EP1649054A1 - Method for diagnosing colorectal cancers - Google Patents

Method for diagnosing colorectal cancers

Info

Publication number
EP1649054A1
EP1649054A1 EP04747831A EP04747831A EP1649054A1 EP 1649054 A1 EP1649054 A1 EP 1649054A1 EP 04747831 A EP04747831 A EP 04747831A EP 04747831 A EP04747831 A EP 04747831A EP 1649054 A1 EP1649054 A1 EP 1649054A1
Authority
EP
European Patent Office
Prior art keywords
fgf
ofthe
crc
expression
compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04747831A
Other languages
German (de)
French (fr)
Inventor
Yusuke Nakamura
Yoichi Furukawa
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oncotherapy Science Inc
Original Assignee
Oncotherapy Science Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncotherapy Science Inc filed Critical Oncotherapy Science Inc
Publication of EP1649054A1 publication Critical patent/EP1649054A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57535Immunoassay; Biospecific binding assay; Materials therefor for cancer of the large intestine, e.g. colon, rectum or anus
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/04Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • the present invention relates to methods of diagnosing colorectal cancers.
  • colorectal carcinogenesis involves an accumulation of genetic alterations within a cell lineage, which include not only mutations that inactivate tumor suppressor genes and activate proto-oncogenes, but also amplifications of DNA and/or losses of DNA in certain chromosomal regions.
  • epigenetic events such as methylation, loss of imprinting, and/or dysregulated expression resulting from genetic changes or unknown mechanisms underlie the genesis of colorectal tumors.
  • Genes in the Wnt/wingless signaling pathway play critical roles in differentiation and morphogenesis during embryogenesis. Impaired regulation of this pathway often is a feature of tumors arising in the colon, liver, prostate, stomach, brain, endometrium- or elsewhere (3).
  • FGF2 stimulates tissue repair in the adult (14, 15).
  • inappropriate expression of FGFs and/or their receptors occurs in a wide range of human tumors including bladder, cervical and gastric cancers (16, 17).
  • FGF18 is the one that most closely resembles FGF8 and, like FGF2, FGF18 stimulates proliferation of NIH3T3 cells (18), osteoblasts (19), chondrocytes (19), and glial cells (20), and induces neurite outgrowth of PC12 rat pheochromocytoma cells (21).
  • FTIs farnesyltransferase
  • trastuzumab Clinical trials on human using a combination of anti-cancer drugs and an anti-HER2 monoclonal antibody, trastuzumab, have been conducted to antagonize the proto-oncogene receptor HER2/neu, and have been achieving improved clinical response and overall survival of breast-cancer patients (Lin et al., Cancer Res 61 :6345-9 (2001)).
  • a tyrosine kinase inhibitor, STI-571 which selectively inactivates bcr-abl fusion proteins, has been developed to treat chronic myelogenous leukemias, wherein constitutive activation of bcr-abl tyrosine kinase plays a crucial role in the transformation of leukocytes.
  • TAAs discovered so far include : MAGE (van der Bruggen et al., Science 254: 1643-7 (1991)), gplOO (Kawakami et al., J Exp Med 180: 347-52 (1994)) ; SART (Shichijo et al., J Exp Med 187: 277-88 (1998)) ; and NY-ESO-1 (Chen et al., Proc Natl Acad Sci USA 94: 1914-8 (1997)).
  • gene products demonstrated to be specifically overexpressed in tumor cells have been shown to be recognized as targets inducing cellular immune responses.
  • Such gene products include p53 (Umano et al., Brit J Cancer 84: 1052-7 (2001)) ; HER2/neu (Tanaka et al., Brit J Cancer 84: 94-9 (2001)) ; CEA (Nukaya et al., Int J Cancer 80: 92-7 (1999)), and so on.
  • PBMCs peripheral blood mononuclear cells
  • HLA-A24 and HLA-A0201 are popular HLA alleles in the Japanese population, as well as the Caucasian population (Date et al., Tissue Antigens 47: 93-101 (1996); Kondo et al., J Immunol 155: 4307-12 (1995); Kubo et al., J Immunol 152: 3913-24 (1994); Imanishi et al., Proceeding ofthe eleventh International Hictocompatibility Workshop and Conference Oxford University Press, Oxford, 1065 (1992); Williams et al., Tissue Antigen 49: 129 (1997)).
  • antigenic peptides of carcinomas presented by these HLAs may be especially useful for the treatment of carcinomas among Japanese and Caucasian.
  • the present inventors analyzed expression profiles of clinical samples from cancer patients using a genome- wide cDNA microarray.
  • the gene encoding fibroblast growth factor 18 (FGF18) was among those that showed elevated expression.
  • the promoter region of this gene was found to contain putative Tcf4- binding motifs; moreover a reporter-gene assay using the luciferase activity as a marker, as well as an electromobility-shift assay, indicated that FGF18 is a downstream transcription target in the ⁇ -catenin/Tcf4 pathway.
  • the present inventors demonstrated that exogenous FGF18 promoted growth of NIH3T3 cells in an autocrine manner, and that transfection of FGF18 siRNAs suppressed growth of colon-cancer cells in culture. These results indicate that FGF18 is activated in colon cancers as a direct downstream target ofthe Wnt signaling pathway, and, accordingly, represents a marker for early diagnosis and a molecular target for treatment of CRC.
  • the present invention is based on the discovery of a pattern of gene expression of FGF18 correlated with colorectal cancer (CRC).
  • the present invention features a method of diagnosing or determining a predisposition to CRC in a subject, including the step of detej-mining an expression level of FGF18 in a patient-derived biological sample, such as tissue sample.
  • a normal cell is one obtained from colorectal tissue.
  • An increase of the level of expression of the FGF 18 as compared to a normal control level ofthe gene indicates that the subject suffers from or is at risk for developing CRC.
  • normal control level is meant a level of gene expression detected in a normal, healthy individual or in a population of individuals not suffering from CRC.
  • a control level is a single expression pattern derived from a single reference population or from a plurality of expression patterns.
  • control level can be a database of expression patterns from previously tested cells.
  • a normal individual is one with no clinical symptoms of CRC and no family history of CRC.
  • An increase in the level of expression of FGF 18 detected in a test sample as compared to a normal control level indicates the subject (from which the sample was obtained) suffers from or is at risk for developing CRC.
  • Gene expression is preferably increased 10%, 25%, 50% as compared to the control level. Alternately, gene expression may be increased 0.1, 0.2, 1, 2, 5, 10 or more fold as compared to the control level. Expression is determined by detecting hybridization, e.g. , the binding of an FGF 18 gene probe to a gene transcript ofthe patient-derived tissue sample.
  • the patient-derived tissue sample may be any tissue from a test subject, e.g., a patient known to or suspected of having CRC.
  • the tissue may contain a colorectal cancer cell.
  • the tissue is preferably a cell from colon.
  • the present invention further provides methods for identifying agents that inhibit the expression or activity of FGF 18, including the steps of contacting a test cell expressing
  • Therapeutic methods ofthe present invention include a method of treating or preventing CRC in a subject by adm-mistering to the subject an antisense compositionthat reduces the expression of a specific target gene, e.g., an antisense composition containing a nucleotide which is complementary to a nucleic acid sequence of FGF18.
  • Another method includes the steps of administering to a subject a small interfering RNA (siRNA) composition.
  • the siRNA composition reduces the expression of a nucleic acid of FGF 18.
  • Fig. 3 depicts the results of EMS A ofthe ⁇ -catenin/Tcf4 complex using TBM3- oligonucleotide as a probe.
  • a super-shifted band was observed after addition of anti- ⁇ - catenin antibody (lanes 2 and 7) but was not elicited by anti-P53 -antibody (lane 3).
  • Bands corresponding to the DNA-protein complex were reduced by addition of non- labeled wild-type probe (lanes 4, 5), but not by non-labeled mutant probe (lanes 6, 7).
  • Fig. 4. depicts the growth promoting effect of FGF 18 (A and B) or the growth suppressive effect of FGF18-siRNAs (C, D, and E).
  • Fig. 4A depicts the immunoblotting of Flag-tagged FGF 18 protein secreted into culture media. Proteins in the medium and cell lysate were immunoblotted with anti-Flag antibody. NIH3T3 cells were transfected with either pFlagCMN or pFlagCMV-FGFl 8. Black and open triangles indicate the cellular or secreted forms respectively of tagged FGF18 protein.
  • Fig. 4A depicts the growth promoting effect of FGF 18 (A and B) or the growth suppressive effect of FGF18-siRNAs (C, D, and E).
  • Fig. 4A depicts the immunoblotting of Flag-tagged FGF 18 protein secreted into culture media. Proteins in the medium and cell lysate were immunoblotted with anti-Flag antibody. NIH3T3 cells were trans
  • FIG. 4B depicts the microscopic appearance of NIH3T3 cells after incubation in DMEM conta ing 0.5% FBS (left), in the conditioned medium after fransfection with pFlagCMV-FGF18 (center), and in the conditioned medium after transfection with pFlagCMN (right).
  • Fig. 4C depicts the effect of FGF 18 siRNAs on expression of FGF18.
  • the present invention is based in part on the discovery of elevated expression of FGF 18 in colon cells of patients with CRC.
  • the elevated gene expression was identified using a comprehensive cDNA microarray system.
  • a cDNA microarray containing 23,040 genes comprehensive gene- expression profiles of 20 patients were previously constructed.
  • FGF 18 was found to be expressed at high levels in CRC patients.
  • candidate molecular markers were selected with the potential of detecting cancer-related proteins in serum or sputum of patients, and some potential targets for development of signal-suppressing strategies in human colorectal cancer were discovered.
  • FGF18 identified herein are used for diagnostic purposes as a marker of CRC and for therapeutic purposes, as a gene target, the expression of which may be altered to treat or alleviate a symptom of CRC.
  • CRC By measuring expression of FGF 18 in a sample of cells, CRC is diagnosed.
  • agents for treating CRC can be identified.
  • the present invention involves detej-mining (e.g., measuring) the expression of FGF18. Using sequence information provided by the GeneBankTM database entries for the FGF 18 sequence, FGF 18 is detected and measured using techniques well known to one of ordinary skill in the art.
  • sequences witi-in the sequence database entries corresponding to FGF 18 may be used to construct probes for detecting an FGF 18 RNA sequence in, e.g., northern blot hybridization analysis.
  • the sequences can be used to construct primers for specifically amplifying FGF 18 in, e.g, amplification-based detection methods, such as reverse-transcription based polymerase chain reaction.
  • Expression level of FGF 18 in the test cell population e.g., a patient-derived tissue sample, is then compared to expression level of FGF 18 in a reference cell population.
  • the reference cell population includes one or more cells for which the compared parameter is known, i.e., CRC cells or non-CRC cells.
  • a pattern of gene expression in the test cell population as compared to the reference cell population indicates CRC or a predisposition thereto depends upon the composition ofthe reference cell population. For example, if the reference cell population is composed of non-CRC cells, a similar gene expression pattern in the test cell population and reference cell population indicates the test cell population is non-CRC. Conversely, if the reference cell population is made up of CRC cells, a similar gene expression profile between the test cell population and the reference cell population indicates that the test cell population includes CRC cells.
  • a level of expression of a CRC marker gene in a test cell population is considered altered in levels of expression in the reference cell population if its expression level varies by more than 1.0, 1.5, 2.0, 5.0, 10.0 or more fold from the expression level ofthe corresponding marker gene, e.g., FGF18, in the reference cell population.
  • Differential gene expression between a test cell population and a reference cell population is normalized to a control nucleic acid, e.g. a housekeeping gene.
  • a confrol nucleic acid is one which is known not to differ depending on the endometriotic or non- endometriotic state ofthe cell. Expression levels ofthe control nucleic acid in the test and reference nucleic acid can be used to normalize signal levels in the compared populations.
  • Confrol genes include ⁇ -actin, glyceraldehyde 3- phosphate dehydrogenase or ribosomal protein P 1.
  • the test cell population is preferably compared to multiple reference cell populations. Each ofthe multiple reference populations may differ in the known parameter. Thus, a test cell population may be compared to a second reference cell population known to contain, e.g., CRC cells, as well as a second reference population known to contain, e.g. , non-CRC cells (normal cells).
  • the test cell is included in a tissue type or cell sample from a subject known to contain or suspected of containing CRC cells.
  • the test cell is obtained from a bodily tissue or a bodily fluid, e.g., biological fluid (such as blood or urine).
  • FGF 18 a human, non- human primate, mouse, rat, dog, cat, horse, or cow.
  • Expression of FGF 18 disclosed herein is determined at the protein or nucleic acid level using methods known in the art. For example, Northern hybridization analysis using probes which specifically recognize the FGF 18 nucleotide sequence can be used to determine gene expression. Alternatively, expression may be measured using reverse- transcription-based PCR assays, e.g., using primers specific for FGF18. Expression may also be determined at the protein level, i.e., by measuring the levels of polypeptide encoded by the gene product described herein, or biological activity thereof.
  • Such methods include, e.g., irnmunoassays based on antibodies to a protein encoded by FGF 18.
  • the biological activity ofthe protein encoded by the gene is also well known. It is kown that recombinant rat FGF 18 induces neurite outgrowth in PC 12 cells (21) and transgenic mice overexpressing FGF 18 in the liver exhibites an increase in liver weight and hepatocellular proliferation (18). FGF18 stimulats proliferation and inhibites differentiation and matrix synthesis in all cultures of mouse osteoblasts and chondrocytes (19).
  • FGF 18 also induces osteoclast formation through RANKL and cyclooxygenase-2 and stimulates osteoclasts to form resorbed pits on a cultured mouse dentine slice (19). It is noted that these effects are similar to those of FGF2 and proposed that FGF18 and FGF2 may be redundant in their effects on bone and cartilage. It is also kwon that conditional overexpression ⁇ FGF18 in lung epithelial cells during fetal development disrupts branching morphogenesis ofthe lung (29).
  • FGF 18 in a test population of cells i. e. , a patient-derived biological sample
  • the test cell population contains an epithelial cell, e.g., a cell obtained from colon tissue.
  • Gene expression may also be measured in blood or other bodily fluids such as urine.
  • FGF 18 is determined in the test cell or biological sample and then compared to the expression level ofthe normal control.
  • a normal control level is an expression profile of FGF 18 typically found in a population known not to be suffering fro CRC.
  • An increase ofthe level of expression in the patient-derived tissue sample of FGF 18 indicates that the subject is suffering from or is at risk for developing CRC.
  • Alteration of FGF18 in the test population as compared to the normal confrol indicates that the subject suffers from or is at risk for developing CRC.
  • the test cell may be a cell, which has been transfected with FGF18 or which has been transfected with a regulatory sequence (e.g., a promoter sequence) from FGF18 operably linked to a reporter gene.
  • a regulatory sequence e.g., a promoter sequence
  • a candidate compound that interferes with the binding between the ⁇ -catenin/Tcf4 binding motif and the ⁇ - catenin/Tcf4 complex may be identified as an inhibiting agent of FGF18.
  • a difference in expression between FGF18 in the test population and a normal confrol reference cell population indicates the less favorable clinical outcome or prognosis.
  • efficacious is meant that the treatment leads to a reduction in expression of a pathologically up-regulated gene, a increase in expression of a pathologically down- regulated gene or a decrease in size, prevalence, or metastatic potential of colorectal tumors in a subject.
  • freatment When freatment is applied prophylactically, “efficacious” means that the freatment retards or prevents CRC from forming or retards, prevents, or alleviates a symptom of clinical CRC. Assessment of colorectal tumors are made using standard clinical protocols. Efficaciousness is determined in association with any known method for diagnosing or treating CRC. CRC is diagnosed for example, by identifying symptomatic anomalies,.
  • a therapeutic agent for treating CRC that is appropriate for a particular individual Differences in the genetic makeup of individuals can result in differences in their relative abilities to metabolize various drugs.
  • An agent that is metabolized in a subject to act as an anti-CRC agent can manifest itself by inducing a change in gene expression pattern in the subject's cells from that characteristic of an CRC state to a gene expression pattern characteristic of a non-CRC state. Accordingly, the differentially expressed
  • the present invention provides methods for screening candidate agents which are potential targets in the freatment of CRC. As discussed in detail above, by controlling the expression level or activity of a marker gene, one can control the onset and progression of CRC. Thus, candidate agents, which are potential targets in the freatment of CRC, can be identified through screenings that use the expression levels and activities of marker genes as indices.
  • the cell proliferative activity of FGF 18 may be selected as the biological activity.
  • the cell proliferative activity of FGF18 may be detected by proliferation of a cell line such as NIH3T3.
  • the screening method ofthe present invention may comprise the following steps: a) contacting a candidate compound with a cell into which a vector comprising the franscriptional regulatory region of FGF 18 and a reporter gene that is expressed under the control ofthe franscriptional regulatory region has been introduced ; b) measuring the activity or expression of said reporter gene; and c) selecting a compound that reduces the activity or expression level of said reporter gene, as compared to a confrol.
  • Suitable reporter genes and host cells are well known in the art.
  • the reporter construct required for the screening can be prepared by using the franscriptional regulatory region of a marker gene. When the transcriptional regulatory region of a marker gene is known to those skilled in the art, a reporter construct can be prepared by using the previous sequence information.
  • the compound isolated by the screening is a candidate for drugs that inhibit the activity ofthe protein encoded by marker gene and, therefore, can be applied to the treatment or prevention of CRC.
  • compound in which a part ofthe structure ofthe compound inhibiting the activity of protein encoded by marker gene is converted by addition, deletion and/or replacement are also included in the compounds obtainable by the screening method ofthe present invention.
  • the isolated compound When administrating the compound isolated by the method ofthe invention as a pharmaceutical for humans and other mammals, such as mice, rats, guinea-pigs, rabbits, cats, dogs, sheep, pigs, cattle, monkeys, baboons, and chimpanzees, the isolated compound can be directly administered or, alternatively, can be formulated into a dosage form using known pharmaceutical preparation methods.
  • the drugs can be taken orally, as sugar-coated tablets, capsules, elixirs and microcapsules, or non-orally, in the form of injections of sterile solutions or suspensions with water or any other pharmaceutically acceptable liquid.
  • the compounds can be mixed with pharmaceutically acceptable carriers or media, such as sterilized water, physiological saline, plant-oils, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders, and such, in a unit dose form required for generally accepted drug implementation.
  • the amount of active ingredients in these preparations makes a suitable dosage within the indicated range acquirable.
  • additives that can be mixed to tablets and capsules are, binders such as gelatin, corn starch, tragacanth gum and arabic gum; excipients such as crystalline cellulose; swelling agents such as corn starch, gelatin and alginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose or saccharin; and flavoring agents such as peppermint, Gaultheria adenothrix oil and cherry.
  • a liquid carrier such as an oil, can also be further included in the above ingredients.
  • Sterile composites for injections can be formulated following normal drug implementations using vehicles such as distilled water used for injections.
  • the dosage and method of administration vary according to the body- weight and age ofthe patient and the administration method selected; however, one skilled in the art can routinely select a suitable dosage and method of administration. If said compound is encodable by a DNA, the DNA can be inserted into a vector for gene therapy and the vector administered to a patient to perform the therapy. Though the dosage and method of administration vary according to the body- weight, age, and symptoms ofthe patient, one skilled in the art can suitably select them.
  • Assessing the prognosis of a subject with CRC Also provided herein is a method of assessing the prognosis of a subject with CRC by comparing the expression of FGF 18 in a test cell population to the expression of the gene in a reference cell population derived from patients over a spectrum of disease stages.
  • expression may be inhibited by adn-iinistering to the subject a nucleic acid that inhibits, or antagonizes, the expression ofthe over-expressed gene, e.g., an antisense oligonucleotide or small interfering RNA (siRNA) which disrupts expression ofthe over-expressed gene.
  • antisense nucleic acids corresponding to the nucleotide sequence of FGF 18 can be used to reduce the expression level of FGF 18.
  • Antisense nucleic acids corresponding to the nucleotide sequence of FGF 18 that are up-regulated in CRC are useful for the freatment of CRC.
  • the antisense nucleic acids ofthe present invention may act by binding to the nucleotide sequence of FGF 18 or an mRNA corresponding thereto, thereby i-nhibiting the transcription or franslation ofthe gene, promoting the degradation ofthe mRNA, and/or i-nhibiting the expression of protein encoded by a nucleic acid of FGF 18, finally inhibiting the function ofthe proteins .
  • the term "antisense nucleic acids" as used herein encompasses both nucleotides that are entirely complementary to the target sequence and those having one or more nucleotide mismatches, so long as the antisense nucleic acids can specifically hybridize to the target sequences.
  • An antisense-mounting medium can also be used to increase durability and membrane-permeability. Examples are, liposomes, poly-L-lysine, lipids, cholesterol, lipofectin or derivatives of these.
  • the dosage ofthe antisense nucleic acid derivative ofthe present invention can be adjusted suitably according to the patient's condition and used in desired amounts. For example, a dose range of 0.1 to 100 mg/kg, preferably 0.1 to 50 mg/kg can be administered.
  • the antisense nucleic acids of present invention include modified oligonucleotides. For example, thioated nucleotides may be used to confer nuclease resistance to an oligonucleotide.
  • the present invention also provides siRNA having the general formula 5 ' - [A] - [B] - [A' ] -3 ' , wherein [A] is a ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID NO: 21, [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides, and [A'] is a ribonucleotide sequence consisting ofthe complementary sequence of [A].
  • the region [A] hybridizes to [A'], and then a loop consisting of region [B] is formed.
  • the loop sequence may be preferably 3 to 23 nucleotide in length.
  • the loop sequence for example, can be selected from group consisting of following sequences (http://www.ambion.com/techlib/tb/tb. 506.html). Furthermore, loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque, J.-M., Triques, K., and Stevenson, M. (2002) Modulation of HIV-l replication by RNA interference. Nature 418 : 435-438.) : 1. CCC, CCACC or CCACACC: Jacque, J. M, Triques, K., and Stevenson, M (2002) Modulation of HIN-1 replication by R ⁇ A interference. Nature, Vol. 418: 435-438 ; 2.
  • UUCG Lee, N.S., Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A., Salvaterra, P., and Rossi, J. (2002) Expression of small interfering RNAs targeted against HIV- 1 rev transcripts in human cells. Nature Biotechnology 20 : 500-505. Fruscoloni, P., Zamboni, M., and Toccl-dni-Nalentini, G. P. (2003) Exonucleolytic degradation of double-stranded R ⁇ A by an activity in Xenopus laevis germinal vesicles. Proc. ⁇ atl. Acad. Sci. USA 100(4): 1639-1644 ; and 3.
  • UUCAAGAGA Dykxhoorn, D. M., ⁇ ovina, C. D., and Sharp, P. A. (2002) Killing the messenger: Short R ⁇ As that silence gene expression. Nature Reviews Molecular Cell Biology 4: 457-467.
  • An exemplary siRNA o the present invention having hairpin loop structure comprises : gguucuggagaacaacuacu-[b]-aguaguuguucuccagaacc (for target sequence of SEQ ID NO:21).
  • the loop sequence can be selected from group consisting of, CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA.
  • a preferable loop sequence is UUCAAGAGA ("ttcaagaga" in DNA).
  • the regulatory sequences flanking the FGF 18 sequence are identical or are different, such that their expression can be modulated independently, or in a temporal or spatial manner.
  • siRNAs are transcribed infracellularly by cloning the FGF 18 gene template into a vector containing, e.g., a RNA pol III franscription unit from the small nuclear RNA (snR A) U6 or the human HI RNA promoter.
  • transfection-enhancing agent can be used for introducing the vector into the cell. FuGENE (Rochediagnostices), Lipofectamin 2000 (Invitrogen), Oligofectamin (Invitrogen), and Nucleofactor (Wako pure Chemical) are useful as the transfection-enhancing agent.
  • the oligonucleotide is 19-25 nucleotides in length. Most preferably, the oligonucleotide is less than 75, 50 , 25 nucleotides in length.
  • FGF 18 siRNA oligonucleotide which inhibit the expression in mammalian cells include the target sequence containing SEQ ID NO: 21.
  • the nucleotide sequence ofthe siRNAs utilized herein were designed using a siRNA design computer program available from the Ambion website (http://www.ambion.com/techlib/ misc/siRNA_finder.html). The computer program selects nucleotide sequences for siRNA synthesis based on the following protocol. Selection of siRNA Target Sites: 1.
  • the homology search can be performed using BLAST, which can be found on the NCBI server at: www.ncbi.nlm.nih.gov/BLAST/. 3. Select qualifying target sequences for synthesis. At Ambion, preferably several target sequences can be selected along the length ofthe gene for evaluation.
  • the antisense oligonucleotide or siRNA ofthe invention inhibit the expression of the polypeptide ofthe invention and are thereby useful for suppressing the biological activity ofthe polypeptide ofthe invention.
  • expression-inhibitors, comprising the antisense oligonucleotide or siRNA ofthe invention are useful in the point that they can inhibit the biological activity o the polypeptide ofthe invention.
  • a composition comprising the antisense oligonucleotide or siRNA ofthe present invention are useful in treating a CRC.
  • function of gene product ofthe over-expressed gene may be inhibited by administering a compound that binds to or otherwise inhibits the function ofthe gene products.
  • the compound may be an antibody which binds to the over- expressed gene product.
  • the present invention encompasses the use of antibodies, particularly antibodies against a protein encoded by an up-regulated marker gene, as well as fragments of such antibodies.
  • an antibody refers to an immunoglobulin molecule having a specific structure, that interacts (i.e., binds) only with the antigen that was used for synthesizing the antibody (i.e., the up-regulated marker gene product) or with an antigen closely related to it.
  • an antibody may be a fragment of an antibody or a modified antibody, so long as it binds to the protein encoded by the marker gene.
  • the antibody fragment may be Fab, F(ab') 2 , Fv, or single chain Fv (scFv), in which Fv fragments from H and L chains are ligated by an appropriate linker (Huston J. S. et al. Proc. Natl. Acad. Sci.
  • an antibody fragment may be generated by freating an antibody with an enzyme, such as papain or pepsin.
  • an enzyme such as papain or pepsin.
