these assays are performed in the presence of the phosphodiesterase inhibitor IB MX, the increases in cAMP is determined to be through activation of adenylate cyclase. As such, it appears that the Pa oai receptor is an octopamine receptor, the Pa oai receptor may be targeted to effect a disruptive change in intracellular levels of cAMP, controlled targeting of the receptor allows for insect control, and the cell lines stably expressing the Pa oai receptor may be used to screen compounds and compositions for insect control activity. B.
  • HEK- 293 cells are plated in 1 mL media with 0.8 mg G418/ ⁇ nL into multi-dishes (4.5 cm2).
  • the media is aspirated and 1 mL PBS with 3O0 ⁇ M IBMX and the test reagent is added.
  • Cells are incubated at 37°C for 20 min, and the PBS is then aspirated.
  • Cells are incubated with 70% ethanol for 1 hour at -20°C. The cellular debris is centrifuged and then the supernatant is removed and lyophilized to dryness.
  • the amount of cAJVD? in the extract is determined by using a cAMP binding protein from the 3 H-cAMP Biotrak assay system (Amersham Biosciences, Piscataway, NJ) as per the manufacturer's instructions.
  • a cAMP binding protein from the 3 H-cAMP Biotrak assay system (Amersham Biosciences, Piscataway, NJ) as per the manufacturer's instructions.
  • To determine Ca 2+ levels in the cells HEK-293 cells are washed once with Hank's balanced salt solution (137 mM NaCl, 5.4 mM KC1, 0.3 mM Na 2 HP0 4 , 0.4 mM KH 2 P0 4 , 4.2 mM NaHC0 3 , 1 mM CaCl 2 , 1 mM MgS0 4 , and 5.6 m t glucose (pH 7.4)) (HBSS) .
  • Hank's balanced salt solution 137 mM NaCl, 5.4 mM KC1,
  • Cells are collected by scraping and are suspended at about 750,000 cells/ml in HBSS with about 5 ⁇ M Fura-2 AM (Sigma-Aldrich). Cells are incubated at abo t 37 C for about 1 h in the dark, centrifuged, suspended in HBSS at about 750,000 cells/ml and used for calcium measurements A spectrofluoremeter with Felix software from Photon Technology International (Lawrenceville, NJ) is used for the fluorescence measurements and data- collection.
  • Octopamine has been demonstrated to modulate; intracellular calcium levels in cultured hemocytes of Malacosoma disstria. Also, in hemocytes from Periplaneta americana, octopamine lead to an increase in inositol triphosphate which likely will lead to increases in calcium in these cells as well . The ability of both octopamine and tyramine to modulate calcium levels in the HEK- 293 clone expressing Pa oai is determined. Neither about 10 ⁇ M octopamine nor about 10 ⁇ M tyramine modulates intracellular calcium levels in control HEK-293 cells transfected with pCDNA3 lacking an insert.
  • the Pa oai receptor is an octopamine receptor
  • the Pa oai receptor may be targeted to effect a disruptive change in intracellular levels of Ca 2+ , controlled targe-ting of the receptor allows for insect control, and the cell lines stably expressing the Pa oai recepto may be used to screen compounds and compositions for insect control activity.
  • Octopamine is found to increase both cAMP and calcium in HEK-293 cells expressing Pa oai and the calcium increase is detected immediately upon octopamine addition. As such, tine possibility that calcium is leading to a secondary increase in cAMP levels in the cells expressing Pa oai is tested.
  • the intracellular calcium chelator BAPTA/AM is used. BAPTA/AM at a out 20 ⁇ M is found to inhibit the increase in fi-ee intracellular calcium when about 1 ⁇ M octopamine is added to the Pa oai -expressing cells .
  • Octopamine-mediated changes in cAMP levels are compared in the absence and presence of about 20 ⁇ M BAPTA/AM.
  • cAMP levels following treatment with either about 100 nM or about 1 ⁇ M octopamine, as well as basal cAMP levels are not foun d to be statistically different, whether in the absence or presence of about 20 ⁇ M BAPTA/AM, as shown in Figure 8.
  • COS-7 cells expressing Pa oai and octopamine receptor' (OAMB) from Drosophila melanogaster are performed. See Bischof and Enan, 2004, Insect Biochem. Mol. Biol. 34. pp. 511-521, which is incorporated herein by this reference.
  • the data shown in Table B demonstrates that the affinity of Pa oai to the radioligand is about 1.5 fold higher than OAMB. Radioligand binding using 3 H- yohimbine is performed on membranes expressing either either Pa oai or OAMT3.
  • K d and B max a range of 3 H-yohimbine is used from 0.5 to 50 n M, and 50 ⁇ M phentolamine is used as a competitor to determine nonspecific binding.
  • Kj of octopamine 4 nM 3 H-yohimbine is used with a concentration range of octopanx ine that gives from 0 to 100%) competition.
  • OA (10 ⁇ M) increases the level of cAMP in HEK-293 cells permanently expressing either OAMB or Pa oai.
  • OA (10 ⁇ M) increases the level [Ca 2+ ] ⁇ in HEK-293 cells permanently expressing either OAMB or Pa oai, where HEK-293 cells expressing either receptor are incubated for 30s before the addition of 10 ⁇ M octopamine (OA).
  • the arrow in the figures indicates addition of the amine.
  • the fluorescence ratio determined from excitation with 340 and 380 run is plotted to indicate changes in [Ca 2+ ]j levels. These increases are mediated through the OAR as judged by the insignificant changes in cAMP level and [Ca 2+ ]j in cells transfected with an empty vector then treated with 10 ⁇ M OA (data not shown).
  • EXAMPLE 5 EFFECTS OF TREAMENT WITH PLANT ESSENTIAL OILS ON CELLS EXPRESSING THE OCTOPAMINE RECEPTOR
  • membranes isolated from COS-7 cells expressing the receptor are used for receptor binding studies and HEK-293 cells are used for cAMP and [Ca 2+ ] ⁇ studies.
  • Plant essential oils including: jc-cymene [methyl(l-methylethyl)benzene], eugenol [2-methoxy-4-(2- propenyl)phenol], trans-anethole [l-methoxy-4-(l-propenyl)benzene], cinnamic alcohol [3- phenyl-2-propen-l-ol], -terpineol [p-menth-l-en-8-ol], methyl salicylate [2-hydroxybenzoic acid methyl ester], 2-phenylethyl propionate, and geraniol [3,7-dimethyl-2,6-octadien-l-ol], are obtained from City Chemical (West Haven, CT) and tested for insect control activity. The chemical structures of these compounds are set forth in Figure 11.
  • A. RECEPTOR BINDING ACTIVITY The binding activity of 3 H-yohimbine to membranes expressing Pa oai or OAMB is performed in the presence and absence of three structurally related plant essential oil monoterpenoids, which are selected based on their insecticidal activity, the absence or presence and location of the hydroxyl group and a spacing group within the molecule.
  • Membrane protein (10 ⁇ ig) expressing Pa oai is incubated with 4 nM 3 H-yohimbine in the presence and absence of 50 ⁇ M of the test chemical.
  • the specific activity is calculated as the difference between counts in the presence and absence of test chemical.
  • Specific binding is calculated by determining nonspecific binding with 50 ⁇ M tested plant essential oils and subtracting nonspecific binding from total binding.
  • FIG. 13 depicts the effect of certain plant essential oils on cAMP levels in HEK-293 cells expressing either Pa oai or OAMB.
  • HEK-293 cells stably expressing either receptor are treated with 300 ⁇ tM IB MX and the effect of tested plant essential oils (50 ⁇ M) on basal cAMP levels is measured.
  • Eugenol (50 ⁇ M) significantly decreases the cAMP level (24%) in cells expressing Pa oai but slightly decreased cAMP level in cells expressing OAMB.
  • a 22% increase in cAMP level in cells expressing OAMB is found in response to treatment with (50 ⁇ M) trans-anethole. Cinnamic alcohol (50 ⁇ M) induces slight increase in cAMP level in both cell models.
  • Figures 14A-14F depict the effect of cinnamic alcohol ( Figures 14A and 14B), eugenol ( Figures 14C and 14D), and t-anethole ( Figures 14E and 14F) on intracellular calcium [Ca 2+ ]j levels in HEK-293 cells either transfected with Pa oai or OAMB.
  • HEK-293 cells are incubated for 30s before the addition of 25 ⁇ M tested agents.
  • the arrow in the figures indicates addition of tested agents.
  • the fluorescence ratio determined from excitation with 340 ran and 380 nm is plotted to indicate transient increase in [Ca 2+ ]j levels.
  • trans- anethole does not have a significant effect on binding to OAMB while eugenol and cinnamic alcohol do (Figure 12), only trans-anethole increases cAMP level (Figure 13) and [Ca 2" ' " ]j ( Figures 14A-14F) through OAMB.
  • EXAMPLE 6 TOXICITY TESTING AGAINST CERTAIN INSECT SPECIES Toxicity bioassay against the wild type Drosophila melanogaster fly and American cockroach is performed to address insect species specificity in response to certain plant essential oils and to determine whether the cellular changes in Pa oai and OAMB cell models in response to treatment with tested essential oils correlate with their insecticidal activity.
  • Drosophila melanogaster wild type strain is purchased from Carolina Biological Supply
  • Plant essential oils including: ⁇ -cymene [methyl(l-methylethyl)benzene], eugenol [2- m.ethoxy-4-(2-propenyl)phenol], trans-anethole [l-methoxy-4-(l-propenyl)benzene], cinnamic alcohol [3-phenyl-2-propen-l-ol], ⁇ -terpineol [p-menth-l-en-8-ol], methyl salicylate [2- hydroxybenzoic acid methyl ester], 2-phenylethyl propionate, and geraniol [3,7-dimethyI-2,6- octadien-1-ol], are obtained from City Chemical (West Haven, CT) and tested for insect control activity.
  • ⁇ -cymene methyl(l-methylethyl)benzene]
  • eugenol 2- m.ethoxy-4-(2-propenyl)phenol
  • FIG. 1 The chemical structures of these compounds are set forth in Figure 1 1.
  • Acetonic solutions of plant essential oils are prepared and different concentrations of each, that give from 10% - 100% mortality, are applied by topical application. Controls are treated with the same volume (0.5 ⁇ l/insect) of acetone. Replicates, with 5 insects per replicate, are used for each concentration. The mortality is calculated 24 hours after treatment. Data are subjected to probit analysis to determine LD50 value for each compound. See Finney, 1971, Probit Analysis, 3 rd Ed., Cambridge University Press, London, pg. 333.
  • octopamine/octopamine receptor (OA/OAR) system is involved in the toxicity of tested plant essential oils
  • octopamine synthesis mutant (iav) Drosophila melanogaster strain is topically treated with a dose equivalent to the determined LD 50 for wild type strain.
  • the LD50 values of eight monoterpenoid plant essential oils p-cymene, eugenol, trans-anethole, cinnamic alcohol, ⁇ -terpineol, methyl salicylate, phenylethyl propionate, and geraniol
  • Controls are treated with the same volume (0.5 ⁇ l/fly) of acetone. The mortality is calculated 24 hour after treatment. Multiple replicates and 5 flies per replicate are used for the bioassay of each chemical. Data are subjected to probit analysis to determine LDso value for each chemical. See Finney, 1971.
  • LD 50 1.65 ⁇ g/fly
  • Eugenol is about 2-fold and about 27-fold more toxic against American cockroach than cinnamic alcohol and trans-anethole, respectively.
  • the toxicity data demonstrates significant differences between the toxicity of the tested chemicals against each insect (Table C).
  • the toxicity data also demonstrates differences between the two insects in response to each chemical.
  • the toxicity data against wild type and octopamine mutant (iav) fruit fly suggests that the toxicity of cinnamic alcohol, eugenol and trans-anethol is mediated through octopamine/octopamine receptors system.
  • certain other plant essential oils tested against both strains of fruit fly only the toxicity of 2-phenylethyl propionate is mediated through octopamine receptors.
  • the octopamine receptor mediates the insecticidal properties of cinnamic alcohol, eugenol, trans-anethole and 2-phenylethyl propionate and, in part, the toxicity of ⁇ -terpineol against Drosophila melanogaster fly. Furthermore, it appears that the presence of an electronegative group such as hydroxyl group, and different spacing groups, may be required for the insecticidal activity of plant essential oils through octopamine receptor. * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Insects & Arthropods (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Endocrinology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

