EP1668133A1 - Coiled-coil fusion proteins comprising cell receptor domains - Google Patents
Coiled-coil fusion proteins comprising cell receptor domainsInfo
- Publication number
- EP1668133A1 EP1668133A1 EP04761779A EP04761779A EP1668133A1 EP 1668133 A1 EP1668133 A1 EP 1668133A1 EP 04761779 A EP04761779 A EP 04761779A EP 04761779 A EP04761779 A EP 04761779A EP 1668133 A1 EP1668133 A1 EP 1668133A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- coil
- coiled
- receptor
- protein
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/04—Drugs for skeletal disorders for non-specific disorders of the connective tissue
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/73—Fusion polypeptide containing domain for protein-protein interaction containing coiled-coiled motif (leucine zippers)
Definitions
- the present invention relates in general to compositions and methods of use of a fusion protein comprised of a domain of a cell surface receptor and a peptide subunit of an ⁇ -helical coiled-coil. More specifically, the invention relates to fusion proteins comprised of a cytoplasmic domain of a receptor and a peptide subunit of an ⁇ -helical coiled-coil, and to homodimers and heterodimers of such fusion proteins.
- the invention also specifically relates to fusion proteins comprised of a protein of an ectodomain of a transforming growth factor ⁇ membrane-bound receptor and a peptide subunit of an ⁇ -helical coiled-coil, and to homodimers and heterodimers of such fusion proteins.
- TGF- ⁇ mature transforming growth factor- ⁇
- TGF- ⁇ mediates signaling by binding to and complexing three types of cell surface receptors known as the TGF- ⁇ type I (T ⁇ RI), type II (T ⁇ RII) and type III (T ⁇ RIII) receptors (Massague, J., Annu. Rev. Biochem. 67:753-791 (1998)).
- T ⁇ RI TGF- ⁇ type I
- T ⁇ RII type II
- T ⁇ RIII type III receptors
- TGF- ⁇ 1 , - ⁇ 2 and - ⁇ 3 TGF- ⁇ isoforms
- the TGF- ⁇ 1 and TGF- ⁇ 3 ligand isoforms which have a high affinity for the type II receptor extracellular domain, promote the formation of a signaling competent complex by simultaneously binding to two type II receptor extracellular domains (Letourneur, O. et al., Biochem. Biophys. Res.
- the signal is then translocated to the nucleus by a cascade of events involving primarily members of the Smad family (Attisano, L. and Wrana, J. L, Cytokine Growth Factor Rev. 7:327-339 (1996); Attisano, L. and Wrana, J. L, Curr. Opin. Cell Biol. 10:188-194 (1998); Massague, J. , Nat. Rev. Mol. Cell Biol. 1 : 169-178 (2000)).
- T ⁇ RIII is generally thought to be an 'accessory' receptor whose role is to present ligand to the signaling receptors (Lopez-Casillas, F. et al., Cell 73:1435- 1444 (1993)).
- the idea that there is a need for this type of 'accessory' receptor is supported by the fact that the affinity of the TGF- ⁇ 2 isoform for T ⁇ RII is low relative to the other mammalian isoforms (Cheifetz, S. et al., Cell 48:409-415 (1987); Cheifetz, S., et al. J. Biol. Chem. 265:20533-20538 (1990); Segarini, P. R.
- T ⁇ RIII cytoplasmic domain can be phosphorylated by, and interact with, T ⁇ RII and that this interaction is necessary for the promotion of signaling (Blobe, G. C. ef al., J. Biol. Chem. 276:24627-24637 (2001)).
- T ⁇ RIII inhibits TGF- ⁇ signaling by preventing T ⁇ RI-T ⁇ RII complex formation (Eickelberg, O. etal., J. Biol. Chem. 277:823-829 (2002)).
- T ⁇ RIII is found at the cell surface in a form containing glycosaminoglycan sulfate chains, which makes it electrophoretically heterogeneous (Lopez-Casillas, F. et al., Cell 67:785-795 (1991)).
- Two independent TGF- ⁇ binding domains were identified within the T ⁇ RIII ectodomain by mutational analysis (Fukushima, D. et al., J. Biol. Chem.
- TGF- ⁇ overexpression has been shown to play a key role in several human disorders including fibrotic diseases which are characterized by an abnormal accumulation of extracellular matrix (Border, W. A. and Noble, N. A., Am. J. Kidney Dis.
- TGF- ⁇ appears to play a significant role as a tumor suppressor since mutations or deletions in the genes for Smad signaling proteins and T ⁇ RII are observed in human tumors (Massague, J. et al., Cell 103:295-309 (2000)).
- TGF- ⁇ promotes metastasis (Wakefield, L. M. and Roberts, A. B., Curr. Opin. Genet. Dev. 12:22-29 (2002)).
- TGF- ⁇ receptors or domains of these receptors, in their biologically-active form suitable for use as a therapeutic agent, or for use in screening and diagnostic assays. More generally, it would be desirable to provide a receptor domain of any selected protein in soluble form and in a biologically active conformation for use as a therapeutic agent and for use in various screening and diagnostic assays, and preferably in a cell free assay.
- the invention provides a fusion protein, comprising all or a portion of an extracellular domain of a cell surface receptor for transforming growth factor- ⁇ and a peptide subunit of an ⁇ -helical coiled-coil.
- the fusion protein in one embodiment, contains a K coil or an E coil peptide subunit having between 3-10 heptad repeat units.
- the heptad repeat in another embodiment, has a sequence selected from the group of sequences identified as SEQ ID NOs:11-17.
- the peptide subunit has a sequence identified herein as SEQ ID NO:8 (K5) or as SEQ ID NO:5 (E5).
- the extracellular domain is from a cell surface receptor selected from the group consisting of receptors for transforming growth factor- ⁇ type II and transforming growth factor- ⁇ type III.
- the fusion protein in some embodiments, is bound to a second fusion protein to form a coiled-coil dimer, where the second fusion protein is comprised of an extracellular domain of a transforming growth factor- ⁇ receptor and a second peptide subunit of the ⁇ -helical coiled-coil.
- the invention includes a polynucleotide comprising a nucleotide sequence encoding the fusion protein described above.
- the invention contemplates a vector comprising the polynucleotide encoding for the fusion protein.
- the invention includes a coiled-coil dimer protein, comprised of (1) a first extracellular domain of all or a portion of a cell surface receptor for transforming growth factor- ⁇ and a first peptide subunit of an ⁇ -helical coiled-coil, and (2) either (i) the first extracellular domain and a second peptide subunit of the ⁇ -helical coiled-coil, or (ii) a second extracellular domain of all or a portion of a cell surface receptor for transforming growth factor- ⁇ and a second peptide subunit of the ⁇ -helical coiled-coil.
- the coiled-coil protein is a homodimer by virtue of being comprised of a first extracellular domain joined to the first and the second peptide subunits.
- the coiled-coil protein is a heterodimer by virtue of being comprised of a first extracellular domain and of a second extracellular domain joined respectively to first and second peptide subunits, the first and second extracellular domains being different.
- the extracellular domain is a cell surface receptor selected from the group consisting of transforming growth factor- ⁇ type II receptor and transforming growth factor- ⁇ type III receptor.
- the first peptide subunit of the ⁇ -helical coiled-coil in another embodiment, has a sequence identified herein as SEQ ID NO:8 (K5).
- the second peptide subunit of the ⁇ -helical coiled-coil can have a sequence identified herein as SEQ ID NO:5 (E5).
- the invention includes the use of the fusion protein described above as a biopharmaceutical agent for treatment of a condition characterized by TGF- ⁇ binding to a TGF- ⁇ receptor.
- the invention also includes a method for selecting a compound capable of inhibiting binding activity.
- the method is comprised of preparing a coiled-coil protein comprised of (i) all or a portion of an extracellular domain of a TGF- ⁇ receptor and a first peptide subunit of an ⁇ -helical coiled-coil; and (ii) an extracellular domain of (a) the same TGF- ⁇ receptor or of (b) a different
- TGF- ⁇ receptor and a second peptide subunit of the ⁇ -helical coiled-coil incubating the coiled-coil protein with a test compound in the presence of a ligand for the first or second receptor extracellular domain; and measuring the ability of the test compound to inhibit interaction between the ligand and the coiled-coil protein.
- the method includes preparing a coiled-coil protein comprised of an extracellular domain of a transforming growth factor- ⁇ receptor selected from the group consisting of transforming growth factor- ⁇ type II and transforming growth factor- ⁇ type III.
- the method includes preparing a coiled-coil protein comprised of an extracellular domain of a transforming growth factor- ⁇ receptor type II joined to the first peptide subunit and the second peptide subunit of the ⁇ -helical coiled-coil, to form a coiled-coil homodimer.
- the method includes preparing a coiled-coil protein comprised of an extracellular domain of a transforming growth factor- ⁇ receptor type II and of an extracellular domain of a transforming growth factor- ⁇ receptor type III to form a coiled-coil heterodimer.
- the measuring step can include measuring by a competitive binding assay or by surface plasmon resonance.
- a method for treating a condition characterized by an overexpression of TGF- ⁇ is provided.
- the method comprises administering a coiled-coil protein capable of inhibiting TGF- ⁇ signaling, where the coiled-coil protein is comprised of (i) an extracellular domain of a TGF- ⁇ receptor and a first peptide subunit of an ⁇ -helical coiled-coil; and (ii) an extracellular domain of (a) the same TGF- ⁇ receptor or (b) a different TGF- ⁇ receptor, and a second peptide subunit of the ⁇ -helical coiled-coil.
- Conditions to be treated by the method include, but are not limited to a tissue fibroproliferative disorder, progressive glomerular disease of the kidney, acute respiratory distress syndrome, cirrhosis of the liver, diabetic nephropathy, human mesangial proliferative glomerulonephritis, or tumor metastasis.
- the invention also includes, in another aspect, a fusion protein comprising a cytoplasmic domain derived from a cell surface receptor for transforming growth factor- ⁇ and a peptide subunit of an ⁇ -helical coiled-coil.
- the peptide subunit of the fusion protein is selected from K5 and E5.
- the peptide subunit can have a sequence identified herein as SEQ ID NO:8 (K5) or as SEQ ID NO:5 (E5).
- the receptor is selected from the group consisting of transforming growth factor- ⁇ type I and transforming growth factor- ⁇ type II.
- the fusion protein is bound to a second fusion protein to form a coiled-coil dimer, the second fusion protein comprised of an cytoplasmic domain of a transforming growth factor- ⁇ membrane-bound receptor and a second peptide subunit of the ⁇ -helical coiled-coil.
- the invention in another aspect, includes a polynucleotide comprising a nucleotide sequence encoding the fusion protein as well as a vector comprising the polynucleotide.
- a coiled-coil dimer protein comprising all or a portion of a first cytoplasmic domain of a cell surface receptor for transforming growth factor- ⁇ and a first peptide subunit of an ⁇ -helical coiled-coil, and (i) the first cytoplasmic domain and a second peptide subunit of the ⁇ -helical coiled-coil or (ii) a second cytoplasmic domain derived from a cell surface receptor for transforming growth factor- ⁇ , and a second peptide subunit of the ⁇ -helical coiled-coil.
