EP1730533A1 - Adam8 as tumor marker and therapeutic target for non-small cell lung cancer - Google Patents

Adam8 as tumor marker and therapeutic target for non-small cell lung cancer

Info

Publication number
EP1730533A1
EP1730533A1 EP04723042A EP04723042A EP1730533A1 EP 1730533 A1 EP1730533 A1 EP 1730533A1 EP 04723042 A EP04723042 A EP 04723042A EP 04723042 A EP04723042 A EP 04723042A EP 1730533 A1 EP1730533 A1 EP 1730533A1
Authority
EP
European Patent Office
Prior art keywords
adam8
double
seq
stranded molecule
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04723042A
Other languages
German (de)
French (fr)
Inventor
Yusuke Nakamura
Yataro Daigo
Shuichi Nakatsuru
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oncotherapy Science Inc
Original Assignee
Oncotherapy Science Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncotherapy Science Inc filed Critical Oncotherapy Science Inc
Publication of EP1730533A1 publication Critical patent/EP1730533A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5752—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the lungs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed

Definitions

  • DESCRIPTION ADAM8 AS TUMOR MARKER AND THERAPEUTIC TARGET FOR NON-SMALL CELL LUNG CANCER
  • PCT/JP03/12072 which, in turn, is related to USSN 60/414,673, filed September 30, 2002, USSN 60/451,374, filed February 28, 2003, and USSN 60/466,100, filed April 28,2003, all of which are incorporated herein by reference in their entirety.
  • the present invention relates to the field of biological science, more specifically to the field of cancer diagnosis and therapy.
  • the invention relates to a method for diagnosing lung cancer and compositions and methods for inhibiting cancer cell proliferation.
  • NSCLC non-small cell lung cancer
  • cancer markers for lung cancer in current use such as carcinoembryonic antigen (CEA) (Shinkai et al., 1986), serum cytokeratin 19 fragment (CYFRA 21-1) (Pujol et al., 1993) and pro-gastrin releasing peptide (pro-GRP) (Miyake et al., 1994), are not satisfactory for early diagnosis in the clinic, due to their relatively low sensitivity and specificity in detecting the presence of cancer cells.
  • CEA carcinoembryonic antigen
  • CYFRA 21-1 serum cytokeratin 19 fragment
  • pro-GRP pro-gastrin releasing peptide
  • lung-cancer tissue is diverse and can be histologically classified into several categories, including adenocarcinoma (ADC), squamous-cell carcinoma (SCC), large-cell carcinoma (LCC), and small-cell lung cancer (SCLC).
  • ADC adenocarcinoma
  • SCC squamous-cell carcinoma
  • LCC large-cell carcinoma
  • SCLC small-cell lung cancer
  • Molecular-targeted drugs are expected to be highly specific to malignant cells, with minimal adverse effects due to their well-defined mechanisms of action.
  • the microarray technology has provided a new approach for identifying specific molecular markers for cancers, such as lung cancer.
  • a previous attempt to isolate novel molecular targets for diagnosis, treatment and prevention of NSCLC involved the analysis of genome-wide expression profile of NSCLC cells, prepared from 37 cancer tissues by laser-capture microdissection, using a cDNA microarray containing 23,040 genes (Kikuchi et al., 2003). In that study, it was demonstrated that the gene-expression data analyzed by a clustering algorithm easily distinguished two major histological types of non-small cell lung cancer, ADC and SCC.
  • NSCLC neurotrophic factor-containing cell surface/secretory proteins
  • all are classified together and patients are often provided the same chemotherapy, particularly in inoperable cases. Therefore, individualized treatment on each type of lung cancer by means of selective suppression of cancer-specific molecules might hold promise for improving the outcome of lung-cancer treatment.
  • the precise cell lineage and differentiation pathways involved in the lung tumorigenesis remains unclear, current evidence suggests that tumor cells express cell surface markers unique to each histological type and each specific stage of differentiation. Therefore, focusing on cancer- specific cell surface/secretory proteins may be an effective approach for identifying novel diagnostic and therapeutic targets.
  • ADAM8 IMS-TM26 was identified as a potential target for development of novel therapeutic drugs and diagnostic markers for NSCLC, and predicted to play a role in human pulmonary carcinogenesis.
  • ADAM8 encodes a protein of 824 amino acids (SEQ ID NO: 2) with a unique structure possessing potential extracellular adhesion and protease domains, and a C-terminal transmembrane domain (Yoshiyama et al., 1997; Yamamoto et al., 1990). While previous studies have demonstrated that the ADAM family of proteins are overexpressed in various human cancers (Karan et al., 2003; O'Shea et al., 2003), the role of ADAM8 in human cancer has not been reported.
  • the present invention is based on the discovery that the ADAM8 gene is specifically overexpressed in non-small cell lung cancer, e.g., squamous cell carcinoma, adenocarcinoma (i.e., acinar, papillary and bronchoalveolar), large cell carcinoma (i.e., giant cell and clear cell), adenosquamous carcinoma and undifferentiated carcinoma. While the present inventors has identifyed ADAM8 gene as up-regulated in non- small cell cancer tissues, the finding of elevated levels of ADAM 8 in the blood of lung-cancer patients is novel to the instant invention.
  • non-small cell lung cancer e.g., squamous cell carcinoma, adenocarcinoma (i.e., acinar, papillary and bronchoalveolar), large cell carcinoma (i.e., giant cell and clear cell), adenosquamous carcinoma and undifferentiated carcinoma. While the present inventors has identifyed ADAM8 gene as up-regulated in
  • ADAM8 is a good target for blocking the protein functions on the cell surface as well as the effectors functions such as complement-dependent cytotoxicity (CDC) and antibody-dependent cellular cytotoxicity (ADCC).
  • CDC complement-dependent cytotoxicity
  • ADCC antibody-dependent cellular cytotoxicity
  • the present invention provides a method of diagnosing or determining a predisposition for developing non-small cell lung cancer in a subject comprising the steps of dete ⁇ nining the level of ADAM8 in a subject-derived biological sample and comparing this level to that found in a reference sample, typically a normal control.
  • a high level of ADAM8 in a sample indicates that the subject either suffers from or is at risk for developing non-small cell lung cancer.
  • a "normal control level” indicates a level associated with a normal, healthy individual or a population of individuals known not to be suffering from non-small cell lung cancer.
  • the level of ADAM8 may be determined by (a) detecting the ADAM8 protein, or (b) detecting the biological activity of the ADAM8 protein.
  • the subject-derived biological sample may be any sample derived from a subject, e.g., a patient known to or suspected of having non-small cell lung cancer.
  • the biological sample may be sputum, blood, serum, plasma or cancer tissue.
  • the biological sample is a body fluid, more preferably blood or blood derived sample.
  • the present invention provides a method of monitoring the course of treatment for non-small cell lung cancer comprising the step of comparing the ADAM8 level in a patient-derived biological sample taken subsequent to treatment with that of a patient-derived biological sample taken prior to treatment or with that of a normal control.
  • the present invention provides a method for assessing the prognosis of a patient with non-small cell lung cancer by comparing the ADAM8 level in a patient-derived biological sample with that of a normal control. A decrease in ADAM8 level subsequent to treatment is indicative of efficacious treatment and/or positive prognosis.
  • the present invention further provides a composition comprising an ADAM8 siRNA.
  • the ADAM8 siRNA comprises a nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 11 as the target sequence.
  • Such siRNAs are demonstrated herein to be effective for inhibiting cell growth of NSCLC cell lines.
  • the present invention provides a method for treating or preventing lung cancer, particularly non-small cell lung cancer, using such compositions.
  • An exemplary therapeutic method includes a method of inhibiting cancer cell growth by contacting the cancer cell, either in vitro or in vivo, with a composition comprising an ADAM8 siRNA that reduces the expression of the ADAM8 gene, hi a preferred embodiment, the cancer cell is a non-small cell lung cancer cell.
  • the therapeutic method may involve treating or preventing non-small cell lung cancer in a subject by administering to the subject a composition of an ADAM8 siRNA that reduces the expression of ADAM8.
  • the present invention also provides pharmaceutical compositions for treating or preventing non-small cell lung cancer comprising an effective amount of an ADAM8 siRNA as the active ingredient.
  • Fig. 1 shows a series of photographs depicting the expression of ADAM8 in primary NSCLCs and cell lines.
  • Fig. 1A depicts the expression of ADAM8 in 10 clinical NSCLC samples and 9 human tissues (heart, liver, ovary, placenta, bone marrow, testis, prostate, kidney, lung), examined by semiquantitative RT-PCR.
  • Fig. IB depicts the expression of ADAM8 in clinical samples of 7 ADCs and corresponding normal lung tissues.
  • Fig. 1C depicts the expression of ADAM8 in 20 NSCLC cell lines.
  • Fig. 1A depicts the expression of ADAM8 in 10 clinical NSCLC samples and 9 human tissues (heart, liver, ovary, placenta, bone marrow, testis, prostate, kidney, lung), examined by semiquantitative RT-PCR.
  • Fig. IB depicts the expression of ADAM8 in clinical samples of 7 ADCs and corresponding normal lung tissues.
  • Fig. 1C depicts the expression
  • FIG. 2 shows a photograph depicting the expression of the 3.5-kb transcript of human ADAM8 cDNA in leukocyte, lymph node, and bone marrow by northern-blot analysis.
  • Fig. 3 shows a series of photographs depicting the subcellular localization of the ADAM8 protein and its secretion.
  • Fig. 3A depicts the subcellular localization of the ADAM8 protein by immunocytochemical analysis, when the COS-7 cells were transfected with the c-myc-His tagged ADAM8 expression plasmid.
  • ADAM8 protein was detected with anti-c-myc-FITC antibody. Merge image of FITC and DAPI at the time point of 48 hours after transfection was obtained by laser confocal microscopy.
  • Fig. 3B depicts the results of western blotting with whole cell lysate and condition media from ADAM8-expressing LC319 cells.
  • the ADAM8 protein is presumed to be cleaved and secreted from the cell surface into medium in the NSCLC cell line.
  • Fig. 4 depicts the cell-surface expression of the ADAM8 protein on the A549 and SK-MES-1 lung-cancer cells evaluated by flow cytometric analysis using anti-ADAM8 antibody-BB014.
  • Fig. 3B depicts the results of western blotting with whole cell lysate and condition media from ADAM8-expressing LC319 cells.
  • the ADAM8 protein is presumed to be cleaved and secreted from the cell surface into medium in the NSCLC cell line.
  • Fig. 4 depicts the cell-surface expression of the ADAM8 protein on the A549 and SK-MES-1 lung-cancer cells evaluated by flow cytometric analysis using anti-ADAM8 antibody-BB014.
  • FIG. 5 shows a series of photographs depicting the results of immunohistochemical staining of representative surgically-resected and autopsy samples including lung ADC, LCC, and SCLC as well " as normal lung tissue using anti-ADAM8 antibody on tissue arrays (X100, X400).
  • Fig. 6 depicts the serologic concentration of the ADAM8 protein determined by ELISA in patients with lung adenocarcinoma and normal subjects (control).
  • Fig. 7 depicts the inhibition of growth of NSCLC cells by siRNA against
  • FIG. 7 A depicts the expression of ADAM8 in response to ⁇ -ADAM8 or control siRNAs (EGFP, luciferase (LUC), or scramble (SCR)) in NCI-H358 cell, analyzed by semiquantitative RT-PCR.
  • EGFP luciferase
  • SCR scramble
  • ADAM Disintegrin And Metalloprotease
  • the words “a”, “an”, and “the” as used herein mean “at least one” unless otherwise specifically indicated.
  • the ADAM (A Disintegrin And Metalloprotease) gene family encodes a group of proteins with a common domain structure including a pro-, metalloprotease, disintegrin-like, cysteine-rich, transmembrane and cytoplasmic domain. Members are known to be cell surface proteins with a unique structure possessing both potential adhesion and protease domains.
  • the human ADAM8 gene encodes an 824 amino acid protein homologous to snake disintegrins, Reprolysin family propeptide, and Reprolysin (M12B) family zinc metalloprotease (Yamamoto et al., 1999).
  • the ADAM8 protein the amino acid sequence of which is set forth herein as SEQ ID NO: 2, is also known as cell surface antigen CD 156 and MS2 and consists of a 16 aa signal peptide, a 637 aa ectodomain, a 25 aa transmembrane domain, and a 146 aa cytoplasmic domain.
  • the extracellular region of the ADAM8 protein shows significant amino acid sequence homology to hemorrhagic snake venom proteins, including the metalloprotease and disintegrin domains.
  • the present invention is based in part on the discovery that serum ADAM8 level can serve as a lung-cancer specific marker.
  • Diagnosing non-small cell luns cancer By measuring the level of ADAM8 in a subject-derived biological sample, the occurrence of non-small cell lung cancer or a predisposition to develop non-small cell lung cancer in a subject can be determined. Accordingly, the present invention involves determining (e.g., measuring) the level of ADAM8 in a biological sample. Any biological materials may be used as the biological sample for dete ⁇ nining the level of ADAM8 so long as either the ADAM8 gene or die ADAM8 protein.can be detected in the sample.
  • the biological sample comprises blood, serum or other bodily fluids such as sputum.
  • the preferred biological sample is blood or blood derived sample.
  • the blood derived sample includes serum, plasma, or whole blood.
  • the subject diagnosed for non-small cell lung cancer according to the method is preferably a mammal and includes human, non-human primate, mouse, rat, dog, cat, horse and cow.
  • a gene transcript of the ADAM8 gene e.g., the ADAM8 protein
  • the ADAM8 gene can be detected and measured using techniques well known to one of ordinary skill in the art.
  • the gene transcripts detected by the method include both the transcription and translation products, such as mRNA and proteins.
  • sequences corresponding to ADAM8 gene can be used to construct probes for detecting ADAM8 mRNAs by, e.g., Northern blot hybridization analysis.
  • the hybridization of the probe to a gene transcript in a subject biological sample can be also carried out on a DNA array.
