CN1906291A

CN1906291A - Process for the preparation of l-amino acids with amplification of the zwf gene

Info

Publication number: CN1906291A
Application number: CNA200480041034XA
Authority: CN
Inventors: 斯特凡·汉斯; 布里吉特·巴斯; 亚历山大·雷特; 格奥尔格·蒂尔巴赫; 卡罗琳·克罗伊策; 贝蒂娜·黑德里希
Original assignee: Degussa GmbH
Current assignee: Evonik Operations GmbH
Priority date: 2004-01-29
Filing date: 2004-01-29
Publication date: 2007-01-31
Also published as: WO2005075631A1; BRPI0418482A; EP1709166A1

Abstract

The invention relates to a process for the preparation of L-amino acids by fermentation of coryneform bacteria, which comprises carrying out the following steps: a) fermenting the L-amino acid-producing bacteria in which at least the zwf gene is amplified, b) concentrating the L-amino acid in the medium or in the cells of the bacteria and c) isolating the L-amino acid produced.

Description

Prepare the amino acid whose method of L-with amplification zwf gene

Invention field

The present invention relates to use excellent bacillus to prepare L-amino acid, the method for L-Methionin, L-Threonine and L-tryptophane particularly, wherein the glucose-6-phosphate dehydrogenase of zwf genes encoding (Zwischenferment) albumen is amplified at least.

Prior art

L-amino acid is used for Animal nutrition, is used for human medicine and pharmaceutical industry.

Known amino acid is by the bar shaped bacteria bacterial strain, and especially the fermentation of Corynebacterium glutamicum (Corynebacterium glutamicum) is produced.Because it is of crucial importance, continues carrying out the trial of improved production method.The improvement of described method can relate to the fermentation measure.As stirring and oxygen supply, or the sugared concentration between the component of nutritional medium such as yeast phase, or the purification process of product form, for example by ion exchange chromatography, or the intrinsic nature of production of microorganism itself.

For improveing the nature of production of these microorganisms, can use methods such as mutagenesis, selection and mutant selection.Can obtain in this way to metabolic antagonist for example Threonine analogue pantonine-hydroxypentanoic acid (AHV), lysine analogues S-(2-amino-ethyl)-L-halfcystine (AEC) bacterial strain of resistance is arranged, perhaps for to regulate the importance metabolite be auxotrophic and produce for example bacterial strain of Threonine or Methionin of L-amino acid.

For a period of time, the method for recombinant DNA technology also has been used to produce the improvement of the amino acid whose Corynebacterium glutamicum strain of L-.

Goal of the invention

The purpose of this invention is to provide and use rod-shaped bacteria through fermentation to prepare the amino acid whose new modification method of L-.

Summary of the invention

L-amino acid is used for human medicine and pharmaceutical industry, grocery trade, is used in particular for Animal nutrition.Therefore need provide preparation amino acid whose new modification method.

The invention provides and use bar shaped bacteria to prepare L-amino acid, the method of L-Methionin, L-Threonine, L-Isoleucine and L-tryptophane particularly, be amplified by zymoprotein (Zwf albumen) between zwf gene nucleotide sequence coded in the used bar shaped bacteria, especially cross and express.

Abbreviation " zwf " is the code name (Jeffrey H.Miller:A Short Course InBacterial Genetics, Cold Spring Harbor Laboratory Press, USA, 1992) of glucose-6-phosphate dehydrogenase, is also referred to as glucose-6-phosphate dehydrogenase (G6PD).

Glucose-6-phosphate dehydrogenase (G6PD) catalysis G-6-P is oxidized to-the 6-phosphogluconolactone, follows NADP to be reduced to NADPH.Its activity is suppressed (Sugimoto and Shiio, Agricultural and Biological Chemistry 51 (1), pp.101-108 (1987)) by NADPH and multiple other metabolite.

Detailed Description Of The Invention

The bacterial strain of advantageous applications is to have produced the amino acid whose bacterial strain of L-before zwf gene amplification.

Embodiment preferred see claim book.

Term in the literary composition " amplification " has been described in the microorganism by active increase in one or more enzyme of corresponding D NA coding or the proteinic born of the same parents, for example have highly active corresponding enzyme or proteinic gene or allelotrope and carry out these measures of optional combination by copy number, the powerful promotor of use or the use coding that increases described one or more gene.

By the amplification measure, particularly cross expression, corresponding enzyme or activity of proteins are based on enzyme described in wild-type enzyme or protein or the initial microorganism or activity of proteins or the general increase at least 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500% of concentration, until maximum 1000% or 2000%.

Microorganism provided by the invention can be from glucose, sucrose, lactose, fructose, maltose, molasses, starch, Mierocrystalline cellulose or preparation L-amino acid from glycerine and ethanol.Described microorganism is that the representative of bar shaped bacteria, particularly coryneform bacteria (Corynebacterium) belong to.For corynebacterium, what can mention especially is Corynebacterium glutamicum, and known its of those skilled in the art produced the amino acid whose ability of L-.

Suitable corynebacterium sp. strain, particularly Corynebacterium glutamicum are for example known wild type strains:

Corynebacterium glutamicum ATCC 13032

Vinegar paddy rod bacillus (Corynebacterium acetoglutamicum) ATCC 15806

Corynebacterium acctoacidophlum (Corynebacterium acetoacidophilum) ATCC13870Corynebacterium thermoaminogenes FERM BP-1539

Brevibacterium flavum (Brevibacterium flavum) ATCC 14067

Brevibacterium lactofermentum (Brevibacterium lactofermentum) ATCC 13869

Fork tyrothricin (Brevibacterium divaricatum) ATCC 14020,

Reach the therefrom amino acid whose mutant of production L-of preparation, for example produce the bacterial strain of L-Threonine:

Corynebacterium glutamicum ATCC21649

Brevibacterium flavum BB69

Brevibacterium flavum DSM5399

Brevibacterium lactofermentum FERM-BP 269

Brevibacterium lactofermentum TBB-10,

Reach the bacterial strain of for example producing the L-Isoleucine:

Corynebacterium glutamicum ATCC 14309

Corynebacterium glutamicum ATCC 14310

Corynebacterium glutamicum ATCC 14311

Corynebacterium glutamicum ATCC 15168

Produce ammonia rod bacillus (Corynebacterium ammoniagenes) ATCC 6871,

Reach the bacterial strain of for example producing the L-tryptophane:

Corynebacterium glutamicum ATCC21850

Corynebacterium glutamicum KY9218 (pKW9901),

Reach the bacterial strain of for example producing L-Methionin:

Corynebacterium glutamicum FERM-P 1709

Brevibacterium flavum FERM-P 1708

Brevibacterium lactofermentum FERM-P 1712

Corynebacterium glutamicum FERM-P 6463

Corynebacterium glutamicum FERM-P 6464

Corynebacterium glutamicum ATCC 13032

Corynebacterium glutamicum DM58-1

Corynebacterium glutamicum DSM12866.

Have been found that bar shaped bacteria produces L-amino acid in the mode of improvement, particularly L-Methionin, L-Threonine and L-tryptophane after the zwf gene overexpression of Zwf albumen or Zwf polypeptide of encoding respectively.

JP-A-09224661 has disclosed the nucleotide sequence of the zwf gene of brevibacterium flavum MJ-223 (FERM BP-1497), and points out that the protein by the zwf genes encoding is glucose-6-phosphate dehydrogenase (G6PD).The sequence information that JP-A-09224661 discloses is shown in SEQ ID NO:7 and 8.The N-terminal aminoacid sequence that JP-A-09224661 has described the Zwf polypeptide is Met Val Ile PheGly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu (SEQ ID NO:8).

Yet, can't confirm really so.Have been found that following N-terminal aminoacid sequence on the contrary: Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp (SEQ ID NO:10).The nucleotides sequence that comprises the corresponding zwf gene of encoding sequence is shown in SEQ ID NO:9.The methionine residues of N position can be divided in posttranslational modification, obtains the N-terminal aminoacid sequence of Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp.

Therefore, the invention provides the nucleotide sequence of the new zwf gene of the bar shaped bacteria shown in the 538-2079 position Nucleotide of SEQ ID NO:9.

Can choose wantonly and use for example intestinal bacteria (Escherichiacoli) or other gram positive bacterium proteic gene of Zwf of streptomyces or bacillus for example of coding gram negative bacterium.

Can use the allelotrope of the zwf gene that the justice sudden change is arranged that derives from genetic code degeneracy or neutral function in addition.

The preferred native gene that uses is particularly from the native gene of bar shaped bacteria." native gene " or " endogenous nucleotide sequence " is meant obtainable gene and nucleotide sequence in a population.

In order to realize amplification (for example cross and express), can improve the copy number of corresponding gene, promotor and the regulatory region or the ribosome bind site that perhaps can suddenly change and be positioned at the structure gene upstream.The expression cassette that mixes the structure gene upstream works with the same manner.But also can pass through inducible promoter, during the L-amino acid production by ferment method, strengthen and express.The measure that prolongs the mRNA life-span also can improve expression.In addition, also can improve enzymic activity by the degraded that prevents zymoprotein.Gene or gene construct can be present in the plasmid by different copy numbers, or can integrate in karyomit(e) and amplification.Perhaps, by changing the component and the cultivation program of substratum, also crossing of the gene that can obtain to be studied expressed.

Those skilled in the art can find the description to this from following document, (Bio/Technology 5 for Martin etal., 137-146 (1987)), (Gene 138 for Guerrero et al., 35-41 (1994)), (Bio/Technology 6 for Tsuchiya and Morinaga, 428-430 (1988)), (Gene 102 for Eikmanns et al., 93-98 (1991)), European patent specification EPS 0 472 869, United States Patent (USP) 4,601,893, (Bio/Technology 9 for Schwarzer and Puehler, 84-87 (1991), Reinscheid et al. (Applied andEnvironmental Microbiology 60,126-132 (1994)), LaBarre et al. (Journal of Bacteriology 175,1001-1007 (1993)), patent application WO96/15246, Malumbres et al. (Gene 134,15-24 (1993)), Japan special permission prospectus JP-A-10-229891, Jensen and Hammer (Biotechnology andBioengineering 58,191-195 (1998)), and known genetics and molecular biology textbook.

For example, Zwf albumen is crossed expression by means of plasmid.Use intestinal bacteria shown in Figure 1-Corynebacterium glutamicum shuttle vectors pEC-T18mob2 for this reason.After the zwf gene is mixed the KpnI/SalI cleavage site of pEC-T18mob2, form plasmid pEC-T18mob2zwf shown in Figure 2.

Other plasmid vector that can duplicate in Corynebacterium glutamicum for example pEKEx1 (Eikmannset al., Gene 102:93-98 (1991)) or pZ8-1 (EP-B-0 375 889) can use in the same manner.

In another aspect of this invention, find between the 369th and 373 and/or the 241st and 246 of aminoacid sequence of the zwf gene product shown in the SEQ ID NO:10 its glucose-6-phosphate dehydrogenase (G6PD) activity that can increase of the amino-acid substitution in the fragment, particularly it is to NADPH (Triphosphopyridine nucleotide, reduced, the reduction form) resistance of Yi Zhiing, and improvement comprises the especially production of Methionin of amino acid of the proteic bar shaped bacteria of Zwf of corresponding zwf gene or zwf allelotrope or its coding respectively.The methionine residues of N-terminal position can be removed by the methionine aminopeptidase by the host during posttranslational modification.

Therefore, the invention provides the Zwf albumen that comprises SEQ ID NO:10 aminoacid sequence, wherein replace by other gal4 amino acid (proteinogenic aminoacid) at one or more amino acid of 369-373 position and/or at one or more amino acid of 241-246 position at least.

Therefore, the present invention further provides encodes comprises the proteinic isolating polynucleotide of SEQ ID NO:10 aminoacid sequence, is wherein replaced by other gal4 amino acid at one or more amino acid of 369-373 position and/or at one or more amino acid of 241-246 position at least.

Especially, displacement in the proteic aminoacid sequence of Zwf comprises one or more amino-acid substitution at least that is selected from as next group: at the L-arginine of the 370th of SEQ ID NO:10 by for example L-methionine(Met) displacement of any other gal4 amino acid, at the L-Xie Ansuan of the 372nd of SEQ ID NO:10 by for example L-L-Ala displacement of any other gal4 amino acid, at the L-methionine(Met) of the 242nd of SEQID NO:10 by for example L-leucine or the displacement of L-Serine of any other gal4 amino acid, at the L-L-Ala of the 243rd of SEQ ID NO:10 by for example L-Threonine displacement of any other gal4 amino acid, at the L-L-glutamic acid of the 244th of SEQ ID NO:10 by any other gal4 amino acid displacement, and at the L-aspartic acid of the 245th of SEQ ID NO:10 by for example L-Serine displacement of any other gal4 amino acid.

The utmost point especially, the L-L-Ala that (SEQ ID NO:10) is the 243rd is by L-Threonine displacement, shown in SEQ ID NO:22.This protein is also referred to as Zwf (A243T) albumen, and the allelotrope of code for said proteins is called zwf (A243T).See SEQ ID NO:21.

In addition, the L-arginine that (SEQ ID NO:10) is the 370th can be by the displacement of L-methionine(Met), shown in SEQ ID NO:29.This protein is also referred to as Zwf (R370M) albumen, and the allelotrope of code for said proteins is called zwf (R370M).See SEQ ID NO:28.

In addition, the L-Xie Ansuan that (SEQ ID NO:10) is the 372nd can be by the displacement of L-L-Ala, shown in SEQ ID NO:31.This protein is also referred to as Zwf (V372A) albumen, and the allelotrope of code for said proteins is called zwf (V372A).See SEQ ID NO:30.

In addition, the L-methionine(Met) that (SEQ ID NO:10) is the 242nd can be by the displacement of L-leucine, shown in SEQ ID NO:33.This protein is also referred to as Zwf (M242L) albumen, and the allelotrope of code for said proteins is called zwf (M242L).See SEQ ID NO:32.

In addition, the L-methionine(Met) that (SEQ ID NO:10) is the 242nd can be by the displacement of L-Serine, shown in SEQ ID NO:35.This protein is also referred to as Zwf (M242S) albumen, and the allelotrope of code for said proteins is called zwf (M242S).See SEQ ID NO:34.

In addition, the L-aspartic acid that (SEQ ID NO:10) is the 245th can be by the displacement of L-Serine, shown in SEQ ID NO:37.This protein is also referred to as Zwf (D245S) albumen, and the allelotrope of code for said proteins is called zwf (D245S).See SEQ ID NO:36.

Zwf albumen of the present invention can further contain one or more amino acid whose replacement, disappearance or insertion, and it does not change the zymologic property of described Zwf protein variant substantially.

Known in the art to protein function have neutrality or almost the aminoacid replacement of neutralism be conservative amino acid replacement.In the situation of die aromatischen Aminosaeuren, phenylalanine, tryptophane and tyrosine can be replaced each other.In the situation of hydrophobic amino acid, leucine, Isoleucine and Xie Ansuan can be replaced each other.In the situation of polare Aminosaeren, glutamine and l-asparagine can be replaced each other.In the situation of basic aminoacids, arginine, Methionin and Histidine can be replaced each other.In the situation of acidic amino acid, aspartic acid and L-glutamic acid can be replaced each other.In containing the amino acid whose situation of oh group, Serine and Threonine can be replaced each other.

For example, when having inhibitor NADPH, enzyme activity change is less than approximately 2.5-3.5% or 2.5-4.5% can think essentially no difference.In other parameter situation, Michaelis constant (K for example _M) or maximum rate (V _Max) or other binding constant difference as less than about 5,10,25,50,100,150 or 200% or even more big-difference can think essentially no difference as 300 or 400%.

Therefore, Zwf (A243T) albumen comprises and is selected from least one following aminoacid sequence: corresponding to the Thr Met Thr Glu Asp Ile sequence of the 241-246 amino acids of SEQ ID NO:22, preferably corresponding to the aminoacid sequence of the 230-250 amino acids of SEQ ID NO:22, more preferably corresponding to the aminoacid sequence of the 225-260 amino acids of SEQ ID NO:22, more preferably corresponding to the aminoacid sequence of the 210-270 amino acids of SEQ ID NO:22.

Similarly, Zwf protein variant Zwf (M242L), Zwf (M242S) and Zwf (D245) comprise and are selected from least one following aminoacid sequence: the aminoacid sequence of SEQ ID No:33,35 and 37 237-250 amino acids, the aminoacid sequence of preferred SEQ ID No:33,35 and 37 227-260 amino acids, the more preferably aminoacid sequence of SEQ ID No:33,35 and 37 217-270 amino acids, the more preferably aminoacid sequence of SEQ ID No:33,35 and 37 202-285 amino acids.

Similarly, Zwf protein variant Zwf (R370M) and Zwf (V372A) comprise and are selected from least one following aminoacid sequence: the aminoacid sequence of SEQ ID No:29 and 31 365-377 amino acids, the aminoacid sequence of SEQ ID No:29 and 31 355-387 amino acids, the aminoacid sequence of SEQ ID No:29 and 31 345-397 amino acids, and the aminoacid sequence of the 325-417 amino acids of SEQ ID No:29 and 31.

In addition, the Zwf protein variant can comprise the N-terminal aminoacid sequence that is selected from following aminoacid sequence: corresponding to the aminoacid sequence of the 1-10 amino acids of SEQ ID NO:10, aminoacid sequence corresponding to the 1-16 amino acids of SEQ ID NO:10, corresponding to the aminoacid sequence of SEQID NO:10 1-20 amino acids, reach aminoacid sequence corresponding to the 1-30 amino acids of SEQ ID NO:10.

In addition, find to cause the enzymic activity forfeiture respectively by disappearance and expression analysis corresponding to the disappearance of proteic 30 the amino acid whose nucleotide sequences of N-terminal of one or more glucose-6-phosphate dehydrogenase (G6PD).These 30 N-terminal amino acid are corresponding to for example SEQ ID NO:10 or SEQ IDNO:22,29,31,33,35 or 37 1-30 position.

Term protein amino acid is meant those amino acid of finding in the protein of microorganism, plant, the natural generation of animal and human's body.These amino acid comprise L-glycine, L-L-Ala, L-Xie Ansuan, L-leucine, L-Isoleucine, L-Serine, L-Threonine, L-halfcystine, L-methionine(Met), L-proline(Pro), L-phenylalanine, L-tyrosine, L-tryptophane, altheine, L-glutaminate, L-aspartic acid, L-L-glutamic acid, L-arginine, L-Methionin, L-Histidine and L-seleno-cysteine.

The 243rd L-L-Ala is replaced preferably to be replaced by VITAMIN B4 by the nuclear base guanine with the 1264th of SEQ ID NO:9 by the L-Threonine to be realized.This guanine VITAMIN B4 conversion also is shown in the 1034th of SEQ ID NO:21.The 1264th of SEQ ID NO:9 and SEQ ID NO:21 the 1034th all corresponding to the 727th (first G of initiator codon GTG is at the 1st in this case) of zwf gene and zwf (A243T) allelotrope encoding sequence.

The allelic interior segments of zwf (A243T) is shown in SEQ ID NO:23.It is corresponding to the 898-1653 position of SEQ ID NO:21.

Compare with wild-type protein, this proteic glucose-6-phosphate dehydrogenase (G6PD) activity of Zwf on the one hand of the present invention is to NADPH restraining effect susceptible to or resistance is arranged more not.Compare with the activity when not adding NADPH in comprising the bacterial strain of described mutain, residual activity is at least 30% or 35% when being exposed to the NADPH of about 260 μ M (μ represents little) concentration, preferably at least 40%, 45% or 50%.Compare with the activity when not adding NADPH, residual activity is at least 20% when being exposed to the NADPH of about 400 μ M concentration, preferably at least 25%.

Induce described sudden change or allelic mutagenesis to be undertaken by the conventional mutafacient system of directed toward bacteria cell, use for example N-methyl-N '-nitro-N-nitrosoguanidine or UV-light of mutagenic compound, as Manual of Methods for General Bacteriology (Gerhard et al. (Eds.), American Society for Microbiology, Washington, DC, USA, 1981) described.Separate suitable mutant then and differentiate by for example sequence measurement or by measuring the glucose-6-phosphate dehydrogenase (G6PD) activity.

Therefore, the invention provides the isolating bar shaped bacteria or the mutant that comprise polynucleotide, described polynucleotide encoding comprises the Zwf albumen of the aminoacid sequence of SEQ ID NO:10, is wherein replaced by other gal4 amino acid at one or more amino acid of 369-373 position and/or at one or more amino acid of 241-246 position at least.

Corynebacterium glutamicum DM658 is the example of this bar shaped bacteria.It is carrying out repeatedly mutagenesis, selection and screening circulation back acquisition, the zwf allelotrope (zwf (A243T)) of the Zwf albumen (Zwf (A243T)) of the aminoacid sequence that containing in its karyomit(e) encodes has SEQID NO:10, wherein replace by the L-Threonine, shown in SEQID NO:22 at the 243rd L-L-Ala.

Mutagenesis also can be undertaken by using the in vitro method at polynucleotide, for example handle (Molecular and General Genetics 145 with azanol, 101 pp. (1978)), perhaps handle (T.A.Brown:Gentechnologie fuer Einsteiger with mutagenic oligonucleotide, SpektrumAkademischer Verlag, Heidelberg, 1993), perhaps use polymerase chain reaction (PCR) to handle, as Newton and Graham (PCR, Spektrum Akademischer Verlag, Heidelberg, 1994) institute's leadoff volume or by Papworth etc. (Strategies 9 (3), 3-4 (1996)) described method is used Stratagene (La Jolla, California, QuikChange directed mutagenesis test kit USA) carries out, and perhaps uses similarity method known in the art to carry out.

To corresponding allelotrope or sudden change is checked order and import in the karyomit(e) of suitable bacterial strain by reorganization by the gene substitution technique, as Schwarzer and Puehler (Bio/Technology9,84-87 (1991) carries out for the described method of pyc gene of Corynebacterium glutamicum for (Microbiology 144,915-927 (1998)) such as described method of Corynebacterium glutamicum lysA gene or Peters-Wendisch.

Therefore, the invention provides the recombinant coryneform bacteria that comprises the proteic polynucleotide of code book invention Zwf, described protein for example comprises the aminoacid sequence of SEQ ID NO:10, is wherein replaced by other gal4 amino acid at one or more amino acid of 369-373 position and/or at one or more amino acid of 241-246 position at least.

Corynebacterium glutamicum DSM5715zwf2_A243T is the example of this bacterial strain.The zwf allelic mutation that comprises bacterial strain DM658 in its karyomit(e), i.e. zwf (A243T).

Corynebacterium glutamicum strain DM1697_zwfD245S is another example of this bacterial strain.Comprise zwf allelotrope zwf (D245S) sudden change that obtains by vitro mutagenesis in its karyomit(e).

Corresponding allelotrope also can import in the karyomit(e) of suitable bacterial strain by the gene redundancy method, (Applied and Environmental Microbiology60 (1) such as Reinscheid for example, 126-132 (1994)) for the described method of hom-thrB operon, perhaps carry out for the described method of ask gene by (Applied Microbiology and Biotechnology 43,76-82 (1995)) such as Jetten.

Therefore, the present invention further provides the bar shaped bacteria that comprises isolating polynucleotide, described polynucleotide encoding comprises the Zwf albumen of the aminoacid sequence of SEQ ID NO:10, is wherein replaced by other gal4 amino acid at one or more amino acid of 369-373 position and/or one or more amino acid of 241-246 position at least.

Corynebacterium glutamicum DSM5715 ∷ pK18mobsacB_zwf (A243T) is the example of this bacterial strain.Comprise in its karyomit(e) and contain the allelic separated DNA of zwf (A243T).

Allelotrope also can be crossed expression by above-mentioned any method, but for example uses plasmid inducible promoter or any other method known in the art.

Thus obtained bacterial strain is used for fermentative production amino acid.Therefore, the present invention also provides and has used bar shaped bacteria of the present invention to produce the amino acid whose method of L-.

In addition, except increase zwf gene of the present invention or allelotrope, one or more enzyme of the special biosynthetic pathway that increases, glycolysis-, anaplerotic reaction, phosphopentose pathway, Sugar intake or amino acid output is useful for producing L-amino acid.

Therefore, for example especially for preparation L-Threonine, being selected from one or more following gene can be amplified simultaneously, is particularly crossed and is expressed:

● hom gene, its encode homoserine dehydrogenase (Peoples et al., MolecularMicrobiology 2,63-72 (1988)), perhaps hom ^DrAllelotrope, its coding " feedback resistance " homoserine dehydrogenase (Archer et al., Gene 107,53-59 (1991),

● the gap gene, its encoding glycerol aldehyde 3-phosphate dehydrogenase (Eikmanns et al., Journal of Bacteriology 174:6076-6086 (1992)),

● the pyc gene, its pyruvate carboxylase (Peters-Wendisch et al., Microbiology 144:915-927 (1998)) of encoding,

● the mqo gene, its oxysuccinic acid of encoding: quinone oxidoreductase (Molenaar et al., European Journal of Biochemistry 254,395-403 (1998)),

● the tkt gene, its coding transketolase (European Molecular Bioglogy Laboratory's database (European Molecular Biologies Laboratories databank) (EMBL, Heidelberg, Germany) accession number AB023377),

● the gnd gene, its coding-6-Phosphogluconic dehydrogenase (JP-A-9-224662),

● the thrE gene, (DE 199 41 478.5 for its coding Threonine output albumen; DSM12840),

● (DE 199 59 328.0 for the zwa1 gene; DSM 13115),

● eno gene, its Hydratase, phosphoenolpyruvate (DE:199 41 478.5) of encoding.

Therefore, for example especially for preparation L-Methionin, being selected from one or more following gene can be increased simultaneously, is particularly crossed and is expressed:

● the dapA gene, its dihydrodipicolinate synthase (EP-B 0 197 335) that encodes,

● the lysC gene, its encoder feedback resistance E.C. 2.7.2.4. (Kalinowski et al. (1990), Molecular and General Genetics 224:317-324),

● the gap gene, its encoding glycerol aldehyde 3-phosphate dehydrogenase (Eikmanns (1992), Journal of Bacteriology 174:6076-6086),

● the pyc gene, its pyruvate carboxylase (DE-A-198 31 609) of encoding,

● the tkt gene, its coding transketolase (European Molecular Bioglogy Laboratory's database (EMBL, Heidelberg, Germany) accession number AB023377),

● the gnd gene, its coding-6-Phosphogluconic dehydrogenase (JP-A-9-224662),

● the lysE gene, its coding Methionin output albumen (DE-A-195 48 222),

● (DE 199 59 328.0 for the zwa1 gene; DSM 13115),

● eno gene, its Hydratase, phosphoenolpyruvate (DE 199 47 791.4) of encoding.

The preferred native gene that uses.

Except amplification, particularly cross and to express zwf gene of the present invention or the allelotrope, reduction simultaneously particularly disappearance is selected from one or more following gene amino acid whose production also is useful for L-:

● the pck gene, (DE 199 50 409.1 for its coding phosphoenolpyruvate carboxykinase; DSM 13047),

● the pgi gene, its coding G-6-P isomerase (US 09/396,478, DSM12969),

● the poxB gene, (DE 199 51 975.7 for its coding pyruvic oxidase; DSM13114),

● (DE:199 59 327.2 for the zwa2 gene; DSM 13113).

Term in the literary composition " reduction " is meant reduction or suppresses one or more enzyme or interior activity of proteinic born of the same parents or concentration in the microorganism, described enzyme or protein is by corresponding D NA coding, for example uses weak promoter or coding to have SA corresponding enzyme or proteinic gene or allelotrope or makes corresponding enzyme or protein inactivation and these measures of optional combination are carried out.

By the reduction measure, corresponding enzyme or activity of proteins or concentration and wild-type enzyme or protein or compare with enzyme described in the initial microorganism or activity of proteins or concentration and generally to be reduced to 0-75%, 0-50%, 0-25%, 0-10% or 0-5%.

Except the proteic amplification of Zwf, particularly mistake expression, amino acid whose production also is useful (Nakayama: " Breeding of Amino AcidProducing Micro-organisms " for L-to eliminate non-required side reaction, in:Overproduction of Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK, 1982).

The microorganism that produces according to the present invention can be continuous or discontinuous by batch process (batch culture), and fed-batch method (feed supplement method) or repeated fed-batch method (repeating the feed supplement method) are cultivated, to produce L-amino acid.Known cultural method is by Chmiel (Bioprozesstechnik 1.Einfuehrung in die Bioverfahrenstechnik[Bioprocess Technology 1.Introduction to Bioprocess Technology (Gustav Fischer Verlag, Stuttgart, 1991)] described or by Storhas (Bioreaktoren und periphereEinrichtungen[Bioreactors and Peripheral Equipment] (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)) show described in the teaching material.

Used substratum must meet the requirement of specified microorganisms in a suitable manner.See the handbook " Manual of Methods forGeneral Bacteriology " (Washington D.C., USA, 1981) of U.S.'s bacteriology meeting about the elaboration of multiple microbiological culture media.Spendable carbon source is sugar and carbohydrate, glucose for example, sucrose, lactose, fructose, maltose, molasses, starch and Mierocrystalline cellulose, oil ﹠ fat such as soya-bean oil, Trisun Oil R 80, Peanut oil and Oleum Cocois, lipid acid such as palmitinic acid, stearic acid and linolic acid, alcohol is as glycerine and ethanol, and organic acid such as acetate.These materials can be used alone or as a mixture.Spendable nitrogenous source is a nitrogen-containing organic compound, as peptone, and yeast extract, meat extract, malt extract, corn immersion liquid, soyflour and urea, or inorganicization thing such as ammonium sulfate, ammonium chloride, ammonium phosphate, volatile salt and ammonium nitrate.

Nitrogenous source can be used alone or as a mixture.Spendable phosphorus source comprises potassium primary phosphate or dipotassium hydrogen phosphate, or contains sodium salt accordingly.Substratum also must contain in addition and is required metal-salt such as sal epsom or the ferric sulfate of growing.At last, except above-mentioned substance, can use the essential material of growth such as amino acid and VITAMIN.In addition, suitable precursor can be added in the substratum.Above-mentioned initial substance can singly be criticized form or join in the culture with appropriate form in the training period.

Using basic compound such as sodium hydroxide in a suitable manner, potassium hydroxide, ammonia, or acidic cpd such as phosphoric acid or sulfuric acid control pH.Foam reducing composition for example fatty acid polyglycol ester can be used for the control foam generation.Suitable material with selectively acting is microbiotic for example, can add in the substratum to keep the stability of plasmid.Oxygen or contain oxygen gas mixture, for example air can charge in the culture to maintain oxygen condition.Culture temperature is usually at 20 ℃～45 ℃, preferred 25 ℃-40 ℃.Continue to cultivate and form maximum until L-amino acid.This purpose reached in the scope at 10～160 hours usually.

Therefore, the present invention further provides by fermentation of coryneform bacteria and prepare amino acid whose method, described method comprises the steps:

A) the amino acid whose bacterium of fermentative production, the proteic zwf gene of glucose-6-phosphate dehydrogenase of wherein encoding at least was expression, and

B) amino acid in enrichment medium or the bacterial cell, wherein said zymoprotein comprises at least the aminoacid sequence corresponding to SEQ ID NO:22 241-246 amino acids, and the N-terminal sequence of the 2-10 amino acids of the 1-10 amino acids of optional SEQ ID NO:10 or SEQ ID NO:10.

The present invention further provides by the isolating bar shaped bacteria that ferments and prepare amino acid whose method, described method comprises the steps:

A) the amino acid whose bacterium of fermentative production, described bacterium comprises the proteic polynucleotide of Zwf that coding has the aminoacid sequence of SEQ ID NO:10, wherein one or more amino acid of one or more amino acid of at least the 369-373 position and/or 241-246 position is reached by other gal4 amino acid displacement

B) amino acid in enrichment medium or the bacterial cell.

The present invention further provides by fermentation of coryneform bacteria and prepare amino acid whose method, described method comprises the steps:

A) fermentation comprise a kind of isolating or recombination of polynucleotide, produce amino acid whose bacterium, described polynucleotide encoding comprises the Zwf albumen of the aminoacid sequence of SEQ ID NO:10, wherein replace by other gal4 amino acid at one or more amino acid of 369-373 position and/or at one or more amino acid of 241-246 position at least, and

B) amino acid in enrichment medium or the bacterial cell.

From substratum or bacterial cell, separate described amino acid then.

Use measure of the present invention, the performance of described bacterium or fermentation process forms in (product/volume of formation and time) or other processing parameter and the combination thereof at production concentration (product/volume), product output (carbon source of the product/consumption of formation), product all can improve at least 0.5%, at least 1% or at least 2%.

The amino acid whose analysis of L-can by anion-exchange chromatography subsequently the triketohydrindene hydrate derivatization carry out, as (Analytical Chemistry such as Spackman, 30, (1958), 1190) described, perhaps can be undertaken, as described in (AnalyticalChemistry (1979) 51:.1167-1174) such as Lindroth by reversed-phase HPLC.