  • a gene encoding the antibody fragment may be constructed, inserted into an expression vector, and expressed in an appropriate host cell (see, for example, Co M. S. et al. J. Immunol. 152:2968-2976 (1994); Better M. and Horwitz A. H. Methods Enzymol. 178:476-496 (1989); Pluckthun A. and Skerra A. Methods Enzymol. 178:497-515 (1989); Lamoyi E. Methods Enzymol. 121:652-663 (1986); Rousseaux J.
  • An antibody may be modified by conjugation with a variety of molecules, such as polyethylene glycol (PEG).
  • PEG polyethylene glycol
  • the present invention provides such modified antibodies.
  • the modified antibody can be obtained by chemically modifying an antibody. These modification methods are conventional in the field.
  • an antibody may be obtained as a chimeric antibody, between a variable region derived from a nonhuman antibody and a constant region derived from a human antibody, or as a humanized antibody, comprising the complementarity determining region (CDR) derived from a nonhuman antibody, the frame work region (FR) and the constant region derived from a human antibody.
  • CDR complementarity determining region
  • FR frame work region
  • Cancer therapies directed at specific molecular alterations that occur in cancer cells have been validated through clinical development and regulatory approval of anti-cancer drugs such as frastuzumab (Herceptin®) for the treatment of advanced breast cancer, imatinib methylate (Gleevec®) for chronic myeloid leukemia, gefitinib (Iressa®) for non- small cell lung cancer (NSCLC), and rituximab (anti-CD20 mAb) for B-cell lymphoma and mantle cell lymphoma (Ciardiello F, Tortora G.
  • a novel approach in the treatment of cancer targeting the epidermal growth factor receptor. Clin Cancer Res. 2001 Oct;7(10):2958-70.
  • targeted drugs can enhance the efficacy of standard chemotherapy when used in combination with it (Gianni L. (2002). Oncology, 63 Suppl 1, 47-56.; Klejman A, Rushen L, Morrione A, Slupianek A and Skorski T. (2002). Oncogene, 21, 5868-5876.). Therefore, future cancer treatments will probably involve combining conventional drugs with target-specific agents aimed at different characteristics of tumor cells such as angiogenesis and invasiveness. These modulatory methods are performed ex vivo or in vitro (e.g., by culturing the cell with the agent) or, alternatively, in vivo (e.g., by adn-unistering the agent to a subject).
  • the methods involve administering a protein or combination of proteins or a nucleic acid molecule or combination of nucleic acid molecules as therapy to counteract aberrant expression or activity ofthe differentially expressed genes.
  • Diseases and disorders that are characterized by increased (relative to a subject not suffering from the disease or disorder) levels of biological activity ofthe genes may be treated with therapeutics that antagonize (i.e., reduce or inhibit) activity ofthe over- expressed gene or genes.
  • Therapeutics that antagonize activity are administered therapeutically or prophylactically.
  • Therapeutics that may be utilized include, e.g., (i) a polypeptide, or analogs, derivatives, fragments or homologs thereof of the over-expressed sequence (ii) antibodies to the over-expressed sequence (iii) nucleic acids encoding the over-expressed sequence; (iv) antisense nucleic acids or nucleic acids that are "dysfunctional" (i.e., due to a heterologous insertion within the coding sequence of over-expressed sequence); (v) small interfering RNA (siRNA); or (vi) modulators (i.e., inhibitors, agonists and antagonists that alter the interaction between an over -expressed polypeptide and its binding partner.
  • modulators i.e., inhibitors, agonists and antagonists that alter the interaction between an over -expressed polypeptide and its binding partner.
  • the dysfunctional antisense molecule is utilized to "knockout" endogenous function of a polypeptide by homologous recombination (see, e.g., Capecchi, Science 244: 1288-1292 1989) .
  • Increased levels can be readily detected by quantifying peptide and/or RNA, by obtaining a patient tissue sample (e.g., from biopsy tissue) and assaying it in vitro for RNA or peptide levels, structure and/or activity ofthe expressed peptides (or m-RNAs of a gene whose expression is altered).
  • Methods that are well-known within the art include, but are not limited to, immunoassays (e.g., by Western blot analysis, im unoprecipitation followed by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, j-mmunocytochemistry, etc.) and/or hybridization assays to detect expression of m-RNAs (e.g., Northern assays, dot blots, in situ hybridization, etc.).
  • immunoassays e.g., by Western blot analysis, im unoprecipitation followed by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, j-mmunocytochemistry, etc.
  • hybridization assays to detect expression of m-RNAs (e.g., Northern assays, dot blots, in situ hybridization, etc.).
  • Prophylactic administration occurs prior to the manifestation of overt clinical symptoms of disease, such that
  • Therapeutic methods of the present invention include contacting a cell with an agent that modulates one or more of the activities of the gene product of the differentially expressed gene.
  • An agent that modulates protein activity includes a nucleic acid or a protein, a naturally-occurring cognate ligand of these proteins, a peptide, a peptidomimetic, or other small molecule.
  • the present invention also relates to a method of treating or preventing CRC in a subject comprising administering to said subject a vaccine comprising a polypeptide encoded by a nucleic acid of FGF 18, an immunologically active fragment of said polypeptide, or a polynucleotide encoding the polypeptide or the fragment thereof.
  • a polypeptide encoded by a nucleic acid of FGF 18, an immunologically active fragment of said polypeptide, or a polynucleotide encoding the polypeptide is administered.
  • the polypeptide or the immunologically active fragments thereof are useful as vaccines against CRC.
  • the proteins or fragments thereof may be administered in a form bound to the T cell recepor (TCR) or presented by an antigen presenting cell (APC), such as macrophage, dendritic cell (DC), or B-cells. Due to the strong antigen presenting ability of DC, the use of DC is most preferable among the APCs.
  • vaccine against CRC refers to a substance that has the function to induce anti-tumor --mmunity upon inoculation into animals.
  • polypeptides encoded by a nucleic acid of FGF 18 or fragments thereof were suggested to be HLA-A24 or HLA-A*0201 restricted epitopes peptides that may induce potent and specific immune response against CRC cells expressing FGFl 8.
  • the present invention also encompasses method of inducing anti-tumor immunity using the polypeptides.
  • anti-tumor immunity includes immune responses such as follows: - induction of cytotoxic lymphocytes against tumors, - induction of antibodies that recognize tumors, and - induction of anti-tumor cytokine production. Therefore, when a certain protein induces any one of these immune responses upon inoculation into an animal, the protein is decided to have anti-tumor immunity inducing effect.
  • the induction ofthe anti-tumor immunity by a protein can be detected by observing in vivo or in vitro the response ofthe immune system in the host against the protein. For example, a method for detecting the induction of cytotoxic T lymphocytes is well known.
  • a foreign substance that enters the living body is presented to T cells and B cells by the action of antigen presenting cells (APCs).
  • T cells that respond to the antigen presented by APC in antigen specific manner differentiate into cytotoxic T cells (or cytotoxic T lymphocytes; CTLs) due to stimulation by the antigen, and then proliferate (this is referred to as activation of T cells). Therefore, CTL induction by a certain peptide can be evaluated by presenting the peptide to T cell by APC, and detecting the induction of CTL.
  • APC has the effect of activating CD4+ T cells, CD8+ T cells, macrophages, eosinophils, and NK cells.
  • CD4+ T cells and CD8+ T cells are also important in anti-tumor ij-nmunity, the anti-tumor --mmunity inducing action ofthe peptide can be evaluated using the activation effect of these cells as indicators.
  • a method for evaluating the inducing action of CTL using dendritic cells (DCs) as APCs is well known in the art.
  • a DC is a representative APC having the strongest CTL inducing action among APCs.
  • the test polypeptide is initially contacted with a DC, and then this DC is contacted with T cells. Detection of T cells having cytotoxic effects against the cells of interest after the contact with DCs shows that the test polypeptide has an activity of inducing the cytotoxic T cells.
  • Activity of CTLs against tumors can be detected, for example, using the lysis of 51 Cr-labeled tumor cells as the indicator.
  • the method of evaluating the degree of tumor cell damage using 3 H-thymidine uptake activity or LDH (lactose dehydrogenase)-release as the indicator is also well known.
  • LDH lactose dehydrogenase
  • PBMCs peripheral blood mononuclear cells
  • the induction of CTLs is reported that the it can be enhanced by culturing PBMC in the presence of GM-CSF and IL-4.
  • CTLs have been shown to be induced by culturing PBMC in the presence of keyhole limpet hemocyanin (KLH) and IL- 7.
  • KLH keyhole limpet hemocyanin
  • test polypeptides confirmed to possess CTL-inducing activity by these methods are polypeptides having a DC activation effect and subsequent CTL-inducing activity. Therefore, polypeptides that induce CTLs against tumor cells are useful as vaccines against tumors. Furthermore, APCs that have acquired the ability to induce CTLs against tumors by contacting with the polypeptides are useful as vaccines against tumors. Furthermore, CTLs that have acquired cytotoxicity against tumors due to presentation ofthe polypeptide antigens by APC can be also used as vaccines against tumors. Such therapeutic methods for tumors using anti-tumor immunity due to APCs and CTLs are referred to as cellular immunotherapy.
  • the induction of anti-tumor immunity by a polypeptide can be confirmed by observing the induction of antibody production against tumors. For example, when antibodies against a polypeptide are induced in a laboratory animal -.mmunized with the polypeptide, and when growth of tumor cells is suppressed by those antibodies, the polypeptide can be determined to have an ability to induce anti-tumor immunity.
  • Anti-tumor j-mmunity is induced by administering the vaccine of this invention; the induction of anti-tumor immunity enables treatment and prevention of CRC.
  • Therapy against cancer or prevention ofthe onset of cancer includes any ofthe steps, such as inhibition ofthe growth of cancerous cells, involution of cancer, and suppression of occurrence of cancer. Decrease in mortality of individuals having cancer, decrease in tumor markers in the blood, alleviation of detectable symptoms accompanying cancer, and such are also included in the therapy or prevention of cancer.
  • Such therapeutic and preventive effects are preferably statistically significant, for example, in observation, at a significance level of 5% or less, wherein the therapeutic or preventive effect of a vaccine against cell proliferative diseases is compared to a confrol without vaccine administration.
  • the above-mentioned protein having immunological activity or a vector encoding the protein may be combined with an adjuvant.
  • An adjuvant refers to a compound that enhances the immune response against the protein when administered together (or successively) with the protein having immunological activity.
  • adjuvants include cholera toxin, salmonella toxin, alum, and such, but are not limited thereto.
  • the vaccine of this invention may be combined with an appropriate pharmaceutically acceptable carrier. Examples of such carriers include sterilized water, physiological saline, phosphate buffer, culture fluid, and such.
  • the vaccine may contain as necessary, stabilizers, suspensions, preservatives, surfactants, and such.
  • the vaccine is administered systemically or locally.
  • Vaccine administration may be performed by single administration, or boosted by multiple aclministrations.
  • tumors can be treated or prevented, for example, by the ex vivo method. More specifically, PBMCs ofthe subject receiving treatment or prevention are collected, the cells are contacted with the polypeptide ex vivo, and following the induction of APCs or CTLs, the cells may be administered to the subject.
  • APCs can be also induced by introducing a vector encoding the polypeptide into PBMCs ex vivo.
  • APCs or CTLs induced in vitro can be cloned prior to administration. By cloning and growing cells having high activity of damaging target cells, cellular immunotherapy can be performed more effectively. Furthermore, APCs and CTLs isolated in this manner may be used for cellular immunotherapy not only against individuals firom whom the cells are derived, but also against other individuals who has similar types of tumors. Furthermore, a pharmaceutical composition for treating or preventing a cell proliferative disease, such as cancer, comprising a pharmaceutically effective amount of the polypeptide ofthe present invention is provided. The pharmaceutical composition may be used for raising anti-tumor immunity.
  • compositions for inhibiting CRC include those suitable for oral, rectal, nasal, topical
  • compositions suitable for oral administration include capsules, cachets or tablets, each containing a predetermined amount ofthe active ingredient.
  • Formulations also include powders, granules or solutions, suspensions or emulsions.
  • the active ingredient is optionally administered as a bolus electuary or paste.
  • Tablets and capsules for oral administration may contain conventional excipients such as binding agents, fillers, lubricants, disintegrants or wetting agents.
  • a tablet may be made by compression or molding, optionally with one or more formulational ingredients.
  • Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing agent.
  • Molded tablets may be made by molding in a suitable machine a mixture ofthe powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art.
  • Oral fluid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives.
  • the tablets may optionally be formulated so as to provide slow or controlled release ofthe active ingredient therein.
  • a package of tablets may contain one tablet to be taken on each day ofthe month.
  • Formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood ofthe intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
  • the formulations may be presented in unit dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a fireeze-dried (lyophilized) condition requiring only the addition ofthe sterile liquid carrier, for example, saline, water- for-injection, immediately prior to use. Alternatively, the formulations may be presented for continuous infusion.
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets ofthe kind previously described.
  • Formulations for rectal administration include suppositories with standard carriers such as cocoa butter or polyethylene glycol.
  • Formulations for topical admimstration in the mouth include lozenges, which contain the active ingredient in a flavored base such as sucrose and acacia or fragacanth, and pastilles comprising the active ingredient in a base such as gelatin and glycerin or sucrose and acacia.
  • the compounds ofthe invention may be used as a liquid spray or dispersible powder or in the form of drops.
  • Drops may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents or suspending agents.
  • the compounds are conveniently delivered from an insufflator, nebulizer, pressurized packs or other convenient means of delivering an aerosol spray.
  • Pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichiorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be deteraiined by providing a valve to deliver a metered amount.
  • the compounds may take the form of a dry powder composition, for example a powder mix ofthe compound and a suitable powder base such as lactose or starch.
  • the powder composition may be presented in unit dosage form, in for example, capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflators.
  • Other formulations include implantable devices and adhesive patches; which release a therapeutic agent. When desired, the above described formulations, adapted to give sustained release ofthe active ingredient, may be employed.
  • the pharmaceutical compositions may also contain other active ingredients such as antimicrobial agents, immunosuppressants or preservatives.
  • the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example, those suitable for oral administration may include flavoring agents.
  • Preferred unit dosage formulations are those containing an effective dose, as recited below, or an appropriate fraction thereof, ofthe active ingredient.
  • the compositions e.g., polypeptides and organic compounds, may be aclministered orally or via injection at a dose of from about 0.1 to about 250 mg/kg per day.
  • the dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day.
  • Tablets or other unit dosage forms of presentation provided in discrete units may conveniently contain an amount which is effective at such dosage or as a multiple ofthe same, for instance, units containing about 5 mg to about 500 mg, usually from about 100 mg to about 500 mg.
  • the dose employed will depend upon a number of factors, including the age and sex ofthe subject, the precise disorder being treated, and its severity. Also the route of administration may vary depending upon the condition and its severity. The invention will be further described in the following examples, which do not limit the scope ofthe invention described in the claims.
  • Human colon-cancer cell lines SW480 HCT116 and DLD1, and murine fibroblast line NIH3T3 were obtained from the American Type Culture Collection (ATCC, Rockville, MD).
  • Human colon-cancer cell lines SNUC4 and SNUC5 were obtained from the Korean cell line bank (KCLB, Seoul, Korea). All ofthe cells were cultured as monolayers in appropriate media, as follows: Leibovitz's L-15 (Invitrogen, Carlsbad, CA) for SW480, MaCoy's 5A (Invitrogen) for HCT116, RPMI1640 (Sigma-Aldrich Corporation, St.
  • GPDH glyceraldehyde-3-phosphate dehydrogenase gene
  • Primer sequences were 5'- ACAACAGCCTCAAGATCATCAG-3'(SEQ ID NO: 1) and 5'- GGTCCACCACTGACACGTTG-3'(SEQ ID NO: 2) for GAPDH, and 5*- GGACATGTGCAGGCTGGGCTA-3'(SEQ ID NO: 3) and 5'-
  • FGF 18 Effect of FGF 18 on cell survival in vitro.
  • the entire coding region of human FGFl 8 was amplified by RT-PCR using primers 5'-CCTCAAGCTTAGCGATGTATTCA-3'(SEQ ID NO: 6) and either 5'- CGGTCTAGACTAGGCAGGGTGT-3'(SEQ ID NO: 7) or 5'- CCTCTCTCGAGGGCAGGGTGTGT-3'(SEQ ID NO: 8), and cloned into appropriate cloning sites of expression vectors pcDNA3.1(+) (Invitrogen) or pFlagCMV5 (Sigma- Aldrich).
  • Plasmids expressing FGF 18 (pcDNA-FGF18 or pFlag-FGF18) or empty vector (pcDNA or pFlagCMV5) were transfected into murine fibroblast NIH3T3 cells for a focus- formation assay.
  • pcDNA-FGF18 or pFlag-FGF18 or empty vector (pcDNA or pFlagCMV5) were transfected into murine fibroblast NIH3T3 cells for a focus- formation assay.
  • the medium supporting NIH3T3 cells transfected with either pFlag-FGF18 or empty vector was conditioned with 0.5% FBS; growth of these cells was analyzed by MTT assay.
  • RNA polymerase III Transcription ofthe HI RNA gene by RNA polymerase III produces short transcripts with uridines at the 3' ends.
  • a genomic fragment containing the promoter region of Hi RNA was amplified by PCR, using primers 5'- TGGTAGCCAAGTGCAGGTTATA-3' (SEQ ID NO: 9), and 5'-
  • the product was purified and cloned into pCR2.1 plasmid vector using a TA cloning kit, according to the supplier's protocol (Invitrogen).
  • the BamHL, Xhol fragment containing HI RNA was purified and cloned into pcDNA3.1(+) between nucleotides 56 and 1257, and the fragment was amplified by PCR using primers 5'-
  • a control plasmid, psiHIBX-EGFP was prepared by cloning double-stranded oligonucleotides 5'- CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTC- 3'(SEQ ID NO: 17) and 5'- AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCTGCTTC- 3'(SEQ ID NO: 18) into the Bbsl site in the psiHIBX vector.
  • MTT assay Cells (lxl 0 5 ) on 6-well plates were transfected with expression vector or confrol vector using FuGene ⁇ (Roche diagnostics) according to the supplier's protocol. Cell viability was evaluated by MTT assay seven days after fransfection. Cell-counting kit-8 (DOJENDO) was added to each dish at a concenfration of 1/10 volume, and the plates were incubated at 37°C for an additional 4 h; then absorbance was measured at 490 nm, and at 630 nm as reference, with a Microplate Reader 550 (Bio-Rad Laboratories, Hercules, CA).
  • DOJENDO Cell-counting kit-8
  • initiation site (TIS) for transcription of FGF 18 was dete ⁇ nined by comparing the human genomic sequence (GenBank accession no. AC093246) with the cDNA sequence of FGF18 (GenBank accession no. NM_003862). To examine activity ofthe FGF 18 promoter we amplified by PCR four fragments, each corresponding to part ofthe region flanking FGF18 on the 5' side, and cloned each product into an appropriate enzyme site of pGL3 -Basic vector (Promega, Madison, WI).
  • Plasmids expressing an activated form of ⁇ -catenin (mut ⁇ -catenin) and wild-type and dominant-negative forms of Tcf4 (wtTcf4 and dnTcf4) were prepared as described previously (22).
  • One microgram of each reporter plasmid and 1 ⁇ g of each expression construct were co-transfected with 0.2 ⁇ g of pRL-TK plasmid (Promega) into SW480 cells using FuGENE6, to normalize the efficiency of fransfection.
  • Reporter assays were carried out using a dual-luciferase reporter assay system according to the supplier's recommendations (Promega).
  • Electrophoretic mobility-shift assay ( ⁇ MSA .
  • the EMSA was performed as previously described (23) using nuclear extracts from SW480 cells.
  • a double-stranded 16-nucleotide DNA probe was prepared by annealing FGFl 8F (5'-CGCCTTTGATGTGGGC-3*(SEQ ID NO: 19)) to FGFl 8R (5'-
  • FGF 18 Accumulation of FGF 18 in tumor cells.
  • an anti-FGF18 antibody was prepared that would recognize endogenous FGF 18 protein in cells, and investigated expression of this protein in four colorectal-cancer tissues by --mmunohistochemical staining.
  • FGFl 8 was stained in the cytoplasm of cancerous cells (Fig. IB); staining in the cytoplasm of non-cancerous epithelial cells from corresponding mucosae was significantly weaker and localized mainly at the bottom of crypts.
  • the sequences were searched for consensus Tcf4-binding motifs, 5'-CTTTGWW-3' or 5'-WWCAAAG-3', within a two-kb genomic fragment ofthe 5' region flanking FGFl 8, and identified three possible candidate sites; i.e., between -1631 and -1625 (TBM1), -1348 and -1342 (TBM2), and -190 and -184 (TBM3; Fig. 2A).
  • TBM1 -1631 and -1625
  • TBM2 -1348 and -1342
  • TBM3 -190 and -184
  • fragments of various lengths were cloned from its 5' flanking region upstream ofthe luciferase gene, and performed a reporter assay using SW480 cells (Fig. 2B).
  • pGL3-Pl (contan-ing nucleotides between -1644 and +26), pGL3-P2 (-1354 and +26), andpGL3-P3 (-195 and +26) revealed approximately 5-fold increases in luciferase activity as compared with pGL3-P4 (-181 and +26), suggesting that the region between -195 and -182 was responsible for the franscriptional activity.
  • TBM-3 we assayed the luciferase activity after introducing a 2-base mutation (CTTTGAT (SEQ ID NO: 24) to CTTTGGC) at the TBM3 site (pGL3-P3mt). As expected, mutation at the TBM3 site (P3mt) reduced luciferase activity by more than 75%.
  • FGF18 inNIH3T3 cells. Since over-expression of FGF 18 was known to promote growth of fibroblasts and osteoblasts, we hypothesized that FGF 18 could render oncogenic effects in an autocrine manner. In line with that hypothesis, our immunoblotting experiments detected Flag- tagged FGF 18 protein in the culture media of murine fibroblast cells transfected with pFlagCMV-FGFl 8 (Fig. 4A). As expected, the NIH3T3 cells proliferated at a significantly higher rate in conditioned medium with FGFl 8 than cells in conditioned medium without FGF18(Fig. 4B).
  • FGFl 8 siRNA Effect of FGFl 8 siRNA on growth of cancer cells.
  • plasmids expressing siRNA of FGF 18 were prepared and transfected them into five lines of colorectal-carcinoma cells expressing abundant amounts of FGF 18.
  • psiHlBX-FGF18 significantly reduced expression of FGF18 as compared with a confrol plasmid (psiHIBX-EGFP), and markedly decreased the number of viable cells as compared with psiHIBX-EGFP (Fig. 4C,D,E).
  • FGF 18 is frequently up-regulated in colorectal carcinomas, as a direct target ofthe ⁇ -catenin/Tcf4 complex. Since FGFl 8 is a secreted protein, it might serve as a novel marker for early detection of colorectal tumors. Moreover, because FGFl 8 protein promoted growth of NIH3T3 cells in an autocrine manner, and its down-regulation suppressed growth or survival of colon-cancer cells, FGF 18 may also represent a promising molecular target for novel anticancer drugs. FGF 18 was first identified on the basis of its amino-acid similarities to FGF8 and
  • FGFl 7 (60% and 58% identity, respectively) (18). Like other FGFs, it has an important role in limb development, probably through modulation of osteoblasts, chondrocytes, and osteoclasts (12, 25), and in organogenesis ofthe midbrain (26). In mice, expression of FGF 18 has been observed in the developing lung, surrounding developing bones, and cerebral cortex ofthe developing brain during embryonic stage El 5.5 (18). fritra- peritoneal injection of recombinant FGF 18 protein induced significant gains in the weights of liver and intestine in mice (18). Additionally FGF18 stimulated growth of NIH3T3 cells in a heparan sulfate-dependent manner (18).
  • FGF 18 stimulates growth and/or prevents death of epithelial and mesenchymal cells in an autocrine manner.
  • FGFs function by binding with FGF receptors (FGFRs); five FGFR genes and their splicing variants have been identified so far.
  • FGFRs FGF receptors
  • a BIAcore assay demonstrated that FGFR-3c and FGFR-2c, but not FGFRlc, have affinity for FGFl 8 (20).
  • FGF 18 exerts its growth-promoting effect by interacting with some receptors.
  • FGF family to be proven as a direct target of Tcf/LEF.
  • FGF4 was reported to be a direct target of LEF1; recombinant FGF4 fully rescued the Lef /_ phenotype for tooth development in mice (13).
  • Wnt signals also control FGF-dependent limb initiation via FGF8 and FGF10 (12, 25). Since FGF18 is expressed in the right side of Hensen's node, before expression of FGF8 occurs, and expression of FGF 18 also precedes FGF8 in the isthmus in the developing brain, Wnt signals may recruit FGF 18 as an initial mediator of organogenesis of the limb and brain.
  • FGF4 which has fransforming activity (17)
  • FGFl 8 probably can become oncogenic when inappropriately over-expressed.
  • 1-mmunohistochemical staining of FGF 18 in human colon-cancer tissues and corresponding non-cancerous mucosae showed a pattern similar to that of ⁇ -catenin and other ⁇ -catenin Tcf downsfream proteins such as ENC1, CD44, and EPHB2 (28). This evidence supports a view that activated ⁇ -catenin/Tcf4 complexes in colonic tumors have switched on the proliferative signals that are normally restricted to progenitor cells located in the lower third of colonic crypts.
  • FGF 18 expressed in non-tumorous crypts may play some role in maintenance of progenitor cells, which are absent in Tcf4-knockout mice.
  • FGFl 8 -knockout mice did not reveal any abnormalities in intestinal structure, other factors may redundantly affect the development of mucosa (27).
  • FGFl 8 could exert different functions in other tissues, specifically bone and brain. Further studies on the function of genes downstream ofthe ⁇ -catemn/Tcf4 franscription complex should help to clarify which factors are required for maintenance of progenitor cells in colonic epithelium. In conclusion, the data herein underscore the importance of elevated expression of
  • FGFl 8 in colorectal tumorigenesis Since FGFl 8 functions as growth factor by binding its receptor(s) at least, but not solely, in an autocrine manner, the data herein clearly indicates that FGFl 8 should be a good candidate as a tumor marker as well as a molecular target for the development of reagents, such as specific neutralizing antibodies or antagonists against the receptor(s), for treatment of patients with colorectal tumors.
  • the previous gene-expression analysis of genome- wide cDNA microarray identified specific up-regulated gene FGF18.
  • FGF18 serves as target for cancer prevention and therapy.
  • the present invention provides a molecular diagnostic marker for identifying or detecting CRC.
  • the methods described herein are also useful in the identification of additional molecular targets for prevention, diagnosis and freatment of CRC.
  • the data reported herein add to a comprehensive understanding of CRC, facilitate development of novel diagnostic strategies, and provide clues for identification of molecular targets for therapeutic drugs and preventative agents. Such information contributes to a more profound understanding of colorectal tumorigenesis, and provide indicators for developing novel strategies for diagnosis, treatment, and ultimately prevention of CRC.
  • FGF- 18 is a neuron- derived glial cell growth factor expressed in the rat brain during early postnatal development. Brain Res. Mol. Brain Res., 105: 60-66, 2002.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Food Science & Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Endocrinology (AREA)