- the coiled-coil protein is a homodimer by virtue of being comprised of a first cytoplasmic domain joined to the first and second peptide subunits.
- the coiled-coil protein is a heterodimer by virtue of being comprised of first and second cytoplasmic domains, which are different, joined to the first and the second peptide subunits, respectively.
- the receptor in the coiled-coil protein is selected from the group consisting of transforming growth factor- ⁇ type I and transforming growth factor- ⁇ type II.
- the first peptide subunit of the ⁇ -helical coiled-coil has a sequence identified herein as SEQ ID NO:8 (K5), in one embodiment.
- the second peptide subunit of the ⁇ -helical coiled-coil has a sequence identified herein as SEQ ID NO:5 (E5), in one embodiment.
- the invention provides a method for selecting a compound capable of inhibiting kinase activity.
- the method involves preparing a coiled-coil protein comprised of (i) a cytoplasmic domain of a TGF- ⁇ receptor and a first peptide subunit of an ⁇ -helical coiled-coil; and (ii) a cytoplasmic domain of (a) the same TGF- ⁇ receptor or (b) a different TGF- ⁇ receptor, and a second peptide subunit of the ⁇ -helical coiled-coil.
- the coiled-coil protein is incubated with a test compound; and the ability of the test compound to inhibit receptor cross phosphorylation is determined, as measured by a suitable technique for detecting the level of phosphorylation, such as 33 P-ATP or mass spectrometry.
- the method includes preparing a coiled-coil protein comprised of a cytoplasmic domain of a transforming growth factor- ⁇ receptor selected from the group consisting of transforming growth factor- ⁇ type I and transforming growth factor- ⁇ type II.
- the method includes preparing a coiled-coil protein comprised of a cytoplasmic domain of a transforming growth factor- ⁇ receptor type I joined to the first peptide subunit and to the second peptide subunit of the ⁇ -helical coiled-coil, to form a coiled-coil homodimer.
- the method includes preparing a coiled-coil protein comprised of a cytoplasmic domain of a transforming growth facfor- ⁇ receptor type II joined to the first peptide subunit and to the second peptide subunit of the ⁇ -helical coiled-coil, to form a coiled-coil homodimer.
- coiled-coil protein is comprised of a cytoplasmic domain of a transforming growth factor- ⁇ receptor type
- Fig. 1 A shows the amino acid sequence of a fusion protein comprised of an ectodomain of transforming growth factor- ⁇ receptor type II (T ⁇ RllED) and an E5 coil (T ⁇ RIIED-E5; SEQ ID NO:1) , where residues 1 to 26 correspond to residues 1 to 26 of the T ⁇ RII sequence (SEQ ID NO:2) according to the numbering used in the Swiss-Protein database (accession number: P37173); T ⁇ RIIED-E5 residues 27 to 36 (underlined) correspond to a myc tag (SEQ ID NO: 3); T ⁇ RIIED- E5 residues 37 to 170 correspond to residues 27 to 160 of the T ⁇ RII sequence in the Swiss-Protein database; residues 171 to 181 (underlined) correspond to an 11 amino-acid linker (SEQ ID NO:4); residues 182 to 216 correspond to the E5 coil (SEQ ID NO:5); and residues 217 to
- Fig. 1 B shows the amino-acid sequence of a fusion protein comprised of an ectodomain of transforming growth factor- ⁇ receptor type II (T ⁇ RllED) and a K5 coil (T ⁇ RIIED-K5; SEQ ID NO: 7).
- Residues 1 to 26 correspond to residues 1 to 26 of the T ⁇ RII sequence (SEQ ID NO:2) according to the numbering used in the Swiss-Protein database (accession number: P37173); T ⁇ RIIED-K5 residues 27 to 36 (underlined) correspond to a myc tag (SEQ ID NO:3); T ⁇ RIIED-K5 residues 37 to 170 correspond to residues 27 to 160 of the T ⁇ RII sequence in the Swiss- Protein database; residues 171 to 181 (underlined) correspond to an 11 amino- acid linker (SEQ ID NO:4); residues 182 to 216 correspond to the K5 coil (SEQ ID NO: 3) and residues 217 to 224 correspond to the His tag (underlined) separated from the K5 coil sequence by two glycines (SEQ ID NO:6).
- Fig. 1C shows the amino-acid sequence of a fusion protein comprised of the membrane proximal region of the ectodomain of transforming growth factor- ⁇ receptor type II (MP-T ⁇ RIIED) and an K5 coil (MP-T ⁇ RIIED-K5; SEQ ID NO: 9).
- Residues 1 to 25 correspond to residues 1 to 25 of the rat T ⁇ RIII sequence (SEQ ID NO:10) according to the numbering used in the Swiss-Protein database (accession number: P26342); MP-T ⁇ RIIIED-K5 residues 26 to 35 (underlined) correspond to a myc tag (SEQ ID NO:3); MP-T ⁇ RIIIED-K5 residues 36 to 242 correspond to residues 576 to 782 of the rat T ⁇ RIII sequence in the Swiss-Protein database; residues 243 to 253 (underlined) correspond to an 11 amino-acid linker (SEQ ID NO:4); residues 254 to 288 correspond to the K5 coil (SEQ ID NO: 3); and residues 291 to 296 correspond to the His tag (underlined) separated from the K5 coil sequence by two glycines (SEQ ID NO:6).
- Figs. 2A-2B show the purification of T ⁇ RIIED-E5 fusion protein (SEQ ID NO:1) using standard Ni-NTA affinity chromatography.
- Fig. 2A shows the Coomassie Blue staining of various fractions collected during the purification of T ⁇ RIIED-E5 after resolving the proteins on a 4-12% gradient gel (reducing conditions).
- Lanes W1 and W2 correspond to the two first buffer A wash steps; Lane FT corresponds to the flow through after the last column loading; Lane 1 corresponds to the 1 st elution.
- Lane 1 corresponds to the 1 st elution (the same sample as in Lane 1 of Fig. 2A) and lanes 2 and 3 correspond to the 2 nd and 3 rd elutions, respectively.
- Figs. 3A-3G show the purification of T ⁇ RIIED-K5 (SEQ ID NO:7) and MP-T ⁇ RIIIED-K5 (SEQ ID NO: 9).
- T ⁇ RIIED-K5 protein was eluted from a Ni-NTA affinity chromatography column and was run on 11% SDS-PAGE under non- reducing (Fig. 3A) and reducing conditions (Fig. 3B and Fig. 3C) followed by Western blotting (Fig. 3A and Fig. 3B; primary and secondary antibody as in Fig. 2) or silver staining (Fig. 3C).
- Figs. 4A-4C are sensorgrams generated from a surface plasmon resonance (SPR) biosensor study showing dimerization, in arbitrary resonance units (RU), as a function of time.
- SPR surface plasmon resonance
- Fig. 4A MP-T ⁇ RIIIED-K5 (SEQ ID NO:9) was injected over the anti TGF- ⁇ RII antibody-loaded biosensor surface ("1") and a control surface, followed by a T ⁇ RIIED-E5 (SEQ ID NO:1 ) injection (“2”) and another MP-T ⁇ RIIIED-K5 ("3").
- SPR surface plasmon resonance
- Figs. 5A-5F show results of kinetic analysis of the T ⁇ RIIED-K5 binding interaction with TGF- ⁇ 1 (Figs. 5A-5C) and of the T ⁇ RIIED-K5 /T ⁇ RIIED-E5 binding interaction with TGF- ⁇ 1 (Fig. 5D-5F).
- the plots are sensorgrams generated from a surface plasmon resonance biosensor with the TGF- ⁇ 1 coupled to the sensor surface. The extent of interaction is shown in arbitrary resonance units (RU) as a function of time.
- RU resonance units
- FIG. 5A is a global fit of the T ⁇ RIIED-K5/TGF- ⁇ 1 interaction sensorgrams, where different concentrations of T ⁇ RIIED-K5 ranging from 9.9 to 50 nM (in addition to buffer injection) were injected over 250 RUs of coupled TGF- ⁇ 1 and over a control surface.
- the points correspond to the resonance units after data preparation and the solid lines represent the fit when globally fitting the data set with a two-to-one stoichiometry model.
- Fig. 5B shows the residuals from the global fit of the T ⁇ RIIED-K5/TGF- ⁇ 1 interaction with the two-to-one stoichiometry model.
- FIG. 5C shows the residuals from the global fit of the T ⁇ RIIED-K5/TGF- ⁇ 1 interaction with a simple one-to-one model.
- Fig. 5D is a global fit of the sensorgrams of the interaction of T ⁇ RIIED-K5/ T ⁇ RIIED-E5 with TGF- ⁇ 1 , where different concentrations of T ⁇ RIIED-K5, preincubated with the same amount of T ⁇ RllED-E5, ranging from 9.9 to 50 nM were injected over the same TGF- ⁇ 1 surface and over a control surface.
- the points are the resonance units obtained after data preparation and the solid lines represent the fit when globally fitting the data set with a rearrangement model.
- Figs. 6A-6D are biosensor sensorgrams showing binding interactions between TGF- ⁇ 1 and MP-T ⁇ RIIIED-K5 or MP-T ⁇ RIIIED-K5 preincubated with equimolar concentration of T ⁇ RIIED-E5.
- FIG. 6A shows the arbitrary resonance units (RUs) as a function of time for different concentrations of MP-T ⁇ RIIIED-K5 (SEQ ID NO:9).
- Figs. 6B-6C show the residuals from the global fit of the MP- T ⁇ RIIED-K5 coil/TGF- ⁇ 1 interaction with the rearrangement model (Fig. 6B) and the simple one-to-one model (Fig. 6C).
- Fig. 6D shows the RUs as a function of time for different concentrations of MP-T ⁇ RIIIED-K5 preincubated with the same amount of T ⁇ RIIED-E5.
- Fig. 7 is a biosensor sensorgram showing binding interactions, in arbitrary resonance units (RUs) as a function of time, of (1 ) T ⁇ RIIED-E5 binding to TGF- ⁇ 1; and of T ⁇ RIIED-E5 binding to TGF- ⁇ 1 after preincubation of T ⁇ RIIED-E5 with (2) 50 nM K5ox; (3) 150 nM K5ox; or (4) 900 nM of K5ox. [0047] Fig.
- Fig. 8A shows the relative luciferase activity, in percent, as a function of antagonist concentration (nM) for the fusion protein antagonists T ⁇ RIIED-K5 (open diamonds) and T ⁇ RIIED-E5 (open triangles), and for the antagonist homodimer T ⁇ RIIED-K5/T ⁇ RIIED-E5 (equimolar mixture, filled squares).
- Fig. 8B shows the percent relative luciferase activity as a function of K5ox concentration, in nM, for K5ox alone (open squares) and forT ⁇ RIIED-E5 at 150 nM with K5ox (filled squares).
- Fig. 8C shows the percent relative luciferase activity for K5ox at 150 nM with various concentrations of T ⁇ RIIED-E5.