A screening method for identifying compounds that are effective insect control agents includes providing cells expressing an octopamine receptor, adding the compounds to the cells, and measuring the effects of the compounds and compositions. The effects of the compounds may be determined by measuring the binding affinity of the compounds to the octopamine receptor or measuring the change in intracellular cAMP or Ca2+ levels.

Description

COMPOSITIONS AND METHODS FOR CONTROLLING INSECTS RELATED TO THE OCTOPAMINE RECEPTOR
FIELD OF THE INVENTION The present invention relates to compounds, compositions and method for controlling insects.
BACKGROUND OF THE INVENTION Animals have chemosensory and mechanosensory systems that recognize a large array of environmental stimuli, generating behavioral responses. Many behavioral studies have been conducted to understand the genetics of these systems. The olfactory system plays a crucial role in the survival and maintenance of species, particularly in insects. Biogenic amines serve a neurotransmitter or neuromodulator role in the olfactory system. The biogenic amine, octopamine, has a prominent role in insects and other invertebrates as it is involved in the regulation of multiple physiological events, for example, effects on muscular systems, sensory organs, endocrine tissues as well as learning and behavior. Octopamine (OA) occurs in large amounts in the nervous systems of species representing the phylum Arthropoda, including the classes Insecta and Crustacea. OA has a broad spectrum of biological roles in insects acting as a neurotransmitter, neurohormone and neuromodulator. OA exerts its effects through interaction with at least four classes of membrane bound receptors that belong to the family of G-protein coupled receptors (GPCRs). All members of GPCRs share the common motif of seven transmembrane (TM) domains.
When a GPCR is activated, depending on its type and the protein to which it binds, changes in intracellular concentrations of cAMP, Ca2+ or both often take place. Since changes in intracellular levels of cAMP or Ca2+ are the most commonly found cellular responses to biogenic amine treatments (e.g., serotonin, dopamine, octopamine, etc.), they are used to functionally classify receptor subtypes. As a result of GPCR activation, intracellular cAMP levels can either be elevated or reduced. The cellular response strictly relies on the specificity of interactioxi between the receptor and the G protein (See e.g.. Gudermann T, Kalkbrenner F, Schultz G- . 1996, "Diversity and selectivity of receptor-G protein interaction," Annu Rev Pharmacol Toxico> 1 36: 429-459; and Gudermann T, Schoneberg T, Schultz G. 1997, "Functional and structural complexity of signal transduction via G-protein-coupled receptors," Annu Rev Neurosci 2 0: 399- 427, both of which are incorporated herein by this reference). When the receptor binds to Gs-type protein, the activated Gas subunit will interact with adenylyl cyclase (AC) in the plasma membrane. This leads to an increase of AC activity and production of cAMP from ATP. Several biogenic amine receptors are also known to inhibit AC activity. This effect is mediated by interaction of the receptor with inhibitory G protein (Gi). Interaction of AC with activated Gαi subunits most likely competes with binding of activated Gas subunits and thtereby interferes with AC activation. Another pathway that is activated by several biogenic amine receptors results in a rise of intracellular Ca2+ levels. In such a scenario the amine-activated receptor binds to G protei τιs of the Gq/o family (See e.g., supra, Gudermann et al., 1996 and Gudermann et al., 1997). Tlx e activated Gαq/o subunits bind to and stimulate phospholipase C (PLC) activity. The enzyme hydrolyzes a membrane-bound substrate, phosphatidylinositol 4,5-bisphosphate which gives rise to two second messengers IP3 and DAG. After binding of IP3 to its receptors, the calcium channel pore is opened and Ca2+ is released into the cytoplasm. Ca2+ ions play a vital role in the regulation of many cellular functions by binding to members of large family of Ca2+-bindix g proteins and/or directly controlling enzymatic or ion channel activities. Multiple insect species have been utilized to understand the biological functions arid pharmacological characteristics of octopamine receptors. Studies with Periplaneta ameήcana (American cockroach) have provided insight into the pharmacology and second messenger signaling of octopamine through octopamine receptors. For example, octopamine has been found to activate adenylate cyclase in certain cells in this species. Furthermore, octopamine has been found to increase inositol triphosphates in certain cells in this species.
As the octopaminergic system is believed to be unique to invertebrate physiology, this pathway has been proposed to offer a target for invertebrate pesticides with potential for low vertebrate toxicity. Formamidine-like chemicals have been found to be octopaminergic agonists and inhibit the uptake of sodium-sensitive octopamine in certain insects; for example, the formamidine pesticides chlordimeform and demethylchloridimeform were found to target the octopamine signaling pathway in certain invertebrates, including Periplaneta americana. To provide insight into the design of octopamine agonists that could be used as potential insecticides, structure function analyses have been performed with 2-(arylimino)oxazolidines and 2- (substituted benzylamino)-2-oxazolines in regard to activation of the octopamine sensitive adenylate cyclase in certain cells in Periplaneta Americana. More recently, it has been suggested that one site of action for the insecticidal activity of plant essential oils against Periplaneta americana is the octopaminergic system and that octopamine receptors may be targeted by these compounds, as described in Enan, E., 2001, "Insecticidal activity of essential oils: octopaminergic sites of action," Comp. Biochem. Phvsiol. C Toxicol. Pharmacol. 130, 325-327, which is incorporated herein by this reference.
Identifying plant essential oils and combinations thereof, having insect-controlling activity is particularly desirable given that many such compounds do not produce unwanted or harmful affects on humans, other animal species, and certain plants. However, identifying the most effective plant essential oils and combinations thereof requires random selection and use of tedious screening methods, which, given the vast number of plant essential oils and possible combinations thereof, is a substantially impossible task. As such, there is a need in the art for an improved method for screening compounds and compositions for insect control activity.
SUMMARY OF THE PRESENT INVENTION The present invention addresses the above identified problems, and others, by providing a screening method for identifying compounds and compositions that are effective insect control agents; a screening method for identifying compounds and compositions that are effective species-specific insect control agents; compounds and compositions isolated from the screening methods; cell lines expressing an octopamine receptor; and isolated nucleic acid molecule sequences.
DESCRIPTION OF THE DRAWINGS Figure 1A is an alignment of the nucleic acid sequence and the translated amino acid sequence from Pa oa,, of SEQ ID NO: 1 and SEQ ID NO: 2; Figure IB is the nucleic acid sequence from Pa oai of SEQ ID NO: 1, with the seven putative transmembrane domains (TM) overlined and numbered 1 through 7, the stop codons (SC) underlined, and the initiation codon (M) underlined; Figure 2 is an alignment of the translated amino acid sequences of Pa oaj of SEQ ID NO: 2 and OAMB of SEQ ID NO: 3, with the seven putative transmembrane domains (TM) overlined and numbered 1 through 7; Figure 3A is saturation binding curve of JH-yohimbine to Pa oaj, where total binding is designated by the squares, nonspecific binding is designated by the triangle, and specific binding is designated by the inverted triangle; Figure 3B is saturation binding curve of 3H-yohimbine to OAMB, where total binding is designated by the squares, nonspecific binding is designated by the triangle, and specific binding is designated by the inverted triangle; Figure 4 is a hydropathy profile of Pa oai with the transmembrane domains (TM) numbered 1 through 7; Figure 5 depicts the similarity between octopamine and tyramine receptors from different insect species; Figure 6 is a graph depicting the change of intracellular cAMP levels in HEK-293 cells expressing Pa oai in response to treatment with various concentrations of either octopamine (OA) or tyramine (TA); and Figures 7 is a graph depicting the change in intracellular calcium levels in HEK-293 cells expressing Pa oai in response to treatment with either 100 nM octopamine (OA) or 100 nM tyramine (TA); Figure 8 is a bar graph depicting the change in intracellular cAMP levels in HEK-293 expressing Pa oai in response to treatment with 0, 100 nM, or 1 μM octopamine (OA) in the presence and absence of 20 μM BAPTA/AM, a calcium chelator; Figure 9 is a bar graph depicting the cAMP response to octopamine through Pa oai and OAMB expressed in HEK-293 cells where the cells expressing either receptor are treated with 10 μM octopamine and the level of cAMP is determined; Figures 10A and 10B are graphs depicting the calcium response to octopamine through Pa oai and OAMB, respectively, expressed in HEK-293 cells; Figure 11 is a depiction of the chemical structures ofp-cymene [methyl(l - methylethyl)benzene], eugenol [2-methoxy-4-(2-propenyl)phenol], trans-anethole [ 1 -methoxy-4- (l-propenyl)benzene], cinnamic alcohol [3-phenyl-2-propen-l-ol], α-terpineol [p-menth-l-en-8- ol], methyl salicylate [2-hydroxybenzoic acid methyl ester], 2-phenylethyl propionate, and geraniol [3,7-dimethyl-2,6-octadien-l-ol]; Figure 12 is a bar graph depicting the effect of certain plant essential oils on specific binding of 3H-yohimbine to Pa oai and OAMB; Figure 13 is a bar graph depicting the effect of certain plant essential oils on cAMP levels in HEK-293 cells expressing either Pa oai or OAMB; and Figures 14A-14F are graphs depicting the effect of certain plant essential oils on intracellular calcium [Ca2+]i levels in HEK-293 cells either transfected with Pa oai or OAMB.
