EP1709166A1 - Process for the preparation of l-amino acids with amplification of the zwf gene - Google Patents

Process for the preparation of l-amino acids with amplification of the zwf gene

Info

Publication number
EP1709166A1
EP1709166A1 EP04706155A EP04706155A EP1709166A1 EP 1709166 A1 EP1709166 A1 EP 1709166A1 EP 04706155 A EP04706155 A EP 04706155A EP 04706155 A EP04706155 A EP 04706155A EP 1709166 A1 EP1709166 A1 EP 1709166A1
Authority
EP
European Patent Office
Prior art keywords
seq
amino acid
protein
isolated
bacterium
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04706155A
Other languages
German (de)
French (fr)
Inventor
Stephan Hans
Brigitte Bathe
Alexander Reth
Georg Thierbach
Caroline Kreutzer
Bettina HÄDRICH
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Evonik Operations GmbH
Original Assignee
Degussa GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Degussa GmbH filed Critical Degussa GmbH
Publication of EP1709166A1 publication Critical patent/EP1709166A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/345Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Brevibacterium (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/06Alanine; Leucine; Isoleucine; Serine; Homoserine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/08Lysine; Diaminopimelic acid; Threonine; Valine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/22Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C12P13/227Tryptophan
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01049Glucose-6-phosphate dehydrogenase (1.1.1.49)

