Definitions

• the invention relates to a method for regulating plant growth.
• Plant growth is accomplished by orderly cell division and tightly regulated cell expansion. In plants the contribution of c ⁇ ll expansion to growth is of much greater significance than in most other organisms. All plant organs owe their final size to a period of significant cell elongation which usually follows active cell division. Cell elongation is a major factor in growth. Coordinate control of plant growth is regulated by both external stimuli and internal mechanism. Of the external signals the most obvious is light. The internal components of plant signalling are generally mediated by chemical growth regulators. Thus, plant growth in response to environmental factors is modulated by plant hormones acting alone or in concert and growth depends on regulated cellular events, such as division, elongation and differentiation.
• GABA Gibberellic acid
• cyto inins promote flowering; in addition, GA stimulates stem elongation, whereas cytokinins have the opposite effect, reducing apical dominance by stimulating increased axillary shoot formation.
• auxins promote apical dominance and stimulate elongation by a process postulated to require acidification of the cell wall by a K + -dependent H + - pumping ATPase.
• BRs brassinosteroids
• Brassinosteroids are plant hormones ⁇ ith a polyoxygenated steroid structure showing pronounced plant growth regulatory activity (see reviews of Zullo et al.
• brassinosteroids show structural similarity to the steroid hormones of vertebrates and insects. Plant mutants defective in brassinosteroid biosynthesis or perception exhibit dwarfism and reduced fertility, and reveal the need for brassinosteroids during growth and development. For example, brassinosteroid signalling in Arabidopsis thaliana and Oryza sativa - dicotyledonous and monoctotyledonous models, respectively - is mediated by the receptor kinases BRI1 and OsBRIl.
• BRI1 The extracellular domain of BRI1 perceives brassinosteroids and the signal is mediated via an in- tracellular kinase domain that autophosphorylates Ser and Thr residues and apparently has the potential to phosphorylate other downstream signalling components.
• BRIl transduces steroid signals across the plasma membrane and mediates regulatory effects on gene expression (M ⁇ ssig et al., TRENDS in Endocrinology & Metabolism 12(9) (2001), 398-402).
• Plants with short stature are advantageous in many agriculturual settings, as the harvesting index is improved (more grain, less straw) and the plants are often more resistant to lodging due to rain, wind and planting in high density.
• Most of the progress of the so called green revolution has been achieved by altering plant hormone homeostasis. Elongation of plants is mediated by gibberellins, auxins and brassinosteroids.
• gibberellins, auxins and brassinosteroids Several molecular mechanisms have been elucidated which cause phenotypes of agricultural value.
• the present invention therefore provides a method for regulating plant growth which is characterised in that the activity of a brassinosteroid specific glycosyltransferase is influenced.
• Brassinosteroid specific glycosyltransferases inactivate a brassinosteroid plant hormone by attachment of a sugar residue.
• the selective control of the activity of these brassinosteroid specific glycosyltransferases is therefore an elegant means for regulating plant growth: Enhancing the activity of such an enzyme inactivates the plant brassinosteroid hormones and may therefore lead to dwarfing, an inhibition of the (physiological) brassinosteroid specific glycosyltransferase activity leads to enhanced action of these plant hormones, improved growth.
• the glycosyltransferases to be used according to the present invention have a specific glycosyltransferase activity to the naturally occurring brassinosteroids, as e.g. given in Figs. 1 and 2, wherein the general structural formula of natural brassinosteroids are given.
• brassinolide biosynthesis begins with the reduction of Campesterol to Campestanol which is oxidised to 6 ⁇ -Hydroxy- campestanol and this to ⁇ -Oxocampestanol.
• action of glycosyltransferases on these brassinosteroids can be made in any step during biosynthesis and action of these hormones. It is, however, preferred to act on the common compounds of both biosynthetic pathways, e.g. on Campesterol or Campestanol on the one hand or on Castasterone or Brassinolide on the other hand.
• specific glycosylation of these intermediate products leads to pathway specific regulation of the hormone synthesis.
• a brassinosteroid specific glycosyltransferase has preferably the brassinoid specific glycosylation as its main activity (under physiological conditions in the plant) . Especially in view of the fact that many glycosyltransferases have further (side) activities, also side specificities may be used according to the present invention, yet less preferred.
• plant growth is reduced by enhancing the expression of the brassinosteroid specific glycosyltransferase.
• Enhancing the activity of the glycosyl- transferase may preferably be achieved by exogenous supplementation of transferase activators, by addition of inhibitors to competing substances, especially enzymes, or by raising the amount of active glycosyltransferase molecules in the plant.
