EP1720854A1 - Dérivés de phthalazinone comme inhibiteurs de pde4 - Google Patents

Dérivés de phthalazinone comme inhibiteurs de pde4

Info

Publication number
EP1720854A1
EP1720854A1 EP05701632A EP05701632A EP1720854A1 EP 1720854 A1 EP1720854 A1 EP 1720854A1 EP 05701632 A EP05701632 A EP 05701632A EP 05701632 A EP05701632 A EP 05701632A EP 1720854 A1 EP1720854 A1 EP 1720854A1
Authority
EP
European Patent Office
Prior art keywords
hydrogen
alkyl
alkoxy
compounds
ring
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP05701632A
Other languages
German (de)
English (en)
Inventor
Geert Jan Sterk
Armin Hatzelmann
Johannes Barsig
Degenhard Marx
Hans-Peter Kley
Johannes A. M. Christiaans
Wiro M. P. B. Menge
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Takeda GmbH
Original Assignee
Altana Pharma AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Altana Pharma AG filed Critical Altana Pharma AG
Priority to EP05701632A priority Critical patent/EP1720854A1/fr
Publication of EP1720854A1 publication Critical patent/EP1720854A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings

Definitions

  • the invention relates to novel phthalazinone-derivatives, which are used in the pharmaceutical industry for the production of pharmaceutical compositions.
  • the invention thus relates to compounds of formula 1 in which
  • R1 and R2 are both hydrogen or together form an additional bond
  • R3 represents a phenyl derivative of formulae (a) or (b)
  • R4 is 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or C-alkoxy which is completely or predominantly substituted by fluorine
  • R6 is 1-4C-alkoxy, 3-5C-cyclo alkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R7 is 1-4C-alkyl and R8 is hydrogen or 1-4C-alkyl, or wherein R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom
  • R9 is hydroxyl, 1-4C-alkoxy, -N(R10)H, -N
  • A is O, S, SO, S0 2 or R15,
  • R15 is hydrogen, 1-4C-alkyl, phenyl, pyridyl, -(CH ⁇ -Rl ⁇ or -(CH2) p -C(0)R17,
  • R16 is -N(R18)R19
  • R17 is -N(R20)R21
  • R18 is hydrogen, 1-4C-alkyI, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl,
  • R19 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, or R18 and R19 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, -piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yl-, 1-hexahydroazepinyl-, 4-morpholinyh 4-thiomorpholinyl-, thiomorpholin-1 -oxide-4-yl- or thiomorpholin-1 ,1-dioxide-4-yl-ring,
  • R20 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyi or 3-7C-cycloalkylmethyl,
  • R21 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, or R20 and R21 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yl-, 1-hexahydroazepinyl-, 4-morpholinyl, 4-thiomorpholinyl-, thiomorpholin-1 -oxide-4-y I- or thiomorpholin-1 ,1-dioxide-4-yl-ring, n is 0, 2, 3 or 4, m is 2, 3 or 4, p is 1 , 2, 3 or 4, and the salts of these compounds.
  • 1-4C-Alkyl is a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl, ethyl and methyl radicals.
  • 1-4C-Alkoxy is a radical which, in addition to the oxygen atom, contains a straight-chain or branched alkyl radical having 1 to 4 carbon atoms.
  • Alkoxy radicals having 1 to 4 carbon atoms which may be mentioned in this context are, for example, the butoxy, isobutoxy, sec-butoxy, tert-butoxy, propoxy, isopropoxy, ethoxy and methoxy radicals.
  • 1-8C-Alkoxy is a radical which, in addition to the oxygen atom, contains a straight -chain or branched alkyl radical having 1 to 8 carbon atoms.
  • Alkoxy radicals having 1 to 8 carbon atoms which may be men- tioned in this context are, for example, the octyloxy, heptyloxy, isoheptyloxy (5-methylhexyloxy), hexy- loxy, isohexyloxy (4-methylpentyloxy), neohexyloxy (3,3-dimethylbutoxy), pentyloxy, isopentyloxy (3-methylbutoxy), neopentyloxy (2,2-dimethylpropoxy), butoxy, isobutoxy, sec-butoxy, tert-butoxy, pro- poxy, isopropoxy, ethoxy and methoxy radicals.
  • 1-4C-Alkoxy which is completely or predominantly substituted by fluorine is, for example, the 2,2,3 ,3,3-perttafluoropropoxy, the perfluoroethoxy, the 1,2,2-trifluoroethoxy and in particular the 1,1,2,2-tetrafluoroethoxy, the 2,2,2-trifluoroethoxy, the trifluoromethoxy and the difluoromethoxy radical, of which the difluoromethoxy radical is preferred.
  • "Predominantly" in this connection means that more than half of the hydrogen atoms of the 1-4C-alkoxy group are replaced by fluorine atoms.
  • 3-7C-Cycloalkoxy stands for cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy or cyclo- heptyloxy, of which cyclopropyloxy, cyclobutyloxy and cyclopentyloxy are preferred.
  • 3-7C-Cycloalkylmethoxy stands for cyclopropylmethoxy, cyclobutylmethoxy, cyclopentylmethoxy, cyclo- hexylmethoxy or cycloheptylmethoxy, of which cyclopropylmethoxy, cyclobutylmethoxy and cyclopentylmethoxy are preferred.
  • 3-5C-Cycloalkoxy stands for cyclopropyloxy, cyclobutyloxy or cyclopentyloxy.
  • 3-5C-Cycloalkylmethoxy stands for cyclopropylmethoxy, cyclobutylmethoxy or cyclopentylmethoxy.
  • spiro-linked 5-, 6- or 7-membered hydrocarbon rings optionally interrupted by an oxygen or sulphur atom
  • the cyclopentane, cyclohexane, cycloheptane, tetrahydrofuran, tetrahydropyran and the tetrahydrothiophen ring may be mentioned the cyclopentane, cyclohexane, cycloheptane, tetrahydrofuran, tetrahydropyran and the tetrahydrothiophen ring.
  • 3-7C-Cycloalkyl stands for cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl, of which cyclopropyl and cyclopentyl are preferred.