Abstract

Objective methods for detecting and diagnosing colorectal cancer (CRC) are described herein. In one embodiment, the diagnostic method involves determining an expression level of FGF18 that discriminate between CRC and normal cell. The present invention further provides methods of screening for therapeutic agents useful in the treatment of CRC, methods of treating CRC, and method of vaccinating a subject against CRC.

Description

DESCRIPTION
METHOD FOR DIAGNOSING COLORECTAL CANCERS
Technical Field The present invention relates to methods of diagnosing colorectal cancers.
Background Art Colorectal cancer (CRC) is one ofthe most common solid tumors worldwide. In 2000, nearly 940,000 individuals were diagnosed with colon cancer and approximately 579,000 died firom it (1 ,2). Although great progress has been made in recent years with regard to diagnosis and treatment, the prognosis for patients with advanced colon cancers remains poor. Hence, discovery of a sensitive and specific diagnostic biomarker for detection of early-stage carcinomas, and development of more effective but less harmful therapeutic drugs, are matters of pressing concern. Furthermore, effective preventive strategies would release many people from fear of this life-lJ-reatening disease. To achieve those goals, the detailed molecular mechanisms underlying colorectal carcinogenesis must first be well understood. Recent molecular studies have revealed that colorectal carcinogenesis involves an accumulation of genetic alterations within a cell lineage, which include not only mutations that inactivate tumor suppressor genes and activate proto-oncogenes, but also amplifications of DNA and/or losses of DNA in certain chromosomal regions. In addition to those types of changes, epigenetic events such as methylation, loss of imprinting, and/or dysregulated expression resulting from genetic changes or unknown mechanisms underlie the genesis of colorectal tumors. Genes in the Wnt/wingless signaling pathway play critical roles in differentiation and morphogenesis during embryogenesis. Impaired regulation of this pathway often is a feature of tumors arising in the colon, liver, prostate, stomach, brain, endometrium- or elsewhere (3). One ofthe key mediators ofthe pathway is β-catenin, which plays a pivotal role in cell-to-cell adhesion and signal transduction. In the absence of Wnt signaling, β-catenin is phosphorylated by a multi-molecular complex composed of β- catenin, APC protein, Axinl, Axil/conductin (AXIN2), and glycogen synthase kinase 3β (GSK3β). β-catenin is normally down-regulated through ubiquitination and subsequent degradation in the proteosome, but wnt signaling allows β-catenin to accumulate in the cytoplasm and/or nucleus due to j-nhibition of GSK3β. Abnormal intracellular accumulation of β-catenin as a consequence of genetic alterations inAPC, AXTN1, AX1N2, or β-catenin (CTNNB1) genes has been observed in various human cancers including colorectal and hepatocellular carcinomas (4). Accumulated β-catenin forms a complex with the Tcf/LEF transcription factor and up-regulates downstream target genes such as c- myc (5) and cyclinDl (6, 7). Activation of one or more of these genes can contribute to processes that confer malignant properties on colon-carcinoma cells. The family of fibroblast growth factors (FGFs) comprises a group of 23 secreted polypeptides which mediate their signals upon binding with one or two of five types of cognate receptors. FGFs play important roles in embryonic development, cell growth, morphogenesis, tissue repair, -----ila mation, and angiogenesis (8). For example, FGF4, FGF8, FGF10, FGF18 and FGF20 are involved in limb development (9, 10); FGF8 participates in the signaling cascade in the organogenesis of midbrai-n-hindbrain (11); and FGF10 appears to be essential for development ofthe lung. Wnt signals control some of the FGFs involved in limb initiation and tooth organogenesis (12, 13). Apart from a crucial role in organogenesis, FGF2 stimulates tissue repair in the adult (14, 15). However, inappropriate expression of FGFs and/or their receptors occurs in a wide range of human tumors including bladder, cervical and gastric cancers (16, 17). Among members ofthe FGF family, FGF18 is the one that most closely resembles FGF8 and, like FGF2, FGF18 stimulates proliferation of NIH3T3 cells (18), osteoblasts (19), chondrocytes (19), and glial cells (20), and induces neurite outgrowth of PC12 rat pheochromocytoma cells (21). cDNA microarray technologies have enabled scientists to obtain comprehensive profiles of gene expression in normal and malignant cells, and compare the gene expression in malignant and corresponding normal cells (Okabe et al., Cancer Res 61:2129-37 (2001); Kitahara et al., Cancer Res 61: 3544-9 (2001); Lin et al., Oncogene 21 :4120-8 (2002); Hasegawa et al., Cancer Res 62:7012-7 (2002)). This approach enables the disclosure ofthe complex nature of cancer cells, and assists in understanding the mechanism of carcinogenesis. Identification of genes that are deregulated in tumors can lead to more precise and accurate diagnosis of individual cancers, and the development of novel therapeutic targets (Bienz and Clevers, Cell 103:311 -20 (2000)). To disclose mechanisms underlying tumors from a genome- wide point of view, and discover target molecules for diagnosis and development of novel therapeutic drugs, the present inventors have been analyzing the expression profiles of tumor cells using a cDNA microarray of 23040 genes (Okabe et al., Cancer Res 61:2129-37 (2001); Kitahara et al., Cancer Res 61 :3544-9 (2001); Lin et al., Oncogene 21 :4120-8 (2002); Hasegawa et al., Cancer Res 62:7012-7 (2002)). Studies designed to reveal mechanisms of carcinogenesis have already facilitated identification of molecular targets for anti-tumor agents. For example, inhibitors of farnesyltransferase (FTIs), which were originally developed to inhibit the growth-signaling pathway related to Ras, whose activation depends on posttranslational famesylation, have proven effective in treating Ras-dependent tumors in animal models (He et al., Cell 99:335-45 (1999)). Clinical trials on human using a combination of anti-cancer drugs and an anti-HER2 monoclonal antibody, trastuzumab, have been conducted to antagonize the proto-oncogene receptor HER2/neu, and have been achieving improved clinical response and overall survival of breast-cancer patients (Lin et al., Cancer Res 61 :6345-9 (2001)). A tyrosine kinase inhibitor, STI-571, which selectively inactivates bcr-abl fusion proteins, has been developed to treat chronic myelogenous leukemias, wherein constitutive activation of bcr-abl tyrosine kinase plays a crucial role in the transformation of leukocytes. Agents of these kind are designed to suppress oncogenic activity of specific gene products (Fujita et al., Cancer Res 61 :7722-6 (2001)). Therefore, gene products commonly up- regulated in cancerous cells may serve as potential targets for developing novel anti-cancer agents. It has been demonstrated that CD 8+ cytotoxic T lymphocytes (CTLs) recognize epitope peptides derived from tumor-associated antigens (TAAs) presented on the MHC Class I molecule and lyse tumor cells. Since the discovery ofthe MAGE family as the first example of TAAs, many other TAAs have been discovered using immunological approaches (Boon, Int J Cancer 54: 177-80 (1993); Boon and van der Bruggen, J Exp Med 183: 725-9 (1996); van der Bruggen et al., Science 254: 1643-7 (1991); Brichard et al., J Exp Med 178: 489-95 (1993); Kawakami et al., J Exp Med 180: 347-52 (1994)). Some of the discovered TAAs are presently undergoing clinical development as targets of --mmunotherapy. TAAs discovered so far include : MAGE (van der Bruggen et al., Science 254: 1643-7 (1991)), gplOO (Kawakami et al., J Exp Med 180: 347-52 (1994)) ; SART (Shichijo et al., J Exp Med 187: 277-88 (1998)) ; and NY-ESO-1 (Chen et al., Proc Natl Acad Sci USA 94: 1914-8 (1997)). On the other hand, gene products demonstrated to be specifically overexpressed in tumor cells have been shown to be recognized as targets inducing cellular immune responses. Such gene products include p53 (Umano et al., Brit J Cancer 84: 1052-7 (2001)) ; HER2/neu (Tanaka et al., Brit J Cancer 84: 94-9 (2001)) ; CEA (Nukaya et al., Int J Cancer 80: 92-7 (1999)), and so on. In spite ofthe significant progress in basic and clinical research concerning TAAs (Rosenbeg et al., Nature Med 4: 321-7 (1998); Mukherji et al., Proc Natl Acad Sci USA 92: 8078-82 (1995); Hu et al, Cancer Res 56: 2479-83 (1996)), only limited number of candidate TAAs for the treatment of adenocarcinomas, including colorectal cancer, are presently available. TAAs abundantly expressed in cancer cells and whose expression is restricted to cancer cells represent promising candidates as immunotherapeutic targets. Further, identification of new TAAs inducing potent and specific antitumor immune responses is expected to encourage clinical use of peptide vaccination strategies in various types of cancer (Boon and can der Bruggen, J Exp Med 183: 725-9 (1996); van der Bruggen et al., Science 254: 1643-7 (1991); Brichard et al., J Exp Med 178: 489-95 (1993); Kawakami et al.,J Exp Med 180: 347-52 (1994); Shichijo et al., J Exp Med 187: 277-88 (1998); Chen et al., Proc Natl Acad Sci USA 94: 1914-8 (1997); Harris, J Natl Cancer Inst 88: 1442-5 (1996); Butterfield et al., Cancer Res 59: 3134-42 (1999); Vissers et al., Cancer Res 59: 5554-9 (1999); van der Burg et al., J Immunol 156: 3308-14 (1996); Tanaka et al., Cancer Res 57: 4465-8 (1997); Fujie et al., Int J Cancer 80: 169-72 (1999); Kikuchi et al., Int J Cancer 81: 459-66 (1999); Oiso et al., Int J Cancer 81: 387-94 (1999)). It has been repeatedly reported that peptide-stimulated peripheral blood mononuclear cells (PBMCs) from certain healthy donors produce significant levels of IFN- a in response to the peptide, but rarely exert cytotoxicity against tumor cells in an HLA- A24 or -A0201 restricted manner in 51Cr-release assays (Kawano et al., Cance Res 60: 3550-8 (2000); Nishizaka et al, Cancer Res 60: 4830-7 (2000); Tamura et al., Jpn J Cancer Res 92: 762-7 (2001)). However, both HLA-A24 and HLA-A0201 are popular HLA alleles in the Japanese population, as well as the Caucasian population (Date et al., Tissue Antigens 47: 93-101 (1996); Kondo et al., J Immunol 155: 4307-12 (1995); Kubo et al., J Immunol 152: 3913-24 (1994); Imanishi et al., Proceeding ofthe eleventh International Hictocompatibility Workshop and Conference Oxford University Press, Oxford, 1065 (1992); Williams et al., Tissue Antigen 49: 129 (1997)). Thus, antigenic peptides of carcinomas presented by these HLAs may be especially useful for the treatment of carcinomas among Japanese and Caucasian. Further, it is known that the induction of low-affinity CTL in vitro usually results from the use of peptide at a high concentration, generating a high level of specific peptide/MHC complexes on antigen presenting cells (APCs), which will effectively activate these CTL (Alexander-Miller et al., Proc Natl Acad Sci USA 93: 4102-7 (1996)).
Summary ofthe Invention In their search for potential molecular targets for development of novel anti-cancer drugs, the present inventors analyzed expression profiles of clinical samples from cancer patients using a genome- wide cDNA microarray. In experiments with colon-cancer cells, the gene encoding fibroblast growth factor 18 (FGF18) was among those that showed elevated expression. The promoter region of this gene was found to contain putative Tcf4- binding motifs; moreover a reporter-gene assay using the luciferase activity as a marker, as well as an electromobility-shift assay, indicated that FGF18 is a downstream transcription target in the β-catenin/Tcf4 pathway. The present inventors demonstrated that exogenous FGF18 promoted growth of NIH3T3 cells in an autocrine manner, and that transfection of FGF18 siRNAs suppressed growth of colon-cancer cells in culture. These results indicate that FGF18 is activated in colon cancers as a direct downstream target ofthe Wnt signaling pathway, and, accordingly, represents a marker for early diagnosis and a molecular target for treatment of CRC. The present invention is based on the discovery of a pattern of gene expression of FGF18 correlated with colorectal cancer (CRC). Accordingly, the present invention features a method of diagnosing or determining a predisposition to CRC in a subject, including the step of detej-mining an expression level of FGF18 in a patient-derived biological sample, such as tissue sample. A normal cell is one obtained from colorectal tissue. An increase of the level of expression of the FGF 18 as compared to a normal control level ofthe gene indicates that the subject suffers from or is at risk for developing CRC. By normal control level is meant a level of gene expression detected in a normal, healthy individual or in a population of individuals not suffering from CRC. A control level is a single expression pattern derived from a single reference population or from a plurality of expression patterns. For example, the control level can be a database of expression patterns from previously tested cells. A normal individual is one with no clinical symptoms of CRC and no family history of CRC. An increase in the level of expression of FGF 18 detected in a test sample as compared to a normal control level indicates the subject (from which the sample was obtained) suffers from or is at risk for developing CRC. Gene expression is preferably increased 10%, 25%, 50% as compared to the control level. Alternately, gene expression may be increased 0.1, 0.2, 1, 2, 5, 10 or more fold as compared to the control level. Expression is determined by detecting hybridization, e.g. , the binding of an FGF 18 gene probe to a gene transcript ofthe patient-derived tissue sample. The patient-derived tissue sample may be any tissue from a test subject, e.g., a patient known to or suspected of having CRC. For example, the tissue may contain a colorectal cancer cell. For example, the tissue is preferably a cell from colon. The present invention further provides methods for identifying agents that inhibit the expression or activity of FGF 18, including the steps of contacting a test cell expressing
FGF 18 with a test agent and determining the expression level or activity of FGF 18. The test cell is preferably a colon cell, such as a colon cell from a colorectal cancer. A decrease in the expression level or activity of FGF 18 as compared to a normal control level ofthe gene indicates that the test agent is an inhibitor ofthe FGF 18 and reduces a symptom of CRC. The present invention also provides a kit with a detection reagent which binds to an FGF 18 nucleic acid sequence or which binds to a gene product encoded by such a nucleic acid sequence. Therapeutic methods ofthe present invention include a method of treating or preventing CRC in a subject by adm-mistering to the subject an antisense compositionthat reduces the expression of a specific target gene, e.g., an antisense composition containing a nucleotide which is complementary to a nucleic acid sequence of FGF18. Another method includes the steps of administering to a subject a small interfering RNA (siRNA) composition. The siRNA composition reduces the expression of a nucleic acid of FGF 18.
In yet another method, treatment or prevention of CRC in a subject is carried out by administering to a subject a ribozyme composition. The nucleic acid-specific ribozyme composition reduces the expression of a nucleic acid of FGF 18. Suitable mechanisms for in vivo expression of a gene of interest are known in the art. The present invention also includes vaccines and vaccination methods. For example, a method of treating or preventing CRC in a subject may be carried out by adn-dmstering to the subject a vaccine containing a polypeptide encoded by a nucleic acid of FGF 18 or an -------munologically active fragment of such a polypeptide. An immunologically active fragment is a polypeptide that is shorter in length than the full- length naturally occurring protein and which induces an immune response. For example, an mimunologically active fragment is preferably at least 8 residues in length and stimulates an immune cell such as a T cell or a B cell. Immune cell stimulation may be measured by detecting cell proliferation, elaboration of cytokines (e.g., IL-2), or production of an antibody. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing ofthe present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. One advantage ofthe methods described herein is that the disease is identified prior to detection of overt clinical symptoms. Other features and advantages ofthe invention will be apparent from the following detailed description, and from the claims.
Brief Description ofthe Drawings Fig. 1A and IB depict elevated expression of FGF18 in CRCs. Fig. 1A depicts the results of semi-quantitative RT-PCR analysis of FGF 18 in 12 colon-cancer tissues (T) and their corresponding normal mucosae (N). Expression of GAPDH served as an internal control. Fig. IB depicts the results of immunohistochemical staining of FGF 18 in cancerous colon tissues (a, c) and corresponding non-cancerous mucosae (b, d). (Bars, 0.1 mm) Fig. 2 A and 2B depict a schematic representation of reporter plasmids of FGF 18 (A) and the results of a reporter assay (B). Fig. 2A depicts schematic representations of various reporter plasmids of FGF18. The putative Tcf4-binding motifs are located between -1631 bp and -1625 bp (TBM1), between -1348 bp and -1342 bp (TBM2), and between - 190 bp and -184 bp (TBM3) from the transcription-initiation site (TIS). Constructs PI, P2 and P3 contain wild-type binding elements; P2mt or P3mt have 2-bp substitutions in TBM2 or TBM3 respectively. Fig. 2B depicts the results of a dual luciferase reporter assay in S W480 cells (T-bars, SD; asterisks, Scheffe' s E test, O.OOO 1 ).
Fig. 3 depicts the results of EMS A ofthe β-catenin/Tcf4 complex using TBM3- oligonucleotide as a probe. A super-shifted band was observed after addition of anti-β- catenin antibody (lanes 2 and 7) but was not elicited by anti-P53 -antibody (lane 3). Bands corresponding to the DNA-protein complex were reduced by addition of non- labeled wild-type probe (lanes 4, 5), but not by non-labeled mutant probe (lanes 6, 7).
Fig. 4. depicts the growth promoting effect of FGF 18 (A and B) or the growth suppressive effect of FGF18-siRNAs (C, D, and E). Fig. 4A depicts the immunoblotting of Flag-tagged FGF 18 protein secreted into culture media. Proteins in the medium and cell lysate were immunoblotted with anti-Flag antibody. NIH3T3 cells were transfected with either pFlagCMN or pFlagCMV-FGFl 8. Black and open triangles indicate the cellular or secreted forms respectively of tagged FGF18 protein. Fig. 4B depicts the microscopic appearance of NIH3T3 cells after incubation in DMEM conta ing 0.5% FBS (left), in the conditioned medium after fransfection with pFlagCMV-FGF18 (center), and in the conditioned medium after transfection with pFlagCMN (right). Fig. 4C depicts the effect of FGF 18 siRNAs on expression of FGF18. Semi-quantitative RT-PCR was carried out with RNAs from cells transfected with siRNA-expressing or control plasmids. Giemsa's staining (Fig. 4D)or MTT assay (Fig. 4E) of viable HCT116 cells in response to EGFP- siRNA or FGF18-siRNA. MTT assays were carried out in triplicate (T-bars, SD; asterisk, Scheffe's Etest,Jp=0.02).