• this can be achieved by plant molecular biology: typically a heterologous UGT with substrates specificity for brassinosteroids is placed downstream of a strong constitutive or inducible, preferentially tissue specific promoter.
• heterologous means that the glycosyltransferase or expression regulating element is a gene or element not naturally present in this location (a gene or sequence being naturally present is referred to as an "endo- geneous" glycosyltransferase or in the genome sequence) in the wild type plant, e.g. an expression regulating element from another plant species or from another locus of the same species is inserted or that a glycosyltransferase from a different plant species is introduced.
• Ways of inhibiting a given glycosyltransferase activity in a specific plant or plant cell include knock out mutations of the genes or essential parts thereof or of regulating elements needed for expression, applying antisense technology or applying RNA interference (RNAi) technology (see e.g. Nature Reviews “RNAi collection” (December 2003), 1-43).
• RNAi RNA interference
• any brassinosteroid specific glycosyltransferase may be used according to the present invention. It is, however, preferred to use a glucosyltransferase since brassinosteroids have proved to be most susceptible to glucosylation.
• Preferred examples of glucosyltransferases to be used according to the present invention are UDP-glucosyltransferases, preferably those corresponding to sub-family 73C of Arabidopsis thaliana, especially UDP-glucosyltransferases 73C5, 73C6 and 73C4. Amino acid sequence of UDP-glucosyltransferase 73C5 is given in Fig. 4.
• homologues to these glucosyltransferases from other plants are also preferred.
• UDP-glucosyltransferases corresponding to sub-family 73C4 and 73C5 of Arabidopsis from other plants especially those having a high amino acid amino acid identity to the polypeptides of Arabidopsis, i.e. a sequence identity being higher than 70%, preferably higher than 80%, especially higher than 90% identity, especially in the N-terminal substrate specificity domain.
• Sequence identities may e.g.
• amino acid identity may also be calculated for a given region (e.g. having a length of at least 100 amino acid residues) of the enzyme comprising the enzymatically important region.
• a preferred method comprises introducing a tissue specific promoter for the brassinosteroid specific glycosyltransferase, especially a stem specific promoter into a plant.
• organ specific promoters it is possible to direct the dwarfing or elongation to specific target tissue.
• an active and high expression promoter acting specifically in the cells of the stem may be provided which is not active in leave or reproductive organs.
• This technique is in principle known to the skilled man in the art and may be applied to the present invention with the knowledge given in the present description (an approach based on expression of a GA catabolic enzyme GA2-oxi- dase is published in Sakamoto et al . , Nat. Biotech. 21(8) (2003), 909-913) .
• the present method is applied to plants selected from the group containing Arabidopsis, tobaccco (as model plants) , and important crop plants (ranging from stapel food plants such as rice, maize, wheat, barley, sorghum to vegetables and to fruit trees.
• important crop plants ranging from stapel food plants such as rice, maize, wheat, barley, sorghum to vegetables and to fruit trees.
• Another important group of plants that can be altered in shape according to the present invention are forest trees, and ornamental plants (flowering plants, bonsai shrubs etc) . These plants are specifically preferred due to their physiology and/or importance to food industry.
• preferred brassinosteroid specific glycosyl- transferases are glucosyltransferases, especially glucosyltransferases being specific for Campesterol, Campestanol, Brassinolide, Stigmasterol, teasterone, methyldolichosterone, epibrassinolide and epicastasterone.
• the plant growth may be reduced by the glycosylation, especially the glucosylation of the C 2 -0H, C 3 -OH, C 23 -OH, C 25 -OH, C 26 -OH and/or C 27 -OH of brassinosteroids by brassinosteroid specific glycosyltransferases because these positions (especially C 2 , C 3 and C 2 3) have been shown to be specifically preferred for glucosylation in (24-epi-) brassinosteroids (see Zullo et al. (2002)). Indeed, brassinosteroid specific glycosyltransferases often . show high specificity as different enzymes catalyse different transformations.
• these enzymes can be located (physiologically) in different plant organs. Therefore, not only a single receptor site for a brassinosteroid is present, but there are different receptor sites in different enzymes in which different brassinosteroid molecules are able to exhibit one of the many brassinosteroid physiological acitivit- ies. Each receptor site must need different structural requirements for exhibiting the maximal activity which makes glycosylation, especially glucosylation of brassinosteroids an effective means for regulating brassinosteroid activity inside plant cells.
• the method according to the present invention comprises the introduction of a inducible promoter for the brassinosteroid specific glycosyltransferase, preferably a tissue specific promoter, especially a stem specific promoter into a plant.