- Fig. 8D shows the percent relative luciferase activity for MP-T ⁇ RIIIED- K5 (open squares) and for MP-T ⁇ RIIIED-K5/T ⁇ RIIED-E5 equimolar mixtures (filled squares) at various concentrations.
- Fig. 8E shows the percent relative luciferase activity for MP-T ⁇ RIIIED- K5 at 150 nM with various concentrations of T ⁇ RIIED-E5.
- Fig. 8D shows the percent relative luciferase activity for MP-T ⁇ RIIIED- K5 (open squares) and for MP-T ⁇ RIIIED-K5/T ⁇ RIIED-E5 equimolar mixtures (filled squares) at various concentrations.
- Fig. 8E shows the percent relative luciferase activity for MP-T ⁇ RIIIED- K5 at 150 nM with various concentrations of T ⁇ RIIED-E5.
- FIG. 9 is an SDS-PAGE gel electrophoresis of the kinase domains of TGF- ⁇ receptor I or receptor II tagged with a peptide subunit (K5 or E5) of a coiled- coil polypeptide, where Lane 1 is TGF- ⁇ receptor I joined with K5 peptide subunit; Lane 2 is TGF- ⁇ receptor II tagged with the E5 peptide subunit; Lane 3 is a mixture of TGF- ⁇ receptor I-K5 and TGF- ⁇ receptor II-E5; and Lane 4 is a sample of co-expressed TGF- ⁇ receptor I-K5 and TGF- ⁇ receptor II-E5. [0053] Fig.
- erbBI CD-K5 residues 1 to 6 correspond to a 6 amino-acid linker (SEQ ID NO:32); erbBI CD-K5 residues 7 to 41 correspond to the K5 coil (SEQ ID NO:8); erbBI CD-K5 residues 42 to 48 (underlined) correspond to 7 amino-acid linker (SEQ ID NO:33); erbBI CD-K5 residues 49 to 590 correspond to residues 669 to 1210 comprising the cytoplasmic domain of the human erbBI sequence according to the numbering used in the Swiss Protein database (accession number: P00533); erbBI CD-K5 residues 591 to 596 (underlined) correspond to a 6 amino-acid His tag peptide sequence.
- Fig. 10B shows the amino acid sequence of the erbBI cytoplasmic domain - E5 (erbBI Cd-E5) fusion protein (SEQ ID NO:34).
- erbBI CD-E5 residues 1 to 6 correspond to a 6 amino-acid linker (SEQ ID NO:32);
- erbBI CD- E5 residues 7 to 41 correspond to the E5 coil (SEQ ID NO:5);
- erbBI CD-E5 residues 42 to 48 correspond to 7 amino-acid linker (SEQ ID NO:33);
- erbBI CD-E5 residues 49 to 590 correspond to residues 669 to 1210 comprising the cytoplasmic domain of the human erbBI sequence according to the numbering used in the Swiss Protein database (accession number: P00533);
- erbBI CD-E5 residues 591 to 596 correspond to a 6 amino-acid His tag peptide sequence.
- Figs. 10C-10D are Western blots of SDS-PAGE gels showing the results of AG1478 inhibitor assays on human embryonic kidney 293 cells transfected with different erbBI (EGFR) constructs: Lanes 1-2: erbBI kinase domain without (Lane 1, control) and with (Lane 2) inhibitor AG1478; Lanes 3-4: erbBI -K5/erbB1- E5 coiled coil dimer without (Lane 3, control) and with (Lane 4) inhibitor; Lanes 5- 6: full-length erbBI (positive control) without (Lane 5) and with (Lane 6) inhibitor.
- EGFR erbBI
- SEQ ID NO:1 is the amino acid sequence of the fusion protein shown in Fig. 1A, which is comprised of the myc tagged extracellular domain of TGF- ⁇ receptor II (T ⁇ RllED, SEQ ID NO:2) joined by a linker (SEQ ID NO:4) to a E coil subunit (SEQ ID NO:5) and a C-terminal His tag plus two glycines (SEQ ID NO:6).
- SEQ ID NO:2 is the amino acid sequence of the extracellular domain of TGF- ⁇ receptor II, including a myc tag sequence (underlined, SEQ ID NO:3).
- SEQ ID NO:3 is the amino acid sequence of the myc tag included in SEQ ID No. 1 , 7, and 9.
- SEQ ID NO:4 is the amino acid sequence of the linker between the extracellular domain of TGF- ⁇ receptor II and the coiled-coil subunit.
- SEQ ID NO:5 is the amino acid sequence of an E coil subunit of a coiled-coil heterodimer, formed of five heptad repeat units.
- SEQ ID NO:6 is the amino acid sequence of the histidine tag plus two glycines.
- SEQ ID NO:7 is the amino acid sequence of the fusion protein shown in Fig. 1B, comprised of the myc tagged extracellular domain of TGF- ⁇ receptor II (T ⁇ RllED, SEQ ID NO:2) joined by a linker (SEQ ID NO:4) to a K coil subunit (SEQ ID NO:8) and a C-terminal His tag plus two glycines (SEQ ID NO:6).
- SEQ ID NO:8 is the amino acid sequence of a K coil subunit of the coiled-coil heterodimer, formed of five heptad repeat units.
- SEQ ID NO:9 is the amino acid sequence of the fusion protein shown in Fig.
- 1C comprised of the myc tagged membrane proximal domain of the extracellular domain of TGF- ⁇ receptor III (SEQ ID NO:10) joined by a linker (SEQ ID NO:4) to a K coil subunit (SEQ ID NO:8) and a C-terminal His tag plus two glycines (SEQ ID NO:6).
- SEQ ID NO:10 is the amino acid sequence of the membrane proximal domain of the extracellular domain of TGF- ⁇ receptor III (MP-T ⁇ RIIIED), including a myc tag (underlined).
- SEQ ID NO:11 is the amino acid sequence of the heptad repeat used in the E coil subunit of SEQ ID NO:5.
- SEQ ID NO:12 is an amino acid sequence of a heptad repeat for use in an E coil subunit of a coiled-coil dimer.
- SEQ ID NO: 13 is an amino acid sequence of a heptad repeat for use in an E coil subunit of a coiled-coil dimer.
- SEQ ID NO:14 is an amino acid sequence of a heptad repeat for use in an E coil subunit of a coiled-coil dimer.
- SEQ ID NO: 15 is the amino acid sequence of the heptad repeat used in the K coil subunit of SEQ ID NO:8.
- SEQ ID NO:16 is an amino acid sequence of a heptad repeat for use in a K coil subunit of a coiled-coil dimer.
- SEQ ID NO: 17 is an amino acid sequence of a heptad repeat for use in an E coil subunit of a coiled-coil dimer.
- SEQ ID NO:18 is an E coil subunit peptide having 5 heptad units.
- SEQ ID NO: 19 is a K coil subunit peptide having 5 heptad units.
- SEQ ID NO:20 is the amino acid sequence of the K coil subunit of the coiled-coil heterodimer with additional Cys and Gly residues at the N-terminus.
- SEQ ID NO:21 is the amino acid sequence of the fusion protein comprised of the cytoplasmic domain of the TGF- ⁇ receptor II joined by glycine linkers to an E coil subunit (SEQ ID NO:5)
- SEQ ID NO:22 is the amino acid sequence of the fusion protein comprised of the cytoplasmic domain of the rat TGF- ⁇ receptor I joined by glycine linkers to a K coil subunit (SEQ ID NO:8).
- SEQ ID NO:23 is nucleic acid primer for amplification of the cDNA encoding for K5 coil (SEQ ID NO:8).
- SEQ ID NO:24 is nucleic acid primer for amplification of the cDNA encoding for K5 coil (SEQ ID NO:8).
- SEQ ID NO:25 is nucleic acid primer for amplification of the cDNA encoding for MP-T ⁇ RIIIED.
- SEQ ID NO:26 is nucleic acid primer for amplification of the cDNA encoding for MP-T ⁇ RIIIED.
- SEQ ID NO:27 is nucleic acid primer for amplification of the cDNA encoding for TGF ⁇ type II receptor kinase domain.
- SEQ ID NO:28 is nucleic acid primer for amplification of the cDNA encoding for TGF ⁇ type II receptor kinase domain.
- SEQ ID NO:29 is nucleic acid primer for amplification of the cDNA encoding for TGF ⁇ type I receptor kinase domain.
- SEQ ID NO:30 is nucleic acid primer for amplification of the cDNA encoding for TGF ⁇ type I receptor kinase domain.
- SEQ ID NO:31 is the amino acid sequence of the erbBI CD-K5 fusion protein shown in Fig. 10A and comprised of a 6 amino-acid linker (SEQ ID NO:32); a K5 coil (SEQ ID NO:8); a 7 amino-acid linker (SEQ ID NO:33), and residues 669-1210 of human erbBI sequence (Accession number: P00533) followed by 6 histidine residues.
- SEQ ID NO:32 is the amino acid sequence of a linker at the N-terminus of the cytoplasmic domain of erbBI .
- SEQ ID NO:33 the amino acid sequence of a linker between the coiled- coil subunit and the cytoplasmic domain of erbBI .
- SEQ ID NO:34 is the amino acid sequence of the erbBI CD-E5 fusion protein shown in Fig. 10B and comprised of a 6 amino-acid linker (SEQ ID NO:32); an E5 coil (SEQ ID NO:5); a 7 amino-acid linker (SEQ ID NO:33), and residues 669-1210 of human erbBI sequence (Accession number: P00533) followed by 6 histidine residues.
- SEQ ID NO:35 is the nucleic acid primer to amplify cDNA encoding erbBI cytoplasmic domain.
- SEQ ID NO:36 is the nucleic acid primer used to amplify cDNA encoding erbBI cytoplasmic domain with attached C-terminal 6xHis tag sequence.
- SEQ ID NO:37 is the nucleic acid primer used to amplify cDNA encoding erbBI cytoplasmic domains.
- Peptide and “polypeptide” are used interchangeably herein and refer to a compound made up of a chain of amino acid residues linked by peptide bonds.
- sequence for peptides is given in the order from the amino termiums to the carboxyl terminus.
- extracellular domain arid “ectodomain” are used interchangeably and are abbreviated “ED.”
- cytoplasmic domain and "kinase domain” are used interchangably.
- T ⁇ RllED refers to the extracellular domain of the cell surface TGF- ⁇ type II receptor.
- MP-T ⁇ RIIIED refers to the membrane-proximal domain (i.e., C- terminal) of TGF- ⁇ type III receptor ectodomain.
- EGFR refers to a receptor for epidermal growth factor, including erbBI , erbB2, erbB3, erbB4.
- SPR refers to surface plasmon resonance
- RU refers to resonance unit.
- the invention relates to a fusion protein comprised of an ectodomain of a membrane-bound receptor attached to a peptide subunit of an ⁇ - helical coiled-coil.
- a fusion protein comprised of the ectodomain from the TGF- ⁇ type II receptor (T ⁇ RllED) and a K5 coil or an E5 coil of an E5/K5 coiled-coil.
- the second model is a fusion protein comprised of the membrane-proximal domain (i.e., C-terminal) of the TGF- ⁇ type 111 receptor ectodomain (MP-T ⁇ RIIIED) fused to a K5 coil.