DETAILED DESCRIPTION OF THE INVENTION The present invention includes: a screening method for identifying compounds and compositions that are effective insect control agents; a screening method for identifying compounds and compositions that are effective species-specific insect control agents; compounds and compositions isolated from the screening methods; transfected cell lines; and isolated nucleic acid molecule sequences. The present invention includes: an isolated nucleic acid molecule sequence which encodes a protein that binds a biogenic amine, resulting in changes in intracellular concentrations of cAMP, Ca2+, or both, having a nucleotide sequence of SEQ ID NO: 1, or a fragment or derivative thereof and/or having an amino acid sequence of SEQ ID NO: 2, or a fragment or derivative thereof; an isolated nucleic acid molecule of having at least about 30% similarity to the nucleotide sequence of SEQ ID NO: 1 , wherein the isolated nucleic acid molecule encodes a protein, resulting in changes in intracellular concentrations of cAMP, Ca2+, or both; an isolated nucleic acid molecule of having at least about 30% similarity to the nucleotide sequence of SEQ ID NO: 1, wherein the molecule encodes an octopamine receptor or a protein having an amino acid sequence of SEQ ID NO: 2, or a fragment or derivative thereof; and an isolated nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 1, or a fragment or derivative thereof, wherein the molecule encodes a protein designated Pa oai. SEQ ID NO: 1 and SEQ ID NO: 2 are shown in alignment in Figure 1A and SEQ ID NO: 1 is also provided in Figure 1 B. Fragments and derivatives of the sequences shall include transmembrane domains (TM) 3, 5 and 6. Fragments and derivatives of the sequences may exclude, for example, portions upstream of TM 1, portions upstream of TM 2, or portions downstream of TM 7. The present invention also includes: a strain of cells including a DNA vector having a nucleic acid sequence of SEQ ID NO:l; a strain of cells expressing an octopamine receptor cloned from an insect species of interest; a strain of cells expressing an octopamine receptor cloned from Periplaneta Americana (Pa oai); a strain of cells expressing a protein having an amino acid sequence of SEQ ID NO: 2, or fragments or derivatives thereof, wherein the fragments or derivatives thereof bind octopamine; a strain of cells expressing an octopamine receptor cloned from Drosophila melanogaster (OAMB); a strain of cells expressing a protein having an amino acid sequence of SEQ ID NO: 3, or fragments or derivatives thereof, wherein the fragments or derivatives thereof bind octopamine. The transfected cells may be mammalian cells or insect cells; for example, they may be African green monkey kidney COS-7 cells (COS-7 cells) or human embryonic kidney-293 cells (HEK-293 cells). The present invention also includes a screening method of using a cell line expressing an octopamine receptor to identify compounds and compositions that are effective insect control agents. For example, the octopamine receptor expressed by the cell line may be Pa oai ; or have an amino acid sequence of SEQ ID NO: 2, or fragments or derivatives thereof, wherein the fragments or derivatives thereof bind octopamine. The present invention also includes a method of using multiple cell lines, wherein the cell lines are transfected with octopamine receptors from different insect species of interest, to identify compounds and compositions that are effective species-specific insect control agents. For example, a cell line expressing Pa oai and a cell line expressing OAMB could be used to screen compounds and compositions having insect control activity which is specific to Periplaneta Americana or to Drosophila melanogaster. The present invention also includes compounds and compositions having the ability to control target insects, which compounds and/or compositions are identified using the screening methods of the present invention. These compounds and/or compositions may include compounds that are general regarded as safe (GRAS compounds) meaning that they do not produce unwanted or harmful affects on humans and other non-target animal species and that they are exempt from the Environmental Protection Agency's (EPA) pesticide registration requirements. The compounds and/or compositions of the present invention include certain plant essential oils identified using the screening methods of the present invention. The compounds and compositions of the present invention control insects by targeting an octopamine receptor, resulting in a disruptive change in the intracellular levels of cAMP, Ca2+ or both. For purposes of simplicity, the term insect has been and shall be used through out this application; however, it should be understood that the term insect refers, not only to insects, but also to arachnids, larvae, and like invertebrates. Also for purposes of this application, the term "insect control" shall refer to repelling or killing an insect. The present invention is further illustrated by the following specific but non-limiting examples.
EXAMPLE 1 PREPARATION OF STABLY TRANSFECTED COS-7 CELL LINES and HEK-293 CELL LINES WITH OCTOPAMINE RECEPTOR
ISOLATION OF A cDNA ENCODING A G-PROTEIN-COUPLED RECEPTOR FROM PERIPLANETA AMERICANA
G protein-coupled receptors from insects and a tick that are demonstrated to be octopamine receptors or have significant DNA similarity to known octopamine receptors are aligned using the program DNAStar (Ma). The following degenerate oligonucleotides are designed based on this alignment: Transmembrane (TM) VI oligonucleotide 5 ACAAGCTTTG(C, T)TGG(C, T) (G, T) (A. C, G. T)CC(A, C. G. TTCTT31 (SEQ ID NO: 4), and TM VII oligonucleotide 5'CATGCGGCCGCTTT(A, C, G, T) (A, C) (A, C) (A. GVTAfA. C. G T)CC(A. OAGCCA3' (SEQ ID NO: 5). The underlined sequence corresponds to the TM regions.
The TM VI oligonucleotide contains a HindlH site and the TM VII oligonucleotide contains a Not1/ site flanking the TM sequences. Total RΝA from the heads of mixed sex adult American cockroaches that have the antennae excised is prepared by ultracentrifugation through cesium chloride, as described in Chirgwin et al, 18 Biochemistry 5294-5299 (1979), and is reverse transcribed into cDΝA using random hexamers and murine leukemia virus reverse transcriptase (Applied Biosystems, Foster City, CA). The polymerase chain reaction (PCR) is performed on this cDΝA using AmpliTaq polymerase (Applied Biosystems) and the TM VI and VII oligonucleotides at final concentrations of about 5 μM. The reaction conditions are about 95 °C, about 5 min for about one cycle; about 95 °C, about 45 s, about 40 °C, about 2 min, about 72 °C, about 30 s for about three cycles; about 95 °C, about 45 s, about 55 C, about 2 min; about 72 °C, about 30 s for about 37 cycles; and about 72 "C, about 10 min for about one cycle. Products are digested with Hindlll and Noll and ligated into pBK-RSV (Stratagene, La Jolla, CA). Inserts are sequenced and compared to known genes by searching the NCBI database with the Blast program.
To obtain the corresponding cDNA for an approximately 101 nucleotide fragment with the highest similarity to octopamine receptors from other species, 5' and 3' rapid amplification of cDNA ends (RACE) are performed using the SMART RACE cDNA amplification system (Clontech, Palo Alto, CA). Poly(A) RNA is prepared from total RNA isolated from the head of Periplaneta americana using an oligo-dT column as per the manufacturer's protocol (Amersham Biosciences, Piscataway, NJ). The poly(A) RNA is used as template in the RACE reverse transcription reaction for production of 5' and 3' RACE cDNA as per the manufacturer's instructions. The gene specific oligonucleotides used for the RACE PCR are 5' RACE oligonucleotide 5'CAGTAGCCCAGCCAGAAGAGGACGGAGAAG3' (SEQ ID NO: 6), and 3' RACE oligonucleotide 5 'GCTGGCTGCCGTTCTTCACCATGTACCTGG3' (SEQ ID NO: 7). 5' RACE and 3' RACE polymerase chain reactions are each about 50 μl and consist of about 2.5 μl of the respective cDNA reaction, about 0.2 μM of the gene specific oligonucleotide and the additional RACE components including Advantage 2 polymerase as per the manufacturer (Clontech). The cycling conditions for the 5' RACE are about 95 °C, about 1 min for about one cycle; about 94 C, about 20 s, about 72 C, about 3 min for about five cycles; about 94 C, about 20 s, about 70 °C, about 10 s, about 72 C, about 3 min for about five cycles; about 94 C, about 20 s, about 68 °C, about 10 s, about 72 °C, about 3 min for about 32 cycles; and about 72 °C, about 10 min for about one cycle.
An approximately 1.9 kb product is gel purified and further, amplified using the same oligonucleotides, Advantage 2 polymerase and cycling parameters of about 95 °C, about 3 min for about one cycle; about 94 °C, about 20 s, about 68 °C, about 10 s, about 72 °C, about 3 min for about 35 cycles; and about 72 °C, about 10 min for about one cycle. To facilitate T/A ligation, the product is A-tailed by precipitating with ethanol, resuspending in 1 x PCR Buffer II (Applied Biosystems), 2 mM MgCl2, 1 inM dATP and 0.05 U AmpliTaq per μl and incubating at about 72 °C for about 15 min. The PCR product is ligated into pBK-RSV (Stratagene) that has been digested with Smal and T-tailed using dTTP and AmpliTaq. The insert is sequenced on both strands by automated fluorescent DNA sequencing (Vanderbilt Cancer Center).