• a inducible promoter for the brassinosteroid specific glycosyltransferase preferably a tissue specific promoter, especially a stem specific promoter into a plant.
• the present invention makes use of a completely different concept of influencing plant growth, especially with respect to enabling dwarfism, compared to the prior art.
• the mode of action is not dependent on gibberellin or auxin.
• WO 97/35986 Al discloses that mutation of the gene for a cytochrome P450-type hydroxylase, an enzyme acting in BR biosynthesis pathway, can induce dwarfism, if the activity of this gene product is reduced or eliminated.
• a cytochrome P450 is used for generating reduced stature when expressed at increased levels.
• the enzyme described in this US-Al catalyses the C 26 -hydroxylation of brassinosteroids, more specifically C 26 -hydroxylation of ecdyso- ne, thus preventing predators from undergoing melting after feeding on plants expressing high levels of the cytochrome P450.
• EP 1 209 227 A2 also discloses a nucleic acid molecule encoding a dark-inducible cytochrome P450 hydroxylase that catalyses the brassinosteroid biosynthesis through C-2 hydroxylations in plants. This gene was used for regulating plant growth (dwarfism and elongation) .
• US 2003/0199684 Al discloses a plant gene capable of controlling a signal transduction system for brassinosteroid hormone. This should enable growth promotion, yield increase and quality improvement by selectively manipulating the brassinosteroid signal transduction.
• the present invention directly aims at the brass- inosteroid hormone molecule by inactivating the hormone molecule by in vivo glycosylation (e.g. for enabling dwarfism) or - alternatively - by reducing or eliminating this glycosylation activity.
• the present invention relates to transgenic plants or a transgenic (plant) cell containing recom- binant glucosyltransferase and/or a recombinant expression regulating element, especially a promoter region for a glucosyltransferase.
• These plants or (plant) cells may be used in a method according to the present invention.
• the present invention also relates a genetically modified cell or organism, especially a plant or plant cell comprising a non- naturally occurring (transgenic) glucosyltransferase in its genome with growth properties being different from the wild type, especially characterised that it shows a "dwarf" phenotype due to the presence of such a glucosyltransferase as transgene.
• a genetically modified cell or organism especially a plant or plant cell comprising a non- naturally occurring (transgenic) glucosyltransferase in its genome with growth properties being different from the wild type, especially characterised that it shows a "dwarf" phenotype due to the presence of such a glucosyltransferase as transgene.
• an endogenous glucosyltransferase in a cell may be subjected to a different transgenic expression regulating region or element, such as a promoter leading to an enhanced expression of the endogenous or exogenous glucosyltransferase, i
• a homologous (or heterologous) glucosyltransferase due to transgenic promoters.
• transgenic promoters Although such cells or plants may show a "dwarf" phenotype, if properly adjusted to the cell and switched-off (if the promoter to be used is a switchable promoter) , such plant cells and plants can be produced by applying standard methods to the teachings of the present invention. Such "dwarf" plants are a specifically preferred embodiment of the present invention.
• transformation of plants with other heterologous brassinosteroid specific glycosyltransferases such as fucosyl- transferases or xylosyltransferases or especially rhamnosyl- transferase may be used to construe specific dwarf plants.
• heterologous brassinosteroid specific glycosyltransferases such as fucosyl- transferases or xylosyltransferases or especially rhamnosyl- transferase may be used to construe specific dwarf plants.
• glucosyltransferases is preferred due to the fact that (UDP-) glucose is the physiological group for substituting especially the -OH groups of brassinosteroids.
• the present invention enables a method for producing glucosylated brassinosteroids wherein a brassinosteroid is contacted with a glucosyltransferase in the presence of an activated glucose (e.g. UDP-glucose) .
• an activated glucose e.g. UDP-glucose
• the above mentioned enzyme specificities can be properly used for producing specifically glucosylated brassinosteroid derivatives. If a brassinosteroid is glucosylated in a non-enzymatic (chemical) way, a crude mixture of glucosylation products is obtained (each free hydroxygroup is in principle a preferred acceptor side for glucosyl residues) .
• Acetylation as protection means for such group has also its drawbacks with respect to specificity (also all hydroxygroups are acetylated) .
• the present invention provides a method for producing well-defined glucosylated derivatives of brassinosteroids. If more than one hydroxygroup is glucosylated or if more than one position is capable of being glucosylated by a given glucosyltransferase, such a limited number of products, e.g. 2 to 5, may easily be separated by suitable separation means, such as HPLC.
• brassinosteroids as depicted in Figs. 1 and 2
• other brassinosteroids e.g. brassinosteroid derivatives and analogues, preferably those depicted in Figs. 5, 6, 21-26 and 129 in Zullo et al. (2002) or the metabolised forms of Figs. 12- 20 in Zullo et al. (2002) .