Disclosure ofthe Invention The present invention is based in part on the discovery of elevated expression of FGF 18 in colon cells of patients with CRC. The elevated gene expression was identified using a comprehensive cDNA microarray system. Using a cDNA microarray containing 23,040 genes, comprehensive gene- expression profiles of 20 patients were previously constructed. FGF 18 was found to be expressed at high levels in CRC patients. In the process, candidate molecular markers were selected with the potential of detecting cancer-related proteins in serum or sputum of patients, and some potential targets for development of signal-suppressing strategies in human colorectal cancer were discovered. FGF18 identified herein are used for diagnostic purposes as a marker of CRC and for therapeutic purposes, as a gene target, the expression of which may be altered to treat or alleviate a symptom of CRC. By measuring expression of FGF 18 in a sample of cells, CRC is diagnosed. Similarly, by measuring the expression of FGF 18 in response to various agents, agents for treating CRC can be identified. The present invention involves detej-mining (e.g., measuring) the expression of FGF18. Using sequence information provided by the GeneBank™ database entries for the FGF 18 sequence, FGF 18 is detected and measured using techniques well known to one of ordinary skill in the art. For example, sequences witi-in the sequence database entries corresponding to FGF 18 may be used to construct probes for detecting an FGF 18 RNA sequence in, e.g., northern blot hybridization analysis. As another example, the sequences can be used to construct primers for specifically amplifying FGF 18 in, e.g, amplification-based detection methods, such as reverse-transcription based polymerase chain reaction. Expression level of FGF 18 in the test cell population, e.g., a patient-derived tissue sample, is then compared to expression level of FGF 18 in a reference cell population. The reference cell population includes one or more cells for which the compared parameter is known, i.e., CRC cells or non-CRC cells. Whether or not a pattern of gene expression in the test cell population as compared to the reference cell population indicates CRC or a predisposition thereto depends upon the composition ofthe reference cell population. For example, if the reference cell population is composed of non-CRC cells, a similar gene expression pattern in the test cell population and reference cell population indicates the test cell population is non-CRC. Conversely, if the reference cell population is made up of CRC cells, a similar gene expression profile between the test cell population and the reference cell population indicates that the test cell population includes CRC cells. A level of expression of a CRC marker gene in a test cell population is considered altered in levels of expression in the reference cell population if its expression level varies by more than 1.0, 1.5, 2.0, 5.0, 10.0 or more fold from the expression level ofthe corresponding marker gene, e.g., FGF18, in the reference cell population. Differential gene expression between a test cell population and a reference cell population is normalized to a control nucleic acid, e.g. a housekeeping gene. For example, a confrol nucleic acid is one which is known not to differ depending on the endometriotic or non- endometriotic state ofthe cell. Expression levels ofthe control nucleic acid in the test and reference nucleic acid can be used to normalize signal levels in the compared populations. Confrol genes include β-actin, glyceraldehyde 3- phosphate dehydrogenase or ribosomal protein P 1. The test cell population is preferably compared to multiple reference cell populations. Each ofthe multiple reference populations may differ in the known parameter. Thus, a test cell population may be compared to a second reference cell population known to contain, e.g., CRC cells, as well as a second reference population known to contain, e.g. , non-CRC cells (normal cells). The test cell is included in a tissue type or cell sample from a subject known to contain or suspected of containing CRC cells. The test cell is obtained from a bodily tissue or a bodily fluid, e.g., biological fluid (such as blood or urine). For example, the test cell may be purified from a tissue. Preferably, the test cell population comprises an epithelial cell, more preferably an epithelial cell from a tissue known to be or suspected to be a CRC. Cells in the reference cell population are derived from a tissue type as similar to test cell. Optionally, the reference cell population is a cell line, e.g. a CRC cell line (positive control) or a normal non-CRC cell line (negative control). Alternatively, the control cell population is derived from a database of molecular information derived from cells for which the assayed parameter or condition is known. The subject is preferably a mammal. The mammal can be, e.g. , a human, non- human primate, mouse, rat, dog, cat, horse, or cow. Expression of FGF 18 disclosed herein is determined at the protein or nucleic acid level using methods known in the art. For example, Northern hybridization analysis using probes which specifically recognize the FGF 18 nucleotide sequence can be used to determine gene expression. Alternatively, expression may be measured using reverse- transcription-based PCR assays, e.g., using primers specific for FGF18. Expression may also be determined at the protein level, i.e., by measuring the levels of polypeptide encoded by the gene product described herein, or biological activity thereof. Such methods are well known in the art and include, e.g., irnmunoassays based on antibodies to a protein encoded by FGF 18. The biological activity ofthe protein encoded by the gene is also well known. It is kown that recombinant rat FGF 18 induces neurite outgrowth in PC 12 cells (21) and transgenic mice overexpressing FGF 18 in the liver exhibites an increase in liver weight and hepatocellular proliferation (18). FGF18 stimulats proliferation and inhibites differentiation and matrix synthesis in all cultures of mouse osteoblasts and chondrocytes (19). FGF 18 also induces osteoclast formation through RANKL and cyclooxygenase-2 and stimulates osteoclasts to form resorbed pits on a cultured mouse dentine slice (19). It is noted that these effects are similar to those of FGF2 and proposed that FGF18 and FGF2 may be redundant in their effects on bone and cartilage. It is also kwon that conditional overexpression ΪFGF18 in lung epithelial cells during fetal development disrupts branching morphogenesis ofthe lung (29).
Diagnosins CRC In the instant invention, CRC is diagnosed by measuring the level of expression of
FGF 18 in a test population of cells, (i. e. , a patient-derived biological sample) . Preferably, the test cell population contains an epithelial cell, e.g., a cell obtained from colon tissue. Gene expression may also be measured in blood or other bodily fluids such as urine.
Other biological samples can be used for measuring the protein level. For example, the protein level in the blood, or serum derived from subject to be diagnosed can be measured by immunoassay or biological assay. Expression of FGF 18 is determined in the test cell or biological sample and then compared to the expression level ofthe normal control. A normal control level is an expression profile of FGF 18 typically found in a population known not to be suffering fro CRC. An increase ofthe level of expression in the patient-derived tissue sample of FGF 18 indicates that the subject is suffering from or is at risk for developing CRC. Alteration of FGF18 in the test population as compared to the normal confrol indicates that the subject suffers from or is at risk for developing CRC.
Identifying Agents that inhibit FGF 18 expression or activity An agent that inhibits the expression or activity of FGF 18 is identified by contacting a test cell population expressing FGF18 with a test agent and dete--m--ning the expression level or activity of FGF 18. A decrease in expression or activity in the presence ofthe agent as compared to a normal control level (or compared to the level in the absence ofthe test agent) indicates that the agent is an inhibitor of FGF 18 and may be useful in inhibiting CRC. The test cell population may be any cell expressing FGF 18. For example, the test cell population preferably contains an epithelial cell, such as a cell is or derived from colon. For example, the test cell may be an immortalized cell line derived from colorectal cancer. Alternatively, the test cell may be a cell, which has been transfected with FGF18 or which has been transfected with a regulatory sequence (e.g., a promoter sequence) from FGF18 operably linked to a reporter gene. Furthermore, a candidate compound that interferes with the binding between the β-catenin/Tcf4 binding motif and the β- catenin/Tcf4 complex may be identified as an inhibiting agent of FGF18.
Assessing efficacy of treatment of CRC in a subject The differentially expressed FGF 18 identified herein also allow for the course of treatment of CRC to be monitored. In this method, a test cell population is provided from a subject undergoing treatment for CRC. If desired, test cell populations are obtained from the subject at various time points before, during, or after treatment. Expression level of FGF 18 in the cell population is then detej-mined and compared to its expression level in a reference cell population which includes cells whose CRC state is known. The reference cells have not been exposed to the freatment. If the reference cell population contains no CRC cells, a similarity in expression between FGF 18 in the test cell population and the reference cell population indicates that the treatment is efficacious. However, a difference in expression between FGF18 in the test population and a normal confrol reference cell population indicates the less favorable clinical outcome or prognosis. By "efficacious" is meant that the treatment leads to a reduction in expression of a pathologically up-regulated gene, a increase in expression of a pathologically down- regulated gene or a decrease in size, prevalence, or metastatic potential of colorectal tumors in a subject. When freatment is applied prophylactically, "efficacious" means that the freatment retards or prevents CRC from forming or retards, prevents, or alleviates a symptom of clinical CRC. Assessment of colorectal tumors are made using standard clinical protocols. Efficaciousness is determined in association with any known method for diagnosing or treating CRC. CRC is diagnosed for example, by identifying symptomatic anomalies,.
Selecting a therapeutic agent for treating CRC that is appropriate for a particular individual Differences in the genetic makeup of individuals can result in differences in their relative abilities to metabolize various drugs. An agent that is metabolized in a subject to act as an anti-CRC agent can manifest itself by inducing a change in gene expression pattern in the subject's cells from that characteristic of an CRC state to a gene expression pattern characteristic of a non-CRC state. Accordingly, the differentially expressed
FGF18 disclosed herein allows for a putative therapeutic or prophylactic inhibitor of CRC to be tested in a test cell population from a selected subject in order to determine if the agent is a suitable inhibitor of CRC in the subject. To identify an inhibitor of CRC, that is appropriate for a specific subject, a test cell population from the subj ect is exposed to a therapeutic agent, and the expression of FGF 18 is determined. The test cell population contains a CRC cell expressing FGF18. Preferably, the test cell is an epithelial cell. For example, a test cell population may be incubated in the presence of a candidate agent and the pattern of gene expression ofthe test sample may be measured and compared to one or more reference profiles, e.g., a CRC reference expression profile or a non-CRC reference expression profile. A decrease in expression of FGF 18 in a test cell population relative to a reference cell population containing CRC indicates that the agent is therapeutic. The test agent can be any compound or composition. For example, the test agent may comprise an immunomodulatory agent.
Screening assays for identifying therapeutic agents FGF 18 disclosed herein can also be used to identify candidate therapeutic agents for treating a CRC. The method is based on screening a candidate therapeutic agent to determine if it converts an expression profile of FGF18 characteristic of a CRC state to a pattern indicative of a non-CRC state. In the present method, a cell is exposed to a test agent or a combination of test agents (sequentially or consequentially) and the expression of FGF 18 in the cell is measured. The expression level of FGF 18 in the test population is compared to expression level of FGF 18 in a reference cell population that has not been exposed to the test agent or agents. An agent effective in suppressing expression of over-expressed genes is deemed to lead to a clinical benefit. Such compounds may be further tested for the ability to prevent CRC growth. In a further embodiment, the present invention provides methods for screening candidate agents which are potential targets in the freatment of CRC. As discussed in detail above, by controlling the expression level or activity of a marker gene, one can control the onset and progression of CRC. Thus, candidate agents, which are potential targets in the freatment of CRC, can be identified through screenings that use the expression levels and activities of marker genes as indices. In the context ofthe present invention, such screening may comprise, for example, the following steps: a) contacting a test compound with a polypeptide encoded by a nucleic acid ofFGF18; b) detecting the binding activity between the polypeptide and the test compound; and c) selecting a compound that binds to the polypeptide. Alternatively, the screening method ofthe present invention may comprise the following steps: a) contacting a candidate compound with a cell expressing FGF18, and b) selecting a compound that reduces the expression level of FGF 18. Cells expressing the marker gene include, for example, cell lines established from
CRC; such cells can be used in the above screening methods ofthe present invention. Alternatively, the screening method ofthe present invention may comprise the following steps: a) contacting a test compound with a polypeptide encoded by a nucleic acid ofFGFlδ; b) detecting the biological activity ofthe polypeptide of step (a); and c) selecting a compound that suppresses the biological activity ofthe polypeptide encoded by a nucleic acid of FGF 18 in comparison with the biological activity detected in the absence ofthe test compound. A protein required for the screening can be obtained as a recombinant protein, using the nucleotide sequence ofthe marker gene. Based on the information ofthe marker gene, one skilled in the art can select any biological activity ofthe protein as an index for screening and a measurement method based on the selected biological activity. Preferably, the cell proliferative activity of FGF 18 may be selected as the biological activity. The cell proliferative activity of FGF18 may be detected by proliferation of a cell line such as NIH3T3. Alternatively, the screening method ofthe present invention may comprise the following steps: a) contacting a candidate compound with a cell into which a vector comprising the franscriptional regulatory region of FGF 18 and a reporter gene that is expressed under the control ofthe franscriptional regulatory region has been introduced ; b) measuring the activity or expression of said reporter gene; and c) selecting a compound that reduces the activity or expression level of said reporter gene, as compared to a confrol. Suitable reporter genes and host cells are well known in the art. The reporter construct required for the screening can be prepared by using the franscriptional regulatory region of a marker gene. When the transcriptional regulatory region of a marker gene is known to those skilled in the art, a reporter construct can be prepared by using the previous sequence information. A DNA comprising a β-catenin/Tcf4 binding motif can be used for the franscriptional regulatory region in the present invention. A DNA comprising a nucleotide sequence set forth in SEQ ID NO:24 is preferable as the franscriptional regulatory region. When the franscriptional regulatory region of a marker gene remains unidentified, a nucleotide segment containing the franscriptional regulatory region can be isolated from a genome library based on the nucleotide sequence information ofthe marker gene. Additionally, the screening method ofthe present invention may comprise the following steps: a) contacting a DNA comprising a β-catenin/Tcf4 binding motif in the franscriptional regulatory region of FGF 18 gene with a β-catenin/Tcf4 complex in the presence or absence of candidate compound; b) detecting the binding ofthe DNA and the β-catenin/Tcf4 complex; and c) selecting a compound that inhibits the binding ofthe β-catenin/Tcf4 complex with the DNA, as compared to a control. In the present invention, the binding ofthe DNA and the β-catenin/Tcf4 complex can be detected using a mobility shift assay (EMS A). The compound isolated by the screening is a candidate for drugs that inhibit the activity ofthe protein encoded by marker gene and, therefore, can be applied to the treatment or prevention of CRC. Moreover, compound in which a part ofthe structure ofthe compound inhibiting the activity of protein encoded by marker gene is converted by addition, deletion and/or replacement are also included in the compounds obtainable by the screening method ofthe present invention. When administrating the compound isolated by the method ofthe invention as a pharmaceutical for humans and other mammals, such as mice, rats, guinea-pigs, rabbits, cats, dogs, sheep, pigs, cattle, monkeys, baboons, and chimpanzees, the isolated compound can be directly administered or, alternatively, can be formulated into a dosage form using known pharmaceutical preparation methods. For example, according to the need, the drugs can be taken orally, as sugar-coated tablets, capsules, elixirs and microcapsules, or non-orally, in the form of injections of sterile solutions or suspensions with water or any other pharmaceutically acceptable liquid. For example, the compounds can be mixed with pharmaceutically acceptable carriers or media, such as sterilized water, physiological saline, plant-oils, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders, and such, in a unit dose form required for generally accepted drug implementation. The amount of active ingredients in these preparations makes a suitable dosage within the indicated range acquirable. Examples of additives that can be mixed to tablets and capsules are, binders such as gelatin, corn starch, tragacanth gum and arabic gum; excipients such as crystalline cellulose; swelling agents such as corn starch, gelatin and alginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose or saccharin; and flavoring agents such as peppermint, Gaultheria adenothrix oil and cherry. When the unit-dose form is a capsule, a liquid carrier, such as an oil, can also be further included in the above ingredients. Sterile composites for injections can be formulated following normal drug implementations using vehicles such as distilled water used for injections. Physiological saline, glucose, and other isotonic liquids, including adjuvants such as D-sorbitol, D-mannnose, D-mannitol, and sodium chloride, can be used as aqueous solutions for injections. These can be used in conjunction with suitable solubilizers, such as alcohol, specifically ethanol, polyalcohols such as propylene glycol and polyethylene glycol, non-ionic surfactants, such as Polysorbate 80 (TM) and HCO-50. Sesame oil or soy-bean oil can be used as a oleaginous liquid and may be used in conjunction with benzyl benzoate or benzyl alcohol as a solubilizer. They may be formulated with a buffer, such as phosphate buffer and sodium acetate buffer; a pain-killer, such as procaine hydrochloride; a stabilizer, such as benzyl alcohol and phenol; and/or an anti-oxidant. The prepared injection may be filled into a suitable ampule. Methods well known to one skilled in the art may be used to administer the pharmaceutical composition ofthe present inevntion to patients, for example, as infraarterial, intravenous, or percutaneous injections or as infranasal, fransbronchial, intramuscular or oral acmii-t-istrations. The dosage and method of administration vary according to the body- weight and age ofthe patient and the administration method selected; however, one skilled in the art can routinely select a suitable dosage and method of administration. If said compound is encodable by a DNA, the DNA can be inserted into a vector for gene therapy and the vector administered to a patient to perform the therapy. Though the dosage and method of administration vary according to the body- weight, age, and symptoms ofthe patient, one skilled in the art can suitably select them. For example, although the dose of a compound that binds to the protein ofthe present invention and regulates its activity depends on the symptoms, the dose is about 0.1 mg to about 100 mg per day, preferably about 1.0 mg to about 50 mg per day and more preferably about 1.0 mg to about 20 mg per day, when administered orally to a normal adult (weight 60 kg). When adn-i-nstering parenterally, in the form of an injection to a normal adult (weight 60 kg), although there are some differences according to the patient, target organ, symptoms and method of administration, it is convenient to intravenously inject a dose of about 0.01 mg to about 30 mg per day, preferably about 0.1 to about 20 mg per day and more preferably about 0.1 to about 10 mg per day. Also, in the case of other animals too, it is possible to administer an amount converted to 60 kgs of body- weight.