The cycling conditions for the 3' RACE reaction are about 95 C, about 1 min for about one cycle; about 94 °C, about 5 s, about 72 C, about 3 min for about five cycles; about 94 °C, about 5 s, about 70 C, about 10 s, about 72 C, about 3 min for about five cycles; about 94 C, about 5 s, about 68 °C, about 10 s, about 72 C, about 3 min for about 32 cycles; and about 72 °C, about 10 min for about one cycle The product of this reaction is A-tailed, subcloned and sequenced as for the 5' RACE product.
B. GENERATION OF THE OPEN READING FRAME FOR OCTOPAMINE RECEPTOR (Pa oai)
Oligonucleotides used to amplify the open reading frame are a sense oligonucleotide 5' CAGGAATTCATGAGGGACGGGGTTATGAACGCTAG 3 ' (SEQ ID NO: 8), and an antisense oligonucleotide 5' GCTTCTAGATCACCTGGAGTCCGATCCATCGTTG 3' (SEQ ID NO: 9) Sequences corresponding to the open reading frame are underlined. The sense oligonucleotide contains an EcoRI restriction site and the antisense oligonucleotide an Xbal restriction site These oligonucleotides are used in a polymerase chain reaction that included the 5 'RACE cD A as template and VENT polymerase (New England Biolabs, Beverly, MA).
The product is subcloned into the plasmid pAc5.1/V5-His (Invitrogen Life Technologies, Carlsbad, CA) at the EcoRI and Xbal restriction sites and sequenced. This plasmid is designated pAc-Pa oai For mammalian cell expression, a Kozak sequence is inserted using a sense oligonucleotide 5'ACAGAATTCGCCACCATGAGGGACGGGGTTATGAACGCTAG 3' (SEQ ID NO: 10) and an internal antisense oligonucleotide that contains an Xlwl 5" TTGACGGCGCTCGAGGACGTC 3' (SEQ ID NO: 11) The sense oligonucleotide contains an EcoRI site These oligonucleotides are used in a polymerase chain reaction that includes pAc-Pa oai as template and VENT polymerase The product is inserted at EcoRI and Xltol sites into pAc- Pa oai, in which the corresponding EcoRI and Xhol fragment have been removed The product is sequenced The entire open reading frame is then transferred into pCDNA3 (Invitrogen Life Technologies, Carlsbad, CA) at EcoRI and Apal restriction sites, and this plasmid is designated pCDNA3-Pa oaι.
C. AMPLIFICATION AND SUBCLONING OF OAMB, AN OCTOPAMINE RECEPTOR FROM THE FRUIT FLY, DROSOPHILA MELANOGASTER The Drosophila melanogaster head cD A phage library GH is obtained through the
Berkeley Drosophila Genome Project (www.fruitfly.org) Phage DNA is purified from this library using a liquid culture lysate as described in Lech, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., pp. 1 (2001) Oligonucleotides designed to amplify the open reading frame of Drosophila melanogaster OAMB consist of the sense oligonucleotide 5' CAGGAATTCGCCACCATGAATGAAACAGAGTGCGAGGATCTC 3' (SEQ ID NO: 12) and the antisense oligonucleotide 5' AATGCGGCCGCTCAGCTGAAGTCCACGCCCTCG 3' (SEQ ID NO: 13) Sequences corresponding to the open reading frame are underlined A Kozak sequence is included in the sense oligonucleotide In addition, the 5' oligonucleotide includes an EcoRI restriction site and the 3" oligonucleotide a Notl site For amplification by the polymerase chain reaction, about 200 ng of the GH library DNA is used as template with about 0.5 μM of each oligonucleotide and VENT DNA polymerase (New England Biolabs). Cycling conditions are about 95 C, about 5 min for about one cycle; about 95 °C, about 30 s and about 70 °C, about 1.5 min for about 40 cycles; and about 70 °C, about 10 min for about one cycle. The product is digested with EcoRI and Notl, ligated into pCDNA3 and sequenced on both strands by automated fluorescent DNA sequencing (Vanderbilt Cancer Center).
D. ISOLATION OF cDNA ENCODING OCTOPAMINE RECEPTOR (Pa oa,)
A polymerase chain reaction with degenerate oligonucleotides corresponding to regions of TM VI and TM VII of previously identified octopamine receptors is used to isolate an approximately 101 nucleotide fragment of cDTMA from the head of Periplaneta americana. This cDNA fragment is used to design gene specific oligonucleotides to amplify the full-length cDNA of the corresponding gene by RACE. This method generates overlapping 5' and 31 segments that include the original cDNA fragment from TM VI to TM VII indicating these segments originate from the same cDNA. The cDNA includes an approximately 1887 nucleotide open reading frame and 5' and 3' untranslated regions (Genbank accession number is AY333178). The predicted initiation codon is preceded by an in-frame stop codon, indicating that the 5' end of the open reading frame is included in the cDNA and that the encoded protein will be full length. This cDNA and encoded protein are designated Pa oai. The open reading frame encodes a protein of approximately 628 amino acids with a predicted molecular mass of about 68,642 Da. Hydropathy analysis by the method described in Kyte et al, J. Mol. Biol. 157, 105-132 (1982), with a window of about nine amino acids indicates about seven potential transmembrane spanning domains. In addition, a protein BLAST search finds similarity of Pa oai to the rhodopsin family of 7 transmembrane G protein-coupled receptors contained within the conserved domain database The BLAST analysis also indicates Pa oai, is most similar to other biogenic amine receptors. As mentioned above, all members of GPCRs share the common motif of seven transmembrane (TM) domains. Of these seven domains, TM 3, 5 and 6 comprise the binding sites. Compared to proteins with defined functions, Pa oai is most closely related to OAMB, an octopamine receptor from the fruit fly Drosophila melanogaster and to Lym- oai , an octopamine receptor from the pond snail Lymnaea stagnalis). Sequence similarity is also detected with vertebrate αlA adrenergic receptors and invertebrate tyramine receptors. Protein alignment indicates Pa oai is about 51% identical to OAMB, 37% identical to Lym oai, and about 27% identical to both the insect tyramine receptors Tyr-Loc from Locusta migratoria and Tyr-Dro from Drosophila melanogaster. Sequence conservation between Pa oai, OAMB and Lym oai, is greatest within the TM domains, as shown in Figure 2. The regions of lowest similarity among these three proteins are in the amino terminus extending into TM 1, extracellular loop 2 (between TM IV and V), intracellular loop 3 (between TM V and VI) and the carboxyl termini following TM VII.
E. CELL CULTUREAND TRANSFECTION OF CELLS Cell culture reagents may be obtained from Sigma-Aldrich (St. Louis, MO), or as otherwise indicated, African green monkey kidney COS-7 cells and human embryonic kidney (HEK)-293 cells are obtained from American Type Culture Collection (Manassas, VA). COS-7 cells are grown in Dulbecco's modified Eagle's medium (about 4.5 g glucose/1) and about 10% fetal bovine serum. HEK-293 cells are grown in Dulbecco's modified Eagle's medium (about lg glucose/1), about 5% fetal bovine serum and about 5% newborn calf serum Both types of media are supplemented with about 100 U penicillin G/ml, about 100 μg streptomycin/ml and about 0.25 μg amphotericin B/ml) except during Lipofectamine 2000 transfections. Lipofectamine 2000 and Opti-MEM I media may be obtained from Invitrogen Life Technologies (Carlsbad, CA). COS-7 cells are transiently transfected using Lipofectamine 2000. Cells are plated at about 1.5 x 106 cells per dish (about 55 cm2) in about 10 ml growth medium without antibiotics the day before transfection. For each dish, about 30 μl Lipofectamine 2000 in about 1 ml Opti-MEM I medium is mixed with about 12 μg plasmid DNA in about 1 ml Opti- MEM I medium and added to the cells after an approximately 20 min incubation at room temperature. The cells are harvested for membrane preparation 24 h following transfection.
For stable transfections of HEK-293 cells, about 1 x 106 cells in about 2.5 ml growth media without antibiotics are plated into dishes (about 10 cm") the day before transfection, For transfection, about 10 μl Lipofectamine 2000 is added to about 250 μl Opti-MEM I medium. This is mixed with about 4 μg plasmid DNA in about 250 pi OptiMEM I medium. After an approximately 20 min incubation at room temperature, the approximately 500 μl of solution is added to cells in a single dish. Cells are split about 24 h after transfection into growth media containing about 0.8 mg G418 sulfate/ml (Mediatech Inc., Heradon, VA). Clonal lines are selected and assayed for receptor expression with whole cell binding by incubating about 500,000 cells in about 1 ml phosphate buffered saline (PBS; 137 mMNaCl, 2.7 mM KC1, 10 mM Na2HP0 , 1.4 mM KH2P04 (pH 7.4)) with about 2 nM 3H-yohimbine for about 30 min at about 27 °C. Cells are pelleted by centrifugation, washed with PBS, and then transferred to scintillation vials. Nonspecific binding is determined by including about 50 μM phentolamine in the binding reaction.
F. EFFICACY OF CELLS LINES TRANSFECTED WITH OCTOPAMINE RECEPTORS FOR SCREENING COMPOUNDS AND COMPOSITIONS FOR OCTOPAMINE RECEPTOR INTERACTION All steps are performed at about 4 C or on ice Cells are harvested in growth media by scraping from the dishes and then rinsing dishes with PBS The cells are centrifuged at about lOOOg for about 3 min, washed with PBS and centrifuged again The cells are suspended in ice cold hypotonic buffer (10 mM Tris-CI (pH 7.4)), incubated on ice for about 10 min, and Iysed using a glass dounce homogenizer and tight glass pestle (Kontes Glass Co., Vineland, NJ) with about 10 strokes Nuclei are pelleted by centrifugation at about 600g for about 5 min The supernatant is decanted and centrifuged at about 30,000g for about 30 min to pellet a crude membrane fraction The pellet is suspended, in binding buffer (50 mM Tris-CI, 5 mM MgCl (pH 7.4)) Protein concentration is determined by the Bradford assay (Bio-Rad Laboratories, Hercules, CA) Membranes are frozen on dry ice and stored at about -75 °C in aliquots.