• uridine diphosphate glucose (UDP-glucose, e.g. glucose which is produced by enzymes, such as pyrophosphorylases) is a preferred activated biological form of glucose
• UDP-glucose e.g. glucose which is produced by enzymes, such as pyrophosphorylases
• activated glucose (cosubstrate)
• any form glucose which can be utilised by a glucosyltransferase (e.g. ADP-glucose, CDP-glucose, or any other form of biologically and synthetically activated glucose being suitable substrates for transfer to brassinosteroids by glucosyltransferases) can be used according to the present invention.
• a glucosyltranferase according to the present invention is defined as a (naturally) occuring or synthetically (recombin- antly) designed or produced enzyme which is capable (as its main or as a side activity) of transferring a glucose moiety to a substrate molecule using an activated glucose as co-substrate thereby producing a glucosylated substrate molecule.
• the mode of action of the present invention is not dependent of gibberellin, the inactivation or enhanced activation of a brassinosteroid molecule by means of brassinosteroid specific glycosyltransferases .
• Fig. 1 and 2 show formulae of natural brassinosteroids.
• Fig. 3 shows biosynthesis of brassinolide via the late C-6 oxidation pathway and via the early C-6 oxidation pathway; this figure shows a simplified scheme of the BR biosynthesis pathway including steps of early and late C-6 oxidation that lead to the synthesis of BL (Noguchi et al . , 2000, Plant Physiol. 124:201- 209; Shimada et al., 2001, Plant Physiol. 126: 770-779).
• DOGTl Arabidopsis thaliana UGT73C5
• the regions implicated (Vegt et al., Plant J. 19 (1999), 507-519) in acceptor substrate binding (dotted) and the UGT consensus sequence motif (dashed) are indicated by boxes below the sequences.
• the triangle above the sequence in the hypothetical acceptor binding region marks the lysine 136 in DOGTl which has been altered by in vitro mutagenesis.
• the genbank ac- cession numbers of the predicted proteins are: ADGT-9, glucosyl- transferase-9 of Vigna angularis (AB070752); DOGTl, Phenylpro- panoid: glucosyltransferase 1 of Nicotiana tabacum (AF346431) ; IS5a of Nicotiana tabacum (U32644); putative glucosyltransferase of Oryza sativa (AP002523) ; Twil of Lycopersicon esculentum (X85138); Betanidin-5-O-glucosyltransferase of Dorothenathus bellidiformis (Y18871) .
• Fig. 5 shows homozygous A. thaliana constitutively expressing high amounts of D0GT1T exhibit a brassinosteroid-deficient phenotype apparent in a dwarf stature, dark green, small, round, wrinkly leaves with short petioles, very short siliques, reduced fertility, reduced apical dominance with an increased number of influorescenses, which leads to a bushy appearance and delayed senescence (A) . 5 week old light grown plants, left wild-type Col-0, right 1319/2, a line with high DOGTl expression (B) . Phenotype of Col-0 and 1319/2 leaves, flowers and siliques after 5 weeks of growth.
• Fig. 6 shows the BR-deficient phenotype can be restored to wild- type by externally applied BL.
• 10 day old seedlings were transferred to MS media resp.
• Externally applied BL restores wild-type growth in DOGTl lines.
• yeast strains The yeast strains used in this work are derived from YPH499 (Mat a, ade2-101oc, his3- ⁇ 200, Ieu2- ⁇ 1, lys2-801a, trpl- ⁇ 1, ura3-52) (Sikorski et al., Genetics 122 (1989), 19- 27).
• the relevant genotype of YZGA452 is pdr5 ⁇ ::TRPl, pdrlO ⁇ : :hisG, snq2 ⁇ ::hisG, yorl ⁇ : :hisG.
• YZGA515 (pdr5 ⁇ : : RP1, pdrlO ⁇ : :hisG, pdrl5 ⁇ : : loxP-KanMX-loxP, aytl ⁇ ::URA3) was constructed by disruption of the acetyltransferase AYT1 in strain YHW10515.
• A. thaliana experiments were conducted with the wild-type ecotype Columbia-0 (Col-0) .
• For propagation seeds were sterilized, plated on standard MS growth medium (Murashige et al . , Plant Physiology 15 (1962), 473-497) supplemented with 1.0 % sucrose and 1.0% phytagar (Life Technologies) and subjected to a 2 day dark treatment at 4°C to synchronize germination.