Definitions

  • T e invention relates to a process for the preparation of L-amino acids, in particular L-lysine, L-threonine and L- tryptophane, using coryneform bacteria in which at least • the insects transferment protein encoded by the zwf gene is amplified.
  • L-amino acids are used in animal nutrition, in human medicine and in the pharmaceuticals industry.
  • amino acids are prepared by fermentation of strains of coryneform bacteria, in particular Corynebacterium glutamicum. Because of its great importance, work is constantly being undertaken to improve the preparation process . Improvements to the process can relate to fermentation measures, such as e.g. stirring and supply of oxygen, or the composition of the nutrient media, such as e.g. the sugar concentration during the fermentation, or the working up to the product form by e.g. ion exchange chromatography, or the intrinsic output properties of the microorganism itself.
  • fermentation measures such as e.g. stirring and supply of oxygen, or the composition of the nutrient media, such as e.g. the sugar concentration during the fermentation, or the working up to the product form by e.g. ion exchange chromatography, or the intrinsic output properties of the microorganism itself.
  • Methods of mutagenesis, selection and mutant selection are used to improve the output properties of these microorganisms.
  • Strains which are resistant to entimetabolites such as e.g. the threonine analogue - amino- ⁇ -hydroxyvaleric acid (AHV) , the lysine analogue S- (2-aminoethyl) -L-cystein (AEC) , or are auxotrophic for metabolites of regulatory importance and produce L-amino acids such as e.g. threonine or lysine are obtained in this manner .
  • Methods of the recombinant DNA technique have also been employed for some years for improving the strain of Corynebacterium glutamicum strains which produce L-amino acids .
  • the object of the present invention is providing new improved processes for the fermentative preparation of L- a ino acids with coryneform bacteria.
  • L-Amino acids are used in human medicine and in the pharmaceuticals industry, in the foodstuffs industry and especially in animal nutrition. There is therefore a general interest in providing new improved processes for the preparation of amino acids .
  • the invention provides a process for the preparation of L- amino acids, in particular L-lysine, L-threonine, L- isoleucine and L-tryptophane, using coryneform bacteria in which the insectsferment protein (Zwf protein) encoded by the nucleotide sequence of the zwf gene is amplified, in particular over-expressed.
  • zwf is a mnemonic for "Zwischenferment” (Jeffrey H. Miller: A Short Course In Bacterial Genetics, Cold Spring Harbor Laboratory Press, USA, 1992.) and also referred to as glucose 6-phosphate dehydrogenase.
  • glucose 6-phosphate dehydrogenase catalyzes the oxidation of glucose-6-phosphate to 6-phosphogluconolactone by concomitant reduction of NADP to NADPH. Its activity is inhibited by NADPH and various other metabolites (Sugi oto and Shiio, Agricultural and Biological Chemistry 51(1), pp. 101 - 108 (1987) ) .
  • NADPH various other metabolites
  • strains employed preferably already produce L-amino acids before amplification of the zwf gene.
  • amplification in this connection describes the increase in the intracellular activity of one or more enzymes or proteins in a microorganism which are coded by the corresponding DNA, for example by increasing the number of copies of the gene or genes, using a potent promoter or using a gene or allele which codes for a corresponding enzyme or protein having a high activity, and optionally combining these measures .
  • the activity or concentration of the corresponding enzyme or protein is in general increased by at least 10%, 25%, 50%, .75%, 100%, 150%, 200%, 300%, 400% or 500%, up to a maximum of 1000% or 2000%, based on that of the wild-type • enzyme or protein or the activity or concentration of the enzyme or protein in the starting microorganism.
  • the microorganisms which the present invention provides can prepare L-amino acids from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol . They are representatives of coryneform bacteria, in particular of the genus Corynebacterium. Of the genus Corynebacterium, there may be mentioned in particular the species Corynebacterium glutamicum, which is known among specialists for its ability to produce L-amino acids .
  • Suitable strains of the genus Corynebacterium, in particular of the species Corynebacterium glutamicum are, for example, the known wild-type strains Corynebacterium glutamicum ATCC13032 Corynebacterium acetoglutamicum ATCC15806 Corynebacterium acetoacidophilum ATCC13870 Corynebacterium thermoaminogenes FERM BP-1539 Brevibacterium flavu ATCC14067 Brevibacterium lactofermentum ATCC13869 Brevibacterium divaricatum ATCC14020,
  • L-amino acid-producing mutants prepared therefrom such as, for example, the L-threonine-producing strains Corynebacterium glutamicum ATCC21649 Brevibacterium flavum BB69 Brevibacterium flavum DSM5399 Brevibacterium lactofermentum FERM-BP 269 Brevibacterium lactofermentum TBB-10,
  • coryneform bacteria produce L-amino acids, in particular L-lysine, L-threonine and L- tryptophane, in an improved manner after over-expression of the zwf gene which codes for the Zwf protein or Zwf polypeptide, respectively.
  • JP-A-09224661 discloses the nucleotide sequence of the zwf ' gene of Brevibacterium flavum MJ-223 (FERM BP-1497) and refers to the protein encoded by the zwf-gene as glucose 6- phosphate dehydrogenase.
  • the sequence information disclosed in JP-A-09224661 is shown in SEQ ID NO 7 and 8.
  • JP-A- 09224661 describes the N-terminal amino acid sequence of the Zwf polypeptide as Met Val lie Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu (SEQ ID NO 8) .
  • N-terminal amino acid sequence Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu-Arg Asp (SEQ ID NO 10) .
  • the nucleotide sequence of the corresponding zwf gene including the coding sequence is shown in SEQ ID NO 9.
  • the methionine residue in the N- position can be split off in the context of post- translational modification, and Ser Thr Asn. Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp is then obtained as the N- terminal amino acid sequence.
  • this invention provides the nucleotide sequence of a novel zwf gene from a coryneform bacterium shown in SEQ ID NO 9 nucleotides 538 to 2079.
  • Genes encoding Zwf proteins from Gram-negative bacteria e.g. Escherichia coli or other Gram-positive bacteria e.g. Streptomyces or Bacillus may optionally be used. Alleles of the zwf gene which result from the degeneracy of the genetic code or due to sense mutations of neutral function can furthermore be used.
  • Endogenous genes in particular endogenous genes from coryneform bacteria, is preferred.
  • Endogenous genes or “endogenous nucleotide sequences” refer to genes or nucleotide sequences which are available in the population of a species .
  • the number of copies of the corresponding genes is increased, or the promoter and regulation region or the ribosome binding site upstream of the structural gene is mutated.
  • Expression cassettes which are incorporated upstream of the structural gene act in the same way.
  • inducible promoters it is additionally possible to increase the expression in the course of fermentative L-amino acid formation.
  • the expression is likewise improved by measures to prolong the life of the -RNA.
  • the enzyme activity is also increased by preventing the degradation of the enzyme protein.
  • the genes or gene constructs are either present here in plasmids with a varying number of copies, or are integrated and amplified in the chromosome.
  • an over-expression of the genes in question • can furthermore be achieved by changing the composition of the media and the culture procedure.
  • Patent Specification EPS 0 472 869 in US Patent 4,601,893, in Schwarzer and Puehler (Bio/Technology 9, 84-87 (1991), in Reinscheid et al. (Applied and Environmental Microbiology 60, 126-132 (1994)), in LaBarre et al . (Journal of Bacteriology 175, 1001-1007 (1993)), in Patent Application WO 96/15246, in Malumbres et al . (Gene 134, 15- 24 (1993)), in Japanese Laid-Open Specification JP-A-10- 229891, in Jensen and Hammer (Biotechnology and Bioengineering 58, 191-195 (1998)) and in known textbooks of genetics and molecular biology.
  • the Zwf protein was over-expressed with the aid of a plasmid.
  • the E. coli - C. glutamicum shuttle vector pEC-Tl8mob2 shown in Figure 1 was used for this.
  • the plasmid pEC-Tl8mob2zwf shown in Figure 2 was formed.
  • plasmid vectors which are capable of replication in C. glutamicum, such as e.g. pEKExl (Eikmanns et al . , Gene 102:93-98 (1991)) or pZ8-l (EP-B- 0 375 889), can be used in the same way.
  • amino acid exchanges in the section between position 369 and 373 and/or position 241 and 246 of the amino acid sequence of the zwf gene product, shown in SEQ ID NO: 10 amplify its glucose 6-phosphate dehydrogenase activity, in particular its resistance against inhibition by NADPH (nicotinamide adenine dinucleotide phosphate, reduced form) ' and improve the production of amino acids, especially lysine, by coryneform bacteria comprising the corresponding zwf genes or zwf alleles respectively or the Zwf proteins encoded by them.
  • the methionine residue in the N-terminal position can be removed during post translational modification by a methionine aminopeptidase of the host.
  • the invention provides Zwf proteins comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is (are) exchanged by another proteinogenic amino acid. Accordingly, the invention further provides isolated polynucleotides encoding a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is (are) exchanged by another proteinogenic amino acid.
  • the exchanges within the amino acid sequence of the Zwf protein comprise at least one or . more of the amino acid exchanges selected from the group consisting of exchange of L-arginine at position 370 of SEQ ID NO: 10 against any other proteinogenic amino acid, e.g. L- methionine, exchange of L-valine at position 372 of SEQ ID NO: 10 against any other proteinogenic amino acid e.g. L- alanine, exchange of L-methionine at position 242 of SEQ ID NO: 10 against any other proteinogenic amino acid e.g. L- ' leucine or L-serine, exchange of L-alanine at position 243 of SEQ ID NO: 10 against any other proteinogenic amino acid e.g.
  • L-alanine in position 243 is exchanged for L-threonine as shown in SEQ ID NO: 22.
  • This protein is also referred to as Zwf(A243T) protein and the allele encoding said protein is referred to as zwf(A243T). See also SEQ ID NO:21.
  • L-arginine in position 370 can be exchanged for L-methionine as shown in SEQ ID NO: 29.
  • This protein is also referred to as Zwf (R370M) protein and the allele encoding said protein is referred to as zwf(R370M). See also SEQ ID NO:28.
  • L-valine in position 372 can be exchanged for L-alanine as shown in SEQ ID NO: 31.
  • This protein is also referred to as Zwf (V372A) protein and the allele encoding said protein is referred to as zwf(V372A). See also SEQ ID NO:30.
  • L-methionine in position 242 can be exchanged for L-leucine as shown in SEQ ID NO: 33.
  • This protein is also referred to as Zwf(M242L) protein and the allele encoding said protein is referred to' as zwf(M242L). See also SEQ ID NO: 32.
  • L-methionine in position 242 can be exchanged for L-serine as shown in SEQ ID NO: 35.
  • This protein is also referred to as Zwf (M242S) protein and the allele encoding said protein is referred to as zwf(M242S). See also SEQ ID NO: 34.
  • L-aspartic acid in position 245 can be exchanged for L-serine as shown in SEQ ID NO: 37.
  • This protein is also referred to as Zwf(D245S) protein and the allele encoding said protein is referred to as zwf(D245S). See also SEQ ID NO:36.
  • the Zwf proteins according to the invention may contain further substitutions, deletions or insertions of one or more amino acids which do not substantially change the enzymatic properties of the Zwf protein variants described.
  • substitutions of amino acids with neutral or almost neutral effect on protein function are known in the art as • conservative amino acid exchanges.
  • aromatic amino acids phenylalanine, tryptophane and tyrosine may be exchanged against each other.
  • isoleucine and valine may be exchanged against each other.
  • glutamine and asparagine may be exchanged against each other.
  • basic amino acids arginine, lysine and histidine may be exchanged against each other.
  • acidic amino acids aspartic acid and glutamic acid may be exchanged against each other.
  • hydroxyl group containing amino acids serine and threonine may be exchanged against each other.
  • a change of enzymatic activity in the presence of the inhibitor NADPH of less than approximately 2.5 to 3.5% or 2.5 to 4.5% can be regarded as not substantially different.
  • other parameters like e.g. the Michaelis constant (K M ) or maximal rate (V max ) or other binding constants differences like less than approximately 5, 10, 25, 50, 100, 150 or 200% or even larger differences like 300 or 400% might be regarded as not substantially different.
  • the Zwf (A243T) protein comprises at least an amino acid sequence selected from the group consisting of Thr Met Thr Glu Asp lie corresponding to the amino acids at positions 241 to 246 of SEQ ID NO: 22, preferably the amino acid sequence corresponding to the amino acids at positions 235 to 250 of SEQ ID NO: 22, more prefereably the amino acid sequence corresponding to the amino acids at positions 225 to 260 of SEQ ID NO: 22 and even preferably the amino acid sequence corresponding to the amino acids at positions 210 to 270 of SEQ ID NO:22.
  • the Zwf protein variants Zwf(M242L), Zwf(M242S) and Zwf (D245) comprise at least an amino acid sequence selected from the group consisting of the amino acid sequence of the amino acids at positions 237 to 250 of SEQ ID Nos. 33, 35 and 37, preferably the amino acid sequence of the amino acids at positions 227 to 260 of SEQ ID Nos. 33, 35 and 37, more preferably the amino acid sequence of the amino acids at positions 217 to 270 of SEQ ID Nos. 33, 35 and 37, and even more preferably the amino acid sequence of the amino acids at positions 202 to 285 of SEQ ID Nos. 33, 35 and 37.
  • the Zwf protein variants Zwf (R370M) and Zwf (V372A) comprise at least an amino acid sequence selected from the group consisting of the ami o acid sequence of the amino acids at positions 365 to 377 of SEQ I ' D Nos. 29 and 31, the amino acid sequence of the amino acids at positions 355 to 387 of SEQ ID Nos. 29 and 31, the, amino acid sequence of the amino acids at positions 345 to 397 of SEQ ID Nos . 29 and 31, and the amino acid sequence of the amino acids at positions 325 to 417 of SEQ ID Nos. 29 and 31.
  • the Zwf protein variants may comprise a N- terminal amino acid sequence selected from the group consisting of the amino acid sequence corresponding to the ' amino.acids at positions 1 to 10 of SEQ ID NO:10, the amino acid sequence corresponding to the amino acids at positions 1 to 16 of SEQ ID NO: 10, the amino acid sequence corresponding to the amino acids at positions 1 to 20 of SEQ ID NO: 10 and the amino acid sequence corresponding to the amino acids at positions 1 to 30 of SEQ ID NO: 10.
  • deletion and expression analysis Furthermore it has been found by deletion and expression analysis that deletion of a nucleotide sequence corresponding to the 30 N terminal amino acids of the glucose-6-phosphate dehydrogenase protein or proteins respectively results in loss of enzymatic acivity. These 30 N terminal amino acids correspond to position 1 to 30 of e. g. SEQ ID NO:10 or SEQ ID NO'S:22, 29, 31, 33, 35 or 37.
  • proteinogenic amino acid denotes those amino acids which are found in naturally occurring proteins of microorganisms, plants, animals and humans. These amino acids comprise L-glycine, L-alanine, L-valine, L-leucine,
  • the replacement of L-alanine in position 243 with L- threonine may preferably be achieved by replacing the nucleobase guanine in position 1264 of SEQ ID NO: 9 with adenine.
  • This guanine adenine transition is also shown in position 1034 of SEQ ID NO:21.
  • Positions 1264 of SEQ ID NO: 9 and 1034 of SEQ ID NO: 21 both correspond to position 727 of the coding sequences (the first G of the start codon GTG is position 1 in this case) of the zwf gene and zwf(A243T) allele.
  • the glucose 6-phosphate dehydrogenase activity of the Zwf proteins according to this aspect of the invention is less susceptible or resistant particularly to inhibition by
  • NADPH as compared to the wild type protein. Being exposed to a concentration of approximately 260 ⁇ M ( ⁇ denotes micro) NADPH the residual activity is at least 30% or 35% preferably at least 40%, 45% or 50% as compared to the activity in the absence of added NADPH in a strain comprising the mutant protein. Being exposed to a concentration of approximately 400 ⁇ M NADPH the residual activity is at least 20% preferably at least 25% as compared to the activity in the absence of added NADPH.
  • Mutagenesis to induce said mutations or alleles may be performed by conventional mutagenesis methods for bacterial cells using utagens such as for example N-methyl- 1 -nitro- N-nitrosoguanidine or ultraviolet light as described in the art for example in the Manual of Methods for General ' Bacteriology (Gerhard et al . (Eds.), American Society for Microbiology, Washington, DC, USA, 1981) . Appropriate mutants are then isolated and identified by e. g. sequencing methods or by measuring the glucose 6-phosphate ⁇ dehydrogenase activity.
  • the invention provides isolated coryneform bacteria or mutants comprising a polynucleotide encoding a Zwf protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is exchanged by another proteinogenic amino acid.
  • Corynebacterium glutamicum DM658 is an example for such a coryneform bacterium. It was obtained after multiple rounds of mutagenesis, selection and screening and contains in its chromosome a zwf allele (zwf(A243T)) coding for a Zwf protein (Zwf(A243T)) having the amino acid sequence of SEQ ID NO: 10 wherein L-alanine at position 243 is replaced by L-threonine as is shown in SEQ ID NO: 22.
  • Mutagenesis may also be performed by using in vitro methods for polynucleotides such as for example treatment with hydroxylamine (Molecular and General Genetics 145, l'Ol pp. (1978)) or mutagenic oligonucleotides (T.A. Brown: Gentechnologie fuer Einsteiger, Spektrum Akademischer Verlag, Heidelberg, 1993) or the polymerase chain reaction (PCR),. as is described in the manual by Newton and Graham (PCR, Spektrum Akademischer Verlag, Heidelberg, 1994) or the method described by Papworth et al . (Strategies 9(3), 3-4 (1996)) using the "Quik Change Site-directed Mutagenesis Kit” of Stratagene (La Jolla, California, USA) or similar methods known in the art.
  • hydroxylamine Molecular and General Genetics 145, l'Ol pp. (1978)
  • mutagenic oligonucleotides T.A. Brown: Gentechnologie fuer Einsteiger, Spek
  • the corresponding alleles or mutations are sequenced and introduced by recombination into the chromosome of an appropriate strain by the method of gene replacement, for example as described by Schwarzer and Puehler
  • the invention provides recombinant coryneform bacteria comprising a polynucleotide encoding a Zwf protein according to the invention e. g. comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is exchanged by another proteinogenic amino acid.
  • Corynebacterium glutamicum DSM5715zwf2_A243T is an example for such a strain. It comprises in its chromosome the mutation of the zwf allele of strain DM658 i.e. zwf(A243T).
  • Corynebacterium glutamicum strain DMl697_zwfD245S is another example for such a strain. It comprises in its chromosome the mutation of the zwf allele zwf (D2 . 45S) which was obtained by in vitro mutagenesis.
  • the corresponding alleles can also be introduced into the chromosome of an appropriate strain by the method of gene duplication for example as described by Reinscheid et al . (Applied and Environmental Microbiology 60(1), 126-132 (1994)) for the hom-thrB operon or by Jetten et al . (Applied Microbiology and Biotechnology 43,76-82 (1995)) for the ask gene.
  • the invention further provides coryneform bacteria comprising an isolated polynucleotide encoding a Zwf protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is exchanged by another proteinogenic amino acid.
  • Corynebacterium glutamicum DSM5715 : :pKl8mobsacB_zwf (A243T) is an example for such a strain. It comprises in its chromosome an isolated DNA containing the zwf (A243T) allele.
  • the alleles can also be overexpressed by any of the methods as described above, for example, using plasmids, inducible promoters or any other method known in the art .
  • the strains thus obtained are used for the fermentative production of amino acids. Accordingly the invention also . provides. rocesses for the production of L-amino acids using the coryneform bacteria of the invention.
  • L-amino acids may be advantageous for the production of L-amino acids to amplify one or more enzymes of the particular biosynthesis pathway, of glycolysis, of anaplerosis, of the pentose phosphate pathway, of sugar uptake or of amino acid export, in addition to amplification of the zwf gene or allele of the invention.
  • the term "attenuation” means reducing or suppressing the intracellular activity or concentration of one or more enzymes or proteins in a microorganism, which enzymes or proteins are coded by the corresponding DNA, for example by using a weak promoter or a gene or allele which codes for a corresponding enzyme or protein which has a low activity or inactivates the corresponding enzyme or protein and optionally by combining these measures .
  • the activity or concentration of the corresponding enzyme or protein is in general reduced to 0 to 75%, 0 to 50%, 0 to 25%, 0 to 10% or 0 to 5% of the activity or concentration of the wild-type enzyme or protein or of the activity or concentration of the enzyme or protein in the starting microorganism.
  • microorganisms prepared according to the invention can be cultured continuously or discontinuously in the batch process (batch culture) or in the fed batch (feed process) or repeated fed batch process (repetitive feed process) for the purpose of L-amino acid production.
  • batch culture batch culture
  • feed process feed process
  • repetitive feed process repetitive feed process
  • the culture medium to be used must meet the requirements of the particular microorganisms in a suitable manner. Descriptions of culture media for various microorganisms are contained in the handbook "Manual of Methods for General Bacteriology" of the American Society for
  • Sugars and carbohydrates such as e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats, such as e.g. soya oil, sunflower oil, groundnut oil and coconut fat, fatty acids, such as e.g. palmitic acid, stearic acid and linoleic acid, alcohols, such as e.g. glycerol and ethanol, and organic acids, such as e.g. acetic acid, can be used as the source of carbon. These substance can be used individually or as a mixture.
  • Organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean flour and urea
  • inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, can be used as the source of nitrogen.
  • the sources of nitrogen can be used individually or as a mixture.
  • Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus .
  • the culture medium must furthermore comprise salts of metals, such as e.g. magnesium sulfate or iron sulfate, which are necessary for growth.
  • essential growth substances such as amino acids and vitamins, can be employed in addition to the above-mentioned substances.
  • Suitable precursors can moreover be added to the culture medium.
  • the starting substances mentioned can be added to the culture in the form of a single batch, or can be fed in during the culture, in a suitable manner.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia, or acid compounds, such as phosphoric acid or sulfuric acid, can be employed in a suitable manner to control the pH.
  • Antifoams such as e.g. fatty acid polyglycol esters, can be employed to control the development of foam.
  • Suitable substances having a selective' action e.g. antibiotics, can be added to the medium to maintain the stability of plasmids .
  • oxygen or oxygen-containing gas mixtures such as e.g. air, are introduced into the culture.
  • the temperature of the culture is usually 20 2 C to 45 S C, and preferably 25 2 C to 40 a C. Culturing is continued until a maximum of L-amino acid has formed. This target is usually reached within 10 hours to 160 hours.
  • the invention further provides a process for the preparation of an amino acid by fermentation of a coryneform bacterium comprising the following steps: a) fermenting of the amino acid producing bacterium , in which at least a zwf gene encoding the insects is overexpressed, and b) concentrating of the amino acid in the medium or in the cells of the bacteria
  • said epithelial protein comprises at least the amino acid sequence corresponding to amino acids at positions 241 to 246 of SEQ ID NO: 22 and optionally the N terminal amino acid sequence of SEQ ID NO: 10 amino acids 1 to 10 or SEQ ID NO: 10 amino acids 2 to 10.
  • the invention further provides a process for the preparation of an amino acid by fermentation of an isolated coryneform bacterium comprising the following steps : a) fermenting of the amino acid producing bacterium comprising a polynucleotide encoding a Zwf protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is exchanged by another proteinogenic amino acid, and b) concentrating of the amino acid in the medium or in the cells of the bacterium.
  • the invention further provides a process for the preparation of an amino acid by fermentation of a coryneform bacterium comprising the following steps : a) fermenting of the amino acid producing bacterium comprising an isolated or recombinant polynucleotide encoding a Zwf protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is exchanged by another proteinogenic amino acid, and b) concentrating of the amino acid in the medium or in the cells of the bacterium.
  • the amino acid may be then isolated from the medium or the cells of the bacterium.
  • the performance of the bacteria or of the fermentation process in terms of product concentration (product per volume) , product yield (product formed per carbon source consumed) , product formation (product formed per volume and time) or other process parameters and combinations thereof can be improved by at least 0,5 %, at least 1 % or at least 2 %.
  • L-amino acids can be carried out by anion exchange chromatography with subsequent ninhydrin derivation, as described by Spackman et al . (Analytical Chemistry, 30, (1958) , 1190) , or it can take place by reversed phase HPLC as described by Lindroth et al . (Analytical Chemistry (1979) 51:. 1167-1174).
  • DSMZ German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany
  • Figure 1 Map of the plasmid pEC-Tl8mob2
  • Figure 2 Map of the plasmid pEC-T18mob2zwf
  • Figure 3 Map of the plasmid pAMCl
  • Figure 5 Map of the plasmid pCR2.
  • Figure 6 Map of the plasmid pKl8mobsacB_zwf (A243T)
  • Figure 7 Map of the plasmid pKl8mobsacB_zwf
  • Figure 8 Map of the plasmid pKl8mobsacB_zwf (D245S)
  • Figure 10 Map of the plasmid pKl8mobsacB_zwfdelta90bp
  • Figure 11 Map of the plasmid pCRBluntII_zwfL
  • Figure 12 Map of the plasmid pCRBluntII_zwfS
  • Figure 13 Map of the plasmid pZ8-l_zwfL
  • Tet Resistance gene for tetracycline oriV: Plasmid-coded replication origin of E. coli RP4mob: mob region for mobilizing the plasmid rep: Plasmid-coded replication origin from C. glutamicum plasmid pGAl per: Gene for controlling the number of copies from pGAl lacZ-alpha: lacZ gene fragment (N-terminus) of the ⁇ -galactosidase gene lacZalpha' : 5 ' -Terminus of the lacZ ⁇ gene fragment 'lacZalpha: 3 ' -Terminus of the lacZ ⁇ gene fragment
  • Neo r Neomycin/kanamycin resistance
  • ColEl ori Replication origin of the plasmid ColEl
  • CMV Cytomegalovirus promoter
  • lacP Lactose promoter
  • pgi Phosphoglucose isomerase gene
  • lacZ Part of the ⁇ -galactosidase gene
  • SV40 polyA Polyadenylation site of Simian virus 40 fl (-) ori : Replication origin of the filamentous phage fl
  • SV40 ori Replication origin of Simian virus 40 kan r: Kanamycin resistance pgi insert: Internal fragment of the pgi gene ori : Replication origin of the plasmid pBGS8 Re Figure 5 :
  • ColEl ori Replication origin of the plasmid ColEl lacZ: Cloning relict of the lacZ ⁇ gene fragment fl ori: Replication origin of phage fl
  • RP4mob mob region with the replication origin for the transfer (oriT)
  • KanR Kanamycin resistance gene
  • oriV Replication origin
  • V zwf(A243T): zwf (A243T) allele sacB sacB gene
  • RP4mob mob region with the replication origin for the transfer (oriT)
  • deltazwf90 cloned DNA fragment containing a 90 bp deletion of the zwf allele
  • Kan kanamycin resistance gene
  • pUC ori origin of replication sacB: sacB gene
  • RP4mob mob region with the replication origin for the transfer (oriT) oriV: origin of replication
  • Xbal cleavage site of the restriction enzyme
  • zwfL cloned DNA fragment of the zwf allele
  • zwfS cloned DNA fragment containing a 90 bp deletion of the zwf allele
  • Km kanamycin resistance gene
  • pUC origin origin of replication
  • zwfL cloned DNA fragment of the zwf allele
  • zwfS cloned DNA fragment containing a 90 bp deletion of the zwf allele
  • Km kanamycin resistance gene rrnB-
  • Ptac promotor rep: origin of replication
  • Sail cleavage site of the restriction enzyme Sail
  • the meaning of the abbreviations for the various restriction enzymes are known from the prior art and are summarized, for example, by Kessler and Hoeltke (Gene 47, 1-153 (1986)) or Roberts et al . (Nucleic Acids Research 27, 312-313 (1999)).
  • the E. coli - C. glutamicum shuttle vector pEC-Tl8mob2 was constructed according to the prior art.
  • the vector contains the replication region rep of the plasmid pGAl including the replication effector per (US-A- 5,175,108; Nesvera et al., Journal of Bacteriology 179, 1525-1532 (1997)), the tetracycline resistance-imparting tetA(Z) gene of the plasmid pAGl (US-A- 5,158,891; gene library entry at the National Center for Biotechnology Information (NCBI, Bethesda, MD, USA) with accession number AF121000) , the replication region oriV of the plasmid pMBl (Sutcliffe, Cold Spring Harbor Symposium on Quantitative Biology 43, 77-90 (1979)), the lacZ ⁇ gene fragment including the lac promoter and a multiple ' cloning site (mcs) (Norrander et al .
  • Plasmid DNA was isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction with the restriction enzyme EcoRI and Hindlll and subsequent agarose gel electrophoresis (0.8%).
  • DSM 13244 Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) as DSM 13244.
  • the gene from Corynebacterium glutamicum ATCC13032 was first amplified by a polymerase chain reaction (PCR) by means of the following oligonucleotide primer:
  • the PCR reaction was carried out in 30 cycles in the presence of 200 ⁇ M deoxynucleotide triphosphates (dATP, dCTP, dGTP, dTTP) , in each case 1 ⁇ M of the corresponding oligonucleotide, 100 nanogram (ng) chromosomal DNA from Corynebacterium glutamicum ATCC13032, 1/10 volume 10-fold reaction buffer and 2.6 units of a heat-stable Taq-/Pwo-DNA polymerase mixture (Expand High Fidelity PCR System from Roche Diagnostics, Mannheim, Germany) in a Thermocycler (PTC-100, MJ Research, Inc., Watertown, USA) under the following conditions: 94°C for 30 seconds, 64°C for 1 minute and 68°C for 3 minutes.
  • dATP deoxynucleotide triphosphates
  • dCTP deoxynucleotide triphosphates
  • dGTP dGTP
  • the amplified fragment about 1.8 kb in size was subsequently ligated with the aid of the SureClone Ligation Kit (Amersham Pharmacia Biotech, Uppsala, Sweden) into t e Smal cleavage site of the vector pUCl8 in accordance with the manufacturer's instructions.
  • the E. coli strain DH5 ⁇ cr (Grant et al . , Proceedings of the National Academy of Sciences of the United States of America USA (1990) 87: 4645-4649) was transformed with the entire ligation batch. Transformants were identified with the aid of their carbenicillin resistance on LB-agar plates containing
  • the plasmids were prepared from 7 of the transformants and checked for the presence of the 1.8 kb PCR fragment as an insert by restriction analysis.
  • the recombinant plasmid formed in this way is called pUCl ⁇ zwf in the following.
  • pUCl8zwf was digested with Kpnl and Sail, and the product was isolated with the aid of the NucleoSpin Extraction Kit from Macherey-Nagel (Dueren, Germany) in accordance with the manufacturer's instructions and then ligated with the vector pEC-Tl8mob2, which had also been cleaved with Kpnl and Sail and dephosphorylated.
  • the E. coli strain DH5ocmcr (Grant et al . , Proceedings of the National Academy of Sciences of the United States of America USA (1990) 87: 4645-4649) was transformed with the entire ligation batch.
  • Transformants were identified with the aid of their tetracycline resistance on LB-agar plates containing 5 ⁇ g/mL tetracycline.
  • the plasmids were prepared from 12 of the transformants and checked for the presence of the 1.8 kb PCR fragment as an insert by restriction analysis .
  • One of the recombinant plasmids isolated in this manner was called pEC-Tl8mob2zwf ( Figure 2).
  • the L-lysine-producing strain Corynebacterium glutamicum DSM5715 is described in EP-B-0435132 and the L-threonine- producing strain Brevibacterium flavum DSM5399 is described in EP-B-0385940. Both strains are deposited at the Deutsche Sammlung fuer Mikroorganismen und Zellkulturen [German Collection of Microorganisms and Cell Cultures] in Braunschweig (Germany) in accordance with the Budapest Treaty.
  • Plasmid DNA was isolated in each case from a transformant by conventional methods (Peters-Wendisch et al . , 1998, Microbiology 144, 915 -927), cleaved with the restriction endonucleases Xbal and Kpnl, and the plasmid was checked by subsequent agarose gel electrophoresis.
  • the strains obtained in this way were called DSM5715/pEC-Tl8mob2zwf and' DSM5399/pEC-Tl8mob2zwf .
  • the C. glutamicum strain DSM5399/pEC-Tl8mob2zwf obtained in Example 2.1 was cultured in a nutrient medium suitable for the production of threonine and the threonine content in the culture supernatant was determined.
  • the strain was first incubated on an agar plate with the corresponding antibiotic (brain-heart agar with tetracycline (5 mg/1)) for 24 hours at 33 S C.
  • a preculture was seeded (10 ml medium in a 100 ml conical flask) .
  • the complete medium Cg III was used as the medium for the preculture.
  • Medium Cg III
  • Tetracycline (5 mg/1) was added to this.
  • the preculture was incubated for 16 hours at 33 a C at 240 rpm on a shaking machine.
  • a main culture was seeded from this preculture such that the initial OD (660nm) of the main culture was 0.1.
  • Medium MM was used for the main culture.
  • MOPS morpholinopropanesulfonic 20 g/1 acid
  • the CSL, MOPS and the salt solution were brought to pH 7 with aqueous ammonia and autoclaved.
  • the sterile substrate and vitamin solutions were then added, as well as the CaC0 3 autoclaved in the dry state.
  • Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles. Tetracycline (5 mg/1) was added. Culturing was carried out at 33 a C and 80% atmospheric humidity.
  • the OD was determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Kunststoff) .
  • the amount of threonine formed was determined with an amino acid analyzer from Eppendorf- ⁇ BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
  • the C. glutamicum strain DSM5715/pEC-Tl8mob2zwf obtained in Example 2.1 was cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant was determined.
  • the strain was first incubated on an agar plate with the corresponding antibiotic (brain-heart agar with tetracycline (5 mg/1)) for 24 hours at 33 a C.
  • a preculture was seeded (10 ml medium in a 100 ml conical flask) .
  • the complete medium Cg III was used as the medium for the preculture.
  • Medium Cg III
  • Tetracycline (5 mg/1) was added to this.
  • the preculture was incubated for 16 hours at 33 a C at 240 rpm on a shaking machine.
  • a main culture was seeded from this preculture such that the initial OD (660nm) of the main culture was 0.1.
  • Medium MM was used for the main culture.
  • MOPS morpholinopropanesulfonic 20 g/1 acid
  • the CSL, MOPS and the salt solution were brought to pH 7 with aqueous ammonia and autoclaved.
  • the sterile substrate and vitamin solutions were then added, as well as the CaC0 3 autoclaved in the dry state.
  • Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles. Tetracycline (5 mg/1) was • added. Culturing was carried out at 33 a C and 80% atmospheric humidity.
  • the OD was determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Kunststoff) .
  • the amount of lysine formed was determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
  • a DNA library of Corynebacterium glutamicum strain AS019 was constructed using ⁇ Zap ExpressTM system, (Short et al., (1988) Nucleic Acids Research, 16: 7583- 7600), as described by O'Donohue (O'Donohue, M. (1997). The Cloning and Molecular Analysis of Four Common Aromatic Amino Acid Biosynthetic Genes from Corynebacterium glutamicum. Ph.D. Thesis, National University of Ireland, Galway) .
  • ⁇ Zap ExpressTM kit was purchased from Stratagene (Stratagene, 11011 North Torrey Pines Rd. , La Jolla, California 92037) and used according to the manufacturers instructions.
  • AS019-DNA was digested with restriction enzyme Sau3A and ligated to BamHI treated and dephosphorylated ⁇ Zap ExpressTM arms .
  • Escherichia coli strain DF1311 carrying mutations in the pgi and pgi genes as described by Kupor and Fraenkel, (Journal of Bacteriology 100: 1296-1301 (1969)), was transformed with approx. 500 ng of the AS019 ⁇ Zap ExpressTM plasmid library described in Example 3. Selection for . transformants was made on M9 minimal media, (Sambrook et al., (1989) . Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratories, USA) , containing kanamycin at a concentration of 50 mg/1 and incubation at 37°C for 48 hours. Plasmid DNA was isolated from one transformant according to Birnboim and Doly (Nucleic Acids Research 7 : 1513-1523 (1979)) and designated pAMCl ( Figure 3).
  • Internal primer 1 (SEQ ID NO 15) : GGA AAC AGG GGA GCC GTC Internal primer 2 (SEQ ID NO 16) : TGC TGA GAT ACC AGC GGT ⁇
  • SEQ ID NO 1 The sequence thus obtained is shown in SEQ ID NO 1.
  • the analysis of the nucleotide sequence obtained revealed an open reading frame of 1650 base pairs which was designated as pgi gene. It codes for a protein of 550 amino acids shown in SEQ ID NO 2.
  • telomere sequence An internal segment of the pgi gene was amplified by polymerase chain reaction (PCR) using genomic DNA isolated from Corynebacterium glutamicum AS019, (Heery and Dunican, (1993) Applied and Environmental Microbiology 59: 791-799), as template.
  • the pgi primers used were: fwd.
  • PCR Parameters were as follows: 35 cycles 94°C for 1 min. 47°C for 1 min. 72°C for 30 sec. - 1.5 mM MgCl 2 approx. 150-200 ng DNA template.
  • the PCR product obtained was cloned into the commercially available pGEM-T vector received from Promega Corp., (Promega UK, Southampton.) using strain E. coli JM109, (Yanisch-Perron et al., 1985. Gene, 33: 103-119), as a host.
  • the sequence of the PCR product is shown as SEQ ID NO , 3.
  • the cloned insert was then excised as an EcoRI fragment and ligated to plasmid pBGS8 (Spratt et al . , Gene 41: 337- 342 (1986)) pretreated with EcoRI.
  • the restriction enzymes used were obtained from Boehringer Mannheim UK Ltd.
  • E. coli JM109 was then transformed with this ligation mixture and electrotransformants were selected on Luria agar supplemented with IPTG (isopropyl- ⁇ -D- thiogalactopyranoside) , XGAL (5-bromo-4-chloro-3-indolyl-D- galactopyranoside) and kanamycin at a concentration of 1 mM, 0.02% and 50 mg/1, respectively.
  • IPTG isopropyl- ⁇ -D- thiogalactopyranoside
  • XGAL 5-bromo-4-chloro-3-indolyl-D- galactopyranoside
  • kanamycin at a concentration of 1 mM, 0.02% and 50 mg/1, respectively.
  • Plasmid DNA was isolated from one transformant, characterized by restriction enzyme analysis using EcoRI, BamHI and Sail designated pMCl ( Figure 4) . Plasmid pMCl was deposited in the form of Escherichia coli strain DH5a/pMCl at the Deutsche Sammlung fuer Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) as DSM 12969 according to the Budapest treaty.
  • Example 5 The vector pMCl mentioned in Example 5 was electroporated by the electroporation method of Tauch et al . (FEMS Microbiological Letters, 123:343-347 (1994)) in
  • Corynebacterium glutamicum DSM 5715 is an AEC-resistant lysine producer.
  • the vector pMCl cannot replicate independently in DSM5715 and is retained in the cell only if it has integrated into the chromosome of DSM 5715.
  • Selection of clones with pMCl integrated into the chromosome was carried out by plating out the electroporation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which had been supplemented with 15 mg/1 kanamycin.
  • the internal pgi fragment (Example 5) was labeled with the Dig hybridization kit from, Boehringer Mannheim by the method of "The DIG System Users Guide for Filter Hybridization” of Boehringer Mannheim GmbH (Mannheim, Germany, 1993) .
  • Chromosomal DNA of a transformant was isolated by the method of Eikmanns et al. (Microbiology 140: 1817 - 1828 (1994)) and in each case cleaved with the restriction enzymes Sail, Sad and Hindlll.
  • the fragments formed were separated by agarose gel electrophoresis and hybridized at 68 a C with the Dig hybridization kit from Boehringer. It was found in this way that the plasmid pMCl was inserted within the chromosomal pgi gene of strain DSM5715.
  • the strain was called DSM5715: :pMCl.
  • the vector pEC-Tl8mob2zwf mentioned in Example 1.2 was electroporated by the electroporation method of Tauch et al. (1994, FEMS Microbiological Letters, 123:343-347) in Corynebacterium glutamicum DSM 5715::pMCl. Selection for plasmid-carrying cells was made by plating out the electroporation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. , 1989), which had been supplemented with 15 mg/1 kanamycin and with 5 mg/1 tetracycline.
  • Plasmid DNA was isolated from ' a transformant by conventional methods (Peters-Wendisch et al., 1998, Microbiology 144, 915-927) and checked by treatment with the restriction enzymes Kpnl and Sail with subsequent agarose gel electrophoresis. The strain was called DSM5715 : :pMCl/pEC-Tl8mob2zwf .
  • the C. glutamicum strain DSM5715 : :pMCl/pEC-T18mob2zwf obtained in Example 7.1 was cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant was determined.
  • the strain was first incubated on an agar plate with the corresponding antibiotic (brain-heart agar with tetracycline (5 mg/1) and kanamycin (25 mg/1) ) for 24 hours at 33 a C.
  • the cultures of the comparison strains were supplemented according to their resistance to antibiotics.
  • a preculture was seeded (10 ml medium in a 100 ml conical flask) .
  • the complete medium Cg III was used as the medium for the preculture.
  • Tetracycline (5 mg/1) and kanamycin (5 mg/1) was added to this.
  • the preculture was incubated for 16 hours at 33 a C at 240 rpm on a shaking machine.
  • a main culture was seeded from this preculture such that the initial OD (660 nm) of the main culture was 0.1.
  • Medium MM was used for the main culture.
  • Medium MM was used for the main culture.
  • MOPS morpholinopropanesulfonic 20 g/1 acid
  • the CSL, MOPS and the salt solution were brought to pH 7 with aqueous ammonia and autoclaved.
  • the sterile substrate and vitamin solutions were then added, as well as the CaC0 3 autoclaved in the dry state.
  • Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles. Tetracycline (5 mg/1) and kanamycin (25 mg/1) were added. Culturing was carried out at 33 a C and 80% atmospheric humidity.
  • the OD was determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Kunststoff) .
  • the amount of lysine formed was determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
  • Chromosomal DNA from Corynebacterium glutamicum ATCC 13032 was isolated as described by Tauch et al . , (1995, Plasmid 33:168-179), and partly cleaved with the restriction enzyme Sau3AI (Amersham Pharmacia, Freiburg, Germany, Product Description Sau3AI, Code no. 27-0913-02) .
  • the DNA fragments were dephosphorylated with shrimp alkaline phosphatase (Roche Molecular Biochemicals, Mannheim, Germany, Product Description SAP, Code no. 1758250) .
  • the DNA of the cosmid vector SuperCosl (Wahl et al .
  • the cosmid DNA was then cleaved with the restriction enzyme BamHI (Amersham Pharmacia, Freiburg, Germany, Product Description BamHI, Code no. 27-0868-04) .