Following microorganism as pure growth be deposited in German microbial preservation center (DSMZ, Braunschweig, Germany):

● e. coli k-12 DH5 α/pEC-T18mob2 according to budapest treaty in preservation on January 20 in 2000, preserving number DSM 13244.

● Corynebacterium glutamicum DM658 is in long-term preservation on January 27th, 1993, preserving number DSM 7431; This preservation thing transfers preservation thing according to budapest treaty on October 17th, 2002.

● in preservation on October 11 in 2002, preserving number was DSM 15237 to Corynebacterium glutamicum DSM5715zwf2_A243T according to budapest treaty.

● in preservation on May 23 in 2003, preserving number was DSM 15632 to Corynebacterium glutamicum DM1697_zwfD245S according to budapest treaty.

The accompanying drawing summary

Fig. 1: plasmid pEC-T18mob2 collection of illustrative plates

Fig. 2: plasmid pEC-T18mob2zwf collection of illustrative plates

Fig. 3: plasmid pAMC1 collection of illustrative plates

Fig. 4: plasmid pMC1 collection of illustrative plates

Fig. 5: plasmid pCR2.1poxBint collection of illustrative plates

Fig. 6: plasmid pK18mobsacB_zwf (A243T) collection of illustrative plates

Fig. 7: plasmid pK18mobsacB_zwf collection of illustrative plates

Fig. 8: plasmid pK18mobsacB_zwf (D245S) collection of illustrative plates

Fig. 9: plasmid pCRBluntII_AB1CD1 collection of illustrative plates

Figure 10: plasmid pK18mobsacB_zwfdelta90bp collection of illustrative plates

Figure 11: plasmid pCRBluntII_zwfL collection of illustrative plates

Figure 12: plasmid pCRBluntII_zwfS collection of illustrative plates

Figure 13: plasmid pZ8-1zwfL collection of illustrative plates

Figure 14: plasmid pZ8-1zwfS collection of illustrative plates

The base pair number is the about value that obtains according to reproducibility.

Fig. 1 and 2:

Used abbreviation has following implication:

Tet: tetracycline resistance gene

OriV: colibacillary plasmid-encoded replication orgin

RP4mob: the mob zone of mobile plasmid

Rep: the plasmid-encoded replication orgin of Corynebacterium glutamicum plasmid pGA1

Per: the gene of control pGA1 copy number

LacZ-alpha: the lacZ alpha gene fragment of beta-galactosidase gene (N-end)

LacZalpha ': 5 ' end of lacZ alpha gene fragment

3 ' end of ' lacZalpha:lacZ alpha gene fragment

Fig. 3 and 4:

Used abbreviation has following implication:

Neor: Xin Meisu/kalamycin resistance

ColE1 ori: the replication orgin of plasmid ColE1

CMV: cytomegalovirus promoter

LacP: lactose promotor

Pgi: glucose phosphate isomerase gene

LacZ: the part of beta-galactosidase gene

SV403 ' splice: 3 ' splice site of simian virus 40

SV40polyA: the polyadenylation site of simian virus 40

F1 (-) ori: the replication orgin of filobactivirus f1

SV40 ori: the replication orgin of simian virus 40

Kan r: kalamycin resistance

The interior segments of pgi insert:pgi gene

Ori: the replication orgin of plasmid pBGS8

Fig. 5:

Used abbreviation has following implication:

ColE1 ori: the replication orgin of plasmid ColE1

Clone's resistates of lacZ:lacZ alpha gene fragment

Fl ori: the replication orgin of phage f1

KmR: kalamycin resistance

ApR: amicillin resistance

The interior segments of PoxBint:poxB gene

Fig. 6:

Used abbreviation has following implication:

RP4mob: mob zone with the replication orgin (oriT) that is used to shift

KanR: kalamycin resistance gene

OriV: replication orgin V

Zwf (A243T): zwf (A243T) allelotrope

The sacB:sacB gene

Fig. 7 and 8:

Used abbreviation has following implication:

The zwf:zwf gene

Zwf (D245S): zwf (D245S) allelotrope

OriV: replication orgin V

RP4mob: mob zone with the replication orgin (oriT) that is used to shift

KanR: kalamycin resistance gene

The sacB:sacB gene

XbaI: the cleavage site of restriction enzyme XbaI

PstI: the cleavage site of restriction enzyme PstI

Fig. 9 and 10:

Used abbreviation has following implication:

Deltazwf90: the dna fragmentation that contains the clone of zwf allelotrope 90bp disappearance

Kan: kalamycin resistance gene

PUC ori: replication orgin

The sacB:sacB gene

RP4mob: mob zone with the replication orgin (oriT) that is used to shift

OriV: replication orgin V

XbaI: the cleavage site of restriction enzyme XbaI

Figure 11 and 12:

Used abbreviation has following implication:

The allelic clone's of zwfL:zwf dna fragmentation

ZwfS: the dna fragmentation that contains the clone of zwf allelotrope 90bp disappearance

Km: kalamycin resistance gene

PUC origin: replication orgin

SalI: the cleavage site of restriction enzyme SalI

Figure 13 and 14:

Used abbreviation has following implication:

The allelic clone's of zwfL:zwf dna fragmentation

Km: kalamycin resistance gene

rrnB-

Terminator: Transcription Termination

Ptac: promotor

Rep: replication orgin

SalI: the cleavage site of restriction enzyme SalI.

The implication of the abbreviation of multiple restriction enzyme known in the art (BamHI for example, EcoRI or the like), for example summarized by Kessler and (Nucleic Acids Research 27,312-313 (1999)) such as Hoeltke (Gene 47,1-153 (1986)) or Roberts.

The further illustration of following embodiment the present invention.The for example plasmid DNA separation of Protocols in Molecular Biology that the present invention uses, restriction enzyme treatment, connection, colibacillary standard conversion etc., (unless stated otherwise) (Molecular Cloning.A LaboratoryManual (1989) Cold Spring Harbor Laboratories USA) describes by Sambrook etc.

Embodiment 1:

The proteic expression of Zwf

1.1 the preparation of plasmid pEC-T18mob2

Make up intestinal bacteria-Corynebacterium glutamicum shuttle vectors pEC-T18mob2 according to prior art.This carrier contains the duplicate field rep of plasmid pGA1, comprises the sub-per of print effect (US-A-5,175,108; Nesvera et al., Journal of Bacteriology 179,1525-1532 (1997)), the tetA that authorizes tetracyclin resistance (Z) gene (US-A-5,158,891 of plasmid pAG1; Gene library entry at the National Center for BiotechnologyInformation (NCBI, Bethesda, MD, USA), accession number AF121000), duplicate field oriV (the Sutcliffe of plasmid pMB1, Cold Spring Harbor Symposium onQuantitative Biology 43,77-90 (1979)), the lacZ alpha gene fragment, it comprises a lac promotor and a multiple clone site (mcs) (Norrander et al.Gene 26,101-106 (1983)), and the mob district (Simon et al., (1983) Bio/Technology1:784-791) of plasmid RP4.With the carrier transformed into escherichia coli bacterial strain DH5 α (Brown (ed.) Molecular Biology Labfax, BIOS Scientific Publishers, Oxford, UK, 1991) that makes up.By transforming batch thing bed board at the LB agar of having added the 5mg/l tsiklomitsin (Sambrook et al., Molecular Cloning:A Laboratory Manual.2 ^NdEd., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) on, select to carry the cell of plasmid.By means of QIAprep Spin Miniprep test kit isolated plasmid dna from transformant of Qiagen, and detect by carrying out agarose gel electrophoresis (0.8%) subsequently with limiting enzyme EcoRI and HindIII restriction.

Described plasmid is called pEC-T18mob2, as shown in Figure 1.It is deposited in DSMZ with e. coli k-12 bacterial strain DH5 α pEC-T18mob2 form, and (Germany), preserving number is DSM 13244 for German microbial preservation center, Braunschweig.

1.2 the preparation of plasmid pEC-T18mob2zwf

At first will utilize following Oligonucleolide primers at first to increase by polymerase chain reaction (PCR) from the gene of Corynebacterium glutamicum ATCC13032:

Zwf-forward (SEQ ID NO:11):

5′-TCG ACG CGG TTC TGG AGC AG-3′

Zwf-is (SEQ ID NO:12) oppositely:

5′-CTA AAT TAT GGC CTG CGC CAG-3′

Described PCR is reflected at and has 200 μ M deoxynucleotide triphosphoric acid (dATP, dCTP, dGTP, dTTP) carry out 30 circulations under the situation, at every turn in thermal cycler (Thermocycler, PTC-100, MJ Research, Inc., watertown, USA) the middle corresponding oligonucleotide of 1 μ M, 100 nanograms (ng) the Corynebacterium glutamicum ATCC13032 chromosomal DNA of using, the 10 times of reaction buffers of 1/10 volume and thermally-stabilised Taq-/Pwo-DNA polysaccharase mixture (the Expand High Fidelity PCR System of 2.6 units, RocheDiagnostics, Mannheim, Germany), react under the following conditions: 94 ℃ 30 seconds, 64 ℃ of 1 minute and 68 ℃ 3 minutes.

(Amersham Pharmacia Biotech, Uppsala Sweden), instruct the amplified fragments with about 1.8kb to connect the into SmaI cleavage site of carrier pUC18 according to manufacturer to connect test kit by means of SureClone subsequently.Coli strain DH5 α mcr (Grant etal., Proceedings of the National Academy of Sciences of the United Statesof America USA (1990) 87:4645-4649) is transformed with whole connections batch thing.On the LB agar plate that contains 50 μ g/mL Pyocianils, differentiate transformant by means of its Pyocianil resistance.From 7 transformant, prepare plasmid, and detect as the segmental situation that exists of 1.8kb PCR of inserting body by restriction analysis.The recombinant plasmid of Xing Chenging is called pUC18zwf hereinafter by this way.

In order to make up pEC-T18mob2zwf, pUC18zwf is digested with KpnI and SalI, and by means of Macherey-Nagel (Dueren, Germany) NucleoSpin extracts test kit and instructs separated product according to manufacturer, and dephosphorylized carrier pEC-T18mob2 is connected with cutting also with KpnI and SalI with it then.Coli strain DH5 α mcr (Grantet al., Proceedings of the National Academy of Sciences of the UnitedStates of America USA (1990) 87:4645-4649) is transformed with whole connections batch thing.Tetracyclin resistance by means of transformant is differentiated transformant on the LB agar plate that contains 5 μ g/mL tsiklomitsins.Preparation plasmid and detect as the segmental situation that exists of 1.8kb PCR of inserting body from 12 transformant by restriction analysis.Isolating by this way recombinant plasmid is called pEC-T18mob2zwf (Fig. 2).

Embodiment 2:

The preparation of amino acid production strain with zwf gene of amplification

The bacterial strain Corynebacterium glutamicum DSM5715 that produces L-Methionin describes in EP-B-0435132, and the bacterial strain brevibacterium flavum DSM5399 that produces the L-Threonine describes in EP-B-0385940.These two bacterial strains all are deposited in the German microbial preservation center (Germany) of Braunschweig according to budapest treaty.

2.1: the preparation of strain DSM 5715/pEC-T18mob2zwf and DSM5399/pEC-T18mob2zwf

Strain DSM 5715 and DSM5399 are used (FEM S Microbiology Letters, 53:299-303 (1989)) described electroporation method conversions such as Liebl with plasmid pEC-T18mob2zwf.Add the 5mg/l tsiklomitsin, comprising 18.5g/l brain heart meat extract, the 0.5M Sorbitol Powder, 5g/l Bacto-tryptone, 2.5g/l Bacto-yeast extract is selected transformant on the LBHIS agar of 5g/l NaCl and 18g/l Bacto agar.33 ℃ of insulations 2 days.

At every turn by ordinary method from transformant isolated plasmid dna (Peters-Wendisch etal., 1998, Microbiology 144,915-927), with restriction endonuclease XbaI and KpnI cutting, detect plasmid by agarose gel electrophoresis subsequently.The bacterial strain of Huo Deing is called DSM5715/pEC-T18mob2zwf and DSM5399/pEC-T18mob2zwf by this way.

2.2:L-the preparation of Threonine

The Corynebacterium glutamicum strain DSM5399/pEC-T18mob2zwf that will obtain in embodiment 2.1 is being suitable for cultivating in the nutritional medium that Threonine produces, determines threonine content in the culture supernatant.

For this reason, at first bacterial strain had corresponding antibiotic agar plate (the brain heart agar with tsiklomitsin (5mg/l)) upward 33 ℃ of insulations 24 hours.From this agar plate culture, inoculate pre-culture (10ml cultivates based in the 100ml Erlenmeyer flask).Perfect medium CgIII is as the substratum of pre-culture.

Culture medium C g III

NaCl 2.5g/l

Bacto-peptone 10g/l

Bacto-yeast extract 10g/l

Glucose (autoclaving separately) 2% (w/v)

With pH regulator is pH7.4

To wherein adding tsiklomitsin (5mg/l).This pre-culture is incubated 16 hours with 240rpm at 33 ℃ on shaking table.Inoculate master culture from this pre-culture, the initial OD (660nm) of master culture is 0.1 thus.Substratum MM is used for master culture.

Substratum MM

CSL (corn immersion liquid) 5g/l

MOPS (morpholino propane sulfonic acid) 20g/l

Glucose (autoclaving separately) 50g/l

(NH ₄) ₂SO ₄ 25g/l

KH ₂PO ₄ 0.1g/l

MgSO ₄*7H ₂O 1.0g/l

CaCl ₂*2H ₂O 10mg/l

FeSO ₄*7H ₂O 10mg/l

MnSO ₄*H ₂O 5.0mg/l

Vitamin H (filtration sterilization) 0.3mg/l

VitB1 * HCl (filtration sterilization) 0.2mg/l

L-leucine (filtration sterilization) 0.1g/l

CaCO ₃ 25g/l

With CSL, the pH regulator of MOPS and described salts solution is 7, and autoclaving with ammoniacal liquor.Add aseptic substrate and vitamin solution then, and under drying regime autoclaved CaCO ₃

In having the 100ml Erlenmeyer flask of baffle plate, cultivate with the 10ml volume.Add tsiklomitsin (5mg/l).Under 33 ℃ and 80% humidity, cultivate.

After 72 hours, (Beckmann Instruments GmbH Munich) measures OD under 660nm mensuration wavelength with Biomek 1000.(Hamburg Germany) detects post-column derivatization and the Threonine amount determining to form through ion exchange chromatography with triketohydrindene hydrate with the amino acidanalyser of Eppendorf-Bio Tronik company.

Experimental result is shown in table 1.

Table 1

Bacterial strain	OD (660nm)	L-Threonine g/l
Bacterial strain	OD (660nm)	L-Threonine g/l	DSM5399	12.3	0.74
DSM5399/pEC-T18mob2zwf	10.2	1.0	DSM5399	12.3	0.74

2.3:L-the preparation of Methionin

The Corynebacterium glutamicum strain DSM5715/pEC-T18mob2zwf that will obtain in embodiment 2.1 is being suitable for cultivating in the nutritional medium that Methionin produces, determines lysine content in the culture supernatant.

For this reason, at first this bacterial strain had corresponding antibiotic agar plate (the brain heart agar with tsiklomitsin (5mg/l)) upward 33 ℃ of insulations 24 hours.From this agar plate culture, inoculate pre-culture (10ml cultivates based in the 100ml Erlenmeyer flask).Perfect medium CgIII is as pre-incubated substratum.

Culture medium C g III

NaCl 2.5g/l

Bacto-peptone 10g/l

Bacto-yeast extract 10g/l

Glucose (autoclaving separately) 2% (w/v)

pH 7.4

Substratum MM

CSL (corn immersion liquid) 5g/l

MOPS (morpholino propane sulfonic acid) 20g/l

Glucose (autoclaving separately) 58g/l

(NH ₄) ₂SO ₄ 25g/l

KH ₂PO ₄ 0.1g/l

MgSO ₄*7H ₂O 1.0g/l

CaCl ₂*2H ₂O 10mg/l

FeSO ₄*7H ₂O 10mg/l

MnSO ₄*H ₂O 5.0mg/l

Vitamin H (filtration sterilization) 0.3mg/l

VitB1 * HCl (filtration sterilization) 0.2mg/l

L-leucine (filtration sterilization) 0.1g/l

CaCO ₃ 25g/l

After 72 hours, (Beckmann Instruments GmbH Munich) measures OD under 660nm mensuration wavelength with Biomek 1000.(Hamburg Germany) detects post-column derivatization and the lysine amount determining to form through ion exchange chromatography with triketohydrindene hydrate with the amino acidanalyser of Eppendorf-Bio Tronik company.

Experimental result is shown in table 2.

Table 2

Bacterial strain	OD (660nm)	L-Methionin HCl g/l
Bacterial strain	OD (660nm)	L-Methionin HCl g/l	DSM5715	10.8	16.0
DSM5715/pEC-T18mob2zwf	7.2	17.1	DSM5715	10.8	16.0

Embodiment 3:

The structure of the gene library of Corynebacterium glutamicum strain ASO19

λ Zap Express is used in the DNA library of Corynebacterium glutamicum strain ASO19 (Yoshihama et al., Journal ofBacteriology 162,591-597 (1985)) ^TM(the Short et al. of system, (1988) Nucleic Acids Research, 16:7583-7600) make up, as O ' Donohue (O ' Donohue, M. (1997) .The Cloning and MolecularAnalysis of Four Common Aromatic Amino Acid Biosynthetic Genes fromCorynebacterium glutamicum.Ph.D.Thesis, National University ofIreland, Galway) described.λ Zap Express ^TMTest kit instructs available from Stratagene (La Jolla, California 92037 for Stratagene, 11011 North Torrey Pines Rd.) and according to manufacturer and uses.AS019-DNA is advanced BamHI with restriction enzyme Sau3A digestion and connection to be handled and dephosphorylized λ Zap Express ^TMIn the arm.

Embodiment 4:

The clone of pgi gene and order-checking

4.1: the clone

To as described in Kupor and Fraenkel (Journal of Bacteriology 100:1296-1301 (1969)), have the AS019 λ Zap Express of the coli strain DF1311 of pgi and pg1 transgenation with embodiment 3 described about 500ng ^TMPlasmid library transforms.At the M9 minimum medium that contains 50mg/l concentration kantlex (Sambrook et al., (1989) .Molecular Cloning.A Laboratory Manual, Cold Spring HarborLaboratories USA) goes up the selection transformant, and 37 ℃ of insulations 48 hours.According to Birnboim and Doly (Nucleic Acids Research 7:1513-1523 (1979)) described from a transformant isolated plasmid dna, be called pAMC1 (Fig. 3).

4.2: order-checking

For the insertion body to the pAMC1 clone carries out sequential analysis, use (Proceedings of the National Academy of Sciences USA 74 such as Sanger, 5463-5467 (1977)) described method, use through coloured fluorescent mark not the primer of isolabeling analyze.Use Perkin Elmer Applied Biosystems (Perkin Elmer Corporation, Norwalk, Connecticut, the ABI prism Big Dye of ABI prism 310 genetic analyzers U.S.A) and PerkinElmer ^TMTerminator Cycle Sequencing ReadyReaction Kit carries out.

The homing sequence analysis use derive from Pharmacia Biotech (St.Albans, Herts, AL13AW, UK) general forward and M13 reverse primer carry out:

General forward primer:

GTA ATA CGA CTC ACT ATA GGG C(SEQ ID NO：13)

The M13 reverse primer:

GGA AAC AGC TAT GAC CAT G(SEQ ID NO：14)

From the sequence that obtains, design inherent primer, the pgi gene that can derive whole thus subsequently.The sequence of inherent primer is as follows:

Inherent primer 1 (SEQ ID NO:15): GGA AAC AGG GGA GCC GTC

Inherent primer 2 (SEQ ID NO:16): TGC TGA GAT ACC AGC GGT

Use DNA Strider program (Marck, (1988) .Nucleic Acids Research16:1829-1836) then, 1.0 versions are analyzed the sequence that obtains on the Apple macintosh computer.This program can be analyzed as restriction site and use, and open reading frame analysis and codon use to be determined.Blast program is used in dna sequence dna that obtains and the search between those sequences in EMBL and the Genbank database, and (Altschul et al., (1997) .Nucleic AcidsResearch 25:3389-3402) carries out.DNA and protein sequence use Clustal V and Clustal W program (Higgins and Sharp, 1988 Gene 73:237-244) to arrange contrast.

Thus obtained sequence is shown in SEQ ID NO:1.The nucleotide sequence analysis that obtains shows the open reading frame of one 1650 base pair, is called the pgi gene, and its coding has 550 amino acid whose protein, shown in SEQ ID NO:2.

Embodiment 5:

Integrate the preparation of the integrative vector of mutagenesis pgi gene

The interior segments of pgi gene is by polymerase chain reaction (PCR) amplification, use to separate genomic dna from Corynebacterium glutamicum AS019 (Heery and Dunican, (1993) Applied andEnvironmental Microbiology 59:791-799) as template.The pgi primer that uses is:

Forward primer: ATG GAR WCC AAY GGH AA (SEQ ID NO:17)

Reverse primer: YTC CAC GCC CCA YTG RTC (SEQ ID NO:18)

Wherein: R=A+G; Y=C+T; W=A+T; H=A+T+C.

The PCR parameter is as follows:

35 circulations

94 ℃ 1 minute

47 ℃ 1 minute

72 ℃ 30 seconds

1.5mM MgCl ₂

About 150-200ng dna profiling

The PCR product cloning that obtains advanced to be purchased (Promega UK in pGEM-T carrier Southampton.), uses coli strain JM109, and (Yanisch-Perron et al., 1985.Gene 33:103-119) are the host from Promega company.The sequence of this PCR product is shown in SEQ ID NO:3.The insertion body that to clone then is cut into the EcoRI fragment and connects with using the pretreated plasmid pBGS8 of EcoRI (Spratt et al., Gene 41:337-342 (1986)).The restriction enzyme of using derives from Boehringer Mannheim UK Ltd., and (BellLane, Lewes East Sussex BN7 1LG UK.), instruct use according to manufacturer.Then e. coli jm109 is connected mixture with this and transforms, and added concentration be respectively 1mM, 0.02% and the Luria agar of IPTG (sec.-propyl-β-D-thio-galactose pyran-glucoside), the XGAL (5-bromo-4-chloro-3-indoles-D-semi-lactosi pyranoside) of 50mg/l and kantlex on selection electric transformant.

Agar plate is incubated 12 hours at 37 ℃.Isolated plasmid dna from a transformant uses EcoRI, BamHI and SalI to identify by restriction enzyme analysis, is called pMC1 (Fig. 4).

Plasmid pMC1 with the form of coli strain DH5 α/pMC1 according to budapest treaty be deposited in German microbial preservation center (DSMZ, Braunschweig, Germany), preserving number DSM 12969.

Embodiment 6:

The integration mutagenesis of pgi gene in Methionin production strain DSM 5715

Embodiment 5 described carrier pMC1 are advanced among the Corynebacterium glutamicum DSM 5715 by (FEMSMicrobiological Letters, 123:343-347 (1994)) described electroporation method electroporations such as Tauch.Strain DSM 5715 is that a kind of AEC-resistance Methionin is produced bacterial strain.Carrier pMC1 can not be independently duplicated in DSM5715, just can be retained in the cell when only being integrated in DSM 5715 karyomit(e)s.By electroporation batch thing bed board is being added the LB agar of 15mg/l kantlex (Sambrook et al., Molecular Cloning:A Laboratory Manual.2 ^NdEd., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) last selection pMC1 is integrated into the clone in the karyomit(e).

In order to detect integration, inherent pgi fragment (embodiment 5) is used the Dig hybridization kit mark that derives from BoehringerMannheim, method (the Mannheim of " The DIG System Users Guide for Filter Hybridization " by Boehringer Mannheim GmbH, Germany, 1993) carry out mark.The chromosomal DNA of transformant separates by the method (Microbiology 140:1817-1828 (1994)) of Eikmanns etc., and at every turn with restriction enzyme SalI, SacI and HindIII cutting.The fragment that forms is separated by sepharose, hybridizes with the Dig hybridization kit that derives from Boehringer at 68 ℃.Find that in this mode plasmid pMC1 is inserted in the karyomit(e) pgi gene of strain DSM 5715.This bacterial strain is called DSM5715 ∷ pMC1.

Embodiment 7:

Zwf gene overexpression and pgi gene elimination simultaneously are to the effect of Methionin preparation

7.1: the preparation of strain DSM 5715 ∷ pMC1/pEC-T18mob2zwf

With embodiment 1.2 described carrier pEC-T18mob2zwf by Tauch etc. (1994, FEMS Microbiological Letters, 123:343-347) described electroporation method electroporation advances among the Corynebacterium glutamicum DSM 5715 ∷ pMC1.By with electroporation batch thing bed board at the LB agar of having added 15mg/l kantlex and 5mg/l tsiklomitsin (Sambrook et al., Molecular Cloning:A Laboratory Manual.2 ^NdEd., Cold Spring HarborLaboratory Press, Cold Spring Harbor, N.Y., 1989) the last cell of selecting to carry plasmid.By ordinary method (Peters-Wendisch et al., 1998, Microbiology144,915-927) isolated plasmid dna from transformant, and by handling with restriction enzyme KpnI and SalI and subsequently agarose coagulates electrophoresis detection.Described bacterial strain is called DSM5715 ∷ pMC1/pEC-T18mob2zwf.

7.2: the preparation of Methionin

The Corynebacterium glutamicum strain DSM5715 ∷ pMC1/pEC-T18mob2zwf that obtains among the embodiment 7.1 is cultivated in the nutritional medium that is suitable for the Methionin generation, determine lysine content in the culture supernatant.

For this reason, at first bacterial strain had corresponding antibiotic agar plate (the brain heart agar with tsiklomitsin (5mg/l) and kantlex (25mg/l)) upward 33 ℃ of insulations 24 hours.Antibiotic resistance is added the culture of contrast bacterial strain according to it.From this agar plate culture, inoculate pre-culture (10ml cultivates based in the 100ml Erlenmeyer flask).Perfect medium CgIII is as pre-incubated substratum.

Culture medium C g III

NaCl 2.5g/l

Bacto-peptone 10g/l

Bacto-yeast extract 10g/l

Glucose (autoclaving separately) 2% (w/v)

pH7.4

To wherein adding tsiklomitsin (5mg/l) and kantlex (5mg/l).This pre-culture is incubated 16 hours with 240rpm at 33 ℃ on shaking table.Inoculate master culture from this pre-culture, the initial OD (660nm) of master culture is 0.1 thus.Substratum MM is used for master culture.

Substratum MM

CSL (corn immersion liquid) 5g/l

MOPS (morpholino propane sulfonic acid) 20g/l

Glucose (autoclaving separately) 50g/l

(NH ₄) ₂SO ₄ 25g/l

KH ₂PO ₄ 0.1g/l

MgSO ₄*7H ₂O 1.0g/l

CaCl ₂*2H ₂O 10mg/l

FeSO ₄*7H ₂O 10mg/l

MnSO ₄*H ₂O 5.0mg/l

Vitamin H (filtration sterilization) 0.3mg/l

VitB1 * HCl (filtration sterilization) 0.2mg/l

L-leucine (filtration sterilization) 0.1g/l

CaCO ₃ 25g/l

Is 7 with ammoniacal liquor with the pH regulator of CSL, MOPS and described salts solution, and autoclaving.Add aseptic substrate and vitamin solution then, and under drying regime autoclaved CaCO ₃

In having the 100ml Erlenmeyer flask of baffle plate, cultivate with the 10ml volume.Add tsiklomitsin (5mg/l) and kantlex (25mg/l).Under 33 ℃ and 80% humidity, cultivate.

Experimental result is shown in table 3.

Table 3

Bacterial strain	OD (660nm)	L-Methionin HCl g/l
Bacterial strain	OD (660nm)	L-Methionin HCl g/l	DSM5715	7.3	14.3
DSM5715/pEC-T18mob2zwf	7.1	14.6	DSM5715	7.3	14.3
DSM5715/pEC-T18mob2zwf	7.1	14.6	DSM5715∷pMC1/ pECTmob2zwf	10.4	15.2

Embodiment 8:

From Corynebacterium glutamicum ATCC 13032 preparation genome clay gene libraries

The chromosomal DNA of Corynebacterium glutamicum ATCC 13032 such as Tauch etc. (1995, Plasmid 33:168-179) the described separation, and with restriction enzyme Sau3AI (AmershamPharmacia, Freiburg, Germany, Product Description Sau3AI, Code no.27-0913-02) the part cutting.With this dna fragmentation shrimp alkaline phosphotase (RocheMolecular Biochemicals, Mannheim, Germany, Product DescriptionSAP, Code no.1758250) dephosphorylation.To derive from Stratagene (La Jolla, USA, Product Description SuperCosl Cosmid Vektor Kit, Code no.251301) DNA of cosmid vector SuperCosl (Wahl et al. (1987) Proceedings of theNational Academy of Sciences USA 84:2160-2164) restriction enzyme XbaI (Amersham Pharmacia, Freiburg, Germany, Product DescriptionXbaI, Code no.27-0948-02) cutting, and use the shrimp alkaline phosphotase dephosphorylation equally.

Then cosmid DNA is cut with restriction enzyme BamHI (Amersham Pharmacia, Freiburg, Germany, Product Description BamHI, Code no.27-0868-04).The cosmid DNA of handling is in this way mixed with the ATCC13032 DNA of processing, and with this batch thing T4 dna ligase (Amersham Pharmacia, Freiburg, Germany, Product Description T4-DNA-Ligase, Code no.27-0870-04) handle.To connect mixture then packs in phage by means of Gigapack II XL PackingExtracts (Stratagene, La Jolla, USA, Product Description Gigapack IIXL Packing Extract, Code no.200217).For ehec infection bacterial strain NM554 (Raleigh et al.1988, Nucleic Acid Res.16:1563-1575), cell is placed 10mM MgSO ₄In and mix with phage suspension liquid equal portions.As (1989, Molecular Cloning:A laboratory Manual, ColdSpring Harbor) such as Sambrook are described cosmid library is infected and titration, with the cell bed board at LB agar (Lennox, 1955, Virology is 1:190)+100 on the μ g/ml penbritin.After 37 ℃ of incubated overnight, select each clone of reorganization.

Embodiment 9:

The separation of poxB gene and order-checking

The cosmid DNA of each bacterium colony (embodiment 7) uses Qiaprep Spin Miniprep test kit (Product No.27106, Qiagen, Hilden, Germany) separate according to manufacturer's guidance, and use restriction enzyme Sau3AI (Amersham Pharmacia, Freiburg, Germany, Product Description Sau3AI, Product No.27-0913-02) the part cutting.With this dna fragmentation shrimp alkaline phosphotase (Roche Molecular Biochemicals, Mannheim, Germany, Product Description SAP, Product No.1758250) dephosphorylation.After the gel electrophoresis separation, size is used QiaExII gel extraction kit (Product No.20021, Qiagen, Hilden, Germany) separation at the cosmid fragment of 1500-2000bp scope.Derive from the DNA (Groningen of the sequencing vector pZero-1 of Invitrogen, Holland, Product Description Zero Background CloningKit, Product No.K2500-01) with restriction enzyme BamHI (Amersham Pharmacia, Freiburg, Germany, Product Description BamHI, Product No.27-0868-04) cutting.By Sambrook etc. (1989, Molecular Cloning:A laboratoryManual, Cold Spring Harbor) described method connects described cosmid fragment in sequencing vector pZero-1, with DNA mixture and T4 ligase enzyme (Pharmacia Biotech, Freiburg, Germany) incubated overnight together.

Then this is connected mixture electroporation (Tauch et al.1994, FEMS MicrobiolLetters, 123:343-7) advance coli strain DH5 α MCR (Grant, 1990, Proceedings of the National Academy of Sciences U.S.A., 87:4645-4649) in, and be plated on LB agar (Lennox with 50 μ g/ml zeocin, 1955, Virology, 1:190) on.Biorobot 9600 is used in the plasmid preparation of recombinant clone, and (Hilden Germany) carries out for ProductNo.900200, Qiagen.Order-checking is by Zimmermann etc. (1990, Nucleic Acids Research, 18:1067) Sanger of Xiu Gaiing etc. (1977, Proceedings of the National Academies of Sciences U.S.A., dideoxy-chain terminating method 74:5463-5467) carries out." the RRdRhodamin Terminator Cycle Sequencing Kit " of use PE Applied Biosystems (Product No.403044, Weiterstadt, Germany).Has PE Applied Biosystems (Weiterstadt, " (Product No.A 124.1; Roth; Karlsruhe carries out the analysis of gel electrophoresis separation and sequencing reaction on Germany) to Gel (29:1) to the Rotiphoresis NFAcrylamide/Bisacrylamide of ABI Prism 377 sequenators of sequenator Germany).

Then the original series data that obtain are used the Staden routine package (1986, NucleicAcids Research, 14:217-231) version 97-0 handles.Each sequence of pZero1 derivative is assembled into continuous contig (contig).With the XNIP program (Staden, 1986, Nucleic Acids Research 14:217-231) carries out computer assisted coding region and analyzes.Use in addition the blast search program (Altschul et al., 1997, Nucleic AcidsResearch, 25:3389-3402) to state-run biotechnology information center (NCBI, Bethesda, MD, Non-redundant data storehouse USA) is analyzed.