Antagonists and biogenic amines are obtained from Sigma- Aldrich (St Louis, MO). Octopamine is the mixed isomeric form DL-octopamine 3H-yohimbine is obtained from Perkin Elmer Life Sciences (Boston, MA) Radioligand binding is performed with about 7.5-15 μg membrane protein in about 250 μl binding buffer for about 30 min at about 27 °C while shaking at about 100 rpm Reactions are terminated by addition of about 3 ml ice cold binding buffer and filtered over GF/C filters (Whatman International, Maidstone, England) that have been soaked for about 30 min in about 0.3% polyethylenimine (Sigma-Aldrich) Filters are rinsed again with about 3 ml binding buffer For the determination of Ka and Bma , a range of 3H-yohimbine is used from about 0.5 to 50 nM, and about 50 μM phentolamine is used as a competitor to determine nonspecific binding To determine K„ of different ligands, about 2 nM 3H-yohimbine is used with a concentration range of competitor that gives from 0% to 100% competition Binding data is analyzed by nonlinear regression using the software GraphPad Prism (San Diego, CA)
For pharmacological binding experiments, Pa oaj, is expressed in COS-7 cells by transient transfection. Membrane fractions are analyzed to determine total, nonspecific and specific binding of H-yohimbine, as shown in Figure 3A. The Kd and Bmax for specific binding are determined to be about 28.4 nM and about 11.8 pmol/mg protein, respectively. Membrane fractions from COS-7 cells transiently transfected with empty pCDNA3 do not demonstrate specific binding. The high affinity binding of 3H-yohimbine by Pa oai indicate that this is a suitable ligand to be used for competition binding experiments.
The octopamine receptor OAMB from Drosophila melanogaster is amplified by the polymerase chain reaction. Saturation binding analysis with 3H-yohimbine is performed with OAMB expressed in COS-7 cells, as shown in Figure 3B. The Kd and Bmax are determined to be about 43.0 nM and about 8.04 pmol/mg, respectively. Competitive binding with various biogenic amines is utilized to determine the affinities for potential natural ligands of Pa oai. Referring now to Table A, below, DL-Octopamine has the lowest Kj (about 13.3 μM) for Pa oai followed by tyramine (about 31.0 μM). The decreasing order of affinity for the biogenic amines is octopamine > tyramine > dopamine > serotonin. The binding affinities for octopamine and tyramine are determined for this receptor. The K, (mean ± standard deviation) of octopamine and tyramine for OAMB are about 8.20 ±2.60μM and about 33.8 ± 7.93 μM, respectively. These values are similar to those obtained for Pa oai. The affinity of octopamine is about 2.3-fold higher than tyramine for Pa oai, and for OAMB, the affinity of octopamine is about 4.1 -fold higher than tyramine, indicating that octopamine is the likely endogenous ligand for Pa oai.
Phentolamine 0.023 ± 0.009 Mianserin 0.048 ± 0.013 Metoclopramine 4.76 ± 1.32 Table A
In addition to using the affinity of octopamine receptors for specific antagonists as a method for classifying these receptors, antagonists may be used to analyze the effects of octopamine on adenylate cyclase activity in the brain, ventral nerve cord and hemocytes of Periplaneta americana. A pharmacological profile is developed for Pa oai using these , antagonists. With reference to Table A, in order of decreasing affinity, the profile of the antagonists is chlorpromazine > phentolamine > mianserin > metoclopramide.
EXAMPLE 2 STRUCTURAL FEATURES OF CLONED AMERICAN COCKROACH OCTOPAMINE RECEPTOR (Pa oai) The Pa oai cDNA of 2268 bp which includes an 1887 nucleotide open reading frame and 5' and 3' untranslated regions is set forth in Figures 1A, IB and SEQ ID NO: 1. With reference to Figure IB, the predicted initiation codon (M) is preceded by an in-frame stop codon (SC). This indicates that the 5' end of the open reading frame is included in the cDNA and that the encoded protein would be full length.
With reference to Figure 4, hydropathy analysis by the method of Kyte and Doolittle with a window of 9 amino acids indicates that this sequence shares the common motif of 7 potential transmembrane scanning domains. See Kyte and Doolittle, 1982, J. Mol. Biol. 157, 105- 132. A phylogenic comparison of invertebrate biogenic amine receptor sequences reveals that both OAMB and Pa oai sequences share ~ 45% similarity, which is illustrated in Figure 5. Pa oai clusters with octopamine and tyramine receptors from different insect species. Similarity between these receptors is analyzed using BLAST search and calculated based on protein alignment using DNASTAR software program. Pa oai is used as a reference for comparisons with other receptors.
With reference to Figure 2, protein alignment indicates sequence conservation between Pa oai and OAMB is greatest within the transmembrane domains (TMs). The regions of loλvest similarity among these two proteins are in the amino terminus extending into TM 1 , extracellular loop2 between TM4 and TM5, intracellular loop between T7M5 and TM6 and the carboxy termini following TM7.
EXAMPLE 3
EFFECTS OF TREATMENT WITH OCTOPAMINE ON CELLS EXPRESSING THE OCTOPAMINE RECEPTO-R (Pa oa
A. EFFECT OF TREATMENT ON [cAMP] Twenty-four hours before cell treatment, about 300-, 000 HEK-293 cells are plated in about 1 ml media with about 0.8 mg G418/ml into multi-well dishes (e.g., 12-well, 4.5 cm2). For cell treatment, the media is aspirated and about 1 ml PBS with about 300 μM IB MX and the test reagent is added. Cells are incubated at about 37 °C for about 20 min, and the PBS is then aspirated. Cells are incubated with about 70% ethanol for a-hout 1 h at about -20 °C The cellular debris is centrifuged and then the supernatant is removed and lyophilized to dryness. The amount of cAMP in the extract is determined by using a cAMP binding protein from the 5H-cAMP Biotrak assay system (Amersham Biosciences) as per the manufacturer's instructions. To test the effects of calcium chelation on cAMP levels, the cells are incubated with about 20 μ 1 V 1 BAPTA/AM (Calbiochem Biochemicals, La Jolla, CA) for about 10 min before the addition of the test reagents. Octopamine has been demonstrated to increase levels of the second messenger cAMP in brain, thoracic ganglion and hemocytes from Periplaneta americana. To determine which second messenger signaling pathways octopamine could affect through the Pa oai receptor, HEK-293 cells are stably transfected with pCDNA3-Pa oai or pCDNA3 without an insert as a control In the control HEK-293 cells, neither DL-octopamine nor tyramine at concentrations up to about 100 μM has significant effects on cAMP levels.
A clone transfected with pCDNA3-Pa oai having a high specific binding to 3H-yohimbine is selected for second messenger analysis. Both octopamine and tyramine are able to increase the levels of cAMP in these cells in a dose dependent manner, as shown in Figure 6. The EC50S for the octopamine and tyramine mediated increases in cAMP are about 1.62 and 97.7μM, respectively (p < 0.05). Octopamine is more potent than tyramine in the cAMP response as a statistically significant increase in cAMP over the basal level (about 0.48 pmol cAMP) is first detected with about 10 nM octopamine (about 1.2 pmol cAMP) (p < 0.05). The cAMP concentration with about 10 nM tyramine is about 0.50 pmol cAMP, and therefore not statistically significant from the basal level (p > 0.05). A concentration of about 1 μM tyramine results in an increase in cAMP to about 1.2 pmol. In addition, about 100 μM octopamine leads to an approximately 911-fold increase in cAMP compared to an approximately 215-fold increase for about 100 μM tyramine. Since these assays are performed in the presence of the phosphodiesterase inhibitor IB MX, the increases in cAMP is determined to be through activation of adenylate cyclase. As such, it appears that the Pa oai receptor is an octopamine receptor, the Pa oai receptor may be targeted to effect a disruptive change in intracellular levels of cAMP, controlled targeting of the receptor allows for insect control, and the cell lines stably expressing the Pa oai receptor may be used to screen compounds and compositions for insect control activity. B. EFFECT OF TREATMENT ON cAMP AND [Ca2+] To determine cAMP levels in cells, about 24-hoτιrs before cell treatment, 300,000 HEK- 293 cells are plated in 1 mL media with 0.8 mg G418/ιnL into multi-dishes (4.5 cm2). For cell treatment, the media is aspirated and 1 mL PBS with 3O0 μM IBMX and the test reagent is added. Cells are incubated at 37°C for 20 min, and the PBS is then aspirated. Cells are incubated with 70% ethanol for 1 hour at -20°C. The cellular debris is centrifuged and then the supernatant is removed and lyophilized to dryness. The amount of cAJVD? in the extract is determined by using a cAMP binding protein from the 3H-cAMP Biotrak assay system (Amersham Biosciences, Piscataway, NJ) as per the manufacturer's instructions. To determine Ca2+ levels in the cells, HEK-293 cells are washed once with Hank's balanced salt solution (137 mM NaCl, 5.4 mM KC1, 0.3 mM Na2HP04, 0.4 mM KH2P04, 4.2 mM NaHC03, 1 mM CaCl2, 1 mM MgS04, and 5.6 m t glucose (pH 7.4)) (HBSS). Cells are collected by scraping and are suspended at about 750,000 cells/ml in HBSS with about 5 μM Fura-2 AM (Sigma-Aldrich). Cells are incubated at abo t 37 C for about 1 h in the dark, centrifuged, suspended in HBSS at about 750,000 cells/ml and used for calcium measurements A spectrofluoremeter with Felix software from Photon Technology International (Lawrenceville, NJ) is used for the fluorescence measurements and data- collection.
Octopamine has been demonstrated to modulate; intracellular calcium levels in cultured hemocytes of Malacosoma disstria. Also, in hemocytes from Periplaneta americana, octopamine lead to an increase in inositol triphosphate which likely will lead to increases in calcium in these cells as well. The ability of both octopamine and tyramine to modulate calcium levels in the HEK- 293 clone expressing Pa oai is determined. Neither about 10 μM octopamine nor about 10 μM tyramine modulates intracellular calcium levels in control HEK-293 cells transfected with pCDNA3 lacking an insert. However, when about 100 nM octopamine is added to the Pa oai expressing HEK-293 cells, a rapid increase in intracellular calcium is detected, as shown in Figure 7. In these same cells, about 100 nM tyramine does not modulate intracellular calcium levels, as shown in Figure 7.