  • 3-7C-Cycloalkylmethyl stands for cyclopropylmethyl, cyclobutylmethyl, cyclopentylmethyl, cyclohexyl- methyl or cycloheptylmethyl.
  • 1-4C-Alkoxy-2-4C-alkyl stands for one a 2-4C-alkyl radical, which is substituted by one of the abovemen- tioned 1-4C-alkoxy radicals. Examples which may be mentioned are the methoxyethyl and the meth- oxypropyl radical.
  • n is zero, the group -(CH 2 ) n - represents a bond. If R1 and R2 together form an additional bond, then there is between the two carbon atoms to which R1 and R2 are attached a double bond.
  • Suitable salts for compounds of formula 1 are - depending on substitution - all acid addition salts or all salts with bases. Particular mention may be made of the pharmacologically tolerable inorganic and organic acids and bases customarily used in pharmacy. Those suitable are, on the one hand, water-soluble and water-insoluble acid addition salts with acids such as, for example, hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulphuric acid, acetic acid, citric acid, D-gluconic acid, benzoic acid, 2-(4-hydroxybenzoyl)benzoic acid, butyric acid, sulphosalicylic acid, maleic acid, lauric acid, malic acid, fumaric acid, succinic acid, oxalic acid, tartaric acid, embonic acid, stearic acid, toluenesulphonic acid, methanesulphonic acid or 3-hydroxy-2-naphthoic acid, the acids being employed in salt preparation -
  • salts with bases are - depending on substitution - also suitable.
  • salts with bases are mentioned the lithium, sodium, potassium, calcium, aluminium, magnesium, titanium, ammonium, meglumine or guanidinium salts, here, too, the bases being employed in salt preparation in an equimolar quantitative ratio or one differing therefrom.
  • Pharmacologically intolerable salts which can be obtained, for example, as process products during the preparation of the compounds according to the invention on an industrial scale, are converted into pharmacologically tolerable salts by processes known to the person skilled in the art.
  • the compounds of the invention as well as their salts may contain, e.g. when isolated in crystalline form, varying amounts of solvents. Included within the scope of the invention are therefore all solvates and in particular all hydrates of the compounds of formula 1 as well as all solvates and in particular all hydrates of the salts of the compounds of formula 1.
  • An embodiment (embodiment A) of the compounds of formula 1 are those in which R1 and R2 are both hydrogen or together form an additional bond, R3 represents a phenyl derivative of formulae (a) or (b)
  • R4 is 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R6 is 1-4C-alkoxy, 3- ⁇ C-cycloalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R7 is 1-4C-alkyl and R8 is hydrogen or 1-4C-alkyl, or wherein R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom
  • R9 is hydroxyl, 1-4C-alkoxy, -N(R10)H,
  • A is O, S, SO, SO a or NR15,
  • R15 is hydrogen, 1-4C-alkyl, phenyl, pyridyl, -(CH 2 ) m -R16 or -(CH 2 ) p -C(0)R17,
  • R16 is -N(R18)R19
  • R17 is -N(R20)R21
  • R18 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl,
  • R19 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, or R18 and R19 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yl-, 1-hexahydroazepinyl-, 4-morpholiny!-, 4-thiomorpholinyl-, thiomorpholin-1 -oxide ⁇ -y I- or thiomorpholin-1 ,1-dioxide-4-yl-ring,
  • R20 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyI,
  • R21 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, or R20 and R21 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yI-, 1-hexahydroazepinyl-, 4-morpholinyl, 4-thiomorpholinyl-, thiomorpholin-1 -oxide-4-yl- or thiomorpholin-1 ,1-dioxide-4-yI-ring, n is 2, 3 or 4, m is 2, 3 or 4, p is 1, 2, 3 or 4, and the salts of these compounds.
  • R4 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-4C-alkoxy
  • R6 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine
  • R7 is methyl and R8 is hydrogen, or wherein R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked cyclopentane, cyclohexane, tetrahydrofuran or tetrahydropyran ring
  • R9 is hydroxyl, 1-4C-alkoxy, -N(R10)H, -N(H)N(R11)R12 or -N(R13)R14
  • R10 is hydroxyl or 1 4C-alkoxy
  • R11 is hydrogen or 1-4C-alkyl
  • R12 is hydrogen or 1-4C-alkyl
  • R13 and R14
  • A is O, S or NR15
  • R15 is hydrogen, 1-4C-alkyl or -(CH 2 ) P -C(0)R17,
  • R17 is -N(R20)R21 ,
  • R20 is hydrogen or 1-4C-alkyl
  • R21 is hydrogen or 1-4C-aikyl, or R20 and R21 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yl-, 1-hexahydroazepinyl-, 4-morpholinyl or 4-thiomorpholinyl-ring, n is 2, p is 1, and the salts of these compounds.
  • R4 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-4C-alkoxy
  • R6 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine
  • R7 is methyl and R8 is hydrogen, or wherein R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked cyclopentane, cyclohexane, tetrahydrofuran or tetrahydropyran ring
  • R9 is -N(R10)H, -N(H)N(R11)R12 or -N(R13)R14
  • R10 is hydroxyl or 1-4C-alkoxy
  • R11 is hydrogen or 1-4C-alkyl
  • R12 is hydrogen or 1-4C-alkyl
  • R13 and R14 are identical and are hydrogen or 1-4C-alky
  • A is O, S or NR15
  • R15 is hydrogen, 1-4C-alkyl or -(CH 2 ) P -C(0)R17,
  • R17 is -N(R20)R21
  • R20 is hydrogen or 1-4C-alkyl