  • the ADAM8 sequence can be used to construct primers for specifically amplifying the ADAM8 polynucleotide in, e.g., amplification-based detection methods such as reverse-transcription based polymerase chain reaction (RT-PCR).
  • RT-PCR reverse-transcription based polymerase chain reaction
  • the level of ADAM8 is determined by measuring the quantity ADAM8 protein in a biological sample.
  • a method for determining the quantity of the ADAM8 protein in a biological sample includes immunoassay methods.
  • the immunoassay comprises an ELISA, such as the commercially available human ADAM8 ELISA kit ("Quantikine", R&D Systems, Minneapolis, MN).
  • the ADAM8 level in the biological sample is then compared with an ADAM8 level associated with a reference sample, such as a normal control sample.
  • a reference sample such as a normal control sample.
  • the phrase "normal control level" refers to the level of ADAM8 typically found in a biological sample of a population not suffering from non-small cell lung cancer.
  • the reference sample is preferably of a similar nature to that of the test sample. For example, if the test sample comprise patient serum, the reference sample should also be serum.
  • the ADAM8 level in the biological samples from control and test subjects may be determined at the same time or, alternatively, the normal control level may be determined by a statistical method based on the results obtained by analyzing the level of ADAM8 in samples previously collected from a control group.
  • the ADAM8 level may also be used to monitor the course of treatment of non-small cell lung cancer.
  • a test biological sample is provided from a subject undergoing treatment for non-small cell lung cancer.
  • multiple test biological samples are obtained from the subject at various time points before, during or after the treatment.
  • the level of ADAM8 in the post-treatment sample may then be compared with the level of ADAM8 in the pre-treatment sample or, alternatively, with a reference sample (e.g., a normal control level).
  • the post-treatment ADAM8 level is lower than the pre-treatment ADAM8 level, one can conclude that the treatment was efficacious.
  • the post- treatment ADAM8 level is similar to the normal control ADAM8 level, one can also conclude that the treatment was efficacious.
  • An "efficacious" treatment is one that leads to a reduction in the level of ADAM8 or a decrease in size, prevalence or metastatic potential of non-small cell lung cancer in a subject. When a treatment is applied prophylactically, "efficacious" means that the treatment retards or prevents occurrence of non-small cell lung cancer or alleviates a clinical symptom of non-small cell lung cancer. The assessment of non-small cell lung cancer can be made using standard clinical protocols.
  • the efficaciousness of a treatment can be determined in association with any known method for diagnosing or treating non-small cell lung cancer.
  • non-small cell lung cancer is routinely diagnosed histopathologically or by identifying symptomatic anomalies such as chronic cough, hoarseness, coughing up blood, weight loss, loss of appetite, shortness of breath, wheezing, repeated bouts of bronchitis or pneumonia and chest pain.
  • the present method for diagnosing non-small cell lung cancer may also be applied for assessing the prognosis of a patient with the cancer by comparing the level of ADAM8 in a patient-derived biological sample with that of a reference sample.
  • the level of ADAM8 in the biological sample may be measured over a spectrum of disease stages to assess the prognosis of the patient.
  • An increase in the level of ADAM8 as compared to a normal control level indicates less favorable prognosis.
  • a similarity in the level of ADAM8 as compared to a normal control level indicates a more favorable prognosis of the patient.
  • Treating and preventing non-small cell lung cancer The present invention provides a method for treating, alleviating or preventing a non-small cell lung cancer in a subject.
  • Therapeutic compounds or compositions are administered prophylactically or therapeutically to subjects suffering from or at risk of (or susceptible to) developing non-small cell lung cancer. Such subjects are identified using standard clinical methods or by detecting an elevated level of ADAM8.
  • An exemplary therapeutic method includes a method of inhibiting cancer cell growth by contacting the cancer cell, either in vitro or in vivo, with a composition comprising an ADAM8 siRNA that reduces the expression of the ADAM8 gene.
  • the therapeutic method may involve treating or preventing non-small cell lung cancer in a subject by administering to the subject a composition comprising an ADAM8 siRNA that reduces the expression of ADAM8.
  • Small interfering RNAs Small interfering RNAs
  • siRNA comprise a combination of a sense strand nucleic acid and an antisense strand nucleic acid of the nucleotide sequence encoding ADAM8.
  • siRNA refers to a double stranded RNA molecule which prevents translation of a target mRNA. Standard techniques of introducing siRNA into the cell can be used in the treatment or prevention of the present invention, including those in which DNA is a template from which RNA is transcribed.
  • the siRNA is constructed such that a single transcript has both the sense and complementary antisense sequences from the target gene, e.g., a hairpin.
  • the therapeutic method of the present invention may be used to suppress expression of the ADAM8 gene.
  • the length of the oligonucleotide is at least 10 nucleotides and may be as long as the naturally occurring transcript.
  • the oligonucleotide is 19-25 nucleotides in length.
  • the oligonucleotide is less than 75, 50 or 25 nucleotides in length.
  • Preferable siRNA of the present invention include the polynucleotides having the nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 11 as the target sequence, both which have been demonstrated to be effective for inhibiting cell growth in NSCLC cell lines.
  • a preferable siRNA used in the present invention has the general formula: 5'-[A]-[B]-[A']-3' wherein [A] is a ribonucleotide sequence corresponding to a target sequence of ADAM8; [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides; and [A'] is a ribonucleotide sequence complementary to [A].
  • the phrase a "target sequence of ADAM8 gene” refers to a sequence that, when introduced into NSCLC cell lines, is effective for suppressing cell viability.
  • Preferred target sequence of ADAM8 gene includes nucleotide sequences comprising: SEQ ID NO: 10 or 11.
  • complementary sequence [A'] and [A] hybridize to each other to form a double strand, and the whole siRNA molecule with the general formula 5'-[A]-[B]-[A']-3' forms a hairpin loop structure.
  • the term "complementary" refers to a Watson-Crick or Hoogsteen base pairing between nucleotide units of a polynucleotide, and hybridization or binding of nucleotide units indicates physical or chemical interaction between the units under appropriate conditions to form a stable duplex (double-stranded configuration) containing few or no mismatches. In a preferred embodiment, such duplexes contain no more than 1 mismatch for every 10 base pairs.
  • the siRNA against the mRNA of ADAM8 gene to be used in the present invention contains a target sequence shorter than the whole mRNA of ADAM8 gene (3236nt), and has a sequence of 500, 200, or 75 nucleotides as the whole length. Also included in the invention is a vector containing one or more of the nucleic acids described herein, and a cell containing the vectors.
  • the isolated nucleic acids of the present invention are useful for siRNA against ADAM8 or DNA encoding the siRNA. When the nucleic acids are used for siRNA or coding DNA thereof, the sense strand is preferably longer than 19 nucleotides, and more preferably longer than 21 nucleotides.
  • nucleotide sequence of siRNAs may be designed using a siRNA design computer program available from the Ambion website (See www.ambion.com/techlib/misc/siRNA finder.html).
  • the nucleotide sequences for the siRNA are selected by the computer program based on the following protocol: Selection of siRNA Target Sites: 1. Beginning with the AUG start codon of the transcript, scan downstream for AA dinucleotide sequences. Record the occurrence of each AA and the 3' adjacent 19 nucleotides as potential siRNA target sites. Tuschl, et al.
  • ADAM8 siRNAs of the instant invention inhibit the expression of the ADAM8 gene and are thereby useful for suppressing the biological activity of the protein and inhibiting cancer cell growth. Therefore, a composition comprising an ADAM8 siRNA is useful in treating or preventing non-small cell lung cancer.
  • phrases A ⁇ naceutical compositions The present invention further provides a pharmaceutical composition for treating or preventing non-small cell lung cancer comprising an amount of an active ingredient effective to inhibit the expression of ADAM8 or inhibits cancer cell growth. More particularly, the present invention provides compositions comprising an effective amount of an ADAM8 siRNA or derivative thereof (e.g., an expression vector) as the active ingredient.
  • the active ingredient may be made into an external preparation, such as liniment or a poultice, by mixing with a suitable base material which is inactive against the derivative.
  • the active ingredient can be formulated into tablets, powders, granules, capsules, liposome capsules, injections, solutions, nose-drops and freeze-drying agents by adding excipients, isotonic agents, solubilizers, preservatives, pain-killers and such.
  • the siRNA derivative is given to the patient by direct application to the ailing site or by injection into a blood vessel so that it will reach the site of ailment.
  • a mounting medium can also be used in the composition to increase durability and membrane-permeability. Examples of mounting mediums include liposome, poly-L-lysine, lipid, cholesterol, lipofectin and derivatives thereof.
  • the dosage of such compositions can be adjusted suitably according to the patient's condition and used in desired amounts. For example, a dose range of 0.1 to 100 mg/kg, preferably 0.1 to 50 mg/kg can be administered.
  • siRNA and vectors encoding it Transfection of vectors expressing siRNA for ADAM8 leads to growth inhibition of NSCLC cells.
  • the double-stranded molecule of the present invention comprises a sense strand and an antisense strand, wherein the sense strand comprises a ribonucleotide sequence corresponding to a ADAM8 target sequence, and wherein the antisense strand comprises a ribonucleotide sequence which is complementary to said sense strand, wherein said sense strand and said antisense strand hybridize to each other to form said double-stranded molecule, and wherein said double-stranded molecule, when introduced into a cell expressing a ADAM8 gene, inhibits expression of said gene.
  • the double-stranded molecule of the present invention may be a polynucleotide derived from its original environment (i.e., when it is a naturally occurring molecule, the natural environment), physically or chemically altered from its natural state, or chemically synthesized.
  • double-stranded molecules include those composed of DNA, RNA, and derivatives thereof.
  • a DNA is suitably composed of bases such as A, T, C and G, and T is replaced by U in an RNA.
  • the term "complementary” refers to a Watson-Crick or Hoogsteen base pairing between nucleotide units of a polynucleotide, and hybridization or binding of nucleotide units indicates physical or chemical interaction between the units under appropriate conditions to form a stable duplex (double-stranded configuration) containing few or no mismatches.
  • such duplexes contain no more than 1 mismatch for every 10 base pairs.
  • Particularly preferred duplexes are fully complementary and contain no mismatch.
  • the double-stranded molecule of the present invention contains a ribonucleotide sequence corresponding to an ADAM8 target sequence shorter than the whole mRNA of ADAM8 gene (3236nt).
  • the phrase a "target sequence of ADAM8 gene” refers to a sequence that, when introduced into NSCLC cell lines, is effective for suppressing cell viability.
  • the target sequence comprises at least about 10, or suitably about 19 to about 25 contiguous nucleotides from the nucleotide sequences of SEQ ID NO: 1. That is, the sense strand of the present double-stranded molecule consists of at least about 10 nucleotides, suitably is longer than 19 nucleotides, and more preferably longer than 21 nucleotides.
  • Preferred target sequences include the sequences of SEQ ID NOs: 10 and 11.
  • the present double-stranded molecule including the sense strand and the antisense strand is an oligonucleotide shorter than about 100, preferably 75, more preferably 50 and most preferably 25 nucleotides in length.
  • a suitable double-stranded molecule of the present invention is an oligonucleotide of a length of about 19 to about 25 nucleotides.
  • nucleotide "u” can be added to 3 'end of the antisense strand of the target sequence.
  • the number of “u”s to be added is at least 2, generally 2 to 10, preferably 2 to 5.
  • the added "u”s form single strand at the 3 'end of the antisense strand of the siRNA.
  • the double-stranded molecule of the present invention may be a single ribonucleotide transcript comprising the sense strand and the antisense strand linked via a single-stranded ribonucleotide sequence.
  • the present double-stranded molecule may have the general formula: 5'-[A]-[B]-[A']-3' wherein [A] is a ribonucleotide sequence corresponding to a target sequence of
  • ADAM8; [B] is a ribonucleotide sequence (loop sequence) consisting of 3 to 23 nucleotides; and [A'J is a ribonucleotide sequence complementary to [A].
  • the complementary sequence [A'] and [A] hybridize to each other to form a double strand, and the whole siRNA molecule with the general formula 5'-[A]-[B]-[A']-3' forms a hairpin loop structure.
  • the region [A] hybridizes to [A'], and then a loop consisting of region [B] is formed.
  • the loop sequence can be selected from those describe in http://www.ambion.com/techlib/tb/tb_506.html, or those described in Jacque, J.-M., Triques, K., and Stevenson, M. "Modulation of HIV-1 replication by RNA interference.” Nature 418: 435-438 (2002). Additional examples of the loop sequence that can be included in the present double-stranded molecules include: CCC, CCACC or CCACACC: Jacque, J. M., Triques, K., and Stevenson, M. "Modulation of HIV-1 replication by RNA interference.” Nature, Vol.
  • the loop sequence can be selected from the group consisting of: CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA.