Assessing the prognosis of a subject with CRC Also provided herein is a method of assessing the prognosis of a subject with CRC by comparing the expression of FGF 18 in a test cell population to the expression of the gene in a reference cell population derived from patients over a spectrum of disease stages.
By comparing gene expression of FGF 18 in the test cell population and the reference cell population(s), or by comparing the pattern of gene expression over time in test cell populations derived from the subject, the prognosis ofthe subject can be assessed. An increase in expression of FGF 18 as compared to a normal control indicates a less favorable prognosis. A decrease in expression of FGF 18 indicates a more favorable prognosis for the subject.
Kits The present invention also includes a CRC-detection reagent, e.g., a nucleic acid that specifically binds to or identifies FGF 18 nucleic acids, such as oligonucleotide sequences which are complementary to a portion of a FGF 18 nucleic acid or antibodies which bind to proteins encoded by a FGF18 nucleic acid. The reagents are packaged together in the form of a kit. The reagents are packaged in separate containers, e.g., a nucleic acid or antibody (either bound to a solid matrix or packaged separately with reagents for binding them to the matrix), a confrol reagent (positive and/or negative), and/or a detectable label. Instructions (e.g., written, tape, NCR, CD-ROM, etc.) for carrying out the assay are included in the kit. The assay format ofthe kit is a Northern hybridization or a sandwich ELIS A known in the art. For example, a CRC detection reagent is immobilized on a solid matrix, such as a porous strip, to form at least one CRC detection site. The measurement or detection region ofthe porous strip may include a plurality of sites containing a nucleic acid. The test strip may also contain sites for negative and/or positive controls. Alternatively, control sites may be located on a separate strip from the test strip. Optionally, the different detection sites may contain different amounts of immobilized nucleic acids, i.e., a higher amount in the first detection site and lesser amounts in subsequent sites. Upon the addition of test sample, the number of sites displaying a detectable signal provides a quantitative indication ofthe amount of CRC present in the sample. The detection sites may be configured in any suitably detectable shape and are typically in the shape of a bar or dot spanning the width of a test strip.
Methods of inhibiting CRC The invention provides a method for treating or alleviating a symptom of CRC in a subject by decreasing expression or activity of FGF 18. Therapeutic compounds are administered prophylactically or therapeutically to subject suffering from (or susceptible to) developing CRC. Administration can be systemic or local. Such subjects may be identified using standard clinical methods or through the detection of an aberrant level of expression or activity of FGF 18. Therapeutic agents include inhibitors of cell proliferation. The method ofthe present invention includes the step of decreasing the expression, or function, or both, of gene products of FGF 18 Expression is inhibited in any of several ways known in the art. For example, expression may be inhibited by adn-iinistering to the subject a nucleic acid that inhibits, or antagonizes, the expression ofthe over-expressed gene, e.g., an antisense oligonucleotide or small interfering RNA (siRNA) which disrupts expression ofthe over-expressed gene. As noted above, antisense nucleic acids corresponding to the nucleotide sequence of FGF 18 can be used to reduce the expression level of FGF 18. Antisense nucleic acids corresponding to the nucleotide sequence of FGF 18 that are up-regulated in CRC are useful for the freatment of CRC. Specifically, the antisense nucleic acids ofthe present invention may act by binding to the nucleotide sequence of FGF 18 or an mRNA corresponding thereto, thereby i-nhibiting the transcription or franslation ofthe gene, promoting the degradation ofthe mRNA, and/or i-nhibiting the expression of protein encoded by a nucleic acid of FGF 18, finally inhibiting the function ofthe proteins . The term "antisense nucleic acids" as used herein encompasses both nucleotides that are entirely complementary to the target sequence and those having one or more nucleotide mismatches, so long as the antisense nucleic acids can specifically hybridize to the target sequences. For example, the antisense nucleic acids ofthe present invention include polynucleotides having a homology of at least 70% or higher, preferably at least 80% or higher, more preferably at least 90% or higher, even more preferably at least 95% or higher over a span of at least 15 continuous nucleotides. Algorithms known in the art can be used to determine the homology. The antisense nucleic acid derivatives ofthe present invention act on cells producing the protein encoded by marker gene by binding to a DNA or mRNA encoding the protein, inhibiting their franscription or translation, promoting the degradation ofthe mRNA, and inhibiting the expression ofthe protein, thereby resulting in inhibition of protein function. An antisense nucleic acid derivative ofthe present invention can be made into an external preparation, such as a liniment or a poultice, by mixing with a suitable base material which is inactive against the derivative. Also, as needed, the derivatives can be formulated into tablets, powders, granules, capsules, liposome capsules, injections, solutions, nose-drops and freeze-drying agents by adding excipients, isotonic agents, solubilizers, stabilizers, preservatives, pain-killers, and such. These can be prepared by following known methods. The antisense nucleic acid derivative is preferably given to the patient by directly applying onto the ailing site or by injecting into a blood vessel so that it will reach the site of ailment. An antisense-mounting medium can also be used to increase durability and membrane-permeability. Examples are, liposomes, poly-L-lysine, lipids, cholesterol, lipofectin or derivatives of these. The dosage ofthe antisense nucleic acid derivative ofthe present invention can be adjusted suitably according to the patient's condition and used in desired amounts. For example, a dose range of 0.1 to 100 mg/kg, preferably 0.1 to 50 mg/kg can be administered. The antisense nucleic acids of present invention include modified oligonucleotides. For example, thioated nucleotides may be used to confer nuclease resistance to an oligonucleotide. Also, a siRNA against marker gene can be used to reduce the expression level ofthe marker gene. By the term "siRNA" is meant a double stranded RNA molecule which prevents translation of a target mRNA. siRNA of FGF 18 which hybridize to target mRNA decrease or inhibit production ofthe FGF 18 polypeptide product encoded by the FGF 18 gene by associating with the normally single-stranded mRNA transcript, thereby mterfering with franslation and thus, expression ofthe protein. The siRNA is preferably less than 500, 200, 100, 50, or 25 nucleotides in length. More preferably, the siRNA is 19-25 nucleotides in length. Exemplary nucleic acid sequences for the production of FGF 18 siRNA include sequences that utilize the nucleotide of SEQ ID NO: 21 as the target sequence. Furthermore, in order to enhance the inhibition activity ofthe siRNA, nucleotide "u" can be added to 3'end ofthe antisense strand ofthe target sequence. The number of "u"s to be added is at least 2, generally 2 to 10, preferably 2 to 5. The added "u"s form single strand at the 3'end ofthe antisense strand ofthe siRNA..
In the context ofthe present invention, the siRNA comprises a sense nucleic acid sequence and an anti-sense nucleic acid sequence against an upregulated marker gene, such as FGF18. The siRNA is constructed such that a single transcript has both the sense and complementary antisense sequences from the target gene, e.g., a hairpin. A loop sequence consisting of an arbitrary nucleotide sequence can be located between the sense and antisense sequence in order to form the haiφin loop structure. Thus, the present invention also provides siRNA having the general formula 5 ' - [A] - [B] - [A' ] -3 ' , wherein [A] is a ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID NO: 21, [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides, and [A'] is a ribonucleotide sequence consisting ofthe complementary sequence of [A]. The region [A] hybridizes to [A'], and then a loop consisting of region [B] is formed. The loop sequence may be preferably 3 to 23 nucleotide in length. The loop sequence, for example, can be selected from group consisting of following sequences (http://www.ambion.com/techlib/tb/tb. 506.html). Furthermore, loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque, J.-M., Triques, K., and Stevenson, M. (2002) Modulation of HIV-l replication by RNA interference. Nature 418 : 435-438.) : 1. CCC, CCACC or CCACACC: Jacque, J. M, Triques, K., and Stevenson, M (2002) Modulation of HIN-1 replication by RΝA interference. Nature, Vol. 418: 435-438 ; 2. UUCG: Lee, N.S., Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A., Salvaterra, P., and Rossi, J. (2002) Expression of small interfering RNAs targeted against HIV- 1 rev transcripts in human cells. Nature Biotechnology 20 : 500-505. Fruscoloni, P., Zamboni, M., and Toccl-dni-Nalentini, G. P. (2003) Exonucleolytic degradation of double-stranded RΝA by an activity in Xenopus laevis germinal vesicles. Proc. Νatl. Acad. Sci. USA 100(4): 1639-1644 ; and 3. UUCAAGAGA: Dykxhoorn, D. M., Νovina, C. D., and Sharp, P. A. (2002) Killing the messenger: Short RΝAs that silence gene expression. Nature Reviews Molecular Cell Biology 4: 457-467. An exemplary siRNA o the present invention having hairpin loop structure comprises : gguucuggagaacaacuacu-[b]-aguaguuguucuccagaacc (for target sequence of SEQ ID NO:21). In this structure, the loop sequence can be selected from group consisting of, CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA. A preferable loop sequence is UUCAAGAGA ("ttcaagaga" in DNA). The regulatory sequences flanking the FGF 18 sequence are identical or are different, such that their expression can be modulated independently, or in a temporal or spatial manner. siRNAs are transcribed infracellularly by cloning the FGF 18 gene template into a vector containing, e.g., a RNA pol III franscription unit from the small nuclear RNA (snR A) U6 or the human HI RNA promoter. For introducing the vector into the cell, transfection-enhancing agent can be used. FuGENE (Rochediagnostices), Lipofectamin 2000 (Invitrogen), Oligofectamin (Invitrogen), and Nucleofactor (Wako pure Chemical) are useful as the transfection-enhancing agent. Standard techniques for introducing siRNA into cells may be used, including those in which DNA is a template from which RNA is transcribed. For example, an siRNA of FGF 18 may be directly introduced into cells in a form that is capable of binding to the m NA transcripts. Alternatively, a DNA encoding an siRNA of FGF 18 may be inserted into a vector. Vectors may be produced, for example, by cloning an FGF 18 target sequence into an expression vector operatively-linked regulatory sequences flanking the FGF 18 sequence in a manner that allows for expression (by transcription ofthe DNA molecule) of both strands (Lee, N.S., Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A.,Salvaterra, P., and Rossi, J. (2002) Expression of small interfering RNAs targeted against HIV-l rev franscripts in human cells. Nature Biotechnology 20 : 500-505.). An RNA molecule that is antisense to FGF18 mRNA is transcribed by a first promoter (e.g., a promoter sequence 3' of the cloned DNA) and an RNA molecule that is the sense strand for the FGF 18 mRNA is transcribed by a second promoter (e.g., a promoter sequence 5' ofthe cloned DNA). The sense and antisense strands hybridize in vivo to generate siRNA constructs for silencing ofthe FGF18 gene. Alternatively, two constructs are utilized to create the sense and anti-sense sfrands of a siRNA construct. Cloned FGF 18 can encode a construct having secondary structure, e.g., hairpins, wherein a single transcript has both the sense and complementary antisense sequences from the target gene. The method of inhibiting CRC ofthe present invention may be used to alter the expression in a cell of an up-regulated marker gene, e.g., one up-regulated as a result of malignant transformation ofthe cells. Binding ofthe siRNA to a transcript corresponding to FGF18 in the target cell results in a reduction in the FGF18 protein production by the cell. The length ofthe oligonucleotide is at least 10 nucleotides and may be as long as the naturally-occurring the transcript. Preferably, the oligonucleotide is 19-25 nucleotides in length. Most preferably, the oligonucleotide is less than 75, 50 , 25 nucleotides in length. Examples of FGF 18 siRNA oligonucleotide which inhibit the expression in mammalian cells include the target sequence containing SEQ ID NO: 21. The nucleotide sequence ofthe siRNAs utilized herein were designed using a siRNA design computer program available from the Ambion website (http://www.ambion.com/techlib/ misc/siRNA_finder.html). The computer program selects nucleotide sequences for siRNA synthesis based on the following protocol. Selection of siRNA Target Sites: 1. Beg- tming with the AUG start codon ofthe object transcript, scan downstream for AA dinucleotide sequences. Record the occurrence of each AA and the 3' adjacent 19 nucleotides as potential siRNA target sites. Tuschl, et al. recommend against designing siRNA to the 5' and 3' untranslated regions (UTR-s) and regions near the start codon (wifr-in 75 bases) as these may be richer in regulatory protein binding sites. UTR-binding proteins and/or translation initiation complexes may interfere with the binding ofthe siRNA endonuclease complex. 2. Compare the potential target sites to the human genome database and eli-minate from consideration any target sequences with significant homology to other coding sequences. The homology search can be performed using BLAST, which can be found on the NCBI server at: www.ncbi.nlm.nih.gov/BLAST/. 3. Select qualifying target sequences for synthesis. At Ambion, preferably several target sequences can be selected along the length ofthe gene for evaluation The antisense oligonucleotide or siRNA ofthe invention inhibit the expression of the polypeptide ofthe invention and are thereby useful for suppressing the biological activity ofthe polypeptide ofthe invention. Also, expression-inhibitors, comprising the antisense oligonucleotide or siRNA ofthe invention, are useful in the point that they can inhibit the biological activity o the polypeptide ofthe invention. Therefore, a composition comprising the antisense oligonucleotide or siRNA ofthe present invention are useful in treating a CRC. Alternatively, function of gene product ofthe over-expressed gene may be inhibited by administering a compound that binds to or otherwise inhibits the function ofthe gene products. For example, the compound may be an antibody which binds to the over- expressed gene product. The present invention encompasses the use of antibodies, particularly antibodies against a protein encoded by an up-regulated marker gene, as well as fragments of such antibodies. As used herein, the term "antibody" refers to an immunoglobulin molecule having a specific structure, that interacts (i.e., binds) only with the antigen that was used for synthesizing the antibody (i.e., the up-regulated marker gene product) or with an antigen closely related to it. Furthermore, an antibody may be a fragment of an antibody or a modified antibody, so long as it binds to the protein encoded by the marker gene. For instance, the antibody fragment may be Fab, F(ab')2, Fv, or single chain Fv (scFv), in which Fv fragments from H and L chains are ligated by an appropriate linker (Huston J. S. et al. Proc. Natl. Acad. Sci. U.S.A. 85:5879-5883 (1988)). More specifically, an antibody fragment may be generated by freating an antibody with an enzyme, such as papain or pepsin. Alternatively, a gene encoding the antibody fragment may be constructed, inserted into an expression vector, and expressed in an appropriate host cell (see, for example, Co M. S. et al. J. Immunol. 152:2968-2976 (1994); Better M. and Horwitz A. H. Methods Enzymol. 178:476-496 (1989); Pluckthun A. and Skerra A. Methods Enzymol. 178:497-515 (1989); Lamoyi E. Methods Enzymol. 121:652-663 (1986); Rousseaux J. et al. Methods Enzymol. 121:663-669 (1986); Bird R. E. and Walker B. W. Trends Biotechnol. 9:132-137 (1991)). An antibody may be modified by conjugation with a variety of molecules, such as polyethylene glycol (PEG). The present invention provides such modified antibodies. The modified antibody can be obtained by chemically modifying an antibody. These modification methods are conventional in the field. Alternatively, an antibody may be obtained as a chimeric antibody, between a variable region derived from a nonhuman antibody and a constant region derived from a human antibody, or as a humanized antibody, comprising the complementarity determining region (CDR) derived from a nonhuman antibody, the frame work region (FR) and the constant region derived from a human antibody. Such antibodies can be prepared by using known technologies. Cancer therapies directed at specific molecular alterations that occur in cancer cells have been validated through clinical development and regulatory approval of anti-cancer drugs such as frastuzumab (Herceptin®) for the treatment of advanced breast cancer, imatinib methylate (Gleevec®) for chronic myeloid leukemia, gefitinib (Iressa®) for non- small cell lung cancer (NSCLC), and rituximab (anti-CD20 mAb) for B-cell lymphoma and mantle cell lymphoma (Ciardiello F, Tortora G. A novel approach in the treatment of cancer: targeting the epidermal growth factor receptor. Clin Cancer Res. 2001 Oct;7(10):2958-70. Review.; Slamon DJ, Leyland- Jones B, Shak S, Fuchs H, Paton V, Bajamonde A, Fleming T, Eiermann W, Wolter J, Pegram M, Baselga J, Norton L. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med. 2001 Mar 15;344(11):783-92.; Rehwald U, Schulz H, Reiser M, Sieber M, Staak JO, Morschhauser F, Driessen C, Rudiger T, Muller-Hermelink K, Diehl V, Engert A. Treatment of relapsed CD20+ Hodgkin lymphoma with the monoclonal antibody rituximab is effective and well tolerated: results of a phase 2 trial of the German Hodgkin Lymphoma Study Group. Blood. 2003 Jan 15;101(2):420-424.; Fang G, Kim CN, Perkins CL, Ramadevi N, Winton E, Wittmann S and Bhalla KN. (2000). Blood, 96, 2246-2253.). These drugs are clinically effective and better tolerated than traditional anti-cancer agents because they target only transformed cells. Hence, such drugs not only improve survival and quality of life for cancer patients, but also validate the concept of molecularly targeted cancer therapy. Furthermore, targeted drugs can enhance the efficacy of standard chemotherapy when used in combination with it (Gianni L. (2002). Oncology, 63 Suppl 1, 47-56.; Klejman A, Rushen L, Morrione A, Slupianek A and Skorski T. (2002). Oncogene, 21, 5868-5876.). Therefore, future cancer treatments will probably involve combining conventional drugs with target-specific agents aimed at different characteristics of tumor cells such as angiogenesis and invasiveness. These modulatory methods are performed ex vivo or in vitro (e.g., by culturing the cell with the agent) or, alternatively, in vivo (e.g., by adn-unistering the agent to a subject). The methods involve administering a protein or combination of proteins or a nucleic acid molecule or combination of nucleic acid molecules as therapy to counteract aberrant expression or activity ofthe differentially expressed genes. Diseases and disorders that are characterized by increased (relative to a subject not suffering from the disease or disorder) levels of biological activity ofthe genes may be treated with therapeutics that antagonize (i.e., reduce or inhibit) activity ofthe over- expressed gene or genes. Therapeutics that antagonize activity are administered therapeutically or prophylactically. Therapeutics that may be utilized include, e.g., (i) a polypeptide, or analogs, derivatives, fragments or homologs thereof of the over-expressed sequence (ii) antibodies to the over-expressed sequence (iii) nucleic acids encoding the over-expressed sequence; (iv) antisense nucleic acids or nucleic acids that are "dysfunctional" (i.e., due to a heterologous insertion within the coding sequence of over-expressed sequence); (v) small interfering RNA (siRNA); or (vi) modulators (i.e., inhibitors, agonists and antagonists that alter the interaction between an over -expressed polypeptide and its binding partner. The dysfunctional antisense molecule is utilized to "knockout" endogenous function of a polypeptide by homologous recombination (see, e.g., Capecchi, Science 244: 1288-1292 1989) . Increased levels can be readily detected by quantifying peptide and/or RNA, by obtaining a patient tissue sample (e.g., from biopsy tissue) and assaying it in vitro for RNA or peptide levels, structure and/or activity ofthe expressed peptides (or m-RNAs of a gene whose expression is altered). Methods that are well-known within the art include, but are not limited to, immunoassays (e.g., by Western blot analysis, im unoprecipitation followed by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, j-mmunocytochemistry, etc.) and/or hybridization assays to detect expression of m-RNAs (e.g., Northern assays, dot blots, in situ hybridization, etc.). Prophylactic administration occurs prior to the manifestation of overt clinical symptoms of disease, such that a disease or disorder is prevented or, alternatively, delayed in its progression.