Testing of these amines at additional concentrations indicates that the lowest concentration of octopamine that increases intracellular calcium levels is about 10 nM. Tyramine is found to increase intracellular calcium when a concentration of about 1 μM or higher is tested. These increases in intracellular calcium by about 10 nM octopamine and about 1 μM tyramine are to a similar level, both of which is lower than the increase in calcium mediated by about 100 nM octopamine. This result is similar to that obtained with the cAMP assay in that an approxim ately 100-fold increase in tyramine concentration compared to about 10 nM octopamine is required to give a similar level of response.
As such, it appears that the Pa oai receptor is an octopamine receptor, the Pa oai receptor may be targeted to effect a disruptive change in intracellular levels of Ca2+, controlled targe-ting of the receptor allows for insect control, and the cell lines stably expressing the Pa oai recepto may be used to screen compounds and compositions for insect control activity.
Octopamine is found to increase both cAMP and calcium in HEK-293 cells expressing Pa oai and the calcium increase is detected immediately upon octopamine addition. As such, tine possibility that calcium is leading to a secondary increase in cAMP levels in the cells expressing Pa oai is tested. The intracellular calcium chelator BAPTA/AM is used. BAPTA/AM at a out 20 μM is found to inhibit the increase in fi-ee intracellular calcium when about 1 μM octopamine is added to the Pa oai -expressing cells. Octopamine-mediated changes in cAMP levels are compared in the absence and presence of about 20 μM BAPTA/AM. cAMP levels following treatment with either about 100 nM or about 1 μM octopamine, as well as basal cAMP levels, are not foun d to be statistically different, whether in the absence or presence of about 20 μM BAPTA/AM, as shown in Figure 8. This indicates that the increase in cAMP by octopamine results from direct coupling of Pa oai to a G protein that leads to activation of adenylate cyclase, making the expression of Pa oai in HEK-293 cells a good model for adenylate cyclase-modulated insect control through this receptor and the cell lines stably expressing the Pa oai receptor useful for screening compounds and compositions for insect control activity.
EXAMPLE 4 RECEPTOR BINDING AND CHANGES IN cAMP AND INTRACELL JLAR CA + IN RESPONSE TO OCTOPAMINE TREATMENT For radioligand binding studies, the binding of 3H-yohimbine to membranes isolated from
COS-7 cells expressing Pa oai and octopamine receptor' (OAMB) from Drosophila melanogaster Are performed. See Bischof and Enan, 2004, Insect Biochem. Mol. Biol. 34. pp. 511-521, which is incorporated herein by this reference. The data shown in Table B demonstrates that the affinity of Pa oai to the radioligand is about 1.5 fold higher than OAMB. Radioligand binding using 3H- yohimbine is performed on membranes expressing either either Pa oai or OAMT3. For the determination of Kd and Bmax, a range of 3H-yohimbine is used from 0.5 to 50 n M, and 50 μM phentolamine is used as a competitor to determine nonspecific binding. To determine Kj of octopamine, 4 nM 3H-yohimbine is used with a concentration range of octopanx ine that gives from 0 to 100%) competition. OAR Species Kd "max Ki (nM) (pmole receptor/mg protein) (μM) OAR species 28.4 11.80 13.30 OAMB 43.0 8.04 8.20 Table B
With reference to Figure 9, OA (10 μM) increases the level of cAMP in HEK-293 cells permanently expressing either OAMB or Pa oai. With reference to Figures 10A and 10B, OA (10 μM) increases the level [Ca2+]ι in HEK-293 cells permanently expressing either OAMB or Pa oai, where HEK-293 cells expressing either receptor are incubated for 30s before the addition of 10 μM octopamine (OA). The arrow in the figures indicates addition of the amine. The fluorescence ratio determined from excitation with 340 and 380 run is plotted to indicate changes in [Ca2+]j levels. These increases are mediated through the OAR as judged by the insignificant changes in cAMP level and [Ca2+]j in cells transfected with an empty vector then treated with 10 μM OA (data not shown).
EXAMPLE 5 EFFECTS OF TREAMENT WITH PLANT ESSENTIAL OILS ON CELLS EXPRESSING THE OCTOPAMINE RECEPTOR In this example, membranes isolated from COS-7 cells expressing the receptor are used for receptor binding studies and HEK-293 cells are used for cAMP and [Ca2+]ι studies. Plant essential oils, including: jc-cymene [methyl(l-methylethyl)benzene], eugenol [2-methoxy-4-(2- propenyl)phenol], trans-anethole [l-methoxy-4-(l-propenyl)benzene], cinnamic alcohol [3- phenyl-2-propen-l-ol], -terpineol [p-menth-l-en-8-ol], methyl salicylate [2-hydroxybenzoic acid methyl ester], 2-phenylethyl propionate, and geraniol [3,7-dimethyl-2,6-octadien-l-ol], are obtained from City Chemical (West Haven, CT) and tested for insect control activity. The chemical structures of these compounds are set forth in Figure 11.
A. RECEPTOR BINDING ACTIVITY The binding activity of 3H-yohimbine to membranes expressing Pa oai or OAMB is performed in the presence and absence of three structurally related plant essential oil monoterpenoids, which are selected based on their insecticidal activity, the absence or presence and location of the hydroxyl group and a spacing group within the molecule. Membrane protein (10 μig) expressing Pa oai is incubated with 4 nM 3H-yohimbine in the presence and absence of 50 μM of the test chemical. The specific activity is calculated as the difference between counts in the presence and absence of test chemical. Specific binding is calculated by determining nonspecific binding with 50 μM tested plant essential oils and subtracting nonspecific binding from total binding. With reference to Figure 12, depicting specific binding of 3H-yohimbine to Pa oai and
OAMB, while eugenol and cinnamic alcohol decrease the binding of 3H-yohimbine to membranes expressing either Pa oai or OAMB as compared to the corresponding control, trans-anethole decreases the 3H-yohimbine binding activity to only Pa oai. It is also found that eugenol and trans-anethole are more potent inhibitors against Pa oai than OAMB, while cinnamic alcohol is more potent against OAMB than Pa oai. The data suggested insect species differences in receptor binding in response to monoterpenoids.
B. EFFECTS OF TREATMENT ON [cAMP] Figure 13 depicts the effect of certain plant essential oils on cAMP levels in HEK-293 cells expressing either Pa oai or OAMB. HEK-293 cells stably expressing either receptor are treated with 300 μtM IB MX and the effect of tested plant essential oils (50 μM) on basal cAMP levels is measured. Eugenol (50 μM) significantly decreases the cAMP level (24%) in cells expressing Pa oai but slightly decreased cAMP level in cells expressing OAMB. A 22% increase in cAMP level in cells expressing OAMB is found in response to treatment with (50 μM) trans-anethole. Cinnamic alcohol (50 μM) induces slight increase in cAMP level in both cell models.
C. EFFECT OF TREATMENT ON INTRACELLULAR CALCIUM MOBILIZATION To address whether changes in [Ca2+]ι in octopamine receptor-expressing cells in response to 25 μM of tested plant essential oils is mediated specifically through the receptor, cells transfected with an empty plasmid (pCDNA3) are treated with either test chemicals or solvent only and changes in [Ca2+]ι are monitored. In cells transfected with an empty plasmid, none of the test chemicals induce remarkable changes in [Ca2+]j levels as compared with cells treated with the solvent (data not shown). On the other hand, changes in [Ca2+]j level in cells expressing either OAMB or Pa oai in response to test chemicals is remarkably high. Figures 14A-14F, depict the effect of cinnamic alcohol (Figures 14A and 14B), eugenol (Figures 14C and 14D), and t-anethole (Figures 14E and 14F) on intracellular calcium [Ca2+]j levels in HEK-293 cells either transfected with Pa oai or OAMB. HEK-293 cells are incubated for 30s before the addition of 25 μM tested agents. The arrow in the figures indicates addition of tested agents. The fluorescence ratio determined from excitation with 340 ran and 380 nm is plotted to indicate transient increase in [Ca2+]j levels. Generally, changes in [Ca2+]j in cells expressing OAMB is more pronounced than changes in cells expressing Pa oai. Based on increased [Cai+]j level in cells expressing OAMB, cinnamic alcohol is the most potent agent tested in this example, followed by eugenol and trans-anethole. In cells expressing Pa oai, eugenol is the most potent agent tested in this example, followed by cinnamic alcohol then trans-anethole. The data suggest that elevation pattern of [Ca2+]j levels is chemical-dependent. While application of octopamine induces an immediate but transient peak (~ 20 sec) in [Ca2+]ι level, as shown in Figure 9, the peaked [Ca2+]ι level is slower in onset and has a longer recovery time (more than 3 min) in response to treatment with tested plant essential oils. In cells expressing OAMB, the increase in [Ca2+]j level in response to cinnamic alcohol is slower than the other two chemicals. In Pa oai -expressing cells, the increase in [Ca2+], in response to trans-anethole is slower than eugenol and cinnamic alcohol. Thus, the efficacy of coupling of both cloned octopamine receptors to different second messenger signaling varies with the chemical used. D. SUMMARY OF THE EFFECTS OF TREATMENT WITH CERTAIN PLANT ESSENTIAL OILS The present example studies the molecular interaction of plant essential oils with octopamine receptors from different insect species. Based on the characteristic features of octopamine receptors from American cockroach and fruit fly, the example characterizes certain molecular basis for insect species differences