- These fusion proteins were characterized in terms of kinetics of binding to TGF- ⁇ 1 using a surface plasmon resonance (SPR)-based biosensor.
- SPR surface plasmon resonance
- the ability of the fusion proteins tagged with an E5 coil to dimerize with a fusion protein tagged with a K5 coil was studied, and is described below. Binding of the coiled-coil induced homodimeric and heterodimeric receptor ectodomains to TGF- ⁇ 1 and their ability to inhibit TGF- ⁇ 1 signaling in vitro was studied, and is described below.
- Figs. 1 A-1 C show the amino acid sequences of the exemplary fusion proteins designed and expressed for the invention described herein.
- Fig. 1A shows a fusion protein referred to as T ⁇ RIIED-E5 and identified herein as SEQ ID NO:1.
- This fusion protein is comprised of the myc-tagged extracellular domain of TGF- ⁇ receptor type II (SEQ ID NO:2) joined via a linker (SEQ ID NO:4) to an E coil formed of five heptad repeat units (SEQ ID NO:5; amino acid residues 182-216 of the sequence in Fig. 1 A) of a coiled-coil dimer, described below.
- T ⁇ RIIED-K5 shows a second exemplary fusion protein, referred to herein as T ⁇ RIIED-K5 and identified as SEQ ID NO:7.
- This fusion protein is comprised of the myc-tagged extracellular domain of TGF- ⁇ receptor type II (SEQ ID NO:2) joined via a linker (SEQ ID NO:4) to a K coil formed of five heptad repeat units (SEQ ID NO:8) of a coiled-coil dimer.
- FIG. 1C shows a third exemplary fusion protein referred to herein as MP- T ⁇ RIIIED-K5 and identified as SEQ ID NO:9.
- MP-T ⁇ RIIIED is comprised of the myc-tagged membrane proximal domain of the extracellular domain of TGF- ⁇ receptor type III (SEQ ID NO:10) joined via a linker (SEQ ID NO:4) to a K coil (SEQ ID NO:8) of a coiled-coil dimer.
- fusion proteins shown in Figs. 1 A-1 C were N- terminally myc-tagged (SEQ ID NO:3) for detection, and C-terminaliy His tagged (SEQ ID NO:6) for purification.
- the coiled-coil peptides used in construction of the fusion proteins and the peptide dimers described herein are comprised of a first coil-forming peptide, also referred to herein as a first peptide subunit, and second coil-forming peptide, also referred to herein as a second peptide subunit.
- the two coils assemble into a heterodimer coiled-coil (coiled-coil heterodimer) in either parallel or antiparallel configurations.
- the two heterodimer-subunit peptide helices are aligned such that they have the same orientation (amino-terminal to carboxyl terminal).
- the two heterodimer-subunit peptide helices are arranged such that the amino-terminal end of one helix is aligned with the carboxyl-terminal end of the other helix, and vice versa.
- Exemplary heterodimer subunits are described in PCT patent application WO 95/31480 entitled “Heterodimer Polypeptide Immunogen Carrier Composition and Method", publication date 23 November 1995, which is incorporated herein by reference in its entirety.
- Heterodimer-subunit peptides designed in accordance with the guidance presented in WO 95/31480 typically show a preference for assembling in a parallel orientation versus an antiparallel orientation.
- the first and second peptide subunits of the coiled-coil heterodimer are also referred to herein as a "K-coil" ("K”), referring to positively charged subunits whose charge is provided dominantly by lysine residues, and an E-coil (“E”), referring to negatively charged subunits whose charge is provided dominantly by glutamic acid residues.
- K K-coil
- E E-coil
- the K coil and the E coil are typically comprised of seven amino acid residues, referred to as a heptad unit, that is repeated a selected number of times.
- the peptide subunits of the coiled-coil peptide are generally of similar size, and typically are the same size, each ranging from about 21 to about 70 residues (3-10 heptads) in length.
- Exemplary SEQ ID NO:5 is comprised of 5 heptad repeats, hence is referred to herein as "E5.” However, it will be appreciated that fewer or more repeats can be used.
- SEQ ID NO:8 the K coil subunit, is comprised of five heptad repeats, and is referred to herein as "K5", however 3-10 heptad units are considered suitable for formation of the coil. [0110] The .
- the heptad unit for formation of the E5 coil identified as SEQ ID NO:5 is comprised of the following amino acid residues: EVSALEK (SEQ ID NO:11).
- Other heptad units for the E coil include EVSALEC (SEQ ID NO:12), EVSALEK (SEQ ID NO:13), EVEALQK (SEQ ID NO:14).
- exemplary heptad units include KVSALKE (SEQ ID NO: 15), KVSALKC (SEQ ID NO:16), and KVEALKK (SEQ ID NO:17).
- an E coil or a K coil subunit In constructing an E coil or a K coil subunit, a single heptad unit can be repeated to form a subunit of a desired length.
- the E5 coil subunit identified as SEQ ID NO:5 is based on the heptad unit EVSALEK (SEQ ID NO:11 ) repeated five times.
- An E coil or a K coil can also be constructed from two or more different heptad units to obtain a coil of a desired length.
- an E5 coil subunit comprised of the heptad units identified as SEQ ID NOS:11, 12, and 14 is identified herein as SEQ ID NO:18.
- SEQ ID NO: 18 corresponds to a K5 coil subunit, where the 5 heptad units are arranged so that the two terminal heptad units are represented as SEQ ID NO:17, with the intermediate units having sequences represented by SEQ ID NO: 15 and SEQ ID NO:16.
- the sequence represented by SEQ ID NO:16 includes a cysteine coupling residue.
- T ⁇ RIIED-E5 SEQ ID NO:1
- T ⁇ RIIED-K5 SEQ ID NO:7
- MP-T ⁇ RIIIED-K5 SEQ ID NO:9
- the proteins were expressed by transiently transfected HEK 293SF cells using polyethylenimine (PEI) as a transfection vehicle.
- PEI polyethylenimine
- the fusion proteins were purified from the cell culture medium by affinity column chromatography, also as described in Example 1.
- FIG. 2A-2B shows the purification of T ⁇ RIIED-E5 protein by standard Ni-NTA affinity chromatography.
- Fig. 2A shows the Coomassie Blue staining of various fractions collected during purification of T ⁇ RIIED-E5 after resolving the proteins on a 4-12% gradient gel (reducing conditions). Lanes W1 and W2 correspond to two wash steps; Lane FT corresponds to the flow through, Lane 1 corresponds to the elution with imidazole.
- Fig. 2B shows Western blotting of various fractions collected during purification after resolving the proteins on 11% SDS-PAGE (non-reducing conditions) using an anti-myc antibody as primary antibody and horseradish peroxidase conjugated goat anti-mouse antibody as a secondary antibody.
- Lane 1 corresponds to the imidazole elution shown in lane 1 of Fig. 2A.
- Lanes 2 and 3 correspond to two other imidazole elutions from similar purifications.
- Figs. 3A-3G show the purification of T ⁇ RIIED-K5 and MP-T ⁇ RIIIED-K5.
- the analyte solution is then replaced by buffer and the dissociation of the surface complexes is recorded (the wash-off phase). If needed, the surface is regenerated, i.e. the analyte remaining at the biosensor surface is eluted. This series of steps constitutes a sensorgram.
- Example 2 describes the studies performed using the T ⁇ RIIED-K5 (SEQ ID NO:7) and the MP-T ⁇ RIIIED-K5 (SEQ ID NO:9) fusion proteins discussed above.
- the fusion proteins were dimerized with a TBRIIED-E5 fusion protein (SEQ ID NO:1) to form a T ⁇ RIIED-K5/T ⁇ RIIED-E5 dimer and a MP-T ⁇ RIIIED- K5/T ⁇ RllED-E5 dimer, through coiled-coil interaction of the K5 and E5 coil tags.
- An antibody, anti-TGF- ⁇ RU which binds to the extracellular domain of T ⁇ RII was coupled to the biosensor surface.
- TGF- ⁇ 1 was coupled to the biosensor surface (approximately 250 RUs) by a standard amino coupling procedure.
- T ⁇ RIIED-K5 solutions (9.8, 14.8, 22.2, 33.3 and 50 nM) were then randomly injected in duplicate over the TGF- ⁇ 1 surface and over a control surface (with no TGF- ⁇ 1).
- the set of sensorgrams was globally fit using a kinetic model depicting the presence of two independent T ⁇ RllED binding sites on the TGF- ⁇ 1 molecule (two-to-one stoichiometry model).
- Fig. 5A shows the set of sensorgrams and the fit obtained when using the two-to-one stoichiometry model.
- a simple kinetic model was also used to analyze the data.
- a better fit was obtained with the two-to-one stoichiometry model as judged by the distribution of the residuals (difference between the experimental and calculated points, Figs. 5B and 5C).
- the kinetic and thermodynamic constants from the two-to-one stoichiometry model are in good agreement with those previously determined for untagged T ⁇ RllED, indicating that the K5 tag did not influence T ⁇ RllED binding to TGF- ⁇ 1.
- TGF- ⁇ 1/T ⁇ RIIED-K5-T ⁇ RIIED-E5 sensorgrams were then globally fit, using different kinetic models. Analysis of the set of sensorgrams with a simple one-to-one model gave poor fits (S.D. of the residuals equal to 6.1 , see Table 2). Such a deviation from a simple binding model can be due to the presence of artifacts resulting from non-optimized experimental conditions, such as mass transport limitations or crowding effects (O'Shannessy, D. J. and Winzor, D. J., Anal. Biochem. 236:275-283 (1996)). Alternatively, it can be due to a more complex binding mechanism.
- TGF- ⁇ 1 is a covalent dimer
- T ⁇ RllED was artificially dimerized through coiled-coil interactions
- two scenarios of binding were evaluated.
- the T ⁇ RIIED-K5/T ⁇ RIIED-E5 dimer can bind to two TGF- ⁇ 1 molecules at the same time (avidity model) or, second, each T ⁇ RllED domain within the T ⁇ RIIED-K5/T ⁇ RIIED-E5 dimer binds to one TGF- ⁇ 1 monomer (such that the dimeric TGF- ⁇ bridges the two T ⁇ RllED domains).
- the percent of dimer varied from 80 to 91% for the range of concentrations used in Fig.5D, suggesting that T ⁇ RllED is binding as a dimer to TGF- ⁇ 1 , i.e., one T ⁇ RllED domain, within the coiled-coil induced dimer, binds to one monomer of TGF- ⁇ 1 followed by the binding of the other T ⁇ RllED domain to the other monomer of the same TGF- ⁇ 1 dimer.
- the calculated amount of active TGF- ⁇ 1 on the surface (which is a global parameter determined during data fitting) should be the same.
- the amount of active TGF- ⁇ 1 was determined to be 62.5 +/- 2 RUs when fitting the monomeric T ⁇ RIIED-K5 interaction with a two-to-one stoichiometry model.