The gained nucleotides sequence is shown in SEQ ID NO:4.Nucleotide sequence analysis illustrates the open reading frame of one 1737 base pair, and it is called the poxB gene.579 amino acid whose polypeptide of poxB genes encoding (SEQ ID NO:5).

Embodiment 10:

Carry out the preparation of the integrative vector of poxB gene integration mutagenesis

From strains A TCC 13032, separate chromosomal DNA by described method such as Eikmanns (Microbiology 140:1817-1828 (1994)).Based on the sequence of the poxB gene of known Corynebacterium glutamicum from embodiment 8, select following oligonucleotide to carry out polymerase chain reaction:

poxBint1(SEQ ID NO：19)：

5`TGC GAG ATG GTG AAT GGT GG 3`

poxBint2(SEQ ID NO：20)：

5`GCA TGA GGC AAC GCA TTA GC 3`

Shown in primer by MWG Biotech (Ebersberg, Germany) synthetic, the PCR reaction is by (PCR protocols.A guide to methods and applications such as Innis, 1990, Academic Press) standard pcr carries out, and uses the Pwo polysaccharase of Boehringer.By means of polymerase chain reaction, separate the dna fragmentation of an about 0.9kb of size, it carries the interior segments of poxB gene, shown in SEQ ID NO:6.

With the dna fragmentation of amplification and TOPO TA clone test kit (Carlsbad, CA, the USA of Invitrogen company; Catalogue Number K4500-01) in carrier pCR2.1-TOPO (Mead at al. (1991) Bio/Technology 9:657-663), connects.Then coli strain DH5 α is used and connect batch thing electroporation (Hanahan, In:DNA cloning.APractical Approach.Vol.I, IRL-Press, Oxford, Washington DC, USA, 1985).Adding the LB agar of 25mg/l kantlex (Sambrook et al., Molecular Cloning:A Laboratory Manual.2 with transforming batch thing bed board ^NdEd., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) on, the cell of plasmid is carried in selection.Plasmid DNA is separated from transformant by means of the QIAprep SpinMiniprep test kit of Qiagen, and by detecting with limiting enzyme EcoRI restriction and agarose gel electrophoresis (0.8%) subsequently.This plasmid is called pCR2.1poxBint (Fig. 5).

Plasmid pCR2.1poxBint is deposited in German microbial preservation center with coli strain DH5 α/pCR2.1poxBint form according to budapest treaty, and (Germany), preserving number is DSM 13114 for DSMZ, Braunschweig.

Embodiment 11:

The integration mutagenesis of poxB gene in Methionin production strain DSM 5715

Embodiment 10 described carrier pCR2.1poxBint are advanced among the Corynebacterium glutamicum DSM 5715 by electroporation method (FEMS Microbiological Letters, 123:343-347 (the 1994)) electroporation of Tauch etc.Strain DSM 5715 is that AEC resistance Methionin is produced bacterial strain.Carrier pCR2.1poxBint can not be independently duplicated in DSM5715, only is integrated in the karyomit(e) of DSM5715 just can be retained in the cell.With electroporation batch thing bed board at the LB agar of having added the 15mg/l kantlex (Sambrook et al., Molecular Cloning:ALaboratory Manual.2 ^NdEd., Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.) on, select pCR2.1poxBint to be integrated into clone in the karyomit(e).In order to detect integration, by Boehringer Mannheim GmbH (Mannheim, the method of Germany, 1993) " The DIG System Users Guide for FilterHybridization " is with the Dig hybridization kit mark of poxBint fragment with Boehringer.

The chromosomal DNA of potential intasome separates by described method such as Eikmanns (Microbiology 140:1817-1828 (1994)), and at every turn with restriction enzyme SalI, SacI and HindIII cutting.The fragment that forms is separated by agarose gel electrophoresis, 68 ℃ of Dig hybridization kit hybridization with Boehringer.Embodiment 9 described plasmid pCR2.1poxBint insert in the chromosomal poxB gene of DSM5715.This bacterial strain is called DSM5715 ∷ pCR2.1poxBint.

Embodiment 12:

Zwf gene overexpression poxB gene is simultaneously eliminated the effect that Methionin is produced

12.1: the preparation of strain DSM 5715 ∷ pCR2.1poxBint/pEC-T18mob2zwf

Use described electroporation methods (FEMS Microbiology Letters, 53:299-303 (1989)) such as Liebl, 5715 ∷ pCR2.1poxBint transform with plasmid pEC-T18mob2zwf with strain DSM.Comprising 18.5g/l brain heart meat extract, 0.5M Sorbitol Powder, 5g/l Bacto-tryptone, 2.5g/l Bacto-yeast extract, 5g/l NaCl and 18g/lBacto-agar have also been added on the LBHIS agar of 5mg/l tsiklomitsin and 25mg/l kantlex and have been selected transformant.33 ℃ of insulations 2 days.

By ordinary method (Peters-Wendisch et al., 1998, Microbiology 144,915-927) isolated plasmid dna from transformant at every turn, with restriction endonuclease XbaI and KpnI cutting, and the agarose gel electrophoresis that plasmid is passed through subsequently detects.The bacterial strain of Huo Deing is called DSM5715:pCR2.1poxBint/pEC-T18mob2zwf by this way.

12.2:L-the preparation of Methionin

The Corynebacterium glutamicum strain DSM5715 ∷ pCR2.1poxBint/EC-T18mob2zwf that obtains among the embodiment 12.1 is cultivated in the nutritional medium that is suitable for Methionin production, determine the lysine content in the culture supernatant.

For this reason, at first bacterial strain had corresponding antibiotic agar plate (the brain heart agar with tsiklomitsin (5mg/l) and kantlex (25mg/l)) upward 33 ℃ of insulations 24 hours.Add the contrast bacterial strain according to its antibiotics resistance.From this agar plate culture, inoculate pre-culture (10ml cultivates based in the 100ml Erlenmeyer flask).Perfect medium Cg III is as pre-incubated substratum.

Culture medium C g III

NaCl 2.5g/l

Bacto-peptone 10g/l

Bacto-yeast extract 10g/l

Glucose (autoclaving separately) 2% (w/v)

pH 7.4

To wherein adding tsiklomitsin (5mg/l) and kantlex (25mg/l).This pre-culture is incubated 16 hours with 240rpm at 33 ℃ on shaking table.Inoculate master culture from this pre-culture, the initial OD (660nm) of master culture is 0.1 thus.Substratum MM is used for master culture.

Substratum MM

CSL (corn immersion liquid) 5g/l

MOPS (morpholino propane sulfonic acid) 20g/l

Glucose (autoclaving separately) 58g/l

(NH ₄) ₂SO ₄ 25g/l

KH ₂PO ₄ 0.1g/l

MgSO ₄*7H ₂O 1.0g/l

CaCl ₂*2H ₂O 10mg/l

FeSO ₄*7H ₂O 10mg/l

MnSO ₄*H ₂O 5.0mg/l

Vitamin H (filtration sterilization) 0.3mg/l

VitB1 * HCl (filtration sterilization) 0.2mg/l

L-leucine (filtration sterilization) 0.1g/l

CaCO ₃ 25g/l

After 72 hours, (Beckmann Instruments GmbH Munich) measures OD under 660nm mensuration wavelength with Biomek 1000.(Hamburg Germany) detects post-column derivatization and the lysine amount determining to form through ion exchange chromatography with triketohydrindene hydrate with the amino acidanalyser of Eppendorf-BioTronik company.

Experimental result is shown in table 4.

Table 4

Bacterial strain	OD (660nm)	L-Methionin HCl g/l
Bacterial strain	OD (660nm)	L-Methionin HCl g/l	DSM5715	10.8	16.0
DSM5715/pEC-T18mob2zwf	8.3	17.1	DSM5715	10.8	16.0
DSM5715/pEC-T18mob2zwf	8.3	17.1	DSM5715∷pCR2.1poxBint	7.1	16.7
DSM5715∷pCR2.1poxBint/ pEC-Tmob2zwf	7.8	17.7	DSM5715∷pCR2.1poxBint	7.1	16.7

Embodiment 13:

Zwf allelotrope zwf (A243T)

Separate and order-checking

Corynebacterium glutamicum strain DM658 is by selecting and screen to prepare through multiple, non-directional mutagenesis, mutant from Corynebacterium glutamicum ATCC 13032.This bacterial strain has resistance to L-lysine analogues S-(2-aminoethyl)-L-halfcystine (AEC), and has the insensitive feedback resistance of the mixture E.C. 2.7.2.4. to L-Methionin, L-lysine analogues S-(2-aminoethyl)-L-halfcystine (AEC) and L-Threonine.Bacterial strain DM658 is deposited in German microbial preservation center (DSMZ), and preserving number is DSM7431.

By ordinary method (Eikmanns et al., Microbiology 140:1817-1828 (1994)), from bacterial strain DM658, separate chromosomal DNA.By means of polymerase chain reaction (PCR), zwf gene or allelic dna fragmentation are carried in amplification.Based on the sequence of the zwf gene of Corynebacterium glutamicum, select the primer tasteless nucleotide among the following embodiment 1.2 to carry out PCR:

Zwf-forward (SEQ ID NO:11):

5′-TCG ACG CGG TTC TGG AGC AG-3′

Zwf-is (SEQ ID NO:12) oppositely:

5′-CTA AAT TAT GGC CTG CGC CAG-3′

Shown in primer (Ebersberg, Germany) synthetic, the standard pcr by (PCR Protocols.A Guide to Methods and Applications, 1990, Academic Press) such as Innis carries out PCR by MWG Biotech.Described primer amplification go out length be about 1.85kb, carry the allelic dna fragmentation of zwf.

Differentiate that by 0.8% agarose gel electrophoresis the zwf that carries bacterial strain DM658 is allelic, length is the dna fragmentation of the amplification of about 1.85kb, from gel, separate and by ordinary method (QIAquick Gel Extraction Kit, Qiagen, Hilden, Germany) purifying.

The dna fragmentation of amplification or the nucleotide sequence of PCR product are by MWG Biotech (Ebersberg, Germany) order-checking and determining.The sequence of this PCR product is shown in SEQ IDNO:21.Aminoacid sequence by means of zymoprotein (Zwf albumen) between the acquisition of Patentin program is shown in SEQ ID NO:22.

The nucleotides sequence of the allelic coding region of zwf of bacterial strain DM658 is listed in the 727th and has bases adenine.The 727th corresponding to nucleotide sequence shown in the SEQ ID NO:21 the 1034th in the nucleotide sequence of zwf allelotrope coding region.

The 727th Nucleotide at the nucleotide sequence of wild-type gene coding region is the base guanine.The 727th of the nucleotide sequence of wild type gene coding region corresponding to SEQ ID NO:9 the 1264th.

The aminoacid sequence of zymoprotein between bacterial strain DM658 (Zwf (A243T)) has amino acid Threonine (SEQ ID NO:22) at the 243rd.In the proteic corresponding position of wild-type is amino acid alanine (SEQ ID NO:10).Therefore, described allelotrope is called zwf (A243T).

SEQ ID NO:23 illustrates an inner segment of the allelic encoding sequence of zwf (A243T) that comprises guanine VITAMIN B4 conversion (see SEQ ID NO:23 the 137th).

Embodiment 14:

The transfer of zwf allelotrope zwf (A243T)

14.1: the separation of carrying the allelic dna fragmentation of zwf (A243T)

By ordinary method (Eikmanns et al., Microbiology 140:1817-1828 (1994)), from bacterial strain DM658, separate chromosomal DNA.Carry the allelic DNA of zwf (A243T) zone by means of PCR amplification, described allelotrope in the coding region (CDS) the 727th contain the base guanine that bases adenine replaces wild type gene to contain in this position.Based on the sequence of the zwf gene of Corynebacterium glutamicum, select following primer tasteless nucleotide primer to carry out polymerase chain reaction:

zwf_XL-A1(SEQ ID NO：24)：

5`ga tct aga-agc tcg cct gaa gta gaa tc 3`

zwf_XL-E1(SEQ ID NO：25)：

5`ga tct aga-gat tca cgc agt cga gtt ag 3`

Shown in primer by MWG Biotech (Ebersberg, Germany) synthetic, carry out the PCR reaction by (PCR Protocols.A Guide to Methods and Applications, 1990, Academic Press) standard pcrs such as Innis.Described primer amplification goes out to carry the dna fragmentation (SEQ IDNO:26) that zwf (A243T) is allelic, length is about 1.75kb.Described primer contains the sequence of the cleavage site of restriction endonuclease XbaI in addition, and it is indicated with underscore in above-mentioned nucleotide sequence.

The dna fragmentation that carries the amplification that zwf (A243T) is allelic, length is about 1.75kb cuts with restriction endonuclease XbaI, differentiate by in 0.8% sepharose, carrying out electrophoresis, from gel, separate and purifying (QIAquick GelExtraction Kit by ordinary method then, Qiagen, Hilden).

14.2: the structure of replacement vector

The XbaI dna fragmentation (seeing embodiment 14.1) that will contain the allelic length of zwf (A243T) and be about 1.75kb mixes in the karyomit(e) of Corynebacterium glutamicum strain DSM5715, by described sacB (Gene of system such as Schaefer, 14,69-73 (1994)) replaces mutagenesis.This system can prepare and select the allelic replacement of generation by homologous recombination.

Movably cloning vector pK18mobsacB digests with restriction enzyme XbaI, and with end alkaline phosphatase (Alkaline Phosphatase, Boehringer Mannheim, Germany) dephosphorylation.The carrier of preparation is by this way mixed with zwf (A243T) fragment of about 1.75kb size, and (Amersham-Pharmacia, Freiburg Germany) handle with the T4 dna ligase with mixture.

Then with coli strain S17-1 (Simon et al., Bio/Technologie 1:784-791,1993) connect batch thing with this and transform (Hanahan, In.DNA cloning.APractical Approach.Vol.1, ILR-Press, Cold Spring Harbor, NewYork, 1989).To transform batch thing bed board at the LB agar of having added the 25mg/l kantlex (Sambrook et al., Molecular Cloning:A Laboratory Manual.2 ^NdEd., Cold Spring Harbor, New York, 1989) on, the cell of plasmid is carried in selection

By means of QIAprep Spin Miniprep test kit isolated plasmid dna from transformant of Qiagen, by detecting with restricted cutting of enzyme PstI and agarose gel electrophoresis subsequently.This plasmid is called pK18mobsacB_zwf (A243T), is shown in Fig. 6.

14.3: allelic transfer

Carrier pK18mobsacB_zwf (A243T) described in the embodiment 14.2 is moved among the Corynebacterium glutamicum strain DSM5715 by joint, and (Journal of Microbiology 172:1663-1666 (1990)) carries out by described methods such as Schaefer.This carrier can not be independently duplicated in DSM5715, has only to be integrated in the karyomit(e) by recombination event just to be retained in the cell.To engage batch thing bed board at the LB agar of having added 15mg/l kantlex and 50mg/l nalidixic acid (Sambrook et al., Molecular Cloning:A LaboratoryManual.2 ^NdEd., Cold Spring Harbor, New York, 1989) on, select transconjugant, promptly have the clone of the pK18mobsacB_zwf (A243T) of integration.Kalamycin resistance transconjugant bed board is being contained on the LB agar plate of 25mg/l kantlex, 33 ℃ of insulations 24 hours.The kalamycin resistance transconjugant is called DSM5715 ∷ pK18mobsacB_zwf (A243T).Be integrated into result in strain DSM 5715 karyomit(e)s as plasmid vector pK18mobsacB_zwf (A243T), the bacterial strain of acquisition is that DSM5715 ∷ pK18mobsacB_zwf (A243T) contains zwf wild type gene and zwf (A243T) allelotrope.

In order to select wherein since the excision due to the secondary recombination event mutant of described plasmid, with the non-selective cultivation 24 hours in the LB liquid nutrient medium of the cell of strain DSM 5715 ∷ pK18mobsacB_zwf (A243T), bed board has on the LB agar of 10% sucrose then, is incubated 30 hours.

(A243T is the same with initial plasmid pK18mobsacB, except kalamycin resistance gene, also contains the sacB gene copy of the levansucrase of coding subtilis (Bacillussubtilis) for plasmid pK18mobsacB_zwf.Can be caused levansucrase to form by the expression of sucrose induction, its catalysis be the synthetic of toxic product Polylevulosan for Corynebacterium glutamicum.Having only wherein those that excised the plasmid pK18mobsacB_zwf (A243T) that integrates owing to the secondary recombination event to be cloned on the LB agar that contains sucrose grows.Depend on position, allelic replacement (promptly mixing sudden change) or original copy (being wild type gene) take place be retained in host's the karyomit(e) about the secondary recombination event in mutational site.

Phenotype to about 40-50 bacterium colony test " growth when having sucrose " and " not growing when having kantlex ".In 4 bacterium colonies of the phenotype that " growth when having sucrose " and " not growing when having kantlex " is shown, a zone order-checking to the zwf gene of crossing over zwf (A243T) sudden change, from sequencing primer zf_1 (SEQID NO:27) (GATC Biotech AG, Konstanz, the Germany preparation) there is zwf (A243T) allelic mutation in beginning to prove in the karyomit(e).The nucleotide sequence of primer zf_1 is as follows:

zf_1(SEQ ID NO：27)：

5`ggc tta cta cct gtc cat tc 3`

Differentiate by this way the 727th of zwf gene coding region (CDS) and contain bases adenine and therefore in its karyomit(e), have the allelic clone of zwf (A243T).This clone is called strain DSM 5715zwf2_A243T.

Strain DSM 5715zwf2_A243T is deposited in German microbial preservation center according to budapest treaty, and (Germany), preserving number is DSM15237 for DSMZ, Braunschweig.

Embodiment 15:

The evaluation of glucose-6-phosphate dehydrogenase (G6PD) and definite

15.1: the glucose-6-phosphate dehydrogenase (G6PD) of bacterial strain DM658 is active to be determined

In order to identify the activity of the glucose-6-phosphate dehydrogenase (G6PD) that zwf allelotrope zwf (A243T) encodes, (Germany) middle insulation is 24 hours for Merck KG, Darmstadt at the LB substratum with bacterial strain DM658.Cultivation is to carry out on shaking table with 200rpm at 33 ℃ in having the 250ml Erlenmeyer flask of plate washer with the 25ml volume.In order to compare parallel cultivation wild type strain ATCC 13032.Also in the Tris-HCl of pH7.8 (100mM) damping fluid, wash subsequently by centrifugal collection of biological amount.(Hybaid AG, Heidelberg Germany) make cytolysis to use the Ribolyser system.By this method, use 1.6g granulated glass sphere (diameter 0.2 μ m) and contain above-mentioned cell pH 7.8,0.6g Tris-HCl (100mM)/NaCl damping fluid (520mM) pair cell carries out mechanize and dissolves.After centrifugal, separate supernatant and be used as crude extract.By colorimetric BCA method (Pierce, Rockford, IL, USA, Order No.23235ZZ), use the equal portions supernatant to determine total protein concentration.Another equal portions are used for determining the glucose-6-phosphate dehydrogenase (G6PD) activity.

The following reaction of glucose-6-phosphate dehydrogenase (G6PD) (EC 1.1.1.49) catalysis:

G-6-P+NADP ⁺ 6-phosphogluconic acid-delta-lactone+NADPH

Determine that the active analytical system of glucose-6-phosphate dehydrogenase (G6PD) contains 100mM Tris-HCl (pH 7.8), 10mM MgCl ₂With 260 μ M NADP ⁺Add G-6-P to final concentration and begin reaction for the 7mM G-6-P.NADPH is absorbed in 25 ℃ in 340nm use Hitachi U3200 spectrophotometer (Nissei Sangyo, Duesseldorf, Germany) monitoring.

For the capacity enzymic activity of Units of Account/milliliter, use following formula:

Variation in the absorption of 340nm NADPH per minute
Variation in the absorption of 340nm NADPH per minute	6.22* the volume of the crude extract that is used to analyze (ml)

Specific enzyme activity (U/mg for Units of Account/milligram total protein; The mU=milliunit/mg), with the protein concn of enzymic activity divided by crude extract.

Active being determined at of glucose-6-phosphate dehydrogenase (G6PD) contained 100mM Tris-HCl (pH7.8), 10mM MgCl when having NADPH ₂, 260 μ M NADP ⁺With carry out in the analytical system of 260 μ MNADPH.Adding G-6-P to final concentration is that 7mM begins reaction.The calculating of enzymic activity is carried out with same way as described above when having NADPH.

Experimental result is shown in table 5.

Table 5

Bacterial strain	Glucose-6-phosphate dehydrogenase (G6PD)
	Glucose-6-phosphate dehydrogenase (G6PD)			Activity when not having NADPH (mU/mg protein)	Activity when having NADPH (mU/mg protein)	Residual activity (%)
	ATCC13032	80	14	Activity when not having NADPH (mU/mg protein)	Activity when having NADPH (mU/mg protein)	Residual activity (%)	17.5
DM658	ATCC13032	80	14	130	84	64.6	17.5

15.2: the glucose-6-phosphate dehydrogenase (G6PD) of strain DSM 5715zwf2_A243T is active to be determined

For the activity of glucose-6-phosphate dehydrogenase (G6PD) that determine to contain among the strain DSM 5715zwf2_A243T, zwf allelotrope zwf (A243T) coding, (Germany) middle insulation is 24 hours for Merck KG, Darmstadt at the LB substratum with this bacterial strain.Cultivation is to have in the Erlenmeyer flask of plate washer at 250ml with the 25ml volume, carries out on shaking table with 200rpm at 33 ℃.In order to compare, parallel insulation has the parental strain DSM5715 of wild-type zwf gene.The preparation of biomass is carried out as described in embodiment 15.1.

Glucose-6-phosphate dehydrogenase (G6PD) activity being determined in the situation that has its reacting final product NADPH contained 100mM Tris-HCl (pH7.8), 10mM MgCl ₂, 260 μ MNADP ⁺, 7mM G-6-P and 400 μ M NADPH analytical system in carry out.Enzymic activity when having NDDPH is calculated with aforementioned same way as.

Experimental result is shown in table 6.

Table 6

Bacterial strain	Glucose-6-phosphate dehydrogenase (G6PD)
	Glucose-6-phosphate dehydrogenase (G6PD)			Activity when not having NADPH (mU/mg protein)	Activity when having NADPH (mU/mg protein)	Residual activity (%)
	DSM5715	86	13	Activity when not having NADPH (mU/mg protein)	Activity when having NADPH (mU/mg protein)	Residual activity (%)	15
DSM5715zwf2_A243T	DSM5715	86	13	64	18	28	15

Embodiment 16:

The production of L-Methionin

Corynebacterium glutamicum strain DSM5715 that will obtain in embodiment 14 and DSM5715zwf2_A243T are being suitable for cultivating in the nutritional medium that Methionin produces, determine lysine content in the culture supernatant.

For this reason, at first bacterial strain is incubated 24 hours at 33 ℃ on agar plate.From this agar plate culture, inoculate pre-culture (10ml cultivates based in the 100ml Erlenmeyer flask) at every turn.Substratum MM is as pre-incubated substratum.Pre-culture is incubated 24 hours with 240rpm at 33 ℃ on shaking table.In all cases, inoculate master culture from these pre-cultures, the initial OD (660nm) of master culture is 0.1 thus.Substratum MM also is used for main the cultivation.

Substratum MM

CSL 5g/l

MOPS 20g/l

Glucose (autoclaving separately) 50g/l

Salt:

(NH ₄) ₂SO ₄ 25g/l

KH ₂PO ₄ 0.1g/l

MgSO ₄*7H ₂O 1.0g/l

CaCl ₂*2H ₂O 10mg/l

FeSO ₄*7H ₂O 10mg/l

MnSO ₄*H ₂O 5.0mg/l

Vitamin H (filtration sterilization) 0.3mg/l

VitB1 * HCl (filtration sterilization) 0.2mg/l

L-leucine (filtration sterilization) 0.1g/l

CaCO ₃ 25g/l

Is 7 with ammoniacal liquor with the pH regulator of CSL (corn immersion liquid), MOPS (morpholino propane sulfonic acid) and described salts solution, and autoclaving.Add aseptic substrate and vitamin solution then, and under drying regime autoclaved CaCO ₃

In having the 100ml Erlenmeyer flask of baffle plate, cultivate with the 10ml volume.Under 33 ℃ and 80% humidity, cultivate.

After 72 hours, (Beckmann Instruments GmbH Munich) measures OD under 660nm mensuration wavelength with Biomek1000.(Hamburg Germany) detects post-column derivatization and the lysine amount determining to form through ion exchange chromatography with triketohydrindene hydrate with the amino acidanalyser of Eppendorf-BioTronik company.

Experimental result is shown in table 7.

Table 7

Bacterial strain	OD (660nm)	Methionin HCl g/l
Bacterial strain	OD (660nm)	Methionin HCl g/l	DSM5715	8.6	15.3
DSM5715zwf2_A243T	9.0	16.2	DSM5715	8.6	15.3

Embodiment 17:

The zwf wild type gene of bacterial strain DM1697 is by zwf (D245S) allelic replacement

17.1: the separation of carrying the dna fragmentation of zwf gene

Corynebacterium glutamicum strain DM1697 is by selecting to produce through repeatedly non-directional mutagenesis, selection and mutant from Corynebacterium glutamicum ATCC21527.ATCC21527 is auxotrophic for L-leucine and L-homoserine.On the contrary, bacterial strain DM1697 is anauxotrophic for L-leucine and L-homoserine, lysine analogues S-(2-aminoethyl)-L-halfcystine there is resistance, and has the insensitive feedback resistance of restraining effect E.C. 2.7.2.4. S-(2-aminoethyl)-L-halfcystine and Threonine (in all situations, being 25mM) mixture.

(Eikmanns et al., Microbiology 140:1817-1828 (1994)) separates chromosomal DNA from bacterial strain DM1697 by ordinary method.The dna fragmentation that carries the zwf gene is by means of PCR amplification.Based on known Corynebacterium glutamicum zwf gene order from embodiment 1, select following Oligonucleolide primers to carry out polymerase chain reaction:

zwf_XL-Al(SEQ ID NO：24)：

5`ga tctaga agc tcg cct gaa gta gaa tc 3`

zwf_XL-E1(SEQ ID NO：25)：

5`ga tctaga gat tca cgc agt cga gtt ag 3`

Shown in primer (Ebersberg, Germany) synthetic, the PCR reaction is carried out (PCR Protocols.A Guide to Methodsand Applications, 1990, Academic Press) by the standard pcr of Innis etc. by MWG Biotech.Primer can amplification length be dna fragmentation about 1.75kb, that carry the zwf gene (SEQ ID NO:38).Described primer contains the sequence of the cleavage site of restriction endonuclease XbaI in addition, indicates with underscore in nucleotide sequence as implied above.

With carry the zwf gene, length is that the dna fragmentation of amplification of about 1.75kb is with restriction endonuclease XbaI cutting, differentiate by electrophoresis in 0.8% sepharose, separate from gel by ordinary method then and purifying (QIAquick Gel Extraction Kit, Qiagen, Hilden).

17.2: the structure of replacement vector pK18mobsacB_zwf

Will be movably cloning vector pK18mobsacB with restriction enzyme XbaI digestion, and with end with the alkaline phosphatase dephosphorylation (Alkaline Phosphatase, BoehringerMannheim, Germany).The carrier of preparation is by this way mixed with the zwf fragment of the about 1.75kb of size, and (Amersham-Pharmacia, Freiburg Germany) handle with the T4 dna ligase with mixture.

Then with coli strain DH5 α (Brown (ed.) Molecular BiologyLabfax, BIOS Scientific Publishers, Oxford, UK, 1991) transform (Hanahan, In.DNA cloning.A Practical Approach.Vol.1 with connecting batch thing, ILR-Press, Cold Spring Harbor, New York, 1989).To transform batch thing bed board at the LB agar of having added the 50mg/l kantlex (Sambrook et al., Molecular Cloning:A Laboratory Manual.2 ^NdEd., Cold Spring Harbor, New York, 1989) on, the cell of plasmid is carried in selection.

By means of QIAprep Spin Miniprep test kit isolated plasmid dna from transformant of Qiagen, by detecting with restricted cutting of enzyme XbaI and agarose gel electrophoresis subsequently.This plasmid is called pK18mobsacB_zwf, is shown in Fig. 7.

17.3: the site-directed mutagenesis by wild-type zwf gene makes up zwf (D245S) allelotrope

(Stratagene, La Jolla USA) carry out site-directed mutagenesis to use QuikChange Site-Directed mutagenesis kit.In the nucleotide sequence of zwf wild type gene shown in the SEQ ID NO:38, import three point mutation (replacement).These replacements be the 861st of nucleotide sequence guanine by thymus pyrimidine replace, the 862nd VITAMIN B4 is replaced by cytosine(Cyt) and the 863rd thymus pyrimidine is replaced by VITAMIN B4.The nucleotides sequence of Chan Shenging is shown in SEQID NO:39 by this way, and it is coded in the 245th variant Zwf albumen that is replaced aspartic acid by Serine of its aminoacid sequence.

This equipotential gene is called zwf (D245S).In order to produce described sudden change, select following Oligonucleolide primers to carry out linear amplification:

DM_D245Sa(SEQ ID NO：40)：

5′AGATCACCATGGCTGAA(TCA)ATTGGCTTGGGTGGAC 3′

DM_D245Sb(SEQ ID NO：41)：

5′GCACGTCCACCCAAGCCAAT(TGA)TTCAGCCATGGTG 3′

Shown in primer synthetic by MWG Biotech.Indicate with bracket in above-mentioned nucleotide sequence at the 245th Serine codon that replaces aspartic acid of aminoacid sequence derived from the zwf gene.Use with embodiment 17.2 described plasmid pK18mobsacB_zwf with two primers of the equal complementary of the chain of plasmid, carry out linear amplification by Pfu Turbo archaeal dna polymerase.Prolong by this primer, formed mutant plasmid with alternate endless chain.The product of linear amplification is methylated and hemimethylated template DNA with DpnI processing-this restriction endonuclease specificity cutting.The carrier DNA transformed into escherichia coli strain X L1 Blue (Bullock, Fernandez and Short, BioTechniques (5) 376-379 (1987)) of new synthetic, alternate, sudden change.After the conversion, the breach in the XL1 Blue cytothesis mutant plasmid.Select transformant having on the LB substratum of 50mg/l kantlex.The plasmid that obtains detects by restricted cutting after DNA isolation, and differentiates by electrophoresis.The dna sequence dna of the dna fragmentation of sudden change detects by order-checking.The sequence of PCR product is corresponding to nucleotide sequence shown in the SEQ ID NO:39.The gained plasmid is called pK18mobsacB_zwf (D245S).The collection of illustrative plates of plasmid is shown in Fig. 8.

17.4: the zwf wild type gene of bacterial strain DM1697 is by zwf (D245S) allelic replacement

17.3 described plasmid pK18mobsacB_zwf (D245S) move among the Corynebacterium glutamicum strain DM1697 by joint as described in embodiment 14.3 with EXAMPLE Example.Select as deciding recombination event at the target in the Corynebacterium glutamicum DM1697 karyomit(e) as described in the embodiment 14.3.Depend on the position of secondary recombination event during the plasmid cleavage, the zwf allelotrope that contains sudden change appears in the karyomit(e) zwf locus, perhaps keeps host's primary zwf locus.

Phenotype to about 40-50 bacterium colony test " when having sucrose, growing " and " when having kantlex, not growing ".In 6 bacterium colonies of the phenotype that " growing when having sucrose " and " not growing when having kantlex " is shown, a zone order-checking to the zwf gene of crossing over zwf (D245S) sudden change, from sequencing primer zf_2 (SEQ ID NO:42) (GATCBiotech AG, Konstanz, the Germany preparation) there is zwf (D245S) allelic mutation in beginning to prove in the karyomit(e).The nucleotide sequence of primer zf_2 is as follows:

zf_2(SEQ ID NO：42)：

5`TTC TGT GTT CCG CAT CGA CC 3`

Differentiated by this way the 733rd, 734 and 735 of zwf gene coding region (CDS) and contained therefore base thymus pyrimidine, cytosine(Cyt) and VITAMIN B4 also have zwf (D245S) allelotrope (SEQ ID NO:36) in its karyomit(e) clone respectively.The the 733rd, 734 and 735 of the nucleotide sequence of zwf allelotrope coding region corresponding to SEQ ID No:39 the 861st, 862 and 863.This clone is called bacterial strain DM1697_zwf (D245S).

Bacterial strain DM1697_zwf (D245S) is deposited in German microbial preservation center according to budapest treaty, and (Germany), preserving number is DSM15632 for DSMZ, Braunschweig.