  • the most preferable loop sequence is UUCAAGAGA (corresponding to "ttcaagaga” in a DNA): gaaggacaug ugugaccuc-[B]-ga ggucacacau guccuuc (for the target sequence of SEQ ID NO: 10); and gacgccuucc aggagaacg-[B]-cg uucuccugga aggcguc (for the target sequence of SEQ ID NO:ll);
  • the present invention further provides a vector encoding the double-stranded molecule of the present invention.
  • the vector encodes a transcript having a secondary structure and which comprises the sense strand and the antisense strand, and suitably comprises a single-stranded ribonucleotide sequence linking said sense strand and said antisense strand.
  • the vector preferably comprises a regulatory sequence adjacent to the region encoding the present double-stranded molecule that directs the expression of the molecule in an adequate cell.
  • the double-stranded molecules of the present invention are intracellularly transcribed by cloning their coding sequence into a vector containing, e.g., a RNA pol III transcription unit from the small nuclear RNA (snRNA) U6 or the human HI RNA promoter.
  • a vector containing e.g., a RNA pol III transcription unit from the small nuclear RNA (snRNA) U6 or the human HI RNA promoter.
  • the present vectors are produced, for example, by cloning the target sequence into an expression vector so the objective sequence is operatively-linked to a regulatory sequence of the vector in a manner to allow expression thereof (transcription of the DNA molecule) (Lee, N.S., Dohjima, T, Bauer, G, Li, H., Li, M.-J., Ehsani, A.,Salvaterra, P., and Rossi, J. "Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells.” Nature Biotechnology 20: 500-505 (2002)).
  • the transcription of an RNA molecule having an antisense sequence to the target sequence is driven by a first promoter (e.g., a promoter sequence linked to the 3'-end of the cloned DNA) and that having the sense strand to the target sequence by a second promoter (e.g., a promoter sequence linked to the 5'-end of the cloned DNA).
  • the expressed sense and antisense strands hybridize to each other in vivo to generate a siRNA construct to silence a gene that comprises the target sequence.
  • two constructs may be utilized to respectively produce the sense and anti-sense strands of a siRNA construct.
  • transfection-enhancing agent can be used for introducing the vectors into a cell.
  • Example 1 General Methods (1) Cell lines and Clinical Samples The following twenty (20) human NSCLC cell lines were used in these examples: lung ADC; A549, LC174, LC176, LC319, PC14/PE6, NCI-H23, NCI-H522, NCI-H1650, NCI-H1735, NCI-H1793, PC-3, PC-9, PC- 14, SW-1573, lung SCC; RERF-LC-AI, SK-MES1, SK-LU-1, SW-900, a brochioalveolar cell carcinoma (BAC); NCI-H358, lung adenosquamous carcinoma (AS); NCI-H596.
  • lung ADC A549, LC174, LC176, LC319, PC14/PE6, NCI-H23, NCI-H522, NCI-H1650, NCI-H1735, NCI-H1793, PC-3, PC-9, PC- 14, SW-1573, lung SCC; RERF-LC-AI, SK-MES1,
  • stage IV A total of 302 formalin-fixed primary NSCLCs (stages I-IIIA) and precancerous lesions, including 162 ADCs, 105 SCCs, 20 LCCs, 11 BACs, 4 ASs and adjacent normal lung tissue samples, were obtained from patients who underwent surgery, and 17 advanced SCLCs (stage IV) were obtained from patients who underwent autopsy. Serum was obtained from 8 healthy individuals as control samples. The healthy individuals had no abnormality in complete blood cell counts, C-reactive protein (CRP), erythrocyte sedimentation rate, liver function tests, renal function tests, urinalysis, fecal examination, chest X-ray, and electrocardiogram.
  • CRP C-reactive protein
  • CT computed tomography
  • MRI magnetic resonance imaging
  • CBDCA Carboplatin
  • TAX:Paclitaxel VNR:Vinorelbin
  • TXT Docetaxel
  • VP-16 Etoposide
  • ADC adenocarcinoma
  • SCLC small-cell cancer
  • SCC Squamous-cell carcinoma
  • LD limited disease
  • ED extensive disease
  • Example 2 Characterization of ADAM8 (1) Semi ⁇ uantitative RT-PCR Analysis In searching for novel target molecules for development of therapeutic agents and/or diagnostic markers for NSCLC, genes that showed 5-fold higher expression in more than 50% of 37 NSCLCs analyzed by cDNA microarray were screened. From the 23,040 genes screened, the ADA S(Accession No.NM_001109,SEQ ID NO: 1) transcript was identified as being overexpressed frequently in NSCLCs. Semi-quantitative RT-PCR experiments were performed as follows to confirm AD AM8 expression: Total RNA was extracted from cultured cells and clinical tissues using Trizol reagent (Life Technologies, Inc. Gaithersburg, MD, USA) according to the manufacturer's protocol. Extracted RNAs and normal human tissue poly A RNAs were treated with Trizol reagent (Life Technologies, Inc. Gaithersburg, MD, USA) according to the manufacturer's protocol. Extracted RNAs and normal human tissue poly A RNAs were treated with Trizol reagent (Life Technologies, Inc. Gaithersburg, MD
  • DNase I (Roche Diagnostic, Basel, Switzerland) and were reverse-transcribed using oligo (dT) 12 . 18 primer and Superscript ⁇ reverse transcriptase (Life Technologies, Inc.).
  • Semiquantitative RT-PCR experiments were carried out with the following synthesized gene-specific primers or with beta-actin (ACrR)-specific primers as an internal control: ADAM8: 5'-GTGTGTGTACGTGTCTCCAGGT-3' (SEQ ID NO: 3) and 5'-CAGACAAGATAGCTGACTCTCCC-3' (SEQ ID NO: 4);
  • ACTB 5'-GAGGTGATAGCATTGCTTTCG-3' (SEQ ID NO: 5) and 5'-CAAGTCAGTGTACAGGTAAGC-3' (SEQ ID NO: 6) All of PCR reactions involved initial denaturation at 94 °C for 2 min followed by 22 (for ACTB) or 35 cycles (for ADAM8) of 94 °C 30 s, 54-60 °C for 30
  • a 32 P-labeled PCR product corresponding to the ADAM8 gene transcript was hybridized with human multiple-tissue blots (BD Biosciences Clontech). Prehybridization, hybridization and washing were performed according to the supplier's recommendations. The blots were autoradiographed with intensifying screens at -80 °C for one week. Northern-blot analysis detected a single 3.5-kb transcript in leukocyte, lymph node, and bone marrow (Fig.2). (3) Western Blot Analysis To examine levels of ADAM8 protein, an ECL western-blotting analysis system was used (Amersham Biosciences, Uppsala, Sweden).
  • lysing buffer 150 mM NaCl, 50 mM Tris-HCl, pH 8.0, 1% Nonidet P-40, 0.1% SDS, 0.5% deoxychorate-Na, plus protease inhibitor.
  • Supernatant of condition media of lung cancer cells were collected and concentrated using StrataCleanTM Resin (Stratagene, La Jolla, CA, USA). SDS-PAGE was performed in 7.5% polyacrylamide gels.
  • pcDNA3.1(+) vectors (Invitrogen Corp., Carlsbad, CA, USA) containing the c-myc-His epitope sequences (LDEESILKQE-HHHHHH) at the C-terminal of ADAM8 protein were constructed and transfected to COS-7 cells.
  • Transiently transfected COS-7 cells replated on chamber slides were fixed with PBS containing 4% paraformaldehyde, then rendered permeable with PBS containing 0.1% Triton X-100 for 3 min at 4°C. Cells were covered with blocking solution (3% BSA in PBS) for 30 min at room temperature to block nonspecific antibody-binding sites.
  • the cells were incubated with a mouse anti-c-myc antibody (diluted 1 : 300 in blocking solution).
  • Antibodies were stained with a goat anti-mouse secondary antibody conjugated to FITC, and viewed with a laser-confocal microscopy (TSC SP2 AOBS: Leica Microsystems, Wetzlar, Germany).
  • TSC SP2 AOBS Leica Microsystems, Wetzlar, Germany.
  • Western-blotting was performed in a manner described above. Western-blotting, using condition media including c-myc-tagged and endogeneous proteins from ADAM8-transfected cells, A549cells and LC319 cells individually, was also performed.
  • ADAM8 expression on the A549 and SK-MES-1 cells was evaluated by flow cytometric analysis using a purified polyclonal AD AM8 antibody (tentatively named BB014).
  • BB014 a purified polyclonal AD AM8 antibody
  • the cancer cells (1 x 10 6 ) were incubated with anti-ADAM8 antibody-BB014 (0.34 mg/ml) or control rabbit IgG (0.34 mg/ml) at 4°C for 1 hour.
  • the cells were washed in phosphophate-buffered saline (PBS) and then incubated in FITC-labeled Alexa Flour 488 at 4°C for 30 min.
  • PBS phosphophate-buffered saline
  • tissue sections were stained using ENVISION+ Kit/horseradish peroxidase (HRP) (DakoCytomation, Glostrup, Denmark). Briefly, anti-human ADAM8 antibody was added after blocking endogenous peroxidase and proteins, and the sections were incubated with HRP-labeled anti-rabbit IgG as the secondary antibody. Subslrate-chromogen was added and the specimens were counterstained with hematoxylin.
  • HRP ENVISION+ Kit/horseradish peroxidase
  • the tumor tissue microarrays were constructed using 319 cases of formalin-fixed lung cancers as published previously (Kononen et al., 1998; Chin et al., 2003, Callagy et al., 2003). The tissue area for sampling was selected based on a visual alignment with the corresponding HE-stained section on a slide. Three, four, or five tissue cores (diameter 0.6 mm; height 3-4 mm) taken from the donor tumor blocks were placed into a recipient paraffin block using a tissue microarrayer (Beecher Instruments, Hummingbird Court Sun Prairie, WI, USA). A core of normal tissue was punched from each case. 3- ⁇ m sections of the resulting microarray block were used for immunohistochemical analysis.
  • ADAM8 is localized at the plasma membrane as well as cytoplasm of tumor cells, but does not present at the surrounding normal tissues. Strong staining appeared in 64% of ADCs (104/162), 32% of SCCs (35/105), 65% of LCCs (13/20), and 30 % of BACs (3/10), all of which were surgically-resectable NSCLC, and 53 % of advanced SCLCs (9/17), while no staining was observed in any of normal lung tissues examined (Fig.5). (7) Serum Levels of ADAM8 Serum AD AM8 was detected in all serum samples from both patients and normal individuals. The serum ADAM8 levels were measured by an ELISA using a commercially available enzyme test kit (R&D systems hie.
  • RNA Interference Assay A vector-based RNA interference (RNAi) system, psiHlBx3.0, which directs the synthesis of small interfering RNAs (siRNAs) in mammalian cells (Suzuki et al., 2003), was used to suppress the expression of a target gene.
  • the product was digested with Hzradi ⁇ , and subsequently self-ligated to produce psi ⁇ lBX3.0 vector plasmid having a nucleotide sequence shown in SEQ ID NO: 12.
  • the DNA flagment encoding siRNA was inserted into the GAP at nucleotide 489-492 as indicated (-) in the following plasmid sequence (SEQ ID NO: 12).
  • siRNA-expression vector 10 ⁇ g of siRNA-expression vector, using 30 ⁇ l of Lipofectamine 2000 (Invitrogen), was transfected into an NSCLC cell line, NCI-H358, which overexpressed ADAM8. More than 90% of the transfected cells expressed the synthetic siRNA, and in those cells endogenous expression of the individual target gene (ADAMS) was effectively suppressed.
  • the transfected cells were cultured for five days in the presence of appropriate concentrations of geneticin (G418), after which cell numbers and viability were measured by Giemsa staining and triplicate MTT assays.
  • control 1 EGFP: enhanced green fluorescent protein (GFP) gene, a mutant of Aequorea victoria GFP), 5'-GAAGCAGCACGACTTCTTC-3' (SEQ ID NO: 7);
  • control 2 Luciferase: Photinus pyralis luciferase gene), 5'-CGTACGCGGAATACTTCGA-3' (SEQ ID NO: 8);
  • control 3 Scmble: chloroplast Euglena gracilis gene coding for 5S and 16S rRNAs), 5'-GCGCGCTTTGTAGGATTCG-3' (SEQ ID NO: 9);
  • ADAM8 siRNA-1 (U-ADAM8-1), 5'-GAAGGACATGTGTGACCTC-3' (SEQ ID NO:
  • ADAM8 siRNA-2 (si-ADAM8-2), 5'-GACGCCTTCCAGGAGAACG-3' (SEQ ID NO:
  • oligonucleotides used for these siRNAs are shown below. Each constructs were prepared by cloning the following double-stranded oligonucleotide into the Bbsl site in the ⁇ siHlBX3.0 vector. The corresponding nucleotide position relative to the ADAM8 nucleic acid sequence of SEQ ID NO:l are listed for each oligonucleotide sequence. Each oligionucleotide is a combination of a sense nucleotide sequence and an antisense nucleotide sequence of the target sequence of ADAM8. The nucleotide sequences of the hairpin loop structure of each siRNAs are also shown bellow, (endonuclease recognition cites are eliminated from each hairpin loop structure sequence).
  • ADAM8 siRNA-1 (1415-1433) (si-ADAM8-l), for the target sequence of 5'-GAAGGACATGTGTGACCTC-3' (SEQ ID NO: 10);
  • Insert F 5'-tcccgaagga catgtgtgac ctcttcaaga gagaggtcac acatgtcctt c-3' (SEQ ID NO: 13) Insert R 5'-aaaagaagga catgtgtgac ctctcttg aagaggtcac acatgtcctt c-3' (SEQ ID NO: 14) hairpin 5'-gaaggacatg tgtgacctct tcaagagaga ggtcacacat gtccttc-3' (SEQ ID NO: 15)
  • ADAM8 siRNA-2 (1473-1491) (si-ADAM8-2), for the target sequence of 5'-GACGCCTTCCAGGAGAACG-3' (SEQ ID NO: 11).
  • Insert F 5'-tcccgacgcc ttccaggaga acgttcaaga gacgttctcc tggaaggcgt c-3' (SEQ ID NO: 16)
  • control 2 (Luciferase: Photinus pyralis luciferase gene), for the target sequence of 5'-CGTACGCGGAATACTTCGA-3' (SEQ.ID.NO.8);
  • control 3 Stemble: chloroplast Euglena gracilis gene coding for 5S and 16S rRNAs), for the target sequence of 5'-GCGCGCTTTGTAGGATTCG-3' (SEQ.ID.NO.9);
  • RNAi system To validate the RNAi system, individual control siRNAs (EGFP, Luciferase, and Scramble) were initially confirmed using semiquantitative RT-PCR to decrease expression of the corresponding target genes that had been transiently transfected into COS-7 cells. Down-regulation of ADAMS expression by the respective siRNAs (si-ADAM8-l, si-ADAMS-2), but not by controls, was confirmed with semiquantitative RT-PCR in the cell lines used for this assay.
  • siRNAs si-ADAM8-l, si-ADAMS-2
  • the present invention involves the discovery that ADAM8 levels are elevated in the sera of lung-cancer patients as compared to normal controls. Accordingly, the ADAM8 gene and protein find utility as novel diagnostic markers (i.e. serum or sputum) as well as targets for development of new drugs and immunotherapy. Using the level of ADAM8 as an index, the present invention provides a method for diagnosing or a predisposition for developing non-small cell lung cancer, a method for monitoring the progress of cancer treatment and a method for assessing the prognosis of a cancer patient. The present invention further discloses ADAM8 siRNAs and method of using same to inhibit cancer cell growth.
  • the present invention provides methods for treating or preventing lung cancer, particularly non-small cell lung cancer, using such siRNAs, as well as derivatives and pharmaceutical formulations thereof. While the invention has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope of the invention.
  • Callagy G Cattaneo E, Daigo Y, Happerfield L, Bobrow LG, Pharoah PD, Caldas C. Molecular classification of breast carcinomas using tissue microarrays. Diagn. Mol. Pathol. 12, 27-34 (2003).
  • ADAM gene family surface proteins with adhesion and protease activity. Trends Genet. 2000 Feb; 16(2): 83-7.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cell Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