  • the cosmid DNA treated in this manner was mixed with the treated ATCC13032 DNA and the batch was treated with T4 DNA ligase (Amersham Pharmacia, Freiburg, Germany, Product Description T4-DNA- Ligase, Code no.27-0870-04) .
  • the ligation mixture was then packed in phages with the aid of Gigapack II XL Packing Extracts (Stratagene, La Jolla, USA, Product Description
  • the cosmid DNA of an individual colony was isolated with the Qiaprep Spin Miniprep Kit (Product No. 27106, Qiagen, Hilden, Germany) in accordance with the manufacturer ' s instructions and partly cleaved with the restriction enzyme Sau3AI (Amersham Pharmacia, Freiburg, Germany, Product Description Sau3AI, Product No. 27-0913-02) .
  • the DNA fragments were dephosphorylated with shrimp alkaline phosphatase (Roche Molecular Biochemicals, Mannheim, Germany, Product Description SAP, Product No. 1758250) .
  • the cosmid fragments in the size range of 1500 to 2000 bp were isolated with the QiaExII Gel Extraction Kit (Product No. 20021, Qiagen, Hilden, Germany) .
  • the DNA of the sequencing vector pZero-1 obtained . from Invitrogen (Groningen, Holland, Product Description Zero Background Cloning Kit, Product No. K2500-01) , was cleaved with the restriction enzyme BamHI (Amersham Pharmacia, Freiburg, Germany, Product Description BamHI, Product No. 27-0868-04) .
  • the ligation of the cosmid fragments in the sequencing vector pZero-1 was carried out as described by Sambrook et al . (1989, Molecular Cloning: A laboratory Manual, Cold Spring Harbor) , the DNA mixture being incubated overnight with T4 ligase (Pharmacia Biotech, Freiburg, Germany) .
  • This ligation mixture was then electroporated (Tauch et al . 1994, FEMS Microbiol Letters, 123:343-7) into the E. coli strain DH5 MCR (Grant, 1990, Proceedings of the National Academy of Sciences U.S.A., 87:4645-4649) and plated out on LB agar (Lennox, 1955, Virology, 1:190) with 50 ⁇ g/ml zeocin.
  • the plasmid preparation of the recombinant clones was carried out with Biorobot 9600 (Product No. 900200, Qiagen, Hilden, Germany) .
  • the sequencing was carried out by the dideoxy chain-stopping method of Sanger et al .
  • the raw sequence data obtained were then processed using the Staden program package (1986, Nucleic Acids Research, 14:217-231) version 97-0.
  • the individual sequences of the pZerol derivatives were assembled to a continuous contig.
  • the computer-assisted coding region analysis were prepared with the XNIP program (Staden, 1986, Nucleic Acids Research, 14:217-231). Further analyses were carried out with the "BLAST search program" (Altschul et al . , 1997, Nucleic Acids Research, 25:3389-3402), against the non- redundant databank of the "National Center for
  • the resulting nucleotide sequence is shown in SEQ ID NO: 4. Analysis of the nucleotide sequence showed an open reading frame of 1737 base pairs, which was called the poxB gene.
  • the poxB gene codes for a polypeptide of 579 amino acids (SEQ ID NO. 5) .
  • chromosomal DNA was isolated by the method of Eikmanns et al. (Microbiology 140: 1817 - 1828 (1994) ) .
  • the sequence of the poxB gene known for C. glutamicum from Example 8, the following oligonucleotides were chosen for the polymerase chain reaction:
  • the primers shown were synthesized by MWG Biotech (Ebersberg, Germany) and the PCR reaction was carried out by the standard PCR method of Innis et al . (PCR protocols. A guide to methods and applications, 1990, Academic Press) with Pwo-Polymerase from Boehringer. With the aid of the polymerase chain reaction, a DNA fragment approx. 0.9 kb in size was isolated, this carrying an internal fragment of the poxB gene and being shown in SEQ ID NO : 6.
  • the amplified DNA fragment was ligated with the TOPO TA
  • Plasmid DNA was isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction with the restriction enzyme EcoRI and subsequent agarose gel electrophoresis (0.8%). The plasmid was called pCR2. lpoxBint ( Figure 5).
  • Example 10 The vector pCR2. lpoxBint mentioned in Example 10 was electroporated by the electroporation method of Tauch et al. (FEMS Microbiological Letters, 123:343-347 (1994)) in
  • Corynebacterium glutamicum DSM 5715 is an AEC-resistant lysine producer.
  • the vector pCR2. lpoxBint cannot replicate independently in DSM5715 and is retained in the cell only if it has integrated into the chromosome of DSM 5715. Selection of clones with pCR2. lpoxBint integrated into the chromosome was carried out by plating out the electroporation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which had been supplemented with 15 mg/1 kanamycin.
  • the poxBint fragment was labeled with the Dig hybridization kit from Boehringer by the method of "The DIG System Users Guide for Filter Hybridization” of Boehringer Mannheim GmbH (Mannheim, Germany, 1993) .
  • Chromosomal DNA of a potential integrant was isolated by the method of Eikmanns et al. (Microbiology 140: 1817 - 1828 (1994) ) and in each case cleaved with the restriction enzymes Sail, Sad and Hindlll. The fragments formed were separated by agarose gel electrophoresis and hybridized at 68 a C with the Dig hybridization kit from Boehringer. The plasmid pCR2. lpoxBint mentioned in Example 9 had been inserted into the chromosome of DSM5715 within the chromosomal poxB gene. The strain was called DSM5715 : :pCR2. lpoxBint .
  • lpoxBint was transformed with the plasmid pEC-Tl8mob2zwf using the electroporation method described by Liebl et al . , (FEMS Microbiology Letters, 53:299-303 (1989)). Selection of the transformants took place on LBHIS agar comprising 18.5 g/1 brain-heart infusion broth, 0.5 M sorbitol, 5 g/1 Bacto-tryptone, 2.5 g/1 Bacto-yeast extract, 5 g/1 NaCI and 18 g/1 Bacto- agar, which had been supplemented with 5 mg/1 tetracycline and 25 mg/1 kanamycin. Incubation was carried out for 2 days at 33 a C.
  • Plasmid DNA was isolated in each case from a transformant by conventional methods (Peters-Wendisch et al . , 1998, Microbiology 144, 915-927) , cleaved with the restriction endonucleases Xbal and Kpnl, and the plasmid was checked by subsequent agarose gel electrophoresis .
  • the strain obtained in this way was called DSM5715 :pCR2. IpoxBint/pEC- Tl8mob2zwf .
  • IpoxBint/pEC- Tl8mob2zwf obtained in Example 12.1 was cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant was determined.
  • the strain was first incubated on an agar plate with the corresponding antibiotic (brain-heart agar with tetracycline (5 mg/1) and kanamycin (25 mg/1)) for 24 hours , at 33 a C.
  • the comparison strains were supplemented according to their resistance to antibiotics .
  • a preculture was seeded (10 ml medium in a 100 ml conical flask) .
  • the complete medium Cg III was used as the medium for the preculture.
  • Tetracycline (5 mg/1) and kanamycin (25 mg/1) were added to this.
  • the preculture was incubated for 16 hours at 33 a C at > 240 rpm on a shaking machine.
  • a main culture was seeded from this preculture such that the initial OD (660nm) of the main culture was 0.1.
  • Medium MM was used for the main culture.
  • MOPS morpholinopropanesulfonic 20 g/1 acid
  • the CSL, MOPS and the salt solution were brought to pH 7 with aqueous ammonia and autoclaved.
  • the sterile substrate and vitamin solutions were then added, as well as the CaC0 3 autoclaved in the dry state.
  • Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles. Tetracycline (5 mg/1) and kanamycin (25 mg/1) were added. Culturing was carried out at 33 a C and 80% atmospheric humidity.
  • the OD was determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Kunststoff) .
  • the amount of lysine formed was determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
  • the Corynebacterium glutamicum strain DM658 was prepared by multiple, non-directed mutagenesis, mutant selection and screening from C. glutamicum ATCC13032.
  • the strain is resistant against the L-lysine analogue S- (2-aminoethyl) -L- cysteine (AEC) and has a feedback resistant aspartate kinase which is insensitive to mixtures of L-lysine, the L- lysine analogue S- (2-aminoethyl) -L-cysteine (AEC) and L- threonine.
  • chromosomal DNA is isolated by conventional methods (Eikmanns et al . , Microbiology 140: 1817 - 1828 (1994)). With the aid of the polymerase chain reaction (PCR) , a DNA section which carries the zwf gene or allele is amplified. On the basis of the sequence of the zwf gene of C. glutamicum the following primer oligonucleotides from Example 1.2 are chosen for the PCR: zwf-forward (SEQ ID NO 11) :
  • the primers shown are synthesized by MWG Biotech (Ebersberg, Germany) and the PCR reaction is carried out by the standard PCR method of Innis et al . (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) .
  • the primers allow amplification of a DNA section of approx. 1.85 kb in length, which carries the zwf allele.
  • the amplified DNA fragment of approx. 1.85 kb in length which carries the zwf allele of strain DM658 is identified by electrophoresis in a 0.8% agarose gel, isolated from the gel and purified by conventional methods (QIAquick Gel Extraction Kit, Qiagen, Hilden, Germany) .
  • the nucleotide sequence of the amplified DNA fragment or PCR product is determined by sequencing by MWG Biotech (Ebersberg, Germany) .
  • the sequence of the PCR product is shown in SEQ ID NO: 21.
  • the amino acid sequence of the insects (Zwf protein) resulting with the aid of the Patentin program is shown in SEQ ID NO: 22.
  • the nucleotide sequence of the coding region of the zwf allele of strain DM658 contains at position 727 the base adenine.
  • the position 727 of the nucleotide sequence in the coding region of the zwf-allele corresponds to position 1034 of the nucleotide sequence shown in SEQ ID NO: 21.
  • the nucleotide is the base guanine.
  • the position 727 of the nucleotide sequence of the coding region of the wild-type gene corresponds to position 1264 in SEQ ID NO: 9.
  • the amino acid sequence of the insects of strain DM658 contains at position 243 the amino acid threonine (SEQ ID NO: 22) .
  • At the corresponding position of the wild-type protein is the amino acid alanine (SEQ ID NO: 10) . Accordingly the allele is referred to as zwf (A243T) .
  • SEQ ID NO: 23 shows an internal segment of the coding sequence of the zwf (A243T) allele comprising the guanine adenine transition (see position 137 of SEQ ID NO: 23) .
  • chromosomal DNA is isolated by conventional methods (Eikmanns et al . , Microbiology 140: 1817 - 1828 (1994)) .
  • a DNA section which carries the zwf (A243T) allele which contains the base adenine at position 727 of the coding region (CDS) instead of the bases guanine contained at this position in the wild-type gene is amplified with the aid of the polymerase chain reaction.
  • the following primer oligonucleotides are chosen for the polymerase chain reaction :
  • the primers shown are synthesized by MWG Biotech (Ebersberg, Germany) and the PCR reaction is carried out by the standard PCR method of Innis et al. (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) .
  • the primers allow amplification of a DNA section approx. 1.75 kb in length which carries the zwf (A243T) allele (SEQ ID NO: 26) .
  • the primers moreover contain the sequence for a cleavage site of the restriction endonuclease Xbal, which is marked by underlining in the nucleotide sequence shown above .
  • the amplified DNA fragment of approx. 1.75 kb in length which carries the zwf (A243T) allele is cleaved with the restriction endonuclease Xbal, identified by electrophoresis in a 0.8% agarose gel and then isolated from the gel and purified by conventional methods (QIAquick Gel Extraction Kit, Qiagen, Hilden) .
  • the Xbal DNA fragment of approx. 1.75 kb length containing the zwf (A243T) allele (see Example 14.1) is incorporated into the chromosome of the C. glutamicum strain DSM5715 by means of replacement mutagenesis using the sacB system as described by Schaefer et al. (Gene, 14, 69-73 (199.4)). This system allows for preparation and selection of allele exchanges occurring by homologous recombination.
  • the mobilizable cloning vector pKl ⁇ mobsacB is digested with the restriction enzyme Xbal and the ends are dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim, Germany) .
  • the vector prepared in this way is mixed with the zwf (A243T) fragment approx. 1.75 kb in size and the mixture is treated with T4 DNA ligase (Amersham-Pharmacia, Freiburg, Germany) .
  • the E. coli strain S17-1 (Simon et al . , Bio/Technologie 1: 784-791, 1993) is then transformed with the ligation batch (Hanahan, In. DNA cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plasmid-carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 25 mg/1 kanamycin.
  • Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme Pstl and subsequent agarose gel electrophoresis .
  • the plasmid is called pKl8mobsacB_zwf (A243T) and is shown in Figure 6.
  • the vector pKl8mobsacB_zwf (A243T) mentioned in Example 14.2 is transferred by conjugation by the protocol of Schaefer et al. (Journal of Microbiology 172: 1663-1666 (1990)) into' C. glutamicum strain DSM5715.
  • the vector cannot replicate independently in DSM5715 and is retained in the cell only if it is integrated in the chromosome as the consequence of a recombination event.
  • Selection for transconjugants i.e. clones with integrated pKl8mobsacB_zwf (A243T) , is made by plating out the conjugation batch on LB agar (Sambrook et al .
  • kanamycin-resistant transconjugants are plated out on LB dgar plates containing 25 mg/1 kanamycin and incubated for 24 hours at 33 °C.
  • a kanamycin-resistant transconjugant is called DSM5715: :pKl8mobsacB_zwf (A243T) .
  • the strain obtained i.e. DSM5715: :pKl8mobsacB_zwf (A243T)
  • DSM5715: :pKl8mobsacB_zwf (A243T) contains the zwf wild type gene and the zwf (A243T) allele.
  • cells of the strain DSM5715 : :pKl ⁇ mobsacB_zwf (A243T) are cultured for 24 hours unselectively in LB liquid medium, and then plated out on LB agar with 10% sucrose and incubated for 30 hours.
  • the plasmid pKl8mobsacB_zwf (A243T) like the starting plasmid pKl ⁇ mobsacB, contains, in addition to the kanamycin resistance gene, a copy of the sacB gene which codes for levan sucrase from Bacillus subtilis .
  • the expression which can be induced by sucrose leads to the formation of levan sucrase, which catalyses the synthesis of the product levan, which is toxic to C. glutamicum.
  • allele exchange i.e. incorporation of the mutation
  • the original copy i.e. the wild type gene
  • Approximately 40 to 50 colonies are tested for the phenotype "growth in the presence of sucrose” and "non- growth in the presence of kanamycin” .
  • a region of the zwf gene spanning the zwf (A243T) mutation is sequenced, starting from the sequencing primer zf_l (SEQ ID NO:27), (prepared by GATC Biotech AG, Konstanz, Germany) to demonstrate that the mutation of the zwf (A243T) allele is present in the chromosome.
  • the nucleotide sequence of primer zf_l is as follows:
  • a clone which contains the base adenine at position 727 of the coding region (CDS) of the zwf gene and thus has the zwf (A243T) allele in its chromosome was identified in this manner.
  • This clone was called strain DSM5715zwf2_A243T.
  • the cells are solubilized by using the Ribolyser system (Hybaid AG, Heidelberg, Germany) .
  • the cells are solubilized mechanically by using 1,6 g glass beads (0,2 ⁇ m in diameter) and 0,6 g of a solution of Tris- HCl (100 mM) /NaCI buffer (520 mM) at pH 7,8, containing the cells mentioned above.
  • After centrifugation the supernatant is isolated and used as crude extract.
  • An aliquot of the supernatant is used for the determination of the total protein concentration using the colorimetric BCA method (Pierce, Rockford, IL, USA, Order No. 23235ZZ) .
  • Another aliquot is used for the determination of the glucose-6- phosphate dehydrogenase activity.
  • the assay system for determination of the glucose-6- phosphate dehydrogenase activity contains lOOmM Tris-HCl (pH 7,8), 10 mM MgCl 2 and 260 ⁇ M NADP + .
  • the reaction is initiated by addition of glucose-6-phosphate to give a final concentration of 7 mM glucose-6-phosphate.
  • the absorption of NADPH is monitored at 340 nm with the Hitachi U3200 spectrophotometer (Nissei Sangyo, Duesseldorf, Germany) at 25°C.
  • Measurement of the glucose-6-phosphate dehydrogenase activity in presence of NADPH is done in an assay system containing 100 mM Tris-HCl (pH 7,8), 10 mM MgCl 2 , 260 ⁇ M NADP + and 260 ⁇ M NADPH. The reaction is initiated by the addition of glucose-6-phosphate to give a final concentration of 7 mM. The calculation of the enzyme activity in the presence of NADPH is done in the same way as described before.
  • strain DSM5715zwf2_A243T For determination of the activity of the glucose-6- phosphate dehydrogenase enzyme encoded by the zwf allele zwf (A243T) contained in strain DSM5715zwf2_A243T the strain is incubated for 24 hours in LB media (Merck KG, Darmstadt, Germany) . Culturing is carried out in a 25 ml volume in a 250 ml conical flask with baffles at 33 a C at 200 rpm on a shaking machine. For comparison the parental strain DSM5715 having a wild-type zwf gene is incubated in parallel. The preparation of the biomass is done as described in Example 15.1.
  • Measurement of the glucose-6-phosphate dehydrogenase activity in presence of its reaction end product NADPH is done in an assay system containing lOOmM Tris-HCl (pH 7,8), 10 mM MgCl 2 , 260 ⁇ M NADP + , 7 mM glucose-6-phosphate and 400 ⁇ M NADPH.
  • the enzyme activity in the presence of NADPH is calculated in the same way as described before.
  • the C. glutamicum strains DSM5715 and DSM5715zwf2_A243T, obtained in Example 14, are cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant is determined.
  • the strains are first incubated on an agar plate for 24 hours at 33 a C.
  • a preculture is seeded (10 ml medium in a 100 ml conical flask) .
  • the medium MM is used as the medium for the precultures .
  • the precultures are incubated for 24 hours at 33 a C at 240 rpm on a shaking machine.
  • a main culture is seeded from these precultures such that the initial OD (660 nm) of the main cultures is 0.1.
  • the Medium MM is also used for the main cultures.
  • Medium MM is also used for the main cultures.
  • the CSL corn steep liquor
  • MOPS morpholmopropanesulfonic acid
  • the salt solution is brought to pH 7 with aqueous ammonia and autoclaved.
  • Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles at 33 a C and 80% atmospheric humidity.
  • the OD is determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Kunststoff) .
  • the amount of lysine formed is determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
  • the Corynebacterium glutamicum strain DM1697 was produced by multiple rounds of non-directed mutagenesis, selection and mutant election from C. glutamicum ATCC21527.
  • ATCC21527 is auxotroph for L-leucine and L-homoserine.
  • the strain DM1697 in contrast is prototroph for L-leucine and L- homoserine, resistant to the lysine analogue S- (2- aminoethyl) -L-cysteine and has a feed back-resistant aspartate kinase which is insensitive to inhibition by a mixture of S- (2-aminoethyl) -L-cysteine and threonine (in each case 25 mM) .
  • chromosomal DNA is isolated by the conventional methods (Eikmanns et al . , Microbiology 140: 1817 - 1828 (1994)).
  • a DNA section which carries the zwf gene is amplified with the aid of the polymerase chain reaction.
  • the following primer oligonucleotides are chosen for the polymerase chain reaction: zwf_XL-Al ( SEQ ID NO : 24 ) :
  • the primers shown are synthesized by MWG Biotech (Ebersberg, Germany) and the PCR reaction is carried out by the standard PCR method of Innis et al . (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) .
  • the primers allow amplification of a DNA section approx. 1.75 kb in length which carries the zwf gene (SEQ ID NO: 38) .
  • the primers moreover contain the sequence for a cleavage site of the restriction endonuclease Xbal, which is marked by underlining in the nucleotide sequence shown above.
  • the amplified DNA fragment of approx. 1.75 kb in length which carries the zwf gene is cleaved with the restriction endonuclease Xbal, identified by electrophoresis in a 0.8% agarose gel and then isolated from the gel and purified by conventional methods (QIAquick Gel Extraction Kit, Qiagen, Hilden) .
  • the mobilizable cloning vector pKl ⁇ mobsacB is digested with the restriction enzyme Xbal and the ends are dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim, Germany) .
  • the vector prepared in this way is mixed with the zwf fragment approx. 1.75 kb in size and the mixture is treated with T4 DNA ligase (Amersham-Pharmacia, Freiburg, Germany) .
  • the E. coli strain DH5 ⁇ (Brown (ed.) Molecular Biology Labfax, BIOS Scientific Publishers, Oxford, UK, 1991) is then transformed with the ligation batch (Hanahan, In. DNA cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plasmid- carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor, New York, 1989) , which was supplemented with 50 mg/1 kanamycin.
  • Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme Xbal and subsequent agarose gel electrophoresis .
  • the plasmid is called pKl8mobsacB_zwf and is shown in figure 7.
  • the site-directed mutagenesis is carried out with the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, USA) .
  • Three point mutations (substitutions) are introduced into the nucleotide sequence of the zwf wild type gene shown in SEQ ID NO: 38. These are substitution of guanine by thymine at position 861, of adenine by cytosine at position 862 and of thymine by adenine at position 863 of the nucleotide sequence.
  • the nucleotide sequence created this way is shown in SEQ ID NO: 39 and encodes a variant Zwf Protein, having a serine instead of aspartate at position 245 of its amino acid sequence.
  • the allele is called zwf(D245S).
  • the following primer oligonucleotides are chosen for the linear amplification:
  • DM_D245Sa (SEQ ID NO: 40):
  • DM_D245Sb (SEQ ID NO: 41) :
  • the primers shown are synthesized by MWG Biotech.
  • the codon for serine which is to replace the aspartate at position 245 of the amino acid sequence derived from the zwf gene, is marked by parentheses in the nucleotide sequence shown above.
  • 17.2 is employed with the two primers, which are each complementary to a strand of the plasmid, for linear amplification by means of Pfu Turbo DNA polymerase.
  • a mutated plasmid with broken circular • strands is formed.
  • the product of the linear amplification is treated with Dpnl - this endonuclease cleaves the methylated and half-methylated template DNA specifically.
  • the newly synthesized broken, mutated vector DNA is transformed in the E. coli strain XLl Blue (Bullock, Fernandez and Short, BioTechniques (5) 376-379 (1987)). After the transformation, the XLl Blue cells repair the nicks in the mutated plasmids .
  • the plasmid obtained is checked by means of restriction cleavage, after isolation of the DNA, and identified by electrophoresis.
  • the DNA sequence of the mutated DNA fragment is checked by sequencing.
  • the sequence of the PCR product corresponds to the nucleotide sequence shown in SEQ ID NO: 39.
  • the resulting plasmid is called pKl8mobsacB_zwf (D245S) .
  • a map of the plasmid is shown in Figure 8.
  • Example 17.3 is transferred as described in Example 14.3 into the C. glutamicum strain DM1697 by conjugation. Selection is made for targeted recombination events in the chromosome of C. glutamicum DM1697 as described in Example 14.3.
  • the zwf allele containing the mutation manifests itself in the chromosome at the zwf locus, or the original zwf locus of the host remains. Approximately 40 to 50 colonies are tested for the phenotype "growth in the presence of sucrose” and "non- growth in the presence of kanamycin” .
  • a region of the zwf gene spanning the zwf (D245S) mutation is sequenced, starting from the sequencing primer zf_2 (SEQ ID NO: 42) (prepared by GATC Biotech AG, Konstanz, Germany) , to demonstrate that the mutation of the zwf (D245S) allele is present in the chromosome.
  • the nucleotide sequence of primer zf_2 is as follows :
  • a clone which contains the bases thymine, cytosine and adenine at positions 733, 734 and 735 respectively of the coding region (CDS) of the zwf gene and thus has the zwf (D245S) allele (SEQ ID NO: 36) in its chromosome was identified in this manner.
  • the positions 733, 734 and 735 of the nucleotide sequence of the coding region of the zwf allele corresponds to positions 861, 862 and 863 in SEQ ID ' No: 39.
  • This clone was called strain DMl697_zwf (D245S) .
  • DSMZ. German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany
  • strain DSM15632 For determination of the activity of the glucose-6- phosphate dehydrogenase enzyme encoded by the zwf (D245S) allele contained in strain DSM15632 the strain is incubated for 24 hours in LB media (Merck KG, Darmstadt, Germany) . Culturing is carried out in a 25 ml volume in a 250 ml conical flask with baffles at 33 a C at 200 rpm on a .shaking machine. For comparison the parental strain DM1697 having a wild-type zwf gene is incubated in parallel. The preparation of the biomass is done as described in Example 15.1.
  • Measurement of the glucose-6-phosphate dehydrogenase activity in presence of its reaction end product NADPH is done in an assay system containing lOOmM Tris-HCl (pH 7,8), 10 mM MgCl 2 , 260 uM NADP + , 7 mM glucose-6-phosphate and 400 ⁇ M NADPH.
  • the enzyme activity in the presence of NADPH is calculated in the same way as described before.
  • the cells of C. glutamicum strain DSM15632 obtained in Example 17.4 grown on an agar plate (brain heart agar) for 24 hours at 33 °C were inoculated into 50ml of LSSl medium (Ohnishi et al . , Applied Microbiology and Biotechnology 58:217-223 (2002)) with 5% glucose instead of 5% sucrose in a 500ml conical flask with baffels .
  • the cultivation at 33°C on a rotary shaker was stopped in the early stationary phase after the total depletion of the initially added sugar. 4 ml of the seed broth were used to inoculate a 2 L fermentor (Biostat B reactor, B. Braun, Melsieux, Germany) containing 1000 ml of medium LPGl (Ohnishi et al . , Applied Microbiology and Biotechnology 58:217-223 (2002)).
  • a solution containing 50% (w/v) glucose and 3,5% (w/v) (NH 4 ) 2 S0 4 was continuously fed until the total culture volume in the fermentor reached 2000ml.
  • the culture was performed with a p0 2 >20%, aeration at >0,5 1/min, and at 33°C.
  • the pH was maintained at 7,0.
  • the amount of lysine formed was determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
  • the C. glutamicum strain DM1698 was constructed on the basis of C. glutamicum DM1697, mentioned in example 17.1.
  • the integration of the mutation zwf (A243T) into the zwf-gene improves the production of L- lysine.
  • the experiments of example 19 and example 20 are designed to demonstrate that the 90 basepairs of the 5 'terminus of the coding sequence of the zwf gene of Corynebacterium glutamicum (see for example the zwf wild type gene in SEQ ID NO: 9 or the zwf (A243T) -allele shown in SEQ ID NO: 21) which are not included in the coding sequence of the zwf gene described in JP-A-092244661 (see SEO ID NO: 7), are required for enzymatic activity of the glucose-6-phosphate dehydrogenase .
  • the 90 basepairs are deleted from the zwf wild type gene of C. glutamicum strain DM1697 (see example 17.1) in order to compare the enzymatic activity of the glucose-6-phosphate dehydrogenase encoded by the wild type allele before and after deletion of the 90 basepairs. 19.1 Cloning of a zwf deletion fragment into the vector . pCRBluntll TOPO
  • Chromosomal DNA is isolated from the strain ATCC13032 by the method of Tauch et al. (1995, Plasmid 33:168-179).
  • the oligonucleotides described below are chosen for generation of the zwf deletion fragment by means of the polymerase chain reaction (PCR) by the gene SOEing method (Gene Splicing by Overlap Extension, Horton, Molecular Biotechnology 3: 93-98 (1995)).
  • the primers shown are synthesized by MWG Biotech (Ebersberg, Germany) and the PCR reaction is carried out by the standard PCR method of Innis et al . (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) with the Vent DNA polymerase from NewEnglandBiolabs (Germany, Product Description Vent DNA Polymerase) .
  • the primers zwfA and zwfD contain in each case an inserted cleavage site for the restriction enzyme Xbal, which is marked by underlining in the nucleotide sequence shown above.
  • the first 20 bases of Primer zwfC contain the reverse complementary sequence of the Primer zwfB. With the aid of the polymerase chain reaction the primers zwfA and zwfB enable the amplification of a 710 bp DNA fragment and the Primers zwfC and zwfD enable the amplification of a 850 bp DNA fragment.
  • the a plificates are examined by subsequent agarose-gel electrophoresis in an 0,8% agarose-gel, isolated from the agarose-gel with the High Pure PCR Product P ⁇ rification Kit (Roche Diagnostics GmbH, Mannheim, Germany) , and used together as a DNA template in another PCR reaction using the primers zwfA and zwfD. This results in the production of a zwf deletion fragment, 1560 bp in size (see also SEQ ID NO: 47) .
  • the amplified product is subsequently examined in a 0,8% agarose-gel .
  • the PCR product obtained is cloned in the vector pCRBluntll TOPO (Zero Blunt TOPO PCR Cloning Kit, Invitrogen,
  • Plasmid DNA is isolated from a transformant with the aid of the High Pure Plasmid Isolation Kit (Roche Diagnostics GmbH, Mannheim, Germany) and checked by restriction with the restriction enzyme Xbal and subsequent agarose gel electrophoresis (0.8%).
  • the plasmid is called pCRBluntII_ABlCDl and is shown in figure 9. 19.2. Construction of the replacement vector pK18mobsacB_zwfdelta90bp
  • the zwf deletion fragment is isolated by complete cleavage of the vector pCRBluntII_ABlCDl, obtained in Example 19.1, with the restriction enzyme Xbal. After separation in an agarose gel (0.8%), the zwf deletion fragment of approx. 1600 bp in size is isolated from the agarose gel with the aid of the High Pure PCR Product purification Kit (Roche Diagnostics GmbH, Mannheim, Germany) .
  • the zwf deletion fragment treated in this way is employed for ligation with the mobilizable cloning vector pKl ⁇ mobsacB (Schafer et al., Gene 14: 69-73 (1994)). This was cleaved open beforehand with the restriction enzyme Xbal and then dephosphorylated with shrimp alkaline phosphatase (Roche Diagnostics GmbH, Mannheim, Germany) . The vector DNA is mixed with the zwf deletion fragment and the mixture is treated with T4 DNA ligase (Amersham- Pharmacia, Freiburg, Germany) .
  • E. coli strain S17-1 (Simon et al . ,Bio/Technologie 1: 784-791, 1993) is transformed with the ligation batch. Selection of plasmid-carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor, New York, 1989), which has been supplemented with 50 mg/1 kanamycin.
  • Plasmid DNA is isolated from a transformant with the aid of the High Pure Plasmid Isolation Kit (Roche Diagnostics GmbH, Mannheim, Germany) and checked by restriction with the restriction enzyme Xbal and subsequent agarose gel electrophoresis (0.8%). Additionally the cloned zwf deletion fragment is verified by means of sequencing by GATC Biotech AG (Konstanz, Germany) . The plasmid is called pKl8mobsacB_zwfdelta90bp and is shown in figure 10. 19.3 Introduction of the 90 basepairs deletion into the zwf wild type gene of strain DM1697
  • the strain DM1697 is described in example 17.1, it carries a zwf wild type gene.
  • the plasmid pKl8mobsacB_zwfdelta90bp described in Example 19.2 is transferred as described in Example 14.3 into the C. glutamicum strain DM1697 by conjugation (Schafer et al . , Applied and Environmental Microbiology 60, 756-759 (1994)).' Selection is made for targeted recombination events in the chromosome of C. glutamicum DM1697 as described in Example 14.3. Depending on the position of the second recombination event, after the excision of the plasmid either the zwf allele carrying the 90 bp deletion manifests itself in the chromosome at the zwf locus, or the original zwf locus of the host remains .
  • Approximately 40 to 50 colonies are tested for the phenotype "growth in the presence of sucrose” and "non- growth in the presence of kanamycin".
  • a region of the zwf gene spanning the zwf deletion is amplified by polymerase chain reaction with Taq DNA Polymease (Qiagen, Hilden, Germany) using the standard PCR method described by Innis et al . (PCR protocols. A guide to methods and applications, 1990, Academic Press), to demonstrate that the 90 bp deletion within the zwf allele is present in the chromosome.
  • PCR reaction was performed using the oligonucleotides described below (synthetised by MWG Biotech, Ebersberg) :
  • a C. glutamicum strain containing the zwf deletion allele is thus identified, isolated and called DMl697deltazwf90bp.
  • strain DM1697deltazwf90bp For determination of the activity of the glucose-6- phosphate dehydrogenase enzyme encoded by the zwf deletion allele contained in strain DM1697deltazwf90bp the strain is , incubated for 24 hours in LB media (Merck KG, Darmstadt, Germany) . Culturing is carried out in a 25 ml volume in a 250 ml conical flask with baffles at 33 a C at 200 rpm on a shaking machine. For comparison the parental strain DM1697 is incubated in parallel . The preparation of the biomass is done as described in Example 15.1.
  • Example 19.2 The plasmid pKl8mobsacB_zwfdelta90bp described in Example 19.2 is transferred as described in Example 14.3 into the C. glutamicum strain DM1698 (see example 18) by conjugation (Schafer et . al., Applied and Environmental Microbiology 60,' 756-759 (1994)). Selection is made for targeted recombination events in the chromosome of C. glutamicum DM1698 as described in Example 14.3.
  • the amplified product is subsequently examined in a 0,8% agarose-gel.
  • a C. glutamicum strain containing the zwf deletion allel is isolated and called DMl698deltazwf90bp(A243T) .
  • the plasmid pKl8mobsacB_zwfdelta90bp from example 19.2 was used to integrate the 90 basepairs deletion into the zwf (A243T) allele of strain DM1698.
  • the nucleotide sequence of the zwf deletion fragment contained in the plasmid carries from positions 711 to 1554 of its nucleotide sequence (SEQ ID NO: 47) the nucleotides 91 to 934 of the coding sequence of the wild type gene (SEQ ID NO: 9) . They code for the amino acids 31 to 311 of the zwf wild type protein (SEQ ID NO:10), which includes the wild type sequence at position 243 of the amino acid sequence.
  • DMl698deltazwf90bp(A243T) the mutation is detected with the aid of the LightCycler (Roche Diagnostics GmbH, Mannheim, Germany) .
  • the LightCycler combines a thermocycler with fluorescence detection.
  • Chromosomal DNA is isolated from the strain
  • DMl698deltazwf90bp(A243T) by the method of Tauch et al . (1995, Plasmid 33: 168-179).
  • a DNA fragment of approximately 0,3 kb of the chromosome of DMl698deltazwf90bp(A243T) which contains the zwf(A243T) mutation, is amplified with the aid of the PCR reaction (Innis et al . , PCR protocols. A guide to methods and applications, 1990, Academic Press) .
  • the PCR reaction was performed with the oligonucleotides described below (synthetised by MWG Biotech, Ebersberg) :
  • oligonucleotides of different sizes labelled with different fluorescent markers (LightCycler (LC) -Red640 and Fluorescein) are used.
  • fluorescent markers LightCycler (LC) -Red640 and Fluorescein
  • Hybridisation occurs within the sequence, where the mutation zwf (A243T) is localized.
  • FRED Fluorescence Resonance Energy Transfer
  • DMl698deltazwf90bp(A243T) still contains the mutation zwf(A243T). It harbors the zwf-allele zwfdelta90bp (A243T) which is shown in SEQ ID NO: 54; the corresponding amino acid sequence of the encoded glucose-6-phosphate dehydrogenase is shown in SEQ ID NO: 55.
  • strain DMl698deltazwf90bp(A243T) For determination of the activity of the glucose-6- phosphate dehydrogenase enzyme encoded by the zwfdelta90bp (A243T) allele contained in strain DMl698deltazwf90bp(A243T) the strain is incubated for 24 hours in LB media (Merck KG, Darmstadt, Germany) . Culturing is carried out in a 25 ml volume in a 250 ml conical flask with baffles at 33 a C at 200 rpm on a shaking machine. For comparison the parental strain DM1698 having a zwf (A243T)- allele is incubated in parallel . The preparation of the biomass is done as described in Example 15.1.
  • Measurement of the glucose-6-phosphate dehydrogenase activity is done in an assay system containing 100 mM Tris-, HCI (pH 7,5) + 1 mM DTT, 15 mM MgCl 2 , 1 , 5 mM NADP + and 10 mM glucose- 6-phosphate.
  • the enzyme activity is calculated in the same way as described before.
  • two plasmids for the expression of two different zwf alleles are constructed and tested for the restoration of the enzymatic activity of the inactive glucose-6-phosphate dehydrogenase of strain DMl698zwfdelta90bp(A243T) , obtained in example 20.1.
  • the tested zwf alleles are zwfL and zwfS, wherein the "L” is the abbreviation for "long” and the "S" is the abbreviation ' for "short” .
  • the allele zwfL harbors the mutation zwf (A243T) and includes the 90 basepairs of the 5 '-region of the coding sequence of the zwf gene (as shown for the wild type gene in SEQ ID NO: 9 and for the zwf (A243T)- allele in SEQ ID NO: 21) .
  • the allele zwfS is also harboring the mutation zwf(A243T), but the 90 basepairs of the 5'- region of the coding sequence of the zwf gene are deleted (as shown for the wild type gene in SEQ ID NO: 7) . 21.1. Amplification of the alleles zwfS and zwfL
  • the zwf alleles zwfS and zwfL are amplified using the polymerase chain reaction (PCR) and the synthetic oligonucleotides which are described below.
  • Chromosomal DNA is isolated from the strain DM658, which is harboring the allele zwf(A243T), by the method of Tauch et al . (1995, Plasmid 33:168-179).
  • primers are chosen so that the amplified fragments contain the coding regions of the zwf allels and 25 basepairs of the upstream-region thereof, but not possible promoter regions.
  • suitable sites for restriction enzymes which allow cloning into the target vector are inserted.
  • the sequences of the PCR primers and the inserted cleavage site for the restriction enzyme Sail are described below.
  • the primers shown are synthesized by MWG Biotech (Ebersberg, Germany) and the PCR reaction is carried out by the standard PCR method of Innis et al. (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) with the Vent DNA polymerase from NewEnglandBiolabs (Germany, Product Description Vent DNA Polymerase) .
  • the primers zwfRBSl and zwfRBSE enable the amplification of a 1732 bp DNA fragment (see also SEQ ID NO: 59) called zwfL which includes the coding sequence for the expression of a Zwf protein consisting of 514 amino acids (SEQ ID NO: 60) .
  • the primers zwfRBS2 and zwfRBSE enable the amplification of a 1642 bp DNA fragment (see also SEQ ID NO: 61) called zwfS which includes the coding sequence for the expression of a Zwf protein consisting of 484 amino. acids (SEQ ID NO: 62) .
  • the amplificates are examined by subsequent agarose-gel electrophoresis in an 0,8% agarose-gel, isolated from the agarose-gel with the High Pure PCR Product Purification Kit (Roche Diagnostics GmbH, Mannheim, Germany) .
  • PCR products obtained are cloned in the vector pCRBluntll TOPO (Zero Blunt TOPO PCR Cloning Kit, Invitrogen, Germany) and then the E. coli strain TOP10 (Grant et al., Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is transformed with the ligation batch in accordance with the manufacturer's instructions. Selection of plasmid-carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2 nd Ed., Cold Spring Harbor, New York, 1989), which has been supplemented with 50 mg/1 kanamycin.
  • Plasmid DNA is isolated from a transformant with the aid of the High Pure Plasmid Isolation Kit (Roche Diagnostics GmbH,, Mannheim, Germany) and checked by restriction with the restriction enzyme Sail and subsequent agarose gel electrophoresis (0.8%).
  • the obtained plasmids are called pCRBluntII_zwfL (shown in figure 11) and pCRBluntII_zwfS (shown in figure 12) .
  • the E. coli - C. glutamicum shuttle expression vector pZ8-l (EP 0 375 889) was employed as the base vector for expression in C. glutamicum as well as in E. coli.
  • DNA of this plasmid was cleaved completely with the restriction enzyme Sail (Invitrogen, Germany) and then dephosphorylated' with shrimp alkaline phosphatase (Roche Diagnostics GmbH, Mannheim, Germany) .
  • the zwfL allele is isolated by complete cleavage of the vector pCRBluntII_zwfL, obtained in Example 21.1, with the restriction enzyme Sail.
  • the zwfS allele is isolated by complete cleavage of the vector pCRBluntII_zwfS, obtained in Example 21.2, with the restriction enzyme Sail. After separation in an agarose gel (0.8%), the zwfL fragment of approx. 1.7 kb in size and the zwfS fragment of approx. 1.6 kb in size are isolated from the agarose gel with the aid of the High Pure PCR Product purification Kit (Roche Diagnostics GmbH, Mannheim, Germany) .
  • the zwfL fragment and the zwfS fragment isolated from the agarose gel are mixed with the vector pZ8-l prepared as mentioned above and the batches are treated with T4 DNA ligase (Amersham Pharmacia, Freiburg, Germany) .
  • the ligation batches are transformed in the E. coli strain ' DH5 (Hanahan, In: DNA cloning. A Practical Approach. Vol. I. IRL-Press, Oxford, Washington DC, USA) .
  • Selection of plasmid-carrying cells is made by plating out the transformation batches on LB agar (Lennox, 1955, Virology, 1:190) with 50 mg/1 kanamycin. After incubation overnight at 37 a C, recombinant individual clones are selected.
  • Plasmid DNA is isolated from a transformant with the aid of the High Pure Plasmid Isolation Kit (Roche Diagnostics GmbH, Mannheim, Germany) in accordance with the manufacturer's instructions and checked by restriction with the restriction enzyme Sail and subsequent agarose gel electrophoresis (0.8%). Additionally the cloned zwf alleles are verified by means of sequencing by GATC Biotech AG (Konstanz, Germany) with the following primers:
  • pZ8-l_zwfL shown in figure 13
  • pZ8-l_zwfS shown in figure 14
  • the vector pZ8-l without inserted fragment is electroporated by the electroporation method of Tauch et al. (1994, FEMS Microbiological Letters, 123:343-347) in Corynebacterium glutamicum DM 1698.
  • the vectors pZ8-l_zwfL and pZ8-l_zwfS mentioned in example 21.2. and the vector pZ8-l without inserted fragment are electroporated by the electroporation method of Tauch et al. (FEMS Microbiological Letters, 123 (1994) :343-347) in Corynebacterium glutamicum DMl698zwfdelta90bp (A243T) as described in Example 20.
  • Plasmid DNA is isolated in each case from a transformant by conventional methods (Peters-Wendisch et al . , 1998,
  • strains are called DM1698/pZ8-l, DMl698zwfdelta90bp(A243T)/pZ8-l,
  • strains DMl698deltazwf90bp(A243T) /pZ8-l_zwfL and DM1698deltazwf90bp(A243T) /pZ8-l_zwfS the strains are incubated for 24 hours in LB media (Merck KG, Darmstadt, Germany) with 25 mg/1 kanamycin. Culturing is carried out in a 25 ml volume in a 250 ml conical flask with baffles at 33 a C at 200 rpm on a shaking machine.
  • glucose-6-phosphate dehydrogenase activity is done in an assay system containing 100 mM Tris- HCl (pH 7,5) + 1 mM DTT, 15 mM MgCl 2 , 1,5 mM NADP + and 10 mM glucose-6-phosphate.
  • the enzyme activity is calculated in the same way as described before.
  • the microorganism identified under I. above was accompanied by:
  • This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on 20 0 0 - 01 - 20 (Date of the original deposit)'.
  • microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of rece i pt of request for conversion).
  • the microorganism identified under I. above was accompanied by:
  • microorganism identified under I above was received by this International Depositary Authority on 1993-01 -27 (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on 2002- 10-17 (date of receipt of request for conversion).
  • the microorganism identified under L above was accompanied by:
  • This International Depositary Authority accepts the microorganism identified under L above, which was received by it on 2002- 10- 1 1 (Date of the original deposit)'.
  • microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).
  • the microorganism identified under I. above was accompanied by:
  • microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to a process for the preparation of L-amino acids by fermentation of coryneform bacteria, which comprises carrying out the following steps: a) fermenting the L-amino acid-producing bacteria in which at least the zwf gene is amplified, b) concentrating the L-amino acid in the medium or in the cells of the bacteria and c) isolating the L-amino acid produced.