17.5: the glucose-6-phosphate dehydrogenase (G6PD) of strain DSM 15632 is active to be determined

In order to determine the activity by the glucose-6-phosphate dehydrogenase (G6PD) of the zwf that contains in the strain DSM 15632 (D245S) allelotrope coding, (Germany) middle insulation is 24 hours for Merck KG, Darmstadt at the LB substratum with this bacterial strain.Cultivation is to carry out on shaking table with 200rpm at 33 ℃ in having the 250ml Erlenmeyer flask of plate washer with the 25ml volume.In order to compare, parallel insulation has the parental strain DM1697 of wild-type zwf gene.The preparation of biomass is as preparation as described in the embodiment 15.1.

The active mensuration of glucose-6-phosphate dehydrogenase (G6PD) is to contain 100mM Tris-HCl (pH 7.8), 10mM MgCl in the situation that has its reacting final product NADPH ₂, 260 μ MNADP ⁺, 7mM G-6-P and 400 μ M NADPH analytical system in carry out.Enzymic activity in having the situation of NADPH is calculated with aforementioned same way as.

Experimental result is shown in table 8.

Table 8

Bacterial strain	Glucose-6-phosphate dehydrogenase (G6PD)
	Glucose-6-phosphate dehydrogenase (G6PD)			Activity when not having NADPH (mU/mg protein)	Activity when having NADPH (mU/mg protein)	Residual activity (%)
	DM1697	97	14	Activity when not having NADPH (mU/mg protein)	Activity when having NADPH (mU/mg protein)	Residual activity (%)	14
DSM15632	DM1697	97	14	57	16	28	14

17.6:L-the preparation of Methionin

To go up LSS1 substratum (the Ohnishi et al. of cell inoculation 50ml in the Erlenmeyer flask that has plate washer at 500ml of the Corynebacterium glutamicum strain DSM15632 that in 24 hours embodiment 17.4 of 33 ℃ of growths, obtains at agar plate (brain heart agar), Applied Microbiologyand Biotechnology 58:217-223 (2002)) in, 5% sucrose replaces with 5% glucose in the substratum.The early stage steady stage after the initial sugar that adds all consumes stops at 33 ℃ of cultivations on rotary shaker.Use the inoculation of 4ml seed meat soup to contain 1000ml LPG1 substratum (Ohnishi et al., Applied Microbiology and Biotechnology 58:217-223 (2002)) 2L fermentor tank (Biostat B reactor, B.Braun, Melsungen, Germany).

After the initial sugar consumption that adds, lasting adding contains 50% (w/v) glucose and 3.5% (w/v) (NH ₄) ₂SO ₄Solution, total volume of culture reaches 2000ml in fermentor tank.Cultivation is at pO ₂＞20%, inflate under＞0.51/ minute and 33 ℃ and carry out.PH remains on 7.0.(Hamburg, amino acidanalyser Germany) detects post-column derivatization and definite lysine amount that forms through ion exchange chromatography with triketohydrindene hydrate with Eppendorf-BioTronik company.

Experimental result is shown in table 9.

Table 9

Bacterial strain	OD (660nm)	L-Methionin HCl g/l
Bacterial strain	OD (660nm)	L-Methionin HCl g/l	DM1697	88	118.6
DSM15632	86	124.6	DM1697	88	118.6

Embodiment 18:

The structure of Corynebacterium glutamicum DM1698

Corynebacterium glutamicum strain DM1698 makes up based on embodiment 17.1 described Corynebacterium glutamicum DM1697.Its replacement vector pK18mobsacB_zwf (A243T) that portably uses embodiment 14.2 structures imports zwf (A243T) allelotrope among the bacterial strain DM1697.Zwf (A243T) allelotrope moves among the DM1697 by joint, displacement and selection as described in embodiment 14.3.Obtained strains is called DM1698, uses in this embodiment.

The production of L-Methionin that sudden change zwf (A243T) has been integrated into the zwf improvement of genes is described for strain DSM 5715 and DSM5715zwf2_A243T as embodiment 16.This equally also is used to carry the allelic bacterial strain DM1698 of zwf (A243T), and the result is than the better L-Methionin of parental strain DM1697 production strain.

Embodiment 19:

The activity of the glucose-6-phosphate dehydrogenase (G6PD) that in the zwf of bacterial strain DM1697 wild type gene, imports 90 base pair disappearances and determine to encode

The experiment of design implementation example 19 and embodiment 20 is that the glucose-6-phosphate dehydrogenase (G6PD) activity is necessary with 5 ' of the zwf gene coded sequence of proving Corynebacterium glutamicum terminal 90 base pairs (seeing zwf (A243T) allelotrope shown in zwf wild type gene shown in the SEQ ID NO:9 for example or the SEQ ID NO:21), and described 90 base pairs are not included in the encoding sequence of the described zwf gene of JP-A-092244661 (seeing SEO ID NO:7).

At embodiment 19, proved the glucose-6-phosphate dehydrogenase (G6PD) (SEQ ID NO:10) of wild type gene (SEQ ID NO:9) and coding.In embodiment 20, proved the glucose-6-phosphate dehydrogenase (G6PD) (SEQ ID NO:22) of embodiment 13 described zwf (A243T) allelotrope (SEQ ID NO:21) and coding.

In this embodiment, 90 base pairs of the zwf wild type gene of Corynebacterium glutamicum strain DM1697 (seeing embodiment 17.1) disappearance are with the activity of the glucose-6-phosphate dehydrogenase (G6PD) that relatively wild-type allele is encoded before and after 90 base pair disappearances.

19.1:zwf deletion fragment is cloned among the carrier pCRBluntII TOPO

From strains A TCC13032, separate chromosomal DNA by described methods such as Tauch (1995, Plasmid 33:168-179).Based on sequence from embodiment 1 known Corynebacterium glutamicum zwf gene, select following oligonucleotide to produce the zwf deletion fragment by polymerase chain reaction (PCR), by gene SOEing method (Gene Splicing by OverlapExtension, Horton, Molecular Biotechnology 3:93-98 (1995)) carry out.

zwfA(SEQ ID NO：43)：

5′-AT TCTAGA CAC CTT GAT CTT CTC CGT TG-3′

zwfB(SEQ ID NO：44)：

5′-GAT GGT AGT GTC ACG ATC CT-3′

zwfC(SEQ ID NO：45)：

5′-AGG ATC GTG ACA CTA CCA TCA TGG TGA TCT TCG GTG TCA C-3′

zwfD(SEQ ID NO：46)：

5′-AT TCTAGA GCG GAG GTT TTA TCC AAT GG-3′

Shown in primer by MWG Biotech (Ebersberg, Germany) synthetic, PCR is by standard pcr (the PCR Protocols.A Guide to Methods andApplications of Innis etc., 1990, Academic Press) carries out, use the Vent archaeal dna polymerase (Germany, Product Description Vent DNAPolymerase) of NewEnglandBiolabs.

In all situations, primer zwfA and zwfD all contain the cleavage site of the insertion of restriction enzyme XbaI, indicate with underscore in above-mentioned nucleotide sequence.Preceding 20 bases of primer zwfC contain the reverse complementary sequence of primer zwfB.

By means of polymerase chain reaction, primer zwfA and zwfB make the dna fragmentation of a 710bp increase, and primer zwfC and zwfD make the dna fragmentation of a 850bp increase.Amplified material detects by the agarose gel electrophoresis in 0.8% sepharose subsequently, use High Pure PCR product purification test kit (Roche Diagnostics GmbH, Mannheim, Deutschland) from sepharose, separate, and in another PCR reaction of using primer zwfA and zwfD, be used as dna profiling together.Cause the zwf deletion fragment to produce like this, size is 1560bp (seeing shown in the SEQ ID NO:47).

The product of amplification detects in 0.8% sepharose subsequently.

The PCR product cloning that obtains is advanced carrier pCRBluntII TOPO (Zero BluntTOPO PCR Cloning Kit, Invitrogen, Deutschland) in, instruct coli strain TOP10 (Grant et al. according to manufacturer then, Proceedings of the NationalAcademy of Sciences USA, 87 (1990) 4645-4649) connect a batch thing conversion with this.To transform batch thing bed board at the LB agar of having added the 50mg/l kantlex (Sambrook et al., Molecular Cloning:A Laboratory Manual.2 ^NdEd., Cold Spring Harbor, New York, 1989) on, the cell of plasmid is carried in selection.

By means of High Pure plasmid separating kit (Roche Diagnostics GmbH, Mannheim, Germany) isolated plasmid dna from transformant, and by detecting with restriction enzyme XbaI restriction and agarose gel electrophoresis (0.8%) subsequently.This plasmid is called pCRBluntII_AB1CD1, is shown in Fig. 9.

19.2: the structure of replacement vector pK18mobsacB_zwfdelta90bp

The zwf deletion fragment that is called " deltazwf90 " among Fig. 9 and 10 is isolating by with restriction enzyme XbaI the carrier pCRBluntII_AB1CD1 that obtains among the embodiment 19.1 being cut fully.After separating in sepharose (0.8%), (Roche DiagnosticsGmbH, Mannheim Germany) separates from sepharose by means of High Pure PCR product purification test kit with the zwf deletion fragment of about 1600bp.

The zwf deletion fragment of Chu Liing is used for and movably cloning vector pK18mobsacB (Sch  fer et al., Gene 14:69-73 (1994)) connection by this way.Described carrier cuts with restriction enzyme XbaI in advance, uses shrimp alkaline phosphotase (Roche DiagnosticsGmbH, Mannheim, Germany) dephosphorylation then.This carrier DNA is mixed with the zwf deletion fragment, and (Amersham-Pharmacia, Freiburg Germany) handle with the T4 dna ligase with mixture.

Then coli strain S17-1 (Simon et al., Bio/Technologie 1:784-791,1993) being connected batch thing with this transforms.To transform batch thing bed board at the LB agar of having added the 50mg/l kantlex (Sambrook et al., Molecular Cloning:A LaboratoryManual.2 ^NdEd., Cold Spring Harbor, New York, 1989) on, the cell of plasmid is carried in selection.

By means of High Pure plasmid separating kit (Roche Diagnostics GmbH, Mannheim, Deutschland) separation quality grain from transformant, and by detecting with restriction enzyme XbaI restriction and agarose gel electrophoresis (0.8%) subsequently.In addition, (Konstanz, Germany) examine by order-checking by GATC Biotech AG for clone's zwf deletion fragment.This plasmid is called pK18mobsacB_zwfdelta90bp, is shown in Figure 10.

19.3: in the zwf of bacterial strain DM1697 wild type gene, import 90 base pairs disappearance

Bacterial strain DM1697 describes in embodiment 17.1, and it carries the zwf wild type gene.

The plasmid pK18mobsacB_zwfdelta90bp that describes among the embodiment 19.2 is moved to (Sch  ifer etal. among the Corynebacterium glutamicum strain DM1697 by joint as described in embodiment 14.3, Applied and Environmental Microbiology 60,756-759 (1994)).Decide recombination event and select as hitting at Corynebacterium glutamicum DM1697 karyomit(e) as described in the embodiment 14.3.Depend on the position of secondary recombination event, after the plasmid excision, the zwf allelotrope that carries the 90bp disappearance appears at karyomit(e) zwf locus, perhaps keeps host's primary zwf locus.

Phenotype to about 40-50 bacterium colony test " when having sucrose, growing " and " when having kantlex, not growing ".In 30 bacterium colonies of the phenotype that " growing when having sucrose " and " not growing when having kantlex " is shown, PCR amplification is passed through in a zone to the zwf gene of crossing over the zwf disappearance, use Taq archaeal dna polymerase (Qiagen, Hilden, Germany) by described standard pcrs such as Innis (PCRprotocols.A guide to methods and applications, 1990, Academic Press) carries out, have 90bp disappearance in the zwf allelotrope in the karyomit(e) to prove.

The PCR reaction uses following oligonucleotide (by MWG Biotech, Ebersberg is synthetic) to carry out:

zwfi1(SEQ ID NO：48)：

5`-GGC GTT GAC TTG GCA GAT GT-3`

zwfi2(SEQ ID NO：49)：

5`-GCA GAC CGC TGT GAA GGA AT-3`

This causes the PCR fragment amplification of 581bp size, and there is the 90bp disappearance in expression, and perhaps the PCR fragment amplification of 671bp size represents to exist the zwf wild-type sequence.

Amplified production detects in 0.8% sepharose subsequently.

Therefore differentiated that containing zwf lacks allelic Corynebacterium glutamicum strain, separated and it is called DM1697deltazwf90bp.

19.4: the glucose-6-phosphate dehydrogenase (G6PD) of bacterial strain DM1697deltazwf90bp is active to be determined

For the activity of the glucose-6-phosphate dehydrogenase (G6PD) of the zwf disappearance allelotrope coding determining to contain among the bacterial strain DM1697deltazwf90bp, with this bacterial strain the LB substratum (MerckKG, Darmstadt, Germany) in insulation 24 hours.Cultivation is to carry out on shaking table with 200rpm at 33 ℃ in having the 250ml Erlenmeyer flask of plate washer with the 25ml volume.In order to compare, with the parallel insulation of parental strain DM1697.The preparation of biomass is carried out as described in embodiment 15.1.

Active being determined at of glucose-6-phosphate dehydrogenase (G6PD) contained 100mM Tris-HCl (pH 7.5)+1mM DTT, 15mM MgCl ₂, 1.5mM NADP ⁺With carry out in the analytical system of 10mM G-6-P.Calculate enzymic activity with same way as described above.

Experimental result is shown in table 10.

Table 10

Bacterial strain	The activity of glucose-6-phosphate dehydrogenase (G6PD) (mU/mg protein)
Bacterial strain		DM1697	80
DM1697zwfdelta90bp	0	DM1697	80

Embodiment 20:

The glucose-6-phosphate dehydrogenase (G6PD) activity that in the zwf of bacterial strain DM1698 (A243T) allelotrope, imports 90 base pair disappearances and determine to encode

20.1: in the zwf of bacterial strain DM1698 (A243T) allelotrope, import 90 base pair disappearances

Embodiment 19.2 described plasmid pK18mobsacB_zwfdelta90bp are passed through to engage (Sch  fer et al. as described in embodiment 14.3, Applied and EnvironmentalMicrobiology 60,756-759 (1994)) moves to Corynebacterium glutamicum strain DM1698 (seeing embodiment 18).As described in embodiment 14.3, select at the secondary recombination event in the Corynebacterium glutamicum DM1698 karyomit(e).Depend on the position of secondary recombination event, after the plasmid excision, the zwf allelotrope that carries 90 base pair disappearances appears at karyomit(e) zwf locus, perhaps keeps host's primary zwf locus.

Phenotype to about 40-50 bacterium colony test " when having sucrose, growing " and " when having kantlex, not growing ".In 30 bacterium colonies of the phenotype that " growing when having sucrose " and " not growing when having kantlex " is shown, PCR amplification is passed through in a zone to the zwf gene of crossing over the zwf disappearance, use Taq archaeal dna polymerase (Qiagen, Hilden, Germany) by described standard pcrs such as Innis (PCRprotocols.A guide to methods and applications, 1990, Academic Press) carries out, to prove the disappearance that exists in the karyomit(e) in the zwf allelotrope.

Use oligonucleotide as described below (by MWG Biotech, Ebersberg is synthetic) to carry out PCR:

zwfi1(SEQ ID NO：48)：

5`-GGC GTT GAC TTG GCA GAT GT-3`

zwfi2(SEQ ID NO：49)：

5`-GCA GAC CGC TGT GAA GGA AT-3`

This dna fragmentation that causes carrying 90bp disappearance, 581bp size forms, and the dna fragmentation that perhaps carries corresponding zwf wild-type sequence, 671bp size forms.

Amplified production detects in 0.8% sepharose subsequently.

Separation contains zwf and lacks allelic Corynebacterium glutamicum strain, and it is called DM1698deltazwf90bp (A243T).

Zwf (A243T) allelotrope that the plasmid pK18mobsacB_zwfdelta90bp of embodiment 19.2 is used for 90 base pair disappearances are integrated into bacterial strain DM1698.The nucleotide sequence of the zwf deletion fragment that contains in this plasmid has the 91-934 position Nucleotide of wild type gene encoding sequence (SEQ ID NO:9) from the 711-1554 position of its nucleotide sequence (SEQ ID NO:47).The 31-311 amino acids of their coding zwf wild-type proteins (SEQ ID NO:10) is included in the wild-type sequence of the 243rd of aminoacid sequence.The possibility of result that engages is that zwf (A243T) sudden change of bacterial strain DM1698 is replaced by the zwf wild-type allele of replacement vector pK18mobsacB_zwfdelta90bp in joint.

Still be present in the karyomit(e) of bacterial strain DM1698deltazwf90bp (A243T) in order to examine sudden change zwf (A243T), (RocheDiagnostics GmbH, Mannheim Germany) detect sudden change by means of LightCycler.

LightCycler has made up thermal cycler and fluorescence detection device.

From bacterial strain DM1698deltazwf90bp (A243T), separate chromosomal DNA by described methods such as Tauch (1995, Plasmid 33:168-179).In the fs, by means of PCR reaction (Innis et al., PCR protocols.A guide to methods andapplications, 1990, Academic Press) dna fragmentation of the chromosomal about 0.3kb of amplification DM 1698deltazwf90bp (A243T), it contains zwf (A243T) sudden change.The PCR reaction uses following oligonucleotide (by MWG Biotech, Ebersberg is synthetic) to carry out:

LC-zwfl(SEQ ID NO：50)：

5′-tccgcatcgaccactatttg-3′

LC-zwf2(SEQ ID NO：51)：

5′-cgctggcacgaaagaaattg-3′

In subordinate phase, use two kinds of different sizes, with the oligonucleotide (LightCycler (LC)-Red640 and fluorescein) of different fluorescent mark substance markers.Hybridize in sequence, sudden change zwf (A243T) is positioned at wherein.By means of " FRET (fluorescence resonance energy transfer) (FluorescenceResonance Energy Transfer) " method (FRED), can detect the existence of sudden change.The following oligonucleotide that is used to hybridize by TIB MOLBIOL (Berlin, Germany) synthetic::

zwf243-C(SEQ ID No：52)：

5`-LC-Red640-tatcttcagtcatggtgatc-(P)3`

zwf243-A(SEQ ID No：53)：

5`-gtcgtagtaaccagcacgtccacccaagcc-fluorescein 3`

Confirmed that like this bacterial strain DM1698deltazwf90bp (A243T) still contains sudden change zwf (A243T).It carries zwf allelotrope zwfdelta90bp (A243T), is shown in SEQID NO:54; The corresponding aminoacid sequence of the glucose-6-phosphate dehydrogenase (G6PD) of coding is shown in SEQID NO:55.

20.2: the glucose-6-phosphate dehydrogenase (G6PD) of bacterial strain DM1698deltazwf90bp (A243T) is active to be determined

Activity for the glucose-6-phosphate dehydrogenase (G6PD) of zwfdelta90bp (A243T) the allelotrope coding determining to contain among the bacterial strain DM1698deltazwf90bp (A243T), with this bacterial strain at LB substratum (Merck KG, Darmstadt, Germany) middle insulation is 24 hours.Cultivation is to carry out on shaking table with 200rpm at 33 ℃ in having the 250ml Erlenmeyer flask of plate washer with the 25ml volume.In order to compare, will have the parallel insulation of the allelic parental strain DM1698 of zwf (A243T).The preparation of biomass is carried out as described in embodiment 15.1.

Active being determined at of glucose-6-phosphate dehydrogenase (G6PD) contained 100mM Tris-HCl (pH 7.5)+1mM DTT, 15mM MgCl ₂, 1.5mM NADP ⁺With carry out in the analytical system of 10mM G-6-P.Enzymic activity same way as is as described above calculated.

Experimental result is shown in table 10.

Table 10

Bacterial strain	The activity of glucose-6-phosphate dehydrogenase (G6PD) (mU/mg protein)
Bacterial strain		DM1698	127
DM1698zwfdelta90bp(A243T)	0	DM1698	127

Embodiment 21:

Determining of the allelic expression of two plasmid-encoded zwf

In this embodiment, allelic two plasmids of two different zwf of construction expression, and the recovery of test enzymic activity of the glucose-6-phosphate dehydrogenase (G6PD) of bacterial strain DM1698zwfdelta90bp (A243T) inactivation of acquisition in embodiment 20.1.The zwf allelotrope of test is zwfL and zwfS, and wherein L is long abbreviation, and S is short abbreviation.Allelotrope zwfL carries sudden change zwf (A243T), comprises 90 base pairs (shown in SEQ ID NO:9 shown in wild type gene and the SEQ ID NO:21 shown in zwf (A243T) allelotrope) in 5 ' zone of zwf gene coded sequence.Allelotrope zwfS also carries sudden change zwf (A243T), but lacks 90 base pairs (shown in SEQ ID NO:7 shown in the wild type gene) in 5 ' zone of zwf gene coded sequence.

21.1: the amplification of allelotrope zwfS and zwfL

Zwf allelotrope zwfS and zwfL use polymerase chain reaction (PCR) and increase as following synthetic oligonucleotide.From bacterial strain DM658, separate the chromosomal DNA that carries allelotrope zwf (A243T) by described methods such as Tauch (1995, Plasmid 33:168-179).Based on sequence from embodiment 1 known Corynebacterium glutamicum zwf gene, select primer so that amplified fragments contains 25 base pairs of allelic coding region of zwf and upstream region thereof, but not possible promoter region.In addition, insert to make and to clone suitable restriction enzyme sites in the targeting vector into.The sequence of the restriction enzyme SalI cleavage site (underscore sequence) of PCR primer and insertion is as described below:

zwfRBS1(SEQ ID NO：56)：

5′-AT GTCGAC AAG AAA GGA TCG TGA CAC TAC-3′

zwfRBS2(SEQ ID NO：57)：

5′-AT GTCGAC CCC CCG CAT CGC TGG CC-3′

zwfRBSE(SEQ ID NO：58)：

5′-AT GTCGAC ATC GCT TTC GGA GTC AGT GA-3′

The primer that illustrates is by MWG Biotech (Ebersberg, Germany) synthetic, by described standard pcrs such as Innis (PCR Protocols.A Guide to Methods andApplications, 1990, Academic Press) use the Vent archaeal dna polymerase of NewEnglandBiolabs (Germany, Product Description Vent DNA Polymerase) to carry out the PCR reaction.

By means of polymerase chain reaction, primer zwfRBS1 and zwfRBSE amplify the 1732bp dna fragmentation (SEQ ID NO:59) that is called zwfL (SEQ ID NO:60), and it comprises the proteinic encoding sequence of Zwf that expression is made up of 514 amino acid.Primer zwfRBS2 and zwfRBSE amplification are called the 1642bp dna fragmentation (SEQ IDNO:61) of zwfS (SEQ ID NO:62), and it comprises the proteinic encoding sequence of Zwf that expression is made up of 484 amino acid.Amplified material is by the detection of the agarose gel electrophoresis in 0.8% sepharose subsequently, and (Roche Diagnostics GmbH, Mannheim Germany) separates from sepharose to use High Pure PCR product purification test kit.

The PCR product cloning that obtains is advanced carrier pCRBluntII TOPO (Zero BluntTOPO PCR Cloning Kit, Invitrogen, Germany) in, then with coli strain TOP 10 (Grant et al., Proceedings of the National Academy of SciencesUSA, 87 (1990) 4645-4649) instruct with this connection batch thing conversion according to manufacturer.Be plated on LB agar (Sambrook et al., the Molecular Cloning:A Laboratory Manual.2 that has added the 50mg/l kantlex with transforming batch thing ^NaEd., Cold Spring Harbor, New York, 1989) on, the cell of plasmid is carried in selection.

By means of High Pure plasmid separating kit (Roche Diagnostics GmbH, Mannheim, Germany) isolated plasmid dna from transformant, by with restriction enzyme SalI restriction and subsequently agarose gel electrophoresis (0.8%) detect.The plasmid that obtains is called pCRBluntII_zwfL (being shown in Figure 11) and pCRBluntII_zwfS (being shown in Figure 12).

21.2: allelotrope zwfS and the zwfL clone in carrier pZ8-1

Use intestinal bacteria-Corynebacterium glutamicum shuttle expression carrier pZ8-1 (EP 0 375 889) as Corynebacterium glutamicum and at the underlying carrier of expression in escherichia coli.(Invitrogen, Germany) shrimp alkaline phosphotase (Roche Diagnostics GmbH, Mannheim, Germany) dephosphorylation are used in cutting fully to the DNA of this plasmid then with restriction enzyme SalI.

ZwfL allelotrope separates by with restriction enzyme SalI the carrier pCRBluntII_zwfL that obtains among the embodiment 21.1 being cut fully.ZwfS allelotrope separates by with restriction enzyme SalI the carrier pCRBluntII_zwfS that obtains among the embodiment 21.2 being cut fully.After in sepharose (0.8%), separating, by means of High Pure PCR product purification test kit (Roche Diagnostics GmbH, Mannheim Germany) separates size approximately zwfL fragment and the big or small approximately zwfS fragment of 1.6kb of 1.7kb from sepharose.

With separate from the zwfL of sepharose fragment and zwfS fragment with as the carrier pZ8-1 of above-mentioned preparation mixes, will batch thing T4DNA ligase enzyme (Amersham Pharmacia, Freiburg, Germany) processing.

To connect a batch thing transform into coli strain DH5 α (Hanahan, In:DNAcloning.A Practical Approach.Vol.I.IRL-Press, Oxford, WashingtonDC, USA) in.Be plated on LB agar (Lennox, 1955, Virology, 1:190) the last cell of selecting to carry plasmid of having added the 50mg/l kantlex with transforming batch thing.After 37 ℃ of incubated overnight, select each clone of reorganization.By means of High Pure plasmid separating kit t (Roche Diagnostics GmbH, Mannheim, Germany) instruct isolated plasmid dna from transformant according to manufacturer, by detecting with restriction enzyme SalI restriction and agarose gel electrophoresis (0.8%) subsequently.In addition, use following primer by GATC Biotech AG (Konstanz, Germany) clone's zwf allelotrope is examined in order-checking:

GATC-R1neu-29234(SEQ ID NO：63)

5`-GGAACACAGAAGATTCTG-3`

GATC-F1_neu-29233(SEQ ID NO：64)

5`-CCGTGTTACTGAGATTGC-3`

GATC-zwf_int-27334(SEQ ID NO：65)

5`-TGGCTGAATCCACCGAAGAA-3`

The gained plasmid is called pZ8-1_zwfL (being shown in Figure 13) and pZ8-1_zwfS (being shown in Figure 14).

21.3: preparation bacterial strain DM1698/pZ8-1, DM1698zwfdelta90bp (A243T)/pZ8-1, DM1698zwfdelta90bp (A243T)/pZ8-1_zwfL and DM1698zwfdelta90bp (A243T)/pZ8-1_zwfS

To not insert segmental carrier pZ8-1 by described electroporation methods such as Tauch (1994, FEMS Microbiological Letters, 123:343-347) electroporation advances among the Corynebacterium glutamicum DM 1698.

With embodiment 21.2 described carrier pZ8-1_zwfL and pZ8-1_zwfS and do not insert segmental carrier pZ8-1 (FEMSMicrobiological Letters, 123 (1994): 343-347) electroporation advances among the embodiment 20 described Corynebacterium glutamicum DM1698zwfdelta90bp (A243T) by described electroporation methods such as Tauch.

With electroporation batch thing bed board at the LB agar of having added the 15mg/l kantlex (Sambrook et al., Molecular Cloning:A Laboratory Manual.2 ^NdEd., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) the last cell of selecting to carry plasmid.In all situations, by ordinary method (Peters-Wendisch et al., 1998, Microbiology 144,915-927) isolated plasmid dna from transformant is by detecting with restriction enzyme SalI restriction and agarose gel electrophoresis (0.8%) subsequently.

Bacterial strain is called DM1698/pZ8-1, DM1698zwfdelta90bp (A243T)/pZ8-1, DM1698zwfdelta90bp (A243T)/pZ8-1_zwfL and DM1698zwfdelta90bp (A243T)/pZ8-1_zwfS.

21.4: the glucose-6-phosphate dehydrogenase (G6PD) of the bacterial strain of acquisition is active to be determined

Activity for the glucose-6-phosphate dehydrogenase (G6PD) of the different zwf allelotrope codings determining to contain among bacterial strain DM1698deltazwf90bp (A243T)/pZ8-1_zwfL and DM1698deltazwf90bp (the A243T)/pZ8-1_zwfS, bacterial strain is being added LB substratum (the Merck KG of 25mg/l kantlex, Darmstadt, Germany) middle insulation is 24 hours.Cultivation is to carry out on shaking table with 200rpm at 33C in having the 250ml Erlenmeyer flask of plate washer with the 25ml volume.

In order to compare, with parental strain DM1698 with as described in embodiment 20, in karyomit(e), have two allelic bacterial strain DM1698zwfdelta90bpA243T of different zwf and have the bacterial strain DM1698/pZ8-1 and DM1698zwfdelta90bp (A243T)/parallel insulation of pZ8-1 of carrier pZ8-1.Because DM1698 and DM1698zwfdelta90bpA243T do not contain any plasmid, so they are incubated with the substratum that does not add kantlex.

The preparation of biomass is carried out as described in embodiment 15.1.

Active being determined at of glucose-6-phosphate dehydrogenase (G6PD) contained 100mM Tris-HCl (pH 7.5)+1mM DTT, 15mM MgCl ₂, 1.5mM NADP ⁺With carry out in the analytical system of 10mM G-6-P.Enzymic activity is with same way as calculating as described above.

This result of experiment is shown in table 11.

Table 11

Bacterial strain/plasmid	The activity of glucose-6-phosphate dehydrogenase (G6PD) (mU/mg protein)
Bacterial strain/plasmid		DM1698	75
DM1698zwfdelta90bp(A243T)	0	DM1698	75
DM1698zwfdelta90bp(A243T)	0	DM1698/pZ8-1	67
DM1698zwfdelta90bp(A243T)/ pZ8-1	0	DM1698/pZ8-1	67
DM1698zwfdelta90bp(A243T)/ pZ8-1	0	DM1698zwfdelta90bp(A243T)/ pZ8-1_zwfL	40
DM1698zwfdelta90bp(A243T)/ pZ8-1_zwfS	0	DM1698zwfdelta90bp(A243T)/ pZ8-1_zwfL	40

The acceptance of original preservation

According to detailed rules and regulations 7.1 by shown at the bottom of the page or leaf

International depositary institution announces

I. microorganism identification
I. microorganism identification	The evaluation reference that the preservation people is given: DH5 α/pEC-T18mob2	The given preserving number of international preservation mechanism: DSM 13244
II. the systematic name of scientific description and/or suggestion
	The microorganism of identifying according to above I has: the systematic name (position that meets is represented with cross) of [] A scientific description [] A suggestion
III. accept and accept
III. accept and accept	International preservation mechanism on 01 20th, 2000 (original preservation date) ¹Accept the microorganism of identifying according to above I
IV. transform the acceptance that requires
IV. transform the acceptance that requires	The microorganism that above I identifies receives for international preservation mechanism and has received in (accepting to transform the date that requires) at (original preservation date) original preservation thing is converted into requirement according to the preservation thing of budapest treaty
V. international preservation mechanism
V. international preservation mechanism	Title: DSMZ-Germany microbial preservation centre address: Mascheroder Weg 1b D-38214 Braunschweig	World preservation mechanism represents official's signature: the date: 2000.01.25

1 uses detailed rules and regulations 6.4 (d), and the described date is the date that international preservation mechanism obtains.