Therapeutic methods of the present invention include contacting a cell with an agent that modulates one or more of the activities of the gene product of the differentially expressed gene. An agent that modulates protein activity includes a nucleic acid or a protein, a naturally-occurring cognate ligand of these proteins, a peptide, a peptidomimetic, or other small molecule. The present invention also relates to a method of treating or preventing CRC in a subject comprising administering to said subject a vaccine comprising a polypeptide encoded by a nucleic acid of FGF 18, an immunologically active fragment of said polypeptide, or a polynucleotide encoding the polypeptide or the fragment thereof. Administration ofthe polypeptide induces an anti-tumor immunity in a subject. To induce anti-tumor immunity, a polypeptide encoded by a nucleic acid of FGF 18, an immunologically active fragment of said polypeptide, or a polynucleotide encoding the polypeptide, is administered. The polypeptide or the immunologically active fragments thereof are useful as vaccines against CRC. In some cases the proteins or fragments thereof may be administered in a form bound to the T cell recepor (TCR) or presented by an antigen presenting cell (APC), such as macrophage, dendritic cell (DC), or B-cells. Due to the strong antigen presenting ability of DC, the use of DC is most preferable among the APCs. In the present invention, vaccine against CRC refers to a substance that has the function to induce anti-tumor --mmunity upon inoculation into animals. According to the present invention, polypeptides encoded by a nucleic acid of FGF 18 or fragments thereof were suggested to be HLA-A24 or HLA-A*0201 restricted epitopes peptides that may induce potent and specific immune response against CRC cells expressing FGFl 8. Thus, the present invention also encompasses method of inducing anti-tumor immunity using the polypeptides. In general, anti-tumor immunity includes immune responses such as follows: - induction of cytotoxic lymphocytes against tumors, - induction of antibodies that recognize tumors, and - induction of anti-tumor cytokine production. Therefore, when a certain protein induces any one of these immune responses upon inoculation into an animal, the protein is decided to have anti-tumor immunity inducing effect. The induction ofthe anti-tumor immunity by a protein can be detected by observing in vivo or in vitro the response ofthe immune system in the host against the protein. For example, a method for detecting the induction of cytotoxic T lymphocytes is well known. A foreign substance that enters the living body is presented to T cells and B cells by the action of antigen presenting cells (APCs). T cells that respond to the antigen presented by APC in antigen specific manner differentiate into cytotoxic T cells (or cytotoxic T lymphocytes; CTLs) due to stimulation by the antigen, and then proliferate (this is referred to as activation of T cells). Therefore, CTL induction by a certain peptide can be evaluated by presenting the peptide to T cell by APC, and detecting the induction of CTL. Furthermore, APC has the effect of activating CD4+ T cells, CD8+ T cells, macrophages, eosinophils, and NK cells. Since CD4+ T cells and CD8+ T cells are also important in anti-tumor ij-nmunity, the anti-tumor --mmunity inducing action ofthe peptide can be evaluated using the activation effect of these cells as indicators. A method for evaluating the inducing action of CTL using dendritic cells (DCs) as APCs is well known in the art. A DC is a representative APC having the strongest CTL inducing action among APCs. In this method, the test polypeptide is initially contacted with a DC, and then this DC is contacted with T cells. Detection of T cells having cytotoxic effects against the cells of interest after the contact with DCs shows that the test polypeptide has an activity of inducing the cytotoxic T cells. Activity of CTLs against tumors can be detected, for example, using the lysis of 51Cr-labeled tumor cells as the indicator. Alternatively, the method of evaluating the degree of tumor cell damage using 3H-thymidine uptake activity or LDH (lactose dehydrogenase)-release as the indicator is also well known. Apart from DCs, peripheral blood mononuclear cells (PBMCs) may also be used as the APC. The induction of CTLs is reported that the it can be enhanced by culturing PBMC in the presence of GM-CSF and IL-4. Similarly, CTLs have been shown to be induced by culturing PBMC in the presence of keyhole limpet hemocyanin (KLH) and IL- 7. The test polypeptides confirmed to possess CTL-inducing activity by these methods are polypeptides having a DC activation effect and subsequent CTL-inducing activity. Therefore, polypeptides that induce CTLs against tumor cells are useful as vaccines against tumors. Furthermore, APCs that have acquired the ability to induce CTLs against tumors by contacting with the polypeptides are useful as vaccines against tumors. Furthermore, CTLs that have acquired cytotoxicity against tumors due to presentation ofthe polypeptide antigens by APC can be also used as vaccines against tumors. Such therapeutic methods for tumors using anti-tumor immunity due to APCs and CTLs are referred to as cellular immunotherapy. Generally, when using a polypeptide for cellular --mmunotherapy, efficiency ofthe CTL-induction is known to increase by combining a plurality of polypeptides having different structures and contacting them with DCs. Therefore, when stimulating DCs with protein fragments, it is advantageous to use a mixture of multiple types of fragments. Alternatively, the induction of anti-tumor immunity by a polypeptide can be confirmed by observing the induction of antibody production against tumors. For example, when antibodies against a polypeptide are induced in a laboratory animal -.mmunized with the polypeptide, and when growth of tumor cells is suppressed by those antibodies, the polypeptide can be determined to have an ability to induce anti-tumor immunity. Anti-tumor j-mmunity is induced by administering the vaccine of this invention; the induction of anti-tumor immunity enables treatment and prevention of CRC. Therapy against cancer or prevention ofthe onset of cancer includes any ofthe steps, such as inhibition ofthe growth of cancerous cells, involution of cancer, and suppression of occurrence of cancer. Decrease in mortality of individuals having cancer, decrease in tumor markers in the blood, alleviation of detectable symptoms accompanying cancer, and such are also included in the therapy or prevention of cancer. Such therapeutic and preventive effects are preferably statistically significant, for example, in observation, at a significance level of 5% or less, wherein the therapeutic or preventive effect of a vaccine against cell proliferative diseases is compared to a confrol without vaccine administration. Student's t-test, the Mann- Whitney U-test, or ANOVA may be used for statistical analysis. The above-mentioned protein having immunological activity or a vector encoding the protein may be combined with an adjuvant. An adjuvant refers to a compound that enhances the immune response against the protein when administered together (or successively) with the protein having immunological activity. Examples of adjuvants include cholera toxin, salmonella toxin, alum, and such, but are not limited thereto. Furthermore, the vaccine of this invention may be combined with an appropriate pharmaceutically acceptable carrier. Examples of such carriers include sterilized water, physiological saline, phosphate buffer, culture fluid, and such. Furthermore, the vaccine may contain as necessary, stabilizers, suspensions, preservatives, surfactants, and such. The vaccine is administered systemically or locally. Vaccine administration may be performed by single administration, or boosted by multiple aclministrations. When using APCs or CTLs as the vaccine of this invention, tumors can be treated or prevented, for example, by the ex vivo method. More specifically, PBMCs ofthe subject receiving treatment or prevention are collected, the cells are contacted with the polypeptide ex vivo, and following the induction of APCs or CTLs, the cells may be administered to the subject. APCs can be also induced by introducing a vector encoding the polypeptide into PBMCs ex vivo. APCs or CTLs induced in vitro can be cloned prior to administration. By cloning and growing cells having high activity of damaging target cells, cellular immunotherapy can be performed more effectively. Furthermore, APCs and CTLs isolated in this manner may be used for cellular immunotherapy not only against individuals firom whom the cells are derived, but also against other individuals who has similar types of tumors. Furthermore, a pharmaceutical composition for treating or preventing a cell proliferative disease, such as cancer, comprising a pharmaceutically effective amount of the polypeptide ofthe present invention is provided. The pharmaceutical composition may be used for raising anti-tumor immunity.
Pharmaceutical compositions for inhibiting CRC Pharmaceutical formulations include those suitable for oral, rectal, nasal, topical
(including buccal and sub-lingual), vaginal or parenteral (including intramuscular, subcutaneous and intravenous) administration, or for administration by inhalation or insufflation. Preferably, administration is intravenous. The formulations are optionally packaged in discrete dosage units. Pharmaceutical formulations suitable for oral administration include capsules, cachets or tablets, each containing a predetermined amount ofthe active ingredient. Formulations also include powders, granules or solutions, suspensions or emulsions. The active ingredient is optionally administered as a bolus electuary or paste. Tablets and capsules for oral administration may contain conventional excipients such as binding agents, fillers, lubricants, disintegrants or wetting agents. A tablet may be made by compression or molding, optionally with one or more formulational ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture ofthe powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art. Oral fluid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives. The tablets may optionally be formulated so as to provide slow or controlled release ofthe active ingredient therein. A package of tablets may contain one tablet to be taken on each day ofthe month. Formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood ofthe intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a fireeze-dried (lyophilized) condition requiring only the addition ofthe sterile liquid carrier, for example, saline, water- for-injection, immediately prior to use. Alternatively, the formulations may be presented for continuous infusion. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets ofthe kind previously described. Formulations for rectal administration include suppositories with standard carriers such as cocoa butter or polyethylene glycol. Formulations for topical admimstration in the mouth, for example buccally or sublingually, include lozenges, which contain the active ingredient in a flavored base such as sucrose and acacia or fragacanth, and pastilles comprising the active ingredient in a base such as gelatin and glycerin or sucrose and acacia. For infra-nasal administration the compounds ofthe invention may be used as a liquid spray or dispersible powder or in the form of drops. Drops may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents or suspending agents. For administration by inhalation, the compounds are conveniently delivered from an insufflator, nebulizer, pressurized packs or other convenient means of delivering an aerosol spray. Pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichiorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be deteraiined by providing a valve to deliver a metered amount. Alternatively, for administration by inhalation or insufflation, the compounds may take the form of a dry powder composition, for example a powder mix ofthe compound and a suitable powder base such as lactose or starch. The powder composition may be presented in unit dosage form, in for example, capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflators. Other formulations include implantable devices and adhesive patches; which release a therapeutic agent. When desired, the above described formulations, adapted to give sustained release ofthe active ingredient, may be employed. The pharmaceutical compositions may also contain other active ingredients such as antimicrobial agents, immunosuppressants or preservatives. It should be understood that in addition to the ingredients particularly mentioned above, the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example, those suitable for oral administration may include flavoring agents. Preferred unit dosage formulations are those containing an effective dose, as recited below, or an appropriate fraction thereof, ofthe active ingredient. For each ofthe aforementioned conditions, the compositions, e.g., polypeptides and organic compounds, may be aclministered orally or via injection at a dose of from about 0.1 to about 250 mg/kg per day. The dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day. Tablets or other unit dosage forms of presentation provided in discrete units may conveniently contain an amount which is effective at such dosage or as a multiple ofthe same, for instance, units containing about 5 mg to about 500 mg, usually from about 100 mg to about 500 mg. The dose employed will depend upon a number of factors, including the age and sex ofthe subject, the precise disorder being treated, and its severity. Also the route of administration may vary depending upon the condition and its severity. The invention will be further described in the following examples, which do not limit the scope ofthe invention described in the claims.
Best Mode for Carrying out the Invention 1. Materials and Methods Cell lines and clinical materials. Human colon-cancer cell lines SW480 HCT116 and DLD1, and murine fibroblast line NIH3T3 were obtained from the American Type Culture Collection (ATCC, Rockville, MD). Human colon-cancer cell lines SNUC4 and SNUC5 were obtained from the Korean cell line bank (KCLB, Seoul, Korea). All ofthe cells were cultured as monolayers in appropriate media, as follows: Leibovitz's L-15 (Invitrogen, Carlsbad, CA) for SW480, MaCoy's 5A (Invitrogen) for HCT116, RPMI1640 (Sigma-Aldrich Corporation, St. Louis, MO) for DLD1, SNUC4 and SNUC5, and DMEM (Sigma-Aldrich) for NIH3T3; each was supplemented with 0.5% or 10% fetal bovine serum (Cansera International Inc., Ontario, Canada) and 1% antibiotic/antimycotic solution (Sigma-Aldrich). Cells were maintained at 37°C in an atmosphere of humidified air with 5% CO2 (HCT116, DLD1, SNUC4, SNUC5, and NIH3T3) or without CO (SW480). Cancerous tissues and corresponding non- cancerous mucosae were excised from 12 patients during surgery, after informed consent had been obtained.
Semi-quantitative RT-PCR. Total RNA was extracted from cultured cells and clinical tissues using TRIZOL reagent (Invitrogen) according to the manufacturer's protocol. Extracted RNA was treated with DNasel (Roche Diagnostics, Mannheim, Germany) and reversely transcribed to single-stranded cDNAs using oligo(dT)12.18 primer with Superscript II reverse transcriptase (Invitrogen). Appropriate dilutions of each single-stranded cDNA were prepared for subsequent PCR amplification by monitoring the glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) gene as a quantitative control. Primer sequences were 5'- ACAACAGCCTCAAGATCATCAG-3'(SEQ ID NO: 1) and 5'- GGTCCACCACTGACACGTTG-3'(SEQ ID NO: 2) for GAPDH, and 5*- GGACATGTGCAGGCTGGGCTA-3'(SEQ ID NO: 3) and 5'-
GTAGAATTCCGTCTCCTTGCCCTT-3'(SEQ ID NO: 4) for FGF18. All ofthe reactions involved initial denaturation at 94°C for 2 min followed by 18 cycles (for GAPDH) or 33 cycles (for FGF18) at 94°C for 30 s, 60°C for 30 s, and 72°C for 60 s, on a GeneAmp PCR system 9700 (PE Applied Biosystems, Foster, CA).
Northern blotting. Human multiple-tissue blots (BD Bioscience, Palo Alto, CA) were hybridized with a 32P-labeled PCR product of FGF 18, which had been labeled by random-oligonucleotide priming with a Mega Label kit (Amersham Biosciences, Buckinghamshire, UK). The product was prepared by RT-PCR using primers 5'-GGACATGTGCAGGCTGGGCTA- 3'(SEQ ID NO: 3) and 5'-GTGTTGGTTTCCTCATTCAAGTC-3'(SEQ ID NO: 5). Prehybridization, hybridization, and washing were performed according to the supplier's recommendations. The blots were autoradiographed with intensifying screens at -80 °C for 240 h.
Preparation of polyclonal antibody against FGFl 8. Plasmids expressing His-tagged carboxyl-terminal FGF 18 protein (codons from 167 to 207) were prepared using pET28 vector (Novagen, Madison, WI). The recombinant protein was expressed in E. coli BL21 codon-plus strain (Sfratagene, La Jolla, CA), and purified using TALON resin (BD Bioscience) according to the supplier's protocol. The protein was inoculated into rabbits and the immune sera were purified on affinity columns according to standard methodology. Immunohistochemistrv. Immunohistochemical staining was carried out using affinity-purified anti-FGF18 antibody against human FGF18. Frozen tissue sections were subjected to the SAB-PO peroxidase --mmunostaming system (Nichirei, Tokyo, Japan) according to the manufacturer's recommended method.
Effect of FGF 18 on cell survival in vitro. The entire coding region of human FGFl 8 was amplified by RT-PCR using primers 5'-CCTCAAGCTTAGCGATGTATTCA-3'(SEQ ID NO: 6) and either 5'- CGGTCTAGACTAGGCAGGGTGT-3'(SEQ ID NO: 7) or 5'- CCTCTCTCGAGGGCAGGGTGTGT-3'(SEQ ID NO: 8), and cloned into appropriate cloning sites of expression vectors pcDNA3.1(+) (Invitrogen) or pFlagCMV5 (Sigma- Aldrich). Plasmids expressing FGF 18 (pcDNA-FGF18 or pFlag-FGF18) or empty vector (pcDNA or pFlagCMV5) were transfected into murine fibroblast NIH3T3 cells for a focus- formation assay. One week after fransfection, the cells were fixed with 100% methanol and stained with Giemsa solution. The medium supporting NIH3T3 cells transfected with either pFlag-FGF18 or empty vector was conditioned with 0.5% FBS; growth of these cells was analyzed by MTT assay.
Construction of psiHIBX. Transcription ofthe HI RNA gene by RNA polymerase III produces short transcripts with uridines at the 3' ends. A genomic fragment containing the promoter region of Hi RNA was amplified by PCR, using primers 5'- TGGTAGCCAAGTGCAGGTTATA-3' (SEQ ID NO: 9), and 5'-
CCAAAGGGTTTCTGCAGTTTCA-3'(SEQ ID NO: 10) and human placental DNA as a template. The product was purified and cloned into pCR2.1 plasmid vector using a TA cloning kit, according to the supplier's protocol (Invitrogen). The BamHL, Xhol fragment containing HI RNA was purified and cloned into pcDNA3.1(+) between nucleotides 56 and 1257, and the fragment was amplified by PCR using primers 5'-