- T ⁇ RIIED-K5/T ⁇ RIIED-E5 data the amount of TGF- ⁇ 1 was 61.7 +/-1 RUs with the rearrangement model, 40 +/- 3 RUs with the simple model, and 145 +/- 4 RUs with the avidity model. This observation further supports the validity of the two-to-one stoichiometry model for the interaction of TGF- ⁇ 1 with monomeric T ⁇ RIIED-K5 and the rearrangement model for the interaction of TGF- ⁇ l with the coiled-coil induced T ⁇ RIIED-K5/T ⁇ RIIED-E5 dimer.
- TGF- ⁇ 1 was coupled to the biosensor surface (less than 75 RUs) and either monomeric MP-T ⁇ RIIIED-K5 or MP-T ⁇ RIIIED-K5 dimerized with T ⁇ RIIED-E5 through the coiled-coil interaction was injected over the biosensor surface.
- Figs. 6A-6D show the results of these studies. Global fitting of both sets of sensorgrams indicated that the interactions of TGF- ⁇ 1 with monomeric MP- T ⁇ RIIIED-K5 and with MP-T ⁇ RIIIED-K5/T ⁇ RIIED-E5 dimer deviated from a simple binding mechanism.
- different concentrations of MP-T ⁇ RIIIED-K5 monomeric fusion protein ranging from 62.5 nM to 500 nM were injected over 75 RUs of coupled TGF- ⁇ 1 and over a control surface. The points are the resonance units obtained after data preparation as described in Example 2, and the solid lines represent the fit when integrating all the curves simultaneously using a rearrangement model.
- Figs. 6A-6D show the results of these studies. Global fitting of both sets of sensorgrams indicated that the interactions of TGF- ⁇ 1 with monomeric MP- T ⁇ RIIIED-K5 and with MP-T ⁇ RIIIED-K5/T ⁇ RIIED-E5 dimer deviated from a simple binding
- FIG. 6B-6C show residuals from the fit of the interaction data using a rearrangement model (Fig. 6B) and a simple one-to-one model (Fig. 6C).
- Global analysis of the TGF- ⁇ 1/MP-T ⁇ RIIIED-K5 interaction using a simple model gave the following kinetic constants: the apparent on-rate was estimated to be (5.0 ⁇ 0.2) x 10 4 M ' V 1 arid the apparent off-rate to be (2.5 ⁇ 0.1) x 10 "3 s resulting in an apparent K of 49 nM (the standard deviation of the residuals being 0.527).
- the apparent K d determined using the rearrangement model was estimated to be 86 nM (the standard deviation of the residuals being 0.359). [0130] Fig.
- FIG. 6D shows the interaction sensorgram for different concentrations of MP-T ⁇ RIIIED-K5/T ⁇ RIIED-E5 coiled-coil dimer ranging from 18.8 nM to 50 nM injected over the same TGF- ⁇ 1 surface as used with MP-T ⁇ RIIIED-K5 alone. The points are the resonance units obtained after data preparation. [0131] A comparison of non-dimerized MP-T ⁇ RIIIED-K5 (Fig. 6A) and the MP- T ⁇ RIIIED-K5 T ⁇ RllED-E5 dimer (Fig.
- the coiled-coil induced heterodimer is likely binding to both T ⁇ RII and T ⁇ RIII sites within one TGF- ⁇ 1 dimer, thereby affecting the affinity by a mechanism similar to that observed for coiled-coil dimerized T ⁇ RllED.
- a dimeric coil is used to act as an adaptor to bridge two proteins.
- a dimer coil referred to as K5ox was obtained by oxidizing a K5 subunit that has Cys at the N-terminus (SEQ ID NO:20) in order to form a K5 covalent dimer capable of bridging two T ⁇ RIIED-E5 proteins.
- the T ⁇ RMED-E5 fusion protein (SEQ ID NO: 1) was preincubated with various concentrations of K5ox (SEQ ID NO:20) and the solutions were injected over immobilized TGF- ⁇ 1 and control biosensor surfaces.
- the results are shown in Fig.7 and indicate that when T ⁇ RIIED-E5 (300 nM) was incubated with 50 (sensorgram 2) and 150 nM (sensorgram 3) of K5ox (6:1 and 2:1 T ⁇ RIIED-E5:K5ox molar ratio, respectively), the sensorgram differed greatly from that corresponding to the injection of T ⁇ RIIED-E5 alone (sensorgram 1).
- sensorgrams 2 and 3 were similar to that obtained for the T ⁇ RIIED-E5/T ⁇ RIIED-K5 dimer that resulted from the E5/K5 interaction (compare Fig.5Dand Fig.7 (sensorgram 2 and 3)).
- Fig.5Dand Fig.7 sensorgram 2 and 3
- K5ox 900 nM
- D. Antagonistic Potency [0133] In other studies performed, the ability of the fusion proteins and of the coiled-coil induced dimers to antagonize TGF- ⁇ 1 signaling was tested. In these studies, described in Example 4, luciferase-transfected mink lung epithelial cells (MLECs) were attached to 96-well plates. TGF- ⁇ 1 in the presence of a fusion protein or of a coiled-coil induced dimer (heterodimer or homodimer) was added to the cells and incubated overnight. The cells were then lysed and assayed for luciferase activity by measuring luminescence.
- MLECs luciferase-transfected mink lung epithelial cells
- Fig. 8A shows the percent relative luciferase activity as a function of antagonist concentration (nM) for the fusion protein antagonists T ⁇ RIIED-K5 (open diamonds) and T ⁇ RIIED-E5 (open triangles), and for the antagonist coiled-coil induced dimer T ⁇ RIIED-K5/T ⁇ RIIED-E5 (equimolar mixture, filled squares).
- nM antagonist concentration
- T ⁇ RIIED-K5 open diamonds
- T ⁇ RIIED-E5 open triangles
- the coiled-coil induced dimeric form of T ⁇ RllED formed by preincubating equimolar concentrations of E5 coiled-tagged T ⁇ RllED and K5 coiled-tagged T ⁇ RllED, was able to block signaling by 50% at a concentration of 7.5 nM.
- T ⁇ RIIED-E5 was preincubated with increasing amounts of K5ox.
- 150 nM T ⁇ RIIED-E5 (filled squares in Fig. 8B) blocked 50% of signaling in the presence of 34 nM K5ox .
- T ⁇ RllED that was dimerized through coiled- coil interactions, by preincubation of T ⁇ RIIED-E5 either with T ⁇ RIIED-K5 or with K5ox, was able to block TGF- ⁇ 1 signaling.
- the IC 50 s for inhibition of signaling were approximately 7.5 nM and 30 nM for the coiled-coil dimer and for the K5ox dimer, respectively.
- the higher IC5 0 for the K5ox-induced dimerization is likely due to the fact that K5ox less effectively induces dimerization as compared to simple mixing of the E5- and K5- coil-tagged T ⁇ RIIEDs.
- coiled-coil induced dimerization can be used as a strategy to enhance the potency of TGF- ⁇ receptor ectodomains to inhibit cell surface receptor signaling.
- the coiled-coil induced dimerization strategy provides for monomeric, homodimeric, and heterodimeric forms of the receptor ectodomains that can be rapidly produced and evaluated.
- T ⁇ RIIED-K5, T ⁇ RIIED-E5, and MP-T ⁇ RIIIED-K5 were prepared and characterized in monomeric form and in dimeric form. Homodimers and heterodimers of the fusion proteins readily form due to interaction of the coil tags. The homodimers and heterodimers are able to bind TGF- ⁇ 1 and to block TGF- ⁇ 1 signaling in vitro.
- TGF- ⁇ 1 The inhibition of TGF- ⁇ 1 by the homodimers and heterodimers allows their use as biopharmaceutical agents and in screening assays for compounds capable of inhibiting TGF- ⁇ 1 binding.
- TGF- ⁇ ectodomain sequences of mouse, rat, pig, chicken are reported in the literature (Guimond, A. et al., FEBS, 515:13-19
- the fusion proteins can be constructed using all or selected portions of the receptor ectodomains.
- portions of the receptor having biological activity can be selected for use in the fusion protein.
- receptor ectodomains having at least about 80% sequence identity, more preferably 85%, still more preferably 90%, and most preferably 95%, to the ectodomain sequences described herein are contemplated for use.
- the invention provides for a. screening assay for selection of a compound capable of inhibiting the binding activity of TGF- ⁇ 1 to one or more of its receptors.
- a coiled-coil homodimer or heterodimer protein is prepared, as described above.
- the protein is comprised of (i) an extracellular domain of a first transmembrane receptor and a first peptide subunit of an ⁇ -helical coiled-coil; and (ii) an extracellular domain of (a) the first transmembrane receptor or (b) a second transmembrane receptor, and a second peptide subunit of the ⁇ -helical coiled-coil.
- the coiled-coil dimer is comprised of first and second fusion proteins.
- the first fusion protein is comprised of an ectodomain or portion of an ectodomain from T ⁇ RII or T ⁇ RIII receptors tagged with either a K5 or E5 coiled-coil subunit peptide.
- the second fusion protein is comprised of either the same receptor ectodomain present in the first fusion protein (to achieve a receptor homodimer) or a different ectodomain or portion of an ectodomain from T ⁇ RII or T ⁇ RIII receptors than that used in the first fusion protein (to achieve a receptor heterodimer).
- the ectodomain in the second fusion protein is tagged with the opposing coiled-coil subunit peptide from that used in the first fusion protein.
- the coiled-coil homodimer or heterodimer is incubated with a test compound in the presence of a ligand for the receptor ectodomains within the coiled-coil dimer.
- a suitable ligand is an isoform of TGF- ⁇ having binding affinity to the ectodomain(s) within the coiled-coil dimer.
- the ability of the test compound to inhibit interaction between the receptor ligand and the coiled-coil dimer is measured by a suitable method known to those of skill in the art, such as a competitive binding assay, SPR using a biosensor, or the like.
- a suitable method known to those of skill in the art, such as a competitive binding assay, SPR using a biosensor, or the like.
- the coiled-coil dimer can be attached to a 96 well plate and then incubated with the test compound. Radiolabelled TGF- ⁇ ligand is then added to the plate and allowed to incubate. After washing to remove unbound ligand, the amount of bound TGF- ⁇ is assayed. Comparison of the amount of bound TGF- ⁇ in the presence and absence of the test compound permits determination of the ability of the test compound to inhibit TGF- ⁇ binding to the receptor, where a decrease in the amount of TGF- ⁇ is indicative of a test compound having inhibition activity.
- a test compound's ability to inhibit TGF- ⁇ binding can also be measured using a biosensor, where the TGF- ⁇ ligand is attached to the biosensor surface. The ability of the test compound to block the interaction between the coiled-coil induced receptor dimer and the immobilized ligand is assayed.
- methods of treating conditions characterized by an overexpression of TGF- ⁇ are contemplated.
- Overexpression of TGF- ⁇ is a characteristic of, for example, tissue fibroproliferative disorders. Tissue fibrosis is a pathological state characterized by a deleterious accumulation of extracellular matrix.
- TGF- ⁇ an d thus by the deleterious accumulation of extracellular matrix
- diabetic nephropathy Another condition characterized overexpression of " TGF- ⁇ , an d thus by the deleterious accumulation of extracellular matrix, is diabetic nephropathy, which is now the most common cause of progressive kidney failure.