Form: DSMZ-BP/4 (single page) 0196

The survival proof

According to detailed rules and regulations 10.2 by shown at the bottom of the page or leaf

International depositary institution announces

I. preservation people	II. microorganism identification
I. preservation people	II. microorganism identification	Title: De Gusa is in Er Si stock company kantstr.2 address: 33790 Halle i.W.	The given preserving number of international preservation mechanism: DSM 13244 preservations or transfer date ¹：2000-01-20
III. survival proves
III. survival proves		The survival of the microorganism of identifying according to above II is tested in 2000-01-20 ²At that time, described microorganism: [*] ³Survival [] ³Not survival
The condition of IV. surviving and testing
The condition of IV. surviving and testing
V. international preservation mechanism
V. international preservation mechanism		Title: DSMZ-Germany microbial preservation centre address: Mascheroder Weg 1b D-38214 Braunschweig	World preservation mechanism represents official's signature: the date: 2000.01.25

1 represents original preservation, carries out new preservation or shifts date, nearest relevant date (new preservation date or transfer date)

2 according to detailed rules and regulations 12.2 (a) (i) profit (ii) refer to survive the date recently

3 positions that meet are represented with cross

4 information be required and test result negative

Form: DSMZ-BP/4 (single page) 0196

The acceptance of original preservation

International depositary institution announces

I. microorganism identification
I. microorganism identification	The evaluation reference that the preservation people is given: DM 658	The given preserving number of international preservation mechanism: DSM 7431
II. the systematic name of scientific description and/or suggestion
	The microorganism of identifying according to above I has: the systematic name (position that meets is represented with cross) of [] A scientific description [*] A suggestion
III. accept and accept
III. accept and accept	International preservation mechanism on 01 27th, 1993 (original preservation date) ¹Accept the microorganism of identifying according to above I
IV. transform the acceptance that requires
IV. transform the acceptance that requires	The microorganism that above I identifies receives for international preservation mechanism and has received in 2002-10-17 (accepting to shift the date that requires) at 1993-01-27 (original preservation date) original preservation thing is converted into requirement according to the preservation thing of budapest treaty
V. international preservation mechanism
V. international preservation mechanism	Title: DSMZ-Germany microbial preservation centre address: Mascheroder Weg 1b D-38214 Braunschweig	World preservation mechanism represents official's signature: the date: 2002.10.18

Form: DSMZ-BP/4 (single page) 12/2001

The survival proof

International depositary institution announces

I. preservation people	II. microorganism identification
I. preservation people	II. microorganism identification	Title: address: the kantstr.2 of Degussa 33790 Halle i.W.	The given preserving number of international preservation mechanism: DSM 7431 preservations or transfer date ¹：1993-01-27
III. survival proves		Title: address: the kantstr.2 of Degussa 33790 Halle i.W.
III. survival proves		The survival of the microorganism of identifying according to above II is tested in: 1999-06-01 at that time, described microorganism: [*] ³Survival [] ³Not survival
The condition of IV. surviving and testing
The condition of IV. surviving and testing
V. international preservation mechanism
V. international preservation mechanism		Title: DSMZ-Germany microbial preservation centre address: Mascheroder Weg 1b D-38214 Braunschweig	World preservation mechanism represents official's signature: the date: 2002.10.18

2 according to detailed rules and regulations 12.2 (a) (i) and (ii), refers to survive the date recently

3 positions that meet are represented with cross

4 information be required and test result negative

Form: DSMZ-BP/4 (single page) 12/2001

The acceptance of original preservation

International depositary institution announces

I. microorganism identification
I. microorganism identification	The evaluation reference that the preservation people is given: DSM5715zwf2_A243T	The given preserving number of international preservation mechanism: DSM 15237
II. the systematic name of scientific description and/or suggestion
	The microorganism of identifying according to above I has: the systematic name (position that meets is represented with cross) of [] A scientific description [] A suggestion
III. accept and accept
III. accept and accept	World preservation mechanism accepts on October 11st, 2002 (original preservation date) ¹The microorganism that the above I of the basis of accepting identifies
IV. transform the acceptance that requires
IV. transform the acceptance that requires	The microorganism that above I identifies receives for international preservation mechanism and has received in (accepting to transform the date that requires) at (original preservation date) original preservation thing is converted into requirement according to the preservation thing of budapest treaty
V. international preservation mechanism
V. international preservation mechanism	Title: DSMZ-Germany microbial preservation centre address: Mascheroder Weg 1b D-38214 Braunschweig	World preservation mechanism represents official's signature: the date: 2002.10.15

Form: DSMZ-BP/4 (single page) 12/2001

The survival proof

International depositary institution announces

I. preservation people	II. microorganism identification
I. preservation people	II. microorganism identification	Title: Degussa FA-FE-BT address: kantstr.2 33790 Halle/Westfalen	The given preserving number of international preservation mechanism: DSM 15237 preservations or transfer date ¹：2002-10-11
III. survival proves
III. survival proves		The survival of the microorganism of identifying according to above II is tested in: 2002-10-14 at that time, described microorganism: [*] ³Survival [] ³Not survival
The condition of IV. surviving and testing
The condition of IV. surviving and testing
V. international preservation mechanism
V. international preservation mechanism		Title: DSMZ-Germany microbial preservation centre address: Mascheroder Weg 1b D-38214 Braunschweig	World preservation mechanism represents official's signature: the date: 2002.10.15

3 positions that meet are represented with cross

4 information be required and test result negative

Form: DSMZ-BP/4 (single page) 12/2001

The acceptance of original preservation

International depositary institution announces

I. microorganism identification
I. microorganism identification	The evaluation reference that the preservation people is given: DM1697_zwfD245S	The given preserving number of international preservation mechanism: DSM 15632
II. the systematic name of scientific description and/or suggestion
	The microorganism of identifying according to above I has: the systematic name (position that meets is represented with cross) of [] A scientific description [] A suggestion
III. accept and accept
III. accept and accept	World preservation mechanism accepts on 05 23rd, 2003 (original preservation date) ¹The microorganism that the above I of the basis of accepting identifies
IV. transform the acceptance that requires
IV. transform the acceptance that requires	The microorganism that above I identifies receives for international preservation mechanism and has received in (accepting to transform the date that requires) at (original preservation date) original preservation thing is converted into requirement according to the preservation thing of budapest treaty
V. international preservation mechanism
V. international preservation mechanism	Title: DSMZ-Germany microbial preservation centre address: Mascheroder Weg 1b D-38214 Braunschweig	World preservation mechanism represents official's signature: the date: 2003.05.26

Form: DSMZ-BP/4 (single page) 12/2001

The survival proof

International depositary institution announces

I. preservation people	II. microorganism identification
I. preservation people	II. microorganism identification	Title: Degussa address: kantstr.2 33790 Halle/Westfalen	The given preserving number of international preservation mechanism: DSM 15632 preservations or transfer date ¹：2003-05-23
III. survival proves		Title: Degussa address: kantstr.2 33790 Halle/Westfalen
III. survival proves		The survival of the microorganism of identifying according to above II is tested in: 2003-05-23 at that time, described microorganism: [*] ³Survival [] ³Not survival
The condition of IV. surviving and testing
The condition of IV. surviving and testing
V. international preservation mechanism
V. international preservation mechanism		Title: DSMZ-Germany microbial preservation centre address: Mascheroder Weg 1b D-38214 Braunschweig	World preservation mechanism represents official's signature: the date: 2003.05.26

3 positions that meet are represented with adopted number

4 information be required and test result negative

Form: DSMZ-BP/4 (single page) 12/2001

Sequence table

＜110〉Degussa

＜120〉prepare the amino acid whose method of L-with amplification zwf gene

<130>990239BT

<160>65

<170>PatentIn version 3.1

<210>1

<211>2811

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>CDS

<222>(373)..(2022)

<223>pgi

<400>1

aaaacccgag gggcgaaaat tccaccctaa cttttttggg atcccctttt tccggggaat 60

taattggttt gggtttcaat gggaaaacgg gaaacaatgg gccaaaggtt caaaaacccc 120

aaaagggggc cgggttcaaa ttcccaaaaa aaatggcaaa aaaggggggg ccaaaaccaa 180

gttggccccc aaaccaccgg ggcaacggcc cacccacaaa ggggttgggt taaaggaagg 240

acgcccaaag taagcccgga atggcccacg ttcgaaaaag caggccccaa ttaaacgcac 300

cttaaatttg tcgtgtttcc cactttgaac actcttcgat gcgcttggcc acaaaagcaa 360

gctaacctga ag atg tta ttt aac gac aat aaa gga gtt ttc atg gcg gac 411

Met Leu Phe Asn Asp Asn Lys Gly Val Phe Met Ala Asp

1 5 10

att tcg acc acc cag gtt tgg caa gac ctg acc gat cat tac tca aac 459

Ile Ser Thr Thr Gln Val Trp Gln Asp Leu Thr Asp His Tyr Ser Asn

15 20 25

ttc cag gca acc act ctg cgt gaa ctt ttc aag gaa gaa aac cgc gcc 507

Phe Gln Ala Thr Thr Leu Arg Glu Leu Phe Lys Glu Glu Asn Arg Ala

30 35 40 45

gag aag tac acc ttc tcc gcg gct ggc ctc cac gtc gac ctg tcg aag 555

Glu Lys Tyr Thr Phe Ser Ala Ala Gly Leu His Val Asp Leu Ser Lys

50 55 60

aat ctg ctt gac gac gcc acc ctc acc aag ctc ctt gca ctg acc gaa 603

Asn Leu Leu Asp Asp Ala Thr Leu Thr Lys Leu Leu Ala Leu Thr Glu

65 70 75

gaa tct ggc ctt cgc gaa cgc att gac gcg atg ttt gcc ggt gaa cac 651

Glu Ser Gly Leu Arg Glu Arg Ile Asp Ala Met Phe Ala Gly Glu His

80 85 90

ctc aac aac acc gaa gac cgc gct gtc ctc cac acc gcg ctg cgc ctt 699

Leu Asn Asn Thr Glu Asp Arg Ala Val Leu His Thr Ala Leu Arg Leu

95 100 105

cct gcc gaa gct gat ctg tca gta gat ggc caa gat gtt gct gct gat 747

Pro Ala Glu Ala Asp Leu Ser Val Asp Gly Gln Asp Val Ala Ala Asp

110 115 120 125

gtc cac gaa gtt ttg gga cgc atg cgt gac ttc gct act gcg ctg cgc 795

Val His Glu Val Leu Gly Arg Met Arg Asp Phe Ala Thr Ala Leu Arg

130 135 140

tca ggc aac tgg ttg gga cac acc ggc cac acg atc aag aag atc gtc 843

Ser Gly Asn Trp Leu Gly His Thr Gly His Thr Ile Lys Lys Ile Val

145 150 155

aac att ggt atc ggt ggc tct gac ctc gga cca gcc atg gct acg aag 891

Asn Ile Gly Ile Gly Gly Ser Asp Leu Gly Pro Ala Met Ala Thr Lys

160 165 170

gct ctg cgt gca tac gcg acc gct ggt atc tca gca gaa ttc gtc tcc 939

Ala Leu Arg Ala Tyr Ala Thr Ala Gly Ile Ser Ala Glu Phe Val Ser

175 180 185

aac gtc gac cca gca gac ctc gtt tct gtg ttg gaa gac ctc gat gca 987

Asn Val Asp Pro Ala Asp Leu Val Ser Val Leu Glu Asp Leu Asp Ala

190 195 200 205

gaa tcc aca ttg ttc gtg atc gct tcg aaa act ttc acc acc cag gag 1035

Glu Ser Thr Leu Phe Val Ile Ala Ser Lys Thr Phe Thr Thr Gln Glu

210 215 220

acg ctg tcc aac gct cgt gca gct cgt gct tgg ctg gta gag aag ctc 1083

Thr Leu Ser Asn Ala Arg Ala Ala Arg Ala Trp Leu Val Glu Lys Leu

225 230 235

ggt gaa gag gct gtc gcg aag cac ttc gtc gca gtg tcc acc aat gct 1131

Gly Glu Glu Ala Val Ala Lys His Phe Val Ala Val Ser Thr Asn Ala

240 245 250

gaa aag gtc gca gag ttc ggt atc gac acg gac aac atg ttc ggc ttc 1179

Glu Lys Val Ala Glu Phe Gly Ile Asp Thr Asp Asn Met Phe Gly Phe

255 260 265

tgg gac tgg gtc gga ggt cgt tac tcc gtg gac tcc gca gtt ggt ctt 1227

Trp Asp Trp Val Gly Gly Arg Tyr Ser Val Asp Ser Ala Val Gly Leu

270 275 280 285

tcc ctc atg gca gtg atc ggc cct cgc gac ttc atg cgt ttc ctc ggt 1275

Ser Leu Met Ala Val Ile Gly Pro Arg Asp Phe Met Arg Phe Leu Gly

290 295 300

gga ttc cac gcg atg gat gaa cac ttc cgc acc acc aag ttc gaa gag 1323

Gly Phe His Ala Met Asp Glu His Phe Arg Thr Thr Lys Phe Glu Glu

305 310 315

aac gtt cca atc ttg atg gct ctg ctc ggt gtc tgg tac tcc gat ttc 1371

Asn Val Pro Ile Leu Met Ala Leu Leu Gly Val Trp Tyr Ser Asp Phe

320 325 330

tat ggt gca gaa acc cac gct gtc cta cct tat tcc gag gat ctc agc 1419

Tyr Gly Ala Glu Thr His Ala Val Leu Pro Tyr Ser Glu Asp Leu Ser

335 340 345

cgt ttt gct gct tac ctc cag cag ctg acc atg gag acc aat ggc aag 1467

Arg Phe Ala Ala Tyr Leu Gln Gln Leu Thr Met Glu Thr Asn Gly Lys

350 355 360 365

tca gtc cac cgc gac ggc tcc cct gtt tcc act ggc act ggc gaa att 1515

Ser Val His Arg Asp Gly Ser Pro Val Ser Thr Gly Thr Gly Glu Ile

370 375 380

tac tgg ggt gag cct ggc aca aat ggc cag cac gct ttc ttc cag ctg 1563

Tyr Trp Gly Glu Pro Gly Thr Asn Gly Gln His Ala Phe Phe Gln Leu

385 390 395

atc cac cag ggc act cgc ctt gtt cca gct gat ttc att ggt ttc gct 1611

Ile His Gln Gly Thr Arg Leu Val Pro Ala Asp Phe Ile Gly Phe Ala

400 405 410

cgt cca aag cag gat ctt cct gcc ggt gag cgc acc atg cat gac ctt 1659

Arg Pro Lys Gln Asp Leu Pro Ala Gly Glu Arg Thr Met His Asp Leu

415 420 425

ttg atg agc aac ttc ttc gca cag acc aag gtt ttg gct ttc ggt aag 1707

Leu Met Ser Asn Phe Phe Ala Gln Thr Lys Val Leu Ala Phe Gly Lys

430 435 440 445

aac gct gaa gag atc gct gcg gaa ggt gtc gca cct gag ctg gtc aac 1155

Asn Ala Glu Glu Ile Ala Ala Glu Gly Val Ala Pro Glu Leu Val Asn

450 455 460

cac aag gtc gtg cca ggt aat cgc cca acc acc acc att ttg gcg gag 1803

His Lys Val Val Pro Gly Asn Arg Pro Thr Thr Thr Ile Leu Ala Glu

465 470 475

gaa ctt acc cct tct att ctc ggt gcg ttg atc gct ttg tac gaa cac 1851

Glu Leu Thr Pro Ser Ile Leu Gly Ala Leu Ile Ala Leu Tyr Glu His

480 485 490

acc gtg atg gtt cag ggc gtg att tgg gac atc aac tcc ttc gac caa 1899

Thr Val Met Val Gln Gly Val Ile Trp Asp Ile Asn Ser Phe Asp Gln

495 500 505

tgg ggt gtt gaa ctg ggc aaa cag cag gca aat gac ctc gct ccg gct 1947

Trp Gly Val Glu Leu Gly Lys Gln Gln Ala Asn Asp Leu Ala Pro Ala

510 515 520 525

gtc tct ggt gaa gag gat gtt gac tcg gga gat tct tcc act gat tca 1995

Val Ser Gly Glu Glu Asp Val Asp Ser Gly Asp Ser Ser Thr Asp Ser

530 535 540

ctg att aag tgg tac cgc gca aat agg tagtcgcttg cttatagggt 2042

Leu Ile Lys Trp Tyr Arg Ala Asn Arg

545 550

caggggcgtg aagaatcctc gcctcatagc actggccgct atcatcctga cctcgttcaa 2102

tctgcgaaca gctattactg ctttagctcc gctggtttct gagattcggg atgatttagg 2162

ggttagtgct tctcttattg gtgtgttggg catgatcccg actgctatgt tcgcggttgc 2222

tgcgtttgcg cttccgtcgt tgaagaggaa gttcactact tcccaactgt tgatgtttgc 2282

catgctgttg actgctgccg gtcagattat tcgtgtcgct ggacctgctt cgctgttgat 2342

ggtcggtact gtgttcgcga tgtttgcgat cggagttacc aatgtgttgc ttccgattgc 2402

tgttagggag tattttccgc gtcacgtcgg tggaatgtcg acaacttatc tggtgtcgtt 2462

ccagattgtt caggcacttg ctccgacgct tgccgtgccg atttctcagt gggctacaca 2522

tgtggggttg accggttgga gggtgtcgct cggttcgtgg gcgctgctgg ggttggttgc 2582

ggcgatttcg tggattccgc tgttgagttt gcagggtgcc agggttgttg cggcgccgtc 2642

gaaggtttct cttcctgtgt ggaagtcttc ggttggtgtg gggctcgggt tgatgtttgg 2702

gtttacttcg tttgcgacgt atatcctcat gggttttatg ccgcagatgg taggtgatcc 2762

aaagaattca aaaagcttct cgagagtact tctagagcgg ccgcgggcc 2811

<210>2

<211>550

<212>PRT

<213>Corynebacterium glutamicum

<400>2

Met Leu Phe Asn Asp Asn Lys Gly Val Phe Met Ala Asp Ile Ser Thr

1 5 10 15

Thr Gln Val Trp Gln Asp Leu Thr Asp His Tyr Ser Asn Phe Gln Ala

20 25 30

Thr Thr Leu Arg Glu Leu Phe Lys Glu Glu Asn Arg Ala Glu Lys Tyr

35 40 45

Thr Phe Ser Ala Ala Gly Leu His Val Asp Leu Ser Lys Asn Leu Leu

50 55 60

Asp Asp Ala Thr Leu Thr Lys Leu Leu Ala Leu Thr Glu Glu Ser Gly

65 70 75 80

Leu Arg Glu Arg Ile Asp Ala Met Phe Ala Gly Glu His Leu Asn Asn

85 90 95

Thr Glu Asp Arg Ala Val Leu His Thr Ala Leu Arg Leu Pro Ala Glu

100 105 110

Ala Asp Leu Ser Val Asp Gly Gln Asp Val Ala Ala Asp Val His Glu

115 120 125

Val Leu Gly Arg Met Arg Asp Phe Ala Thr Ala Leu Arg Ser Gly Asn

130 135 140

Trp Leu Gly His Thr Gly His Thr Ile Lys Lys Ile Val Asn Ile Gly

145 150 155 160

Ile Gly Gly Ser Asp Leu Gly Pro Ala Met Ala Thr Lys Ala Leu Arg

165 170 175

Ala Tyr Ala Thr Ala Gly Ile Ser Ala Glu Phe Val Ser Asn Val Asp

180 185 190

Pro Ala Asp Leu Val Ser Val Leu Glu Asp Leu Asp Ala Glu Ser Thr

195 200 205

Leu Phe Val Ile Ala Ser Lys Thr Phe Thr Thr Gln Glu Thr Leu Ser

210 215 220

Asn Ala Arg Ala Ala Arg Ala Trp Leu Val Glu Lys Leu Gly Glu Glu

225 230 235 240

Ala Val Ala Lys His Phe Val Ala Val Ser Thr Asn Ala Glu Lys Val

245 250 255

Ala Glu Phe Gly Ile Asp Thr Asp Asn Met Phe Gly Phe Trp Asp Trp

260 265 270

Val Gly Gly Arg Tyr Ser Val Asp Ser Ala Val Gly Leu Ser Leu Met

275 280 285

Ala Val Ile Gly Pro Arg Asp Phe Met Arg Phe Leu Gly Gly Phe His

290 295 300

Ala Met Asp Glu His Phe Arg Thr Thr Lys Phe Glu Glu Asn Val Pro

305 310 315 320

Ile Leu Met Ala Leu Leu Gly Val Trp Tyr Ser Asp Phe Tyr Gly Ala

325 330 335

Glu Thr His Ala Val Leu Pro Tyr Ser Glu Asp Leu Ser Arg Phe Ala

340 345 350

Ala Tyr Leu Gln Gln Leu Thr Met Glu Thr Asn Gly Lys Ser Val His

355 360 365

Arg Asp Gly Ser Pro Val Ser Thr Gly Thr Gly Glu Ile Tyr Trp Gly

370 375 380

Glu Pro Gly Thr Asn Gly Gln His Ala Phe Phe Gln Leu Ile His Gln

385 390 395 400

Gly Thr Arg Leu Val Pro Ala Asp Phe Ile Gly Phe Ala Arg Pro Lys

405 410 415

Gln Asp Leu Pro Ala Gly Glu Arg Thr Met His Asp Leu Leu Met Ser

420 425 430

Asn Phe Phe Ala Gln Thr Lys Val Leu Ala Phe Gly Lys Asn Ala Glu

435 440 445

Glu Ile Ala Ala Glu Gly Val Ala Pro Glu Leu Val Asn His Lys Val

450 455 460

Val Pro Gly Asn Arg Pro Thr Thr Thr Ile Leu Ala Glu Glu Leu Thr

465 470 475 480

Pro Ser Ile Leu Gly Ala Leu Ile Ala Leu Tyr Glu His Thr Val Met

485 490 495

Val Gln Gly Val Ile Trp Asp Ile Asn Ser Phe Asp Gln Trp Gly Val

500 505 510

Glu Leu Gly Lys Gln Gln Ala Asn Asp Leu Ala Pro Ala Val Ser Gly

515 520 525

Glu Glu Asp Val Asp Ser Gly Asp Ser Ser Thr Asp Ser Leu Ile Lys

530 535 540

Trp Tyr Arg Ala Asn Arg

545 550

<210>3

<211>462

<212>DNA

<213>Corynebacterium glutamicum

<400>3

atggagacca atggcaagtc agtccaccgc gacggctccc ctgtttccac tggcactggc 60

gaaatttact ggggtgagcc tggcacaaat ggccagcacg ctttcttcca gctgatccac 120

cagggcactc gccttgttcc agctgatttc attggtttcg ctcgtccaaa gcaggatctt 180

cctgccggtg agcgcaccat gcatgacctt ttgatgagca acttcttcgc acagaccaag 240

gttttggctt tcggtaagaa cgctgaagag atcgctgcgg aaggtgtcgc acctgagctg 300

gtcaaccaca aggtcgtgcc aggtaatcgc ccaaccacca ccattttggc ggaggaactt 360

accccttcta ttctcggtgc gttgatcgct ttgtacgaac acaccgtgat ggttcagggc 420

gtgatttggg acatcaactc cttcgaccaa tggggcgtgg aa 462

<210>4

<211>2160

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>CDS

<222>(327)..(2063)

<223>poxB

<400>4

ttagaggcga ttctgtgagg tcactttttg tggggtcggg gtctaaattt ggccagtttt 60

cgaggcgacc agacaggcgt gcccacgatg tttaaatagg cgatcggtgg gcatctgtgt 120

ttggtttcga cgggctgaaa ccaaaccaga ctgcccagca acgacggaaa tcccaaaagt 180

gggcatccct gtttggtacc gagtacccac ccgggcctga aactccctgg caggcgggcg 240

aagcgtggca acaactggaa tttaagagca caattgaagt cgcaccaagt taggcaacac 300

aatagccata acgttgagga gttcag atg gca cac agc tac gca gaa caa tta 353

Met Ala His Ser Tyr Ala Glu Gln Leu

1 5

att gac act ttg gaa gct caa ggt gtg aag cga att tat ggt ttg gtg 401

Ile Asp Thr Leu Glu Ala Gln Gly Val Lys Arg Ile Tyr Gly Leu Val

10 15 20 25

ggt gac agc ctt aat ccg atc gtg gat gct gtc cgc caa tca gat att 449

Gly Asp Ser Leu Asn Pro Ile Val Asp Ala Val Arg Gln Ser Asp Ile

30 35 40

gag tgg gtg cac gtt cga aat gag gaa gcg gcg gcg ttt gca gcc ggt 497

Glu Trp Val His Val Arg Asn Glu Glu Ala Ala Ala Phe Ala Ala Gly

45 50 55

gcg gaa tcg ttg atc act ggg gag ctg gca gta tgt gct gct tct tgt 545

Ala Glu Ser Leu Ile Thr Gly Glu Leu Ala Val Cys Ala Ala Ser Cys

60 65 70

ggt cct gga aac aca cac ctg att cag ggt ctt tat gat tcg cat cga 593

Gly Pro Gly Asn Thr His Leu Ile Gln Gly Leu Tyr Asp Ser His Arg

75 80 85

aat ggt gcg aag gtg ttg gcc atc gct agc cat att ccg agt gcc cag 641

Asn Gly Ala Lys Val Leu Ala Ile Ala Ser His Ile Pro Ser Ala Gln

90 95 100 105

att ggt tcg acg ttc ttc cag gaa acg cat ccg gag att ttg ttt aag 689

Ile Gly Ser Thr Phe Phe Gln Glu Thr His Pro Glu Ile Leu Phe Lys

110 115 120

gaa tgc tct ggt tac tgc gag atg gtg aat ggt ggt gag cag ggt gaa 737

Glu Cys Ser Gly Tyr Cys Glu Met Val Asn Gly Gly Glu Gln Gly Glu

125 130 135

cgc att ttg cat cac gcg att cag tcc acc atg gcg ggt aaa ggt gtg 785

Arg Ile Leu His His Ala Ile Gln Ser Thr Met Ala Gly Lys Gly Val

140 145 150

tcg gtg gta gtg att cct ggt gat atc gct aag gaa gac gca ggt gac 833

Ser Val Val Val Ile Pro Gly Asp Ile Ala Lys Glu Asp Ala Gly Asp

155 160 165

ggt act tat tcc aat tcc act att tct tct ggc act cct gtg gtg ttc 881

Gly Thr Tyr Ser Asn Ser Thr Ile Ser Ser Gly Thr Pro Val Val Phe

170 175 180 185

ccg gat cct act gag gct gca gcg ctg gtg gag gcg att aac aac gct 929

Pro Asp Pro Thr Glu Ala Ala Ala Leu Val Glu Ala Ile Asn Asn Ala

190 195 200

aag tct gtc act ttg ttc tgc ggt gcg ggc gtg aag aat gct cgc gcg 977

Lys Ser Val Thr Leu Phe Cys Gly Ala Gly Val Lys Asn Ala Arg Ala

205 210 215

cag gtg ttg gag ttg gcg gag aag att aaa tca ccg atc ggg cat gcg 1025

Gln Val Leu Glu Leu Ala Glu Lys Ile Lys Ser Pro Ile Gly His Ala

220 225 230

ctg ggt ggt aag cag tac atc cag cat gag aat ccg ttt gag gtc ggc 1073

Leu Gly Gly Lys Gln Tyr Ile Gln His Glu Asn Pro Phe Glu Val Gly

235 240 245

atg tct ggc ctg ctt ggt tac ggc gcc tgc gtg gat gcg tcc aat gag 1121

Met Ser Gly Leu Leu Gly Tyr Gly Ala Cys Val Asp Ala Ser Asn Glu

250 255 260 265

gcg gat ctg ctg att cta ttg ggt acg gat ttc cct tat tct gat ttc 1169

Ala Asp Leu Leu Ile Leu Leu Gly Thr Asp Phe Pro Tyr Ser Asp Phe

270 275 280

ctt cct aaa gac aac gtt gcc cag gtg gat atc aac ggt gcg cac att 1217

Leu Pro Lys Asp Asn Val Ala Gln Val Asp Ile Asn Gly Ala His Ile

285 290 295

ggt cga cgt acc acg gtg aag tat ccg gtg acc ggt gat gtt gct gca 1265

Gly Arg Arg Thr Thr Val Lys Tyr Pro Val Thr Gly Asp Val Ala Ala

300 305 310

aca atc gaa aat att ttg cct cat gtg aag gaa aaa aca gat cgt tcc 1313

Thr Ile Glu Asn Ile Leu Pro His Val Lys Glu Lys Thr Asp Arg Ser

315 320 325

ttc ctt gat cgg atg ctc aag gca cac gag cgt aag ttg agc tcg gtg 1361

Phe Leu Asp Arg Met Leu Lys Ala His Glu Arg Lys Leu Ser Ser Val

330 335 340 345

gta gag acg tac aca cat aac gtc gag aag cat gtg cct att cac cct 1409

Val Glu Thr Tyr Thr His Asn Val Glu Lys His Val Pro Ile His Pro

350 355 360

gaa tac gtt gcc tct att ttg aac gag ctg gcg gat aag gat gcg gtg 1457

Glu Tyr Val Ala Ser Ile Leu Asn Glu Leu Ala Asp Lys Asp Ala Val

365 370 375

ttt act gtg gat acc ggc atg tgc aat gtg tgg cat gcg agg tac atc 1505

Phe Thr Val Asp Thr Gly Met Cys Asn Val Trp His Ala Arg Tyr Ile

380 385 390

gag aat ccg gag gga acg cgc gac ttt gtg ggt tca ttc cgc cac ggc 1553

Glu Asn Pro Glu Gly Thr Arg Asp Phe Val Gly Ser Phe Arg His Gly

395 400 405

acg atg gct aat gcg ttg cct cat gcg att ggt gcg caa agt gtt gat 1601

Thr Met Ala Asn Ala Leu Pro His Ala Ile Gly Ala Gln Ser Val Asp

410 415 420 425

cga aac cgc cag gtg atc gcg atg tgt ggc gat ggt ggt ttg ggc atg 1649

Arg Asn Arg Gln Val Ile Ala Met Cys Gly Asp Gly Gly Leu Gly Met

430 435 440

ctg ctg ggt gag ctt ctg acc gtt aag ctg cac caa ctt ccg ctg aag 1697

Leu Leu Gly Glu Leu Leu Thr Val Lys Leu His Gln Leu Pro Leu Lys

445 450 455

gct gtg gtg ttt aac aac agt tct ttg ggc atg gtg aag ttg gag atg 1745

Ala Val Val Phe Asn Asn Ser Ser Leu Gly Met Val Lys Leu Glu Met

460 465 470

ctc gtg gag gga cag cca gaa ttt ggt act gac cat gag gaa gtg aat 1793

Leu Val Glu Gly Gln Pro Glu Phe Gly Thr Asp His Glu Glu Val Asn

475 480 485

ttc gca gag att gcg gcg gct gcg ggt atc aaa tcg gta cgc atc acc 1841

Phe Ala Glu Ile Ala Ala Ala Ala Gly Ile Lys Ser Val Arg Ile Thr

490 495 500 505

gat ccg aag aaa gtt cgc gag cag cta gct gag gca ttg gca tat cct 1889

Asp Pro Lys Lys Val Arg Glu Gln Leu Ala Glu Ala Leu Ala Tyr Pro

510 515 520

gga cct gta ctg atc gat atc gtc acg gat cct aat gcg ctg tcg atc 1937

Gly Pro Val Leu Ile Asp Ile Val Thr Asp Pro Asn Ala Leu Ser Ile

525 530 535

cca cca acc atc acg tgg gaa cag gtc atg gga ttc agc aag gcg gcc 1985

Pro Pro Thr Ile Thr Trp Glu Gln Val Met Gly Phe Ser Lys Ala Ala

540 545 550

acc cga acc gtc ttt ggt gga gga gta gga gcg atg atc gat ctg gcc 2033

Thr Arg Thr Val Phe Gly Gly Gly Val Gly Ala Met Ile Asp Leu Ala

555 560 565

cgt tcg aac ata agg aat att cct act cca tgatgattga tacacctgct 2083

Arg Ser Asn Ile Arg Asn Ile Pro Thr Pro

570 575

gttctcattg accgcgagcg cttaactgcc aacatttcca ggatggcagc tcacgccggt 2143

gcccatgaga ttgccct 2160

<210>5

<211>579

<212>PRT

<213>Corynebacterium glutamicum

<400>5

Met Ala His Ser Tyr Ala Glu Gln Leu Ile Asp Thr Leu Glu Ala Gln

1 5 10 15

Gly Val Lys Arg Ile Tyr Gly Leu Val Gly Asp Ser Leu Asn Pro Ile

20 25 30

Val Asp Ala Val Arg Gln Ser Asp Ile Glu Trp Val His Val Arg Asn

35 40 45

Glu Glu Ala Ala Ala Phe Ala Ala Gly Ala Glu Ser Leu Ile Thr Gly

50 55 60

Glu Leu Ala Val Cys Ala Ala Ser Cys Gly Pro Gly Asn Thr His Leu

65 70 75 80

Ile Gln Gly Leu Tyr Asp Ser His Arg Asn Gly Ala Lys Val Leu Ala

85 90 95

Ile Ala Ser His Ile Pro Ser Ala Gln Ile Gly Ser Thr Phe Phe Gln

100 105 110

Glu Thr His Pro Glu Ile Leu Phe Lys Glu Cys Ser Gly Tyr Cys Glu

115 120 125

Met Val Asn Gly Gly Glu Gln Gly Glu Arg Ile Leu His His Ala Ile

130 135 140

Gln Ser Thr Met Ala Gly Lys Gly Val Ser Val Val Val Ile Pro Gly

145 150 155 160

Asp Ile Ala Lys Glu Asp Ala Gly Asp Gly Thr Tyr Ser Asn Ser Thr

165 170 175

Ile Ser Ser Gly Thr Pro Val Val Phe Pro Asp Pro Thr Glu Ala Ala

180 185 190

Ala Leu Val Glu Ala Ile Asn Asn Ala Lys Ser Val Thr Leu Phe Cys

195 200 205

Gly Ala Gly Val Lys Asn Ala Arg Ala Gln Val Leu Glu Leu Ala Glu

210 215 220

Lys Ile Lys Ser Pro Ile Gly His Ala Leu Gly Gly Lys Gln Tyr Ile

225 230 235 240

Gln His Glu Asn Pro Phe Glu Val Gly Met Ser Gly Leu Leu Gly Tyr

245 250 255

Gly Ala Cys Val Asp Ala Ser Asn Glu Ala Asp Leu Leu Ile Leu Leu

260 265 270

Gly Thr Asp Phe Pro Tyr Ser Asp Phe Leu Pro Lys Asp Asn Val Ala

275 280 285

Gln Val Asp Ile Asn Gly Ala His Ile Gly Arg Arg Thr Thr Val Lys

290 295 300

Tyr Pro Val Thr Gly Asp Val Ala Ala Thr Ile Glu Asn Ile Leu Pro

305 310 315 320

His Val Lys Glu Lys Thr Asp Arg Ser Phe Leu Asp Arg Met Leu Lys

325 330 335

Ala His Glu Arg Lys Leu Ser Ser Val Val Glu Thr Tyr Thr His Asn

340 345 350

Val Glu Lys His Val Pro Ile His Pro Glu Tyr Val Ala Ser Ile Leu

355 360 365

Asn Glu Leu Ala Asp Lys Asp Ala Val Phe Thr Val Asp Thr Gly Met

370 375 380

Cys Asn Val Trp His Ala Arg Tyr Ile Glu Asn Pro Glu Gly Thr Arg

385 390 395 400

Asp Phe Val Gly Ser Phe Arg His Gly Thr Met Ala Asn Ala Leu Pro

405 410 415

His Ala Ile Gly Ala Gln Ser Val Asp Arg Asn Arg Gln Val Ile Ala

420 425 430

Met Cys Gly Asp Gly Gly Leu Gly Met Leu Leu Gly Glu Leu Leu Thr

435 440 445

Val Lys Leu His Gln Leu Pro Leu Lys Ala Val Val Phe Asn Asn Ser

450 455 460

Ser Leu Gly Met Val Lys Leu Glu Met Leu Val Glu Gly Gln Pro Glu

465 470 475 480

Phe Gly Thr Asp His Glu Glu Val Asn Phe Ala Glu Ile Ala Ala Ala

485 490 495

Ala Gly Ile Lys Ser Val Arg Ile Thr Asp Pro Lys Lys Val Arg Glu

500 505 510

Gln Leu Ala Glu Ala Leu Ala Tyr Pro Gly Pro Val Leu Ile Asp Ile

515 520 525

Val Thr Asp Pro Asn Ala Leu Ser Ile Pro Pro Thr Ile Thr Trp Glu

530 535 540

Gln Val Met Gly Phe Ser Lys Ala Ala Thr Arg Thr Val Phe Gly Gly

545 550 555 560

Gly Val Gly Ala Met Ile Asp Leu Ala Arg Ser Asn Ile Arg Asn Ile

565 570 575

Pro Thr Pro

<210>6

<211>875

<212>DNA

<213>Corynebacterium glutamicum

<400>6

tgcgagatgg tgaatggtgg tgagcagggt gaacgcattt tgcatcacgc gattcagtcc 60

accatggcgg gtaaaggtgt gtcggtggta gtgattcctg gtgatatcgc taaggaagac 120

gcaggtgacg gtacttattc caattccact atttcttctg gcactcctgt ggtgttcccg 180

gatcctactg aggctgcagc gctggtggag gcgattaaca acgctaagtc tgtcactttg 240

ttctgcggtg cgggcgtgaa gaatgctcgc gcgcaggtgt tggagttggc ggagaagatt 300

aaatcaccga tcgggcatgc gctgggtggt aagcagtaca tccagcatga gaatccgttt 360

gaggtcggca tgtctggcct gcttggttac ggcgcctgcg tggatgcgtc caatgaggcg 420

gatctgctga ttctattggg tacggatttc ccttattctg atttccttcc taaagacaac 480

gttgcccagg tggatatcaa cggtgcgcac attggtcgac gtaccacggt gaagtatccg 540

gtgaccggtg atgttgctgc aacaatcgaa aatattttgc ctcatgtgaa ggaaaaaaca 600

gatcgttcct tccttgatcg gatgctcaag gcacacgagc gtaagttgag ctcggtggta 660

gagacgtaca cacataacgt cgagaagcat gtgcctattc accctgaata cgttgcctct 720

attttgaacg agctggcgga taaggatgcg gtgtttactg tggataccgg catgtgcaat 780

gtgtggcatg cgaggtacat cgagaatccg gagggaacgc gcgactttgt gggttcattc 840

cgccacggca cgatggctaa tgcgttgcct catgc 875

<210>7

<211>2260

<212>DNA

<213>Brevibacterium flavum MJ-233

<220>

<221>CDS

<222>(629)..(2080)