in response to plant essential oils. Although trans- anethole does not have a significant effect on binding to OAMB while eugenol and cinnamic alcohol do (Figure 12), only trans-anethole increases cAMP level (Figure 13) and [Ca2"'"]j (Figures 14A-14F) through OAMB. These findings suggest that, in the case of trans-anethole, ionic interaction between the tested agent and the receptor is not critical for the activation of signaling down stream to OAMB . On the other hand, while both eugenol and cinnamic alcohol decrease the binding activity to Pa oai (Figure 12), only eugenol decreases cAMP levels through this receptor (Figure 13). However, these two chemicals increase [Ca2+]ι through Pa oai and OAMB (Figures 14A-14F). The data demonstrates that activation of Pa oai by trans-anethole and cinnamic alcohol is not primarily coupled to cyclic nucleotide system. It appears that it is coupled to IP3-system, which activates the release of Ca2+ ions from internal stores. Activation of Pa oai by eugenol is found to be coupled to both adenylate cyclase/cAMP and IP3/Ca 0+ signaling cascades. Therefore, the current changes in cellular responses suggest that tested plant essential oils differing by only a single hydroxyl group or methoxy group in their chemical structure are capable of differentially coupling each octopamine receptor to different second messenger systems. The data also suggest that, activation of single GPCR such as Pa oai or OAMB, may potentially couple to multiple second messenger systems. Thus, a single receptor may have a different pharmacological profile depending on which second messenger system is activated. The variability of the transmembrane regions and N-termini of Pa oai and OAMB might determine the selectivity of tested monoterpenoids. In addition, conservation of certain transmembrane motifs and the variability of the intracellular loops might enable Pa oai and OAMB to discriminate among the various G- protein subtypes upon treatment with tested monoterpenoids. Protein alignment indicate that the regions of lowest similarity among these two proteins are in the amino terminus extending into TM1, extracellular loop2 between TM4 and TM5, intracellular loop between TM5 and TM6 and the carboxy termini following TM7 (Figure 2). On the other hand, protein alignment indicates sequence conservation between Pa oai and OAMB is greatest within the transmembrane domains (TMs).
EXAMPLE 6 TOXICITY TESTING AGAINST CERTAIN INSECT SPECIES Toxicity bioassay against the wild type Drosophila melanogaster fly and American cockroach is performed to address insect species specificity in response to certain plant essential oils and to determine whether the cellular changes in Pa oai and OAMB cell models in response to treatment with tested essential oils correlate with their insecticidal activity. Drosophila melanogaster wild type strain is purchased from Carolina Biological Supply
Company (Burlington, NC). Flies carrying the inactive (iav) mutation that exhibit low locomotor activity and poor mating success, both of which are associated with a deficiency in octopamine synthesis are obtained from Bloomington Drosophila Stock Center (flybase ID FBal 0005570, stock* BL-6029 iav). Plant essential oils, including: ^-cymene [methyl(l-methylethyl)benzene], eugenol [2- m.ethoxy-4-(2-propenyl)phenol], trans-anethole [l-methoxy-4-(l-propenyl)benzene], cinnamic alcohol [3-phenyl-2-propen-l-ol], α-terpineol [p-menth-l-en-8-ol], methyl salicylate [2- hydroxybenzoic acid methyl ester], 2-phenylethyl propionate, and geraniol [3,7-dimethyI-2,6- octadien-1-ol], are obtained from City Chemical (West Haven, CT) and tested for insect control activity. The chemical structures of these compounds are set forth in Figure 1 1. Acetonic solutions of plant essential oils are prepared and different concentrations of each, that give from 10% - 100% mortality, are applied by topical application. Controls are treated with the same volume (0.5 μl/insect) of acetone. Replicates, with 5 insects per replicate, are used for each concentration. The mortality is calculated 24 hours after treatment. Data are subjected to probit analysis to determine LD50 value for each compound. See Finney, 1971, Probit Analysis, 3rd Ed., Cambridge University Press, London, pg. 333.
To determine whether the octopamine/octopamine receptor (OA/OAR) system is involved in the toxicity of tested plant essential oils, octopamine synthesis mutant (iav) Drosophila melanogaster strain is topically treated with a dose equivalent to the determined LD50 for wild type strain. For this study, the LD50 values of eight monoterpenoid plant essential oils (p-cymene, eugenol, trans-anethole, cinnamic alcohol, α-terpineol, methyl salicylate, phenylethyl propionate, and geraniol) are determined against wild type as described above and being used to treat the octopamine mutant (iav) fruit fly. Controls are treated with the same volume (0.5 μl/fly) of acetone. The mortality is calculated 24 hour after treatment. Multiple replicates and 5 flies per replicate are used for the bioassay of each chemical. Data are subjected to probit analysis to determine LDso value for each chemical. See Finney, 1971.
To determine insect species differences in response to plant essential oil monoterpenoids, the toxicity of certain monoterpenoids is determined against fruit fly and American cockroach. Based on the calculated LD50 values, shown in Table C, cinnamic alcohol is the most toxic chemical tested in the example (LD50 = 1.65 μg/fly) against wild type fruit fly strain, followed by eugenol (LD50 = 1.90 μg/fly), and trans-anethole (LD50 = 6.00 μg/fly). Eugenol is about 2-fold and about 27-fold more toxic against American cockroach than cinnamic alcohol and trans-anethole, respectively. Table C
To determine whether the OA/OAR system mediates the toxicity of certain plant essential oil monoterpenoids, fruit flies carrying the iav mutations, which are highly susceptible to the octopamine analogue -cresol, are used in parallel with wild type fruit fly strain in the toxicity bioassay test. The toxicity of cinnamic alcohol, eugenol, trans-anethole and 2-phenyethyl propionate is remarkably increased when they are topically applied to the iav strain, as shown in Table D.
Table D However, mutation of the octopamine synthesis does not affect the toxicity of p-cymene, methyl salicylate, and geraniol. Therefore, the current data suggests a correlation between agents inducing cellular changes in clonal cells expressing octopamine receptors and their insecticidal activity. The data also suggests that the insecticidal activity of cinnamic alcohol, eugenol, trans- anethole and 2-phenyethyl propionate is mediated through the octopamine/octopamine receptor system. From these data it can be concluded that the increase in the insecticidal activity of these chemicals results from the deficiency of octopamine synthesis in iav mutants because low octopamine levels may be unable to compete against the toxic effect of these chemicals.
As mentioned above, the toxicity data demonstrates significant differences between the toxicity of the tested chemicals against each insect (Table C). The toxicity data also demonstrates differences between the two insects in response to each chemical. The toxicity data against wild type and octopamine mutant (iav) fruit fly suggests that the toxicity of cinnamic alcohol, eugenol and trans-anethol is mediated through octopamine/octopamine receptors system. Among certain other plant essential oils tested against both strains of fruit fly only the toxicity of 2-phenylethyl propionate is mediated through octopamine receptors. Collectively the data suggest a correlation between cellular changes and toxicity of certain plant essential oils.
In the present example, chemical-structure relationships of plant essential oil monoterpenoids against wild type fruit fly suggest certain structural features required for chemical-receptor interaction. Among these features are the presence and location of a hydroxyl group, and a spacing group such as methoxy group. The rank order of toxicity demonstrates that cyclic alcohols and phenolic compounds are more toxic than other monoterpenoids such as acyclic alcohols and esters. The efficacy of each compound is found to be determined by the presence and location of the spacing group on the benzene ring. For example, although the phenolic derivative, eugenol, and propenyl benzene, trans-anethol, contain the same spacing group (- OCH3) on position 2 and 1, respectively, eugenol is 3-fold more toxic against wild type flies than trans-anethole (Figure 11 and Table D). In summary, the similarities and differences between both Pa oai and OAMB sequences are determining features in the toxicity differences of certain plant essential oil monoterpenoids. Additionally, it appears that the octopamine receptor mediates the insecticidal properties of cinnamic alcohol, eugenol, trans-anethole and 2-phenylethyl propionate and, in part, the toxicity of α-terpineol against Drosophila melanogaster fly. Furthermore, it appears that the presence of an electronegative group such as hydroxyl group, and different spacing groups, may be required for the insecticidal activity of plant essential oils through octopamine receptor. * * *
It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. It is intended that the Specification and Example be considered as exemplary only, and not intended to limit the scope and spirit of the invention. The references and publications cited herein are incorporated herein by this reference. Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as reaction conditions, and so forth used in the Specification, Examples, and Claims are to be understood as being modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in the Specification, Example, and Claims are approximations that may vary depending upon the desired properties sought to be determined by the present invention.