- human mesangial proliferative glomerulonephritis and postradiation fibrosis are characterized by excess TGF- ⁇ and overproduction of connective tissue.
- TGF- ⁇ Tumor metastasis are also characterized by excess TGF- ⁇ expression.
- uncontrolled synthesis of TGF- ⁇ is one factor which caused the deleterious accumulation of extracellular matrix that underlies the development of tissue fibrosis. Progressive fibrosis of the kidney, liver, lung, heart, bone marrow, and skin is both a major cause of suffering and death and an important contributor to the cost of health care.
- TGF- ⁇ also stimulates cells to produce more proteins, including collagen, biglycan, decorin, and fibronectin, and to inhibit enzymes which degrade these proteins.
- the invention contemplates a method of treating these and other conditions characterized by production and/or overexpression of TGF- ⁇ by administering a coiled-coil induced receptor dimer, homodimer or heterodimer, comprised of two ectodomains, or portions of ectodomains, which can be the same (for a homodimer) or different (for a heterodimer), each ectodomain tagged with a subunit of an ⁇ -helical coiled-coil.
- the coiled-coil homodimer or heterodimer is effective to inhibit TGF- ⁇ binding to the cell-surface receptor, thereby preventing the downstream cascade of events initiated by TGF- ⁇ receptor binding.
- Determination of the appropriate dose regimen of a coiled-coil homodimer or heterodimer for a given patient is well within the skill of the attending physician. Since the proper dose varies from person to person based on the age and general state of health, it is a common practice of physicians to "dose-titrate" the patient; that is, to start the patient on a dosing regimen which is at a level below that required to produce the desired response, and gradually increase the dose until the desired effect is achieved.
- the invention also contemplates a kit comprising a coiled-coil dimer based on a TGF- ⁇ ectodomain for use in identifying compounds capable of inhibiting and/or competing with TGF- ⁇ receptor binding.
- the kit is comprised of a first container holding a coiled-coil dimerized receptor ectodomain homodimer or heterodimer, comprised of two ectodomains, or portions of ectodomains, which can be the same (for a homodimer) or different (for a heterodimer), each ectodomain tagged with a subunit of an ⁇ -helical coiled-coil.
- the kit can provide a container with a first fusion protein, a container with a second fusion protein; the two fusion proteins combined by the user prior to use to form the coiled-coil dimerized receptor ectodomain.
- the kit also includes a container holding a ligand (the term ligand generally referring to a binding partner) for the coiled-coil dimerized receptor, for example, the ligand can be a protein or a peptide.
- a ligand for a coiled-coil dimer formed using a TGF- ⁇ ectodomain is TGF- ⁇ .
- the ligand is labeled for detection by a conventional technique; the label can be a radiolabel, a fluorescent label, a photolabel, etc.
- the kit also includes written instructions that describe use of the kit components, where the user mixes all or a portion of the coiled-coil dimer with the labeled-ligand in the presence and/or in the absence of one or more test compounds. The ability of the test compound(s) to inhibit binding of the coiled-coiled dimer to the labeled ligand is detected.
- the instructions can also provide guidance for a washing and/or separation step, if needed.
- the invention includes a fusion protein comprised of a cytoplasmic domain of a transmembrane bound receptor and a peptide subunit of a coiled-coil dimer.
- the fusion protein is preferably constructed using the soluble, intracellular domain of a cell receptor; that is, the transmembrane spanning segment of the receptor is excluded. Fusion proteins comprised of a cytoplasmic domain derived from cell surface receptors for TGF- ⁇ and for epidermal growth factor, joined to a peptide subunit of an ⁇ -helical coiled-coil, were prepared, as will now be described.
- fusion proteins comprised of a kinase domain from TGF- ⁇ type II receptor having a sequence identified herein as SEQ ID NO:21 and a NH 2 -terminal E-coil (SEQ ID NO:5) of a coiled-coil dimer were prepared.
- a second fusion protein comprised of a kinase domain from TGF- ⁇ type I receptor having a sequence identified herein as SEQ ID NO:22 and a NH 2 -terminal K-coil (SEQ ID NO:8) of a coiled-coil dimer was prepared as described in Example 5.
- the coding sequences for the receptor domains were PCR amplified to introduce the coiled-coil tail.
- the amplified sequences were ligated to a pBlueBac vector and used to express the proteins in insect cells.
- the recombinant fusion proteins were purified by affinity chromatography and characterized by electrophoresis.
- Fig. 9 is an SDS-PAGE gel electrophoresis showing autophosphoryation of the fusion proteins comprised of the kinase domains of TGF- ⁇ receptor I or receptor II tagged with a peptide subunit (K5 or E5) of a coiled- coil polypeptide, and of a, heterodimer of the two fusion proteins.
- a peptide subunit K5 or E5
- a coiled- coil polypeptide a coiled- coil polypeptide
- Lane 1 in the figure corresponds to TGF- ⁇ receptor I cytoplasmic domain joined with a K5 peptide subunit; Lane 2 corresponds to TGF- ⁇ receptor II cytoplasmic domain tagged with the E5 peptide subunit; Lane 3 is a mixture of TGF- ⁇ receptor I-K5 and TGF- ⁇ receptor II-E5; and Lane 4 is a sample of co- expressed TGF- ⁇ receptor I-K5 and TGF- ⁇ receptor 11-E5.
- Lane 4 corresponding to the heterodimer shows the most autophosphorylation, indicating that the kinase domains when presented as a coiled-coil heterodimer are biologically active, i.e., are in an orientation that promotes cross-phosphorylation, the event that initiates signaling.
- Fusion proteins comprised of epidermal growth factor receptor (EGFR) erbBI cytoplasmic domain (CD) were prepared, as described in Example 6.
- DNA constructs encoding for erbBI were ligated to DNA constructs for E5 or K5 and subcloned into a expression vector to generate an EGFR erbBI -K5 (SEQ ID NO:31) protein and an EGFR erbBI -E5 (SEQ ID NO:34) fusion protein.
- the amino acid sequence of the erbB1-K5 cytoplasmic domain fusion protein is shown in Fig. 10A (erbBI CD-K5) and the amino acid sequence of the erbBI -E5 - cytoplasmic domain (erbBI CD-E5) fusion protein is shown in Fig. 10B.
- erbBI CD-K5 residues 1 to 6 correspond to a 6 amino-acid linker (SEQ ID NO:32); erbBI CD-K5 residues 7 to 41 correspond to the K5 coil (SEQ ID NO:8); erbBI CD-K5 residues 42 to 48 (underlined) correspond to 7 amino-acid linker (SEQ ID NO: 33); erbBI CD-K5 residues 49 to 590 correspond to residues 669 to 1210 comprising the cytoplasmic domain of the human erbBI sequence according to the numbering used in the Swiss Protein database (accession number: P00533); erbBI CD-K5 residues 591 to 596 (underlined) correspond to a 6 amino-acid His tag peptide sequence.
- Fig. 10B shows the amino acid sequence of the erbBI cytoplasmic domain - E5 (erbBI CD-E5) fusion protein (SEQ ID NO:34).
- erbBI CD-E5 residues 1 to 6 correspond to a 6 amino-acid linker (SEQ ID NO:32);
- erbBI CD- E5 residues 7 to 41 correspond to the E5 coil (SEQ ID NO:5);
- erbBI CD-E5 residues 42 to 48 correspond to 7 amino-acid linker (SEQ ID NO:33);
- erbBI CD-E5 residues 49 to 590 correspond to residues 669 to 1210 comprising the cytoplasmic domain of the human erbBI sequence according to the numbering used in the Swiss Protein database (accession number: P00533);
- erbBI CD-E5 residues 591 to 596 correspond to a 6 amino-acid His tag peptide sequence.
- plasmids encoding for the cytoplasmic domain of erbBI , for the fusion proteins (erbB1CD-K5 and erbB1CD-E5), and for the full length erbBI were transfected into human embryonic kidney 293 cells. After transfection, the erbBI kinase inhibitor AG1478 was added. Western blot analysis of the cell lysates was done and the results are shown in Figs. 10C-10D.
- Fig. 10C is a Western blot for detectioo of phosphotyrosine, to determine the effect of AG1478 inhibitor on EGFR autophosphorylation.
- Fig. 10C is a Western blot for detectioo of phosphotyrosine, to determine the effect of AG1478 inhibitor on EGFR autophosphorylation.
- Fig. 10C is a Western blot for detectioo of phosphotyrosine, to determine the effect of AG1478 inhibitor on EGFR autophosphorylation.
- 10D is an anti-erbB1 Western blot showing the amount of transfected EGFR in each sample.
- Lanes 1-2 in Figs. 10C-10D correspond to cell lysates transfected with erbBI kinase domain without coils, where Lane 1 was a control not treated with the AG1478 inhibitor and Lane 2 was treated with AG1478 inhibitor. The inhibitor had little or no effect on the phosphorylation of the non-coiled coil dimerized erbBI cytoplasmic domain.
- Lanes 3 and 4 correspond to cells transfected with erbB1-K5 and with erbB1-E5 and untreated with AG1478 inhibitor (Lane 3) or treated with inhibitor (Lane 4).
- Lanes 5 and 6 correspond to cells transfected with full length erbBI and not treated with inhibitor (control, Lane 5) or treated with inhibitor (Lane 6) followed by EGF stimulation.
- the inhibition of autophosphorylation by the inhibitor was observed with full-length erbBI (Lane 6) and with the coiled-coil dimerized erbBI cytoplasmic domain (Lane 4), but not with the erbBI cytoplasmic domain without coils (Lane 2).
- Protein-protein interactions are involved in most cellular responses to environmental stimuli. For example, in signal transduction, protein-protein interactions are used to promote or regulate signal transfer from the plasma membrane, through the cytoplasm, to the nucleus. Tools to modulate these interactions and to study biological responses at the molecular level are desirable, as are methods and assays for screening inhibitors of specific steps in signal transduction pathways. Such inhibitors are candidates for therapeutic agents. As noted above, for TGF- ⁇ excess receptor signaling is causally related to disease pathogenesis in fibrotic disorders, immunosuppression, and metastasis.
- TGF- ⁇ receptor superfamily of serine-threonine kinase receptors two transmembrane receptors (Type I and Type II) are needed for signal transduction to occur.
- TGF- ⁇ binding to the Type II receptor induces recruitment and orientation of the Type I receptor into the complex, allowing the constitutively active Type II receptor kinase to phosphorylate the Type I receptor.
- the Type I receptor kinase phosphorylates downstream substrates of the signalling pathway.
- the invention in another aspect provides a method for selecting a compound capable of inhibiting kinase activity.
- a coiled- coil protein comprised of a first fusion protein comprised of a receptor peptide having a sequence corresponding to a cytoplasmic domain of a cell surface receptor and a first peptide subunit of an ⁇ -helical coiled-coil; and a second fusion protein comprised of a receptor peptide having a sequence corresponding to a cytoplasmic domain of a cell surface receptor and a second peptide subunit of an ⁇ -helical coiled-coil is prepared.
- the receptor peptide can be the same or different in the first and second fusion proteins, resulting in a homodimer or a heterodimer, respectively.