• the seedlings were grown for 2 weeks in a controlled environment of 16h/8h light-dark cycle (140 ⁇ mol m "2 sec "1 white light) at 22 °C before they were transferred to soil and grown at 20 °C and 55% humidity under continuous white light.
• Arabidopsis thaliana cDNA library screen in yeast The ATP-bind- ing cassette (ABC) transporter deficient Saccharomyces cerevisi- ae strain YZGA452, which is hypersensitive to DON, was transformed with an A. thaliana cDNA library constitutively expressed under the control of the phoshoglucerate kinase (PGK1) promoter (Minet et al., Plant J. 2 (1992), 417-422). A total of 10 7 transformants were selected on minimal medium lacking uracil and transferred to media containing 180 ppm DON, sufficient to completely inhibit growth of yeast transformed with the empty library plasmid.
• ABSC ATP-bind- ing cassette
• Colonies that showed resistance were isolated and from candidates that formed single colonies on toxin containing media, the plasmid dependency of the phenotype was tested by plasmid DNA preparation and retransformation of YZGA452.
• the Notl fragment containing the cDNA insert of the candidate (which was named DON glucosyltransferase 1, DOGTl) was subcloned into pBluescript SKII+ (Stratagene) and sequenced. Constitutive expression and immunodetection of the DON-glucosyl- transferase (DOGTl) and close homologues in yeast.
• DOGTl The intron- less open reading frames (ORFs) of DOGTl (UGT73C5, locus At2g36800) and 5 of its closest homologues (UGT73C1, At2g36750; UGT73C2, At2g36760; UGT73C3, At2g36780; UGT73C4, At2g36770; UGT73C6, At2g36790) were PCR amplified (Triple Master PCR System, Eppendorf) from genomic DNA using gene specific primers containing flanking Hindlll and Notl restriction sites at the 5' and 3' ends, respectively (DOGTl, fw: 5'-ACTA ⁇ GCTTGGA ⁇ TCATGGTTTCCGAAACA-3' , rv: 5'-AAGCGGCCGCATACTCAATTATTGG-3' ; 73C1, fw: 5' -CTAAGCTTGGAAT- CATGGCATCGGAATTTCG-3' , rv: 5' -TAGCGGCCGCATTCATTTCTTG
• 73C6 5'-CTAAGCTTGGAACATGTGTTCTCATGATCCT-3' , rv: 5' -TAGCGGCCGC- ATTCAATTATTGGACTGTGC-3' ) .
• the PCR products were cloned into the Hindlll + Notl cloning sites of the yeast expression vector pYAK7 (PADHl-c-Myc-PDR5 LEU2 2 ⁇ ) , replacing the PDR5 gene.
• the vector pYAK7 was constructed by first inserting the double stranded linker 5 ' -GGATGCCCGAACAAAAGTTAATTTCAGAAGAGGACTTAT- CAAAGCTTGAGGCCTCGCGA into the Smal site of vector pAD4 ⁇ (Ballester et al., Cell 59 (1989), 681-686), thereby generating the N-terminal c-Myc epitope and a Hindlll site, into which a genomic Hindlll fragment containing the yeast PDR5 was inserted in frame.
• the tagged UGT constructs were verified by sequencing and used to transform the yeast strain YZGA515.
• the empty vector Hindlll + Notl digested and religated pYAK7 was used as a control. Transformants were selected on minimal media lacking leucine.
• the resulting plasmids were digested with Hindlll and a conserved EcoRl site present in both genes that cleaves DOGTl at nucleotide position 565 (73C6 at 568) .
• Hybrids were constructed by ligation of the N-terminal part of one gene to the C-terminal part of the other.
• the resulting genes were moved back into the yeast expression vector pYAK7 using the Hindlll and Notl restriction sites.
• Yeast strain YZGA515 was used as a host to test the constructs for altered detoxification abilities.
• Mutations were constructed by overlap extension PCR (Pagulis et al., Meth.Mol. Biol . 57 (1996), 167- 176) using overlapping mutant primers DOGTl-K136E-fw (5'-TACAAGCGAAATCGCCAAGAAGTTCA-3' ) and DOGTl-K136E-rv (5'-CTTCT- TGGCGATTTCGCTTGTATAAG-3' ) and flanking primers DOGTlIpYAK7-fw-a (5'-ACTAAGCTTGGAATCATGGTTTCCGAAACA-3' ) and DOGTl-EcoRI-rv (5'-TCTTGTGAATTCAACTCTATC AGGA-3' ) for mutagenesis of DOGTl, and mutant primers 73C6-E137K-fw (5' -TACAAGCAAAATCGCC AAGAAGTTCAA- 3') and 73C6-E137K-rv (5' -ACTTCTTGGCGATT
• the resulting PCR products were cloned as Hindlll+EcoRI fragments into the corresponding genes present in vector pBluescript SKII+.