  • R21 is hydrogen or 1-4C-alkyl, or R20 and R21 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yl-, 1-hexahydroazepinyl-, 4-morpholinyl or 4-thiomorpholinyl-ring, n is 2, P is 1, and the salts of these compounds.
  • Preferred compounds of formula 1 of embodiment A are those in which R1 and R2 are both hydrogen or together form an additional bond, R3 represents a phenyl derivative of formula (a)
  • R4 is methoxy or ethoxy
  • R5 is methoxy or ethoxy
  • R9 is -N(R13)R14
  • R13 is hydrogen
  • R14 is hydrogen, or R13 and R14 together and with inclusion of the nitrogen atom to which they are bonded, form a ring of formula (c), wherein
  • A is O or NR15
  • R15 is methyl or -(CH 2 ) P -C(0)R17,
  • R17 is 1-pyrrolidinyl, n is 2,
  • FIG. 1 Another embodiment (embodiment B) of the compounds of formula 1 are those in which R1 and R2 are both hydrogen or together form an additional bond, R3 represents a phenyl derivative of formulae (a) or (b)
  • R4 is 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R6 is 1-4C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R7 is 1-4C-alkyl and R8 is hydrogen or 1-4C-alkyl, or wherein R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom
  • R9 is 1-4C-alkoxy, -N(R10)H, -N(H
  • A is O, S, SO, S0 2 or NR15,
  • R15 is hydrogen, 1-4C-alkyl, phenyl, pyridyl, -(CH 2 ) m -R16 or -(CHz) p -C(0)R17,
  • R16 is -N(R18)R19
  • R17 is -N(R20)R21 ,
  • R18 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl,
  • R19 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkyImethyI, or R18 and R19 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyI)-piperazin-4-yl-, 1-hexahydroazepinyl-, 4-morpholinyl-, 4-thiomorpholinyl-, thiomorpholin-1-oxide-4-yl- or thiomorpholin-1 ,1-dioxide-4-yl-ring,
  • R20 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl,
  • R21 is hydrogen, 1-4C-aIkyI, 3-7C-cycloaIkyl or 3-7C-cycloalkylmethyl, or R20 and R21 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin ⁇ -yl-, 1-hexahydroazepinyl-, 4-morpholinyl, 4-thiomorpholinyl-, thiomorpholin-1 -oxide-4-yl- or thiomorpholin-1 ,1-dioxide-4-yl-ring, n is 0, 2, 3 or 4, m is 2, 3 or 4, p is 1 , 2, 3 or 4, and the salts of these compounds.
  • R4 is 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R6 is 1-4C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloaIkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R7 is 1-4C-alkyl and R8 is hydrogen or 1-4C-alkyl, or wherein R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom
  • R9 is 1-4C-alkoxy, -N(R10)H, -N(
  • A is O, S, SO, S0 2 or R15,
  • R15 is hydrogen, 1 ⁇ C-alkyl, phenyl, pyridyl, -(CH ⁇ -Rl ⁇ or -(CH ⁇ p -C JRI ⁇
  • R16 is -N(R18)R19
  • R17 is -N(R20)R21 ,
  • R18 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl,
  • R19 is hydrogen, 1-4C-alkyl, 3-7C-cyclo alkyl or 3-7C-cyc!oalkylmethyl, or R18 and R19 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yl-, 1-hexahydroazepinyl-, 4-morpholinyl-, 4-thiomorpholinyl-, thiomorpholin-1 -oxide-4-y I- or thiomorpholin-1 ,1-dioxide-4-yl-ring,
  • R20 is hydrogen, 1 ⁇ C-alkyi, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl,
  • R21 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyl, or R20 and R21 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yl-, 1-hexahydroazepinyl-, 4-morpholinyl, 4-thiomorpholinyl-, thiomorpholin-1 -oxide-4-yl- or thiomorpholin-1 ,1-dioxide-4-yl-ring, n is 2, 3 or 4, m is 2, 3 or 4, p is 1, 2, 3 or 4, and the salts of these compounds.
  • R4 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-4C-alkoxy
  • R6 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine
  • R7 is methyl and R8 is hydrogen, or wherein R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked cyclopentane, cyclohexane, tetrahydrofuran or tetrahydropyran ring
  • R9 is 1-4C-alkoxy, -N(R10)H, -N(H)N(R11)R12 or -N(R13)R14
  • R10 is hydroxyl or 1-4C-alkoxy
  • R11 is hydrogen or 1-4C-alkyl
  • R12 is hydrogen or 1-4C-alkyl
  • R13 and R14 are identical and are
  • A is O, S or R15,
  • R15 is hydrogen, 1-4C-alkyl or -(CH Z ) P -C(0)R17,
  • R17 is -N(R20)R21 ,
  • R20 is hydrogen or 1-4C-alkyl
  • R21 is hydrogen or 1-4C-alkyl, or R20 and R21 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yl-, 1-hexahydroazepinyl-, 4-morpholinyl or 4-thiomorpholinyl-ring, n is 2, P is 1, and the salts of these compounds.
  • R4 is 1-4C-alkoxy or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-8C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R6 is 1-4C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, or 1-4C-alkoxy which is completely or predominantly substituted by fluorine
  • R7 is 1-4C-alkyl and R8 is hydrogen or 1-4C-alkyl, or wherein R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked 5-, 6- or 7-membered hydrocarbon ring, optionally interrupted by an oxygen or sulphur atom
  • R9 is hydroxyl, 1-4C-alkoxy, -N(R10)H,
  • A is O, S, SO, S0 2 or NR15,
  • R15 is hydrogen, 1-4C-alkyl, phenyl, pyridyl, -(CH 2 ) m -R16 or -(CH 2 ) P -C(0)R17,
  • R16 is -N(R18)R19
  • R17 is -N(R20)R21 ,
  • R18 is hydrogen, 1-4C-aikyl, 3-7C-cycloalkyl or 3-7G-cycloalkylmethyl,
  • R19 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycloalkylmethyI, or R18 and R19 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yl-, 1-hexahydroazepinyl-, 4-morpholinyl-, 4-thiomorpholinyl-, thiomorpholin-1-oxide-4-yl- or thiomorpholin-1 ,1-dioxide- -yl-ring,
  • R20 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyi or 3-7C-cycloalkylmethyl,