Description

Process for the Preparation of Iι-Amino Acids wit Amplification of the zwf Gene
Field of the Invention
T e invention relates to a process for the preparation of L-amino acids, in particular L-lysine, L-threonine and L- tryptophane, using coryneform bacteria in which at least the Zwischenferment protein encoded by the zwf gene is amplified.
Prior Art
L-amino acids are used in animal nutrition, in human medicine and in the pharmaceuticals industry.
It is known that amino acids are prepared by fermentation of strains of coryneform bacteria, in particular Corynebacterium glutamicum. Because of its great importance, work is constantly being undertaken to improve the preparation process . Improvements to the process can relate to fermentation measures, such as e.g. stirring and supply of oxygen, or the composition of the nutrient media, such as e.g. the sugar concentration during the fermentation, or the working up to the product form by e.g. ion exchange chromatography, or the intrinsic output properties of the microorganism itself.
Methods of mutagenesis, selection and mutant selection are used to improve the output properties of these microorganisms. Strains which are resistant to entimetabolites, such as e.g. the threonine analogue - amino-β-hydroxyvaleric acid (AHV) , the lysine analogue S- (2-aminoethyl) -L-cystein (AEC) , or are auxotrophic for metabolites of regulatory importance and produce L-amino acids such as e.g. threonine or lysine are obtained in this manner . Methods of the recombinant DNA technique have also been employed for some years for improving the strain of Corynebacterium glutamicum strains which produce L-amino acids .
Object of the Invention
The object of the present invention is providing new improved processes for the fermentative preparation of L- a ino acids with coryneform bacteria.
Summary of the Invention
L-Amino acids are used in human medicine and in the pharmaceuticals industry, in the foodstuffs industry and especially in animal nutrition. There is therefore a general interest in providing new improved processes for the preparation of amino acids .
The invention provides a process for the preparation of L- amino acids, in particular L-lysine, L-threonine, L- isoleucine and L-tryptophane, using coryneform bacteria in which the Zwischenferment protein (Zwf protein) encoded by the nucleotide sequence of the zwf gene is amplified, in particular over-expressed.
The abbreviation "zwf" is a mnemonic for "Zwischenferment" (Jeffrey H. Miller: A Short Course In Bacterial Genetics, Cold Spring Harbor Laboratory Press, USA, 1992.) and also referred to as glucose 6-phosphate dehydrogenase.
The enzyme glucose 6-phosphate dehydrogenase catalyzes the oxidation of glucose-6-phosphate to 6-phosphogluconolactone by concomitant reduction of NADP to NADPH. Its activity is inhibited by NADPH and various other metabolites (Sugi oto and Shiio, Agricultural and Biological Chemistry 51(1), pp. 101 - 108 (1987) ) . Detailed Description of the Invention
The strains employed preferably already produce L-amino acids before amplification of the zwf gene.
Preferred embodiments are to be found in the claims .
The term "amplification" in this connection describes the increase in the intracellular activity of one or more enzymes or proteins in a microorganism which are coded by the corresponding DNA, for example by increasing the number of copies of the gene or genes, using a potent promoter or using a gene or allele which codes for a corresponding enzyme or protein having a high activity, and optionally combining these measures .
By amplification measures, in particular over-expression, the activity or concentration of the corresponding enzyme or protein is in general increased by at least 10%, 25%, 50%, .75%, 100%, 150%, 200%, 300%, 400% or 500%, up to a maximum of 1000% or 2000%, based on that of the wild-type enzyme or protein or the activity or concentration of the enzyme or protein in the starting microorganism.
The microorganisms which the present invention provides can prepare L-amino acids from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol . They are representatives of coryneform bacteria, in particular of the genus Corynebacterium. Of the genus Corynebacterium, there may be mentioned in particular the species Corynebacterium glutamicum, which is known among specialists for its ability to produce L-amino acids .
Suitable strains of the genus Corynebacterium, in particular of the species Corynebacterium glutamicum, are, for example, the known wild-type strains Corynebacterium glutamicum ATCC13032 Corynebacterium acetoglutamicum ATCC15806 Corynebacterium acetoacidophilum ATCC13870 Corynebacterium thermoaminogenes FERM BP-1539 Brevibacterium flavu ATCC14067 Brevibacterium lactofermentum ATCC13869 Brevibacterium divaricatum ATCC14020,
and L-amino acid-producing mutants prepared therefrom, such as, for example, the L-threonine-producing strains Corynebacterium glutamicum ATCC21649 Brevibacterium flavum BB69 Brevibacterium flavum DSM5399 Brevibacterium lactofermentum FERM-BP 269 Brevibacterium lactofermentum TBB-10,
and such as, for example,- the L-isoleucine-producing strains
Corynebacterium glutamicum ATCC 14309 Corynebacterium glutamicum ATCC 14310 Corynebacterium glutamicum ATCC 14311 Corynebacterium glutamicum ATCC 15168 Corynebacterium ammoniagenes ATCC 6871,
and such as, for example, the L-tryptophane-producing strains
Corynebacterium glutamicum ATCC21850 and Corynebacterium glutamicum KY9218 (pKW9901) ,
and- such as, for example, the L-lysine-producing strains
Corynebacterium glutamicum FERM-P 1709 Brevibacterium flavum FERM-p 1708 Brevibacterium lactofermentum FERM-P 1712 Corynebacterium glutamicum FERM-P 6463 Corynebacterium glutamicum FERM-P '6464 Corynebacterium glutamicum ATCC13032 Corynebacterium glutamicum DM58-1 Corynebacterium glutamicum DSM12866.
It has been found, that coryneform bacteria produce L-amino acids, in particular L-lysine, L-threonine and L- tryptophane, in an improved manner after over-expression of the zwf gene which codes for the Zwf protein or Zwf polypeptide, respectively.
JP-A-09224661 discloses the nucleotide sequence of the zwf ' gene of Brevibacterium flavum MJ-223 (FERM BP-1497) and refers to the protein encoded by the zwf-gene as glucose 6- phosphate dehydrogenase. The sequence information disclosed in JP-A-09224661 is shown in SEQ ID NO 7 and 8. JP-A- 09224661 describes the N-terminal amino acid sequence of the Zwf polypeptide as Met Val lie Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu (SEQ ID NO 8) .
However, it has not been possible to confirm this. Instead, the following N-terminal amino acid sequence has been found: Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu-Arg Asp (SEQ ID NO 10) . The nucleotide sequence of the corresponding zwf gene including the coding sequence is shown in SEQ ID NO 9. The methionine residue in the N- position can be split off in the context of post- translational modification, and Ser Thr Asn. Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp is then obtained as the N- terminal amino acid sequence.
Accordingly, this invention provides the nucleotide sequence of a novel zwf gene from a coryneform bacterium shown in SEQ ID NO 9 nucleotides 538 to 2079.
Genes encoding Zwf proteins from Gram-negative bacteria e.g. Escherichia coli or other Gram-positive bacteria e.g. Streptomyces or Bacillus may optionally be used. Alleles of the zwf gene which result from the degeneracy of the genetic code or due to sense mutations of neutral function can furthermore be used.
The use of endogenous genes, in particular endogenous genes from coryneform bacteria, is preferred. λEndogenous genes" or "endogenous nucleotide sequences" refer to genes or nucleotide sequences which are available in the population of a species .
To achieve an amplification (e.g. over-expression) , the number of copies of the corresponding genes is increased, or the promoter and regulation region or the ribosome binding site upstream of the structural gene is mutated. Expression cassettes which are incorporated upstream of the structural gene act in the same way. By inducible promoters, it is additionally possible to increase the expression in the course of fermentative L-amino acid formation. The expression is likewise improved by measures to prolong the life of the -RNA. Furthermore, the enzyme activity is also increased by preventing the degradation of the enzyme protein. The genes or gene constructs are either present here in plasmids with a varying number of copies, or are integrated and amplified in the chromosome. Alternatively, an over-expression of the genes in question • can furthermore be achieved by changing the composition of the media and the culture procedure.
Instructions in this context can be found by the expert, inter alia, in Martin et al. (Bio/Technology 5, 137-146 (1987)), in Guerrero et al . (Gene 138, 35-41 (1994)), Tsuchiya and Morinaga (Bio/Technology 6, 428-430 (1988)), in Eikmanns et al . (Gene 102, 93-98 (1991)), in European
Patent Specification EPS 0 472 869, in US Patent 4,601,893, in Schwarzer and Puehler (Bio/Technology 9, 84-87 (1991), in Reinscheid et al. (Applied and Environmental Microbiology 60, 126-132 (1994)), in LaBarre et al . (Journal of Bacteriology 175, 1001-1007 (1993)), in Patent Application WO 96/15246, in Malumbres et al . (Gene 134, 15- 24 (1993)), in Japanese Laid-Open Specification JP-A-10- 229891, in Jensen and Hammer (Biotechnology and Bioengineering 58, 191-195 (1998)) and in known textbooks of genetics and molecular biology.
By way of example, the Zwf protein was over-expressed with the aid of a plasmid. The E. coli - C. glutamicum shuttle vector pEC-Tl8mob2 shown in Figure 1 was used for this. After incorporation of the zwf gene into the Kpnl/Sall cleavage site of pEC-Tl8mob2, the plasmid pEC-Tl8mob2zwf shown in Figure 2 was formed.
Other plasmid vectors which are capable of replication in C. glutamicum, such as e.g. pEKExl (Eikmanns et al . , Gene 102:93-98 (1991)) or pZ8-l (EP-B- 0 375 889), can be used in the same way.
In a further aspect of the invention, it has been found that amino acid exchanges in the section between position 369 and 373 and/or position 241 and 246 of the amino acid sequence of the zwf gene product, shown in SEQ ID NO: 10, amplify its glucose 6-phosphate dehydrogenase activity, in particular its resistance against inhibition by NADPH (nicotinamide adenine dinucleotide phosphate, reduced form) ' and improve the production of amino acids, especially lysine, by coryneform bacteria comprising the corresponding zwf genes or zwf alleles respectively or the Zwf proteins encoded by them. The methionine residue in the N-terminal position can be removed during post translational modification by a methionine aminopeptidase of the host.
Accordingly, the invention provides Zwf proteins comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is (are) exchanged by another proteinogenic amino acid. Accordingly, the invention further provides isolated polynucleotides encoding a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is (are) exchanged by another proteinogenic amino acid.
In particular, the exchanges within the amino acid sequence of the Zwf protein comprise at least one or. more of the amino acid exchanges selected from the group consisting of exchange of L-arginine at position 370 of SEQ ID NO: 10 against any other proteinogenic amino acid, e.g. L- methionine, exchange of L-valine at position 372 of SEQ ID NO: 10 against any other proteinogenic amino acid e.g. L- alanine, exchange of L-methionine at position 242 of SEQ ID NO: 10 against any other proteinogenic amino acid e.g. L- ' leucine or L-serine, exchange of L-alanine at position 243 of SEQ ID NO: 10 against any other proteinogenic amino acid e.g. L-threonine, exchange of L-glutamic acid at position 244 of SEQ ID NO: 10 against any other proteinogenic amino acid and exchange of L-aspartic acid at position 245 of SEQ ID NO: 10 against any other proteinogenic amino acid e.g. L- serine.
Very particularly, L-alanine in position 243 (see SEQ ID NO: 10) is exchanged for L-threonine as shown in SEQ ID NO: 22. This protein is also referred to as Zwf(A243T) protein and the allele encoding said protein is referred to as zwf(A243T). See also SEQ ID NO:21.
Furthermore, L-arginine in position 370 (see SEQ ID NO: 10) can be exchanged for L-methionine as shown in SEQ ID NO: 29. This protein is also referred to as Zwf (R370M) protein and the allele encoding said protein is referred to as zwf(R370M). See also SEQ ID NO:28.
Furthermore, L-valine in position 372 (see SEQ ID NO: 10) can be exchanged for L-alanine as shown in SEQ ID NO: 31. This protein is also referred to as Zwf (V372A) protein and the allele encoding said protein is referred to as zwf(V372A). See also SEQ ID NO:30.
Furthermore, L-methionine in position 242 (see SEQ ID NO: 10) can be exchanged for L-leucine as shown in SEQ ID NO: 33. This protein is also referred to as Zwf(M242L) protein and the allele encoding said protein is referred to' as zwf(M242L). See also SEQ ID NO: 32.
Furthermore, L-methionine in position 242 (see SEQ ID NO: 10) can be exchanged for L-serine as shown in SEQ ID NO: 35. This protein is also referred to as Zwf (M242S) protein and the allele encoding said protein is referred to as zwf(M242S). See also SEQ ID NO: 34.
Furthermore, L-aspartic acid in position 245 (see SEQ ID NO: 10) can be exchanged for L-serine as shown in SEQ ID NO: 37. This protein is also referred to as Zwf(D245S) protein and the allele encoding said protein is referred to as zwf(D245S). See also SEQ ID NO:36.
The Zwf proteins according to the invention may contain further substitutions, deletions or insertions of one or more amino acids which do not substantially change the enzymatic properties of the Zwf protein variants described.
Substitutions of amino acids with neutral or almost neutral effect on protein function are known in the art as • conservative amino acid exchanges. In the case of aromatic amino acids phenylalanine, tryptophane and tyrosine may be exchanged against each other. In the case of hydrophobic amino acids leucine, isoleucine and valine may be exchanged against each other. In the case of polar amino acids glutamine and asparagine may be exchanged against each other. In the case of basic amino acids arginine, lysine and histidine may be exchanged against each other. In the case of acidic amino acids aspartic acid and glutamic acid may be exchanged against each other. In the case of hydroxyl group containing amino acids serine and threonine may be exchanged against each other.
For example,- a change of enzymatic activity in the presence of the inhibitor NADPH of less than approximately 2.5 to 3.5% or 2.5 to 4.5% can be regarded as not substantially different. In the case of other parameters like e.g. the Michaelis constant (KM) or maximal rate (Vmax) or other binding constants differences like less than approximately 5, 10, 25, 50, 100, 150 or 200% or even larger differences like 300 or 400% might be regarded as not substantially different.
Accordingly, the Zwf (A243T) protein comprises at least an amino acid sequence selected from the group consisting of Thr Met Thr Glu Asp lie corresponding to the amino acids at positions 241 to 246 of SEQ ID NO: 22, preferably the amino acid sequence corresponding to the amino acids at positions 235 to 250 of SEQ ID NO: 22, more prefereably the amino acid sequence corresponding to the amino acids at positions 225 to 260 of SEQ ID NO: 22 and even preferably the amino acid sequence corresponding to the amino acids at positions 210 to 270 of SEQ ID NO:22.
Similarly, the Zwf protein variants Zwf(M242L), Zwf(M242S) and Zwf (D245) comprise at least an amino acid sequence selected from the group consisting of the amino acid sequence of the amino acids at positions 237 to 250 of SEQ ID Nos. 33, 35 and 37, preferably the amino acid sequence of the amino acids at positions 227 to 260 of SEQ ID Nos. 33, 35 and 37, more preferably the amino acid sequence of the amino acids at positions 217 to 270 of SEQ ID Nos. 33, 35 and 37, and even more preferably the amino acid sequence of the amino acids at positions 202 to 285 of SEQ ID Nos. 33, 35 and 37. Similarly, the Zwf protein variants Zwf (R370M) and Zwf (V372A) comprise at least an amino acid sequence selected from the group consisting of the ami o acid sequence of the amino acids at positions 365 to 377 of SEQ I'D Nos. 29 and 31, the amino acid sequence of the amino acids at positions 355 to 387 of SEQ ID Nos. 29 and 31, the, amino acid sequence of the amino acids at positions 345 to 397 of SEQ ID Nos . 29 and 31, and the amino acid sequence of the amino acids at positions 325 to 417 of SEQ ID Nos. 29 and 31.
Furthermore, the Zwf protein variants may comprise a N- terminal amino acid sequence selected from the group consisting of the amino acid sequence corresponding to the ' amino.acids at positions 1 to 10 of SEQ ID NO:10, the amino acid sequence corresponding to the amino acids at positions 1 to 16 of SEQ ID NO: 10, the amino acid sequence corresponding to the amino acids at positions 1 to 20 of SEQ ID NO: 10 and the amino acid sequence corresponding to the amino acids at positions 1 to 30 of SEQ ID NO: 10.
Furthermore it has been found by deletion and expression analysis that deletion of a nucleotide sequence corresponding to the 30 N terminal amino acids of the glucose-6-phosphate dehydrogenase protein or proteins respectively results in loss of enzymatic acivity. These 30 N terminal amino acids correspond to position 1 to 30 of e. g. SEQ ID NO:10 or SEQ ID NO'S:22, 29, 31, 33, 35 or 37.
The term proteinogenic amino acid denotes those amino acids which are found in naturally occurring proteins of microorganisms, plants, animals and humans. These amino acids comprise L-glycine, L-alanine, L-valine, L-leucine,
L-isoleucine, L-serine, L-threonine, L-cysteine, L- methionine, L-proline, L-phenylalanine, L-tyrosine, L- tryptophane, L-asparagine, L-glutamine, L-aspartic acid, L- glutamic acid, L-arginine, L-lysine, L-histidine and L- selenocysteine. The replacement of L-alanine in position 243 with L- threonine may preferably be achieved by replacing the nucleobase guanine in position 1264 of SEQ ID NO: 9 with adenine. This guanine adenine transition is also shown in position 1034 of SEQ ID NO:21. Positions 1264 of SEQ ID NO: 9 and 1034 of SEQ ID NO: 21 both correspond to position 727 of the coding sequences (the first G of the start codon GTG is position 1 in this case) of the zwf gene and zwf(A243T) allele.
An internal segment of the zwf (A243T) allele is shown in SEQ ID NO:23. It corresponds to positions 898. to 1653 of SEQ ID NO: 21.
The glucose 6-phosphate dehydrogenase activity of the Zwf proteins according to this aspect of the invention is less susceptible or resistant particularly to inhibition by
NADPH as compared to the wild type protein. Being exposed to a concentration of approximately 260 μM (μ denotes micro) NADPH the residual activity is at least 30% or 35% preferably at least 40%, 45% or 50% as compared to the activity in the absence of added NADPH in a strain comprising the mutant protein. Being exposed to a concentration of approximately 400 μM NADPH the residual activity is at least 20% preferably at least 25% as compared to the activity in the absence of added NADPH.
Mutagenesis to induce said mutations or alleles may be performed by conventional mutagenesis methods for bacterial cells using utagens such as for example N-methyl- 1 -nitro- N-nitrosoguanidine or ultraviolet light as described in the art for example in the Manual of Methods for General ' Bacteriology (Gerhard et al . (Eds.), American Society for Microbiology, Washington, DC, USA, 1981) . Appropriate mutants are then isolated and identified by e. g. sequencing methods or by measuring the glucose 6-phosphate ■ dehydrogenase activity. Accordingly, the invention provides isolated coryneform bacteria or mutants comprising a polynucleotide encoding a Zwf protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is exchanged by another proteinogenic amino acid.
Corynebacterium glutamicum DM658 is an example for such a coryneform bacterium. It was obtained after multiple rounds of mutagenesis, selection and screening and contains in its chromosome a zwf allele (zwf(A243T)) coding for a Zwf protein (Zwf(A243T)) having the amino acid sequence of SEQ ID NO: 10 wherein L-alanine at position 243 is replaced by L-threonine as is shown in SEQ ID NO: 22.
Mutagenesis may also be performed by using in vitro methods for polynucleotides such as for example treatment with hydroxylamine (Molecular and General Genetics 145, l'Ol pp. (1978)) or mutagenic oligonucleotides (T.A. Brown: Gentechnologie fuer Einsteiger, Spektrum Akademischer Verlag, Heidelberg, 1993) or the polymerase chain reaction (PCR),. as is described in the manual by Newton and Graham (PCR, Spektrum Akademischer Verlag, Heidelberg, 1994) or the method described by Papworth et al . (Strategies 9(3), 3-4 (1996)) using the "Quik Change Site-directed Mutagenesis Kit" of Stratagene (La Jolla, California, USA) or similar methods known in the art.
The corresponding alleles or mutations are sequenced and introduced by recombination into the chromosome of an appropriate strain by the method of gene replacement, for example as described by Schwarzer and Puehler
(Bio/Technology 9, 84-87 (1991) for the lysA gene of C. glutamicum or by Peters-Wendisch et al . (Microbiology 144, 915-927 (1998)) for the pyc gene of C. glutamicum. Accordingly, the invention provides recombinant coryneform bacteria comprising a polynucleotide encoding a Zwf protein according to the invention e. g. comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is exchanged by another proteinogenic amino acid.
Corynebacterium glutamicum DSM5715zwf2_A243T is an example for such a strain. It comprises in its chromosome the mutation of the zwf allele of strain DM658 i.e. zwf(A243T).
Corynebacterium glutamicum strain DMl697_zwfD245S is another example for such a strain. It comprises in its chromosome the mutation of the zwf allele zwf (D2.45S) which was obtained by in vitro mutagenesis.
The corresponding alleles can also be introduced into the chromosome of an appropriate strain by the method of gene duplication for example as described by Reinscheid et al . (Applied and Environmental Microbiology 60(1), 126-132 (1994)) for the hom-thrB operon or by Jetten et al . (Applied Microbiology and Biotechnology 43,76-82 (1995)) for the ask gene.
Accordingly, the invention further provides coryneform bacteria comprising an isolated polynucleotide encoding a Zwf protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is exchanged by another proteinogenic amino acid.
Corynebacterium glutamicum DSM5715 : :pKl8mobsacB_zwf (A243T) is an example for such a strain. It comprises in its chromosome an isolated DNA containing the zwf (A243T) allele. The alleles can also be overexpressed by any of the methods as described above, for example, using plasmids, inducible promoters or any other method known in the art .
The strains thus obtained are used for the fermentative production of amino acids. Accordingly the invention also . provides. rocesses for the production of L-amino acids using the coryneform bacteria of the invention.
In addition, it may be advantageous for the production of L-amino acids to amplify one or more enzymes of the particular biosynthesis pathway, of glycolysis, of anaplerosis, of the pentose phosphate pathway, of sugar uptake or of amino acid export, in addition to amplification of the zwf gene or allele of the invention.
Thus, for example, in particular for the preparation of L-threonine, one or more genes chosen from the group consisting of:
• the horn gene which codes for homoserine dehydrogenase (Peoples et al . , Molecular Microbiology 2, 63-72 (1988)) or the homdr allele which codes for a "feed back resistant" homoserine dehydrogenase (Archer et al . , Gene 107, 53-59 (1991),
• the gap gene which codes for glyceraldehyde 3-phosphate dehydrogenase (Eikmanns et al., Journal of Bacteriology 174: 6076-6086 (1992)), • the pyc gene which codes for pyruvate carboxylase (Peters-Wendisch et al . , Microbiology 144: 915-927 (1998)),
• the mqo gene which codes for malate : quinone oxido- reductase (Molenaar et al., European Journal of Biochemistry 254, 395-403 (1998)), • the tkt gene which codes for transketolase (accession number AB023377 of the European Molecular Biologies Laboratories databank (EMBL, Heidelberg, Germany) ) ,
• the gnd gene which codes for 6-phosphogluconate dehydrogenase (JP-A-9-224662) ,
• the thrE gene which codes for the threonine export protein (DE 199 41 478.5; DSM 12840),
• the zwal gene (DE 199 59 328.0; DSM 13115),
• the eno gene which codes for enolase (DE: 199 41 478.5)
can be amplified, in particular over-expressed, at the same time.
Thus, for example, in particular for the preparation of L- lysine, one or more genes chosen from the group consisting of
• the dapA gene which codes for dihydrodipicolinate synthase (EP-B 0 197 335),
• the lysC gene which codes for a feed back resistant aspartate kinase (Kalinowski et al . (1990), Molecular and General Genetics 224: 317-324),
• the gap gene which codes for glyceraldehyde 3-phosphate dehydrogenase (Eikmanns (1992) , Journal of Bacteriology 174:6076-6086) ,
• the pyc gene which codes for pyruvate carboxylase (DE-A- 198 31 609) ,
• the tkt gene which codes for transketolase (accession number AB023377 of the European Molecular Biologies Laboratories databank (EMBL, Heidelberg, Germany) ) ,
• the gnd gene which codes for 6-phosphogluconate dehydrogenase (JP-A-9-224662), • the lysE gene which codes for the lysine export protein (DE-A-195 48 222) ,
• the zwal gene (DE 199 59 328.0; DSM 13115),
• the eno gene which codes for enolase (DE 199 47 791.4)
can be amplified, in particular over-expressed, at the same time. The use of endogenous genes is preferred.
It may furthermore be advantageous that for the production ' of L-amino acids at the same time one or more of the genes chosen from the group consisting of
• the pck gene which codes for phosphoenol pyruvate carboxykinase (DE 199 50 409.1; DSM 13047),
• the pgi gene which codes for glucose 6-phosphate isomerase (US 09/396,478, DSM 12969),
• the poxB gene which codes f-or pyruvate oxidase (DE 199 51 975.7; DSM 13114),
• the zwa2 gene (DE: 199 59 327.2; DSM 13113) are attenuated, in particular deleted
in addition to the amplification, in particular to overexpression of the zwf gene or allele of the invention.
In this connection, the term "attenuation" means reducing or suppressing the intracellular activity or concentration of one or more enzymes or proteins in a microorganism, which enzymes or proteins are coded by the corresponding DNA, for example by using a weak promoter or a gene or allele which codes for a corresponding enzyme or protein which has a low activity or inactivates the corresponding enzyme or protein and optionally by combining these measures . By attenuation measures, the activity or concentration of the corresponding enzyme or protein is in general reduced to 0 to 75%, 0 to 50%, 0 to 25%, 0 to 10% or 0 to 5% of the activity or concentration of the wild-type enzyme or protein or of the activity or concentration of the enzyme or protein in the starting microorganism.
In addition to amplification, in particular over- expression, of the Zwf protein, it may furthermore be advantageous for the production of L-amino acids to eliminate undesirable side reactions (Nakayama: "Breeding of Amino Acid Producing Micro-organisms", in: Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982).
The microorganisms prepared according to the invention can be cultured continuously or discontinuously in the batch process (batch culture) or in the fed batch (feed process) or repeated fed batch process (repetitive feed process) for the purpose of L-amino acid production. A summary of known culture methods is described in the textbook by Chmiel (Bioprozesstechnik 1. Einfuehrung in die
Bioverfahrenstechnik [Bioprocess Technology 1. Introduction to Bioprocess Technology (Gustav Fischer Verlag, Stuttgart, , 1991) ) or in the textbook by Storhas (Bioreaktoren und periphere Einrichtungen [Bioreactors and Peripheral Equipment] (Vieweg Verlag, Braunschweig/Wiesbaden, 1994) ) .
The culture medium to be used must meet the requirements of the particular microorganisms in a suitable manner. Descriptions of culture media for various microorganisms are contained in the handbook "Manual of Methods for General Bacteriology" of the American Society for
Bacteriology (Washington D.C., USA, 1981). Sugars and carbohydrates, such as e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats, such as e.g. soya oil, sunflower oil, groundnut oil and coconut fat, fatty acids, such as e.g. palmitic acid, stearic acid and linoleic acid, alcohols, such as e.g. glycerol and ethanol, and organic acids, such as e.g. acetic acid, can be used as the source of carbon. These substance can be used individually or as a mixture. Organic nitrogen-containing compounds, such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean flour and urea, or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, can be used as the source of nitrogen.
The sources of nitrogen can be used individually or as a mixture. Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus . The culture medium must furthermore comprise salts of metals, such as e.g. magnesium sulfate or iron sulfate, which are necessary for growth. Finally, essential growth substances, such as amino acids and vitamins, can be employed in addition to the above-mentioned substances. Suitable precursors can moreover be added to the culture medium. The starting substances mentioned can be added to the culture in the form of a single batch, or can be fed in during the culture, in a suitable manner.
Basic compounds, such as sodium hydroxide, potassium hydroxide, ammonia, or acid compounds, such as phosphoric acid or sulfuric acid, can be employed in a suitable manner to control the pH. Antifoams, such as e.g. fatty acid polyglycol esters, can be employed to control the development of foam. Suitable substances having a selective' action, e.g. antibiotics, can be added to the medium to maintain the stability of plasmids . To maintain aerobic conditions, oxygen or oxygen-containing gas mixtures, such as e.g. air, are introduced into the culture. The temperature of the culture is usually 202C to 45SC, and preferably 252C to 40aC. Culturing is continued until a maximum of L-amino acid has formed. This target is usually reached within 10 hours to 160 hours.
Accordingly, the invention further provides a process for the preparation of an amino acid by fermentation of a coryneform bacterium comprising the following steps: a) fermenting of the amino acid producing bacterium , in which at least a zwf gene encoding the Zwischenferment protein is overexpressed, and b) concentrating of the amino acid in the medium or in the cells of the bacteria