- the coiled-coil protein is comprised of (i) a cytoplasmic domain of a TGF- ⁇ receptor or an EGF receptor and a first peptide subunit of an ⁇ -helical coiled-coil; and (ii) a cytoplasmic domain of (a) the same TGF- ⁇ receptor or EGF receptor or (b) a different TGF- ⁇ receptor or EGF receptor, and a second peptide subunit of the ⁇ -helical coiled-coil.
- the coiled-coil protein is incubated with a test compound.
- the ability of the test compound to inhibit receptor cross-phosphorylation is measured by a suitable technique, such as using P 33 gamma ATP followed by SDS gel electrophoresis, or using non-radioactive ATP followed by mass spectrometry analysis of phosphorylation. .
- the coiled-coil protein can be either a homodimer or a heterodimer. That is, for a homodimer, the coiled-coil protein can be comprised of two fusion proteins, both fusion proteins having the same kinase domain from, for example, TGF- ⁇ receptor I, TGF- ⁇ receptor II, or from an EGF receptor, one fusion protein having the K coil subunit, the other having the E coil subunit. The fusion proteins thus dimerize into a homodimer. For a heterodimer, the two fusion proteins will have different cytoplasmic domains of TGF- ⁇ or of EGF receptors.
- Exemplary fusion proteins for a heterodimer are one fusion protein having the kinase domain for TGF- ⁇ receptor I and the other having the kinase domain for TGF- ⁇ receptor II.
- the two fusion proteins are dimerized to form a heterodimer.
- the invention also contemplates a kit for use in identifying compounds capable of inhibiting or reducing receptor kinase activity and in identifying compounds capable of disrupting binding of the coiled-coil dimerized receptor with interacting ligands, including but not limited to peptides or proteins.
- the kit is comprised of a coiled-coil dimer, formed of a first fusion protein of a receptor cytoplasmic domain and a first subunit of an ⁇ -helical coiled-coil and a second fusion protein of a receptor cytoplasmic domain and a second subunit of an ⁇ - helical coiled-coil; the two fusion, protein forming a coiled-coil dimer.
- the first and second fusion proteins can be provided in separate containers that are combined by the user to form the coiled-coil prior to use.
- the kinase domains selected for use in the coiled-coil dimer can provide a homodimer or a heterodimer, and the cytoplasmic domains of the fusion proteins can consist of all or a portion of a receptor cytoplasmic domains.
- the kit also includes written instructions for use of the kit components, where the user mixes all or a portion of the coiled-coil dimer with a kit-supplied or a user-supplied compound to enable kinase reaction, e.g., labeled ATP, in the presence or in the absence of one or more test compounds.
- the ability of the test compound(s) to inhibit or enhance the kinase reaction, i.e., auto-phosphorylation is detected using a conventional technique.
- the kit can also optionally provide another protein or peptide capable of being phosphorylated by, or binding to, the receptor of interest.
- polynucleotides encoding for the fusion proteins described above that is, the fusion proteins comprised of an ectodomain or a cytoplasmic domain of a transmembrane receptor and a coiled- coil dimer subunit.
- the amino acid sequence for the fusion protein is used Jo generate a corresponding nucleic acid sequence, typically a DNA sequence.
- the codon usage of the generated DNA sequence can be optimized for expression in a particular host system, as is known in the art. Construction of the DNA sequence is done synthetically by techniques well known in the art.
- an expression vector containing the fusion protein coding sequences is also included in the invention.
- the expression vector will also typically include expression control elements to achieve expression of the coding regions in a suitable host.
- the co ⁇ tol elements generally include a promoter, translation initiation codon, and translation and transcription termination sequences, and an insertion site for introducing the insert into the vector.
- the DNA encoding the fusion protein can be cloned into any number of vectors to generate expression of the protein in the appropriate host system. Additional features can be engineered into the expression vectors, such as leader sequences that promote secretion of the expressed sequences into culture medium. Recombinantly produced protein can be isolated from lysed cells or from the culture media. Purification is done by methods known in the art, such as ion exchange chromatography, affinity chromatography, and the like.
- EXAMPLE 1 Construction of Expression Vectors for Production of TBRIIED-E5.
- TBRIIED-K5 and MP-TBRIIIED-K5 Fusion Proteins A.
- Materials [0166] The pcDNA3 vectors containing the cDNA encoding the E5 and K5 coils (pcDNA3-K5coil and pcDNA3-E5coil) and the pcDNA3 vector containing the cDNA encoding for the N-terminally myc-tagged TGF- ⁇ type II receptor (pcDNA3-T ⁇ RII) were obtained from The Biotechnology Research Institute (Montreal, Canada).
- the pcDNA3 vector containing the myc tagged membrane-proximal domain of the TGF- ⁇ type III receptor extracellular domain was prepared as previously described (Pepin, M. C, et al., FEBS Lett. 377:368-372. (1995)). All the enzymes were from New England Biolabs Inc. and were used according to the manufacturer's recommendations. All the primers were purchased from Hu Stamm Scientific Ltd. (Montreal, Quebec, Canada). Recombinant human TGF- ⁇ 1 and the anti hTGF- ⁇ RII antibody were purchased from R&D Systems (Minneapolis, MN). Recombinant human T ⁇ RllED, expressed in E.
- BIACORE 3000 N-hydroxysuccinimide (NHS), N-ethyl-N'-(3-diethylaminopropyl) carbodiimide hydrochloride (EDC) and 1 M ethanolamine (pH 8.5) were purchased from BIACORE Inc. (Piscataway, NJ, USA).
- pTT2 T ⁇ RIIED-E5 vector Construction of the pTT2 T ⁇ RIIED-E5 vector is described in De Crescenzo, G. et al., J. Mol. Biol., 328(5):1173-83 (2003).
- the cDNA encoding for the K5 coil was PCR amplified using the pcDNA3-K5coil as template and the following primers: Kfor 5'-TAGAGCGGCCGCGGTGGCAAGGTATCCG -3' (SEQ ID NO:23; Notl restriction site underlined), and •Vev- 5'- TAGGAJCCCTAATGGTGATGATGGTGATGACCGCCCTC TTTAAGTG -3' (SEQ ID NO:24; Bamhfl restriction site underlined).
- pTT2 T ⁇ RIIED-K5 For construction of pTT2 T ⁇ RIIED-K5, the cDNA encoding for the myc tagged T ⁇ RllED was PCR amplified as described elsewhere (De Crescenzo, G. et al., J. Mol. Biol., 328(5): 1173-83 (2003)), digested with Hind ⁇ INot ⁇ , and ligated to pTT2 K5coil digested with the same enzymes.
- pTT2 MP-T ⁇ RIIIED-K5 For construction of pTT2 MP-T ⁇ RIIIED-K5, the cDNA encoding for the myc tagged MP-T ⁇ RIIIED was PCR amplified using the pcDNA3-MP-T ⁇ RIII as template, and the following primers: lll f0r 5'-ATGCTAGCGTTGGAGAGATGGCAGTGACATCCC -3' (SEQ ID NO:25; Nhe ⁇ restriction site underlined) and llirev 5'-TAGAGCGGCCGCCATGGAAAATCTGTGGAGG-3' (SEQ ID NO:26; Not restriction site underlined).
- pTT2 T ⁇ RIIED-E5, pTT2 T ⁇ RIIED-K5, and pTT2 MP-T ⁇ RIIIED-K5 ligations were then transformed into Escherichia coli (DH5 ⁇ ) and the plasmids were purified using the MAXI prep columns (QIAgen, Mississauga, Ontario, Canada). Each construct was verified by sequencing. For quantification, plasmids were diluted in 50 mM Tris-HCI pH 7.4 and the absorbances at 260 and 280 nm measured. Only plasmid preparations with A 26 o/ A 2 eo ratios between 1.8 and 2.0 were used for transient transfection.
- the vectors were transiently transfected into HEK 293SF cells using polyethylenimine (PEI) as a transfection vehicle as described in De Crescenzo, G., et al. (J. Mol. Biol., 328(5): 1173-83 (2003)).
- PEI polyethylenimine
- the recombinant proteins were expressed by the transiently transfected cells and secreted into the medium.
- the cultures were harvested five days after transfection and the medium was clarified by centrifugation at 3500 x g for 10 min.
- T ⁇ RIIED-E5 was purified as described in De Crescenzo, G. et al. (J. Mol. Biol., 328(5): 1173-83 (2003)) and shown in Fig. 2.
- the T ⁇ RIIED-K5 and MP- T ⁇ RIIIED-K5 fusion proteins were purified using a Ni-NTA Agarose affinity column (2 mL bed volume, QIAgen) by loading the culture medium by gravity flow. The column was then washed two times with 25 mL buffer A (50 mM sodium phosphate, 300 mM NaCI, pH 7.4). Elution was achieved with buffer B (buffer A + 100 mM imidazole, pH 7.4, 8 mL fraction collected).
- the flow through fraction was reloaded twice and eluted using the same conditions as above. Elution fractions (8 mL each) were then individually concentrated , (for T ⁇ RIIED-K5, this step included buffer exchange for PBS) by using a Centriprep 10 device (Amicon), according to the manufacturer's recommendations. The concentration of the purified fusion proteins was determined with the Coomassie Plus Protein Assay Reagent Kit (Pierce), using bovine serum albumin as the standard. The yields of T ⁇ RIIED-E5, T ⁇ RIIED-K5, and MP-T ⁇ RIIIED-K5 from 500 mL of conditioned media were approximately 766 ⁇ g, 570 ⁇ g and 600 ⁇ g, respectively.
- the purity of the fusion proteins was estimated by either Silver staining using the Silver Stain Plus Kit (Bio-Rad) or Coomassie Blue staining after resolving the proteins on 11% or 4-12% gradient SDS-poiyacrylamide gels under reducing conditions.
- the purified proteins were also detected by Western blot (anti-myc 9E10, SantaCruz) following protein separation on SDS-polyacrylamide gels under reducing and non-reducing conditions. The results are shown in Figs. 2 and 3, where Western blot detection was done using anti-myc as a primary antibody and horseradish peroxidase conjugated goat anti-mouse as a secondary antibody.
- lane FT corresponds to the flow through after passing the sample medium on the affinity column; lanes W1 and W2 correspond to two column washes with buffer A; lanes 1, 2, and 3 in Fig. 2 correspond to three elutions of T ⁇ RIIIED-E5 with buffer B.
- Fig. 3 shows the purification of T ⁇ RIIED-K5 and MP- T ⁇ RIIIED-K5.
- protein eluted from a Ni-NTA affinity chromatography column was run on 11% SDS-PAGE under non-reducing (A) and reducing conditions (B and C) followed by Western blotting (A and B; primary and secondary antibody as in Fig. 2) or Silver staining (C).
- T ⁇ RIIED-K5 Separation of TBRIIED-K5 monomers from higher order aggregates
- T ⁇ RIIED-E5 As in the case of T ⁇ RIIED-E5, higher order aggregates were observed by Western blot under non-reducing condition for T ⁇ RIIED-K5.