  • R21 is hydrogen, 1-4C-alkyl, 3-7C-cycloalkyl or 3-7C-cycioalkylmethyl, or R20 and R21 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yl-, 1-hexahydroazepinyl-, 4-morpholinyl, 4-thiomorpholinyl-, thiomorpholin-1 -oxide-4-yl- or thiomorpholin-1 ,1- ioxide-4-yl-ring, n is 0, m is 2, 3 or 4, p is 1 , 2, 3 or 4, and the salts of these compounds.
  • R4 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-4C-alkoxy
  • R6 is 1-2C ⁇ alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine
  • R7 is methyl and R8 is hydrogen, or wherein R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked cyclopentane, cyclohexane, tetrahydrofuran or tetrahydropyran ring
  • R9 is hydroxyl, 1-4C-alkoxy, -N(R10)H, -N(H)N(R11)R12 or -N(R13)R14
  • R10 is hydroxyl, 1-4C-alkoxy or 1-4C-alkoxy-2-4C-alkyl
  • R11 is hydrogen or 1-4C-alkyl
  • R12 is hydrogen
  • A is O, S or NR15
  • R15 is hydrogen, 1 ⁇ C-alkyl or -(0 ⁇ -0(0) R17,
  • R17 is -N(R20)R21
  • R20 is hydrogen or 1-4C-alkyl
  • R21 is hydrogen or 1-4C-alkyl, or R20 and R21 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yl-, 1-hexahydroazepinyl- 4-morpholinyl or 4-thiomorpholinyl-ring, n is 0, p is 1, and the salts of these compounds.
  • R4 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine
  • R5 is 1-4C-alkoxy
  • R6 is 1-2C-alkoxy or 1-2C-alkoxy which is completely or predominantly substituted by fluorine
  • R7 is methyl and R8 is hydrogen, or wherein R7 and R8 together and with inclusion of the two carbon atoms, to which they are bonded, form a spiro-linked cyclopentane, cyclohexane, tetrahydrofuran or tetrahydropyran ring
  • R9 is -N(R10)H, -N(H)N(R11 )R12 or -N(R13)R14
  • R10 is hydroxyl, 1-4C-alkoxy or 1-4C-alkoxy-2-4C-alkyl
  • R11 is hydrogen or 1-4C-alkyl
  • R12 is hydrogen or 1-4C-aIkyl
  • A is O, S or R15,
  • R15 is hydrogen, 1-4C-alkyl or - ⁇ C+y p -C(O)R17,
  • R17 is -N(R20)R21
  • R20 is hydrogen or 1-4C-alkyl
  • R21 is hydrogen or 1-4C-alkyl
  • R20 and R21 together and with inclusion of the nitrogen atom to which they are bonded, form a 1-pyrrolidinyl-, 1-piperidinyl-, 1-piperazinyl, 1-(1-4C-alkyl)-piperazin-4-yl-, 1-hexahydroazepinyl-, 4-morpholinyl or 4-thiomorpholinyl-ring
  • n is 0, P is 1, and the salts of these compounds.
  • Preferred compounds of formula 1 of embodiment C are those in which R1 and R2 are both hydrogen or together form an additional bond, R3 represents a phenyl derivative of formulae (a) or (b)
  • R4 is methoxy or ethoxy
  • ⁇ -J R5 is methoxy or ethoxy
  • R6 is methoxy
  • R7 is methyl and R8 is hydrogen
  • R9 is -N(R10)H, -N(H)N(R11)R12 or -N(R13)R14
  • R10 is hydroxyl or methoxyethyl
  • R11 is methyl
  • R12 is methyl
  • R13 is hydrogen or methyl
  • R14 is hydrogen or methyl
  • R13 and R14 together and with inclusion of the nitrogen atom to which they are bonded, form a ring of formula (c),
  • A is O or NR15
  • R15 is methyl, n is 0, and the salts of these compounds.
  • a subgroup of preferred compounds of formula 1 of embodiment C are those in which R1 and R2 are both hydrogen or together form an additional bond, R3 represents a phenyl derivative of formula (a)
  • R4 is methoxy or ethoxy
  • R5 is methoxy or ethoxy
  • R9 is -N(R10)H, -N(H)N(R11)R12 or -N(R13)R14
  • R10 is hydroxyl or methoxyethyl
  • R11 is methyl
  • R12 is methyl
  • R13 is hydrogen or methyl
  • R14 is hydrogen or methyl
  • R13 and R14 together and with inclusion of the nitrogen atom to which they are bonded, form a ring of formula (c)
  • A is O or NR15
  • R15 is methyl, n is 0, and the salts of these compounds.
  • Particularly preferred compounds of formula 1 of embodiment C are those in which R1 and R2 are both hydrogen or together form an additional bond, R3 represents a phenyl derivative of formulae (a) or (b) wherein R4 is methoxy or ethoxy, R5 is methoxy or ethoxy, R6 is methoxy, R7 is methyl and R8 is hydrogen, R9 is -N(R13)R14, R13 and R14 together and with inclusion of the nitrogen atom to which they are bonded, form a ring of formula (c), wherein
  • A is O, n is 0, and the salts of these compounds.
  • a special embodiment of the compounds of the present invention includes those compounds of formula 1 in which R3 represents a phenyl derivative of formula (a).
  • Another special embodiment of the compounds of the present invention includes those compounds of formula 1 in which R3 represents a phenyl derivative of formula (a) and R4 and R5 have the meaning methoxy.
  • Still another special embodiment of the compounds of the present invention includes those compounds of formula 1 in which R1 and R2 are both hydrogen.
  • a further special embodiment of the compounds of the present invention includes those compounds of formula 1 in which R3 represents a phenyl derivative of formula (a), R4 and R5 have the meaning methoxy and n is 0. Still a further special embodiment of the compounds of the present invention includes those compounds of formula 1 in which R3 represents a phenyl derivative of formula (a), R4 and R5 have the meaning methoxy and n is 2.
  • Another special embodiment of the compounds of the present invention includes those compounds of formula 1 in which R3 represents a phenyl derivative of formula (b).
  • the compounds of formula 1 are chiral compounds. Chiral centers exist in the compounds of formula 1 in the positions 4a and 8a.
  • R3 represents a phenyl derivative of formula (b) there is one further chiral center in the dihydrofuran-ring, if the substituents -R7 and -CH 2 R8 are not identical.