wherein said Zwischenferment protein comprises at least the amino acid sequence corresponding to amino acids at positions 241 to 246 of SEQ ID NO: 22 and optionally the N terminal amino acid sequence of SEQ ID NO: 10 amino acids 1 to 10 or SEQ ID NO: 10 amino acids 2 to 10.
The invention further provides a process for the preparation of an amino acid by fermentation of an isolated coryneform bacterium comprising the following steps : a) fermenting of the amino acid producing bacterium comprising a polynucleotide encoding a Zwf protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is exchanged by another proteinogenic amino acid, and b) concentrating of the amino acid in the medium or in the cells of the bacterium.
The invention further provides a process for the preparation of an amino acid by fermentation of a coryneform bacterium comprising the following steps : a) fermenting of the amino acid producing bacterium comprising an isolated or recombinant polynucleotide encoding a Zwf protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is exchanged by another proteinogenic amino acid, and b) concentrating of the amino acid in the medium or in the cells of the bacterium.
The amino acid may be then isolated from the medium or the cells of the bacterium.
Using the measures of the invention the performance of the bacteria or of the fermentation process in terms of product concentration (product per volume) , product yield (product formed per carbon source consumed) , product formation (product formed per volume and time) or other process parameters and combinations thereof can be improved by at least 0,5 %, at least 1 % or at least 2 %.
The analysis of L-amino acids can be carried out by anion exchange chromatography with subsequent ninhydrin derivation, as described by Spackman et al . (Analytical Chemistry, 30, (1958) , 1190) , or it can take place by reversed phase HPLC as described by Lindroth et al . (Analytical Chemistry (1979) 51:. 1167-1174).
The following microorganism have been deposited as pure cultures at the Deutsche Sammlung fuer Mikroorganismen und Zellkulturen (DSMZ = German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany):
• Escherichia coli K-12 DH5 /pEC-Tl8mob2 was deposited on January 20, 2000 as DSM 13244 in accordance with the Budapest Treaty. ΔΔ
• Corynebacterium glutamicum DM658 was deposited on January 27, 1993 as DSM 7431 for long term storage; this deposition was converted to a deposition in accordance with the Budapest Treaty on October 17, 2002.
• Corynebacterium glutamicum DSM5715zwf2_A243T was deposited on October 11, 2002 as DSM 15237 in accordance with the Budapest Treaty.
• Corynebacterium glutamicum DMl697_zwfD245S was deposited on May 23 2003 as DSM 15632 in accordance with the Budapest Treaty.
Brief Description of the Figures :
Figure 1: Map of the plasmid pEC-Tl8mob2 Figure 2: Map of the plasmid pEC-T18mob2zwf Figure 3 : Map of the plasmid pAMCl
• Figure 4: Map of the plasmid pMCl
Figure 5 : Map of the plasmid pCR2. lpoxBint Figure 6: Map of the plasmid pKl8mobsacB_zwf (A243T) Figure 7: Map of the plasmid pKl8mobsacB_zwf Figure 8: Map of the plasmid pKl8mobsacB_zwf (D245S)
• Figure 9: Map of the plasmid pCRBluntII_ABlCDl
Figure 10: Map of the plasmid pKl8mobsacB_zwfdelta90bp Figure 11 : Map of the plasmid pCRBluntII_zwfL Figure 12 : Map of the plasmid pCRBluntII_zwfS Figure 13 : Map of the plasmid pZ8-l_zwfL
• Figure 14: Map of the plasmid pZ8-l_zwfS The base pair numbers stated are approx. values obtained in the context of reproducibility.
Re Figure 1 and 2 :
The abbreviations used have the following meaning:
Tet : Resistance gene for tetracycline oriV: Plasmid-coded replication origin of E. coli RP4mob: mob region for mobilizing the plasmid rep: Plasmid-coded replication origin from C. glutamicum plasmid pGAl per: Gene for controlling the number of copies from pGAl lacZ-alpha: lacZ gene fragment (N-terminus) of the β-galactosidase gene lacZalpha' : 5 ' -Terminus of the lacZα gene fragment 'lacZalpha: 3 ' -Terminus of the lacZα gene fragment
Re Figure 3 and 4 :
The abbreviations used have the following meaning;
Neo r : Neomycin/kanamycin resistance
ColEl ori : Replication origin of the plasmid ColEl
CMV: Cytomegalovirus promoter lacP: Lactose promoter pgi: Phosphoglucose isomerase gene lacZ: Part of the β-galactosidase gene
SV40 3 ' spl 3 ' splice site of Simian virus 40
SV40 polyA: Polyadenylation site of Simian virus 40 fl (-) ori : Replication origin of the filamentous phage fl
SV40 ori: Replication origin of Simian virus 40 kan r: Kanamycin resistance pgi insert: Internal fragment of the pgi gene ori : Replication origin of the plasmid pBGS8 Re Figure 5 :
The abbreviations used have the following meaning:
ColEl ori : Replication origin of the plasmid ColEl lacZ: Cloning relict of the lacZα gene fragment fl ori: Replication origin of phage fl
K R: Kanamycin resistance
ApR: Ampicillin resistance poxBint: Internal fragment of the poxB gene
Re Figure 6 : The abbreviations used have the following meaning:
RP4mob: mob region with the replication origin for the transfer (oriT) KanR: Kanamycin resistance gene oriV: Replication origin V zwf(A243T): zwf (A243T) allele sacB: sacB gene
Re Figure 7 and 8 :
The abbreviations used have the following meaning:
zwf: zwf gene zwf(D245S): zwf(D245S) allele oriV: origin of replication V
RP4mob: mob region with the replication origin for the transfer (oriT) KanR: kanamycin resistance gene sacB: sacB gene
Xbal : cleavage site of the restriction enzyme Xbal
Pstl: cleavage site of the restriction enzyme Pstl
Re Figure 9 and 10:
The abbreviations used have the following meaning: deltazwf90: cloned DNA fragment containing a 90 bp deletion of the zwf allele
Kan: kanamycin resistance gene pUC ori: origin of replication sacB: sacB gene RP4mob: mob region with the replication origin for the transfer (oriT) oriV: origin of replication V Xbal: cleavage site of the restriction enzyme Xbal
Re Figure 11 and 12:
The abbreviations used have the following meaning:
zwfL: cloned DNA fragment of the zwf allele zwfS: cloned DNA fragment containing a 90 bp deletion of the zwf allele
Km: kanamycin resistance gene pUC origin: origin of replication
Sail: cleavage site of the restriction enzyme Sail
Re Figure 13 and 14:
The abbreviations used have the following meaning:
zwfL: cloned DNA fragment of the zwf allele zwfS: cloned DNA fragment containing a 90 bp deletion of the zwf allele Km: kanamycin resistance gene rrnB-
Terminator: termination of transcription
Ptac: promotor rep: origin of replication Sail: cleavage site of the restriction enzyme Sail The meaning of the abbreviations for the various restriction enzymes (e.g. BamHI, EcoRI etc.) are known from the prior art and are summarized, for example, by Kessler and Hoeltke (Gene 47, 1-153 (1986)) or Roberts et al . (Nucleic Acids Research 27, 312-313 (1999)).
The following examples will further illustrate the present invention. The molecular biology techniques, e.g. plasmid DNA isolation, restriction enzyme treatment, ligations, standard transformations of Escherichia coli etc. used are, (unless stated otherwise), described by Sambrook et al . ,
(Molecular Cloning. A Laboratory Manual (1989) Cold Spring Harbor Laboratories, USA) .
Example 1
Expression of the Zwf protein
1.1 Preparation of the plasmid pEC-Tl8mob2
The E. coli - C. glutamicum shuttle vector pEC-Tl8mob2 was constructed according to the prior art. The vector contains the replication region rep of the plasmid pGAl including the replication effector per (US-A- 5,175,108; Nesvera et al., Journal of Bacteriology 179, 1525-1532 (1997)), the tetracycline resistance-imparting tetA(Z) gene of the plasmid pAGl (US-A- 5,158,891; gene library entry at the National Center for Biotechnology Information (NCBI, Bethesda, MD, USA) with accession number AF121000) , the replication region oriV of the plasmid pMBl (Sutcliffe, Cold Spring Harbor Symposium on Quantitative Biology 43, 77-90 (1979)), the lacZα gene fragment including the lac promoter and a multiple' cloning site (mcs) (Norrander et al . Gene 26, 101-106 (1983)) and the mob region of the plasmid RP4 (Simon et al.,(1983) Bio/Technology 1:784-791). The vector constructed was transformed in the E. coli strain DH5α (Brown (ed.) Molecular Biology Labfax, BIOS Scientific Publishers, Oxford, UK, 1991) . Selection for plasmid-carrying cells was made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular' Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which had been supplemented with 5 mg/1 tetracycline. Plasmid DNA was isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction with the restriction enzyme EcoRI and Hindlll and subsequent agarose gel electrophoresis (0.8%).
The plasmid was called pEC-Tl8mob2 and is shown in Figure 1. It is deposited in the form of the strain Escherichia coli K-12 strain DH5αpEC-Tl8mob2 at the Deutsche Sammlung fuer Mikroorganismen und Zellkulturen (DSMZ = German Δ o
Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) as DSM 13244.
1.2 Preparation of the plasmid pEC-T18mob2zwf
The gene from Corynebacterium glutamicum ATCC13032 was first amplified by a polymerase chain reaction (PCR) by means of the following oligonucleotide primer:
zwf-forward (SEQ ID NO 11) :
5 ' -TCG ACG CGG TTC TGG AGC AG-3 '
zwf-reverse (SEQ ID NO 12) : 5'-CTA AAT TAT GGC CTG CGC CAG-3 '
The PCR reaction was carried out in 30 cycles in the presence of 200 μM deoxynucleotide triphosphates (dATP, dCTP, dGTP, dTTP) , in each case 1 μM of the corresponding oligonucleotide, 100 nanogram (ng) chromosomal DNA from Corynebacterium glutamicum ATCC13032, 1/10 volume 10-fold reaction buffer and 2.6 units of a heat-stable Taq-/Pwo-DNA polymerase mixture (Expand High Fidelity PCR System from Roche Diagnostics, Mannheim, Germany) in a Thermocycler (PTC-100, MJ Research, Inc., Watertown, USA) under the following conditions: 94°C for 30 seconds, 64°C for 1 minute and 68°C for 3 minutes.
The amplified fragment about 1.8 kb in size was subsequently ligated with the aid of the SureClone Ligation Kit (Amersham Pharmacia Biotech, Uppsala, Sweden) into t e Smal cleavage site of the vector pUCl8 in accordance with the manufacturer's instructions. The E. coli strain DH5α cr (Grant et al . , Proceedings of the National Academy of Sciences of the United States of America USA (1990) 87: 4645-4649) was transformed with the entire ligation batch. Transformants were identified with the aid of their carbenicillin resistance on LB-agar plates containing
50 μg/mL carbenicillin. The plasmids were prepared from 7 of the transformants and checked for the presence of the 1.8 kb PCR fragment as an insert by restriction analysis. The recombinant plasmid formed in this way is called pUClδzwf in the following.
For construction of pEC-Tl8mob2zwf , pUCl8zwf was digested with Kpnl and Sail, and the product was isolated with the aid of the NucleoSpin Extraction Kit from Macherey-Nagel (Dueren, Germany) in accordance with the manufacturer's instructions and then ligated with the vector pEC-Tl8mob2, which had also been cleaved with Kpnl and Sail and dephosphorylated. The E. coli strain DH5ocmcr (Grant et al . , Proceedings of the National Academy of Sciences of the United States of America USA (1990) 87: 4645-4649) was transformed with the entire ligation batch. Transformants were identified with the aid of their tetracycline resistance on LB-agar plates containing 5 μg/mL tetracycline. The plasmids were prepared from 12 of the transformants and checked for the presence of the 1.8 kb PCR fragment as an insert by restriction analysis . One of the recombinant plasmids isolated in this manner was called pEC-Tl8mob2zwf (Figure 2).
Example 2
Preparation of amino acid producers with an amplified zwf gene
The L-lysine-producing strain Corynebacterium glutamicum DSM5715 is described in EP-B-0435132 and the L-threonine- producing strain Brevibacterium flavum DSM5399 is described in EP-B-0385940. Both strains are deposited at the Deutsche Sammlung fuer Mikroorganismen und Zellkulturen [German Collection of Microorganisms and Cell Cultures] in Braunschweig (Germany) in accordance with the Budapest Treaty.
2.1 Preparation of the strains DSM5715/pEC-Tl8mob2zwf and DSM5399/pEC-Tl8mob2zwf The strains DSM5715 and DSM5399 were transformed with the plasmid pEC-Tl8mob2zwf using the electroporation method described by Liebl et al . , (FEMS Microbiology Letters, 53:299-303 (1989)) Selection of the transformants took place on LBHIS agar comprising 18.5 g/1 brain-heart infusion broth, 0.5 M sorbitol, 5 g/1 Bacto-tryptone, 2.5 g/1 Bacto-yeast extract, 5 g/1 NaCI and 18 g/1 Bacto- agar, which had been supplemented with 5 mg/1 tetracycline.. Incubation was carried out for 2 days at 33 aC.
Plasmid DNA was isolated in each case from a transformant by conventional methods (Peters-Wendisch et al . , 1998, Microbiology 144, 915 -927), cleaved with the restriction endonucleases Xbal and Kpnl, and the plasmid was checked by subsequent agarose gel electrophoresis. The strains obtained in this way were called DSM5715/pEC-Tl8mob2zwf and' DSM5399/pEC-Tl8mob2zwf .
2.2 Preparation of L-threonine
The C. glutamicum strain DSM5399/pEC-Tl8mob2zwf obtained in Example 2.1 was cultured in a nutrient medium suitable for the production of threonine and the threonine content in the culture supernatant was determined.
For this, the strain was first incubated on an agar plate with the corresponding antibiotic (brain-heart agar with tetracycline (5 mg/1)) for 24 hours at 33SC. Starting from this agar plate culture, a preculture was seeded (10 ml medium in a 100 ml conical flask) . The complete medium Cg III was used as the medium for the preculture. Medium Cg III
NaCI 2.5 g/1
Bacto-Peptone 10 g/1
Bacto-Yeast extract 10 g/1
Glucose (autoclaved separately) 2% (w/v) The pH was brought to pH 7.4
Tetracycline (5 mg/1) was added to this. The preculture was incubated for 16 hours at 33 aC at 240 rpm on a shaking machine. A main culture was seeded from this preculture such that the initial OD (660nm) of the main culture was 0.1. Medium MM was used for the main culture.
Medium MM
CSL (corn steep liquor) 5 g/1
MOPS (morpholinopropanesulfonic 20 g/1 acid)
Glucose (autoclaved separately) 50 g/1
(NH4)2S04 25 g/1
KH2P04 0.1 g/1
MgS04 * 7 H20 1.0 g/1
CaCl2 * 2 H20 10 mg/1
FeS04 * 7 H20 10 mg/1
MhS04 * H20 5.0 mg/1
Biotin (sterile-filtered) 0.3 mg/1 Thiamine * HCI (sterile-filtered) 0.2 mg/1
L-Leucine (sterile-filtered) 0.1 g/1
CaC03 25 g/1
The CSL, MOPS and the salt solution were brought to pH 7 with aqueous ammonia and autoclaved. The sterile substrate and vitamin solutions were then added, as well as the CaC03 autoclaved in the dry state.
Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles. Tetracycline (5 mg/1) was added. Culturing was carried out at 33aC and 80% atmospheric humidity.
After 72 hours, the OD was determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Munich) . The amount of threonine formed was determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
The result of the experiment is shown in Table 1.
Table 1
2.3 Preparation of L-lysine
The C. glutamicum strain DSM5715/pEC-Tl8mob2zwf obtained in Example 2.1 was cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant was determined.
For this, the strain was first incubated on an agar plate with the corresponding antibiotic (brain-heart agar with tetracycline (5 mg/1)) for 24 hours at 33aC. Starting from this agar plate culture, a preculture was seeded (10 ml medium in a 100 ml conical flask) . The complete medium Cg III was used as the medium for the preculture. Medium Cg III
NaCI 2.5 g/1
Bacto-Peptone 10 g/1
Bacto-Yeast extract 10 g/1
Glucose (autoclaved separately) 2% (w/v) The pH was brought to pH 7.4
Tetracycline (5 mg/1) was added to this. The preculture was incubated for 16 hours at 33aC at 240 rpm on a shaking machine. A main culture was seeded from this preculture such that the initial OD (660nm) of the main culture was 0.1. Medium MM was used for the main culture.
Medium MM
CSL (corn steep liquor) 5 g/1
MOPS (morpholinopropanesulfonic 20 g/1 acid)
Glucose (autoclaved separately) 58 g/1
(NH4)2S04 25 g/1
KH2P04 0.1 g/1
MgS04 * 7 H20 1.0 g/1
CaCl2 * 2 H20 10 mg/1
FeS04 * 7 H20 10 mg/1
MnS04 * H20 5.0mg/l
Biotin (sterile-filtered) 0.3 mg/1 Thiamine * HCI (sterile-filtered) 0.2 mg/1
L-Leucine (sterile-filtered) 0.1 g/1
CaC03 25 g/1
The CSL, MOPS and the salt solution were brought to pH 7 with aqueous ammonia and autoclaved. The sterile substrate and vitamin solutions were then added, as well as the CaC03 autoclaved in the dry state.
Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles. Tetracycline (5 mg/1) was • added. Culturing was carried out at 33 aC and 80% atmospheric humidity.
After 72 hours, the OD was determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Munich) . The amount of lysine formed was determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
The result of the experiment is shown in Table 2.
Table 2
Example 3
Construction of a gene library of Corynebacterium glutamicum strain AS019
A DNA library of Corynebacterium glutamicum strain AS019 (Yoshihama et al . , Journal of Bacteriology 162, 591-597 (1985)) was constructed using λ Zap Express™ system, (Short et al., (1988) Nucleic Acids Research, 16: 7583- 7600), as described by O'Donohue (O'Donohue, M. (1997). The Cloning and Molecular Analysis of Four Common Aromatic Amino Acid Biosynthetic Genes from Corynebacterium glutamicum. Ph.D. Thesis, National University of Ireland, Galway) . λ Zap Express™ kit was purchased from Stratagene (Stratagene, 11011 North Torrey Pines Rd. , La Jolla, California 92037) and used according to the manufacturers instructions. AS019-DNA was digested with restriction enzyme Sau3A and ligated to BamHI treated and dephosphorylated λ Zap Express™ arms .
Example 4
Cloning and sequencing of the pgi gene
4.1 Cloning
Escherichia coli strain DF1311, carrying mutations in the pgi and pgi genes as described by Kupor and Fraenkel, (Journal of Bacteriology 100: 1296-1301 (1969)), was transformed with approx. 500 ng of the AS019 λ Zap Express™ plasmid library described in Example 3. Selection for . transformants was made on M9 minimal media, (Sambrook et al., (1989) . Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratories, USA) , containing kanamycin at a concentration of 50 mg/1 and incubation at 37°C for 48 hours. Plasmid DNA was isolated from one transformant according to Birnboim and Doly (Nucleic Acids Research 7 : 1513-1523 (1979)) and designated pAMCl (Figure 3).
4.2 Sequencing
For sequence analysis of the cloned insert of pAMCl the method of Sanger et al. (Proceedings of the National
Academy of Sciences USA 74,5463-5467 (1977)) was applied using primers differentially labeled with a colored fluorescent tag. It was carried out using the ABI prism 310' genetic analyzer from Perkin Elmer Applied Biosystems, (Perkin Elmer Corporation, Norwalk, Connecticut, U.S.A), and the ABI prism Big Dye™ Terminator Cycle Sequencing Ready Reaction kit also from Perkin Elmer.
Initial sequence analysis was carried out using the universal forward and Ml3 reverse primers obtained from Pharmacia Biotech (St. Albans, Herts, ALl 3AW, UK) : Universal forward primer: GTA ATA CGA CTC ACT ATA GGG C (SEQ ID NO 13) M13 reverse primer: GGA AAC AGC TAT GAC CAT G (SEQ ID NO 14)
Internal primers were subsequently designed from the sequence obtained which allowed the entire pgi gene to be deduced. The sequence of the internal primers is as follows :
Internal primer 1 (SEQ ID NO 15) : GGA AAC AGG GGA GCC GTC Internal primer 2 (SEQ ID NO 16) : TGC TGA GAT ACC AGC GGT
Sequence obtained was then analyzed using the DNA Strider program, (Marck, (1988). Nucleic Acids Research 16: 1829- 1836), version 1.0 on an Apple Macintosh computer. This program allowed for analyses such as restriction site usage, open reading frame analysis and codon usage determination. Searches between DNA sequence obtained and those in EMBL and Genbank databases were achieved using the BLAST program, (Altschul et al . , (1997). Nucleic Acids Research, 25: 3389-3402). DNA and protein sequences were aligned using the Clustal V and Clustal W programs (Higgins and Sharp, 1988 Gene 73: 237-244).
The sequence thus obtained is shown in SEQ ID NO 1. The analysis of the nucleotide sequence obtained revealed an open reading frame of 1650 base pairs which was designated as pgi gene. It codes for a protein of 550 amino acids shown in SEQ ID NO 2.
Example 5
Preparation of an integration vector for integration mutagenesis of the pgi gene
An internal segment of the pgi gene was amplified by polymerase chain reaction (PCR) using genomic DNA isolated from Corynebacterium glutamicum AS019, (Heery and Dunican, (1993) Applied and Environmental Microbiology 59: 791-799), as template. The pgi primers used were: fwd. Primer: ATG GAR WCC AAY GGH AA (SEQ ID NO 17) rev. Primer: YTC CAC GCC CCA YTG RTC (SEQ ID NO 18) with R=A+G; Y=C+T; W=A+T; H=A+T+C .
PCR Parameters were as follows: 35 cycles 94°C for 1 min. 47°C for 1 min. 72°C for 30 sec. - 1.5 mM MgCl2 approx. 150-200 ng DNA template.
The PCR product obtained was cloned into the commercially available pGEM-T vector received from Promega Corp., (Promega UK, Southampton.) using strain E. coli JM109, (Yanisch-Perron et al., 1985. Gene, 33: 103-119), as a host. The sequence of the PCR product is shown as SEQ ID NO, 3. The cloned insert was then excised as an EcoRI fragment and ligated to plasmid pBGS8 (Spratt et al . , Gene 41: 337- 342 (1986)) pretreated with EcoRI. The restriction enzymes used were obtained from Boehringer Mannheim UK Ltd. , (Bell Lane, Lewes East Sussex BN7 ILG, UK.) and used according to manufacturers instructions. E. coli JM109 was then transformed with this ligation mixture and electrotransformants were selected on Luria agar supplemented with IPTG (isopropyl-β-D- thiogalactopyranoside) , XGAL (5-bromo-4-chloro-3-indolyl-D- galactopyranoside) and kanamycin at a concentration of 1 mM, 0.02% and 50 mg/1, respectively.
Agar plates were incubated for twelve hours at 37°C. Plasmid DNA was isolated from one transformant, characterized by restriction enzyme analysis using EcoRI, BamHI and Sail designated pMCl (Figure 4) . Plasmid pMCl was deposited in the form of Escherichia coli strain DH5a/pMCl at the Deutsche Sammlung fuer Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) as DSM 12969 according to the Budapest treaty.
Example 6
Integration mutagenesis of the pgi gene in the lysine producer DSM 5715
The vector pMCl mentioned in Example 5 was electroporated by the electroporation method of Tauch et al . (FEMS Microbiological Letters, 123:343-347 (1994)) in
Corynebacterium glutamicum DSM 5715. Strain DSM 5715 is an AEC-resistant lysine producer. The vector pMCl cannot replicate independently in DSM5715 and is retained in the cell only if it has integrated into the chromosome of DSM 5715. Selection of clones with pMCl integrated into the chromosome was carried out by plating out the electroporation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which had been supplemented with 15 mg/1 kanamycin.
For detection of the integration, the internal pgi fragment (Example 5) was labeled with the Dig hybridization kit from, Boehringer Mannheim by the method of "The DIG System Users Guide for Filter Hybridization" of Boehringer Mannheim GmbH (Mannheim, Germany, 1993) . Chromosomal DNA of a transformant was isolated by the method of Eikmanns et al. (Microbiology 140: 1817 - 1828 (1994)) and in each case cleaved with the restriction enzymes Sail, Sad and Hindlll. The fragments formed were separated by agarose gel electrophoresis and hybridized at 68aC with the Dig hybridization kit from Boehringer. It was found in this way that the plasmid pMCl was inserted within the chromosomal pgi gene of strain DSM5715. The strain was called DSM5715: :pMCl. Example 7
Effect of over-expression of the zwf gene with simultaneous elimination of the pgi gene on the preparation of lysine
7.1 Preparation of the strain DSM5715 : :pMCl/pEC- T18mob2zwf
The vector pEC-Tl8mob2zwf mentioned in Example 1.2 was electroporated by the electroporation method of Tauch et al. (1994, FEMS Microbiological Letters, 123:343-347) in Corynebacterium glutamicum DSM 5715::pMCl. Selection for plasmid-carrying cells was made by plating out the electroporation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. , 1989), which had been supplemented with 15 mg/1 kanamycin and with 5 mg/1 tetracycline. Plasmid DNA was isolated from' a transformant by conventional methods (Peters-Wendisch et al., 1998, Microbiology 144, 915-927) and checked by treatment with the restriction enzymes Kpnl and Sail with subsequent agarose gel electrophoresis. The strain was called DSM5715 : :pMCl/pEC-Tl8mob2zwf .
7.2 Preparation of lysine
The C. glutamicum strain DSM5715 : :pMCl/pEC-T18mob2zwf obtained in Example 7.1 was cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant was determined.
For this, the strain was first incubated on an agar plate with the corresponding antibiotic (brain-heart agar with tetracycline (5 mg/1) and kanamycin (25 mg/1) ) for 24 hours at 33 aC. The cultures of the comparison strains were supplemented according to their resistance to antibiotics. Starting from this agar plate culture, a preculture was seeded (10 ml medium in a 100 ml conical flask) . The complete medium Cg III was used as the medium for the preculture.
Medium Cg III
NaCI 2.5 g/1
Bacto-Peptone 10 g/1
Bacto-Yeast extract 10 g/1
Glucose (autoclaved separately) 2% (w/v) The pH was brought to pH 7.4
Tetracycline (5 mg/1) and kanamycin (5 mg/1) was added to this. The preculture was incubated for 16 hours at 33aC at 240 rpm on a shaking machine. A main culture was seeded from this preculture such that the initial OD (660 nm) of the main culture was 0.1. Medium MM was used for the main culture. Medium MM
CSL (corn steep liquor) 5 g/1
MOPS (morpholinopropanesulfonic 20 g/1 acid)
Glucose (autoclaved separately) 50 g/1
(NH4)2S04 25 g/1
KH2P04 0.1 g/1
MgS04 * 7 H20 1.0 g/1
CaCl2 * 2 H20 10 mg/1
FeS04 * 7 H20 10 mg/1
MnS04 * H20 5.0mg/l
Biotin (sterile-filtered) 0.3 mg/1 Thiamine * HCI (sterile-filtered) 0.2 mg/1
L-Leucine (sterile-filtered) 0.1 g/1
CaC03 25 g/1
The CSL, MOPS and the salt solution were brought to pH 7 with aqueous ammonia and autoclaved. The sterile substrate and vitamin solutions were then added, as well as the CaC03 autoclaved in the dry state.
Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles. Tetracycline (5 mg/1) and kanamycin (25 mg/1) were added. Culturing was carried out at 33 aC and 80% atmospheric humidity.
After 72 hours, the OD was determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Munich) . The amount of lysine formed was determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
The result of the experiment is shown in Table 3.
Table 3
Example 8
Preparation of a genomic cosmid gene library from Corynebacterium glutamicum ATCC 13032
Chromosomal DNA from Corynebacterium glutamicum ATCC 13032 was isolated as described by Tauch et al . , (1995, Plasmid 33:168-179), and partly cleaved with the restriction enzyme Sau3AI (Amersham Pharmacia, Freiburg, Germany, Product Description Sau3AI, Code no. 27-0913-02) . The DNA fragments, were dephosphorylated with shrimp alkaline phosphatase (Roche Molecular Biochemicals, Mannheim, Germany, Product Description SAP, Code no. 1758250) . The DNA of the cosmid vector SuperCosl (Wahl et al . (1987) Proceedings of the National Academy of Sciences USA 84:2160-2164), obtained from Stratagene (La Jolla, USA, Product Description SuperCosl Cosmid Vektor Kit, Code no. 251301) was cleaved with the restriction enzyme Xbal (Amersham Pharmacia, Freiburg, Germany, Product Description Xbal, Code no. 27- 0948-02) and likewise dephosphorylated with shrimp alkaline phosphatase.
The cosmid DNA was then cleaved with the restriction enzyme BamHI (Amersham Pharmacia, Freiburg, Germany, Product Description BamHI, Code no. 27-0868-04) . The cosmid DNA treated in this manner was mixed with the treated ATCC13032 DNA and the batch was treated with T4 DNA ligase (Amersham Pharmacia, Freiburg, Germany, Product Description T4-DNA- Ligase, Code no.27-0870-04) . The ligation mixture was then packed in phages with the aid of Gigapack II XL Packing Extracts (Stratagene, La Jolla, USA, Product Description
Gigapack II XL Packing Extract, Code no. 200217) . For infection of the E. coli strain NM554 (Raleigh et al . 1988, Nucleic Acid Res. 16:1563-1575) the cells were taken up in 10 mM MgS0 and mixed with an aliquot of the phage suspension. The infection and titering of the cosmid library were carried out as described by Sambrook et al . (1989, Molecular Cloning: A laboratory Manual, Cold Spring ' Harbor) , the cells being plated out on LB agar (Lennox, 1955, Virology, 1:190) + 100 μg/ml ampicillin. After incubation overnight at 37 aC, recombinant individual clones were selected. Example 9
Isolation and sequencing of the poxB gene
The cosmid DNA of an individual colony (Example 7) was isolated with the Qiaprep Spin Miniprep Kit (Product No. 27106, Qiagen, Hilden, Germany) in accordance with the manufacturer ' s instructions and partly cleaved with the restriction enzyme Sau3AI (Amersham Pharmacia, Freiburg, Germany, Product Description Sau3AI, Product No. 27-0913-02) . The DNA fragments were dephosphorylated with shrimp alkaline phosphatase (Roche Molecular Biochemicals, Mannheim, Germany, Product Description SAP, Product No. 1758250) . After separation by gel electrophoresis, the cosmid fragments in the size range of 1500 to 2000 bp were isolated with the QiaExII Gel Extraction Kit (Product No. 20021, Qiagen, Hilden, Germany) . The DNA of the sequencing vector pZero-1, obtained .from Invitrogen (Groningen, Holland, Product Description Zero Background Cloning Kit, Product No. K2500-01) , was cleaved with the restriction enzyme BamHI (Amersham Pharmacia, Freiburg, Germany, Product Description BamHI, Product No. 27-0868-04) . The ligation of the cosmid fragments in the sequencing vector pZero-1 was carried out as described by Sambrook et al . (1989, Molecular Cloning: A laboratory Manual, Cold Spring Harbor) , the DNA mixture being incubated overnight with T4 ligase (Pharmacia Biotech, Freiburg, Germany) .
This ligation mixture was then electroporated (Tauch et al . 1994, FEMS Microbiol Letters, 123:343-7) into the E. coli strain DH5 MCR (Grant, 1990, Proceedings of the National Academy of Sciences U.S.A., 87:4645-4649) and plated out on LB agar (Lennox, 1955, Virology, 1:190) with 50 μg/ml zeocin. The plasmid preparation of the recombinant clones was carried out with Biorobot 9600 (Product No. 900200, Qiagen, Hilden, Germany) . The sequencing was carried out by the dideoxy chain-stopping method of Sanger et al . (1977, Proceedings of the National Academies of Sciences U.S.A., 74:5463-5467) with modifications according to Zimmermann et al. (1990, Nucleic Acids Research, 18:1067). The "RR dRhodamin Terminator Cycle Sequencing Kit" from PE Applied Biosystems (Product No. 403044, Weiterstadt, Germany) was used. The separation by gel electrophoresis and analysis of the sequencing reaction were carried out in a "Rotiphoresis- NF Acrylamide/Bisacrylamide" Gel (29:1) (Product No. A124.1, Roth, Karlsruhe, Germany) with the "ABI Prism 377" sequencer from PE Applied Biosystems (Weiterstadt, Germany) .