Claims

What is claimed is: 1. A strain of cells comprising a DNA vector having a nucleic acid sequence consisting essentially of SEQ ID NO: 1.
2. The strain of cells of claim 1 , wherein the cells are COS-7 cells or HEK-293 cells.
3. A strain of cells expressing a protein having the amino acid sequence of SEQ ID NO: 2, or a fragment or derivative thereof, wherein the fragment or derivative thereof binds octopamine.
4. A strain of cells expressing a protein having the amino acid sequence of SEQ ID
NO: 2.
5. The strain of cells of claim 4, wherein the cells are COS-7 cells or HEK-293 cells.
6. A strain of COS-7 cells or HEK-293 cells expressing a protein having the amino acid sequence of SEQ ID NO: 3.
7. An isolated nucleic acid molecule sequence encoding a protein that binds a biogenic amine, resulting in changes in intracellular concentrations of cAMP, Ca2+, or both, having a nucleic acid sequence consisting essentially of SEQ ID NO: 1.
8. A molecule of claim 7, wherein the protein has an amino acid sequence consisting essentially of SEQ ID NO: 2.
9. An isolated nucleic acid molecule sequence having at least about 30% similarity to SEQ ID NO: 1, wherein the molecule encodes a protein that binds a biogenic amine, resulting in changes in intracellular concentrations of cAMP, Ca2+, or both.
10. The isolated nucleic acid molecule of claim 9, wherein the molecule encodes an octopamine receptor.
11. The isolated nucleic acid molecule of claim 10, wherein the molecule encodes a protein having an amino acid sequence consisting essentially of SEQ ID NO: 2, or a fragment or derivative thereof.
12. An isolated nucleic acid molecule sequence of SEQ ID NO: 1 , or a fragment or derivative thereof, wherein the molecule encodes an octopamine receptor.
13. The isolated nucleic acid molecule of claim 12, wherein the molecule encodes a protein having the amino acid sequence set forth in SEQ ID NO: 2, or a fragment or derivative thereof.
14. A method of screening compounds and/or compositions for insect control activity, comprising: providing cells expressing a protein having the amino acid sequence of SEQ ID
NO: 2; or a fragment or derivative therof, wherein the fragment or derivative binds a biogenic amine; adding said compounds and/or compositions to the cells; and measuring the effects of the compounds and/or compositions.
15. The method of claim 14, wherein the step of measuring the effects of the compounds and/or compositions includes measuring the binding affinity of said compounds and/or compositions to the receptor.
16. The method of claim 15, and additionally comprising: selecting compounds and/or compositions having an affinity for the receptor.
17. The method of claim 14, wherein the step of measuring the effects of the compounds and/or compositions includes: extracting intracellular cAMP and/or Ca21" from the cells; determining the intracellular cAMP and/or Ca2+ levels; and comparing the intracellular cAMP and/or Ca2+ levels in cells treated with said compounds and/or compositions to the intracellular cAMP and/or Ca levels in untreated cells.
18. The method of claim 17, and additionally comprising: selecting compounds and/or compositions, the treatment with which, causes a change in intracellular cAMP and/or Ca2+ levels.
19. A method of screening compounds and/or compositions for species-specific insect control activity, comprising: providing first cells expressing a first octopamine receptor cloned from a first insect species-of-interest; providing second cells expressing a second octopamine receptor cloned from a second insect species-of-interest; adding said compounds and/or compositions to the first and the second cells; and measuring the effects of the compounds and/or compositions.
20. The method of claim 19, wherein the step of measuring the effects of the compounds and/or compositions includes measuring the binding affinity of said compounds and/or compositions to the first and the second receptor.
21. The method of claim 20, and additionally comprising: selecting compounds and/or compositions having a desired relative affinity for one of the receptors.
22. The method of claim 19, wherein the step of measuring the effects of the compounds and/or compositions includes: extracting intracellular cAMP and/or Ca2+ from the first and the second cells; determining the intracellular cAMP and/or Ca2+ levels; and comparing the change in intracellular cAMP and/or Ca" levels in the first cells and the second cells.
23. The method of claim 22, and additionally comprising: selecting compounds and/or compositions, the treatment with which, causes a desired relative change in intracellular cAMP and/or Ca2+ levels in one of the cells.
24. The method of claim 19, wherein one of the octopamine receptors has an amino acid sequence of SEQ ID NO: 2, or a fragment or derivative thereof.
25. The method of claim 24, wherein one of the octopamine receptors has an amino acid sequence of SEQ ID NO: 3, or a fragment or derivative thereof.
26. A method of testing the effects of compounds on cells, said method comprising: providing cells expressing a protein having the amino acid sequence of SEQ ID NO: 2; or a fragment or derivative therof, wherein the fragment or derivative binds a biogenic amine; adding said compounds and/or compositions to the cells; and measuring the effects of the compounds and/or compositions.
27. A method of testing the effects of compounds on cells, said method comprising: providing first cells expressing a first octopamine receptor cloned from a first insect species-of- interest; providing second cells expressing a second octopamine receptor cloned from a second insect species-of-interest; adding said compounds and/or compositions to the first and the second cells; and measuring the effects of the compounds and/or compositions.
28. A report produced by a method, comprising: providing cells expressing a protein having the amino acid sequence of SEQ ID NO: 2; or a fragment or derivative therof, wherein the fragment or derivative binds a biogenic amine; adding said compounds and/or compositions to the cells; and measuring the effects of the compounds and/or compositions.
29. A report produced by a method, comprising: providing first cells expressing a first octopamine receptor cloned from a first insect species-of-interest; providing second cells expressing a second octopamine receptor cloned from a second insect species-of-interest; adding said compounds and/or compositions to the first and the second cells; and measuring the effects of the compounds and/or compositions.
30. A compound and/or composition for controlling insects identified by a method, comprising: providing cells expressing a protein having the amino acid sequence of SEQ ID NO: 2; or a fragment or derivative therof, wherein the fragment or derivative binds a biogenic amine; adding said compounds and/or compositions to the cells; and measuring the effects of the compounds and/or compositions.
31. A compound and/or composition for controlling insects identified by a method comprising: providing first cells expressing a first octopamine receptor cloned from a first insect species-of-interest; providing second cells expressing a second octopamine receptor cloned from a second insect species-of-interest; adding said compounds and/or compositions to the first and the second cells; and measuring the effects of the compounds and/or compositions.
EP05728601A 2004-03-19 2005-03-21 Compositions and methods for controlling insects related to the octopamine receptor Withdrawn EP1737478A4 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US55496804P 2004-03-19 2004-03-19
PCT/US2005/009223 WO2005092016A2 (en) 2004-03-19 2005-03-21 Compositions and methods for controlling insects related to the octopamine receptor

Publications (2)

Publication Number Publication Date
EP1737478A2 true EP1737478A2 (en) 2007-01-03
EP1737478A4 EP1737478A4 (en) 2008-09-03

Family

ID=35056738

Family Applications (1)

Application Number Title Priority Date Filing Date
EP05728601A Withdrawn EP1737478A4 (en) 2004-03-19 2005-03-21 Compositions and methods for controlling insects related to the octopamine receptor

Country Status (6)

Country Link
EP (1) EP1737478A4 (en)
AU (1) AU2005226676B2 (en)
CA (1) CA2563886A1 (en)
NZ (1) NZ550426A (en)
WO (1) WO2005092016A2 (en)
ZA (1) ZA200608396B (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7622269B2 (en) 2004-03-19 2009-11-24 Tyratech, Inc. Methods of screening tyramine- and octopamine-expressing cells for compounds and compositions having potential insect control activity
EP1624881A4 (en) 2003-04-24 2010-01-06 Tyratech Inc Compositions and methods for controlling insects
EP2043620B1 (en) 2006-06-27 2017-05-03 Tyratech, Inc. Compositions for use in treating a parasitic infections in a mammalian subject
CN101489377A (en) 2006-07-17 2009-07-22 蒂拉德克公司 Compositions and methods for controlling insects
EP2077724A2 (en) * 2007-01-16 2009-07-15 Tyratech, Inc. Pest control compositions and methods

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5344776A (en) * 1991-03-28 1994-09-06 The United States Of America As Represented By The Department Of Health And Human Services DNA encoding an insect octopamine receptor
WO1999021891A1 (en) * 1997-10-27 1999-05-06 Baylor College Of Medicine Invertebrate octopamine receptor
WO2001018201A1 (en) * 1999-09-09 2001-03-15 Ecosmart Technologies, Inc. Pesticidal activity of plant essential oils and their constituents

Also Published As

Publication number Publication date
AU2005226676A1 (en) 2005-10-06
EP1737478A4 (en) 2008-09-03
ZA200608396B (en) 2009-02-25
WO2005092016A3 (en) 2006-03-23
WO2005092016A2 (en) 2005-10-06
AU2005226676B2 (en) 2009-07-30
NZ550426A (en) 2009-05-31
CA2563886A1 (en) 2005-10-06

Similar Documents

Publication Publication Date Title
Enan Molecular response of Drosophila melanogaster tyramine receptor cascade to plant essential oils
US7622269B2 (en) Methods of screening tyramine- and octopamine-expressing cells for compounds and compositions having potential insect control activity
Ohta et al. B96Bom encodes a Bombyx mori tyramine receptor negatively coupled to adenylate cyclase
Enan Molecular and pharmacological analysis of an octopamine receptor from American cockroach and fruit fly in response to plant essential oils
Qi et al. A new Drosophila octopamine receptor responds to serotonin
Balfanz et al. A family of octapamine receptors that specifically induce cyclic AMP production or Ca2+ release in Drosophila melanogaster
Blenau et al. Characterization of a dopamine D1 receptor from Apis mellifera: cloning, functional expression, pharmacology, and mRNA localization in the brain
US20110003317A1 (en) Methods of screening compounds for insect-control activity involving the tyramine receptor
Xia et al. A new family of insect muscarinic acetylcholine receptors
Wu et al. Molecular cloning and pharmacological characterisation of a tyramine receptor from the rice stem borer, Chilo suppressalis (Walker)
Jiang et al. Functional characterization of five different PRXamide receptors of the red flour beetle Tribolium castaneum with peptidomimetics and identification of agonists and antagonists
Hull et al. Identification of the western tarnished plant bug (Lygus hesperus) olfactory co‐receptor Orco: expression profile and confirmation of atypical membrane topology
Wolff et al. Characterization and comparative pharmacological studies of a functional γ-aminobutyric acid (GABA) receptor cloned from the tobacco budworm, Heliothis virescens (Noctuidae: Lepidoptera)
Wang et al. Functional characterization of sex pheromone neurons and receptors in the armyworm, Mythimna separata (Walker)
EP2971060A1 (en) Methods for identifying arthropod repellents based on modulation of ionotropic receptors, and compounds and compositions identified thereby
AU2005226676B2 (en) Compositions and methods for controlling insects related to the octopamine receptor
US20040213771A1 (en) Targets and screens for agents useful in controlling parasitic nematodes
Hariton-Shalev et al. Structural and functional differences between pheromonotropic and melanotropic PK/PBAN receptors
WO2007121512A1 (en) Insect olfactory receptors
Shalev et al. Pheromonotropic and melanotropic PK/PBAN receptors: Differential ligand–receptor interactions
WO1999021891A1 (en) Invertebrate octopamine receptor
Xiong et al. Pharmacological characterization of the 5-HT1A receptor of Bombyx mori and its role in locomotion
Hull et al. Sex pheromone production in the silkworm, Bombyx mori, is mediated by store-operated Ca2+ channels
EP3433265B1 (en) Pheromonal receptor of spodoptera littoralis and identification of natural ligand of said receptor and uses thereof
CA2616144A1 (en) Insect olfactory receptors and ligands therefor

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20061005

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR

DAX Request for extension of the european patent (deleted)
RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: TYRATECH, LLC

A4 Supplementary search report drawn up and despatched

Effective date: 20080731

RIC1 Information provided on ipc code assigned before grant

Ipc: G01N 33/50 20060101ALI20080725BHEP

Ipc: C07K 14/435 20060101AFI20080725BHEP

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: TYRATECH, INC.

17Q First examination report despatched

Effective date: 20090331

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20091013