<223>Glucose-6-Phosphate Dehydrogenase(EC 1.1.1.49)；JP-A-09-22461

<400>7

gatccgatga ggctttggct ctgcgtggca aggcaggcgt tgccaacgct cagcgcgctt 60

acgctgtgta caaggagctt ttcgacgccg ccgagctgcc tgtaaggcgc caacactcag 120

cgcccactgt gggcatccac cggcgtgaag aaccctgcgt acgctgcaac tctttacgtt 180

tccgagctgg ctggtccaaa caccgtcaac accatgccag aaggcaccat cgacgctgtt 240

ctggaactgg gcaacctgca cggtgacaac ctgtccaact ccgcggcaga agctgacgct 300

gtgttctccc agcttgaggc tctgggcgtt gacttggcag atgtcttcca ggtcctggag 360

accgaggccg tggacaagtt cgttgcttct tggagcgaac tgcttgagtc catggaagct 420

cgcctgaagt agaatcagca cgctgcatca gtaacggcga catgaaatcg aattagttcg 480

atcttatgtg gccgttacac atctttcatt aaagaaagga tcgtgacgct taccatcgtg 540

agcacaaaac acgaccccct ccagctggac aaacccactg cgcgacccgc aggataaacg 600

actcccccgc atcgctggcc cttccggc atg gtg atc ttc ggt gtc act ggc 652

Met Val Ile Phe Gly Val Thr Gly

1 5

gac ttg gct cga aag aag ctg ctc ccc gcc att tat gat cta gca aac 700

Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala Ile Tyr Asp Leu Ala Asn

10 15 20

cgc gga ttg ctg ccc cca gga ttc tcg ttg gta ggt tac ggc cgc cgc 748

Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu Val Gly Tyr Gly Arg Arg

25 30 35 40

gaa tgg tcc aaa gaa gac ttt gaa aaa tac gta cgc gat gcc gca agt 796

Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr Val Arg Asp Ala Ala Ser

45 50 55

gct ggt gct cgt acg gaa ttc cgt gaa aat gtt tgg gag cgc ctc gcc 844

Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn Val Trp Glu Arg Leu Ala

60 65 70

gag ggt atg gaa ttt gtt cgc ggc aac ttt gat gat gat gca gct ttc 892

Glu Gly Met Glu Phe Val Arg Gly Asn Phe Asp Asp Asp Ala Ala Phe

75 80 85

gac aac ctc gct gca aca ctc aag cgc atc gac aaa acc cgc ggc acc 940

Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile Asp Lys Thr Arg Gly Thr

90 95 100

gcc ggc aac tgg gct tac tac ctg tcc att cca cca gat tcc ttc gca 988

Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile Pro Pro Asp Ser Phe Ala

105 110 115 120

gcg gtc tgc cac cag ctg gag cgt tcc ggc atg gct gaa tcc acc gaa 1036

Ala Val Cys His Gln Leu Glu Arg Ser Gly Met Ala Glu Ser Thr Glu

125 130 135

gaa gca tgg cgc cgc gtg atc atc gag aag cct ttc ggc cac aac ctc 1084

Glu Ala Trp Arg Arg Val Ile Ile Glu Lys Pro Phe Gly His Asn Leu

140 145 150

gaa tcc gca cac gag ctc aac cag ctg gtc aac gca gtc ttc cca gaa 1132

Glu Ser Ala His Glu Leu Asn Gln Leu Val Asn Ala Val Phe Pro Glu

155 160 165

tct tct gtg ttc cgc atc gac cac tat ttg ggc aag gaa aca gtt caa 1180

Ser Ser Val Phe Arg Ile Asp His Tyr Leu Gly Lys Glu Thr Val Gln

170 175 180

aac atc ctg gct ctg cgt ttt gct aac cag ctg ttt gag cca ctg tgg 1228

Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln Leu Phe Glu Pro Leu Trp

185 190 195 200

aac tcc aac tac gtt gac cac gtc cag atc acc atg gct gaa gat att 1276

Asn Ser Asn Tyr Val Asp His Val Gln Ile Thr Met Ala Glu Asp Ile

205 210 215

ggc ttg ggt gga cgt gct ggt tac tac gac ggc atc ggc gca gcc cgc 1324

Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp Gly Ile Gly Ala Ala Arg

220 225 230

gac gtc atc cag aac cac ctg atc cag ctc ttg gct ctg gtt gcc atg 1372

Asp Val Ile Gln Asn His Leu Ile Gln Leu Leu Ala Leu Val Ala Met

235 240 245

gaa gaa cca att tct ttc gtg cca gcg cag ctg cag gca gaa aag atc 1420

Glu Glu Pro Ile Ser Phe Val Pro Ala Gln Leu Gln Ala Glu Lys Ile

250 255 260

aag gtg ctc tct gcg aca aag ccg tgc tac cca ttg gat aaa acc tcc 1468

Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr Pro Leu Asp Lys Thr Ser

265 270 275 280

gct cgt ggt cag tac gct gcc ggt tgg cag ggc tct gag tta gtc aag 1516

Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln Gly Ser Glu Leu Val Lys

285 290 295

gga ctt cgc gaa gaa gat ggc ttc aac cct gag tcc acc act gag act 1564

Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro Glu Ser Thr Thr Glu Thr

300 305 310

ttt gcg gct tgt acc tta gag atc acg tct cgt cgc tgg gct ggt gtg 1612

Phe Ala Ala CVs Thr Leu Glu Ile Thr Ser Arg Arg Trp Ala Gly Val

315 320 325

ccg ttc tac ctg cgc acc ggt aag cgt ctt ggt cgc cgt gtt act gag 1660

Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu Gly Arg Arg Val Thr Glu

330 335 340

att gcc gtg gtg ttt aaa gac gca cca cac cag cct ttc gac ggc gac 1708

Ile Ala Val Val Phe Lys Asp Ala Pro His Gln Pro Phe Asp Gly Asp

345 350 355 360

atg act gta tcc ctt ggc caa aac gcc atc gtg att cgc gtg cag cct 1756

Met Thr Val Ser Leu Gly Gln Asn Ala Ile Val Ile Arg Val Gln Pro

365 370 375

gat gaa ggt gtg ctc atc cgc ttc ggt tcc aag gtt cca ggt tct gcc 1804

Asp Glu Gly Val Leu Ile Arg Phe Gly Ser Lys Val Pro Gly Ser Ala

380 385 390

atg gaa gtc cgt gac gtc aac atg gac ttc tcc tac tca gaa tcc ttc 1852

Met Glu Val Arg Asp Val Asn Met Asp Phe Ser Tyr Ser Glu Ser Phe

395 400 405

act gaa gaa tca cct gaa gca tac gag cgc ctt atc ttg gat gcg ctg 1900

Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg Leu Ile Leu Asp Ala Leu

410 415 420

ttg gat gaa tcc agc ctt ttc cct acc aac gag gaa gtg gaa ctg agc 1948

Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn Glu Glu Val Glu Leu Ser

425 430 435 440

tgg aag att ctg gat cca att ctt gaa gca tgg gat gcc gat gga gaa 1996

Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala Trp Asp Ala Asp Gly Glu

445 450 455

cca gag gat tac cca gca ggt acg tgg ggt cca aag agc gct gat gaa 2044

Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly Pro Lys Ser Ala Asp Glu

460 465 470

atg ctt tcc cgc aac ggt cac acc tgg cgc agg cca taatttaggg 2090

Met Leu Ser Arg Asn Gly His Thr Trp Arg Arg Pro

475 480

gcaaaaaatg atctttgaac ttccggatac caccacccag caaatttcca agaccctaac 2150

tcgactgcgt gaatcgggca cccaggtcac caccggccga gtgctcaccc tcatcgtggt 2210

cactgactcc gaaagcgatg tcgctgcagt taccgagtcc accaatgaag 2260

<210>8

<211>484

<212>PRT

<213>Brevibacterium flavum MJ-233

<400>8

Met Val Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu

1 5 10 15

Pro Ala Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe

20 25 30

Ser Leu Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu

35 40 45

Lys Tyr Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg

50 55 60

Glu Asn Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly

65 70 75 80

Asn Phe Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys

85 90 95

Arg Ile Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu

100 105 110

Ser Ile Pro Pro Asp Ser Phe Ala Ala Val Cys His Gln Leu Glu Arg

115 120 125

Ser Gly Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile

130 135 140

Glu Lys Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln

145 150 155 160

Leu Val Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His

165 170 175

Tyr Leu Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala

180 185 190

Asn Gln Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val

195 200 205

Gln Ile Thr Met Ala Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr

210 215 220

Tyr Asp Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile

225 230 235 240

Gln Leu Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro

245 250 255

Ala Gln Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro

260 265 270

Cys Tyr Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly

275 280 285

Trp Gln Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe

290 295 300

Asn Pro Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile

305 310 315 320

Thr Ser Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys

325 330 335

Arg Leu Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala

340 345 350

Pro His Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn

355 360 365

Ala Ile Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe

370 375 380

Gly Ser Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met

385 390 395 400

Asp Phe Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr

405 410 415

Glu Arg Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro

420 425 430

Thr Asn Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu

435 440 445

Glu Ala Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr

450 455 460

Trp Gly Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr

465 470 475 480

Trp Arg Arg Pro

<210>9

<211>2259

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>CDS

<222>(538)..(2079)

<223>Zwf-Protein

<220>

<221>nucleotide guanine

<222>(1264)..(1264)

<223>corresponds to position 727 of the coding sequence

<400>9

gatccgatga ggctttggct ctgcgtggca aggcaggcgt tgccaacgct cagcgcgctt 60

acgctgtgta caaggagctt ttcgacgccg ccgagctgcc tgtaaggcgc caacactcag 120

cgcccactgt gggcatccac cggcgtgaag aaccctgcgt acgctgcaac tctttacgtt 180

tccgagctgg ctggtccaaa caccgtcaac accatgccag aaggcaccat cgacgctgtt 240

ctggaactgg gcaacctgca cggtgacaac ctgtccaact ccgcggcaga agctgacgct 300

gtgttctccc agcttgaggc tctgggcgtt gacttggcag atgtcttcca ggtcctggag 360

accgaggccg tggacaagtt cgttgcttct tggagcgaac tgcttgagtc catggaagct 420

cgcctgaagt agaatcagca cgctgcatca gtaacggcga catgaaatcg aattagttcg 480

atcttatgtg gccgttacac atctttcatt aaagaaagga tcgtgacgct taccatc 537

gtg agc aca aac acg acc ccc tcc agc tgg aca aac cca ctg cgc gac 585

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

ccg cag gat aaa cga ctc ccc cgc atc gct ggc cct tcc ggc atg gtg 633

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

atc ttc ggt gtc act ggc gac ttg gct cga aag aag ctg ctc ccc gcc 681

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

att tat gat cta gca aac cgc gga ttg ctg ccc cca gga ttc tcg ttg 729

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

gta ggt tac ggc cgc cgc gaa tgg tcc aaa gaa gac ttt gaa aaa tac 777

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

gta cgc gat gcc gca agt gct ggt gct cgt acg gaa ttc cgt gaa aat 825

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

gtt tgg gag cgc ctc gcc gag ggt atg gaa ttt gtt cgc ggc aac ttt 873

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

gat gat gat gca gct ttc gac aac ctc gct gca aca ctc aag cgc atc 921

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

gac aaa acc cgc ggc acc gcc ggc aac tgg gct tac tac ctg tcc att 969

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

cca cca gat tcc ttc gca gcg gtc tgc cac cag ctg gag cgt tcc ggc 1017

Pro Pro Asp Ser Phe Ala Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

atg gct gaa tcc acc gaa gaa gca tgg cgc cgc gtg atc atc gag aag 1065

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

cct ttc ggc cac aac ctc gaa tcc gca cac gag ctc aac cag ctg gtc 1113

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

aac gca gtc ttc cca gaa tct tct gtg ttc cgc atc gac cac tat ttg 1161

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

ggc aag gaa aca gtt caa aac atc ctg gct ctg cgt ttt gct aac cag 1209

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

ctg ttt gag cca ctg tgg aac tcc aac tac gtt gac cac gtc cag atc 1257

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

acc atg gct gaa gat att ggc ttg ggt gga cgt gct ggt tac tac gac 1305

Thr Met Ala Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

ggc atc ggc gca gcc cgc gac gtc atc cag aac cac ctg atc cag ctc 1353

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

ttg gct ctg gtt gcc atg gaa gaa cca att tct ttc gtg cca gcg cag 1401

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

ctg cag gca gaa aag atc aag gtg ctc tct gcg aca aag ccg tgc tac 1449

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

cca ttg gat aaa acc tcc gct cgt ggt cag tac gct gcc ggt tgg cag 1497

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

ggc tct gag tta gtc aag gga ctt cgc gaa gaa gat ggc ttc aac cct 1545

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

gag tcc acc act gag act ttt gcg gct tgt acc tta gag atc acg tct 1593

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

cgt cgc tgg gct ggt gtg ccg ttc tac ctg cgc acc ggt aag cgt ctt 1641

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

ggt cgc cgt gtt act gag att gcc gtg gtg ttt aaa gac gca cca cac 1689

Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

cag cct ttc gac ggc gac atg act gta tcc ctt ggc caa aac gcc atc 1737

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

gtg att cgc gtg cag cct gat gaa ggt gtg ctc atc cgc ttc ggt tcc 1785

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

aag gtt cca ggt tct gcc atg gaa gtc cgt gac gtc aac atg gac ttc 1833

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

tcc tac tca gaa tcc ttc act gaa gaa tca cct gaa gca tac gag cgc 1881

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

ctt atc ttg gat gcg ctg ttg gat gaa tcc agc ctt ttc cct acc aac 1929

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

gag gaa gtg gaa ctg agc tgg aag att ctg gat cca att ctt gaa gca 1977

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

tgg gat gcc gat gga gaa cca gag gat tac cca gca ggt acg tgg ggt 2025

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

cca aag agc gct gat gaa atg ctt tcc cgc aac ggt cac acc tgg cgc 2073

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

agg cca taatttaggg gcaaaaaatg atctttgaac ttccggatac caccacccag 2129

Arg Pro

caaatttcca agaccctaac tcgactgcgt gaatcgggca cccaggtcac caccggccga 2189

gtgctcaccc tcatcgtggt cactgactcc gaaagcgatg tcgctgcagt taccgagtcc 2249

accaatgaag 2259

<210>10

<211>514

<212>PRT

<213>Corynebacterium glutamicum

<400>10

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

l 5 10 15

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

Pro Pro Asp Ser Phe Ala Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

Thr Met Ala Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

Arg Pro

<210>11

<211>20

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer zwf-forward

<400>11

tcgacgcggt tctggagcag 20

<210>12

<211>21

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer zwf reverse

<400>12

ctaaattatg gcctgcgcca g 21

<210>13

<211>22

<212>DNA

<213>Artificial Sequence

<220>

<223>Universal forward Primer

<400>13

gtaatacgac tcactatagg gc 22

<210>14

<211>18

<212>DNA

<213>Artificial Sequence

<220>

<223>M13 reverse primer

<400>14

ytccacgccc caytgrtc 18

<210>15

<211>18

<212>DNA

<213>Artificial Sequence

<220>

<223>Internal Primer 1

<400>15

ggaaacaggg gagccgtc 18

<210>16

<211>18

<212>DNA

<213>Artificial Sequence

<220>

<223>Internal Primer 2

<400>16

tgctgagata ccagcggt 18

<210>17

<211>17

<212>DNA

<213>Artificial Sequence

<220>

<223>fwd.primer

<400>17

atggarwcca aygghaa 17

<210>18

<211>18

<212>DNA

<213>Artificial Sequence

<220>

<223>rev.primer

<400>18

ytccacgccc caytgrtc 18

<210>19

<211>20

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer poxBint1

<220>

<221>misc_feature

<223>Primer poxBint1

<400>19

tgcgagatgg tgaatggtgg 20

<210>20

<211>20

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer poxBint2

<400>20

gcatgaggca acgcattagc 20

<210>21

<211>1857

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>CDS

<222>(308)..(1849)

<223>

<220>

<221>mutation

<222>(1034)..(1034)

<223>corresponds to position 727 of the coding sequence

<220>

<221>nucleotide adenine

<222>(1034)..(1034)

<223>corresponds to position 727 of the coding sequence

<400>21

tcgacgcggt tctggagcag ggcaacctgc acggtgacac cctgtccaac tccgcggcag 60

aagctgacgc tgtgttctcc cagcttgagg ctctgggcgt tgacttggca gatgtcttcc 120

aggtcctgga gaccgagggt gtggacaagt tcgttgcttc ttggagcgaa ctgcttgagt 180

ccatggaagc tcgcctgaag tagaatcagc acgctgcatc agtaacggcg acatgaaatc 240

gaattagttc gatcttatgt ggccgttaca catctttcat taaagaaagg atcgtgacac 300

taccatc gtg agc aca aac acg acc ccc tcc agc tgg aca aac cca ctg 349

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu

1 5 10

cgc gac ccg cag gat aaa cga ctc ccc cgc atc gct ggc cct tcc ggc 397

Arg Asp Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly

15 20 25 30

atg gtg atc ttc ggt gtc act ggc gac ttg gct cga aag aag ctg ctc 445

Met Val Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu

35 40 45

ccc gcc att tat gat cta gca aac cgc gga ttg ctg ccc cca gga ttc 493

Pro Ala Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe

50 55 60

tcg ttg gta ggt tac ggc cgc cgc gaa tgg tcc aaa gaa gac ttt gaa 541

Ser Leu Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu

65 70 75

aaa tac gta cgc gat gcc gca agt gct ggt gct cgt acg gaa ttc cgt 589

Lys Tyr Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg

80 85 90

gaa aat gtt tgg gag cgc ctc gcc gag ggt atg gaa ttt gtt cgc ggc 637

Glu Asn Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly

95 100 105 110

aac ttt gat gat gat gca gct ttc gac aac ctc gct gca aca ctc aag 685

Asn Phe Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys

115 120 125

cgc atc gac aaa acc cgc ggc acc gcc ggc aac tgg gct tac tac ctg 733

Arg Ile Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu

130 135 140

tcc att cca cca gat tcc ttc aca gcg gtc tgc cac cag ctg gag cgt 781

Ser Ile Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg

145 150 155

tcc ggc atg gct gaa tcc acc gaa gaa gca tgg cgc cgc gtg atc atc 829

Ser Gly Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile

160 165 170

gag aag cct ttc ggc cac aac ctc gaa tcc gca cac gag ctc aac cag 877

Glu Lvs Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln

175 180 185 190

ctg gtc aac gca gtc ttc cca gaa tct tct gtg ttc cgc atc gac cac 925

Leu Val Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His

195 200 205

tat ttg ggc aag gaa aca gtt caa aac atc ctg gct ctg cgt ttt gct 973

Tyr Leu Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala

210 215 220

aac cag ctg ttt gag cca ctg tgg aac tcc aac tac gtt gac cac gtc 1021

Asn Gln Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val

225 230 235

cag atc acc atg act gaa gat att ggc ttg ggt gga cgt gct ggt tac 1069

Gln Ile Thr Met Thr Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr

240 245 250

tac gac ggc atc ggc gca gcc cgc gac gtc atc cag aac cac ctg atc 1117

Tyr Asp Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile

255 260 265 270

cag ctc ttg gct ctg gtt gcc atg gaa gaa cca att tct ttc gtg cca 1165

Gln Leu Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro

275 280 285

gcg cag ctg cag gca gaa aag atc aag gtg ctc tct gcg aca aag ccg 1213

Ala Gln Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro

290 295 300

tgc tac cca ttg gat aaa acc tcc gct cgt ggt cag tac gct gcc ggt 1261

Cys Tyr Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly

305 310 315

tgg cag ggc tct gag tta gtc aag gga ctt cgc gaa gaa gat ggc ttc 1309

Trp Gln Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe

320 325 330

aac cct gag tcc acc act gag act ttt gcg gct tgt acc tta gag atc 1357

Asn Pro Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile

335 340 345 350

acg tct cgt cgc tgg gct ggt gtg ccg ttc tac ctg cgc acc ggt aag 1405

Thr Ser Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys

355 360 365

cgt ctt ggt cgc cgt gtt act gag att gcc gtg gtg ttt aaa gac gca 1453

Arg Leu Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala

370 375 380

cca cac cag cct ttc gac ggc gac atg act gta tcc ctt ggc caa aac 1501

Pro His Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn

385 390 395

gcc atc gtg att cgc gtg cag cct gat gaa ggt gtg ctc atc cgc ttc 1549

Ala Ile Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe

400 405 410

ggt tcc aag gtt cca ggt tct gcc atg gaa gtc cgt gac gtc aac atg 1597

Gly Ser Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met

415 420 425 430

gac ttc tcc tac tca gaa tcc ttc act gaa gaa tca cct gaa gca tac 1645

Asp Phe Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr

435 440 445

gag cgc ctc att ttg gat gcg ctg tta gat gaa tcc agc ctc ttc cct 1693

Glu Arg Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro

450 455 460

acc aac gag gaa gtg gaa ctg agc tgg aag att ctg gat cca att ctt 1741

Thr Asn Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu

465 470 475

gaa gca tgg gat gcc gat gga gaa cca gag gat tac cca gcg ggt acg 1789

Glu Ala Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr

480 485 490

tgg ggt cca aag agc gct gat gaa atg ctt tcc cgc aac ggt cac acc 1837

Trp Gly Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr

495 500 505 510

tgg cgc agg cca taatttag 1857

Trp Arg Arg Pro

<210>22

<211>514

<212>PRT

<213>Corynebacterium glutamicum

<400>22

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

Thr Met Thr Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

Arg Pro

<210>23

<211>756

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>misc_feature

<222>(1)..(756)

<223>Internal segment of the coding sequence of the zwf(A243T) allele

<220>

<221>nucleotide adenine

<222>(137)..(137)

<223>Corresponding to position 727 of the coding sequence of the zwf(A

243T)allele

<400>23

agaatcttct gtgttccgca tcgaccacta tttgggcaag gaaacagttc aaaacatcct 60

ggctctgcgt tttgctaacc agctgtttga gccactgtgg aactccaact acgttgacca 120

cgtccagatc accatgactg aagatattgg cttgggtgga cgtgctggtt actacgacgg 180

catcggcgca gcccgcgacg tcatccagaa ccacctgatc cagctcttgg ctctggttgc 240

catggaagaa ccaatttctt tcgtgccagc gcagctgcag gcagaaaaga tcaaggtgct 300

ctctgcgaca aagccgtgct acccattgga taaaacctcc gctcgtggtc agtacgctgc 360

cggttggcag ggctctgagt tagtcaaggg acttcgcgaa gaagatggct tcaaccctga 420

gtccaccact gagacttttg cggcttgtac cttagagatc acgtctcgtc gctgggctgg 480

tgtgccgttc tacctgcgca ccggtaagcg tcttggtcgc cgtgttactg agattgccgt 540

ggtgtttaaa gacgcaccac accagccttt cgacggcgac atgactgtat cccttggcca 600

aaacgccatc gtgattcgcg tgcagcctga tgaaggtgtg ctcatccgct tcggttccaa 660

ggttccaggt tctgccatgg aagtccgtga cgtcaacatg gacttctcct actcagaatc 720

cttcactgaa gaatcacctg aagcatacga gcgcct 756

<210>24

<211>28

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer zwf_XL-Al

<400>24

gatctagaag ctcgcctgaa gtagaatc 28

<210>25

<211>28

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer zwf_XL-E1

<400>25

gatctagaga ttcacgcagt cgagttag 28

<210>26

<211>1763

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>PCR product

<222>(1)..(1763)

<223>

<400>26

gatctagaag ctcgcctgaa gtagaatcag cacgctgcat cagtaacggc gacatgaaat 60

cgaattagtt cgatcttatg tggccgttac acatctttca ttaaagaaag gatcgtgaca 120

ctaccatcgt gagcacaaac acgaccccct ccagctggac aaacccactg cgcgacccgc 180

aggataaacg actcccccgc atcgctggcc cttccggcat ggtgatcttc ggtgtcactg 240

gcgacttggc tcgaaagaag ctgctccccg ccatttatga tctagcaaac cgcggattgc 300

tgcccccagg attctcgttg gtaggttacg gccgccgcga atggtccaaa gaagactttg 360

aaaaatacgt acgcgatgcc gcaagtgctg gtgctcgtac ggaattccgt gaaaatgttt 420

gggagcgcct cgccgagggt atggaatttg ttcgcggcaa ctttgatgat gatgcagctt 480

tcgacaacct cgctgcaaca ctcaagcgca tcgacaaaac ccgcggcacc gccggcaact 540

gggcttacta cctgtccatt ccaccagatt ccttcacagc ggtctgccac cagctggagc 600

gttccggcat ggctgaatcc accgaagaag catggcgccg cgtgatcatc gagaagcctt 660

tcggccacaa cctcgaatcc gcacacgagc tcaaccagct ggtcaacgca gtcttcccag 720

aatcttctgt gttccgcatc gaccactatt tgggcaagga aacagttcaa aacatcctgg 780

ctctgcgttt tgctaaccag ctgtttgagc cactgtggaa ctccaactac gttgaccacg 840

tccagatcac catggctgaa gatattgact tgggtggacg tgctggttac tacgacggca 900

tcggcgcagc ccgcgacgtc atccagaacc acctgatcca gctcttggct ctggttgcca 960

tggaagaacc aatttctttc gtgccagcgc agctgcaggc agaaaagatc aaggtgctct 1020

ctgcgacaaa gccgtgctac ccattggata aaacctccgc tcgtggtcag tacgctgccg 1080

gttggcaggg ctctgagtta gtcaagggac ttcgcgaaga agatggcttc aaccctgagt 1140

ccaccactga gacttttgcg gcttgtacct tagagatcac gtctcgtcgc tgggctggtg 1200

tgccgttcta cctgcgcacc ggtaagcgtc ttggtcgccg tgttactgag attgccgtgg 1260

tgtttaaaga cgcaccacac cagcctttcg acggcgacat gactgtatcc cttggccaaa 1320

acgccatcgt gattcgcgtg cagcctgatg aaggtgtgct catccgcttc ggttccaagg 1380

ttccaggttc tgccatggaa gtccgtgacg tcaacatgga cttctcctac tcagaatcct 1440

tcactgaaga atcacctgaa gcatacgagc gcctcatttt ggatgcgctg ttagatgaat 1500

ccagcctctt ccctaccaac gaggaagtgg aactgagctg gaagattctg gatccaattc 1560

ttgaagcatg ggatgccgat ggagaaccag aggattaccc agcgggtacg tggggtccaa 1620

agagcgctga tgaaatgctt tcccgcaacg gtcacacctg gcgcaggcca taatttaggg 1680

gcaaaaaatg atctttgaac ttccggatac caccacccag caaatttcca agaccctaac 1740

tcgactgcgt gaatctctag atc 1763

<210>27

<211>20

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer zf_1

<400>27

ggcttactac ctgtccattc 20

<210>28

<211>1545

<212>DNA

<213>Artificial Sequence

<220>

<223>Obtained by in-vitro mutagenesis

<220>

<221>CDS

<222>(1)..(1542)