TGCGGATCCAGAGCAGATTGTACTGAGAGT-3'(SEQ ID NO: 11) and 5'- CTCTATCTCGAGTGAGGCGGAAAGAACCA-3'(SEQ ID NO: 12). The ligated DNA became the template for PCR amplification with primers 5'- TTTAAGCTTGAAGACCATTTTTGGAAAAAAAAAAAAAAAAAAAAAACA- 3'(SEQ ID NO: 13) and 5'-TTTAAGCTTGAAGACATGGGAAAGAGTGGTCTCA-3' (SEQ ID NO: 14). The product was digested with H dIII and subsequently self-ligated to produce a psiΗ 1 BX vector plasmid. An siRNA expression vector against FGF 18 (psiΗlBX-FGF18) was prepared by cloning double-stranded oligonucleotides 5'-
TCCCGGTTCTGGAGAACAACTACTTCAAGAGAGTAGTTGTTCTCCAGAACC- 3'(SEQ ID NO: 15) and 5'- AAAAGGTTCTGGAGAACAACTACTCTCTTGAAGTAGTTGTTCTCCAGAACC- 3 ' (SEQ ID NO: 16) into the Bbsl site in the psiHl BX vector. A control plasmid, psiHIBX-EGFP, was prepared by cloning double-stranded oligonucleotides 5'- CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTC- 3'(SEQ ID NO: 17) and 5'- AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCTGCTTC- 3'(SEQ ID NO: 18) into the Bbsl site in the psiHIBX vector.
Suppression of FGF 18 expression by siRNAs. SW480, HCT116, DLD1, and SNUC4 cells plated onto 10-cm dishes (4x 105 cells/dish) were transfected with FGFl 8 siRNA expression plasmids using FuGeneδ reagent (Roche diagnostics) and maintained in media containing 10% fetal bovine serum with appropriate concentrations of Geneticin. The cells were then fixed with 100% methanol and stained with Giemsa solution. Viable cells were measured with a cell- counting kit (DOJINDO, Kumamoto, Japan). Expression of FGF18 in the treated cells was examined by semi-quantitative RT-PCR 24 h after fransfection.
MTT assay. Cells (lxl 05) on 6-well plates were transfected with expression vector or confrol vector using FuGeneδ (Roche diagnostics) according to the supplier's protocol. Cell viability was evaluated by MTT assay seven days after fransfection. Cell-counting kit-8 (DOJENDO) was added to each dish at a concenfration of 1/10 volume, and the plates were incubated at 37°C for an additional 4 h; then absorbance was measured at 490 nm, and at 630 nm as reference, with a Microplate Reader 550 (Bio-Rad Laboratories, Hercules, CA).
Reporter assay. An initiation site (TIS) for transcription of FGF 18 was deteπnined by comparing the human genomic sequence (GenBank accession no. AC093246) with the cDNA sequence of FGF18 (GenBank accession no. NM_003862). To examine activity ofthe FGF 18 promoter we amplified by PCR four fragments, each corresponding to part ofthe region flanking FGF18 on the 5' side, and cloned each product into an appropriate enzyme site of pGL3 -Basic vector (Promega, Madison, WI). Plasmids expressing an activated form of β-catenin (mut β-catenin) and wild-type and dominant-negative forms of Tcf4 (wtTcf4 and dnTcf4) were prepared as described previously (22). One microgram of each reporter plasmid and 1 μg of each expression construct were co-transfected with 0.2 μg of pRL-TK plasmid (Promega) into SW480 cells using FuGENE6, to normalize the efficiency of fransfection. Reporter assays were carried out using a dual-luciferase reporter assay system according to the supplier's recommendations (Promega).
Electrophoretic mobility-shift assay (ΕMSA . The EMSA was performed as previously described (23) using nuclear extracts from SW480 cells. A double-stranded 16-nucleotide DNA probe was prepared by annealing FGFl 8F (5'-CGCCTTTGATGTGGGC-3*(SEQ ID NO: 19)) to FGFl 8R (5'-
GCCCACATCAAAGGCG-3'(SEQ ID NO: 20)), and labeled with 32P-ATP and T4 polynucleotide kinase.
Statistical analysis. Statistical significance was analysed by ANOVA with Scheffe's F test, using commercially available software (Statview, SAS Institute, Gary, NC).
2. Results
Up-regulation of FGFl 8 in CRC. Previously, the expression profiles of nine adenomas and 11 adenocarcinomas of the colon were analyzed by means of a cDNA microarray representing 23,040 genes (24). Among the genes whose expression levels were commonly up-regulated in cancer cells, a spot corresponding to FGF 18 showed high tumor/normal intensity ratios in the majority of the cases examined. The putative full-length cDNA consisted of 1546 nucleotides, with an open reading frame of 624 nucleotides (SEQ ID NO: 22) encoding a 207-amino-acid protein (SEQ ID NO: 23) (GenBank Accession number: AF075292). Subsequent semi- quantitative RT-PCR corroborated enhanced expression of this gene in 10 of 12 additional colon-cancer tissues examined (Fig. 1 A). To examine expression of FGFl 8 in normal adult human tissues, northern-blot analysis was carried out. Accordingly, a transcript of approximately 1.8 kb was identified that was abundantly expressed in the heart but not in any of 28 other tissues examined (data not shown).
Accumulation of FGF 18 in tumor cells. To analyze the function of FGF 18, an anti-FGF18 antibody was prepared that would recognize endogenous FGF 18 protein in cells, and investigated expression of this protein in four colorectal-cancer tissues by --mmunohistochemical staining. In all four cases, FGFl 8 was stained in the cytoplasm of cancerous cells (Fig. IB); staining in the cytoplasm of non-cancerous epithelial cells from corresponding mucosae was significantly weaker and localized mainly at the bottom of crypts.
Assay ofthe FGFl 8 promoter in colon-cancer cells. Since transactivation ofthe β-catenin/Tcf4 complex is a relatively common feature of colon-cancer cells, we tested whether this complex regulates expression of FGFl 8 by infecting SW480 cells with adenovirus expressing a dominant negative form of Tcf4 (dnTcf4), or with a control gene (LacZ). Expression of FGF18 was significantly decreased in response to dnTcf4 as compared to the confrol, suggesting that Tcf4-mediated franscriptional activity was correlated with expression of FGF18 (data not shown).
Hence, the sequences were searched for consensus Tcf4-binding motifs, 5'-CTTTGWW-3' or 5'-WWCAAAG-3', within a two-kb genomic fragment ofthe 5' region flanking FGFl 8, and identified three possible candidate sites; i.e., between -1631 and -1625 (TBM1), -1348 and -1342 (TBM2), and -190 and -184 (TBM3; Fig. 2A). To examine which of these binding sites might be responsible for the promoter activity of FGFl 8, fragments of various lengths were cloned from its 5' flanking region upstream ofthe luciferase gene, and performed a reporter assay using SW480 cells (Fig. 2B). pGL3-Pl (contan-ing nucleotides between -1644 and +26), pGL3-P2 (-1354 and +26), andpGL3-P3 (-195 and +26) revealed approximately 5-fold increases in luciferase activity as compared with pGL3-P4 (-181 and +26), suggesting that the region between -195 and -182 was responsible for the franscriptional activity. To further clarify the role of TBM-3, we assayed the luciferase activity after introducing a 2-base mutation (CTTTGAT (SEQ ID NO: 24) to CTTTGGC) at the TBM3 site (pGL3-P3mt). As expected, mutation at the TBM3 site (P3mt) reduced luciferase activity by more than 75%. These results suggested that TBM3 indeed contained the promoter sequence for FGFl 8.
Association between the putative Tcf4 binding site and the β-catenin/Tcf complex. To examine whether the β-catenin/Tcf4 complex associates with the TBM-3 site in the promoter region of FGF18, we carried out an electrophoretic mobility-shift assay (EMSA) using oligonucleotides corresponding to the TBM-3 sequence. A single band was shifted by addition of anti-β-catenin antibody, but not by an unrelated (confrol) antibody. This binding was abrogated by addition of wild-type unlabeled oligonucleotide, but not by mutant unlabeled oligonucleotides, indicating direct interaction between the binding sequence and the β-catenin/Tcf4 complex (Fig. 3).
Growth advantage conferred by over-expression of FGF18 inNIH3T3 cells. Since over-expression of FGF 18 was known to promote growth of fibroblasts and osteoblasts, we hypothesized that FGF 18 could render oncogenic effects in an autocrine manner. In line with that hypothesis, our immunoblotting experiments detected Flag- tagged FGF 18 protein in the culture media of murine fibroblast cells transfected with pFlagCMV-FGFl 8 (Fig. 4A). As expected, the NIH3T3 cells proliferated at a significantly higher rate in conditioned medium with FGFl 8 than cells in conditioned medium without FGF18(Fig. 4B).
Effect of FGFl 8 siRNA on growth of cancer cells. To evaluate the potentially oncogenic role of FGF 18, we prepared plasmids expressing siRNA of FGF 18 and transfected them into five lines of colorectal-carcinoma cells expressing abundant amounts of FGF 18. Among the constructed plasmids, psiHlBX-FGF18 significantly reduced expression of FGF18 as compared with a confrol plasmid (psiHIBX-EGFP), and markedly decreased the number of viable cells as compared with psiHIBX-EGFP (Fig. 4C,D,E).
As demonstrated herein, FGF 18 is frequently up-regulated in colorectal carcinomas, as a direct target ofthe β-catenin/Tcf4 complex. Since FGFl 8 is a secreted protein, it might serve as a novel marker for early detection of colorectal tumors. Moreover, because FGFl 8 protein promoted growth of NIH3T3 cells in an autocrine manner, and its down-regulation suppressed growth or survival of colon-cancer cells, FGF 18 may also represent a promising molecular target for novel anticancer drugs. FGF 18 was first identified on the basis of its amino-acid similarities to FGF8 and
FGFl 7 (60% and 58% identity, respectively) (18). Like other FGFs, it has an important role in limb development, probably through modulation of osteoblasts, chondrocytes, and osteoclasts (12, 25), and in organogenesis ofthe midbrain (26). In mice, expression of FGF 18 has been observed in the developing lung, surrounding developing bones, and cerebral cortex ofthe developing brain during embryonic stage El 5.5 (18). fritra- peritoneal injection of recombinant FGF 18 protein induced significant gains in the weights of liver and intestine in mice (18). Additionally FGF18 stimulated growth of NIH3T3 cells in a heparan sulfate-dependent manner (18). These observations agree well with the conclusions herein, that elevated expression of FGF 18 stimulates growth and/or prevents death of epithelial and mesenchymal cells in an autocrine manner. FGFs function by binding with FGF receptors (FGFRs); five FGFR genes and their splicing variants have been identified so far. A BIAcore assay demonstrated that FGFR-3c and FGFR-2c, but not FGFRlc, have affinity for FGFl 8 (20). Those data suggest that FGF 18 exerts its growth-promoting effect by interacting with some receptors. However, the phenotypes of FGF 18-deficient mice, which show delayed ossification and decreased expression of osteogenic markers, do not conform completely with the phenotype of mice lacking FGFR-3 (27). Therefore, antagonizing FGFR-3c and/or other FGFRs, such as FGFR-2c, might be an effective strategy for suppressing FGF18-mediated cell growth. The experiments herein also revealed that FGF 18 is the second member ofthe
FGF family to be proven as a direct target of Tcf/LEF. Previously, FGF4 was reported to be a direct target of LEF1; recombinant FGF4 fully rescued the Lef/_ phenotype for tooth development in mice (13). Wnt signals also control FGF-dependent limb initiation via FGF8 and FGF10 (12, 25). Since FGF18 is expressed in the right side of Hensen's node, before expression of FGF8 occurs, and expression of FGF 18 also precedes FGF8 in the isthmus in the developing brain, Wnt signals may recruit FGF 18 as an initial mediator of organogenesis of the limb and brain. Like FGF4, which has fransforming activity (17), FGFl 8 probably can become oncogenic when inappropriately over-expressed. 1-mmunohistochemical staining of FGF 18 in human colon-cancer tissues and corresponding non-cancerous mucosae showed a pattern similar to that of β-catenin and other β-catenin Tcf downsfream proteins such as ENC1, CD44, and EPHB2 (28). This evidence supports a view that activated β-catenin/Tcf4 complexes in colonic tumors have switched on the proliferative signals that are normally restricted to progenitor cells located in the lower third of colonic crypts. Therefore, FGF 18 expressed in non-tumorous crypts may play some role in maintenance of progenitor cells, which are absent in Tcf4-knockout mice. However, since in published experiments FGFl 8 -knockout mice did not reveal any abnormalities in intestinal structure, other factors may redundantly affect the development of mucosa (27). Furthermore, FGFl 8 could exert different functions in other tissues, specifically bone and brain. Further studies on the function of genes downstream ofthe β-catemn/Tcf4 franscription complex should help to clarify which factors are required for maintenance of progenitor cells in colonic epithelium. In conclusion, the data herein underscore the importance of elevated expression of
FGFl 8 in colorectal tumorigenesis. Since FGFl 8 functions as growth factor by binding its receptor(s) at least, but not solely, in an autocrine manner, the data herein clearly indicates that FGFl 8 should be a good candidate as a tumor marker as well as a molecular target for the development of reagents, such as specific neutralizing antibodies or antagonists against the receptor(s), for treatment of patients with colorectal tumors.
Industrial Applicability The previous gene-expression analysis of genome- wide cDNA microarray identified specific up-regulated gene FGF18. The present invention reveals that FGF18 serves as target for cancer prevention and therapy. Based on the expression of FGFl 8, the present invention provides a molecular diagnostic marker for identifying or detecting CRC. The methods described herein are also useful in the identification of additional molecular targets for prevention, diagnosis and freatment of CRC. The data reported herein add to a comprehensive understanding of CRC, facilitate development of novel diagnostic strategies, and provide clues for identification of molecular targets for therapeutic drugs and preventative agents. Such information contributes to a more profound understanding of colorectal tumorigenesis, and provide indicators for developing novel strategies for diagnosis, treatment, and ultimately prevention of CRC. All patents, patent applications, and publications cited herein are incorporated by reference in their entirety. Furthermore, while the invention has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope ofthe invention.
REFERENCES 1. Parkin, D. M. Global cancer statistics in the year 2000. Lancet Oncol., 2: 533-543, 2001. 2. Murthy, R. S., Bertolote, J. M., Epping- Jordan, J., Funk, M., Prentice, T., Saraceno, B., and Saxena, S. The World Health Report 2001. In: A. Haden and B. Campanim (eds.), pp. 144-149: World Health Organization, 2001. 3. Bullions, L. C, and Levine, A. J. The role of β-catenin in cell adhesion, signal fransduction, and cancer. Curr. Opin. Oncol., 10: 81-87, 1998.
4. Polakis, P. Wnt signaling and cancer. Genes Dev., 14: 1837-1851, 2000.
5. He, T. C, Sparks, A. B., Rago, C, Hermeking, H., Zawel, L., da Costa, L. T., Morin, P. J., Vogelstein, B., and Kinzler, K. W. Identification of c-MYC as a target ofthe APC pathway. Science, 281: 1509-1512, 1998.
6. Tetsu, O., and McCormick, F. β-catenin regulates expression of cyclin Dl in colon carcinoma cells. Nature, 398: 422-426, 1999.
7. Shtutman, M., Zhurinsky, J., Simcha, I., Albanese, C, D'Amico, M., Pestell, R., and Ben-Ze'ev, A. The cyclin Dl gene is a target ofthe β-catenin/LEF-1 pathway. Proc. Natl. Acad. Sci. USA, 96: 5522-5527, 1999.
8. Ornitz, D. M., and Itoh, N. Fibroblast growth factors. Genome Biol., 2: REVIEWS3005, 2001. 9. Hajihosseini, M. K., and Heath, J. K. Expression patterns of fibroblast growth factors- 18 and -20 in mouse embryos is suggestive of novel roles in calvarial and limb development. Mech. Dev., 113: 79-83, 2002.
10. Martin, G. Making a vertebrate limb: new players enter from the wings. Bioessays, 23: 865-868, 2001.
11. Crossley, P. H., and Martin, G. R. The mouse FgfS gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development, 121: 439-451, 1995.
12. Kawakami, Y., Capdevila, J., Buscher, D., Itoh, T., Rodriguez Esteban, C, and Izpisua Belmonte, J. C. WNT signals control FGF-dependent limb initiation and AER induction in the chick embryo. Cell, 104: 891-900, 2001.
13. Kratochwil, K., Galceran, J., Tontsch, S., Roth, W., and Grosschedl, R. FGF4, a direct target of LEF1 and Wnt signaling, can rescue the arrest of tooth organogenesis in Lefl' ' mice. Genes Dev., 16: 3173-3185, 2002. 14. Clarke, M. S., Khakee, R., and McNeil, P. L. Loss of cytoplasmic basic fibroblast growth factor from physiologically wounded myofibers of normal and dystrophic muscle. J. Cell. Sci., 106 (Pt l): 121-133, 1993.
15. Cuevas, P., Burgos, J., and Baird, A. Basic fibroblast growth factor (FGF) promotes cartilage repair in vivo. Biochem. Biophys. Res. Commun., 156: 611- 618, 1988.
16. Cappellen, D., De Oliveira, C, Ricol, D., de Medina, S., Bourdin, J., Sasfre-Garau, X., Chopin, D., Thiery, J. P., and Radvanyi, F. Frequent activating mutations of FGFR3 in human bladder and cervix carcinomas. Nat. Genet., 23: 18-20, 1999.
17. Sakamoto, H., Mori, M., Taira, M., Yoshida, T., Matsukawa, S., Shimizu, K., Sekiguchi, M., Terada, M., and Sugimura, T. Transforming gene from human stomach cancers and a noncancerous portion of stomach mucosa. Proc. Natl. Acad. Sci. USA, 83: 3997-4001, 1986.
18. Hu, M. C, Qiu, W. R.5 Wang, Y. P., Hill, D., Ring, B. D., Scully, S., Bolon, B., DeRose, M., Luethy, R., Simonet, W. S., Arakawa, T., and Danilenko, D. M. FGF-18, a novel member ofthe fibroblast growth factor family, stimulates hepatic and intestinal proliferation. Mol. Cell. Biol., 18: 6063-6074, 1998.
19. Shimoaka, T., Ogasawara, T., Yonarnine, A., Chikazu, D., Kawano, H., Nakamura, K., Itoh, N., and Kawaguchi, H. Regulation of osteoblast, chondrocyte, and osteoclast functions by fibroblast growth factor (FGF)- 18 in comparison with FGF-2 and FGF-10. J. Biol. Chem., 277: 7493-7500, 2002.
20. Hoshikawa, M., Yonamine, A., Konishi, M., and Itoh, N. FGF- 18 is a neuron- derived glial cell growth factor expressed in the rat brain during early postnatal development. Brain Res. Mol. Brain Res., 105: 60-66, 2002.
21. Ohbayashi, N., Hoshikawa, M., Kimura, S., Yamasaki, M., Fukui, S., and Itoh, N. Structure and expression ofthe mRNA encoding a novel fibroblast growth factor, FGF-18. J. Biol. Chem., 273: 18161-18164, 1998. 22. Fujita, M., Furukawa, Y., Tsunoda, T., Tanaka, T., Ogawa, M., and Nakamura, Y. Up-regulation ofthe ectodermal-neural cortex 1 (ENC1) gene, a downsfream target ofthe β-catenin/T-cell factor complex, in colorectal carcinomas. Cancer Res., 61: 7722-7726., 2001.
23. Satoh, S., Daigo, Y., Furukawa, Y., Kato, T., Miwa, N., Nishiwaki, T., Kawasoe, T., Ishiguro, H., Fujita, M., Tokino, T., Sasaki, Y., Imaoka, S., Murata, M., Shimano, T., Yamaoka, Y., and Nakamura, Y. AXIN1 mutations in hepatocellular carcinomas, and growth suppression in cancer cells by virus-mediated transfer of AXTNl. Nat. Genet., 24: 245-250, 2000.
24. Lin, Y. M., Furukawa, Y., Tsunoda, T., Yue, C. T., Yang, K. C, and Nakamura, Y. Molecular diagnosis of colorectal tumors by expression profiles of 50 genes expressed differentially in adenomas and carcinomas. Oncogene, 21: 4120-4128, 2002.
25. McQueeney, K., Soufer, R., and Dealy, C. N. β-catenin-dependent Wnt signaling in apical ectodermal ridge induction and FGF8 expression in normal and limbless mutant chick limbs. Dev. Growth Differ., 44: 315-325, 2002.
26. Ohuchi, H., Kimura, S., Watamoto, M., and Itoh, N. Involvement of fibroblast growth factor (FGF)18-FGF8 signaling in specification of left-right asymmetry and brain and limb development ofthe chick embryo. Mech. Dev., 95: 55-66, 2000. 27. Liu, Z., Xu, J., Colvin, J. S., and Ornitz, D. M. Coordination of chondrogenesis and osteogenesis by fibroblast growth factor 18. Genes Dev., 16: 859-869, 2002. 28. van de Wetering, M., Sancho, E., Verweij, C, de Lau, W., Oving, I., Hurlstone, A., van der Horn, K., Battle, E., Coudreuse, D., Haramis, A. P., Tjon-Pon-Fong, M., Moerer, P., van den Born, M., Soete, G., Pals, S., Eilers, M., Medema, R., and Clevers, H. The β-catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell, 111: 241-250, 2002. 29. Whitsett, J. A.; Clark, J. C; Picard, L.; Tichelaar, J. W.; Wert, S. E.; Itoh, N.; Perl, A.-K. T.; Stahlman, M. T. Fibroblast growth factor 18 influences proximal programming during lung morphogenesis. J. Biol. Chem. 277: 22743-22749, 2002.