The raw sequence data obtained were then processed using the Staden program package (1986, Nucleic Acids Research, 14:217-231) version 97-0. The individual sequences of the pZerol derivatives were assembled to a continuous contig. The computer-assisted coding region analysis were prepared with the XNIP program (Staden, 1986, Nucleic Acids Research, 14:217-231). Further analyses were carried out with the "BLAST search program" (Altschul et al . , 1997, Nucleic Acids Research, 25:3389-3402), against the non- redundant databank of the "National Center for
Biotechnology Information" (NCBI, Bethesda, MD, USA) .
The resulting nucleotide sequence is shown in SEQ ID NO: 4. Analysis of the nucleotide sequence showed an open reading frame of 1737 base pairs, which was called the poxB gene. The poxB gene codes for a polypeptide of 579 amino acids (SEQ ID NO. 5) .
Example 10
Preparation of an integration vector for integration mutagenesis of the poxB gene
From the strain ATCC 13032, chromosomal DNA was isolated by the method of Eikmanns et al. (Microbiology 140: 1817 - 1828 (1994) ) . On the basis of the sequence of the poxB gene, known for C. glutamicum from Example 8, the following oligonucleotides were chosen for the polymerase chain reaction:
poxBintl (SEQ ID NO 19) :
5' TGC GAG ATG GTG AAT GGT GG 3 s
poxBint2 (SEQ ID NO 20) :
5V GCA TGA GGC AAC GCA TTA GC 3"
The primers shown were synthesized by MWG Biotech (Ebersberg, Germany) and the PCR reaction was carried out by the standard PCR method of Innis et al . (PCR protocols. A guide to methods and applications, 1990, Academic Press) with Pwo-Polymerase from Boehringer. With the aid of the polymerase chain reaction, a DNA fragment approx. 0.9 kb in size was isolated, this carrying an internal fragment of the poxB gene and being shown in SEQ ID NO : 6.
The amplified DNA fragment was ligated with the TOPO TA
Cloning Kit from Invitrogen Corporation (Carlsbad, CA, USA; Catalogue Number K4500-01) in the vector pCR2.1-TOPO (Mead at al. (1991) Bio/Technology 9:657-663). The E. coli strain DH5α was then electroporated with the ligation batch (Hanahan, In: DNA cloning. A Practical Approach. Vol. I,
IRL-Press, Oxford, Washington DC, USA, 1985) . Selection for plasmid-carrying cells was made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), which had been supplemented with 25 mg/1 kanamycin. Plasmid DNA was isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction with the restriction enzyme EcoRI and subsequent agarose gel electrophoresis (0.8%). The plasmid was called pCR2. lpoxBint (Figure 5).
Plasmid pCR2. lpoxBint has been deposited in the form of the strain Escherichia coli DH5α/pCR2. lpoxBint as DSM 13114 at the Deutsche Sammlung fuer Mikroorganismen und Zellkulturen (DSMZ = German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) in accordance with the Budapest Treaty.
Example 11
Integration mutagenesis of the poxB gene in the lysine producer DSM 5715
The vector pCR2. lpoxBint mentioned in Example 10 was electroporated by the electroporation method of Tauch et al. (FEMS Microbiological Letters, 123:343-347 (1994)) in
Corynebacterium glutamicum DSM 5715. Strain DSM 5715 is an AEC-resistant lysine producer. The vector pCR2. lpoxBint cannot replicate independently in DSM5715 and is retained in the cell only if it has integrated into the chromosome of DSM 5715. Selection of clones with pCR2. lpoxBint integrated into the chromosome was carried out by plating out the electroporation batch on LB agar (Sambrook et al . , , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which had been supplemented with 15 mg/1 kanamycin. For detection of the integration, the poxBint fragment was labeled with the Dig hybridization kit from Boehringer by the method of "The DIG System Users Guide for Filter Hybridization" of Boehringer Mannheim GmbH (Mannheim, Germany, 1993) .
Chromosomal DNA of a potential integrant was isolated by the method of Eikmanns et al. (Microbiology 140: 1817 - 1828 (1994) ) and in each case cleaved with the restriction enzymes Sail, Sad and Hindlll. The fragments formed were separated by agarose gel electrophoresis and hybridized at 68 aC with the Dig hybridization kit from Boehringer. The plasmid pCR2. lpoxBint mentioned in Example 9 had been inserted into the chromosome of DSM5715 within the chromosomal poxB gene. The strain was called DSM5715 : :pCR2. lpoxBint .
Example 12
Effect of over-expression of the zwf gene with simultaneous elimination of the poxB gene on the preparation of lysine
12.1 Preparation of the strain DSM5715 : :pCR2. lpoxBint/pEC- T18mob2zwf
The strain DSM5715 : :pCR2. lpoxBint was transformed with the plasmid pEC-Tl8mob2zwf using the electroporation method described by Liebl et al . , (FEMS Microbiology Letters, 53:299-303 (1989)). Selection of the transformants took place on LBHIS agar comprising 18.5 g/1 brain-heart infusion broth, 0.5 M sorbitol, 5 g/1 Bacto-tryptone, 2.5 g/1 Bacto-yeast extract, 5 g/1 NaCI and 18 g/1 Bacto- agar, which had been supplemented with 5 mg/1 tetracycline and 25 mg/1 kanamycin. Incubation was carried out for 2 days at 33 aC.
Plasmid DNA was isolated in each case from a transformant by conventional methods (Peters-Wendisch et al . , 1998, Microbiology 144, 915-927) , cleaved with the restriction endonucleases Xbal and Kpnl, and the plasmid was checked by subsequent agarose gel electrophoresis . The strain obtained in this way was called DSM5715 :pCR2. IpoxBint/pEC- Tl8mob2zwf .
12.2 Preparation of L-lysine
The C. glutamicum strain DSM5715 : :pCR2. IpoxBint/pEC- Tl8mob2zwf obtained in Example 12.1 was cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant was determined. For this, the strain was first incubated on an agar plate with the corresponding antibiotic (brain-heart agar with tetracycline (5 mg/1) and kanamycin (25 mg/1)) for 24 hours, at 33aC.The comparison strains were supplemented according to their resistance to antibiotics . Starting from this agar plate culture, a preculture was seeded (10 ml medium in a 100 ml conical flask) . The complete medium Cg III was used as the medium for the preculture.
Medium Cg III
NaCI 2.5 g/1
Bacto-Peptone 10 g/1
Bacto-Yeast extract 10 g/1
Glucose (autoclaved separately) 2% (w/v) The pH was brought to pH 7.4
Tetracycline (5 mg/1) and kanamycin (25 mg/1) were added to this. The preculture was incubated for 16 hours at 33 aC at > 240 rpm on a shaking machine. A main culture was seeded from this preculture such that the initial OD (660nm) of the main culture was 0.1. Medium MM was used for the main culture.
Medium MM
CSL (corn steep liquor) 5 g/1
MOPS (morpholinopropanesulfonic 20 g/1 acid)
Glucose (autoclaved separately) 58 g/1
(NH4)2S04 25 g/1
KH2P04 0.1 g/1
MgS04 * 7 H20 1.0 g/1
CaCl2 * 2 H20 10 mg/1
FeS04 * 7 H20 10 mg/1
MnS04 * H20 5.0mg/l
Biotin (sterile-filtered) 0.3 mg/1 Thiamine * HCI (sterile-filtered) 0.2 mg/1
L-Leucine (sterile-filtered) 0.1 g/1
CaC03 25 g/1
The CSL, MOPS and the salt solution were brought to pH 7 with aqueous ammonia and autoclaved. The sterile substrate and vitamin solutions were then added, as well as the CaC03 autoclaved in the dry state.
Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles. Tetracycline (5 mg/1) and kanamycin (25 mg/1) were added. Culturing was carried out at 33 aC and 80% atmospheric humidity.
After 72 hours, the OD was determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Munich) . The amount of lysine formed was determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
The result of the experiment is shown in Table 4. 2005/07563
Table 4
Example' 13
The zwf allele zwf(A243T)
Isolation and sequencing
The Corynebacterium glutamicum strain DM658 was prepared by multiple, non-directed mutagenesis, mutant selection and screening from C. glutamicum ATCC13032. The strain is resistant against the L-lysine analogue S- (2-aminoethyl) -L- cysteine (AEC) and has a feedback resistant aspartate kinase which is insensitive to mixtures of L-lysine, the L- lysine analogue S- (2-aminoethyl) -L-cysteine (AEC) and L- threonine. Strain DM658 is deposited at the Deutsche Sammlung fuer Mikroorganismen und Zellkulturen (DSMZ = German Collection of Microorganisms and Cell as DSM7431.
From the strain DM658, chromosomal DNA is isolated by conventional methods (Eikmanns et al . , Microbiology 140: 1817 - 1828 (1994)). With the aid of the polymerase chain reaction (PCR) , a DNA section which carries the zwf gene or allele is amplified. On the basis of the sequence of the zwf gene of C. glutamicum the following primer oligonucleotides from Example 1.2 are chosen for the PCR: zwf-forward (SEQ ID NO 11) :
5 ' -TCG ACG CGG TTC TGG AGC AG-3 '
zwf-reverse (SEQ ID NO 12) :
5 ' -CTA AAT TAT GGC CTG CGC CAG-3 '
The primers shown are synthesized by MWG Biotech (Ebersberg, Germany) and the PCR reaction is carried out by the standard PCR method of Innis et al . (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) . The primers allow amplification of a DNA section of approx. 1.85 kb in length, which carries the zwf allele.
The amplified DNA fragment of approx. 1.85 kb in length which carries the zwf allele of strain DM658 is identified by electrophoresis in a 0.8% agarose gel, isolated from the gel and purified by conventional methods (QIAquick Gel Extraction Kit, Qiagen, Hilden, Germany) .
The nucleotide sequence of the amplified DNA fragment or PCR product is determined by sequencing by MWG Biotech (Ebersberg, Germany) . The sequence of the PCR product is shown in SEQ ID NO: 21. The amino acid sequence of the Zwischenferment protein (Zwf protein) resulting with the aid of the Patentin program is shown in SEQ ID NO: 22.
The nucleotide sequence of the coding region of the zwf allele of strain DM658 contains at position 727 the base adenine. The position 727 of the nucleotide sequence in the coding region of the zwf-allele corresponds to position 1034 of the nucleotide sequence shown in SEQ ID NO: 21.
At position 727 of the nucleotide sequence of the coding region of the wild-type gene the nucleotide is the base guanine. The position 727 of the nucleotide sequence of the coding region of the wild-type gene corresponds to position 1264 in SEQ ID NO: 9. The amino acid sequence of the Zwischenferment protein of strain DM658 (Zwf(A243T)) contains at position 243 the amino acid threonine (SEQ ID NO: 22) . At the corresponding position of the wild-type protein is the amino acid alanine (SEQ ID NO: 10) . Accordingly the allele is referred to as zwf (A243T) .
SEQ ID NO: 23 shows an internal segment of the coding sequence of the zwf (A243T) allele comprising the guanine adenine transition (see position 137 of SEQ ID NO: 23) .
Example 14
Transfer of the zwf allele zwf(A243T)
14.1 Isolation of a DNA fragment which carries the zwf(A243T) allele
From strain DM658, chromosomal DNA is isolated by conventional methods (Eikmanns et al . , Microbiology 140: 1817 - 1828 (1994)) . A DNA section which carries the zwf (A243T) allele which contains the base adenine at position 727 of the coding region (CDS) instead of the bases guanine contained at this position in the wild-type gene is amplified with the aid of the polymerase chain reaction. On the basis of the sequence of the zwf gene of C. glutamicum, the following primer oligonucleotides are chosen for the polymerase chain reaction :
zwf_XL-Al (SEQ ID NO: 24) : 5" ga tct aga-agc teg cct gaa gta gaa tc 3N
zwf_XL-El (SEQ ID NO: 25) :
5N ga tct aga-gat tea cgc agt cga gtt ag 3N
The primers shown are synthesized by MWG Biotech (Ebersberg, Germany) and the PCR reaction is carried out by the standard PCR method of Innis et al. (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) . The primers allow amplification of a DNA section approx. 1.75 kb in length which carries the zwf (A243T) allele (SEQ ID NO: 26) . The primers moreover contain the sequence for a cleavage site of the restriction endonuclease Xbal, which is marked by underlining in the nucleotide sequence shown above .
The amplified DNA fragment of approx. 1.75 kb in length which carries the zwf (A243T) allele is cleaved with the restriction endonuclease Xbal, identified by electrophoresis in a 0.8% agarose gel and then isolated from the gel and purified by conventional methods (QIAquick Gel Extraction Kit, Qiagen, Hilden) .
14.2 Construction of an exchange vector
The Xbal DNA fragment of approx. 1.75 kb length containing the zwf (A243T) allele (see Example 14.1) is incorporated into the chromosome of the C. glutamicum strain DSM5715 by means of replacement mutagenesis using the sacB system as described by Schaefer et al. (Gene, 14, 69-73 (199.4)). This system allows for preparation and selection of allele exchanges occurring by homologous recombination.
The mobilizable cloning vector pKlδmobsacB is digested with the restriction enzyme Xbal and the ends are dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim, Germany) . The vector prepared in this way is mixed with the zwf (A243T) fragment approx. 1.75 kb in size and the mixture is treated with T4 DNA ligase (Amersham-Pharmacia, Freiburg, Germany) .
The E. coli strain S17-1 (Simon et al . , Bio/Technologie 1: 784-791, 1993) is then transformed with the ligation batch (Hanahan, In. DNA cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plasmid-carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989), which was supplemented with 25 mg/1 kanamycin.
Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme Pstl and subsequent agarose gel electrophoresis . The plasmid is called pKl8mobsacB_zwf (A243T) and is shown in Figure 6.
14.3 Transfer of the allele
The vector pKl8mobsacB_zwf (A243T) mentioned in Example 14.2 is transferred by conjugation by the protocol of Schaefer et al. (Journal of Microbiology 172: 1663-1666 (1990)) into' C. glutamicum strain DSM5715. The vector cannot replicate independently in DSM5715 and is retained in the cell only if it is integrated in the chromosome as the consequence of a recombination event. Selection for transconjugants, i.e. clones with integrated pKl8mobsacB_zwf (A243T) , is made by plating out the conjugation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold , Spring Harbor, New York, 1989), which is supplemented with 15 mg/1 kanamycin and 50 mg/1 nalidixic acid. Kanamycin- resistant transconjugants are plated out on LB dgar plates containing 25 mg/1 kanamycin and incubated for 24 hours at 33 °C. A kanamycin-resistant transconjugant is called DSM5715: :pKl8mobsacB_zwf (A243T) . As a result of the integration of plasmid vector pKl8mobsacB_zwf (A243T) in the chromosome of strain DSM5715, the strain obtained, i.e. DSM5715: :pKl8mobsacB_zwf (A243T) , contains the zwf wild type gene and the zwf (A243T) allele.
For selection of mutants in which excision of the plasmid has taken place as a consequence of a second recombination event, cells of the strain DSM5715 : :pKlδmobsacB_zwf (A243T) are cultured for 24 hours unselectively in LB liquid medium, and then plated out on LB agar with 10% sucrose and incubated for 30 hours.
The plasmid pKl8mobsacB_zwf (A243T) , like the starting plasmid pKlδmobsacB, contains, in addition to the kanamycin resistance gene, a copy of the sacB gene which codes for levan sucrase from Bacillus subtilis . The expression which can be induced by sucrose leads to the formation of levan sucrase, which catalyses the synthesis of the product levan, which is toxic to C. glutamicum. Only those clones in which the integrated plasmid pKl8mobsacB_zwf (A243T) has excised as the consequence of a second recombination event therefore grow on LB agar containing sucrose. Depending on the position of the second recombination event with respect to the mutation site either allele exchange (i.e. incorporation of the mutation) occurs or the original copy (i.e. the wild type gene) remains in the chromosome of the host.
Approximately 40 to 50 colonies are tested for the phenotype "growth in the presence of sucrose" and "non- growth in the presence of kanamycin" . In 4 colonies which show the phenotype "growth in the presence of sucrose" and "non-growth in the presence of kanamycin" , a region of the zwf gene spanning the zwf (A243T) mutation is sequenced, starting from the sequencing primer zf_l (SEQ ID NO:27), (prepared by GATC Biotech AG, Konstanz, Germany) to demonstrate that the mutation of the zwf (A243T) allele is present in the chromosome. The nucleotide sequence of primer zf_l is as follows:
zf_l (SEQ ID NO: 27) : 5 ggc tta eta cct gtc cat tc 3s
A clone which contains the base adenine at position 727 of the coding region (CDS) of the zwf gene and thus has the zwf (A243T) allele in its chromosome was identified in this manner. This clone was called strain DSM5715zwf2_A243T. Strain DSM5715zwf2_A243T was deposited at the Deutsche Sammlung fuer Mikroorganismen und Zellkulturen (DSMZ = German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) in accordance with the Budapest Treaty under DSM15237.
Example 15
Characterization and determination of glucose-6-phosphate dehydrogenase
15.1 Determination of the glucose-6-phosphate dehydrogenase activity of strain DM658
For characterization of the activity of the glucose-6- phosphate dehydrogenase enzyme encoded by the zwf allele zwf (A243T) strain DM658 is incubated for 24 hours in LB media (Merck KG, Darmstadt, Germany) . Culturing is carried out in a 25 ml volume in a 250 ml conical flask with baffles at 33 aC at 200 rpm on a shaking machine. For comparison the wild-type strain ATCC13032 is incubated in parallel. The biomass is collected by centrifugation and subsequently washed in a Tris-HCl (100 mM) buffer at pH 7,8. The cells are solubilized by using the Ribolyser system (Hybaid AG, Heidelberg, Germany) . By this method the cells are solubilized mechanically by using 1,6 g glass beads (0,2 μm in diameter) and 0,6 g of a solution of Tris- HCl (100 mM) /NaCI buffer (520 mM) at pH 7,8, containing the cells mentioned above. After centrifugation the supernatant is isolated and used as crude extract. An aliquot of the supernatant is used for the determination of the total protein concentration using the colorimetric BCA method (Pierce, Rockford, IL, USA, Order No. 23235ZZ) . Another aliquot is used for the determination of the glucose-6- phosphate dehydrogenase activity.
The glucose-6-phosphate dehydrogenase (EC 1.1.1.49) catalyses the reaction: glucose-6-phosphate + NADP+ =
6-phosphoglucono-δ-lactone + NADPH
The assay system for determination of the glucose-6- phosphate dehydrogenase activity contains lOOmM Tris-HCl (pH 7,8), 10 mM MgCl2 and 260 μM NADP+. The reaction is initiated by addition of glucose-6-phosphate to give a final concentration of 7 mM glucose-6-phosphate. The absorption of NADPH is monitored at 340 nm with the Hitachi U3200 spectrophotometer (Nissei Sangyo, Duesseldorf, Germany) at 25°C.
For calculation of the volumetric enzyme activity in Units per ml the following formula is used:
change of absorption of NADPH at 340 nm per minute
6.22 * volume of crude extract used for the assay (ml]
To calculate the specific enzyme activity in Units per mg (U/mg; mU = milliunits/mg) total protein the enzyme activity is divided by the protein concentration of the crude extract.
Measurement of the glucose-6-phosphate dehydrogenase activity in presence of NADPH is done in an assay system containing 100 mM Tris-HCl (pH 7,8), 10 mM MgCl2, 260 μM NADP+ and 260 μM NADPH. The reaction is initiated by the addition of glucose-6-phosphate to give a final concentration of 7 mM. The calculation of the enzyme activity in the presence of NADPH is done in the same way as described before.
The results of this experiment are shown in Table 5. Table 5
15.2 Determination of the glucose-6-phosphate dehydrogenase activity of strain DSM5715zwf2_A243T
For determination of the activity of the glucose-6- phosphate dehydrogenase enzyme encoded by the zwf allele zwf (A243T) contained in strain DSM5715zwf2_A243T the strain is incubated for 24 hours in LB media (Merck KG, Darmstadt, Germany) . Culturing is carried out in a 25 ml volume in a 250 ml conical flask with baffles at 33 aC at 200 rpm on a shaking machine. For comparison the parental strain DSM5715 having a wild-type zwf gene is incubated in parallel. The preparation of the biomass is done as described in Example 15.1.
Measurement of the glucose-6-phosphate dehydrogenase activity in presence of its reaction end product NADPH is done in an assay system containing lOOmM Tris-HCl (pH 7,8), 10 mM MgCl2, 260 μM NADP+, 7 mM glucose-6-phosphate and 400 μM NADPH. The enzyme activity in the presence of NADPH is calculated in the same way as described before.
The results of this experiment are shown in Table 6. Table 6
Example 16
Production of L-lysine
The C. glutamicum strains DSM5715 and DSM5715zwf2_A243T, obtained in Example 14, are cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant is determined.
For this, the strains are first incubated on an agar plate for 24 hours at 33 aC. Starting from this agar plate culture, in each case a preculture is seeded (10 ml medium in a 100 ml conical flask) . The medium MM is used as the medium for the precultures . The precultures are incubated for 24 hours at 33aC at 240 rpm on a shaking machine. In each case a main culture is seeded from these precultures such that the initial OD (660 nm) of the main cultures is 0.1. The Medium MM is also used for the main cultures. Medium MM
CSL 5 g/1
MOPS 20 g/1
Glucose (autoclaved separately) 50 g/1 Salts: (NH4)2S04 25 g/1
KH2P04 0.1 g/1
MgS04 * 7 H20 1.0 g/1
CaCl2 * 2 H20 10 mg/1
FeS04 * 7 H20 10 mg/1
MnS04 * H20 5.0mg/l
Biotin (sterile-filtered) 0.3 mg/1 Thiamine * HCI (sterile-filtered) 0.2 mg/1
L-Leucine (sterile-filtered) 0.1 g/1
CaC03 25 g/1
The CSL (corn steep liquor) , MOPS (morpholmopropanesulfonic acid) and the salt solution are brought to pH 7 with aqueous ammonia and autoclaved. The sterile substrate and vitamin solutions, as well as the CaC03 autoclaved in the dry state, are then added.
Culturing is carried out in a 10 ml volume in a 100 ml conical flask with baffles at 33 aC and 80% atmospheric humidity.
After 72 hours, the OD is determined at a measurement wavelength of 660 nm with a Biomek 1000 (Beckmann Instruments GmbH, Munich) . The amount of lysine formed is determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
The result of the experiment is shown in Table 7. Table 7
Example 17
Replacement of the zwf wild-type gene of strain DM1697 by the zwf(D245S) allele
17.1 Isolation of a DNA fragment which carries the zwf gene
The Corynebacterium glutamicum strain DM1697 was produced by multiple rounds of non-directed mutagenesis, selection and mutant election from C. glutamicum ATCC21527. ATCC21527 is auxotroph for L-leucine and L-homoserine. The strain DM1697 in contrast is prototroph for L-leucine and L- homoserine, resistant to the lysine analogue S- (2- aminoethyl) -L-cysteine and has a feed back-resistant aspartate kinase which is insensitive to inhibition by a mixture of S- (2-aminoethyl) -L-cysteine and threonine (in each case 25 mM) .
From the strain DM1697, chromosomal DNA is isolated by the conventional methods (Eikmanns et al . , Microbiology 140: 1817 - 1828 (1994)). A DNA section which carries the zwf gene is amplified with the aid of the polymerase chain reaction. On the basis of the sequence of the zwf gene known for C. glutamicum from example 1, the following primer oligonucleotides are chosen for the polymerase chain reaction: zwf_XL-Al ( SEQ ID NO : 24 ) :
5N ga tctaga age teg cct gaa gta gaa tc 3
zwf_XL-El (SEQ ID NO: 25) :
5 ga tctaga gat tea cgc agt cga gtt ag 3"
The primers shown are synthesized by MWG Biotech (Ebersberg, Germany) and the PCR reaction is carried out by the standard PCR method of Innis et al . (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) . The primers allow amplification of a DNA section approx. 1.75 kb in length which carries the zwf gene (SEQ ID NO: 38) . The primers moreover contain the sequence for a cleavage site of the restriction endonuclease Xbal, which is marked by underlining in the nucleotide sequence shown above.
The amplified DNA fragment of approx. 1.75 kb in length which carries the zwf gene is cleaved with the restriction endonuclease Xbal, identified by electrophoresis in a 0.8% agarose gel and then isolated from the gel and purified by conventional methods (QIAquick Gel Extraction Kit, Qiagen, Hilden) .
17.2 Construction of the exchange vector pK18mobsacB_zwf
The mobilizable cloning vector pKlδmobsacB is digested with the restriction enzyme Xbal and the ends are dephosphorylated with alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim, Germany) . The vector prepared in this way is mixed with the zwf fragment approx. 1.75 kb in size and the mixture is treated with T4 DNA ligase (Amersham-Pharmacia, Freiburg, Germany) .
The E. coli strain DH5α (Brown (ed.) Molecular Biology Labfax, BIOS Scientific Publishers, Oxford, UK, 1991) is then transformed with the ligation batch (Hanahan, In. DNA cloning. A Practical Approach. Vol. 1, ILR-Press, Cold Spring Harbor, New York, 1989) . Selection of plasmid- carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989) , which was supplemented with 50 mg/1 kanamycin.
Plasmid DNA is isolated from a transformant with the aid of the QIAprep Spin Miniprep Kit from Qiagen and checked by restriction cleavage with the enzyme Xbal and subsequent agarose gel electrophoresis . The plasmid is called pKl8mobsacB_zwf and is shown in figure 7.
17.3 Construction of the zwf (D245S) allele by means of site-specific mutagenesis of the wild-type zwf gene
The site-directed mutagenesis is carried out with the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, USA) . Three point mutations (substitutions) are introduced into the nucleotide sequence of the zwf wild type gene shown in SEQ ID NO: 38. These are substitution of guanine by thymine at position 861, of adenine by cytosine at position 862 and of thymine by adenine at position 863 of the nucleotide sequence. The nucleotide sequence created this way is shown in SEQ ID NO: 39 and encodes a variant Zwf Protein, having a serine instead of aspartate at position 245 of its amino acid sequence.
The allele is called zwf(D245S). To generate the mutation described, the following primer oligonucleotides are chosen for the linear amplification:
DM_D245Sa (SEQ ID NO: 40):
5 ' AGATCACCATGGCTGAA (TCA) ATTGGCTTGGGTGGAC 3 '
DM_D245Sb (SEQ ID NO: 41) :
5 ' GCACGTCCACCCAAGCCAAT (TGA) TTCAGCCATGGTG 3 '
The primers shown are synthesized by MWG Biotech. The codon for serine, which is to replace the aspartate at position 245 of the amino acid sequence derived from the zwf gene, is marked by parentheses in the nucleotide sequence shown above. The plasmid pKl8mobsacB_zwf described in Example
17.2 is employed with the two primers, which are each complementary to a strand of the plasmid, for linear amplification by means of Pfu Turbo DNA polymerase. By this lengthening of the primers, a mutated plasmid with broken circular strands is formed. The product of the linear amplification is treated with Dpnl - this endonuclease cleaves the methylated and half-methylated template DNA specifically. The newly synthesized broken, mutated vector DNA is transformed in the E. coli strain XLl Blue (Bullock, Fernandez and Short, BioTechniques (5) 376-379 (1987)). After the transformation, the XLl Blue cells repair the nicks in the mutated plasmids . Selection of the transformants was carried out on LB medium with kanamycin 50 mg/1. The plasmid obtained is checked by means of restriction cleavage, after isolation of the DNA, and identified by electrophoresis. The DNA sequence of the mutated DNA fragment is checked by sequencing. The sequence of the PCR product corresponds to the nucleotide sequence shown in SEQ ID NO: 39. The resulting plasmid is called pKl8mobsacB_zwf (D245S) . A map of the plasmid is shown in Figure 8.
17.4 Replacement of the zwf wild-type gene of strain DM1697 by the zwf(D245S) allele
The plasmid pKl8mobsacB_zwf (D245S) described in Example
17.3 is transferred as described in Example 14.3 into the C. glutamicum strain DM1697 by conjugation. Selection is made for targeted recombination events in the chromosome of C. glutamicum DM1697 as described in Example 14.3.
Depending on the position of the second recombination event during excision of the plasmid, the zwf allele containing the mutation manifests itself in the chromosome at the zwf locus, or the original zwf locus of the host remains. Approximately 40 to 50 colonies are tested for the phenotype "growth in the presence of sucrose" and "non- growth in the presence of kanamycin" . In 6 colonies which show the phenotype "growth in the presence of sucrose" and "non-growth in the presence of kanamycin" , a region of the zwf gene spanning the zwf (D245S) mutation is sequenced, starting from the sequencing primer zf_2 (SEQ ID NO: 42) (prepared by GATC Biotech AG, Konstanz, Germany) , to demonstrate that the mutation of the zwf (D245S) allele is present in the chromosome. The nucleotide sequence of primer zf_2 is as follows :
zf_2 (SEQ ID NO: 42) :
5N TTC TGT GTT CCG CAT CGA CC 3 "
A clone which contains the bases thymine, cytosine and adenine at positions 733, 734 and 735 respectively of the coding region (CDS) of the zwf gene and thus has the zwf (D245S) allele (SEQ ID NO: 36) in its chromosome was identified in this manner. The positions 733, 734 and 735 of the nucleotide sequence of the coding region of the zwf allele corresponds to positions 861, 862 and 863 in SEQ ID ' No: 39. This clone was called strain DMl697_zwf (D245S) .
Strain DMl697_zwf (D245S) was deposited at the Deutsche Sammlung fuer Mikroorganismen und Zellkulturen (DSMZ. = German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) in accordance with the Budapest Treaty under DSM15632.
17.5 Determination of the glucose-6-phosphate dehydrogenase activity of strain DSM15632
For determination of the activity of the glucose-6- phosphate dehydrogenase enzyme encoded by the zwf (D245S) allele contained in strain DSM15632 the strain is incubated for 24 hours in LB media (Merck KG, Darmstadt, Germany) . Culturing is carried out in a 25 ml volume in a 250 ml conical flask with baffles at 33 aC at 200 rpm on a .shaking machine. For comparison the parental strain DM1697 having a wild-type zwf gene is incubated in parallel. The preparation of the biomass is done as described in Example 15.1.
Measurement of the glucose-6-phosphate dehydrogenase activity in presence of its reaction end product NADPH is done in an assay system containing lOOmM Tris-HCl (pH 7,8), 10 mM MgCl2, 260 uM NADP+, 7 mM glucose-6-phosphate and 400 μM NADPH. The enzyme activity in the presence of NADPH is calculated in the same way as described before.
The results of this experiment are shown in Table 8
Table 8
17.6 Preparation of L-lysine