  • preferred are in this connection those compounds, in which the substituents -R7 and -CH 2 R8 are identical or together and with inclusion of the two carbon atoms to which they are bonded form a spiro-connected 5-, 6- or 7-membered hydrocarbon ring.
  • the invention includes all conceivable pure diastereomers and pure enantiomers, as well as all mixtures thereof independent from the ratio, including the racemates.
  • Preferred are those compounds, in which the hydrogen atoms in the positions 4a and 8a are cis-configu rated.
  • Particular preferred in this connection are those compounds, in which the absolute configuration (according to the rules of Cahn, Ingold and Prelog) is S in the position 4a and R in the position 8a. Racemates can be split up into the corresponding enantiomers by methods known by a person skilled in the art.
  • racemic mixtures are separated into two diastereomers during the preparation with the help of an optical active separation agent on the stage of the cyclohexanecarboxylic acids or the 1 ,2,3,6-tetrahydrobenzoic acids (for example, starting compound A1 and A4).
  • an optical active separation agent on the stage of the cyclohexanecarboxylic acids or the 1 ,2,3,6-tetrahydrobenzoic acids (for example, starting compound A1 and A4).
  • the compounds of formula 1 according to the invention can be prepared, for example, as described in Reaction schemes 1 and 2.
  • Reaction scheme 2 shows an analogous synthesis for compounds of formulae 1a and 1b, in which R1, R2, R4, R5, R6, R7 and R8 have the above-mentioned meanings and n is 0.
  • dimethyl oxalate is used instead of succinic acid anhydride or glutaric acid anhydride.
  • the conversions are carried out analogous to methods, which are familiar per se to the person skilled in the art, for example, in the manner which is described in the following examples.
  • the substances according to the invention are isolated and purified in a manner known per se, e.g. by distilling off the solvent in vacuo and recrystallising the residue obtained from a suitable solvent or subjecting it to one of the customary purification methods, such as column chromatography on a suitable support material.
  • Salts are obtained by dissolving the free compound in a suitable solvent (for example a ketone like acetone, methylethylketone, or methylisobutylketone, an ether, like diethyl ether, tetrahydrofuran or dioxane, a chlorinated hydrocarbon, such as methylene chloride or chloroform, or a low molecular weight aliphatic alcohol, such as ethanol, isopropanol) which contains the desired acid, or to which the desired acid is then added.
  • the salts are obtained by filtering, reprecipitating, precipitating with a non-solvent for the addition salt or by evaporating the solvent. Salts obtained can be converted by basification into the free compounds which, in turn, can be converted into salts. In this manner, pharmacologically non-tolerable salts can be converted into pharmacologically tolerable salts.
  • RT room temperature
  • h hour(s)
  • min minute(s)
  • M. p. melting point
  • the compounds according to the invention have useful pharmacological properties which make them industrially utilizable.
  • selective cyclic nucleotide phosphodiesterase (PDE) inhibitors specifically of type 4
  • they are suitable on the one hand as bronchial therapeutics (for the treatment of airway obstructions on account of their dilating action but also on account of their respiratory rate- or respiratory drive-increasing action) and for the removal of erectile dysfunction on account of their vascular dilating action, but on the other hand especially for the treatment of disorders, in particular of an inflammatory nature, e.g.
  • the compounds according to the invention are distinguished by a low toxicity, a good enteral absorption (high bioavailability), a large therapeutic breadth and the absence of significant side effects.
  • the compounds according to the invention can be employed in human and veterinary medicine as therapeutics, where they can be used, for example, for the treatment and prophylaxis of the following illnesses: acute and chronic (in particular inflammatory and allergen-induced) airway disorders of varying origin (bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD); dermatoses (especially of proliferative, inflammatory and allergic type) such as psoriasis (vulgaris), toxic and allergic contact eczema, atopic eczema, seborrhoeic eczema, Lichen simplex, sunburn, pruritus in the anogenital area, alopecia areata, hypertrophic scars, discoid lupus erythematosus, follicular and widespread pyodermias, endogenous and exogenous acne, acne rosacea and other prolife
  • the compounds of the invention are useful in the treatment of diabetes insipidus, diabetes mellitus, leukaemia, osteoporosis and conditions associated with cerebral metabolic inhibition, such as cerebral senility, senile demen- tia (Alzheimer's disease), memory impairment associated with Parkinson's disease or multiinfarct dementia; and also illnesses of the central nervous system, such as depressions or arteriosclerotic dementia.
  • the invention further relates to a method for the treatment of mammals, including humans, which are suffering from one of the above mentioned illnesses.
  • the method is characterized in that a therapeutically active and pharmacologically effective and tolerable amount of one or more of the compounds according to the invention is administered to the ill mammal.