• the ORFs were moved as Hindlll + Notl fragments back into the yeast expression vector pYAK7 (replacing the PDR5 gene) and the resulting plasmids were transformed into strain YZGA515 to analyze the detoxification properties of the engineered UGTs.
• DOGTl Heterologous expression of DOGTl in Escherichia coli .
• the DOGTl protein was expressed in Escherichia coli XLl-blue as a GST fusion.
• the DOGTl gene was released from the yeast expression vector by Hindlll digestion and Klenow fill in, followed by a Notl digest. The resulting fragment was cloned into the Smal + Notl sites of the GST gene fusion vector pGEX-4T-3 (Amersham Pharmacia) .
• Recombinant fusion protein was purified using glutathione- coupled Sepharose (Amersham Pharmacia) according to the manufacturer's instructions.
• the gene encoding the fusion protein was PCR amplified using DNA polymerase with proof reading activity (Pfu polymerase, MBI) and the fusion protein specific primers GSTD0GTlpYAK7-fw (5'-TCAC- CCGGGAAACAGTAATCATGTCC-3' ) and GSTDOGTlpYAK7-rv (5' -CGAGGCAG- ATCGTCAGTCAGTC-3' ) .
• the PCR product was cloned Hindlll+Notl into the yeast expression vector pYAK7.
• the glucosyltransferase activity assay mix contained 1 ⁇ g of recombinant GST-fusion protein, 10 mM 2-mercapto- ethanol, 50 mM Tris/HCl pH 7.0, 0.5 mM radioactive labeled UDP- [ 14 C] glucose (4.4*10 3 cpm, NEN Life Science Products, USA), 0.01% BSA and 1 mM of acceptor substrate (dissolved in DMSO in 20 mM stock solutions) .
• the reactions were carried out in volumes of 20 ⁇ l at 30°C for 1 h, stopped by adding 2 ⁇ l trichloroacetic acid (240 mg/ml) , frozen and stored at -20°C. Analysis of reaction products was performed by TLC.
• RT-PCR analysis of mRNA expression of DOGTl following treatments with DON, salicylic acid (SA) , jasmonic acid (JA) and 1-aminocyclopropyl- carbonic acid (ACC) seedlings were grown for 2 weeks on vertical MS plates (0.8% phytagar) before they were transferred to liquid MS media.
• the plants were incubated for 48 h on an orbital shaker (50 rpm) before adding 5 ppm DON, 200 ⁇ M SA, 2 ⁇ M ACC or 50 ⁇ M JA.
• the compounds were kept in stock solutions dissolved either in 70% ethanol or in DMSO. Treatments with ethanol and DMSO were performed as controls. Plants were harvested at different time points, ground in liquid nitrogen and stored at -70° C until RNA extraction was performed.
• PCR was performed with approximately 2 ⁇ l of the 1:20 diluted cDNA using primers that amplify 200 to 400 bp large fragments located in the C-terminal part of the genes to be analyzed (DOGTlRT-fw: 5'-ATCCGGGGTTGAACAGCCT-3' , DOGTIRT-rv: 5' -TCAATTATTGGGTTCTGCC- 3'; 73C4RT-fw: 5' -GGAGAAAATAGGAGTGTTA-3' , 73C4RT-rv: 5'-TCAGTTCTTGGATTTCACT-3' ; 73C6RT-fw: 5' - GAGAAACTGGTCGTACAA-3' , 73C6RT-rv: 5' -TCAATTATTGGACTGTGCT-3' ; UBQ5-U: 5' -GTCCTTCTTTCTG- GTAAACGT-3' , UBQ5-D: 5'-AACC CTTGAGGTTGAATCATC
• the vector pBP1319 was constructed for constitutive overexpression of c-Myc-tagged DOGTl protein in Arabidopsis. It is derived from a modified version of the plant expression vector pPZP221 (Hojdukiewicz et al., Plant Mol.Biol.25 (1994), 989- 994).
• the promoter cassette consisting of two copies of the 35S- promoter and the polyadenylation signal of CaMV strain Cabb B-D was used from the vector p2RT, a modified version of pRTlOO (T ⁇ pfer et al., NAR 14 (1987), 5890).
• the c-Myc-tagged DOGTl-fragment was released by Smal + Notl digestion (Klenow filled) from the yeast expression vector and cloned into pBluescript SKII+, which was cut with Clal+Smal and treated with Klenow enzyme.
• the gene was excised from the resulting plasmid as Sail 4- BamHl fragment and inserted in the Xhol + BamHl sites of p2RT.