The cells of C. glutamicum strain DSM15632 obtained in Example 17.4 grown on an agar plate (brain heart agar) for 24 hours at 33 °C were inoculated into 50ml of LSSl medium (Ohnishi et al . , Applied Microbiology and Biotechnology 58:217-223 (2002)) with 5% glucose instead of 5% sucrose in a 500ml conical flask with baffels . The cultivation at 33°C on a rotary shaker was stopped in the early stationary phase after the total depletion of the initially added sugar. 4 ml of the seed broth were used to inoculate a 2 L fermentor (Biostat B reactor, B. Braun, Melsungen, Germany) containing 1000 ml of medium LPGl (Ohnishi et al . , Applied Microbiology and Biotechnology 58:217-223 (2002)).
After the sugar initially added was consumed, a solution containing 50% (w/v) glucose and 3,5% (w/v) (NH4)2S04 was continuously fed until the total culture volume in the fermentor reached 2000ml. The culture was performed with a p02 >20%, aeration at >0,5 1/min, and at 33°C. The pH was maintained at 7,0. The amount of lysine formed was determined with an amino acid analyzer from Eppendorf- BioTronik (Hamburg, Germany) by ion exchange chromatography and post-column derivation with ninhydrin detection.
The result of the experiment is shown in Table 9.
Table 9
Example 18
Construction of C. glutamicum DM1698
The C. glutamicum strain DM1698 was constructed on the basis of C. glutamicum DM1697, mentioned in example 17.1.
It harbors the zwf (A243T) -allele which was introduced into strain DM1697 using the exchange vector pKl8mobsacB_zwf (A243T) , constructed in example 14.2. The zwf (A243T) -allele was transferred into DM1697 by conjugation, exchanged and selected as described in example 14.3. The resulting strain is called DM1698, used in this example.
As shown in example 16 for the strains DSM5715 and DSM5715zwf2_A243T, the integration of the mutation zwf (A243T) into the zwf-gene improves the production of L- lysine. This also applies to the strain DM1698, harboring the zwf (A243T) -allele and as a result is a better producer of L-lysine than the parental strain DM1697.
Example 19
Introduction of a 90 basebairs deletion into the zwf wild type gene of strain DM1697 and determination of the activity of the encoded glucose-6-phosphate dehydrogenase.
The experiments of example 19 and example 20 are designed to demonstrate that the 90 basepairs of the 5 'terminus of the coding sequence of the zwf gene of Corynebacterium glutamicum (see for example the zwf wild type gene in SEQ ID NO: 9 or the zwf (A243T) -allele shown in SEQ ID NO: 21) which are not included in the coding sequence of the zwf gene described in JP-A-092244661 (see SEO ID NO: 7), are required for enzymatic activity of the glucose-6-phosphate dehydrogenase .
In example 19, this is proven for the wild type gene (SEQ ID NO: 9) and the encoded glucose-6-phosphate dehydrogenase, (SEQ ID NO: 10) . In example 20 it is proven for the zwf (A243T) -allele (SEQ ID NO: 21) and the encoded glucose- 6-phosphate) dehydrogenase (SEQ ID NO: 22) which are described in example 13.
In this example, the 90 basepairs are deleted from the zwf wild type gene of C. glutamicum strain DM1697 (see example 17.1) in order to compare the enzymatic activity of the glucose-6-phosphate dehydrogenase encoded by the wild type allele before and after deletion of the 90 basepairs. 19.1 Cloning of a zwf deletion fragment into the vector . pCRBluntll TOPO
Chromosomal DNA is isolated from the strain ATCC13032 by the method of Tauch et al. (1995, Plasmid 33:168-179). On the basis of the sequence of the zwf gene known for C. glutamicum from Example 1, the oligonucleotides described below are chosen for generation of the zwf deletion fragment by means of the polymerase chain reaction (PCR) by the gene SOEing method (Gene Splicing by Overlap Extension, Horton, Molecular Biotechnology 3: 93-98 (1995)).
zwfA (SEQ ID NO: 43) :
5'- AT TCTAGA CAC CTT GAT CTT CTC CGT TG - 3 '
zwfB (SEQ ID NO: 44) :
5 '- GAT GGT' AGT GTC ACG ATC CT - 3 '
zwfC (SEQ ID NO: 45) :
5'- AGG ATC GTG ACA CTA CCA TCA TGG TGA TCT TCG GTG TCA C -' 3'
zwfD (SEQ ID NO: 46) :
5 '- AT TCTAGA GCG GAG GTT TTA TCC AAT GG - 3 '
The primers shown are synthesized by MWG Biotech (Ebersberg, Germany) and the PCR reaction is carried out by the standard PCR method of Innis et al . (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) with the Vent DNA polymerase from NewEnglandBiolabs (Germany, Product Description Vent DNA Polymerase) .
The primers zwfA and zwfD contain in each case an inserted cleavage site for the restriction enzyme Xbal, which is marked by underlining in the nucleotide sequence shown above. The first 20 bases of Primer zwfC contain the reverse complementary sequence of the Primer zwfB. With the aid of the polymerase chain reaction the primers zwfA and zwfB enable the amplification of a 710 bp DNA fragment and the Primers zwfC and zwfD enable the amplification of a 850 bp DNA fragment. The a plificates are examined by subsequent agarose-gel electrophoresis in an 0,8% agarose-gel, isolated from the agarose-gel with the High Pure PCR Product Pμrification Kit (Roche Diagnostics GmbH, Mannheim, Deutschland) , and used together as a DNA template in another PCR reaction using the primers zwfA and zwfD. This results in the production of a zwf deletion fragment, 1560 bp in size (see also SEQ ID NO: 47) .
The amplified product is subsequently examined in a 0,8% agarose-gel .
The PCR product obtained is cloned in the vector pCRBluntll TOPO (Zero Blunt TOPO PCR Cloning Kit, Invitrogen,
Deutschland) and then the E. coli strain TOP10 (Grant et al . , Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is transformed with the ligation batch in accordance with the manufacturer's instructions. Selection of plasmid-carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989) , which has been supplemented with 50 mg/1 kanamycin.
Plasmid DNA is isolated from a transformant with the aid of the High Pure Plasmid Isolation Kit (Roche Diagnostics GmbH, Mannheim, Germany) and checked by restriction with the restriction enzyme Xbal and subsequent agarose gel electrophoresis (0.8%). The plasmid is called pCRBluntII_ABlCDl and is shown in figure 9. 19.2. Construction of the replacement vector pK18mobsacB_zwfdelta90bp
The zwf deletion fragment, called "deltazwf90" in figures 9 and 10, is isolated by complete cleavage of the vector pCRBluntII_ABlCDl, obtained in Example 19.1, with the restriction enzyme Xbal. After separation in an agarose gel (0.8%), the zwf deletion fragment of approx. 1600 bp in size is isolated from the agarose gel with the aid of the High Pure PCR Product purification Kit (Roche Diagnostics GmbH, Mannheim, Germany) .
The zwf deletion fragment treated in this way is employed for ligation with the mobilizable cloning vector pKlδmobsacB (Schafer et al., Gene 14: 69-73 (1994)). This was cleaved open beforehand with the restriction enzyme Xbal and then dephosphorylated with shrimp alkaline phosphatase (Roche Diagnostics GmbH, Mannheim, Germany) . The vector DNA is mixed with the zwf deletion fragment and the mixture is treated with T4 DNA ligase (Amersham- Pharmacia, Freiburg, Germany) .
Then the E. coli strain S17-1 (Simon et al . ,Bio/Technologie 1: 784-791, 1993) is transformed with the ligation batch. Selection of plasmid-carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989), which has been supplemented with 50 mg/1 kanamycin.
Plasmid DNA is isolated from a transformant with the aid of the High Pure Plasmid Isolation Kit (Roche Diagnostics GmbH, Mannheim, Deutschland) and checked by restriction with the restriction enzyme Xbal and subsequent agarose gel electrophoresis (0.8%). Additionally the cloned zwf deletion fragment is verified by means of sequencing by GATC Biotech AG (Konstanz, Germany) . The plasmid is called pKl8mobsacB_zwfdelta90bp and is shown in figure 10. 19.3 Introduction of the 90 basepairs deletion into the zwf wild type gene of strain DM1697
The strain DM1697 is described in example 17.1, it carries a zwf wild type gene.
The plasmid pKl8mobsacB_zwfdelta90bp described in Example 19.2 is transferred as described in Example 14.3 into the C. glutamicum strain DM1697 by conjugation (Schafer et al . , Applied and Environmental Microbiology 60, 756-759 (1994)).' Selection is made for targeted recombination events in the chromosome of C. glutamicum DM1697 as described in Example 14.3. Depending on the position of the second recombination event, after the excision of the plasmid either the zwf allele carrying the 90 bp deletion manifests itself in the chromosome at the zwf locus, or the original zwf locus of the host remains .
Approximately 40 to 50 colonies are tested for the phenotype "growth in the presence of sucrose" and "non- growth in the presence of kanamycin". In 30 colonies which show the phenotype "growth in the presence of sucrose" and "non-growth in the presence of kanamycin", a region of the zwf gene spanning the zwf deletion is amplified by polymerase chain reaction with Taq DNA Polymease (Qiagen, Hilden, Germany) using the standard PCR method described by Innis et al . (PCR protocols. A guide to methods and applications, 1990, Academic Press), to demonstrate that the 90 bp deletion within the zwf allele is present in the chromosome.
PCR reaction was performed using the oligonucleotides described below (synthetised by MWG Biotech, Ebersberg) :
zwfil (SEQ ID NO: 48) :
5"- GGC GTT GAC TTG GCA GAT GT - 3 "
zwfi2 (SEQ ID NO: 49):
5 - GCA GAC CGC TGT GAA GGA AT - 3 This results in the amplification of a PCR fragment of 581 bp in size which indicates the presence of the 90 bp deletion, or a PCR fragment of 671 bp in size which indicates the zwf wild type sequence. The amplified product is subsequently examined in a 0,8% agarose-gel .
A C. glutamicum strain containing the zwf deletion allele is thus identified, isolated and called DMl697deltazwf90bp.
19.4 Determination of the glucose-6-phosphate dehydrogenase activity of strain DMl697deltazwf90bp
For determination of the activity of the glucose-6- phosphate dehydrogenase enzyme encoded by the zwf deletion allele contained in strain DM1697deltazwf90bp the strain is, incubated for 24 hours in LB media (Merck KG, Darmstadt, Germany) . Culturing is carried out in a 25 ml volume in a 250 ml conical flask with baffles at 33 aC at 200 rpm on a shaking machine. For comparison the parental strain DM1697 is incubated in parallel . The preparation of the biomass is done as described in Example 15.1. Measurement of the glucose-6-phosphate dehydrogenase activity is done in an assay system containing 100 mM Tris- HCl (pH 7,5) + 1 mM DTT, 15 mM MgCl2, 1,5 mM NADP+ and 10 mM glucose-6-phosphate. The enzyme activity is calculated in the same way as described before. The results of this experiment are shown in Table 10.
Table 10
Example 20
Introduction of the 90 basepairs deletion into the zwf (A243T) -allele of strain DM1698 and determination of the activity of the encoded glucose-6-phosphate dehydrogenase.
20.1 Introduction of the 90 basepairs deletion into the zwf (A243T) -allele of strain DM1698
The plasmid pKl8mobsacB_zwfdelta90bp described in Example 19.2 is transferred as described in Example 14.3 into the C. glutamicum strain DM1698 (see example 18) by conjugation (Schafer et. al., Applied and Environmental Microbiology 60,' 756-759 (1994)). Selection is made for targeted recombination events in the chromosome of C. glutamicum DM1698 as described in Example 14.3. Depending on the position of the second recombination event, after the excision of the plasmid either the zwf allele carrying the 90 basepairs deletion manifests itself in the chromosome at the zwf locus, or the original zwf locus of the host remains . Approximately 40 to 50 colonies are tested for the phenotype "growth in the presence of sucrose" and "non- growth in the presence of kanamycin" . In 30 colonies which show the phenotype "growth in the presence of sucrose" and "non-growth in the presence of kanamycin", a region of the zwf gene spanning the zwf deletion is amplified by polymerase chain reaction with Taq DNA Polymease (Qiagen, Hilden, Germany) using the standard PCR method described by Innis et al . (PCR protocols. A guide to methods and applications, 1990, Academic Press), to demonstrate that the deletion within the zwf allele is present in the chromosome. PCR reaction was performed using the oligonucleotides described below (synthetised by MWG Biotech, Ebersberg) :
zwfil (SEQ ID NO: 48) :
5'~ GGC GTT GAC TTG GCA GAT GT - 3 v
zwfi2 (SEQ ID NO: 49) :
5X - GCA GAC CGC TGT GAA GGA AT - 3
This results in the formation of a DNA fragment of 581 bp in size, bearing the 90 bp deletion, or a DNA fragment of 671 bp in size, bearing the corresponding zwf wild type sequence.
The amplified product is subsequently examined in a 0,8% agarose-gel.
A C. glutamicum strain containing the zwf deletion allel is isolated and called DMl698deltazwf90bp(A243T) .
The plasmid pKl8mobsacB_zwfdelta90bp from example 19.2 was used to integrate the 90 basepairs deletion into the zwf (A243T) allele of strain DM1698. The nucleotide sequence of the zwf deletion fragment contained in the plasmid carries from positions 711 to 1554 of its nucleotide sequence (SEQ ID NO: 47) the nucleotides 91 to 934 of the coding sequence of the wild type gene (SEQ ID NO: 9) . They code for the amino acids 31 to 311 of the zwf wild type protein (SEQ ID NO:10), which includes the wild type sequence at position 243 of the amino acid sequence. As a result of the conjugation it is possible that the zwf (A243T) mutation of strain DM1698 has been replaced by the zwf wild type allele of the replacement vector pKl8mobsacB_zwfdelta90bp within the conjugation.
In order to verify that the mutation zwf (A243T) is still present in the chromosome of strain
DMl698deltazwf90bp(A243T) , the mutation is detected with the aid of the LightCycler (Roche Diagnostics GmbH, Mannheim, Germany) .
The LightCycler combines a thermocycler with fluorescence detection.
Chromosomal DNA is isolated from the strain
DMl698deltazwf90bp(A243T) by the method of Tauch et al . (1995, Plasmid 33: 168-179). In the first phase a DNA fragment of approximately 0,3 kb of the chromosome of DMl698deltazwf90bp(A243T) , which contains the zwf(A243T) mutation, is amplified with the aid of the PCR reaction (Innis et al . , PCR protocols. A guide to methods and applications, 1990, Academic Press) . The PCR reaction was performed with the oligonucleotides described below (synthetised by MWG Biotech, Ebersberg) :
LC-zwfl (SEQ ID NO: 50) :
5'- tccgcatcgaccactatttg -3'
LC-zwf2 (SEQ ID NO: 51):
5'- cgctggcacgaaagaaattg -3'
In the second phase, two oligonucleotides of different sizes, labelled with different fluorescent markers (LightCycler (LC) -Red640 and Fluorescein) are used.
Hybridisation occurs within the sequence, where the mutation zwf (A243T) is localized. With the aid of the
"Fluorescence Resonance Energy Transfer"-method (FRED) the presence of the mutation can be detected. The following oligonucleotides, used for hybridization, were synthetised by TIB MOLBIOL (Berlin, Germany) : zwf243 -C ( SEQ ID No : 52 ) :
5 s - LC-Red640 - tatcttcagtcatggtgatc - (p) 3s
zwf243-A (SEQ ID No: 53): 5V- gtcgtagtaaccagcacgtccacccaagcc - Fluorescein 3
This way it is proven that the strain
DMl698deltazwf90bp(A243T) still contains the mutation zwf(A243T). It harbors the zwf-allele zwfdelta90bp (A243T) which is shown in SEQ ID NO: 54; the corresponding amino acid sequence of the encoded glucose-6-phosphate dehydrogenase is shown in SEQ ID NO: 55.
20.2 Determination of the glucose-6-phosphate dehydrogenase activity of strain DMl698deltazwf90bp (A243T)
For determination of the activity of the glucose-6- phosphate dehydrogenase enzyme encoded by the zwfdelta90bp (A243T) allele contained in strain DMl698deltazwf90bp(A243T) the strain is incubated for 24 hours in LB media (Merck KG, Darmstadt, Germany) . Culturing is carried out in a 25 ml volume in a 250 ml conical flask with baffles at 33 aC at 200 rpm on a shaking machine. For comparison the parental strain DM1698 having a zwf (A243T)- allele is incubated in parallel . The preparation of the biomass is done as described in Example 15.1.
Measurement of the glucose-6-phosphate dehydrogenase activity is done in an assay system containing 100 mM Tris-, HCI (pH 7,5) + 1 mM DTT, 15 mM MgCl2, 1 , 5 mM NADP+ and 10 mM glucose- 6-phosphate. The enzyme activity is calculated in the same way as described before.
The results of this experiment are shown in Table 10. Table 10
Example 21
Determination of the expression of two plasmid-encoded zwf- alleles In this example, two plasmids for the expression of two different zwf alleles are constructed and tested for the restoration of the enzymatic activity of the inactive glucose-6-phosphate dehydrogenase of strain DMl698zwfdelta90bp(A243T) , obtained in example 20.1. The tested zwf alleles are zwfL and zwfS, wherein the "L" is the abbreviation for "long" and the "S" is the abbreviation' for "short" . The allele zwfL harbors the mutation zwf (A243T) and includes the 90 basepairs of the 5 '-region of the coding sequence of the zwf gene (as shown for the wild type gene in SEQ ID NO: 9 and for the zwf (A243T)- allele in SEQ ID NO: 21) . The allele zwfS is also harboring the mutation zwf(A243T), but the 90 basepairs of the 5'- region of the coding sequence of the zwf gene are deleted (as shown for the wild type gene in SEQ ID NO: 7) . 21.1. Amplification of the alleles zwfS and zwfL
The zwf alleles zwfS and zwfL are amplified using the polymerase chain reaction (PCR) and the synthetic oligonucleotides which are described below. Chromosomal DNA is isolated from the strain DM658, which is harboring the allele zwf(A243T), by the method of Tauch et al . (1995, Plasmid 33:168-179). On the basis of the sequence of the zwf gene known for C. glutamicum from Example 1, primers are chosen so that the amplified fragments contain the coding regions of the zwf allels and 25 basepairs of the upstream-region thereof, but not possible promoter regions. In addition, suitable sites for restriction enzymes which allow cloning into the target vector are inserted. The sequences of the PCR primers and the inserted cleavage site for the restriction enzyme Sail (sequence underlined) are described below.
zwfRBSKsee also SEQ ID NO: 56):
5'- AT GTCGAC AAG AAA GGA TCG TGA CAC TAC-3 '
zwfRBS2(see also SEQ ID NO: 57):
5'- AT GTCGAC CCC CCG CAT CGC TGG CC-3 '
zwfRBSE(see also SEQ ID NO: 58) :
5'- AT GTCGAC ATC GCT TTC GGA GTC AGT GA-3 '
The primers shown are synthesized by MWG Biotech (Ebersberg, Germany) and the PCR reaction is carried out by the standard PCR method of Innis et al. (PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) with the Vent DNA polymerase from NewEnglandBiolabs (Germany, Product Description Vent DNA Polymerase) .
With the aid of the polymerase chain reaction the primers zwfRBSl and zwfRBSE enable the amplification of a 1732 bp DNA fragment (see also SEQ ID NO: 59) called zwfL which includes the coding sequence for the expression of a Zwf protein consisting of 514 amino acids (SEQ ID NO: 60) . The primers zwfRBS2 and zwfRBSE enable the amplification of a 1642 bp DNA fragment (see also SEQ ID NO: 61) called zwfS which includes the coding sequence for the expression of a Zwf protein consisting of 484 amino. acids (SEQ ID NO: 62) . The amplificates are examined by subsequent agarose-gel electrophoresis in an 0,8% agarose-gel, isolated from the agarose-gel with the High Pure PCR Product Purification Kit (Roche Diagnostics GmbH, Mannheim, Germany) .
The PCR products obtained are cloned in the vector pCRBluntll TOPO (Zero Blunt TOPO PCR Cloning Kit, Invitrogen, Germany) and then the E. coli strain TOP10 (Grant et al., Proceedings of the National Academy of Sciences USA, 87 (1990) 4645-4649) is transformed with the ligation batch in accordance with the manufacturer's instructions. Selection of plasmid-carrying cells is made by plating out the transformation batch on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor, New York, 1989), which has been supplemented with 50 mg/1 kanamycin.
Plasmid DNA is isolated from a transformant with the aid of the High Pure Plasmid Isolation Kit (Roche Diagnostics GmbH,, Mannheim, Germany) and checked by restriction with the restriction enzyme Sail and subsequent agarose gel electrophoresis (0.8%). The obtained plasmids are called pCRBluntII_zwfL (shown in figure 11) and pCRBluntII_zwfS (shown in figure 12) .
21.2. Cloning of the alleles zwfS and zwfL in the vector pZ8-l
The E. coli - C. glutamicum shuttle expression vector pZ8-l (EP 0 375 889) was employed as the base vector for expression in C. glutamicum as well as in E. coli. DNA of this plasmid was cleaved completely with the restriction enzyme Sail (Invitrogen, Germany) and then dephosphorylated' with shrimp alkaline phosphatase (Roche Diagnostics GmbH, Mannheim, Germany) . The zwfL allele is isolated by complete cleavage of the vector pCRBluntII_zwfL, obtained in Example 21.1, with the restriction enzyme Sail. The zwfS allele is isolated by complete cleavage of the vector pCRBluntII_zwfS, obtained in Example 21.2, with the restriction enzyme Sail. After separation in an agarose gel (0.8%), the zwfL fragment of approx. 1.7 kb in size and the zwfS fragment of approx. 1.6 kb in size are isolated from the agarose gel with the aid of the High Pure PCR Product purification Kit (Roche Diagnostics GmbH, Mannheim, Germany) .
The zwfL fragment and the zwfS fragment isolated from the agarose gel are mixed with the vector pZ8-l prepared as mentioned above and the batches are treated with T4 DNA ligase (Amersham Pharmacia, Freiburg, Germany) .
The ligation batches are transformed in the E. coli strain' DH5 (Hanahan, In: DNA cloning. A Practical Approach. Vol. I. IRL-Press, Oxford, Washington DC, USA) . Selection of plasmid-carrying cells is made by plating out the transformation batches on LB agar (Lennox, 1955, Virology, 1:190) with 50 mg/1 kanamycin. After incubation overnight at 37 aC, recombinant individual clones are selected. Plasmid DNA is isolated from a transformant with the aid of the High Pure Plasmid Isolation Kit (Roche Diagnostics GmbH, Mannheim, Germany) in accordance with the manufacturer's instructions and checked by restriction with the restriction enzyme Sail and subsequent agarose gel electrophoresis (0.8%). Additionally the cloned zwf alleles are verified by means of sequencing by GATC Biotech AG (Konstanz, Germany) with the following primers:
GATC-Rl_neu-29234 (SEQ ID NO: 63)
5 - GGAACACAGAAGATTCTG-3N
GATC-Fl_neu-29233 (SEQ ID NO: 64)
5N - CCGTGTTACTGAGATTGC-3 N GATC-zwf_int-27334 (SEQ ID NO: 65)
5 N - TGGCTGAATCCACCGAAGAA-3 v
The resulting plasmids are called pZ8-l_zwfL (shown in figure 13) and pZ8-l_zwfS (shown in figure 14).
21.3. Preparation of the strains DMl698/pZ8-l, DMl698zwfdelta90bp(A243T) /pZ8-l, DMl698zwfdelta90bp(A243T) /pZ8-l_zwfL and DMl698zwfdelta90bp (A243T) /pZ8-l_zwfS
The vector pZ8-l without inserted fragment is electroporated by the electroporation method of Tauch et al. (1994, FEMS Microbiological Letters, 123:343-347) in Corynebacterium glutamicum DM 1698.
The vectors pZ8-l_zwfL and pZ8-l_zwfS mentioned in example 21.2. and the vector pZ8-l without inserted fragment are electroporated by the electroporation method of Tauch et al. (FEMS Microbiological Letters, 123 (1994) :343-347) in Corynebacterium glutamicum DMl698zwfdelta90bp (A243T) as described in Example 20.
Selection for plasmid-carrying cells is made by plating out the electroporation batches on LB agar (Sambrook et al . , Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. , 1989) , which has been supplemented with 15 mg/1 kanamycin. Plasmid DNA is isolated in each case from a transformant by conventional methods (Peters-Wendisch et al . , 1998,
Microbiology 144, 915-927) and checked by restriction with the restriction enzyme Sail and subsequent agarose gel electrophoresis (0.8%).
The strains are called DM1698/pZ8-l, DMl698zwfdelta90bp(A243T)/pZ8-l,
DMl698zwfdelta90bp(A243T) /pZ8-l_zwfL and DM1698zwfdelta90bp (A243T) /pZ8-l_zwfS . 21.4. Determination of the glucose-6-phosphate dehydrogenase activity of the obtained strains
For determination of the activity of the glucose-6- phosphate dehydrogenase enzymes encoded by the different zwf alleles contained in strains DMl698deltazwf90bp(A243T) /pZ8-l_zwfL and DM1698deltazwf90bp(A243T) /pZ8-l_zwfS, the strains are incubated for 24 hours in LB media (Merck KG, Darmstadt, Germany) with 25 mg/1 kanamycin. Culturing is carried out in a 25 ml volume in a 250 ml conical flask with baffles at 33aC at 200 rpm on a shaking machine.
For comparison the parental strains DM1698 and DMl698zwfdelta90bpA243T having the two different zwf alleles in the chromosome as described in Example 20 and the strains DMl698/pZ8-l and DMl698zwfdelta90bp (A243T) /pZ8-, 1 having the vector pZ8-l are incubated in parallel. Because DM1698 and DMl698zwfdelta90bpA243T do not contain any plasmid, they are incubated without kanamycin added to the culture medium.
The preparation of the biomass is done as described in Example 15.1.
Measurement of the glucose-6-phosphate dehydrogenase activity is done in an assay system containing 100 mM Tris- HCl (pH 7,5) + 1 mM DTT, 15 mM MgCl2, 1,5 mM NADP+ and 10 mM glucose-6-phosphate. The enzyme activity is calculated in the same way as described before.
The results of this experiment are shown in Table 11.
Table 11
RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
I. IDENTIFICATION OF THE MICROORGANISM
Identification reference given by the DEPOSITOR: Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY:
DH5α/pEC-T18mob2 DSM 13244
II. SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNATION
The microorganism identified under I. above was accompanied by:
(X ) a scientific description (X ) a proposed taxonomic designation
(Mark with a cross where applicable).
III. RECEIPT AND ACCEPTANCE
This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on 20 0 0 - 01 - 20 (Date of the original deposit)'.
IV. RECEIPT OF REQUEST FOR CONVERSION
The microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).
V. INTERNATIONAL DEPOSITARY AUTHORITY
Name: DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the MIKROORGANISMEN UND ZELLKULTUREN GmbH Internationa! Depositary Authority or of authorized official(s):
Address: Mascheroder Weg 1 b D-38124 Braunschweig Date: 2000 - 01 - 25
1 Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired Form DSMZ-BP/4 (sole page) 0196 VIABILITY STATEMENT issued pursuant to Rule 10.2 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
Form DSMZ-BP/9 (sole page) 0196 RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
I. IDENTIFICATION OF THE MICROORGANISM
Identification reference given by the DEPOSITOR: Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY: DM658 DSM 7431
π. SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNATION
The microorganism identified under I. above was accompanied by:
( ) a scientific description ( x) a proposed taxonomic designation
(Mark with a cross where applicable).
Dl. RECEIPT AND ACCEPTANCE
This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on 1993-01-27 (Date of the original deposit)'.
IV. RECEIPTOFREQUESTFORCONVERSION
The microorganism identified under I above was received by this International Depositary Authority on 1993-01 -27 (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on 2002- 10-17 (date of receipt of request for conversion).
V. INTERNATIONAL DEPOSITARY AUTHORITY
Name: DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the MH ROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized officials):
Address: Mascheroder Weg lb D-38124 Braunschweig ^ C eJβ* Date: 2002-10-18
1 Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired. Form DSMZ-BP/4 (sole page) 12/2001 VIABILITY STATEMENT issued pursuant to Rule 10.2 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
' Indicate the date of original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the transfer). 1 In the cases referred to in Rule 10.2(a) (ii) and (iii), refer to the most recent viability test. 3 Mark with a cross the applicable box. 4 Fill in if the information has been requested and if the results of the test were negative. Form DSMZ-BP/9 (sole page) 12/2001 RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
I IDENTIFICATION OF THE MICROORGANISM
Identification reference given by the DEPOSITOR: Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY: DSM5715zwf2_A243T DSM 15237
H. SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNATION
The microorganism identified under L above was accompanied by:
( X ) a scientific description ( χ) a proposed taxonomic designation
(Mark with a cross where applicable).
UL RECEIPT AND ACCEPTANCE
This International Depositary Authority accepts the microorganism identified under L above, which was received by it on 2002- 10- 1 1 (Date of the original deposit)'.
IV. RECEIPT OF REQUEST FOR CONVERSION
The microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).
V. INTERNATIONAL DEPOSITARY AUTHORITY
Name: DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the MD ROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized officials):
Address: MascheroderWeg lb D-38124 Braunschweig 7ύ 4t. Date: 2002-10-15
1 Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired. Form DSMZ-BP/4 (sole page) 12/2001 VIABILITY STATEMENT issued pursuant to Rule 10.2 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
1 Indicate the date of original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the transfer). 2 In the cases referred to in Rule 10.2(a) (ii) and (iii), refer to the most recent viability test. 3 Mark with a cross the applicable box. 4 Fill in if the information has been requested and if the results of the test were negative. Form DSMZ-BP/9 (sole page) 12/2001 RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
I IDENTIFICATION OF THE MICROORGANISM
Identification reference given by the DEPOSITOR: Accession number given by the INTERNATIONAL DEPOSITARY AUTHORΠY: DM1697_zwiD245S DSM 15632
E. SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNATION
The microorganism identified under I. above was accompanied by:
( X ) a scientific description ( ) a proposed taxonomic designation
(Mark with a cross where applicable).
m. RECEIPT AND ACCEPTANCE
This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on 2003-05-23 (Date of the original deposit)'.
IV. RECEIPTOFREQUESTFORCONVERSION
The microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).
V. INTERNATIONAL DEPOSITARY AUTHORITY
Name: DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the MKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized officials):
Address: Mascheroder Weg lb D-38124 Braunschweig 6/ Date: 2003-05-26
1 Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired. Form DSMZ-BP/4 (sole page) 12/2001 VIABILΠΎ STATEMENT issued pursuant to Rule 10.2 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
' Indicate the date of original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the transfer). In the cases referred to in Rule 10.2(a) (ii) and (iii), refer to the most recent viability test. 3 Mark with a cross the applicable box. 4 Fill in if the information has been requested and if the results of the test were negative. Form DSMZ-BP/9 (sole page) 12/2001