  • the invention further relates to the compounds according to the invention for use in the treatment and/or prophylaxis of illnesses, especially the illnesses mentioned.
  • the invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions which are employed for the treatment and/or prophylaxis of the illnesses mentioned.
  • the invention furthermore relates to pharmaceutical compositions for the treatment and/or prophylaxis of the illnesses mentioned, which contain one or more of the compounds according to the invention.
  • the invention relates to an article of manufacture, which comprises packaging material and a pharmaceutical agent contained within said packaging material, wherein the pharmaceutical agent is therapeutically effective for antagonizing the effects of the cyclic nucleotide phosphodiesterase of type 4 (PDE4), ameliorating the symptoms of an PDE4-mediated disorder, and wherein the packaging material comprises a label or package insert which indicates that the pharmaceutical agent is useful for preventing or treating PDE4-mediated disorders, and wherein said pharmaceutical agent comprises one or more compounds of formula 1 according to the invention.
  • the packaging material, label and package insert otherwise parallel or resemble what is generally regarded as standard packaging material, labels and package inserts for pharmaceuticals having related utilities.
  • compositions are prepared by processes which are known per se and familiar to the person skilled in the art.
  • the compounds according to the invention are either employed as such, or preferably in combination with suitable pharmaceutical auxiliaries and/or excipients, e.g. in the form of tablets, coated tablets, capsules, caplets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between 0.1 and 95% and where, by the appropriate choice of the auxiliaries and/or excipients, a pharmaceutical administration form (e.g. a delayed release form or an enteric form) exactly suited to the active compound and/or to the desired onset of action can be achieved.
  • suitable pharmaceutical auxiliaries and/or excipients e.g. in the form of tablets, coated tablets, capsules, caplets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between
  • auxiliaries or excipients which are suitable for the desired pharmaceutical formulations on account of his/her expert knowledge.
  • solvents for example antioxidants, dispersants, emulsifiers, preservatives, solubili ⁇ ers, colorants, complexing agents or permeation promoters, can be used.
  • compositions according to the invention may be performed in any of the generally accepted modes of administration available in the art.
  • suitable modes of administration include intravenous, oral, nasal, parenteral, topical, transdermal and rectal delivery. Oral delivery is preferred.
  • the compounds according to the invention are preferably also administered by inhalation in the form of an aerosol; the aerosol particles of solid, liquid or mixed composition preferably having a diameter of 0.5 to 10 ⁇ m, advantageously of 2 to 6 ⁇ m.
  • Aerosol generation can be carried out, for example, by pressure-driven jet atomizers or ultrasonic atomizers, but advantageously by propellant-driven metered aerosols or propellant-free administration of micro- nized active compounds from inhalation capsules.
  • the administration forms additionally contain the required excipients, such as, for example, propellants (e.g. Frigen in the case of metered aerosols), surface-active substances, emulsifiers, stabilizers, preservatives, flavorings, fillers (e.g. lactose in the case of powder inhalers) or, if appropriate, further active compounds.
  • propellants e.g. Frigen in the case of metered aerosols
  • surface-active substances e.g. Frigen in the case of metered aerosols
  • emulsifiers emulsifiers
  • stabilizers emulsifiers
  • preservatives e.g., emulsifiers, stabilizers, preservatives
  • flavorings e.g. lactose in the case of powder inhalers
  • fillers e.g. lactose in the case of powder inhalers
  • the compounds according to the invention are in particular administered in the form of those pharmaceutical compositions which are suitable for topical application.
  • suitable pharmaceutical formulations are, for example, powders, emulsions, suspensions, sprays, oils, ointments, fatty ointments, creams, pastes, gels or solutions.
  • the pharmaceutical compositions according to the invention are prepared by processes known per se. The dosage of the active compounds is carried out in the order of magnitude customary for PDE inhibitors.
  • Topical application forms for the treatment of dermatoses thus contain the active compounds in a concentration of, for example, 0.1-99%.
  • the dose for administration by inhalation is customariy between 0.1 and 3 mg per day.
  • the customary dose in the case of systemic therapy is between 0.03 and 3 mg/kg per day.
  • the second messenger cyclic AMP (cAMP) is well-known for inhibiting inflammatory and immunocom- petent cells.
  • the PDE4 isoenzyme is broadly expressed in cells involved in the initiation and propagation of inflammatory diseases (H Tenor and C Schudt, in .Phosphodiesterase Inhibitors", 21-40, addedThe Handbook of Immunopharmacology", Academic Press, 1996), and its inhibition leads to an increase of the intracellular cAMP concentration and thus to the inhibition of cellular activation (JE Souness et al., Immunopharmacology 47: 127-162, 2000).