In searching for molecules involved in pulmonary carcinogenesis and genes that may serve as diagnostic markers or targets for new molecular therapies, the ADAM8 gene was discovered to be abundantly overexpressed in the great majority of NSCLC samples examined. Subsequent analysis proved that the serum levels of the ADAM8 protein detected by ELISA in lung-cancer patients were significantly higher than those in normal individuals. Furthermore, treatment of NSCLC cells with vector-based small interfering RNAs (siRNAs) against the ADAM8 gene suppressed its expression and resulted in growth suppression of the NSCLC cells. These results indicate that ADAM8 may be useful as a diagnostic marker and as a target for development of new molecular therapies for lung cancer.

Description

DESCRIPTION ADAM8 AS TUMOR MARKER AND THERAPEUTIC TARGET FOR NON-SMALL CELL LUNG CANCER The present application is related to PCT Application No. PCT/JP03/12072, which, in turn, is related to USSN 60/414,673, filed September 30, 2002, USSN 60/451,374, filed February 28, 2003, and USSN 60/466,100, filed April 28,2003, all of which are incorporated herein by reference in their entirety.
Technical Field The present invention relates to the field of biological science, more specifically to the field of cancer diagnosis and therapy. In particular, the invention relates to a method for diagnosing lung cancer and compositions and methods for inhibiting cancer cell proliferation.
Background Art Lung cancer is one of the most common cancers in the world, and non-small cell lung cancer (NSCLC) accounts for nearly 80% of those cases (Greenlee et al., 2001). The prognosis of advanced lung cancer remains poor and novel treatments and diagnosis strategies are urgently needed (Naruke et al., 2001). Most of the tumor markers for lung cancer in current use, such as carcinoembryonic antigen (CEA) (Shinkai et al., 1986), serum cytokeratin 19 fragment (CYFRA 21-1) (Pujol et al., 1993) and pro-gastrin releasing peptide (pro-GRP) (Miyake et al., 1994), are not satisfactory for early diagnosis in the clinic, due to their relatively low sensitivity and specificity in detecting the presence of cancer cells. In addition, the morphology of lung-cancer tissue is diverse and can be histologically classified into several categories, including adenocarcinoma (ADC), squamous-cell carcinoma (SCC), large-cell carcinoma (LCC), and small-cell lung cancer (SCLC). At present, histological and cytological diagnoses of lung cancer are mainly dependent on morphological evaluation and thus the development of a highly reliable tool for early diagnosis is eagerly anticipated. Recent acceleration in identification and characterization of novel molecular targets for cancer therapy has focused considerable interest on the development of new types of anticancer agents (Schiller et al., 2002; Kelly et al., 2001). Molecular-targeted drugs are expected to be highly specific to malignant cells, with minimal adverse effects due to their well-defined mechanisms of action. The microarray technology has provided a new approach for identifying specific molecular markers for cancers, such as lung cancer. A previous attempt to isolate novel molecular targets for diagnosis, treatment and prevention of NSCLC involved the analysis of genome-wide expression profile of NSCLC cells, prepared from 37 cancer tissues by laser-capture microdissection, using a cDNA microarray containing 23,040 genes (Kikuchi et al., 2003). In that study, it was demonstrated that the gene-expression data analyzed by a clustering algorithm easily distinguished two major histological types of non-small cell lung cancer, ADC and SCC. Thus, though the label "NSCLC" encompasses two different histological subtypes, in clinical settings, all are classified together and patients are often provided the same chemotherapy, particularly in inoperable cases. Therefore, individualized treatment on each type of lung cancer by means of selective suppression of cancer-specific molecules might hold promise for improving the outcome of lung-cancer treatment. Although the precise cell lineage and differentiation pathways involved in the lung tumorigenesis remains unclear, current evidence suggests that tumor cells express cell surface markers unique to each histological type and each specific stage of differentiation. Therefore, focusing on cancer- specific cell surface/secretory proteins may be an effective approach for identifying novel diagnostic and therapeutic targets. One of promising strategy is to combine the power of genome- wide expression analysis to effectively identify genes that are overexpressed in cancer cells, with screening of their expression on the cell surface by means of antibody-binding assays and of loss of function phenotypes by RNA interference (RNAi) systems. Using this combined approach, ADAM8 (IMS-TM26) was identified as a potential target for development of novel therapeutic drugs and diagnostic markers for NSCLC, and predicted to play a role in human pulmonary carcinogenesis. ADAM8 encodes a protein of 824 amino acids (SEQ ID NO: 2) with a unique structure possessing potential extracellular adhesion and protease domains, and a C-terminal transmembrane domain (Yoshiyama et al., 1997; Yamamoto et al., 1990). While previous studies have demonstrated that the ADAM family of proteins are overexpressed in various human cancers (Karan et al., 2003; O'Shea et al., 2003), the role of ADAM8 in human cancer has not been reported.
Summary of the Invention The present invention is based on the discovery that the ADAM8 gene is specifically overexpressed in non-small cell lung cancer, e.g., squamous cell carcinoma, adenocarcinoma (i.e., acinar, papillary and bronchoalveolar), large cell carcinoma (i.e., giant cell and clear cell), adenosquamous carcinoma and undifferentiated carcinoma. While the present inventors has identifyed ADAM8 gene as up-regulated in non- small cell cancer tissues, the finding of elevated levels of ADAM 8 in the blood of lung-cancer patients is novel to the instant invention. Although the mechanism of the induction of the expression of ADAM8 in cancers is extremely complicated and remains to be elucidated, the present inventors discovered that treatment of NSCLC cells with siRNA specific to the ADAM8 gene resulted in growth suppression. The lower expression of this gene in normal tissues, higher expression in lung cancers, reduced growth of lung-cancer cells by suppression of this gene, and the evidence that ADAM8 gene encodes membrane/secretory protein together suggest that ADAM8 is a good target for blocking the protein functions on the cell surface as well as the effectors functions such as complement-dependent cytotoxicity (CDC) and antibody-dependent cellular cytotoxicity (ADCC). Moreover, the elevated levels of ADAM8 in the blood and tumor tissues of lung-cancer patients suggest that this gene and its protein may be useful as novel diagnostic markers (i.e. serum or sputum) as well as targets for development of new drugs and immunotherapy. Accordingly, the present invention provides a method of diagnosing or determining a predisposition for developing non-small cell lung cancer in a subject comprising the steps of deteπnining the level of ADAM8 in a subject-derived biological sample and comparing this level to that found in a reference sample, typically a normal control. A high level of ADAM8 in a sample indicates that the subject either suffers from or is at risk for developing non-small cell lung cancer. A "normal control level" indicates a level associated with a normal, healthy individual or a population of individuals known not to be suffering from non-small cell lung cancer. The level of ADAM8 may be determined by (a) detecting the ADAM8 protein, or (b) detecting the biological activity of the ADAM8 protein. The subject-derived biological sample may be any sample derived from a subject, e.g., a patient known to or suspected of having non-small cell lung cancer. For example, the biological sample may be sputum, blood, serum, plasma or cancer tissue. In a preferred embodiment, the biological sample is a body fluid, more preferably blood or blood derived sample. In addition, the present invention provides a method of monitoring the course of treatment for non-small cell lung cancer comprising the step of comparing the ADAM8 level in a patient-derived biological sample taken subsequent to treatment with that of a patient-derived biological sample taken prior to treatment or with that of a normal control. In a similar fashion, the present invention provides a method for assessing the prognosis of a patient with non-small cell lung cancer by comparing the ADAM8 level in a patient-derived biological sample with that of a normal control. A decrease in ADAM8 level subsequent to treatment is indicative of efficacious treatment and/or positive prognosis. The present invention further provides a composition comprising an ADAM8 siRNA. In a preferred embodiment, the ADAM8 siRNA comprises a nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 11 as the target sequence. Such siRNAs are demonstrated herein to be effective for inhibiting cell growth of NSCLC cell lines. Accordingly, the present invention provides a method for treating or preventing lung cancer, particularly non-small cell lung cancer, using such compositions. An exemplary therapeutic method includes a method of inhibiting cancer cell growth by contacting the cancer cell, either in vitro or in vivo, with a composition comprising an ADAM8 siRNA that reduces the expression of the ADAM8 gene, hi a preferred embodiment, the cancer cell is a non-small cell lung cancer cell. Alternatively, the therapeutic method may involve treating or preventing non-small cell lung cancer in a subject by administering to the subject a composition of an ADAM8 siRNA that reduces the expression of ADAM8. Finally, the present invention also provides pharmaceutical compositions for treating or preventing non-small cell lung cancer comprising an effective amount of an ADAM8 siRNA as the active ingredient. It is to be understood that both the foregoing summary of the invention and the following detailed description are of a preferred embodiment, and not restrictive of the invention or other alternate embodiments of the invention.
Brief Description of the Drawings Fig. 1 shows a series of photographs depicting the expression of ADAM8 in primary NSCLCs and cell lines. Fig. 1A depicts the expression of ADAM8 in 10 clinical NSCLC samples and 9 human tissues (heart, liver, ovary, placenta, bone marrow, testis, prostate, kidney, lung), examined by semiquantitative RT-PCR. Fig. IB depicts the expression of ADAM8 in clinical samples of 7 ADCs and corresponding normal lung tissues. Fig. 1C depicts the expression of ADAM8 in 20 NSCLC cell lines. Fig. 2 shows a photograph depicting the expression of the 3.5-kb transcript of human ADAM8 cDNA in leukocyte, lymph node, and bone marrow by northern-blot analysis. Fig. 3 shows a series of photographs depicting the subcellular localization of the ADAM8 protein and its secretion. Fig. 3A depicts the subcellular localization of the ADAM8 protein by immunocytochemical analysis, when the COS-7 cells were transfected with the c-myc-His tagged ADAM8 expression plasmid. ADAM8 protein was detected with anti-c-myc-FITC antibody. Merge image of FITC and DAPI at the time point of 48 hours after transfection was obtained by laser confocal microscopy. The ADAM8/c-myc-His protein mainly detected in cytoplasmic membrane. Fig. 3B depicts the results of western blotting with whole cell lysate and condition media from ADAM8-expressing LC319 cells. The ADAM8 protein is presumed to be cleaved and secreted from the cell surface into medium in the NSCLC cell line. Fig. 4 depicts the cell-surface expression of the ADAM8 protein on the A549 and SK-MES-1 lung-cancer cells evaluated by flow cytometric analysis using anti-ADAM8 antibody-BB014. Fig. 5 shows a series of photographs depicting the results of immunohistochemical staining of representative surgically-resected and autopsy samples including lung ADC, LCC, and SCLC as well" as normal lung tissue using anti-ADAM8 antibody on tissue arrays (X100, X400). Fig. 6 depicts the serologic concentration of the ADAM8 protein determined by ELISA in patients with lung adenocarcinoma and normal subjects (control). Fig. 7 depicts the inhibition of growth of NSCLC cells by siRNA against
ADAM8. Fig. 7 A depicts the expression of ADAM8 in response to ή-ADAM8 or control siRNAs (EGFP, luciferase (LUC), or scramble (SCR)) in NCI-H358 cell, analyzed by semiquantitative RT-PCR. (b) Colony-formation assays of NCI-H358 cells transfected with specific siRNAs or control plasmids. (c) Viability of NCI-H358 cells evaluated by MTT assay in response to si-ADAM8, -EGFP, -LUC, or -SCR.
Detailed Description of the Invention The words "a", "an", and "the" as used herein mean "at least one" unless otherwise specifically indicated. The ADAM (A Disintegrin And Metalloprotease) gene family encodes a group of proteins with a common domain structure including a pro-, metalloprotease, disintegrin-like, cysteine-rich, transmembrane and cytoplasmic domain. Members are known to be cell surface proteins with a unique structure possessing both potential adhesion and protease domains. The human ADAM8 gene, the nucleotide sequence of which gene is set forth herein as SEQ ID NO: 1, encodes an 824 amino acid protein homologous to snake disintegrins, Reprolysin family propeptide, and Reprolysin (M12B) family zinc metalloprotease (Yamamoto et al., 1999). The ADAM8 protein, the amino acid sequence of which is set forth herein as SEQ ID NO: 2, is also known as cell surface antigen CD 156 and MS2 and consists of a 16 aa signal peptide, a 637 aa ectodomain, a 25 aa transmembrane domain, and a 146 aa cytoplasmic domain. The extracellular region of the ADAM8 protein shows significant amino acid sequence homology to hemorrhagic snake venom proteins, including the metalloprotease and disintegrin domains. The present invention is based in part on the discovery that serum ADAM8 level can serve as a lung-cancer specific marker.