Claims

What is claimed is :
1. An isolated polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is exchanged by another proteinogenic amino acid.
2. The isolated polynucleotide according to claim 1 encoding a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids selected from the group consisting of L- arginine at position 370, L-valine at position 372, L- methionine at position 242, L-alanine at position 243, L-glutamic acid at position 244 and L-aspartic acid at position 245 is exchanged against any other proteinogenic amino acid.
3. The isolated polynucleotide according to claim 1 encoding a protein selected from the group consisting of: a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least L-alanine at position 243 is exchanged against L-threonine; a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least L-methionine at position 242 is exchanged against L-leucine; a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least L-methionine at position 242 is exchanged against L- serine, a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least L-aspartic acid at position 245 is exchanged against L-serine, a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least L-arginine at position 370 is exchanged against L-methionine and a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least L-valine at position 372 is exchanged against L-alanine.
4. The isolated polynucleotide according to claim 1 encoding a protein comprising at least the amino acids 241 to 246 of the amino acid sequence of SEQ ID NO: 22 and optionally the amino acids 1 to 10 of amino acid sequence of SEQ ID NO: 10.
5. The isolated polynucleotide according to claim 3 comprising nucleotides 308 to 1849 of the nucleotide sequence of SEQ ID NO: 21.
6. The isolated polynucleotide according to claim 1 encoding a protein comprising at least the amino acids 237 to 250 of one of the amino acid sequences of SEQ ID NOs: 33, 35 and 37 and optionally the amino acids 1 to 10 of amino acid sequence of SEQ ID NO: 10.
7. The isolated polynucleotide according to claim 3 comprising nucleotides 1 to 1542 of one of the nucleotide sequences of SEQ ID NOs: 32, 34 and 36.
8. The isolated polynucleotides according to one or more of claims 1 to 7, wherein said encoded protein has glucose 6-phosphate dehydrogenase activity.
9. The isolated polynucleotide according to claim 8, wherein said glucose 6-phosphate dehydrogenase activity is resistant to inhibition by NADPH.
10. The isolated polynucleotide according to claim 5 or 6 consisting of one of sequences SEQ ID NO: 21, 33, 35 and 37 or a fragment thereof encoding a protein having glucose 6-phosphate dehydrogenase activity.
11. The isolated polynucleotide according to claim 10 encoding a protein having glucose 6-phosphate dehydrogenase activity, wherein said protein comprises at least the amino acids 1 to 10 of the N terminal sequence of SEQ ID NO: 10.
12. A bacterium comprising the isolated polynucleotide of any of the claims 1 to 11.
13. The bacterium according to claim 12 , wherein said isolated polynucleotide is comprised in the chromosome of said bacterium.
14. The bacterium according to claim 13, wherein said bacterium is a coryneform bacterium or Escherichia coli .
15. A vector comprising the isolated polynucleotides of any of the claims 1 to 11.
16. The vector according to claim 15, wherein said vector is a plasmid.
17. An isolated bacterium comprising a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is/are exchanged by another proteinogenic amino acid. •
18. The isolated bacterium according to claim 17 comprising a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids selected from the group consisting of L-arginine at position 370, L-valine at position 372, L-methionine at position 242, L-alanine at position 243, L- glutamic acid at position 244 and L-aspartic acid at position 245 is/are exchanged against any other proteinogenic amino acid.
19. The isolated bacterium according to claim 17 comprising a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least L-alanine at position 243 is exchanged against L-threonine.
20. The isolated bacterium according to claim 17 comprising a polynucleotide encoding a protein, wherein said protein comprises at least the amino . acids 241 to 246 of the amino acid sequence of SEQ ID NO: 22.
21. The isolated bacterium according to claim 17 comprising a polynucleotide encoding a protein comprising at least the amino acids 1 to 10 of amino acid sequence of SEQ ID NO: 10 and the amino acids 241 to 246 of the amino acid sequence of SEQ ID NO: 22.
22. The isolated bacterium according to claim 17 comprising a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 22 nucleotides 308 to 1849.
23. The isolated bacterium according to claim 17 comprising a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least L-aspartic acid at position 245 is exchanged against L-serine.
24. The isolated bacterium according to claim 17 comprising a polynucleotide encoding a protein, wherein said protein comprises at least the amino acids 237 to 250 of one of the amino acid sequence of SEQ ID NOs: 33, 35 and 37.
25. The isolated bacterium according to claim 17 comprising a polynucleotide encoding a protein comprising at least the amino acids 1 to 10 of amino acid sequence of SEQ ID NO: 10 and the amino acids 237 to 250 of one of the amino acid sequence of SEQ ID NOs: 33, 35 and 37.
26. The isolated bacterium according to claim 17 comprising a polynucleotide comprising the nucleotides 1 to 1542 of one of the sequences of SEQ ID Nos: 32, 34 and 36.
27. The isolated bacterium according to one or more of the claims 17 to 26 comprising polynucleotide encoding a protein, wherein said protein has glucose 6-phosphate dehydrogenase activity.
28. The isolated bacterium according to claim 27, wherein said glucose 6-phosphate dehydrogenase activity is resistant to inhibition by NADPH.
29. The isolated bacterium according to one or more of the claims 12 to 26 comprising a polynucleotide encoding a protein, wherein the N terminal methionine is eliminated from said protein during processing within said bacterium.
30. The isolated bacterium according to one or more of the claims 17 to 26 wherein said bacterium is a coryneform bacterium.
31. Corynebacterium glutamicum DM658 deposited under DSM 7431.
32. Corynebacterium glutamicum DSM5715zwf2_A243T deposited under DSM15237.
33. Corynebacterium glutamicum DSM 1697_zwfD245S deposited under DSM15632.
34. A process for the preparation of an amino acid by fermentation of an isolated coryneform bacterium comprising: a) fermenting of the amino acid producing bacterium. comprising a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acicls at positions 241 to. 246 is exchanged by another proteinogenic amino acid, . and b) concentrating of the amino acid in the medium or in the cells of the bacterium.
35. The process according to claim 28, wherein said bacterium comprises a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 22.
36. The process according to claim 34 wherein said bacterium comprises a polynucleotide encoding a protein comprising one of ' the amino acid. sequences of SEQ ID NOs: 33, 35 and 37.
37. A process for the preparation of an amino acid by fermentation of a coryneform bacterium comprising the following steps : a) fermenting of the amino acid producing bacterium comprising an isolated or recombinant polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 10, wherein at least one or more of the amino acids at positions 369 to 373 and/or one or more of the amino acids at positions 241 to 246 is exchanged by another proteinogenic amino acid, and b) concentrating of the amino acid in the medium or in the cells of the bacterium.
38. The process according to 32, wherein said isolated polynucleotide encodes a protein comprising the amino acid sequence of SEQ ID NO: 22.
39. The process according to claim 37, wherein said isolated polynucleotide encodes a protein comprising one of the amino acid sequences of SEQ ID NOs: 33, 35 and.37.
40. A process for the preparation of an amino acid by fermentation of an isolated coryneform bacterium comprising: a) fermenting of the amino acid producing bacterium comprising a polynucleotide encoding a protein having glucose-6-phosphate dehydrogenase activity comprising at least the amino acids of positions 241 to 246 of SEQ ID NO:22 or 237 to 250 of SEQ ID NOs: 33, 35 and 37, b) concentrating of the amino acid in the medium or in the cells of the bacterium.
41. A process for the preparation of an amino acid by fermentation of a coryneform bacterium comprising the following steps : a) fermenting of the amino acid producing bacterium comprising an isolated or recombinant polynucleotide encoding a protein having glucose- 6-phosphate dehydrogenase activity comprising at least the amino acids of positions 241 to 246 of SEQ ID NO: 22 or 237 to 250 of SEQ ID NOs : 33, 35 and 37, and b) concentrating of the amino acid in the medium or in the cells of the bacterium.
42. The process according to one or more of the claims 34 to 41, wherein said amino acid is selected from the group consisting of L-lysine, L-threonine, L- isoleucine and L-tryptophane.
43. The process according to one or more of the claims 34 to 42 comprising isolating said L-amino acid.
44. The process according to claim 40 to 41 wherein said protein further comprises the amino acids positions 1 to 10 of the N-terminal sequence of SEQ ID NO: 10.
45. The process of one or more of the claims 34 to 41, wherein additionally the intracellular activity of the pyruvate oxidase encoded by the poxB gene is decreased or switched off.
46. The process of one or more of the claims 34 to 41, wherein additionally the intracellular activity of the glucose 6-phosphate isomerase encoded by the pgi gene is decreased or switched off.
EP04706155A 2004-01-29 2004-01-29 Process for the preparation of l-amino acids with amplification of the zwf gene Withdrawn EP1709166A1 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP2004/000775 WO2005075631A1 (en) 2004-01-29 2004-01-29 Process for the preparation of l-amino acids with amplification of the zwf gene

Publications (1)

Publication Number Publication Date
EP1709166A1 true EP1709166A1 (en) 2006-10-11

Family

ID=34833862

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04706155A Withdrawn EP1709166A1 (en) 2004-01-29 2004-01-29 Process for the preparation of l-amino acids with amplification of the zwf gene

Country Status (4)

Country Link
EP (1) EP1709166A1 (en)
CN (1) CN1906291A (en)
BR (1) BRPI0418482A (en)
WO (1) WO2005075631A1 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10155505A1 (en) * 2001-11-13 2003-05-22 Basf Ag Genes that code for glucose-6-phosphate dehydrogenase proteins
DE102006026328A1 (en) * 2006-06-02 2008-01-03 Evonik Degussa Gmbh Process for the preparation of a feed additive containing L-lysine
CN103789341B (en) * 2014-01-23 2016-05-18 河北工业大学 A kind of construction method of saccharomyces cerevisiae isobutanol superior strain
CN109423504B (en) * 2017-08-24 2022-10-04 廊坊梅花生物技术开发有限公司 Strain and use for producing L-tryptophan
CN113637699B (en) * 2020-04-27 2023-05-30 中国科学院分子植物科学卓越创新中心 A method for improving the production capacity of amino acid producing bacteria
CN114107141B (en) * 2021-08-19 2022-07-12 中国科学院天津工业生物技术研究所 Corynebacterium glutamicum capable of producing L-proline in high yield and method for producing L-proline in high yield
CN114181288B (en) * 2022-02-17 2022-05-03 北京中科伊品生物科技有限公司 Method for preparing L-valine and gene used therefor and protein encoded by the gene

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060014259A9 (en) * 1999-07-09 2006-01-19 Kevin Burke Process for the preparation of L-amino acids with amplification of the zwf gene
US20030175911A1 (en) * 2000-03-20 2003-09-18 Stephen Hans Process for the preparation of L-amino acids with amplification of the zwf gene

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2005075631A1 *

Also Published As

Publication number Publication date
CN1906291A (en) 2007-01-31
BRPI0418482A (en) 2007-06-19
WO2005075631A1 (en) 2005-08-18

Similar Documents

Publication Publication Date Title
US6420151B1 (en) Nucleotide sequences which code for the pck gene
US20050196848A1 (en) Process for the fermentative production of L-amino acids by attenuation of the poxB gene
US20040214219A1 (en) Nucleotide sequences which code for the tal gene
US20060014259A9 (en) Process for the preparation of L-amino acids with amplification of the zwf gene
CA2374261C (en) Process for the fermentative preparation of l-amino acids with amplification of the zwf gene
US6872553B2 (en) Nucleotide sequences which code for the pck gene
US20030175911A1 (en) Process for the preparation of L-amino acids with amplification of the zwf gene
EP1179076B9 (en) Process for the fermentative preparation of l-amino acids with amplification of the gnd gene
CA2339307A1 (en) Nucleotide sequences coding for the dapc gene and process for the production of l-lysine
US20050112733A1 (en) Process for the preparation of L-amino acids with amplification of the zwf gene
EP1179084B1 (en) Process for the fermentative preparation of l-amino acids with amplification of the tkt gene
WO2005075631A1 (en) Process for the preparation of l-amino acids with amplification of the zwf gene
WO2002066651A2 (en) Nucleotide sequences of the ribosomal protein s12 gene (rpsl) from corynebacterium glutamicum
US20030166173A1 (en) Nucleotide sequences coding for the glbO gene
US20030109014A1 (en) Process for the fermentative preparation of L-amino acids with amplification of the tkt gene
US7205144B2 (en) Nucleotide sequences encoding a sensor kinase, citA, from Corynebacterium glutamicum
US7029904B2 (en) Nucleotide sequences which code for the dep34 gene
US7202061B2 (en) Process for the preparation of L-amino acids by attenuating the mikE17 gene
EP1414985A2 (en) Process for the fermentative preparation of l-amino acids using coryneform bacteria
US7132272B2 (en) Nucleotide sequence encoding corynebacterium glutamicum leucine response regulatory protein
KR20060129352A (en) 제조 Method of producing L-amino acid using amplification of gene
MXPA06007762A (en) Process for the preparation of l-amino acids with amplification of the zwf gene
US20020042106A1 (en) Nucleotide sequences which code for the cma gene

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20060616

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

RIN1 Information on inventor provided before grant (corrected)

Inventor name: THIERBACH, GEORG

Inventor name: HANS, STEPHAN

Inventor name: HAEDRICH, BETTINA

Inventor name: BATHE, BRIGITTE

Inventor name: RETH, ALEXANDER

Inventor name: KREUTZER, CAROLINE

RIN1 Information on inventor provided before grant (corrected)

Inventor name: BATHE, BRIGITTE

Inventor name: THIERBACH, GEORG

Inventor name: KREUTZER, CAROLINE

Inventor name: HAEDRICH, BETTINA

Inventor name: HANS, STEPHAN

Inventor name: RETH, ALEXANDER

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20070620

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: EVONIK DEGUSSA GMBH

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20071031