  • Examples are the superoxide production of neutrophilic (C Schudt et al., Arch Pharmacol 344: 682-690, 1991) or eosinophilic (A Hatzel- mann et al., Brit J Pharmacol 114: 821-831, 1995) granulocytes, which can be measured as luminol- enhanced chemiluminescence, or the synthesis of tumor necrosis factor- ⁇ in monocytes, macrophages or dendritic cells (Gantner et al., Brit J Pharmacol 121 : 221-231, 1997, and Pulmonary Pharmacol Therap 12: 377-386, 1999).
  • the PDE activity was determined according to Thompson et al. (Adv Cycl Nucl Res 10: 69-92, 1979) with some modifications (Bauer and Schwabe, Naunyn-Schmiedeberg's Arch Pharmacol 311 : 193-198, 1980).
  • the test samples contained 20 mM Tris (pH 7.4), 5 mM MgCI 2 , 0.5 ⁇ M cAMP or cGMP, [ 3 H]cAMP or [ 3 H]c ⁇ MP (about 30 000 cpm/sample), the PDE isoenzyme-specific additives described in greater detail below, the indicated concentrations of inhibitor and an aliquot of the enzyme solution in a total sample volume of 200 ⁇ l.
  • Dilution series of the compounds according to the invention were prepared in DMSO and further diluted in the samples [1 :100 (v/v)], to give the desired end concentration of the inhibitors at a DMSO concentration of 1% (v/v), which for its part has only a minute effect on PDE activity.
  • the radioactivity of the eluate was measured and corrected by the corresponding blank values (measured in the presence of denatured protein); the blank values were less than 5% of the total radioactivity. In no case did the proportion of hydrolyzed nucleotide exceed 30% of the original substrate concentration.
  • PDE4 cAMP-specific was investigated in the cytosol of human polymorphonuclear leukocytes (PMNL) [isolated from leukocyte concentrates, see Schudt et al., Arch Pharmacol 1991 : 344. 682-690] using cAMP as substrate.
  • PMNL human polymorphonuclear leukocytes
  • the IC50 values were determined from the concentration-inhibition curves by nonlinear regression.
  • the PDE4B2 (GB no. M97515) was a gift of Prof. M. Conti (Stanford University, USA). It was amplified from the original plasmid (pCMV5) via PCR with primers Rb9 (5'- GCCAGCGTGCAAATAATGAAGG -3') and Rb10 (5'- AGAGGGGGATTATGTATCCAC -3') and cloned into the pCR-Bac vector (Invitrogen, Gron- ingen, NL). The recombinant baculovirus was prepared by means of homologous recombination in SF9 insect cells.
  • the expression plasmids were cotransfected with Bac-N-Blue (Invitrogen, Groningen, NL) or Baculo-Gold DNA (Pharmingen, Hamburg) using a standard protocol (Pharmingen, Hamburg). Wt virus-free recombinant virus supernatants were selected using plaque assay methods. After that, high-titre virus superna- tants were prepared by amplifying 3 times.
  • PDE4B2 was expressed in SF21 cells by infecting 2x10 6 cells/ml with an MOI (multiplicity o.f infection) between 1 and 10 in serum-free SF900 medium (Life Technologies, Paisley, UK). The cells were cultured at 28 ⁇ 0 for 48 - 72 hours, after which they were pelleted for 5-10 min at 1000 g and 4°C.
  • the SF21 insect cells were resuspended, at a concentration of approx. 10 7 cells/ml, in ice-cold (4°C) homogenization buffer (20 mM Tris, pH 8.2, containing the following additions: 140 mM NaCl, 3.8 mM KCI, 1 mM EGTA, 1 mM MgC 10 mM ⁇ -mercaptoethanol, 2 mM benzamidine, 0.4 mM Pefablock, 10 ⁇ M leupeptin, 10 ⁇ M pepstatin A, 5 ⁇ M trypsin inhibitor) and disrupted by ultrasonication. The ho- mogenate was then centrifuged for 10 min at 1000xg and the supernatant was stored at- ⁇ OO until subsequent use (see below). The protein content was determined by the Bradford method (BioRad, Kunststoff) using BSA as the standard.
  • PDE4B2 activity was inhibited by the said compounds in a modified SPA (scintillation proximity assay) test, supplied by Amersham Biosciences (see procedural instructions "phosphodiesterase [3H]cAMP SPA enzyme assay, code TRKQ 7090"), carried out in 96-welI microtitre plates (MTP's).
  • modified SPA sintillation proximity assay
  • the test volume is 100 ⁇ l and contains 20 mM Tris buffer (pH 7.4), 0.1 mg of BSA (bovine serum albumin)/ml, 5 mM Mg 2+ , 0.5 ⁇ M cAMP (including about 50,000 cpm of [3H]cAMP), 1 ⁇ l of the respective substance dilution in DMSO and sufficient recombinant PDE (1000xg supernatant, see above) to ensure that 10-20% of the cAMP is converted under the said experimental conditions.
  • the final concentration of DMSO in the assays (1 % v/v) does not substantially affect the activity of the PDEs investigated.
  • the reaction is started by adding the substrate (cAMP) and the assays are incubated for a further 15 min; after that, they are stopped by adding SPA beads (50 ⁇ l).
  • the SPA beads had previously been resuspended in water, but were then diluted 1 :3 (v/v) in water; the diluted solution also contains 3 mM IBMX to ensure a complete PDE activity stop.
  • the MTP's are analyzed in commercially available luminescence detection devices. The corresponding ICso values of the compounds for the inhibition of PDE activities are determined from the concentration-effect curves by means of non-linear regression.
  • the inhibitory values of the compounds 1-6 have been determined according to Method A.
  • the inhibitory values of the compounds 7-15 have been determined according to Method B. Table 1