<223>zwf(R370M)allele

<400>28

gtg agc aca aac acg acc ccc tcc agc tgg aca aac cca ctg cgc gac 48

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

ccg cag gat aaa cga ctc ccc cgc atc gct ggc cct tcc ggc atg gtg 96

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

atc ttc ggt gtc act ggc gac ttg gct cga aag aag ctg ctc ccc gcc 144

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

att tat gat cta gca aac cgc gga ttg ctg ccc cca gga ttc tcg ttg 192

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

gta ggt tac ggc cgc cgc gaa tgg tcc aaa gaa gac ttt gaa aaa tac 240

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

gta cgc gat gcc gca agt gct ggt gct cgt acg gaa ttc cgt gaa aat 288

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

gtt tgg gag cgc ctc gcc gag ggt atg gaa ttt gtt cgc ggc aac ttt 336

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

gat gat gat gca gct ttc gac aac ctc gct gca aca ctc aag cgc atc 384

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

gac aaa acc cgc ggc acc gcc ggc aac tgg gct tac tac ctg tcc att 432

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

cca cca gat tcc ttc aca gcg gtc tgc cac cag ctg gag cgt tcc ggc 480

Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

atg gct gaa tcc acc gaa gaa gca tgg cgc cgc gtg atc atc gag aag 528

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

cct ttc ggc cac aac ctc gaa tcc gca cac gag ctc aac cag ctg gtc 576

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

aac gca gtc ttc cca gaa tct tct gtg ttc cgc atc gac cac tat ttg 624

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

ggc aag gaa aca gtt caa aac atc ctg gct ctg cgt ttt gct aac cag 672

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

ctg ttt gag cca ctg tgg aac tcc aac tac gtt gac cac gtc cag atc 720

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

acc atg gct gaa gat att ggc ttg ggt gga cgt gct ggt tac tac gac 768

Thr Met Ala Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

ggc atc ggc gca gcc cgc gac gtc atc cag aac cac ctg atc cag ctc 816

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

ttg gct ctg gtt gcc atg gaa gaa cca att tct ttc gtg cca gcg cag 864

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

ctg cag gca gaa aag atc aag gtg ctc tct gcg aca aag ccg tgc tac 912

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

cca ttg gat aaa acc tcc gct cgt ggt cag tac gct gcc ggt tgg cag 960

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

ggc tct gag tta gtc aag gga ctt cgc gaa gaa gat ggc ttc aac cct 1008

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

gag tcc acc act gag act ttt gcg gct tgt acc tta gag atc acg tct 1056

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

cgt cgc tgg gct ggt gtg ccg ttc tac ctg cgc acc ggt aag cgt ctt 1104

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

ggt atg cgt gtt act gag att gcc gtg gtg ttt aaa gac gca cca cac 1152

Gly Met Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

cag cct ttc gac ggc gac atg act gta tcc ctt ggc caa aac gcc atc 1200

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

gtg att cgc gtg cag cct gat gaa ggt gtg ctc atc cgc ttc ggt tcc 1248

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

aag gtt cca ggt tct gcc atg gaa gtc cgt gac gtc aac atg gac ttc 1296

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

tcc tac tca gaa tcc ttc act gaa gaa tca cct gaa gca tac gag cgc 1344

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

ctc att ttg gat gcg ctg tta gat gaa tcc agc ctc ttc cct acc aac 1392

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

gag gaa gtg gaa ctg agc tgg aag att ctg gat cca att ctt gaa gca 1440

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

tgg gat gcc gat gga gaa cca gag gat tac cca gcg ggt acg tgg ggt 1488

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

cca aag agc gct gat gaa atg ctt tcc cgc aac ggt cac acc tgg cgc 1536

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

agg cca taa 1545

Arg Pro

<210>29

<211>514

<212>PRT

<213>Artificial Sequence

<220>

<223>Obtained by in-Vitro mutagenesis

<400>29

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

Thr Met Ala Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

Gly Met Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

Arg Pro

<210>30

<211>1545

<212>DNA

<213>Artificial Sequence

<220>

<223>Obtained by in-vitro mutagenesis

<220>

<221>CDS

<222>(1)..(1542)

<223>zwf(V372A)allele

<400>30

gtg agc aca aac acg acc ccc tcc agc tgg aca aac cca ctg cgc gac 48

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

ccg cag gat aaa cga ctc ccc cgc atc gct ggc cct tcc ggc atg gtg 96

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

atc ttc ggt gtc act ggc gac ttg gct cga aag aag ctg ctc ccc gcc 144

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

att tat gat cta gca aac cgc gga ttg ctg ccc cca gga ttc tcg ttg 192

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

gta ggt tac ggc cgc cgc gaa tgg tcc aaa gaa gac ttt gaa aaa tac 240

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

gta cgc gat gcc gca agt gct ggt gct cgt acg gaa ttc cgt gaa aat 288

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

gtt tgg gag cgc ctc gcc gag ggt atg gaa ttt gtt cgc ggc aac ttt 336

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

gat gat gat gca gct ttc gac aac ctc gct gca aca ctc aag cgc atc 384

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

gac aaa acc cgc ggc acc gcc ggc aac tgg gct tac tac ctg tcc att 432

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

cca cca gat tcc ttc aca gcg gtc tgc cac cag ctg gag cgt tcc ggc 480

Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

atg gct gaa tcc acc gaa gaa gca tgg cgc cgc gtg atc atc gag aag 528

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

cct ttc ggc cac aac ctc gaa tcc gca cac gag ctc aac cag ctg gtc 576

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

aac gca gtc ttc cca gaa tct tct gtg ttc cgc atc gac cac tat ttg 624

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

ggc aag gaa aca gtt caa aac atc ctg gct ctg cgt ttt gct aac cag 672

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

ctg ttt gag cca ctg tgg aac tcc aac tac gtt gac cac gtc cag atc 720

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

acc atg gct gaa gat att ggc ttg ggt gga cgt gct ggt tac tac gac 768

Thr Met Ala Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

ggc atc ggc gca gcc cgc gac gtc atc cag aac cac ctg atc cag ctc 816

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

ttg gct ctg gtt gcc atg gaa gaa cca att tct ttc gtg cca gcg cag 864

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

ctg cag gca gaa aag atc aag gtg ctc tct gcg aca aag ccg tgc tac 912

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

cca ttg gat aaa acc tcc gct cgt ggt cag tac gct gcc ggt tgg cag 960

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

ggc tct gag tta gtc aag gga ctt cgc gaa gaa gat ggc ttc aac cct 1008

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

gag tcc acc act gag act ttt gcg gct tgt acc tta gag atc acg tct 1056

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

cgt cgc tgg gct ggt gtg ccg ttc tac ctg cgc acc ggt aag cgt ctt 1104

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

ggt cgc cgt gca act gag att gcc gtg gtg ttt aaa gac gca cca cac 1152

Gly Arg Arg Ala Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

cag cct ttc gac ggc gac atg act gta tcc ctt ggc caa aac gcc atc 1200

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

gtg att cgc gtg cag cct gat gaa ggt gtg ctc atc cgc ttc ggt tcc 1248

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

aag gtt cca ggt tct gcc atg gaa gtc cgt gac gtc aac atg gac ttc 1296

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

tcc tac tca gaa tcc ttc act gaa gaa tca cct gaa gca tac gag cgc 1344

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

ctc att ttg gat gcg ctg tta gat gaa tcc agc ctc ttc cct acc aac 1392

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

gag gaa gtg gaa ctg agc tgg aag att ctg gat cca att ctt gaa gca 1440

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

tgg gat gcc gat gga gaa cca gag gat tac cca gcg ggt acg tgg ggt 1488

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

cca aag agc gct gat gaa atg ctt tcc cgc aac ggt cac acc tgg cgc 1536

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

agg cca taa 1545

Arg Pro

<210>31

<211>514

<212>PRT

<213>Artificial Sequence

<220>

<223>Obtained by in-vitro mutagenesis

<400>31

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gin Ile

225 230 235 240

Thr Met Ala Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

Gly Arg Arg Ala Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

Arg Pro

<210>32

<211>1545

<212>DNA

<213>Artificial Sequence

<220>

<223>Obtained by in-vitro mutagenesis

<220>

<221>CDS

<222>(1)..(1542)

<223>zwf(M242L)allele

<400>32

gtg agc aca aac acg acc ccc tcc agc tgg aca aac cca ctg cgc gac 48

Met Ser Thr Ash Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

ccg cag gat aaa cga ctc ccc cgc atc gct ggc cct tcc ggc atg gtg 96

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

atc ttc ggt gtc act ggc gac ttg gct cga aag aag ctg ctc ccc gcc 144

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

att tat gat cta gca aac cgc gga ttg ctg ccc cca gga ttc tcg ttg 192

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

gta ggt tac ggc cgc cgc gaa tgg tcc aaa gaa gac ttt gaa aaa tac 240

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

gta cgc gat gcc gca agt gct ggt gct cgt acg gaa ttc cgt gaa aat 288

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

gtt tgg gag cgc ctc gcc gag ggt atg gaa ttt gtt cgc ggc aac ttt 336

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

gat gat gat gca gct ttc gac aac ctc gct gca aca ctc aag cgc atc 384

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

gac aaa acc cgc ggc acc gcc ggc aac tgg gct tac tac ctg tcc att 432

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

cca cca gat tcc ttc aca gcg gtc tgc cac cag ctg gag cgt tcc ggc 480

Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

atg gct gaa tcc acc gaa gaa gca tgg cgc cgc gtg atc atc gag aag 528

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

cct ttc ggc cac aac ctc gaa tcc gca cac gag ctc aac cag ctg gtc 576

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

aac gca gtc ttc cca gaa tct tct gtg ttc cgc atc gac cac tat ttg 624

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

ggc aag gaa aca gtt caa aac atc ctg gct ctg cgt ttt gct aac cag 672

Gly LVs Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

ctg ttt gag cca ctg tgg aac tcc aac tac gtt gac cac gtc cag atc 720

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

acc ctt gct gaa gat att ggc ttg ggt gga cgt gct ggt tac tac gac 768

Thr Leu Ala Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

ggc atc ggc gca gcc cgc gac gtc atc cag aac cac ctg atc cag ctc 816

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

ttg gct ctg gtt gcc atg gaa gaa cca att tct ttc gtg cca gcg cag 864

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

ctg cag gca gaa aag atc aag gtg ctc tct gcg aca aag ccg tgc tac 912

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

cca ttg gat aaa acc tcc gct cgt ggt cag tac gct gcc ggt tgg cag 960

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

ggc tct gag tta gtc aag gga ctt cgc gaa gaa gat ggc ttc aac cct 1008

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

gag tcc acc act gag act ttt gcg gct tgt acc tta gag atc acg tct 1056

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

cgt cgc tgg gct ggt gtg ccg ttc tac ctg cgc acc ggt aag cgt ctt 1104

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

ggt cgc cgt gtt act gag att gcc gtg gtg ttt aaa gac gca cca cac 1152

Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

cag cct ttc gac ggc gac atg act gta tcc ctt ggc caa aac gcc atc 1200

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

gtg att cgc gtg cag cct gat gaa ggt gtg ctc atc cgc ttc ggt tcc 1248

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

aag gtt cca ggt tct gcc atg gaa gtc cgt gac gtc aac atg gac ttc 1296

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

tcc tac tca gaa tcc ttc act gaa gaa tca cct gaa gca tac gag cgc 1344

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

ctc att ttg gat gcg ctg tta gat gaa tcc agc ctc ttc cct acc aac 1392

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

gag gaa gtg gaa ctg agc tgg aag att ctg gat cca att ctt gaa gca 1440

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

tgg gat gcc gat gga gaa cca gag gat tac cca gcg ggt acg tgg ggt 1488

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

cca aag agc gct gat gaa atg ctt tcc cgc aac ggt cac acc tgg cgc 1536

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

agg cca taa 1545

Arg Pro

<210>33

<211>514

<212>PRT

<213>Artificial Sequence

<220>

<223>Obtained by in-vitro mutagenesis

<400>33

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

Thr Leu Ala Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

Arg Pro

<210>34

<211>1545

<212>DNA

<213>Artificial Sequence

<220>

<223>Obtained by in-vitro mutagenesis

<220>

<221>CDS

<222>(1)..(1542)

<223>zwf(M242S)allele

<400>34

gtg agc aca aac acg acc ccc tcc agc tgg aca aac cca ctg cgc gac 48

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

ccg cag gat aaa cga ctc ccc cgc atc gct ggc cct tcc ggc atg gtg 96

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

atc ttc ggt gtc act ggc gac ttg gct cga aag aag ctg ctc ccc gcc 144

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

att tat gat cta gca aac cgc gga ttg ctg ccc cca gga ttc tcg ttg 192

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

gta ggt tac ggc cgc cgc gaa tgg tcc aaa gaa gac ttt gaa aaa tac 240

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

gta cgc gat gcc gca agt gct ggt gct cgt acg gaa ttc cgt gaa aat 288

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

gtt tgg gag cgc ctc gcc gag ggt atg gaa ttt gtt cgc ggc aac ttt 336

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

gat gat gat gca gct ttc gac aac ctc gct gca aca ctc aag cgc atc 384

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

gac aaa acc cgc ggc acc gcc ggc aac tgg gct tac tac ctg tcc att 432

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

cca cca gat tcc ttc aca gcg gtc tgc cac cag ctg gag cgt tcc ggc 480

Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

atg gct gaa tcc acc gaa gaa gca tgg cgc cgc gtg atc atc gag aag 528

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

cct ttc ggc cac aac ctc gaa tcc gca cac gag ctc aac cag ctg gtc 576

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

aac gca gtc ttc cca gaa tct tct gtg ttc cgc atc gac cac tat ttg 624

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

ggc aag gaa aca gtt caa aac atc ctg gct ctg cgt ttt gct aac cag 672

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

ctg ttt gag cca ctg tgg aac tcc aac tac gtt gac cac gtc cag atc 720

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

acc tca gct gaa gat att ggc ttg ggt gga cgt gct ggt tac tac gac 768

Thr Ser Ala Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

ggc atc ggc gca gcc cgc gac gtc atc cag aac cac ctg atc cag ctc 816

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

ttg gct ctg gtt gcc atg gaa gaa cca att tct ttc gtg cca gcg cag 864

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

ctg cag gca gaa aag atc aag gtg ctc tct gcg aca aag ccg tgc tac 912

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

cca ttg gat aaa acc tcc gct cgt ggt cag tac gct gcc ggt tgg cag 960

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

ggc tct gag tta gtc aag gga ctt cgc gaa gaa gat ggc ttc aac cct 1008

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

gag tcc acc act gag act ttt gcg gct tgt acc tta gag atc acg tct 1056

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

cgt cgc tgg gct ggt gtg ccg ttc tac ctg cgc acc ggt aag cgt ctt 1104

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

ggt cgc cgt gtt act gag att gcc gtg gtg ttt aaa gac gca cca cac 1152

Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

cag cct ttc gac ggc gac atg act gta tcc ctt ggc caa aac gcc atc 1200

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

gtg att cgc gtg cag cct gat gaa ggt gtg ctc atc cgc ttc ggt tcc 1248

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

aag gtt cca ggt tct gcc atg gaa gtc cgt gac gtc aac atg gac ttc 1296

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

tcc tac tca gaa tcc ttc act gaa gaa tca cct gaa gca tac gag cgc 1344

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

ctc att ttg gat gcg ctg tta gat gaa tcc agc ctc ttc cct acc aac 1392

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

gag gaa gtg gaa ctg agc tgg aag att ctg gat cca att ctt gaa gca 1440

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

tgg gat gcc gat gga gaa cca gag gat tac cca gcg ggt acg tgg ggt 1488

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

cca aag agc gct gat gaa atg ctt tcc cgc aac ggt cac acc tgg cgc 1536

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

agg cca taa 1545

Arg Pro

<210>35

<211>514

<212>PRT

<213>Artificial Sequence

<220>

<223>Obtained by in-vitro mutagenesis

<400>35

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

Thr Ser Ala Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

Arg Pro

<210>36

<211>1545

<212>DNA

<213>Artificial Sequence

<220>

<223>Obtained by in-vitro mutagenesis

<220>

<221>CDS

<222>(1)..(1542)

<223>zwf(D245S)allele

<400>36

gtg agc aca aac acg acc ccc tcc agc tgg aca aac cca ctg cgc gac 48

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

ccg cag gat aaa cga ctc ccc cgc atc gct ggc cct tcc ggc atg gtg 96

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

atc ttc ggt gtc act ggc gac ttg gct cga aag aag ctg ctc ccc gcc 144

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

att tat gat cta gca aac cgc gga ttg ctg ccc cca gga ttc tcg ttg 192

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

gta ggt tac ggc cgc cgc gaa tgg tcc aaa gaa gac ttt gaa aaa tac 240

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

gta cgc gat gcc gca agt gct ggt gct cgt acg gaa ttc cgt gaa aat 288

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

gtt tgg gag cgc ctc gcc gag ggt atg gaa ttt gtt cgc ggc aac ttt 336

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

gat gat gat gca gct ttc gac aac ctc gct gca aca ctc aag cgc atc 384

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

gac aaa acc cgc ggc acc gcc ggc aac tgg gct tac tac ctg tcc att 432

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

cca cca gat tcc ttc aca gcg gtc tgc cac cag ctg gag cgt tcc ggc 480

Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

atg gct gaa tcc acc gaa gaa gca tgg cgc cgc gtg atc atc gag aag 528

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

cct ttc ggc cac aac ctc gaa tcc gca cac gag ctc aac cag ctg gtc 576

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

aac gca gtc ttc cca gaa tct tct gtg ttc cgc atc gac cac tat ttg 624

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

ggc aag gaa aca gtt caa aac atc ctg gct ctg cgt ttt gct aac cag 672

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

ctg ttt gag cca ctg tgg aac tcc aac tac gtt gac cac gtc cag atc 720

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

acc atg gct gaa tca att ggc ttg ggt gga cgt gct ggt tac tac gac 768

Thr Met Ala Glu Ser Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

ggc atc ggc gca gcc cgc gac gtc atc cag aac cac ctg atc cag ctc 816

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

ttg gct ctg gtt gcc atg gaa gaa cca att tct ttc gtg cca gcg cag 864

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

ctg cag gca gaa aag atc aag gtg ctc tct gcg aca aag ccg tgc tac 912

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

cca ttg gat aaa acc tcc gct cgt ggt cag tac gct gcc ggt tgg cag 960

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

ggc tct gag tta gtc aag gga ctt cgc gaa gaa gat ggc ttc aac cct 1008

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

gag tcc acc act gag act ttt gcg gct tgt acc tta gag atc acg tct 1056

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

cgt cgc tgg gct ggt gtg ccg ttc tac ctg cgc acc ggt aag cgt ctt 1104

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

ggt cgc cgt gtt act gag att gcc gtg gtg ttt aaa gac gca cca cac 1152

Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

cag cct ttc gac ggc gac atg act gta tcc ctt ggc caa aac gcc atc 1200

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

gtg att cgc gtg cag cct gat gaa ggt gtg ctc atc cgc ttc ggt tcc 1248

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

aag gtt cca ggt tct gcc atg gaa gtc cgt gac gtc aac atg gac ttc 1296

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

tcc tac tca gaa tcc ttc act gaa gaa tca cct gaa gca tac gag cgc 1344

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

ctc att ttg gat gcg ctg tta gat gaa tcc agc ctc ttc cct acc aac 1392

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

gag gaa gtg gaa ctg agc tgg aag att ctg gat cca att ctt gaa gca 1440

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

tgg gat gcc gat gga gaa cca gag gat tac cca gcg ggt acg tgg ggt 1488

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

cca aag agc gct gat gaa atg ctt tcc cgc aac ggt cac acc tgg cgc 1536

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

agg cca taa 1545

Arg Pro

<210>37

<211>514

<212>PRT

<213>Artificial Sequence

<220>

<223>Obtained by in-vitro mutagenesis

<400>37

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

Thr Met Ala Glu Ser Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

Arg Pro

<210>38

<211>1763

<212>DNA

<213>Artificial Sequence

<220>

<223>PCR-Product

<220>

<221>misc_feature

<222>(1)..(1763)

<223>PCR-product

<400>38

gatctagaag ctcgcctgaa gtagaatcag cacgctgcat cagtaacggc gacatgaaat 60

cgaattagtt cgatcttatg tggccgttac acatctttca ttaaagaaag gatcgtgaca 120

ctaccatcgt gagcacaaac acgaccccct ccagctggac aaacccactg cgcgacccgc 180

aggataaacg actcccccgc atcgctggcc cttccggcat ggtgatcttc ggtgtcactg 240

gcgacttggc tcgaaagaag ctgctccccg ccatttatga tctagcaaac cgcggattgc 300

tgcccccagg attctcgttg gtaggttacg gccgccgcga atggtccaaa gaagactttg 360

aaaaatacgt acgcgatgcc gcaagtgctg gtgctcgtac ggaattccgt gaaaatgttt 420

gggagcgcct cgccgagggt atggaatttg ttcgcggcaa ctttgatgat gatgcagctt 480

tcgacaacct cgctgcaaca ctcaagcgca tcgacaaaac ccgcggcacc gccggcaact 540

gggcttacta cctgtccatt ccaccagatt ccttcacagc ggtctgccac cagctggagc 600

gttccggcat ggctgaatcc accgaagaag catggcgccg cgtgatcatc gagaagcctt 660

tcggccacaa cctcgaatcc gcacacgagc tcaaccagct ggtcaacgca gtcttcccag 720

aatcttctgt gttccgcatc gaccactatt tgggcaagga aacagttcaa aacatcctgg 780

ctctgcgttt tgctaaccag ctgtttgagc cactgtggaa ctccaactac gttgaccacg 840

tccagatcac catggctgaa gatattggct tgggtggacg tgctggttac tacgacggca 900

tcggcgcagc ccgcgacgtc atccagaacc acctgatcca gctcttggct ctggttgcca 960

tggaagaacc aatttctttc gtgccagcgc agctgcaggc agaaaagatc aaggtgctct 1020

ctgcgacaaa gccgtgctac ccattggata aaacctccgc tcgtggtcag tacgctgccg 1080

gttggcaggg ctctgagtta gtcaagggac ttcgcgaaga agatggcttc aaccctgagt 1140

ccaccactga gacttttgcg gcttgtacct tagagatcac gtctcgtcgc tgggctggtg 1200

tgccgttcta cctgcgcacc ggtaagcgtc ttggtcgccg tgttactgag attgccgtgg 1260

tgtttaaaga cgcaccacac cagcctttcg acggcgacat gactgtatcc cttggccaaa 1320

acgccatcgt gattcgcgtg cagcctgatg aaggtgtgct catccgcttc ggttccaagg 1380

ttccaggttc tgccatggaa gtccgtgacg tcaacatgga cttctcctac tcagaatcct 1440

tcactgaaga atcacctgaa gcatacgagc gcctcatttt ggatgcgctg ttagatgaat 1500

ccagcctctt ccctaccaac gaggaagtgg aactgagctg gaagattctg gatccaattc 1560

ttgaagcatg ggatgccgat ggagaaccag aggattaccc agcgggtacg tggggtccaa 1620

agagcgctga tgaaatgctt tcccgcaacg gtcacacctg gcgcaggcca taatttaggg 1680

gcaaaaaatg atctttgaac ttccggatac caccacccag caaatttcca agaccctaac 1740

tcgactgcgt gaatctctag atc 1763

<210>39

<211>1763

<212>DNA

<213>Artificial Sequence

<220>

<223>PCR-Product

<220>

<221>mutation

<222>(861)..(861)

<223>nucleotide thymine，corresponding to position 733 of the coding

sequence of the zwf(D245S)allele

<220>

<221>mutation

<222>(862)..(862)

<223>nucleotide cytosine，corresponding to position 734 of the coding

sequence of the zwf(D245S)-Allele

<220>

<221>mutation

<222>(863)..(863)

<223>nucleotide adenine，corresponiding to position 735 of the coding

sequence of the zwf(D245S)-Allele

<400>39

gatctagaag ctcgcctgaa gtagaatcag cacgctgcat cagtaacggc gacatgaaat 60

cgaattagtt cgatcttatg tggccgttac acatctttca ttaaagaaag gatcgtgaca 120

ctaccatcgt gagcacaaac acgaccccct ccagctggac aaacccactg cgcgacccgc 180

aggataaacg actcccccgc atcgctggcc cttccggcat ggtgatcttc ggtgtcactg 240

gcgacttggc tcgaaagaag ctgctccccg ccatttatga tctagcaaac cgcggattgc 300

tgcccccagg attctcgttg gtaggttacg gccgccgcga atggtccaaa gaagactttg 360

aaaaatacgt acgcgatgcc gcaagtgctg gtgctcgtac ggaattccgt gaaaatgttt 420

gggagcgcct cgccgagggt atggaatttg ttcgcggcaa ctttgatgat gatgcagctt 480

tcgacaacct cgctgcaaca ctcaagcgca tcgacaaaac ccgcggcacc gccggcaact 540

gggcttacta cctgtccatt ccaccagatt ccttcacagc ggtctgccac cagctggagc 600

gttccggcat ggctgaatcc accgaagaag catggcgccg cgtgatcatc gagaagcctt 660

tcggccacaa cctcgaatcc gcacacgagc tcaaccagct ggtcaacgca gtcttcccag 720

aatcttctgt gttccgcatc gaccactatt tgggcaagga aacagttcaa aacatcctgg 780

ctctgcgttt tgctaaccag ctgtttgagc cactgtggaa ctccaactac gttgaccacg 840

tccagatcac catggctgaa tcaattggct tgggtggacg tgctggttac tacgacggca 900

tcggcgcagc ccgcgacgtc atccagaacc acctgatcca gctcttggct ctggttgcca 960

tggaagaacc aatttctttc gtgccagcgc agctgcaggc agaaaagatc aaggtgctct 1020

ctgcgacaaa gccgtgctac ccattggata aaacctccgc tcgtggtcag tacgctgccg 1080

gttggcaggg ctctgagtta gtcaagggac ttcgcgaaga agatggcttc aaccctgagt 1140

ccaccactga gacttttgcg gcttgtacct tagagatcac gtctcgtcgc tgggctggtg 1200

tgccgttcta cctgcgcacc ggtaagcgtc ttggtcgccg tgttactgag attgccgtgg 1260

tgtttaaaga cgcaccacac cagcctttcg acggcgacat gactgtatcc cttggccaaa 1320

acgccatcgt gattcgcgtg cagcctgatg aaggtgtgct catccgcttc ggttccaagg 1380

ttccaggttc tgccatggaa gtccgtgacg tcaacatgga cttctcctac tcagaatcct 1440

tcactgaaga atcacctgaa gcatacgagc gcctcatttt ggatgcgctg ttagatgaat 1500

ccagcctctt ccctaccaac gaggaagtgg aactgagctg gaagattctg gatccaattc 1560

ttgaagcatg ggatgccgat ggagaaccag aggattaccc agcgggtacg tggggtccaa 1620

agagcgctga tgaaatgctt tcccgcaacg gtcacacctg gcgcaggcca taatttaggg 1680

gcaaaaaatg atctttgaac ttccggatac caccacccag caaatttcca agaccctaac 1740

tcgactgcgt gaatctctag atc 1763

<210>40

<211>36

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer DM_zwfD245Sa

<400>40

agatcaccat ggctgaatca attggcttgg gtggac 36

<210>41

<211>36

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer DM_D245Sb

<400>41

gcacgtccac ccaagccaat tgattcagcc atggtg 36

<210>42

<211>20

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>misc_feature

<222>(1)..(20)

<223>Primer zf_2

<400>42

ttctgtgttc cgcatcgacc 20

<210>43

<211>28

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer zwfA

<400>43

attctagaca ccttgatctt ctccgttg 28

<210>44

<211>20

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>misc_feature

<222>(1)..(20)

<223>Primer zwfB

<400>44

gatggtagtg tcacgatcct 20

<210>45

<211>39

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer zwfC

<400>45

aggatcgtga cactaccatc atggtgatct tcggtgtca 39

<210>46

<211>28

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer zwfD

<400>46

attctagagc ggaggtttta tccaatgg 28

<210>47

<211>1560

<212>DNA

<213>Artificial Sequence

<220>

<223>PCR-Product：zwf deletion fragment

<220>

<221>misc_feature

<222>(1)..(710)

<223>upstream region of the zwf-gene

<220>

<221>misc_feature

<222>(711)..(1560)

<223>Internal segment of the coding sequence of the zwf-gene(SEQ ID N

O：9)，starting from nucleotide 91 of the zwf gene.Nucleotide 71

1 is identically to nucleotide 1 of the coding sequence of the zw

f-gene mentioned in JP-A-09-22461 as shown in SEQ ID NO：7).

<400>47

attctagaca ccttgatctt ctccgttgct cgctaccgcg aggtcatcgc tgcgttcatc 60

gagggcatca agcaggctgc tgcaaacggc cacgacgtct ccaagatcca ctctgtggct 120

tccttcttcg tctcccgcgt cgacgttgag atcgacaagc gcctcgaggc aatcggatcc 180

gatgaggctt tggctctgcg cggcaaggca ggcgttgcca acgctcagcg cgcttacgct 240

gtgtacaagg agcttttcga cgccgccgag ctgcctgaag gtgccaacac tcagcgccca 300

ctgtgggcat ccaccggcgt gaagaaccct gcgtacgctg caactcttta cgtttccgag 360

ctggctggtc caaacaccgt caacaccatg ccagaaggca ccatcgacgc ggttctggag 420

cagggcaacc tgcacggtga caccctgtcc aactccgcgg cagaagctga cgctgtgttc 480

tcccagcttg aggctctggg cgttgacttg gcagatgtct tccaggtcct ggagaccgag 540

ggtgtggaca agttcgttgc ttcttggagc gaactgcttg agtccatgga agctcgcctg 600

aagtagaatc agcacgctgc atcagtaacg gcgacatgaa atcgaattag ttcgatctta 660

tgtggccgtt acacatcttt cattaaagaa aggatcgtga cactaccatc atggtgatct 720

tcggtgtcac tggcgacttg gctcgaaaga agctgctccc cgccatttat gatctagcaa 780

accgcggatt gctgccccca ggattctcgt tggtaggtta cggccgccgc gaatggtcca 840

aagaagactt tgaaaaatac gtacgcgatg ccgcaagtgc tggtgctcgt acggaattcc 900

gtgaaaatgt ttgggagcgc ctcgccgagg gtatggaatt tgttcgcggc aactttgatg 960

atgatgcagc tttcgacaac ctcgctgcaa cactcaagcg catcgacaaa acccgcggca 1020

ccgccggcaa ctgggcttac tacctgtcca ttccaccaga ttccttcaca gcggtctgcc 1080

accagctgga gcgttccggc atggctgaat ccaccgaaga agcatggcgc cgcgtgatca 1140

tcgagaagcc tttcggccac aacctcgaat ccgcacacga gctcaaccag ctggtcaacg 1200

cagtcttccc agaatcttct gtgttccgca tcgaccacta tttgggcaag gaaacagttc 1260

aaaacatcct ggctctgcgt tttgctaacc agctgtttga gccactgtgg aactccaact 1320

acgttgacca cgtccagatc accatggctg aagatattgg cttgggtgga cgtgctggtt 1380

actacgacgg catcggcgca gcccgcgacg tcatccagaa ccacctgatc cagctcttgg 1440

ctctggttgc catggaagaa ccaatttctt tcgtgccagc gcagctgcag gcagaaaaga 1500

tcaaggtgct ctctgcgaca aagccgtgct acccattgga taaaacctcc gctctagaat 1560

<210>48

<211>20

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>misc_feature

<222>(1)..(20)

<223>Primer zwfi1

<400>48

ggcgttgact tggcagatgt 20

<210>49

<211>20

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>misc_feature

<222>(1)..(20)

<223>Primer zwfi2

<400>49

gcagaccgct gtgaaggaat 20

<210>50

<211>20

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>misc_feature

<222>(1)..(20)

<223>Primer LC-zwf1

<400>50

tccgcatcga ccactatttg 20

<210>51

<211>20

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>misc_feature

<222>(1)..(20)

<223>Primer LC-zwf2

<400>51

cgctggcacg aaagaaattg 20

<210>52

<211>20

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>misc_feature

<222>(1)..(20)

<223>Oligonucleotide zwf243-C

<400>52

tatcttcagt catggtgatc 20

<210>53

<211>30

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>misc_feature

<222>(1)..(30)

<223>Oligonucleotide zwf243-A

<400>53

gtcgtagtaa ccagcacgtc cacccaagcc 30

<210>54

<211>1455

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>allele

<222>(1)..(1455)

<223>zwfdelta90bp(A243T)allele

<220>

<221>CDS

<222>(1)..(1452)