Diagnosing non-small cell luns cancer: By measuring the level of ADAM8 in a subject-derived biological sample, the occurrence of non-small cell lung cancer or a predisposition to develop non-small cell lung cancer in a subject can be determined. Accordingly, the present invention involves determining (e.g., measuring) the level of ADAM8 in a biological sample. Any biological materials may be used as the biological sample for deteπnining the level of ADAM8 so long as either the ADAM8 gene or die ADAM8 protein.can be detected in the sample. Preferably, the biological sample comprises blood, serum or other bodily fluids such as sputum. The preferred biological sample is blood or blood derived sample. The blood derived sample includes serum, plasma, or whole blood. The subject diagnosed for non-small cell lung cancer according to the method is preferably a mammal and includes human, non-human primate, mouse, rat, dog, cat, horse and cow. hi one embodiment of the present invention, a gene transcript of the ADAM8 gene (e.g., the ADAM8 protein) is detected to determine the ADAM8 level. The ADAM8 gene can be detected and measured using techniques well known to one of ordinary skill in the art. The gene transcripts detected by the method include both the transcription and translation products, such as mRNA and proteins. For example, sequences corresponding to ADAM8 gene can be used to construct probes for detecting ADAM8 mRNAs by, e.g., Northern blot hybridization analysis. The hybridization of the probe to a gene transcript in a subject biological sample can be also carried out on a DNA array. As another example, the ADAM8 sequence can be used to construct primers for specifically amplifying the ADAM8 polynucleotide in, e.g., amplification-based detection methods such as reverse-transcription based polymerase chain reaction (RT-PCR). i an alternate embodiment, the level of ADAM8 is determined by measuring the quantity ADAM8 protein in a biological sample. A method for determining the quantity of the ADAM8 protein in a biological sample includes immunoassay methods. In a preferred embodiment, the immunoassay comprises an ELISA, such as the commercially available human ADAM8 ELISA kit ("Quantikine", R&D Systems, Minneapolis, MN). The ADAM8 level in the biological sample is then compared with an ADAM8 level associated with a reference sample, such as a normal control sample. The phrase "normal control level" refers to the level of ADAM8 typically found in a biological sample of a population not suffering from non-small cell lung cancer. The reference sample is preferably of a similar nature to that of the test sample. For example, if the test sample comprise patient serum, the reference sample should also be serum. The ADAM8 level in the biological samples from control and test subjects may be determined at the same time or, alternatively, the normal control level may be determined by a statistical method based on the results obtained by analyzing the level of ADAM8 in samples previously collected from a control group. The ADAM8 level may also be used to monitor the course of treatment of non-small cell lung cancer. In this method, a test biological sample is provided from a subject undergoing treatment for non-small cell lung cancer. Preferably, multiple test biological samples are obtained from the subject at various time points before, during or after the treatment. The level of ADAM8 in the post-treatment sample may then be compared with the level of ADAM8 in the pre-treatment sample or, alternatively, with a reference sample (e.g., a normal control level). For example, if the post-treatment ADAM8 level is lower than the pre-treatment ADAM8 level, one can conclude that the treatment was efficacious. Likewise, if the post- treatment ADAM8 level is similar to the normal control ADAM8 level, one can also conclude that the treatment was efficacious. An "efficacious" treatment is one that leads to a reduction in the level of ADAM8 or a decrease in size, prevalence or metastatic potential of non-small cell lung cancer in a subject. When a treatment is applied prophylactically, "efficacious" means that the treatment retards or prevents occurrence of non-small cell lung cancer or alleviates a clinical symptom of non-small cell lung cancer. The assessment of non-small cell lung cancer can be made using standard clinical protocols. Furthermore, the efficaciousness of a treatment can be determined in association with any known method for diagnosing or treating non-small cell lung cancer. For example, non-small cell lung cancer is routinely diagnosed histopathologically or by identifying symptomatic anomalies such as chronic cough, hoarseness, coughing up blood, weight loss, loss of appetite, shortness of breath, wheezing, repeated bouts of bronchitis or pneumonia and chest pain. Moreover, the present method for diagnosing non-small cell lung cancer may also be applied for assessing the prognosis of a patient with the cancer by comparing the level of ADAM8 in a patient-derived biological sample with that of a reference sample. Alternatively, the level of ADAM8 in the biological sample may be measured over a spectrum of disease stages to assess the prognosis of the patient. An increase in the level of ADAM8 as compared to a normal control level indicates less favorable prognosis. A similarity in the level of ADAM8 as compared to a normal control level indicates a more favorable prognosis of the patient. Treating and preventing non-small cell lung cancer: The present invention provides a method for treating, alleviating or preventing a non-small cell lung cancer in a subject. Therapeutic compounds or compositions are administered prophylactically or therapeutically to subjects suffering from or at risk of (or susceptible to) developing non-small cell lung cancer. Such subjects are identified using standard clinical methods or by detecting an elevated level of ADAM8. Prophylactic administration occurs prior to the manifestation of overt clinical symptoms of disease, such that a disease or disorder is prevented or alternatively delayed in its progression. An exemplary therapeutic method includes a method of inhibiting cancer cell growth by contacting the cancer cell, either in vitro or in vivo, with a composition comprising an ADAM8 siRNA that reduces the expression of the ADAM8 gene. Alternatively, the therapeutic method may involve treating or preventing non-small cell lung cancer in a subject by administering to the subject a composition comprising an ADAM8 siRNA that reduces the expression of ADAM8. Small interfering RNAs
(siRNA) comprise a combination of a sense strand nucleic acid and an antisense strand nucleic acid of the nucleotide sequence encoding ADAM8. The term "siRNA" refers to a double stranded RNA molecule which prevents translation of a target mRNA. Standard techniques of introducing siRNA into the cell can be used in the treatment or prevention of the present invention, including those in which DNA is a template from which RNA is transcribed. The siRNA is constructed such that a single transcript has both the sense and complementary antisense sequences from the target gene, e.g., a hairpin. The therapeutic method of the present invention may be used to suppress expression of the ADAM8 gene. Binding of the siRNA to the ADAM8 gene transcript in the target cell results in a reduction of ADAM8 protein production by the cell. The length of the oligonucleotide is at least 10 nucleotides and may be as long as the naturally occurring transcript. Preferably, the oligonucleotide is 19-25 nucleotides in length. Most preferably, the oligonucleotide is less than 75, 50 or 25 nucleotides in length. Preferable siRNA of the present invention include the polynucleotides having the nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 11 as the target sequence, both which have been demonstrated to be effective for inhibiting cell growth in NSCLC cell lines. Specifically, a preferable siRNA used in the present invention has the general formula: 5'-[A]-[B]-[A']-3' wherein [A] is a ribonucleotide sequence corresponding to a target sequence of ADAM8; [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides; and [A'] is a ribonucleotide sequence complementary to [A]. Herein, the phrase a "target sequence of ADAM8 gene" refers to a sequence that, when introduced into NSCLC cell lines, is effective for suppressing cell viability. Preferred target sequence of ADAM8 gene includes nucleotide sequences comprising: SEQ ID NO: 10 or 11. The complementary sequence [A'] and [A] hybridize to each other to form a double strand, and the whole siRNA molecule with the general formula 5'-[A]-[B]-[A']-3' forms a hairpin loop structure. As used herein, the term "complementary" refers to a Watson-Crick or Hoogsteen base pairing between nucleotide units of a polynucleotide, and hybridization or binding of nucleotide units indicates physical or chemical interaction between the units under appropriate conditions to form a stable duplex (double-stranded configuration) containing few or no mismatches. In a preferred embodiment, such duplexes contain no more than 1 mismatch for every 10 base pairs. Particularly preferred duplexes are fully complementary and contain no mismatch. The siRNA against the mRNA of ADAM8 gene to be used in the present invention contains a target sequence shorter than the whole mRNA of ADAM8 gene (3236nt), and has a sequence of 500, 200, or 75 nucleotides as the whole length. Also included in the invention is a vector containing one or more of the nucleic acids described herein, and a cell containing the vectors. The isolated nucleic acids of the present invention are useful for siRNA against ADAM8 or DNA encoding the siRNA. When the nucleic acids are used for siRNA or coding DNA thereof, the sense strand is preferably longer than 19 nucleotides, and more preferably longer than 21 nucleotides. Furthermore, the nucleotide sequence of siRNAs may be designed using a siRNA design computer program available from the Ambion website (See www.ambion.com/techlib/misc/siRNA finder.html). The nucleotide sequences for the siRNA are selected by the computer program based on the following protocol: Selection of siRNA Target Sites: 1. Beginning with the AUG start codon of the transcript, scan downstream for AA dinucleotide sequences. Record the occurrence of each AA and the 3' adjacent 19 nucleotides as potential siRNA target sites. Tuschl, et al. recommend not to design siRNA against the 5' and 3' untranslated regions (UTRs) and regions near the start codon (within 75 bases) as these may be richer in regulatory protein binding sites, and thus the complex of endonuclease and siRNAs that were designed against these regions may interfere with the binding of UTR-binding proteins and/or translation initiation complexes. 2. Compare the potential target sites to the human genome database and eliminate from consideration any target sequences with significant homology to other coding sequences. The homology search can be performed using BLAST, which can be found on the NCBI server at: www.ncbi.nlm.nih. gov/BLAST/ 3. Select qualifying target sequences for synthesis. On the website of Ambion, several preferable target sequences can be selected along the length of the gene for evaluation. The ADAM8 siRNAs of the instant invention inhibit the expression of the ADAM8 gene and are thereby useful for suppressing the biological activity of the protein and inhibiting cancer cell growth. Therefore, a composition comprising an ADAM8 siRNA is useful in treating or preventing non-small cell lung cancer.
Phaπnaceutical compositions: The present invention further provides a pharmaceutical composition for treating or preventing non-small cell lung cancer comprising an amount of an active ingredient effective to inhibit the expression of ADAM8 or inhibits cancer cell growth. More particularly, the present invention provides compositions comprising an effective amount of an ADAM8 siRNA or derivative thereof (e.g., an expression vector) as the active ingredient. The active ingredient may be made into an external preparation, such as liniment or a poultice, by mixing with a suitable base material which is inactive against the derivative.
Also, as needed, the active ingredient can be formulated into tablets, powders, granules, capsules, liposome capsules, injections, solutions, nose-drops and freeze-drying agents by adding excipients, isotonic agents, solubilizers, preservatives, pain-killers and such.
These can be prepared according to conventional methods for preparing nucleic acid containing pharmaceuticals. Preferably, the siRNA derivative is given to the patient by direct application to the ailing site or by injection into a blood vessel so that it will reach the site of ailment. A mounting medium can also be used in the composition to increase durability and membrane-permeability. Examples of mounting mediums include liposome, poly-L-lysine, lipid, cholesterol, lipofectin and derivatives thereof. The dosage of such compositions can be adjusted suitably according to the patient's condition and used in desired amounts. For example, a dose range of 0.1 to 100 mg/kg, preferably 0.1 to 50 mg/kg can be administered. siRNA and vectors encoding it Transfection of vectors expressing siRNA for ADAM8 leads to growth inhibition of NSCLC cells. Thus, it is another aspect of the present invention to provide a double-stranded molecule comprising a sense-strand and antisense-strand which molecule functions as an siRNA for ADAM8, and a vector encoding the double-stranded molecule. The double-stranded molecule of the present invention comprises a sense strand and an antisense strand, wherein the sense strand comprises a ribonucleotide sequence corresponding to a ADAM8 target sequence, and wherein the antisense strand comprises a ribonucleotide sequence which is complementary to said sense strand, wherein said sense strand and said antisense strand hybridize to each other to form said double-stranded molecule, and wherein said double-stranded molecule, when introduced into a cell expressing a ADAM8 gene, inhibits expression of said gene. The double-stranded molecule of the present invention may be a polynucleotide derived from its original environment (i.e., when it is a naturally occurring molecule, the natural environment), physically or chemically altered from its natural state, or chemically synthesized. According to the present invention, such double-stranded molecules include those composed of DNA, RNA, and derivatives thereof. A DNA is suitably composed of bases such as A, T, C and G, and T is replaced by U in an RNA. As described above, the term "complementary" refers to a Watson-Crick or Hoogsteen base pairing between nucleotide units of a polynucleotide, and hybridization or binding of nucleotide units indicates physical or chemical interaction between the units under appropriate conditions to form a stable duplex (double-stranded configuration) containing few or no mismatches. In a preferred embodiment, such duplexes contain no more than 1 mismatch for every 10 base pairs. Particularly preferred duplexes are fully complementary and contain no mismatch. The double-stranded molecule of the present invention contains a ribonucleotide sequence corresponding to an ADAM8 target sequence shorter than the whole mRNA of ADAM8 gene (3236nt). Herein, the phrase a "target sequence of ADAM8 gene" refers to a sequence that, when introduced into NSCLC cell lines, is effective for suppressing cell viability. Specifically, the target sequence comprises at least about 10, or suitably about 19 to about 25 contiguous nucleotides from the nucleotide sequences of SEQ ID NO: 1. That is, the sense strand of the present double-stranded molecule consists of at least about 10 nucleotides, suitably is longer than 19 nucleotides, and more preferably longer than 21 nucleotides. Preferred target sequences include the sequences of SEQ ID NOs: 10 and 11. The present double-stranded molecule including the sense strand and the antisense strand is an oligonucleotide shorter than about 100, preferably 75, more preferably 50 and most preferably 25 nucleotides in length. A suitable double-stranded molecule of the present invention is an oligonucleotide of a length of about 19 to about 25 nucleotides.
Furthermore, in order to enhance the inhibition activity of the siRNA, nucleotide "u" can be added to 3 'end of the antisense strand of the target sequence. The number of "u"s to be added is at least 2, generally 2 to 10, preferably 2 to 5. The added "u"s form single strand at the 3 'end of the antisense strand of the siRNA. Furthermore, the double-stranded molecule of the present invention may be a single ribonucleotide transcript comprising the sense strand and the antisense strand linked via a single-stranded ribonucleotide sequence. Namely, the present double-stranded molecule may have the general formula: 5'-[A]-[B]-[A']-3' wherein [A] is a ribonucleotide sequence corresponding to a target sequence of
ADAM8; [B] is a ribonucleotide sequence (loop sequence) consisting of 3 to 23 nucleotides; and [A'J is a ribonucleotide sequence complementary to [A]. The complementary sequence [A'] and [A] hybridize to each other to form a double strand, and the whole siRNA molecule with the general formula 5'-[A]-[B]-[A']-3' forms a hairpin loop structure.
The region [A] hybridizes to [A'], and then a loop consisting of region [B] is formed. The loop sequence can be selected from those describe in http://www.ambion.com/techlib/tb/tb_506.html, or those described in Jacque, J.-M., Triques, K., and Stevenson, M. "Modulation of HIV-1 replication by RNA interference." Nature 418: 435-438 (2002). Additional examples of the loop sequence that can be included in the present double-stranded molecules include: CCC, CCACC or CCACACC: Jacque, J. M., Triques, K., and Stevenson, M. "Modulation of HIV-1 replication by RNA interference." Nature, Vol. 418: 435-438 (2002); UUCG: Lee, N.S., Dohjima, T., Bauer, G, Li, H., Li, M.-J., Ehsani, A., Salvaterra, P., and Rossi, J. "Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells." Nature Biotechnology 20: 500-505 (2002); Fruscoloni, P., Zamboni, M., and Tocchini-Valentini, G. P. "Exonucleolytic degradation of double-stranded RNA by an activity in Xenopus laevis germinal vesicles." Proc. Natl. Acad. Sci. USA 100(4): 1639-1644 (2003); and UUCAAGAGA: Dykxhoorn, D. M., Novina, C. D., and Sharp, P. A. "Killing the messenger: Short RNAs that silence gene expression." Nature Reviews Molecular Cell Biology 4: 457-467 (2002). Preferable siRNAs having hairpin loop structure of the present invention are shown below. In the following structure, the loop sequence can be selected from the group consisting of: CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA. Among these sequences, the most preferable loop sequence is UUCAAGAGA (corresponding to "ttcaagaga" in a DNA): gaaggacaug ugugaccuc-[B]-ga ggucacacau guccuuc (for the target sequence of SEQ ID NO: 10); and gacgccuucc aggagaacg-[B]-cg uucuccugga aggcguc (for the target sequence of SEQ ID NO:ll);