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Pulmonology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne les composés représentés par la formule (1), dans laquelle R1, R2, R3, R9 et n ont les significations données dans le descriptif. Ces composés sont de nouveaux inhibiteurs efficaces de PDE4.
EP05701632A 2004-02-04 2005-02-01 Dérivés de phthalazinone comme inhibiteurs de pde4 Withdrawn EP1720854A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP05701632A EP1720854A1 (fr) 2004-02-04 2005-02-01 Dérivés de phthalazinone comme inhibiteurs de pde4

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP04002423 2004-02-04
EP05701632A EP1720854A1 (fr) 2004-02-04 2005-02-01 Dérivés de phthalazinone comme inhibiteurs de pde4
PCT/EP2005/050417 WO2005075457A1 (fr) 2004-02-04 2005-02-01 Derives de phtalazinone utilises en tant qu'inhibiteurs de pde4

Publications (1)

Publication Number Publication Date
EP1720854A1 true EP1720854A1 (fr) 2006-11-15

Family

ID=34833571

Family Applications (1)

Application Number Title Priority Date Filing Date
EP05701632A Withdrawn EP1720854A1 (fr) 2004-02-04 2005-02-01 Dérivés de phthalazinone comme inhibiteurs de pde4

Country Status (2)

Country Link
EP (1) EP1720854A1 (fr)
WO (1) WO2005075457A1 (fr)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7494990B2 (en) 2004-02-04 2009-02-24 Nycomed Gmbh 2-(piperidin-4-yl)-4,5-dihydro-2H-pyridazin-3-one derivatives as PDE4 inhibitors
RS52074B (en) * 2007-05-16 2012-06-30 Nycomed Gmbh PIRAZOLONE DERIVATED AS PDE4 INHIBITORS
AR074318A1 (es) 2008-11-14 2011-01-05 Nycomed Gmbh Derivados heterociclicos de pirazolona, composiciones farmaceuticas que los contienen y uso de los mismos para el tratamiento de enfermedades de las vias respiratorias.
AR086915A1 (es) * 2011-06-17 2014-01-29 Nycomed Gmbh Derivados de ftalazinona-pirrolopirimidinacarboxamida y composiciones farmaceuticas que los contiene

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MXPA03007310A (es) * 2001-02-15 2003-12-04 Altana Pharma Ag Derivados de ftalazinona piperidino como inhibidores pde4.

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
None *
See also references of WO2005075457A1 *

Also Published As

Publication number Publication date
WO2005075457A1 (fr) 2005-08-18
WO2005075457A8 (fr) 2006-03-02

Similar Documents

Publication Publication Date Title
US7220746B2 (en) Pyrrolidinedione substituted piperidine-phthalazones as PDE4 inhibitors
US20060166995A1 (en) Piperidine-n-oxide-derivatives
WO2004018449A1 (fr) Derives de piperidine utilises comme inhibiteurs de la phospodiesterase-4 (pde4)
CA2495597A1 (fr) Nouvelles phenanthridines
JP2005538138A (ja) Ｐｄｅ４インヒビターとしてのピリダジノン誘導体
AU2002315311B2 (en) Piperazino-derivatives and their use as PDE4 inhibitor
AU781503B2 (en) Phthalazinone derivatives as PDE 4 inhibitors
AU2002315311A1 (en) Piperazino-derivatives and their use as PDE4 inhibitor
EP1720854A1 (fr) Dérivés de phthalazinone comme inhibiteurs de pde4
US7820669B2 (en) 2-(piperidin-4-yl)-4,5-dihydro-2H-pyridazin-3-one derivatives as PDE4 inhibitors
US20080119505A1 (en) Novel 6-Pyridylphenanthridines
US20080227790A1 (en) Pyridazinone Derivatives and their Use as Pde4 Inhibitors

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20060914

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR

RIN1 Information on inventor provided before grant (corrected)

Inventor name: BARSIG, JOHANNES

Inventor name: HATZELMANN, ARMIN

Inventor name: KLEY, HANS-PETER

Inventor name: STERK, GEERT JAN

Inventor name: MENGE, WIRO M. P. B.

Inventor name: MARX, DEGENHARD

Inventor name: CHRISTIAANS, JOHANNES A. M.

RIN1 Information on inventor provided before grant (corrected)

Inventor name: HATZELMANN, ARMIN

Inventor name: KLEY, HANS-PETER

Inventor name: CHRISTIAANS, JOHANNES A. M.

Inventor name: MARX, DEGENHARD

Inventor name: MENGE, WIRO M. P. B.

Inventor name: BARSIG, JOHANNES

Inventor name: STERK, GEERT JAN

17Q First examination report despatched

Effective date: 20061208

R17P Request for examination filed (corrected)

Effective date: 20060904

RIN1 Information on inventor provided before grant (corrected)

Inventor name: CHRISTIAANS, JOHANNES A. M.

Inventor name: HATZELMANN, ARMIN

Inventor name: BARSIG, JOHANNES

Inventor name: MENGE, WIRO M. P. B.

Inventor name: MARX, DEGENHARD

Inventor name: STERK, GEERT JAN

Inventor name: KLEY, HANS-PETER

DAX Request for extension of the european patent (deleted)
RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: NYCOMED GMBH

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070619