<223>zwfdelta90bp(A243T)allele

<400>54

atg gtg atc ttc ggt gtc act ggc gac ttg gct cga aag aag ctg ctc 48

Met Val Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu

1 5 10 15

ccc gcc att tat gat cta gca aac cgc gga ttg ctg ccc cca gga ttc 96

Pro Ala Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe

20 25 30

tcg ttg gta ggt tac ggc cgc cgc gaa tgg tcc aaa gaa gac ttt gaa 144

Ser Leu Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu

35 40 45

aaa tac gta cgc gat gcc gca agt gct ggt gct cgt acg gaa ttc cgt 192

Lys Tyr Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg

50 55 60

gaa aat gtt tgg gag cgc ctc gcc gag ggt atg gaa ttt gtt cgc ggc 240

Glu Asn Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly

65 70 75 80

aac ttt gat gat gat gca gct ttc gac aac ctc gct gca aca ctc aag 288

Asn Phe Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys

85 90 95

cgc atc gac aaa acc cgc ggc acc gcc ggc aac tgg gct tac tac ctg 336

Arg Ile Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu

100 105 110

tcc att cca cca gat tcc ttc aca gcg gtc tgc cac cag ctg gag cgt 384

Ser Ile Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg

115 120 125

tcc ggc atg gct gaa tcc acc gaa gaa gca tgg cgc cgc gtg atc atc 432

Ser Gly Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile

130 135 140

gag aag cct ttc ggc cac aac ctc gaa tcc gca cac gag ctc aac cag 480

Glu Lys Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln

145 150 155 160

ctg gtc aac gca gtc ttc cca gaa tct tct gtg ttc cgc atc gac cac 528

Leu Val Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His

165 170 175

tat ttg ggc aag gaa aca gtt caa aac atc ctg gct ctg cgt ttt gct 576

Tyr Leu Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala

180 185 190

aac cag ctg ttt gag cca ctg tgg aac tcc aac tac gtt gac cac gtc 624

Asn Gln Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val

195 200 205

cag atc acc atg act gaa gat att ggc ttg ggt gga cgt gct ggt tac 672

Gln Ile Thr Met Thr Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr

210 215 220

tac gac ggc atc ggc gca gcc cgc gac gtc atc cag aac cac ctg atc 720

Tyr Asp Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile

225 230 235 240

cag ctc ttg gct ctg gtt gcc atg gaa gaa cca att tct ttc gtg cca 768

Gln Leu Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro

245 250 255

gcg cag ctg cag gca gaa aag atc aag gtg ctc tct gcg aca aag ccg 816

Ala Gln Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro

260 265 270

tgc tac cca ttg gat aaa acc tcc gct cgt ggt cag tac gct gcc ggt 864

Cys Tyr Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly

275 280 285

tgg cag ggc tct gag tta gtc aag gga ctt cgc gaa gaa gat ggc ttc 912

Trp Gln Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe

290 295 300

aac cct gag tcc acc act gag act ttt gcg gct tgt acc tta gag atc 960

Asn Pro Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile

305 310 315 320

acg tct cgt cgc tgg gct ggt gtg ccg ttc tac ctg cgc acc ggt aag 1008

Thr Ser Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys

325 330 335

cgt ctt ggt cgc cgt gtt act gag att gcc gtg gtg ttt aaa gac gca 1056

Arg Leu Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala

340 345 350

cca cac cag cct ttc gac ggc gac atg act gta tcc ctt ggc caa aac 1104

Pro His Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn

355 360 365

gcc atc gtg att cgc gtg cag cct gat gaa ggt gtg ctc atc cgc ttc 1152

Ala Ile Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe

370 375 380

ggt tcc aag gtt cca ggt tct gcc atg gaa gtc cgt gac gtc aac atg 1200

Gly Ser Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met

385 390 395 400

gac ttc tcc tac tca gaa tcc ttc act gaa gaa tca cct gaa gca tac 1248

Asp Phe Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr

405 410 415

gag cgc ctc att ttg gat gcg ctg tta gat gaa tcc agc ctc ttc cct 1296

Glu Arg Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro

420 425 430

acc aac gag gaa gtg gaa ctg agc tgg aag att ctg gat cca att ctt 1344

Thr Asn Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu

435 440 445

gaa gca tgg gat gcc gat gga gaa cca gag gat tac cca gcg ggt acg 1392

Glu Ala Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr

450 455 460

tgg ggt cca aag agc gct gat gaa atg ctt tcc cgc aac ggt cac acc 1440

Trp Gly Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr

465 470 475 480

tgg cgc agg cca taa 1455

Trp Arg Arg Pro

<210>55

<211>484

<212>PRT

<213>Corynebacterium glutamicum

<400>55

Met Val Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu

1 5 10 15

Pro Ala Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe

20 25 30

Ser Leu Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu

35 40 45

Lys Tyr Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg

50 55 60

Glu Asn Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly

65 70 75 80

Asn Phe Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys

85 90 95

Arg Ile Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu

100 105 110

Ser Ile Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg

115 120 125

Ser Gly Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile

130 135 140

Glu Lys Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln

145 150 155 160

Leu Val Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His

165 170 175

Tyr Leu Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala

180 185 190

Asn Gln Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val

195 200 205

Gln Ile Thr Met Thr Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr

210 215 220

Tyr Asp Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile

225 230 235 240

Gln Leu Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro

245 250 255

Ala Gln Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro

260 265 270

Cys Tyr Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly

275 280 285

Trp Gln Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe

290 295 300

Asn Pro Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile

305 310 315 320

Thr Ser Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys

325 330 335

Arg Leu Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala

340 345 350

Pro His Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn

355 360 365

Ala Ile Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe

370 375 380

Gly Ser Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met

385 390 395 400

Asp Phe Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr

405 410 415

Glu Arg Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro

420 425 430

Thr Asn Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu

435 440 445

Glu Ala Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr

450 455 460

Trp Gly Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr

465 470 475 480

Trp Arg Arg Pro

<210>56

<211>29

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer zwfRBS1

<400>56

atgtcgacaa gaaaggatcg tgacactac 29

<210>57

<211>25

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer zwfRBS2

<400>57

atgtcgaccc cccgcatcgc tggcc 25

<210>58

<211>28

<212>DNA

<213>Artificial Sequence

<220>

<223>Primer zwfRBSE

<400>58

atgtcgacat cgctttcgga gtcagtga 28

<210>59

<211>1732

<212>DNA

<213>Artificial Sequence

<220>

<223>PCR-Product zwfL

<220>

<221>CDS

<222>(34)..(1575)

<223>zwf-allele zwfL

<400>59

atgtcgacaa gaaaggatcg tgacactacc atc gtg agc aca aac acg acc ccc 54

Met Ser Thr Asn Thr Thr Pro

1 5

tcc agc tgg aca aac cca ctg cgc gac ccg cag gat aaa cga ctc ccc 102

Ser Ser Trp Thr Asn Pro Leu Arg Asp Pro Gln Asp Lys Arg Leu Pro

10 15 20

cgc atc gct ggc cct tcc ggc atg gtg atc ttc ggt gtc act ggc gac 150

Arg Ile Ala Gly Pro Ser Gly Met Val Ile Phe Gly Val Thr Gly Asp

25 30 35

ttg gct cga aag aag ctg ctc ccc gcc att tat gat cta gca aac cgc 198

Leu Ala Arg Lys Lys Leu Leu Pro Ala Ile Tyr Asp Leu Ala Asn Arg

40 45 50 55

gga ttg ctg ccc cca gga ttc tcg ttg gta ggt tac ggc cgc cgc gaa 246

Gly Leu Leu Pro Pro Gly Phe Ser Leu Val Gly Tyr Gly Arg Arg Glu

60 65 70

tgg tcc aaa gaa gac ttt gaa aaa tac gta cgc gat gcc gca agt gct 294

Trp Ser Lys Glu Asp Phe Glu Lys Tyr Val Arg Asp Ala Ala Ser Ala

75 80 85

ggt gct cgt acg gaa ttc cgt gaa aat gtt tgg gag cgc ctc gcc gag 342

Gly Ala Arg Thr Glu Phe Arg Glu Asn Val Trp Glu Arg Leu Ala Glu

90 95 100

ggt atg gaa ttt gtt cgc ggc aac ttt gat gat gat gca gct ttc gac 390

Gly Met Glu Phe Val Arg Gly Asn Phe Asp Asp Asp Ala Ala Phe Asp

105 110 115

aac ctc gct gca aca ctc aag cgc atc gac aaa acc cgc ggc acc gcc 438

Asn Leu Ala Ala Thr Leu Lys Arg Ile Asp Lys Thr Arg Gly Thr Ala

120 125 130 135

ggc aac tgg gct tac tac ctg tcc att cca cca gat tcc ttc aca gcg 486

Gly Asn Trp Ala Tyr Tyr Leu Ser Ile Pro Pro Asp Ser Phe Thr Ala

140 145 150

gtc tgc cac cag ctg gag cgt tcc ggc atg gct gaa tcc acc gaa gaa 534

Val Cys His Gln Leu Glu Arg Ser Gly Met Ala Glu Ser Thr Glu Glu

155 160 165

gca tgg cgc cgc gtg atc atc gag aag cct ttc ggc cac aac ctc gaa 582

Ala Trp Arg Arg Val Ile Ile Glu Lys Pro Phe Gly His Asn Leu Glu

170 175 180

tcc gca cac gag ctc aac cag ctg gtc aac gca gtc ttc cca gaa tct 630

Ser Ala His Glu Leu Asn Gln Leu Val Asn Ala Val Pne Pro Glu Ser

185 190 195

tct gtg ttc cgc atc gac cac tat ttg ggc aag gaa aca gtt caa aac 678

Ser Val Phe Arg Ile Asp His Tyr Leu Gly Lys Glu Thr Val Gln Asn

200 205 210 215

atc ctg gct ctg cgt ttt gct aac cag ctg ttt gag cca ctg tgg aac 726

Ile Leu Ala Leu Arg Phe Ala Asn Gln Leu Phe Glu Pro Leu Trp Asn

220 225 230

tcc aac tac gtt gac cac gtc cag atc acc atg act gaa gat att ggc 774

Ser Asn Tyr Val Asp His Val Gln Ile Thr Met Thr Glu Asp Ile Gly

235 240 245

ttg ggt gga cgt gct ggt tac tac gac ggc atc ggc gca gcc cgc gac 822

Leu Gly Gly Arg Ala Gly Tyr Tyr Asp Gly Ile Gly Ala Ala Arg Asp

250 255 260

gtc atc cag aac cac ctg atc cag ctc ttg gct ctg gtt gcc atg gaa 870

Val Ile Gln Asn His Leu Ile Gln Leu Leu Ala Leu Val Ala Met Glu

265 270 275

gaa cca att tct ttc gtg cca gcg cag ctg cag gca gaa aag atc aag 918

Glu Pro Ile Ser Phe Val Pro Ala Gln Leu Gln Ala Glu Lys Ile Lys

280 285 290 295

gtg ctc tct gcg aca aag ccg tgc tac cca ttg gat aaa acc tcc gct 966

Val Leu Ser Ala Thr Lys Pro Cys Tyr Pro Leu Asp Lys Thr Ser Ala

300 305 310

cgt ggt cag tac gct gcc ggt tgg cag ggc tct gag tta gtc aag gga 1014

Arg Gly Gln Tyr Ala Ala Gly Trp Gln Gly Ser Glu Leu Val Lys Gly

315 320 325

ctt cgc gaa gaa gat ggc ttc aac cct gag tcc acc act gag act ttt 1062

Leu Arg Glu Glu Asp Gly Phe Asn Pro Glu Ser Thr Thr Glu Thr Phe

330 335 340

gcg gct tgt acc tta gag atc acg tct cgt cgc tgg gct ggt gtg ccg 1110

Ala Ala Cys Thr Leu Glu Ile Thr Ser Arg Arg Trp Ala Gly Val Pro

345 350 355

ttc tac ctg cgc acc ggt aag cgt ctt ggt cgc cgt gtt act gag att 1158

Phe Tyr Leu Arg Thr Gly Lys Arg Leu Gly Arg Arg Val Thr Glu Ile

360 365 370 375

gcc gtg gtg ttt aaa gac gca cca cac cag cct ttc gac ggc gac atg 1206

Ala Val Val Phe Lys Asp Ala Pro His Gln Pro Phe Asp Gly Asp Met

380 385 390

act gta tcc ctt ggc caa aac gcc atc gtg att cgc gtg cag cct gat 1254

Thr Val Ser Leu Gly Gln Asn Ala Ile Val Ile Arg Val Gln Pro Asp

395 400 405

gaa ggt gtg ctc atc cgc ttc ggt tcc aag gtt cca ggt tct gcc atg 1302

Glu Gly Val Leu Ile Arg Phe Gly Ser Lys Val Pro Gly Ser Ala Met

410 415 420

gaa gtc cgt gac gtc aac atg gac ttc tcc tac tca gaa tcc ttc act 1350

Glu Val Arg Asp Val Asn Met Asp Phe Ser Tyr Ser Glu Ser Phe Thr

425 430 435

gaa gaa tca cct gaa gca tac gag cgc ctc att ttg gat gcg ctg tta 1398

Glu Glu Ser Pro Glu Ala Tyr Glu Arg Leu Ile Leu Asp Ala Leu Leu

440 445 450 455

gat gaa tcc agc ctc ttc cct acc aac gag gaa gtg gaa ctg agc tgg 1446

Asp Glu Ser Ser Leu Phe Pro Thr Asn Glu Glu Val Glu Leu Ser Trp

460 465 470

aag att ctg gat cca att ctt gaa gca tgg gat gcc gat gga gaa cca 1494

Lys Ile Leu Asp Pro Ile Leu Glu Ala Trp Asp Ala Asp Gly Glu Pro

475 480 485

gag gat tac cca gcg ggt acg tgg ggt cca aag agc gct gat gaa atg 1542

Glu Asp Tyr Pro Ala Gly Thr Trp Gly Pro Lys Ser Ala Asp Glu Met

490 495 500

ctt tcc cgc aac ggt cac acc tgg cgc agg cca taatttaggg gcaaaaaatg 1595

Leu Ser Arg Asn Gly His Thr Trp Arg Arg Pro

505 510

atctttgaac ttccggatac caccacccag caaatttcca agaccctaac tcgactgcgt 1655

gaatcgggca cccaggtcac caccggccga gtgctcaccc tcatcgtggt cactgactcc 1715

gaaagcgatg tcgacat 1732

<210>60

<211>514

<212>PRT

<213>Artificial Sequence

<220>

<223>PCR-Product zwfL

<400>60

Met Ser Thr Asn Thr Thr Pro Ser Ser Trp Thr Asn Pro Leu Arg Asp

1 5 10 15

Pro Gln Asp Lys Arg Leu Pro Arg Ile Ala Gly Pro Ser Gly Met Val

20 25 30

Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala

35 40 45

Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu

50 55 60

Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr

65 70 75 80

Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn

85 90 95

Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe

100 105 110

Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile

115 120 125

Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile

130 135 140

Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly

145 150 155 160

Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys

165 170 175

Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val

180 185 190

Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu

195 200 205

Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln

210 215 220

Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile

225 230 235 240

Thr Met Thr Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp

245 250 255

Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu

260 265 270

Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln

275 280 285

Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr

290 295 300

Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln

305 310 315 320

Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro

325 330 335

Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser

340 345 350

Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu

355 360 365

Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala Pro His

370 375 380

Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile

385 390 395 400

Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser

405 410 415

Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met Asp Phe

420 425 430

Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg

435 440 445

Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn

450 455 460

Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala

465 470 475 480

Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly

485 490 495

Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg

500 505 510

Arg Pro

<210>61

<211>1642

<212>DNA

<213>Artificial Sequence

<220>

<223>PCR-Product zwfS

<220>

<221>CDS

<222>(34)..(1485)

<223>zwf-allele zwfS

<400>61

atgtcgaccc cccgcatcgc tggcccttcc ggc atg gtg atc ttc ggt gtc act 54

Met Val Ile Phe Gly Val Thr

1 5

ggc gac ttg gct cga aag aag ctg ctc ccc gcc att tat gat cta gca 102

Gly Asp Leu Ala Arg Lys Lys Leu Leu Pro Ala Ile Tyr Asp Leu Ala

10 15 20

aac cgc gga ttg ctg ccc cca gga ttc tcg ttg gta ggt tac ggc cgc 150

Asn Arg Gly Leu Leu Pro Pro Gly Phe Ser Leu Val Gly Tyr Gly Arg

25 30 35

cgc gaa tgg tcc aaa gaa gac ttt gaa aaa tac gta cgc gat gcc gca 198

Arg Glu Trp Ser Lys Glu Asp Phe Glu Lys Tyr Val Arg Asp Ala Ala

40 45 50 55

agt gct ggt gct cgt acg gaa ttc cgt gaa aat gtt tgg gag cgc ctc 246

Ser Ala Gly Ala Arg Thr Glu Phe Arg Glu Asn Val Trp Glu Arg Leu

60 65 70

gcc gag ggt atg gaa ttt gtt cgc ggc aac ttt gat gat gat gca gct 294

Ala Glu Gly Met Glu Phe Val Arg Gly Asn Phe Asp Asp Asp Ala Ala

75 80 85

ttc gac aac ctc gct gca aca ctc aag cgc atc gac aaa acc cgc ggc 342

Phe Asp Asn Leu Ala Ala Thr Leu Lys Arg Ile Asp Lys Thr Arg Gly

90 95 100

acc gcc ggc aac tgg gct tac tac ctg tcc att cca cca gat tcc ttc 390

Thr Ala Gly Asn Trp Ala Tyr Tyr Leu Ser Ile Pro Pro Asp Ser Phe

105 110 115

aca gcg gtc tgc cac cag ctg gag cgt tcc ggc atg gct gaa tcc acc 438

Thr Ala Val Cys His Gln Leu Glu Arg Ser Gly Met Ala Glu Ser Thr

120 125 130 135

gaa gaa gca tgg cgc cgc gtg atc atc gag aag cct ttc ggc cac aac 486

Glu Glu Ala Trp Arg Arg Val Ile Ile Glu Lys Pro Phe Gly His Asn

140 145 150

ctc gaa tcc gca cac gag ctc aac cag ctg gtc aac gca gtc ttc cca 534

Leu Glu Ser Ala His Glu Leu Asn Gln Leu Val Asn Ala Val Phe Pro

155 160 165

gaa tct tct gtg ttc cgc atc gac cac tat ttg ggc aag gaa aca gtt 582

Glu Ser Ser Val Phe Arg Ile Asp His Tyr Leu Gly Lys Glu Thr Val

170 175 180

caa aac atc ctg gct ctg cgt ttt gct aac cag ctg ttt gag cca ctg 630

Gln Asn Ile Leu Ala Leu Arg Phe Ala Asn Gln Leu Phe Glu Pro Leu

185 190 195

tgg aac tcc aac tac gtt gac cac gtc cag atc acc atg act gaa gat 678

Trp Asn Ser Asn Tyr Val Asp His Val Gln Ile Thr Met Thr Glu Asp

200 205 210 215

att ggc ttg ggt gga cgt gct ggt tac tac gac ggc atc ggc gca gcc 726

Ile Gly Leu Gly Gly Arg Ala Gly Tyr Tyr Asp Gly Ile Gly Ala Ala

220 225 230

cgc gac gtc atc cag aac cac ctg atc cag ctc ttg gct ctg gtt gcc 774

Arg Asp Val Ile Gln Asn His Leu Ile Gln Leu Leu Ala Leu Val Ala

235 240 245

atg gaa gaa cca att tct ttc gtg cca gcg cag ctg cag gca gaa aag 822

Met Glu Glu Pro Ile Ser Phe Val Pro Ala Gln Leu Gln Ala Glu Lys

250 255 260

atc aag gtg ctc tct gcg aca aag ccg tgc tac cca ttg gat aaa acc 870

Ile Lys Val Leu Ser Ala Thr Lys Pro Cys Tyr Pro Leu Asp Lys Thr

265 270 275

tcc gct cgt ggt cag tac gct gcc ggt tgg cag ggc tct gag tta gtc 918

Ser Ala Arg Gly Gln Tyr Ala Ala Gly Trp Gln Gly Ser Glu Leu Val

280 285 290 295

aag gga ctt cgc gaa gaa gat ggc ttc aac cct gag tcc acc act gag 966

Lys Gly Leu Arg Glu Glu Asp Gly Phe Asn Pro Glu Ser Thr Thr Glu

300 305 310

act ttt gcg gct tgt acc tta gag atc acg tct cgt cgc tgg gct ggt 1014

Thr Phe Ala Ala Cys Thr Leu Glu Ile Thr Ser Arg Arg Trp Ala Gly

315 320 325

gtg ccg ttc tac ctg cgc acc ggt aag cgt ctt ggt cgc cgt gtt act 1062

Val Pro Phe Tyr Leu Arg Thr Gly Lys Arg Leu Gly Arg Arg Val Thr

330 335 340

gag att gcc gtg gtg ttt aaa gac gca cca cac cag cct ttc gac ggc 1110

Glu Ile Ala Val Val Phe Lys Asp Ala Pro His Gln Pro Phe Asp Gly

345 350 355

gac atg act gta tcc ctt ggc caa aac gcc atc gtg att cgc gtg cag 1158

Asp Met Thr Val Ser Leu Gly Gln Asn Ala Ile Val Ile Arg Val Gln

360 365 370 375

cct gat gaa ggt gtg ctc atc cgc ttc ggt tcc aag gtt cca ggt tct 1206

Pro Asp Glu Gly Val Leu Ile Arg Phe Gly Ser Lys Val Pro Gly Ser

380 385 390

gcc atg gaa gtc cgt gac gtc aac atg gac ttc tcc tac tca gaa tcc 1254

Ala Met Glu Val Arg Asp Val Asn Met Asp Phe Ser Tyr Ser Glu Ser

395 400 405

ttc act gaa gaa tca cct gaa gca tac gag cgc ctc att ttg gat gcg 1302

Phe Thr Glu Glu Ser Pro Glu Ala Tyr Glu Arg Leu Ile Leu Asp Ala

410 415 420

ctg tta gat gaa tcc agc ctc ttc cct acc aac gag gaa gtg gaa ctg 1350

Leu Leu Asp Glu Ser Ser Leu Phe Pro Thr Asn Glu Glu Val Glu Leu

425 430 435

agc tgg aag att ctg gat cca att ctt gaa gca tgg gat gcc gat gga 1398

Ser Trp Lys Ile Leu Asp Pro Ile Leu Glu Ala Trp Asp Ala Asp Gly

440 445 450 455

gaa cca gag gat tac cca gcg ggt acg tgg ggt cca aag agc gct gat 1446

Glu Pro Glu Asp Tyr Pro Ala Gly Thr Trp Gly Pro Lys Ser Ala Asp

460 465 470

gaa atg ctt tcc cgc aac ggt cac acc tgg cgc agg cca taatttaggg 1495

Glu Met Leu Ser Arg Asn Gly His Thr Trp Arg Arg Pro

475 480

gcaaaaaatg atctttgaac ttccggatac caccacccag caaatttcca agaccctaac 1555

tcgactgcgt gaatcgggca cccaggtcac caccggccga gtgctcaccc tcatcgtggt 1615

cactgactcc gaaagcgatg tcgacat 1642

<210>62

<21l>484

<212>PRT

<213>Artificial Sequence

<220>

<223>PCR-Product zwfS

<400>62

Met Val Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu

1 5 10 15

Pro Ala Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe

20 25 30

Ser Leu Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu

35 40 45

Lys Tyr Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg

50 55 60

Glu Asn Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly

65 70 75 80

Asn Phe Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys

85 90 95

Arg Ile Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu

100 105 110

Ser Ile Pro Pro Asp Ser Phe Thr Ala Val Cys His Gln Leu Glu Arg

115 120 125

Ser Gly Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile

130 135 140

Glu Lys Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln

145 150 155 160

Leu Val Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His

165 170 175

Tyr Leu Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala

180 185 190

Asn Gln Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val

195 200 205

Gln Ile Thr Met Thr Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr

210 215 220

Tyr Asp Gly Ile Gly Ala Ala Arg Asp Val Ile Gln Asn His Leu Ile

225 230 235 240

Gln Leu Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro

245 250 255

Ala Gln Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro

260 265 270

Cys Tyr Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly

275 280 285

Trp Gln Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe

290 295 300

Asn Pro Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile

305 310 315 320

Thr Ser Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys

325 330 335

Arg Leu Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala

340 345 350

Pro His Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn

355 360 365

Ala Ile Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe

370 375 380

Gly Ser Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met

385 390 395 400

Asp Phe Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr

405 410 415

Glu Arg Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro

420 425 430

Thr Asn Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu

435 440 445

Glu Ala Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr

450 455 460

Trp Gly Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr

465 470 475 480

Trp Arg Arg Pro

<210>63

<211>18

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>misc_feature

<222>(1)..(18)

<223>Primer GATC-R1_neu-29234

<400>63

ggaacacaga agattctg 18

<210>64

<211>18

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>misc_feature

<222>(1)..(18)

<223>Primer GATC-F1_neu-29233

<400>64

ccgtgttact gagattgc 18

<210>65

<211>20

<212>DNA

<213>Corynebacterium glutamicum

<220>

<221>misc_feature

<222>(1)..(18)

<223>Primer GATC-zwf_int-27334

<400>65

tggctgaatc caccgaagaa 20

Claims

1. isolating polynucleotide, its coding comprises the protein of the aminoacid sequence of SEQ ID NO:10, is wherein replaced by other gal4 amino acid at one or more amino acid of 369-373 position and/or at one or more amino acid of 241-246 position at least.

2. the isolating polynucleotide of claim 1, its coding comprises the protein of the aminoacid sequence of SEQ ID NO:10, wherein is selected from least as one or more amino acid of next group to be replaced by any other gal4 amino acid: the 370th L-arginine, the 372nd L-Xie Ansuan, the 242nd L-methionine(Met), the 243rd L-L-Ala, the 244th L-L-glutamic acid and the 245th L-aspartic acid.

3. the isolating polynucleotide of claim 1, its coding is selected from a kind of protein as next group: comprise the protein of the aminoacid sequence of SEQ ID NO:10, wherein at least the 243 L-L-Ala is replaced by the L-Threonine; The protein that comprises the aminoacid sequence of SEQ ID NO:10, wherein at least the 242 L-methionine(Met) is replaced by the L-leucine; The protein that comprises the aminoacid sequence of SEQ ID NO:10, wherein at least the 242 L-methionine(Met) is replaced by the L-Serine; The protein that comprises the aminoacid sequence of SEQ ID NO:10, wherein at least the 245 L-aspartic acid is replaced by the L-Serine; The protein that comprises the aminoacid sequence of SEQ IDNO:10, wherein at least the 370 L-arginine is by L-methionine(Met) displacement and comprise the protein of the aminoacid sequence of SEQ ID NO:10, and wherein at least the 372 L-Xie Ansuan is replaced by the L-L-Ala.

4. the isolating polynucleotide of claim 1, its coding comprise at least the 241-246 amino acids and the protein of the 1-10 amino acids of the aminoacid sequence of SEQ ID NO:10 randomly of the aminoacid sequence of SEQ ID NO:22.

5. the isolating polynucleotide of claim 3, it comprises the 308-1849 position Nucleotide of the nucleotide sequence of SEQ ID NO:21.

6. the isolating polynucleotide of claim 1, its coding comprise at least the 237-250 amino acids of one of SEQ ID NO:33, aminoacid sequence of 35 and 37 and the protein of the 1-10 amino acids of the aminoacid sequence of SEQ IDNO:10 randomly.

7. the isolating polynucleotide of claim 3, it comprises the 1-1542 position Nucleotide of one of SEQ ID NO:32, nucleotide sequence of 34 and 36.

8. each isolating polynucleotide of claim 1-7, wherein said encoded protein matter has the glucose-6-phosphate dehydrogenase (G6PD) activity.

9. the isolating polynucleotide of claim 8, wherein said glucose-6-phosphate dehydrogenase (G6PD) activity has resistance to the restraining effect of NADPH.

10. claim 5 or 6 isolating polynucleotide, it has the active proteinic fragment of glucose-6-phosphate dehydrogenase (G6PD) by SEQ ID NO:21, one of 33,35 and 37 sequence or its coding and forms.

11. the isolating polynucleotide of claim 10, its coding have the active protein of glucose-6-phosphate dehydrogenase (G6PD), wherein said protein comprises the 1-10 amino acids of the N-terminal sequence of SEQ ID NO:10 at least.

12. one kind comprises each the bacterium of isolating polynucleotide of claim 1-11.

13. the bacterium of claim 12, wherein said isolating polynucleotide are included in the karyomit(e) of described bacterium.

14. the bacterium of claim 13, wherein said bacterium are bar shaped bacteria or intestinal bacteria.

15. one kind comprises each the carrier of isolating polynucleotide of claim 1-11.

16. the carrier of claim 15, wherein said carrier is a plasmid.

17. isolated bacterial, it comprises the proteinic polynucleotide that coding comprises the aminoacid sequence of SEQ ID NO:10, and wherein one or more amino acid of one or more amino acid of at least the 369-373 position and/or 241-246 position is by other gal4 amino acid displacement.

18. the isolated bacterial of claim 17, it comprises the proteinic polynucleotide of aminoacid sequence that coding comprises SEQ ID NO:10, wherein is selected from as one or more amino acid at least of next group by any other gal4 amino acid displacement: the 370th L-arginine, the 372nd L-Xie Ansuan, the 242nd L-methionine(Met), the 243rd L-L-Ala, the 244th L-L-glutamic acid and the 245th L-aspartic acid.

19. the isolated bacterial of claim 17, it comprises the proteinic polynucleotide that coding comprises the aminoacid sequence of SEQ ID NO:10, and wherein at least the 243 L-L-Ala is replaced by the L-Threonine.

20. the isolated bacterial of claim 17, it comprises a kind of proteinic polynucleotide of coding, and wherein said protein comprises the 241-246 amino acids of SEQ ID NO:22 aminoacid sequence at least.

21. the isolated bacterial of claim 17, it comprises a kind of proteinic polynucleotide of coding, and described protein comprises the 1-10 amino acids of SEQ ID NO:10 aminoacid sequence and the 241-246 amino acids of SEQ ID NO:22 aminoacid sequence at least.

22. the isolated bacterial of claim 17, it comprises a kind of polynucleotide, and described polynucleotide comprise the 308-1849 position Nucleotide of SEQ ID NO:22 nucleotide sequence.

23. the isolated bacterial of claim 17, it comprises the proteinic polynucleotide that coding comprises the aminoacid sequence of SEQ ID NO:10, and wherein at least the 245 L-aspartic acid is replaced by the L-Serine.

24. the isolated bacterial of claim 17, it comprises a kind of proteinic polynucleotide of coding, and wherein said protein comprises the 237-250 amino acids of one of SEQ ID NO:33,35 and 37 aminoacid sequences at least.

25. the isolated bacterial of claim 17, it comprises a kind of proteinic polynucleotide of coding, and described protein comprises the 237-250 amino acids of one of the 1-10 amino acids of SEQ ID NO:10 aminoacid sequence at least and SEQ ID NO:33,35 and 37 aminoacid sequences.

26. the isolated bacterial of claim 17, it comprises a kind of polynucleotide, and described polynucleotide comprise the 1-1542 position Nucleotide of one of SEQ ID NO:32,34 and 36 sequences.

27. each isolated bacterial of claim 17-26, it comprises a kind of proteinic polynucleotide of coding, and wherein said protein has the glucose-6-phosphate dehydrogenase (G6PD) activity.

28. the isolated bacterial of claim 27, wherein said glucose-6-phosphate dehydrogenase (G6PD) activity has resistance to the restraining effect of NADPH.

29. each isolated bacterial of claim 17-26, it comprises a kind of proteinic polynucleotide of coding, is removed during wherein said proteinic N-terminal methionine(Met) is processed in described bacterium.

30. each isolated bacterial of claim 17-26, wherein said bacterium is a bar shaped bacteria.

31. Corynebacterium glutamicum DM658, preserving number are DSM7431.

32. Corynebacterium glutamicum DSM5715zwf2_A243T, preserving number are DSM15237.

33. Corynebacterium glutamicum DSM1697_zwfD245S, preserving number are DSM15632.

34. one kind prepares amino acid whose method by the isolating bar shaped bacteria that ferments, and comprising:

A) the amino acid whose bacterium of fermentative production, this bacterium comprises the proteinic polynucleotide that coding comprises the aminoacid sequence of SEQ ID NO:10, and wherein one or more amino acid of one or more amino acid of at least the 369-373 position and/or 241-246 position is by other gal4 amino acid displacement; With

B) in the enrichment medium or the amino acid in the bacterial cell.

35. the method for claim 28, wherein said bacterium comprise the proteinic polynucleotide that coding comprises the aminoacid sequence of SEQ IDNO:22.

36. the method for claim 34, wherein said bacterium comprise the proteinic polynucleotide that coding comprises one of SEQ IDNO:33,35 and 37 aminoacid sequences.

37. one kind prepares amino acid whose method by fermentation of coryneform bacteria, comprises the steps:

A) the amino acid whose bacterium of fermentative production, this bacterium comprises coding and comprises aminoacid sequence proteinic isolating of SEQ ID NO:10 or the polynucleotide of reorganization, and wherein one or more amino acid of one or more amino acid of at least the 369-373 position and/or 241-246 position is by other gal4 amino acid displacement; And

B) in the enrichment medium or the amino acid in the bacterial cell.

38. the method for claim 32, wherein said isolating polynucleotide encoding comprises the protein of the aminoacid sequence of SEQID NO:22.

39. the method for claim 37, wherein said isolating polynucleotide encoding comprise the protein of one of SEQID NO:33,35 and 37 aminoacid sequences.

40. one kind prepares amino acid whose method by the isolating bar shaped bacteria that ferments, and comprising:

A) fermentation comprises a kind of amino acid whose bacterium of production of polynucleotide, and described polynucleotide encoding has the glucose-6-phosphate dehydrogenase (G6PD) activity, comprise the 241-246 amino acids of SEQ ID NO:22 at least or SEQ ID NO:33, the protein of 35 and 37 237-250 amino acids;

B) in the enrichment medium or the amino acid in the bacterial cell.

41. one kind prepares amino acid whose method by fermentation of coryneform bacteria, comprises the steps:

A) fermentation comprises a kind of amino acid whose bacterium of production of polynucleotide of separation or reorganization, and described polynucleotide encoding has the glucose-6-phosphate dehydrogenase (G6PD) activity, comprise the 241-246 amino acids of SEQ IDNO:22 at least or SEQ ID NO:33, the protein of 35 and 37 237-250 amino acids; With

B) in the enrichment medium or the amino acid in the bacterial cell.

42. each method of claim 34-41, wherein said amino acid is selected from L-Methionin, L-Threonine, L-Isoleucine and L-tryptophane.

43. each method of claim 34-42, it comprises and separates described L-amino acid.

44. each method of claim 40-41, wherein said protein further comprises the 1-10 amino acids of the N-terminal sequence of SEQ ID NO:10.

45. each method of claim 34-41 wherein is lowered extraly or is closed by activity in the born of the same parents of the pyruvic oxidase of poxB genes encoding.

46. each method of claim 34-41 wherein is lowered extraly or is closed by activity in the born of the same parents of the G-6-P isomerase of pgi genes encoding.