The present invention further provides a vector encoding the double-stranded molecule of the present invention. The vector encodes a transcript having a secondary structure and which comprises the sense strand and the antisense strand, and suitably comprises a single-stranded ribonucleotide sequence linking said sense strand and said antisense strand. The vector preferably comprises a regulatory sequence adjacent to the region encoding the present double-stranded molecule that directs the expression of the molecule in an adequate cell. For example, the double-stranded molecules of the present invention are intracellularly transcribed by cloning their coding sequence into a vector containing, e.g., a RNA pol III transcription unit from the small nuclear RNA (snRNA) U6 or the human HI RNA promoter.
Alternatively, the present vectors are produced, for example, by cloning the target sequence into an expression vector so the objective sequence is operatively-linked to a regulatory sequence of the vector in a manner to allow expression thereof (transcription of the DNA molecule) (Lee, N.S., Dohjima, T, Bauer, G, Li, H., Li, M.-J., Ehsani, A.,Salvaterra, P., and Rossi, J. "Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells." Nature Biotechnology 20: 500-505 (2002)). For example, the transcription of an RNA molecule having an antisense sequence to the target sequence is driven by a first promoter (e.g., a promoter sequence linked to the 3'-end of the cloned DNA) and that having the sense strand to the target sequence by a second promoter (e.g., a promoter sequence linked to the 5'-end of the cloned DNA). The expressed sense and antisense strands hybridize to each other in vivo to generate a siRNA construct to silence a gene that comprises the target sequence. Furthermore, two constructs (vectors) may be utilized to respectively produce the sense and anti-sense strands of a siRNA construct. For introducing the vectors into a cell, transfection-enhancing agent can be used. FuGENE (Rochediagnostices), Lipofectamin 2000 (Invitrogen), Oligofectamin (Invitrogen), and Nucleofactor (Wako pure Chemical) are useful as the transfection-enhancing agent. The following examples are presented to illustrate the present invention and to assist one of ordinary skill in making and using the same. The examples are not intended in any way to otherwise limit the scope of the invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. Any patents, patent applications, and publications cited herein are incorporated by reference.
Best Mode for Carrying out the Invention The present invention is illustrated in details by following Examples, but is not restricted to these Examples.
[Example 1] General Methods (1) Cell lines and Clinical Samples The following twenty (20) human NSCLC cell lines were used in these examples: lung ADC; A549, LC174, LC176, LC319, PC14/PE6, NCI-H23, NCI-H522, NCI-H1650, NCI-H1735, NCI-H1793, PC-3, PC-9, PC- 14, SW-1573, lung SCC; RERF-LC-AI, SK-MES1, SK-LU-1, SW-900, a brochioalveolar cell carcinoma (BAC); NCI-H358, lung adenosquamous carcinoma (AS); NCI-H596. All cells were grown in monolayers in appropriate medium supplemented with 10% fetal calf serum (FCS) and were maintained at 37°C in an atmosphere of humidified air with 5% CO2- Primary NSCLC samples, of which 22 were classified as ADCs, 14 as SCCs, and one as AS, had been obtained earlier with informed consent from 37 patients. 15 additional primary NSCLCs, including 7 ADCs and 8 SCCs, were obtained along with adjacent normal lung tissue samples from patients undergoing surgery at Hokkaido University and its affiliated hospitals (Hokkaido, Japan). A total of 302 formalin-fixed primary NSCLCs (stages I-IIIA) and precancerous lesions, including 162 ADCs, 105 SCCs, 20 LCCs, 11 BACs, 4 ASs and adjacent normal lung tissue samples, were obtained from patients who underwent surgery, and 17 advanced SCLCs (stage IV) were obtained from patients who underwent autopsy. Serum was obtained from 8 healthy individuals as control samples. The healthy individuals had no abnormality in complete blood cell counts, C-reactive protein (CRP), erythrocyte sedimentation rate, liver function tests, renal function tests, urinalysis, fecal examination, chest X-ray, and electrocardiogram. Serum was also obtained from 49 lung-cancer patients (38 male, 11 female; median age, 64.5 ± 10.8 yr, 30 to 84 year) consecutively admitted (see Table.1 for patient characteristics). Patients were selected based on the following characteristics: (1) newly diagnosed, previously untreated cases, or (2) cases with pathologically diagnosed advanced lung cancer (stage DIB or IV). They consisted of 27 patients with ADCs, 13 with SCCs, and 9 with SCLCs. Their clinical records and histopathological diagnoses were fully documented. The sera of all the patients were obtained at the time of diagnosis and stored at -80° C. Disease staging of all patients was supported by a computed tomography (CT) scan of the chest, CT scan of the abdomen, bone scintigraphy, and magnetic resonance imaging (MRI) of the head. Table 1 Patient characteristics
PUL:lung, OSS: bone, HEP iver, BRA:brain, LYM ymph node, MAR:bone marrow, ADR:adrenal gland, OTH:others
CBDCA:Carboplatin, TAX:Paclitaxel, VNR:Vinorelbin,TXT: Docetaxel, VP-16:Etoposide, CPT-ll:Irinotecan ADC: adenocarcinoma, SCLC: small-cell cancer, SCC:Squamous-cell carcinoma, LD:limited disease, ED:extensive disease
(2) Anti-ADAM8 polyclonal antibody Plasmids expressing the ADAM8 protein (codons 94-228) were prepared. The recombinant protein was inoculated into rabbits, and the immune sera were purified on affinity columns according to standard methods (tentatively named BB014). Rabbit anti-ADAM8 polyclonal antibody was also purchased from a commercial vendor (TRIPLE POINT BIOLOGIES). (3) Statistical Analysis The differences between tumor groups were evaluated by the Mann- Whitney test, and the level of significance was set asp < 0.05. All analyses were conducted using Statview J-4.11 (Abacus Concepts, Berkeley, CA).
[Example 2] Characterization of ADAM8 (1) Semiαuantitative RT-PCR Analysis In searching for novel target molecules for development of therapeutic agents and/or diagnostic markers for NSCLC, genes that showed 5-fold higher expression in more than 50% of 37 NSCLCs analyzed by cDNA microarray were screened. From the 23,040 genes screened, the ADA S(Accession No.NM_001109,SEQ ID NO: 1) transcript was identified as being overexpressed frequently in NSCLCs. Semi-quantitative RT-PCR experiments were performed as follows to confirm AD AM8 expression: Total RNA was extracted from cultured cells and clinical tissues using Trizol reagent (Life Technologies, Inc. Gaithersburg, MD, USA) according to the manufacturer's protocol. Extracted RNAs and normal human tissue poly A RNAs were treated with
DNase I (Roche Diagnostic, Basel, Switzerland) and were reverse-transcribed using oligo (dT) 12.18 primer and Superscript π reverse transcriptase (Life Technologies, Inc.). Semiquantitative RT-PCR experiments were carried out with the following synthesized gene-specific primers or with beta-actin (ACrR)-specific primers as an internal control: ADAM8: 5'-GTGTGTGTACGTGTCTCCAGGT-3' (SEQ ID NO: 3) and 5'-CAGACAAGATAGCTGACTCTCCC-3' (SEQ ID NO: 4); ACTB: 5'-GAGGTGATAGCATTGCTTTCG-3' (SEQ ID NO: 5) and 5'-CAAGTCAGTGTACAGGTAAGC-3' (SEQ ID NO: 6) All of PCR reactions involved initial denaturation at 94 °C for 2 min followed by 22 (for ACTB) or 35 cycles (for ADAM8) of 94 °C 30 s, 54-60 °C for 30 s, and 72 °C for 60 s on a GeneAmp PCR system 9700 (Applied Biosystems, Foster City, CA). Results confirmed that ADA S expression is increased in 6 of 10 NSCLCs cases (5 of 5 ADCs and in 1 of 5 SCCs), as compared with 9 human tissues (heart, liver, ovary, placenta, bone marrow, testis, prostate, kidney and lung) (Fig. 1A). . Next, increased ADAM8 expression was confirmed in 6 of 7 additional ADCs (Fig. IB). In addition, up-regulation of ADAM8 was observed in 18 of 20 the NSCLC cell lines (Fig. 1C). (2) Northern Blot Analysis To determine the tissue distribution and the size of the ADAM8 gene, human multiple tissue northern blot analysis was performed using human ADAM8 cDNA as a probe. Specifically, a 32P-labeled PCR product corresponding to the ADAM8 gene transcript was hybridized with human multiple-tissue blots (BD Biosciences Clontech). Prehybridization, hybridization and washing were performed according to the supplier's recommendations. The blots were autoradiographed with intensifying screens at -80 °C for one week. Northern-blot analysis detected a single 3.5-kb transcript in leukocyte, lymph node, and bone marrow (Fig.2). (3) Western Blot Analysis To examine levels of ADAM8 protein, an ECL western-blotting analysis system was used (Amersham Biosciences, Uppsala, Sweden). Cells were maintained in serum-free medium for 24 hours after transfection and were lysed in appropriate amounts of lysing buffer (150 mM NaCl, 50 mM Tris-HCl, pH 8.0, 1% Nonidet P-40, 0.1% SDS, 0.5% deoxychorate-Na, plus protease inhibitor. Supernatant of condition media of lung cancer cells were collected and concentrated using StrataClean™ Resin (Stratagene, La Jolla, CA, USA). SDS-PAGE was performed in 7.5% polyacrylamide gels. PAGE-separated proteins were electroblotted onto nitrocellulose membranes (Amersham Biosciences) and incubated with a rabbit polyclonal anti-human AD AM8 antibody (TRIPLE POINT BIOLOGIES). A sheep anti-mouse IgG-HRP antibody (Amersham Biosciences) and a goat anti-rabbit IgG-HRP antibody (Amersham Biosciences) served as the secondary antibodies for these experiments. (4) Immunocytochemical analysis To determine the subcellular localization of the ADAM8 protein, COS-7 cells were transfected with a c-myc-His tagged ADAM8 expression plasmid. To prepare c-myc-His tagged proteins, pcDNA3.1(+) vectors (Invitrogen Corp., Carlsbad, CA, USA) containing the c-myc-His epitope sequences (LDEESILKQE-HHHHHH) at the C-terminal of ADAM8 protein were constructed and transfected to COS-7 cells. Transiently transfected COS-7 cells replated on chamber slides were fixed with PBS containing 4% paraformaldehyde, then rendered permeable with PBS containing 0.1% Triton X-100 for 3 min at 4°C. Cells were covered with blocking solution (3% BSA in PBS) for 30 min at room temperature to block nonspecific antibody-binding sites. Then, the cells were incubated with a mouse anti-c-myc antibody (diluted 1 : 300 in blocking solution). Antibodies were stained with a goat anti-mouse secondary antibody conjugated to FITC, and viewed with a laser-confocal microscopy (TSC SP2 AOBS: Leica Microsystems, Wetzlar, Germany). To confirm the expression of the protein, western-blotting was performed in a manner described above. Western-blotting, using condition media including c-myc-tagged and endogeneous proteins from ADAM8-transfected cells, A549cells and LC319 cells individually, was also performed. Immunocytochemical analysis confirmed that the ADAM8/c-myc-His protein was detected mainly in cytoplasmic membrane (Fig.3A). Further, a band with an approximate molecular weight of 55 kDa was detected in the cell lysate from COS-7 cells transfected with the ADAM8 expression plasmid and from LC319 cells. As ADAM8 is presumed to be a secretory protein, the secretion of ADAM8 in NSCLC culture medium from A549 and LC319 was also detected (Fig.3B). Results confirm that ADAM8 functions as a secretory protein. (5) Flow Cytometric Analysis ADAM8 expression on the A549 and SK-MES-1 cells was evaluated by flow cytometric analysis using a purified polyclonal AD AM8 antibody (tentatively named BB014). Specifically, the cancer cells (1 x 106) were incubated with anti-ADAM8 antibody-BB014 (0.34 mg/ml) or control rabbit IgG (0.34 mg/ml) at 4°C for 1 hour. The cells were washed in phosphophate-buffered saline (PBS) and then incubated in FITC-labeled Alexa Flour 488 at 4°C for 30 min. The cells were washed in PBS. Flow cytometry was performed on a Becton Dickinson FACScan and analyzed by ModFit software (Verity Software House, Inc., Topsham ME, USA). The anti-ADAM8 antibody-BB014 bound to A549 and SK-MES-1 cells at a higher rate than did the rabbit IgG (control) (Fig.4). These results confirm that ADAM8 is initially expressed on the cell surface and the extracellular domain of its protein is cleaved and secreted into the culture media from NSCLC cells (Fig.3B). (6) Immunohistochemistry and Tissue Microarray ADAM8 expression in clinical lung cancers was examined using tissue arrays. Specifically, to determine the presence of the ADAM8 protein in clinical samples (normal lung tissues, NSCLCs, and SCLCs that had been embedded in the paraffin block), tissue sections were stained using ENVISION+ Kit/horseradish peroxidase (HRP) (DakoCytomation, Glostrup, Denmark). Briefly, anti-human ADAM8 antibody was added after blocking endogenous peroxidase and proteins, and the sections were incubated with HRP-labeled anti-rabbit IgG as the secondary antibody. Subslrate-chromogen was added and the specimens were counterstained with hematoxylin. The tumor tissue microarrays were constructed using 319 cases of formalin-fixed lung cancers as published previously (Kononen et al., 1998; Chin et al., 2003, Callagy et al., 2003). The tissue area for sampling was selected based on a visual alignment with the corresponding HE-stained section on a slide. Three, four, or five tissue cores (diameter 0.6 mm; height 3-4 mm) taken from the donor tumor blocks were placed into a recipient paraffin block using a tissue microarrayer (Beecher Instruments, Hummingbird Court Sun Prairie, WI, USA). A core of normal tissue was punched from each case. 3-μm sections of the resulting microarray block were used for immunohistochemical analysis. Results demonstrate that ADAM8 is localized at the plasma membrane as well as cytoplasm of tumor cells, but does not present at the surrounding normal tissues. Strong staining appeared in 64% of ADCs (104/162), 32% of SCCs (35/105), 65% of LCCs (13/20), and 30 % of BACs (3/10), all of which were surgically-resectable NSCLC, and 53 % of advanced SCLCs (9/17), while no staining was observed in any of normal lung tissues examined (Fig.5). (7) Serum Levels of ADAM8 Serum AD AM8 was detected in all serum samples from both patients and normal individuals. The serum ADAM8 levels were measured by an ELISA using a commercially available enzyme test kit (R&D systems hie. Mckinly Place NE, MN, USA). First, the serum ADAM8 expression between lung-cancer patients and healthy individuals was compared. The serum levels of ADAM8 were 151.7 ± 73.5 pg/ml (mean±SD) in NSCLC patients and 70.7 ± 31.3 pg/ml (mean±SD) in healthy individuals (Fig.6A). Accordingly, there was a statistically significant difference in the serum level of ADAM8 between lung-cancer patients and healthy individuals (p < 0.01). The serum levels of ADAM8 were 152.9 ± 82.1 pg/ml (mean±SD) in ADC patients, 148.9 ± 50.6 pg/ml (mean±SD) in SCC patients, and 104.7 ± 29.8 pg/ml (mean±SD) in SCLC patients. Accordingly, there were statistically significant differences in the serum levels of ADAM8 between ADC patients and healthy individuals (p < 0.01), between SCC patients and healthy individuals (p < 0.01), and between SCLC patients and healthy individuals (p =
0.02) (Fig. 6B). (8) RNA Interference Assay A vector-based RNA interference (RNAi) system, psiHlBx3.0, which directs the synthesis of small interfering RNAs (siRNAs) in mammalian cells (Suzuki et al., 2003), was used to suppress the expression of a target gene. The product was digested with Hzradiπ, and subsequently self-ligated to produce psiΗlBX3.0 vector plasmid having a nucleotide sequence shown in SEQ ID NO: 12. The DNA flagment encoding siRNA was inserted into the GAP at nucleotide 489-492 as indicated (-) in the following plasmid sequence (SEQ ID NO: 12).
GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGG
ATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGGCTTGGTAGCCAAGTGCAGGTT
ATAGGGAGCTGAAGGGAAGGGGGTCACAGTAGGTGGCATCGTTCCTTTCTGACTGCCC
GCCCCCCGCATGCCGTCCCGCGATATTGAGCTCCGAACCTCTCGCCCTGCCGCCGCCG
GTGCTCCGTCGCCGCCGCGCCGCCATGGAATTCGAACGCTGACGTCATCAACCCGCTC