• the obtained 2x35S c-Myc-DOGTl cassette was isolated by Pstl digestion and cloned into the unique Pstl site of pPZP221 after the multiple cloning site in that vector had been destroyed by digesting the plasmid with EcoRI+Sall, filling the sites with Klenow and religating it.
• the 2x35S c-Myc-DOGTl cassette is orientated in the opposite direction than the 2x35S gentamycin resistance marker.
• the GUS vector pPZP-GUS.l which originates from pPZP200 and contains the GUS gene from pBIlOl.l (inserted Hindlll + EcoRl into the MCS) , was used (Diener et al., Plant Cell 12 (2000), 853-870).
• the DOGTl promoter region was PCR amplified from genomic DNA using DNA polymerase with proof reading activity (Pfu Polymerase, MBI) and specific primers (DOGTlP-GUS-fw: 5' -GTTAAAAGCTTACATGTGCAT- TACGGTCTGTGTGAATA, DOGTlP-GUS-rv: 5' -TTTCGGATCCCATG ATTCAACCT- TAGTAAGAAACTCTC) .
• the resulting product was cloned in frame with the GUS gene Hindlll + Ba Hl into the pPZP-GUS.l vector. Constructs were confirmed by DNA sequencing.
• transgenic A. thaliana For all plant transformations, the recA deficient Agrobacterium tumefaciens strain UIA143 (Farraud et al. , J.Bact.171 (1989), 5314-5321) which harbors the helper plasmid pMP90 (Koncz et al., Mol. Gen. - Genet.204 (1986), 383-396) was used. A. thaliana was transformed applying the floral dip technique (Clough et al . , Plant J. 16 (1998), 735-743). The progeny of 15 independent transformants was selected through three generations to obtain homozygous lines .
• DON-glucosyltransferase DOGTl
• An unbiased functional screen based on heterologous expression of cDNAs in yeast was set up with the goal to identify plant genes that contribute to resistance against mycotoxins .
• Wild-type Saccharomyces cerevisiae is highly resistant to deoxynivalenol (DON) .
• DON deoxynivalenol
• a strain deficient in four ABC transporters was generated, which are to a large extent responsible for pleiotropic drug resistance in yeast (Wolfger et al . , Res.Microbiol.152 (2001), 375-389).
• Strain YZGA452 (snq2 ⁇ : :hisG pdr5 ⁇ ::TRPl pdrlO ⁇ : :hisG yorl ⁇ : :hisG) is hypersensitive to a wide range of different xenobiotic substances and natural products, including DON.
• YZGA452 was transformed with a cDNA expression library of A. thaliana (Minet et al. (1992)), where cD- NAs are constitutively expressed under the control of the yeast phosphoglucerate kinase promoter. Ten million transformants were generated and diluted pools of transformants were plated on DON containing medium. After selection of DON resistant yeast colonies and confirmation of plasmid dependency of the phenotype, the insert was subcloned and sequenced.
• DOGTl is a member of the UDP-glucosyltransferase family of A. thaliana and exhibits high similarity to salicylic acid and wound inducible genes of other species.
• the cDNA conferring resistance had a size of 1.75 kb and contained an open reading frame of 1488 bp length encoding a putative uridine diphosphate (UDP) -glucosyltransferase.
• the identified DON-glucosyltransferase (DOGTl) corresponds to gene UGT73C5 and belongs to subfamily 73C, part of group D of UDP-glucosyltransferases (UGTs) of A. thaliana (33) .
• Arabidopsis UGTs constitute a very large gene family, that has been divided into 14 distinct groups, believed to have originated from common ancestors (Ross et al., Genome Biol. 2 (2001), 3004.1-3004.6). DOGTl is located in a cluster together with five other members of subfamily 73C on chromosome II (BAC clone F13K3, At2g36800) . All six tandemly repeated genes contain no introns, and are highly similar to each other (77 - 89% identity at the amino acid level) . The similarity is also very high in the intergenic promoter regions.
• DOGTl amino acid sequence revealed high similarity to glucosyltransferases from tobacco (TOGTl, Fraissinet-Tachet et al., FEBS 437 (1998), 319-323; Is5a and IslOa, Horwath et al . , Plant Mol. Biol.
• Regions of high similarity were observed in both amino- and carboxy-terminal domains of the deduced amino acid sequences. Indicated in Figure 4 are the hypothetical acceptor substrate binding region (Vogt et al. (1999)) and the UGT consensus sequence (Li et al., JBC 276 (2001) , 4338-4343) .
• DOGTl The expression of DOGTl is developmentally regulated and induced by DON and other stress response related compounds .