- Monomeric T ⁇ RIIED-K5 was prepared as follows. T ⁇ RIIED-K5 (320 ⁇ g) was diluted in PBS to a final volume of 10 mL and spun in a Centriprep 30 (Amicon). The filtrate was then concentrated using a Centriprep 10, leading to a 500 ⁇ L fraction with a T ⁇ RllED-K5 concentration of 555 nM. The efficacy of the separation of oligomers from monomer was estimated by Western blotting (non-reducing conditions) and the protein concentration was determined as described above in 5.
- Surface plasmon resonance studies were performed using a BIACORETM biosensor (see for example U.S. Patent No. 6,165,335 and related patents) using a running buffer composed of HBS; 20 mM Hepes (pH 7.4), 150 mM NaCI, 3.4 mM EDTA, and 0.05% Tween20 for diluting all the test analytes.
- Anti hTGF- ⁇ RII antibody was coupled to the CM5 biosensor chip surface using the standard amine coupling procedure and a flow rate set at 5 ⁇ L/min.
- Sequential injections consisted of a 0.05 M NHS/0.2 M EDC mixture (25 ⁇ L) followed by an anti hTGF- ⁇ RII antibody injection (20 ⁇ g/mL) in 10 mM acetic acid (pH 4.0) until the desired coupled amount was reached (more than 3500 RUs).
- a solution of 0.1 M ethanoIamine-HCI (pH 8.5, 35 ⁇ L) was then used to block the remaining activated carboxyl groups.
- a control dextran surface was also generated by replacing the anti hTGF- ⁇ RII antibody solution with running buffer.
- TGF- ⁇ 1 surfaces and control dextran surfaces on CM5 sensor chips were prepared as described elsewhere (De Crescenzo, G. et al., J.Biol.Chem. 276, 29632-29643 (2001)) using a standard amine coupling procedure.
- K5 coil with a cysteine linker (20 mg, SEQ ID NO:20) was dissolved in 2 mL of 100 mM ammonium bicarbonate pH 8.0 at room temperature. Aliquots of the reaction mixture were applied in regular intervals to an analytical C18 HPLC system to monitor the progress of the oxidation. Peptide oxidation was allowed to proceed until 90% completion or up to 12 hours. Acetic acid was.added to the mixture at the end of the oxidation to acidify the solution to pH 6. The peptides were then lyophilized and resuspended in PBS buffer prior to use.
- Mink lung epithelial cells stably transfected with the PAI-1 promoter fused to the firefly luciferase reporter gene (Abe, M., etal.,
- TGF- ⁇ .1 (10 pM) in DMEM/1% FBS/0.1 % BSA, which was preincubated with the following additions for one hour, was then added to the cells: A) T ⁇ RIIED-K5, T ⁇ RIIED-E5, or T ⁇ RIIED-K5/T ⁇ RHED-E5 equimolar mixture at various concentrations (Fig.
- Fusion proteins consisting of N-terminal E coil fused to the TGF- ⁇ type II receptor kinase domain and N-terminal K coil fused to the TGF- ⁇ type I receptor kinase domain were generated by PCR using mammalian expression vectors encoding SEQ ID NO:21 (pAEcoilRII-KD( ⁇ TM)#5) or SEQ ID NO:22 (pAKcoilRI-
- E coil -TGF ⁇ type II receptor kinase domain with a C-terminal His tag was PCR amplified using the following primers.
- the Nhel and Hindlll restriction sites are underlined in the primer sequences 5'EIIHis and 3'EIIHis, respectively:
- the K coil - TGF ⁇ type I receptor kinase domain with a C-terminal His tag was PCR amplified using the following primers.
- the Nhel and Hindlll restriction sites are underlined in the primer sequences 5'KIHis and 3'EIHis, respectively:
- Equal amounts of either the TGF- ⁇ receptor l-K coil fusion protein, the TGF- ⁇ receptor ll-E coil fusion protein, a mixture of the two fusion proteins, and or co-expressed TGF- ⁇ receptor l-K / TGF- ⁇ receptor ll-E coil fusion proteins were separately incubated in the presence of P33-gamma ATP for 30 minutes at 30°C. An aliquot of each reaction sample was then electrophoresed under reducing conditions in a 8% acrylamide gel. The gel was dried and the phosphorylated kinases were detected by phosphorimaging. The results are shown in Fig. 9, where the positions of the type I and type II receptors are indicated on the right.
- STEP 2 pGemT vector (Promega) containing cDNA encoding K5- TGF ⁇ RI (SEQ ID NO:22) or E5-TGF ⁇ RII kinase (SEQ ID NO:22) (from pGemT/K5- RIKD and pGemT/E5-RIIKD-E5-TGF, property of Biotechnology Research Institute, National Research Council of Canada) was restricted with Xhol- Hindlll (blunt ended) to remove Rl or Rll kinase domains. Xhol- Nhel (blunt ended) restricted erbBI cytoplamic domain PCR product (step 1 ) was inserted at this site.
- STEP 1 erbBI cytoplasmic domain was PCR amplified with the following Xbal (5') and His tagged Nhe I (3') primers (restriction sites underlined) from pcDNA3-erbB1 malian expression vector encoding the full length cDNA for human EGFR (Genbank accession number: NM 005228).
- STEP 2 Xbal and Nhel restricted PCR products were subcloned into pTT2 mammalian expression vector (property of Biotechnology Research Institute, National Resource Council of Canada) to generate pTT2/erbB1CD #2 construct encoding the cytoplasmic domain of erbBI attached to a carboxy-terminal His tag peptide sequence. After ligation, plasmids were transformed into E. coli (DH5 ⁇ ) purified using CONCERT plasmid DNA purification columns (Gibco-BRL) and verified by sequencing.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Genetics & Genomics (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Wood Science & Technology (AREA)
- Physical Education & Sports Medicine (AREA)
- Cell Biology (AREA)
- Oncology (AREA)
- Toxicology (AREA)
- Pulmonology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Urology & Nephrology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US50085503P | 2003-09-05 | 2003-09-05 | |
PCT/CA2004/001616 WO2005024035A1 (en) | 2003-09-05 | 2004-09-02 | Coiled-coil fusion proteins comprising cell receptor domains |
Publications (2)
Publication Number | Publication Date |
---|---|
EP1668133A1 true EP1668133A1 (en) | 2006-06-14 |
EP1668133A4 EP1668133A4 (en) | 2007-08-29 |
Family
ID=34273005
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP04761779A Withdrawn EP1668133A4 (en) | 2003-09-05 | 2004-09-02 | Coiled-coil fusion proteins comprising cell receptor domains |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1668133A4 (en) |
JP (1) | JP2007503820A (en) |
AU (1) | AU2004270774A1 (en) |
CA (1) | CA2536936A1 (en) |
WO (1) | WO2005024035A1 (en) |
Families Citing this family (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20070184052A1 (en) * | 2003-05-09 | 2007-08-09 | Lin Herbert Y | Soluble tgf-b type III receptor fusion proteins |
US7710853B2 (en) | 2004-03-18 | 2010-05-04 | Lg Electronics, Inc. | Recording medium with segment information thereon and apparatus and methods for forming, recording, and reproducing the recording medium |
JP4610607B2 (en) | 2004-03-18 | 2011-01-12 | エルジー エレクトロニクス インコーポレイティド | Method and apparatus for recording / reproducing data on / from a recording medium |
TWI381374B (en) | 2004-03-18 | 2013-01-01 | Lg Electronics Inc | Recording medium with overlapping segment information thereon and apparatus and methods for forming, recording, and reproducing the recording medium |
EP2491391B1 (en) * | 2009-10-23 | 2018-02-28 | GE Healthcare Bio-Sciences AB | Method for determination of macromolecular multimers |
EP2646472B1 (en) * | 2010-11-29 | 2017-08-30 | National Research Council of Canada | Covalently dimerized bivalent binding agents |
JP7079779B2 (en) * | 2016-11-18 | 2022-06-02 | ユニバーシティ オブ ピッツバーグ - オブ ザ コモンウェルス システム オブ ハイヤー エデュケイション | Manipulated TGF beta monomers and their use for TGF beta signaling |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997012988A1 (en) * | 1995-10-06 | 1997-04-10 | Pence | Coiled-coil heterodimer methods and compositions for the detection and purification of expressed proteins |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6472179B2 (en) * | 1998-09-25 | 2002-10-29 | Regeneron Pharmaceuticals, Inc. | Receptor based antagonists and methods of making and using |
EP1153295A2 (en) * | 1999-02-11 | 2001-11-14 | Xencor, Inc. | Structure-based screening techniques for drug discovery |
-
2004
- 2004-09-02 JP JP2006525014A patent/JP2007503820A/en not_active Abandoned
- 2004-09-02 AU AU2004270774A patent/AU2004270774A1/en not_active Abandoned
- 2004-09-02 EP EP04761779A patent/EP1668133A4/en not_active Withdrawn
- 2004-09-02 CA CA002536936A patent/CA2536936A1/en not_active Abandoned
- 2004-09-02 WO PCT/CA2004/001616 patent/WO2005024035A1/en active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997012988A1 (en) * | 1995-10-06 | 1997-04-10 | Pence | Coiled-coil heterodimer methods and compositions for the detection and purification of expressed proteins |
Non-Patent Citations (7)
Also Published As
Publication number | Publication date |
---|---|
AU2004270774A1 (en) | 2005-03-17 |
EP1668133A4 (en) | 2007-08-29 |
CA2536936A1 (en) | 2005-03-17 |
WO2005024035A1 (en) | 2005-03-17 |
JP2007503820A (en) | 2007-03-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10392430B2 (en) | Methods of making nucleic acid molecules encoding modified chimeric polypeptides with improved pharmacokinetic properties | |
JP4723140B2 (en) | Modified chimeric polypeptide with improved pharmacokinetic properties | |
US7309586B2 (en) | Chimeric coiled coil molecules | |
CN111182915A (en) | Veterinary IgG Fc variants | |
US20060234343A1 (en) | Truncated EGF receptor | |
US7786261B2 (en) | Coiled-coil fusion proteins comprising cell receptor domains | |
US7008781B1 (en) | Method of enhancing the biological activity of ligands | |
CA2083778A1 (en) | Variable region within fibroblast growth factor receptors that confers ligand specificity | |
CN113840831A (en) | Medical NGF antagonists | |
WO2005024035A1 (en) | Coiled-coil fusion proteins comprising cell receptor domains | |
CN116034112A (en) | Animal IL4/IL13 receptor molecules | |
US20120263707A1 (en) | Broad Spectrum ErbB Ligand Binding Molecules and Methods for Preparing and Using Them | |
AU2006203619A1 (en) | Truncated EGF receptor |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20060330 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR |
|
DAX | Request for extension of the european patent (deleted) | ||
RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61K 38/00 20060101ALN20070511BHEP Ipc: G01N 33/53 20060101ALN20070511BHEP Ipc: C07K 14/71 20060101ALI20070511BHEP Ipc: C12N 15/62 20060101AFI20050331BHEP |
|
A4 | Supplementary search report drawn up and despatched |
Effective date: 20070727 |
|
17Q | First examination report despatched |
Effective date: 20071015 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20081008 |