CAAGGAATCGCGGGCCCAGTGTCACTAGGCGGGAACACCCAGCGCGCGTGCGCCCTG
GCAGGAAGATGGCTGTGAGGGACAGGGGAGTGGCGCCCTGCAATATTTGCATGTCGCT
ATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAA
GTTCTGTATGAGACCACTCTTTCCC — TTTTTGGGAAAAAAAAAAAAAAAAAAAAAAC
GAAACCGGGCCGGGCGCGGTGGTTCACGCCTATAATCCCAGCACTTTGGGAGGCCGAG
GCGGGCGGATCACAAGGTCAGGAGGTCGAGACCATCCAGGCTAACACGGTGAAACCC
CCCCCCATCTCTACTAAAAAAAAAAAATACAAAAAATTAGCCATTAGCCGGGCGTGGT
GGCGGGCGCCTATAATCCCAGCTACTTGGGAGGCTGAAGCAGAATGGCGTGAACCCG
GGAGGCGGACGTTGCAGTGAGCCGAGATCGCGCCGACTGCATTCCAGCCTGGGCGAC
AGAGCGAGTCTCAAAAAAAAAACCGAGTGGAATGTGAAAAGCTCCGTGAAACTGCAG
AAACCCAAGCCGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGTGAGGCGG
AAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAG
CGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCG
CCCGCTCCTTTCGC1TTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAA
GCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCC
CAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTT
TTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGG
AACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTT CGGCCTA1TGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTG
TGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTA
TGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCC
AGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCC
CTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGG
AGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGC
TTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTG
AACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTA
TGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCG
CAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGC
AGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGT
GCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGG
GCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATG
CAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAA
ACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGAT
CTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCG
CGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATA
TCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGC
GGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGC
GAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCAT
CGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGAC
CGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTAT
GAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCG
GGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGT
TACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTC
TAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCT
CTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCG
CTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCT
AATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGA
AACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGC
GTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGG
GATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAA
AAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA AATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCG
TTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATA
CCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGT
ATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTT
CAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGAC
ACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGT
AGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACA
GTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTC
ACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACG
CTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGAT
CTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATG
AGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGAT
CTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATAC
GGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACC
GGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGG
TCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAA
GTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTG
TCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGT
TACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTG
TCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCT
CTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTC
ATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGAT
AATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGG
GGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCG
TGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAA
CAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATA
CTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGC
GGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTC
CCCGAAAAGTGCCACCTGACGTC
Specifically, 10 μg of siRNA-expression vector, using 30 μl of Lipofectamine 2000 (Invitrogen), was transfected into an NSCLC cell line, NCI-H358, which overexpressed ADAM8. More than 90% of the transfected cells expressed the synthetic siRNA, and in those cells endogenous expression of the individual target gene (ADAMS) was effectively suppressed. The transfected cells were cultured for five days in the presence of appropriate concentrations of geneticin (G418), after which cell numbers and viability were measured by Giemsa staining and triplicate MTT assays. The target sequences of the synthetic oligonucleotides for RNAi were as follows: control 1 (EGFP: enhanced green fluorescent protein (GFP) gene, a mutant of Aequorea victoria GFP), 5'-GAAGCAGCACGACTTCTTC-3' (SEQ ID NO: 7); control 2 (Luciferase: Photinus pyralis luciferase gene), 5'-CGTACGCGGAATACTTCGA-3' (SEQ ID NO: 8); control 3 (Scramble: chloroplast Euglena gracilis gene coding for 5S and 16S rRNAs), 5'-GCGCGCTTTGTAGGATTCG-3' (SEQ ID NO: 9);
ADAM8 siRNA-1 (U-ADAM8-1), 5'-GAAGGACATGTGTGACCTC-3' (SEQ ID NO:
10); and
ADAM8 siRNA-2 (si-ADAM8-2), 5'-GACGCCTTCCAGGAGAACG-3' (SEQ ID NO:
ID- The oligonucleotides used for these siRNAs are shown below. Each constructs were prepared by cloning the following double-stranded oligonucleotide into the Bbsl site in the ρsiHlBX3.0 vector. The corresponding nucleotide position relative to the ADAM8 nucleic acid sequence of SEQ ID NO:l are listed for each oligonucleotide sequence. Each oligionucleotide is a combination of a sense nucleotide sequence and an antisense nucleotide sequence of the target sequence of ADAM8. The nucleotide sequences of the hairpin loop structure of each siRNAs are also shown bellow, (endonuclease recognition cites are eliminated from each hairpin loop structure sequence).
ADAM8 siRNA-1 (1415-1433) (si-ADAM8-l), for the target sequence of 5'-GAAGGACATGTGTGACCTC-3' (SEQ ID NO: 10);
Insert F 5'-tcccgaagga catgtgtgac ctcttcaaga gagaggtcac acatgtcctt c-3' (SEQ ID NO: 13) Insert R 5'-aaaagaagga catgtgtgac ctctctcttg aagaggtcac acatgtcctt c-3' (SEQ ID NO: 14) hairpin 5'-gaaggacatg tgtgacctct tcaagagaga ggtcacacat gtccttc-3' (SEQ ID NO: 15)
ADAM8 siRNA-2 (1473-1491) (si-ADAM8-2), for the target sequence of 5'-GACGCCTTCCAGGAGAACG-3' (SEQ ID NO: 11). Insert F 5'-tcccgacgcc ttccaggaga acgttcaaga gacgttctcc tggaaggcgt c-3' (SEQ ID NO: 16) Insert R 5'-aaaagacgcc ttccaggaga acgtctcttg aacgttctcc tggaaggcgt c-3' (SEQ ID NO: 17) hairpin 5'-gacgccttcc aggagaacgt tcaagagacg ttctcctgga aggcgtc-3' (SEQ ID NO: 18) control 1 (EGFP: enhanced green fluorescent protein (GFP) gene, a mutant of Aequorea victoria GFP), for the target sequence of 5'-GAAGCAGCACGACTTCTTC-3' (SEQ ID NO: 7); Insert F 5'-Tccc GAAGCAGCACGACTTCTTC ttcaagaga GAAGAAGTCGTGCTGCTTC-3' (SEQ ID NO: 19) Insert R 5'-Aaaa GAAGCAGCACGACTTCTTC tctcttgaa GAAGAAGTCGTGCTGCTTC-3' (SEQ ID NO: 20) hairpin 5 '-GAAGCAGCACGACTTCTTC ttcaagaga GAAGAAGTCGTGCTGCTTC-3' (SEQ ID NO: 21)
control 2 (Luciferase: Photinus pyralis luciferase gene), for the target sequence of 5'-CGTACGCGGAATACTTCGA-3' (SEQ.ID.NO.8);
Insert F 5'-Tccc CGTACGCGGAATACTTCGA ttcaagaga TCGAAGTATTCCGCGTACG-3'
(SEQ ID NO: 22)
Insert R5'-Aaaa CGTACGCGGAATACTTCGA tctcttgaa TCGAAGTATTCCGCGTACG-3' (SEQ ID NO: 23) hairpin 5 '-CGTACGCGGAATACTTCGA ttcaagaga TCGAAGTATTCCGCGTACG-3' (SEQ
ID NO: 24)
control 3 (Scramble: chloroplast Euglena gracilis gene coding for 5S and 16S rRNAs), for the target sequence of 5'-GCGCGCTTTGTAGGATTCG-3' (SEQ.ID.NO.9);
Insert F 5'-Tccc GCGCGCTTTGTAGGATTCG ttcaagaga CGAATCCTACAAAGCGCGC-3'
(SEQ ID NO: 25)
Insert R 5'-Aaaa GCGCGCTTTGTAGGATTCG tctcttgaa CGAATCCTACAAAGCGCGC-3'
(SEQ ID NO: 26) hairpin 5 '-GCGCGCTTTGTAGGATTCG ttcaagaga CGAATCCTACAAAGCGCGC-3' (SEQ
ID NO: 27)
To validate the RNAi system, individual control siRNAs (EGFP, Luciferase, and Scramble) were initially confirmed using semiquantitative RT-PCR to decrease expression of the corresponding target genes that had been transiently transfected into COS-7 cells. Down-regulation of ADAMS expression by the respective siRNAs (si-ADAM8-l, si-ADAMS-2), but not by controls, was confirmed with semiquantitative RT-PCR in the cell lines used for this assay.
(9) Effect of ADAM8 on NSCLC cells To assess whether ADAM8 is essential for growth or survival of lung-cancer cells, plasmids expressing siRNA against ADAMS (si-ADAMS-i, -2), and three different control plasmids (siRNAs for EGFP, Luciferase (LUC), or Scramble (SCR)), were designed, constructed and transfected into NCI-H358 cells to suppress expression of endogenous ADAM8. The amount of ADAM8 transcript in the cells transfected with si-ADAMS-i and si-ADAMS-2 was significantly decreased in comparison with cells transfected with any of the three control siRNAs (Fig.7A). Transfection of si-ADAMS also resulted in significant decreases in cell viability and colony numbers measured by colony-formation and MTT assays (Fig. 7B, 7C).
Industrial Applicability The present invention involves the discovery that ADAM8 levels are elevated in the sera of lung-cancer patients as compared to normal controls. Accordingly, the ADAM8 gene and protein find utility as novel diagnostic markers (i.e. serum or sputum) as well as targets for development of new drugs and immunotherapy. Using the level of ADAM8 as an index, the present invention provides a method for diagnosing or a predisposition for developing non-small cell lung cancer, a method for monitoring the progress of cancer treatment and a method for assessing the prognosis of a cancer patient. The present invention further discloses ADAM8 siRNAs and method of using same to inhibit cancer cell growth. Accordingly, the present invention provides methods for treating or preventing lung cancer, particularly non-small cell lung cancer, using such siRNAs, as well as derivatives and pharmaceutical formulations thereof. While the invention has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope of the invention.
References:
Bauvois B. Transmembrane proteases in cell growth and invasion: new contributors to angiogenesis? Oncogene. 2004 Jan 15; 23(2): 317-29.
Callagy G, Cattaneo E, Daigo Y, Happerfield L, Bobrow LG, Pharoah PD, Caldas C. Molecular classification of breast carcinomas using tissue microarrays. Diagn. Mol. Pathol. 12, 27-34 (2003).
Chin SF, Daigo Y, Huang HE, Iyer NQ Callagy Q Kranjac T, Gonzalez M, Sangan T, Earl H, Caldas C. A simple and reliable pretreatment protocol facilitates fluorescent in situ hybridisation on tissue microarrays of paraffin wax embedded tumour samples. Mol Pathol. 2003 Oct; 56(5): 275-9.
Costa FF, Verbisck NV, Salim AC, Ierardi DF, Pires LC, Sasahara RM, Sogayar MC, Zanata SM, Mackay A, OΗare M, Soares F, Simpson AJ, Camargo AA. Epigenetic silencing of the adhesion molecule ADAM23 is highly frequent in breast tumors. Oncogene. 2003 Dec 8.
Fogel M, Gutwein P, Mechtersheimer S, Riedle S, Stoeck A, Smirnov A, Edler L, Ben-Arie A, Huszar M, Altevogt P. LI expression as a predictor of progression and survival in - patients with uterine and ovarian carcinomas. Lancet. 2003 Sep 13; 362(9387): 869-75.
Fourie AM, Coles F, Moreno V, Karlsson L. Catalytic activity of ADAM8, AD AMI 5, and MDC-L (ADAM28) on synthetic peptide substrates and in ectodomain cleavage of CD23. J Biol Chem. 2003 Aug 15; 278(33): 30469-77
Gandara DR. Randomized phase El trial of paclitaxel plus carboplatin versus vinorelbine plus cisplatin in the treatment of patients with advanced non~small-cell lung cancer: a Southwest Oncology Group trial. J Clin Oncol. 2001 Jul 1; 19(13): 3210-8.
Greenlee RT, Murray T, Bolden S, Wingo PA. Cancer statistics, 2000. CA Cancer J Clin. 2000 Jan-Feb; 50(1): 7-33.
Karan D, Lin FC, Bryan M, Ringel J, Moniaux N, Lin MF, Batra SK. Expression of ADAMs (a disintegrin and metalloproteases) and TIMP-3 (tissue inhibitor of metalloproteinase-3) in human prostatic adenocarcinomas. t J Oncol. 2003 Nov; 23(5): 1365-71.
Kelly K, Crowley J, Bunn PA Jr, Presant CA, Grevstad PK, Moinpour CM, Ramsey SD, Wozniak AJ, Weiss GR, Moore DF, Israel VK, Livingston RB, Gandara DR. Randomized phase m trial of paclitaxel plus carboplatin versus vinorelbine plus cisplatin in the treatment of patients with advanced non-small-cell lung cancer: a Southwest Oncology Group trial. J Clin Oncol. 2001 Jul 1; 19(13): 3210-8. Kikuchi T, Daigo Y, Katagiri T, Tsunoda T, Okada K, Kakiuchi S, Zembutsu H, Furukawa Y, Kawamura M, Kobayashi K, Imai K, Nakamura Y. Expression profiles of non-small cell lung cancers on cDNA microarrays: identification of genes for prediction of lymph-node metastasis and sensitivity to anti-cancer drugs. Oncogene. 2003 Apr 10; 22(14): 2192-205.
Kononen J, Bubendorf L, KalUoniemi A, Barlund M, Schraml P, Leighton S, Torhorst J, Mihatsch MJ, Sauter G, Kallioniemi OP. Tissue microarrays for high-throughput molecular profiling of tumor specimens. Nat Med. 1998 Jul; 4(7): 844-7.
Miyake Y, Kodama T, Yamaguchi K. Pro-gastrin-releasing peptide(31-98) is a specific mmor marker in patients with small cell lung carcinoma. Cancer Res. 1994 Apr 15; 54(8): 2136-40. . . -
Naruke T, Tsuchiya R, Kondo H, Asamura H. Prognosis and survival after resection for bronchogenic carcinoma based on the 1997 TNM-staging classification: the Japanese experience. Ann Thorac Surg. 2001 Jun; 71(6): 1759-64.
O'Shea C, McKie N, Buggy Y, Duggan C, Hill AD, McDermott E, O'Higgins N, Duffy MJ. Expression of ADAM-9 mRNA and protein in human breast cancer, it J Cancer. 2003 Jul 20; 105(6): 754-61.
Primakoff P, Myles DG The ADAM gene family: surface proteins with adhesion and protease activity. Trends Genet. 2000 Feb; 16(2): 83-7.
Pujol JL, Grenier J, Daures JP, Daver A, Pujol H, Michel FB. Serum fragment of cytokeratin subunit 19 measured by CYFRA 21-1 immunoradiometric assay as a marker of lung cancer. Cancer Res. 1993 Jan 1; 53(1): 61-6.
Schiller JH, Harrington D, Belani CP, Langer C, Sandier A, Krook J, Zhu J, Johnson DH; Eastern Cooperative Oncology Group. Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N Engl J Med. 2002 Jan 10; 346(2): 92-8.
Schlomann U, Wildeboer D, Webster A, Antropova O, Zeuschner D, Knight CQ Docherty AJ, Lambert M, Skelton L, Jockusch H, Bartsch JW. The metalloprotease disintegrin ADAM8. Processing by autocatalysis is required for proteolytic activity and cell adhesion. Biol Chem. 2002 Dec 13; 277(50): 48210-9. Seals DF, Courtneidge SA. The ADAMs family of metalloproteases: multidomain proteins with multiple functions. Genes Dev. 2003 Jan 1; 17(1): 7-30.
Shinkai T, Saijo N, Tominaga K, Eguchi K, Shimizu E, Sasaki Y, Fujita J, Futami H, Ohkura H, Suemasu K. Serial plasma carcinoembryonic antigen measurement for monitoring patients with advanced lung cancer during chemotherapy. Cancer. 1986 Apr 1; 57(7): 1318-23.
Suzuki C, Daigo Y, Kikuchi T, Katagiri T, Nakamura Y. Identification of COX17 as a therapeutic target for non-small cell lung cancer. Cancer Res. 2003 Nov 1; 63(21): 7038-41.
Yamamoto S, Higuchi Y, Yoshiyama K, Shimizu E, Kataoka M, Hijiya N, Matsuura K. ADAM family proteins in the immune system. Immunol Today. 1999 Jun; 20(6): 278-84.
Yoshida S, Setoguchi M, Higuchi Y, Akizuki S, Yamamoto S. Molecular cloning of cDNA encoding MS2 antigen, a novel cell surface antigen strongly expressed in murine monocytic lineage, h t Immunol. 1990; 2(6): 585-91.
Yoshiyama K, Higuchi Y, Kataoka M, Matsuura K, Yamamoto S. CD156 (human ADAM8): expression, primary amino acid sequence, and gene location. Genomics. 1997 Apr 1; 41(1): 56-62. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods and examples are illustrative only and not intended to be limiting.
The invention has been illustrated by reference to specific examples and preferred embodiments. It should be understood that the invention is intended not to be limited by the foregoing description, but to be defined by the appended claims and their equivalents.