• the ORF of the ⁇ -glucuronidase reporter gene was placed behind the DOGTl promoter (P DOGTI -GUS) .
• the tissue specific expression of the transcriptional GUS fusion was examined histochemic- ally in transgenic Arabidopsis homozygous for the fusion gene. The results demonstrated that DOGTl expression is regulated de- velopmentally and is overall rather low.
• GUS activity was observed to be root and hypocotyl specific, with the strongest expression in the vascular system, in meristematic tissue of the root tips (in the primary root as well as in lateral roots) and in the vasculature of the hypocotyl right after germination. Staining in the vasculature decreased significantly later in development and a patchy staining pattern appeared in epidermal root cells. In adult plants GUS activity was detected in late stages of flower development in petals and in abscission zones.
• Arab ⁇ dopsxs plants constitutively overexpressing UGT73C5 display a brassinosteroid deficient phenotype and are resistant to externally applied brassinolide
• DOGTl-overexpression lines show a typical brassinosteroid-defi- cient phenotype (Clouse, 2002 Brassinosteroids. In: The Arabidopsis book. American Society of Plant Biologists) that correlates in severeness with the amount of recombinant protein present in the plant.
• the light grown phenotype exhibited by high-expression lines in soil includes a dwarf stature, darker than wild-type, small, round, wrinkly leaves with short petioles, very short siliques, reduced fertility, reduced apical dominance with an increased number of influorescenses, which leads to a bushy appearance and delayed senescence ( Figure 4) .
• the phenotype is already apparent in seedlings grown on agar ( Figure 5, upper row, right) , which have short hypocotyls and smaller leaves with shorter petioles compared to wild-type.
• DOGTl does not lead to a de-etiolated phenotype when seeds are germinated in the dark, which is a characteristic feature of some BR deficient or BR insensitive mutants like det2 (Chory et al . , 1991, Plant Cell. 3: 445-459), bin2 (Li et al . , 2001a, Plant Physiol. 127:14-22) or jril (Clouse et al . , 1996, Plant Physiol . Ill: 671-678).
• det2 Cho et al . , 1991, Plant Cell. 3: 445-459
• bin2 Li et al . , 2001a, Plant Physiol. 127:14-22
• jril Clouse et al . , 1996, Plant Physiol . Ill: 671-678.
• the hypocotyls are elongated and neither does the apical hock nor do the cotyledons
• brassinolide the BR with the highest biological activity restores normal growth in dwarf mutants with defects in BR biosynthesis (Altmann, 1999, Planta.208: 1-11); Clouse and Feldmann, 1999 (Molecular genetics of brassinosteroid action. 163-190. In: Sakurai, A., Yokota, T., Clouse, S.D. (ed. ) Brassinosteroids: Steroidal Plant Hormones. Springer, Tokyo, Japan). The effect of externally applied epi-brassinolide (epi-BL) was determined by transferring 10 day old seedlings of wild-type and a high DOGTl-expression line (1319/2) to media containing different concentrations of the brassinosteroid.
• DOGTl is located in a cluster with 5 other members of family 73C on chromosome II (At2g36800) indicative for gene duplication by unequal recombination events.
• At2g36800 chromosome II
• DOGTl and other members in the cluster have very similar protein sequences suggesting redundancy in enzymatic function.
• yeast expressing the gene with the highest sequence similarity UGT73C6 was as sensitive as wild-type to all toxins tested (as well as UGT73C3) , while the second closest homologue UGT73C4 exhibited the same properties as DOGTl.
• Plant UDP-glucosyltransferases are structurally very similar in their carboxy-terminal signature motif to mammalian UGTs which use UDP-glucuronic acid instead of UDP-glucose as donor substrate.
• the mammalian enzymes play a central role in metabolism and detoxification of chemicals like carcinogens or hydrophobic drugs.
• Higher plant UGTs have been found to be involved in a parallel range of activities also modifying xenobiotic substances such as herbicides and other pesticides.
• One open question is whether these detoxification reactions are side- activities of UGTs conjugating endogenous plant compounds.
• Recent publications are in favor of the hypothesis that UGTs responsible for the conversion of endogenous substrates may also account for the capacity of plants to detoxify xenobiotic substances.

Landscapes

• Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Priority Applications (1)

Applications Claiming Priority (3)

Publications (1)

Family

ID=36997282

Family Applications (1)

Country Status (1)

• 2005
  • 2005-02-14 EP EP05707369A patent/EP1713920A1/de not_active Withdrawn

Non-Patent Citations (1)

Similar Documents

Legal Events