Claims

1. A method of diagnosing non-small cell lung cancer or a predisposition for developing non-small cell lung cancer in a subject, comprising the steps of: (a) collecting a biological sample from a subject to be diagnosed; (b) determining a level of ADAM8 in the biological sample;
(c) comparing the ADAM8 level of (b) with that of a normal control; and (d) judging that a high ADAM8 level in the subject-derived sample, compared to the normal control, indicates that the subject suffers from or is at risk of developing non-small cell lung cancer.
2. The method of claim 1, wherein the biological sample comprises a body fluid.
3. The method of claim 2, wherein the body fluid comprises blood or blood derived sample.
4. The method of claim 1, wherein the ADAM8 level is determined by detecting the ADAM8 protein in the biological sample.
5. The method of claim 4, wherein the ADAM8 protein is detected by immunoassay.
6. The method of claim 5, wherein the immunoassay is an ELISA.
7. A method of treating or preventing non-small cell lung cancer in a subject comprising administering to said subject an ADAM8 small interfering RNA (siRNA) composition.
8. The method of claim 7, wherein the ADAM8 siRNA comprises a nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 11 as the target sequence.
9. The method of claim 8, wherein the siRNA has the general formula 5'-[A]-[B]-[A']-3' wherein [A] is a ribonucleotide sequence corresponding to a nucleotide sequence of SEQ ID NO: 10 or 11; [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides; and [A'] is a ribonucleotide sequence complementary to [A].
10. A double-stranded molecule comprising a sense strand and an antisense strand, wherein the sense strand comprises a ribonucleotide sequence corresponding to an ADAM8 target sequence of SEQ ID NO: 10 or 11, and wherein the antisense strand comprises a ribonucleotide sequence which is complementary to said sense strand, wherein said sense strand and said antisense strand hybridize to each other to form said double-stranded molecule, and wherein said double-stranded molecule, when introduced into a cell expressing a ADAM8 gene, inhibits expression of said gene.
11. The double-stranded molecule of claim 10, wherein said ADAM8 target sequence comprises at least about 10 contiguous nucleotides from the nucleotide sequences of SEQ ID NO: 1.
12. The double-stranded molecule of claim 11, wherein said ADAM8 target sequence comprises from about 19 to about 25 contiguous nucleotides from the nucleotide sequences of SEQ ID NO: 1.
13. The double- stranded molecule of claim 10, wherein said double- stranded molecule is a single ribonucleotide transcript comprising the sense strand and the antisense strand linked via a single-stranded ribonucleotide sequence.
14. The double-stranded molecule of claim 10, wherein the double- stranded molecule is an oligonucleotide of less than about 100 nucleotides in length.
15. The double-stranded molecule of claim 14, wherein the double-stranded molecule is an oligonucleotide of less than about 75 nucleotides in length.
16. The double-stranded molecule of claim 15, wherein the double- stranded molecule is an oligonucleotide of less than about 50 nucleotides in length.
17. The double- stranded molecule of claim 16, wherein the double-stranded molecule is an oligonucleotide of less than about 25 nucleotides in length.
18. The double-stranded polynucleotide of claim 17, wherein the double stranded molecule is an oligonucleotide of between about 19 and about 25 nucleotides in length.
19. A vector encoding the double-stranded molecule of claim 10.
20. The vector of claim 19, wherein the vector encodes a transcript having a secondary structure and comprises the sense strand and the antisense strand.
21. The vector of claim 20, wherein the transcript further comprises a single-stranded ribonucleotide sequence linking said sense strand and said antisense strand.
22. A vector comprising a polynucleotide comprising a combination of a sense strand nucleic acid and an antisense strand nucleic acid, wherein said sense strand nucleic acid comprises nucleotide sequence of SEQ ID NO: 10 or 11, and said antisense strand nucleic acid consists of a sequence complementary to the sense strand.
23. The vector of claim 22, wherein said polynucleotide has the general formula 5'-[A]-[B]-[A']-3' wherein [A] is a nucleotide sequence of SEQ ID NO: 10 or 11; [B] is a nucleotide sequence consisting of 3 to 23 nucleotides; and [A'] is a nucleotide sequence complementary to [A].
24. A pharmaceutical composition for treating or preventing non-small cell lung cancer comprising a pharmaceutically effective amount of an ADAM8 small interfering RNA (siRNA) as an active ingredient, and a pharmaceutically acceptable carrier..
25. The pharmaceutical composition of claim 24, wherein the ADAM8 siRNA comprises a nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 11 as the target sequence.
26. The composition of claim 25, wherein the siRNA has the general formula 5'-[A]-[B]-[A']-3' wherein [A] is a ribonucleotide sequence corresponding to a nucleotide sequence of SEQ ID NO: 10 or 11; [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides; and [A'] is a ribonucleotide sequence complementary to [A].
EP04723042A 2004-03-24 2004-03-24 Adam8 as tumor marker and therapeutic target for non-small cell lung cancer Withdrawn EP1730533A1 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/JP2004/004075 WO2005090991A1 (en) 2004-03-24 2004-03-24 Adam8 as tumor marker and therapeutic target for non-small cell lung cancer

Publications (1)

Publication Number Publication Date
EP1730533A1 true EP1730533A1 (en) 2006-12-13

Family

ID=34957282

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04723042A Withdrawn EP1730533A1 (en) 2004-03-24 2004-03-24 Adam8 as tumor marker and therapeutic target for non-small cell lung cancer

Country Status (3)

Country Link
EP (1) EP1730533A1 (en)
JP (1) JP2007530921A (en)
WO (1) WO2005090991A1 (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX2010002002A (en) 2007-08-20 2010-03-11 Oncotherapy Science Inc Foxm1 peptide and medicinal agent comprising the same.
GB2453589A (en) 2007-10-12 2009-04-15 King S College London Protease inhibition
TWI469791B (en) 2009-02-18 2015-01-21 Oncotherapy Science Inc Foxm1 peptides and vaccines containing the same
WO2014186364A2 (en) * 2013-05-13 2014-11-20 Tufts University Methods and compositions for prognosis, diagnosis and treatment of adam8-expressing cancer
AU2020283906A1 (en) * 2019-05-31 2022-01-20 Trustees Of Tufts College Anti-ADAM8 antibodies and uses of the same

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2378182C (en) * 1999-07-28 2014-09-23 Genentech, Inc. Compositions and methods for the treatment of tumors
EP1358349A2 (en) * 2000-06-05 2003-11-05 Avalon Pharmaceuticals Cancer gene determination and therapeutic screening using signature gene sets
AU2003213005A1 (en) * 2002-02-20 2003-09-09 Sirna Therapeutics, Inc RNA INTERFERENCE MEDIATED INHIBITION OF PROTEIN KINASE C ALPHA (PKC-ALPHA) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
TW200413725A (en) * 2002-09-30 2004-08-01 Oncotherapy Science Inc Method for diagnosing non-small cell lung cancers

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2005090991A1 *

Also Published As

Publication number Publication date
JP2007530921A (en) 2007-11-01
WO2005090991A1 (en) 2005-09-29

Similar Documents

Publication Publication Date Title
Chen et al. MicroRNA145 targets BNIP3 and suppresses prostate cancer progression
WO2010067487A1 (en) Nectin-4 for target genes of cancer therapy and diagnosis
EP2361317B1 (en) Use of eif3m for the diagnosis and treatment of cancer
WO2005028676A2 (en) Method of diagnosing breast cancer
WO2008101118A2 (en) A gene expression signature identifying pro-angiogenic genes in ovarian tumor endothelial cell isolates
EP2185732A1 (en) Cancer associated gene ly6k
JP4658936B2 (en) Compositions and methods for treating lung cancer
CA2805548A1 (en) The role of fragile x mental retardation gene and protein in cancer metastasis
US20070253954A1 (en) Epha4 As Therapeutic Target Of Prc And Pdaca
WO2005090991A1 (en) Adam8 as tumor marker and therapeutic target for non-small cell lung cancer
US20080063640A1 (en) Pin-Prc Transition Genes
US10294476B2 (en) NEAT1 as a prognostic marker and therapeutic target for prostate cancer
CN107362361B (en) Biomarker related to laryngeal squamous cell carcinoma
WO2008020652A1 (en) Imp-1 oncogene as a therapeutic target and prognostic indicator for lung cancer
US20260117226A1 (en) Long non-coding rnas as target for treating fibrosis and cancer
WO2003104488A1 (en) Eef1a2 for use in the prognosis, diagnosis and treatment of cancer
WO2005106039A1 (en) Ibc-1 (invasive breast cancer-1), a putative oncogene amplified in breast cancer
EP2199407A1 (en) In vitro methods and compositions for the diagnosis and/or treatment of adenocarcinoma
WO2003035848A9 (en) Ibc-1 (invasive breast cancer-1), a putative oncogene amplified in breast cancer
JP6823320B2 (en) Nucleic acid drug targeting cancer type SLCO1B3
WO2024189064A1 (en) The circular rna circltbp2 as a biomarker and biotarget in intrahepatic cholangiocarcinomas
CN117599078A (en) Cancer marker PANX1 and its uses
WO2012157239A1 (en) Chodl as tumor marker and therapeutic target for cancer
WO2004092407A1 (en) Pygopus in diagnosis and treatment of cancer
WO2005095447A2 (en) Low molecular weight forms of foxp1 proteins and splice variants thereof

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20061023

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

17Q First examination report despatched

Effective date: 20070326

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20101001