Claims

1. A method of diagnosing CRC or a predisposition for developing CRC in a subject, comprising determining a level of expression of FGF 18 in a patient-derived biological sample, wherein an increase of said level as compared to a normal control level of said gene indicates that said subject suffers from or is at risk for developing CRC.
2. The method of claim 1, wherein said deteraiined expression level is at least 10% greater than said normal confrol level.
3. The method of claim 1, wherein the expression level is determined by any one method selected from group consisting of: (a) detecting mRNA of FGF 18, (b) detecting a protein encoded by FGFl 8, and (c) detecting a biological activity of a protein encoded by FGFl 8,
4. The method of claim 1, wherein said level of expression is determined by detecting hybridization of an FGFl 8 probe to a gene transcript of said patient-derived biological sample.
5. The method of claim 4, wherein said hybridization step is carried out on a DNA array.
6. The method of claim 1, wherein said biological sample comprises an epithelial cell.
7. The method of claim 1, wherein said biological sample comprises a CRC cell.
8. The method of claim 4, wherein said biological sample comprises an epithelial cell
9. A method of screening for a compound for freating or preventing CRC, said method comprising the steps of: a) contacting a test compound with a polypeptide encoded by a nucleic acid of FGFl 8; b) detecting the binding activity between the polypeptide and the test compound; and c) selecting a compound that binds to the polypeptide.
10. A method of screening for a compound for treating or preventing CRC , said method comprising the steps of: a) contacting a candidate compound with a cell expressing FGFl 8, and b) selecting a compound that reduces the expression level of FGF 18.
11. The method of claim 10, wherein said cell comprises a colorectal cancer cell.
12. A method of screening for a compound for treating or preventing CRC, said method comprising the steps of: a) contacting a test compound with a polypeptide encoded by a nucleic acid of FGFl 8; b) detecting the biological activity ofthe polypeptide of step (a); and c) selecting a compound that suppresses the biological activity ofthe polypeptide encoded by a nucleic acid of FGF 18 in comparison with the biological activity detected in the absence ofthe test compound.
13. The method of claim 12, wherein the biological activity ofthe polypeptide is cell proliferative activity.
14. A method of screening for compound for treating or preventing CRC, said method comprising the steps of: a) contacting a candidate compound with a cell into which a vector comprising the franscriptional regulatory region of FGF 18 and a reporter gene that is expressed under the confrol ofthe franscriptional regulatory region has been introduced b) measuring the activity or expression of said reporter gene; and c) selecting a compound that reduces the activity or expression level of said reporter gene, as compared to a control.
15. The method of claiml4, wherein the transcriptional regulatory region comprises the β-catenin/Tcf4 binding motief in the transcriptional regulatory region of FGF 18.
16. The method of claim 15, wherein said binding motif consists of nucleotide sequence set forth in SEQ ID NO: 24.
17. A method of screening for compound for treating or preventing CRC, said method comprising the steps of: a) contacting a DNA comprising a β-catenin/Tcf4 binding motif in the transcriptional regulatory region of FGF 18 with a β-catenin Tcf4 complex in the presence or absence of a candidate compound; b) detecting the binding ofthe DNA and the β-catenin/Tcf4 complex; and c) selecting a compound that inhibits the binding ofthe β-catenin/Tcf4 complex with the DNA, , as compared to a control.
18. The method of claim 17, wherein said binding motif consists of SEQ ID NO: 24.
19. A kit comprising a detection reagent which binds to nucleic acid sequence or polypeptide of FGF 18.
20. A method of treating or preventing CRC in a subject comprising administering to said subject an antisense composition, said composition comprising a nucleotide sequence complementary to a coding sequence of FGFl 8.
21. A method of treating or preventing CRC in a subject comprising administering to said subject a siRNA composition, wherein said composition reduces the expression of a nucleic acid sequence of FGF 18.
22. The method of claim 21, wherein the siRNA comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 21.
23. A method for treating or preventing CRC in a subject comprising the step of adm--nistering to said subject a pharmaceutically effective amount of an antibody or fragment thereof that binds to a protein encoded by nucleic acid of FGF 18.
24. A method of treating or preventing CRC in a subject comprising adπ- stering to said subject a vaccine comprising a polypeptide encoded by a nucleic acid of FGF 18 or an immunologically active fragment of said polypeptide, or a polynucleotide encoding the polypeptide.
25. A method for treating or preventing CRC in a subject, said method comprising the step of administering a compound that is obtained by the method according to any one of claims 9-18.
26. A composition for treating or preventing CRC, said composition comprising a pharmaceutically effective amount of an antisense polynucleotide or small interfering RNA against a polynucleotide of FGF 18.
27. The composition of claim 26, wherein the siRNA comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 21.
28. A composition for treating or preventing CRC, said composition comprising a pharmaceutically effective amount of an antibody or fragment thereof that binds to a protein encoded by nucleic acid of FGFl 8.
9. A composition for treating or preventing CRC, said composition comprising a pharmaceutically effective amount ofthe compound selected by the method of any one of claims 9-18 as an active ingredient, and a pharmaceutically acceptable carrier.
EP04747831A 2003-07-21 2004-07-15 Method for diagnosing colorectal cancers Withdrawn EP1649054A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US48892403P 2003-07-21 2003-07-21
PCT/JP2004/010442 WO2005007889A1 (en) 2003-07-21 2004-07-15 Method for diagnosing colorectal cancers

Publications (1)

Publication Number Publication Date
EP1649054A1 true EP1649054A1 (en) 2006-04-26

Family

ID=34079465

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04747831A Withdrawn EP1649054A1 (en) 2003-07-21 2004-07-15 Method for diagnosing colorectal cancers

Country Status (3)

Country Link
EP (1) EP1649054A1 (en)
JP (1) JP2007528717A (en)
WO (1) WO2005007889A1 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110105602A2 (en) 2007-03-08 2011-05-05 Daria Mochly-Rosen Mitochondrial Aldehyde Dehydrogenase-2 Modulators and Methods of Use Thereof
US8354435B2 (en) 2008-09-08 2013-01-15 The Board Of Trustees Of The Leland Stanford Junior University Modulators of aldehyde dehydrogenase activity and methods of use thereof
CN102202669A (en) 2008-10-28 2011-09-28 利兰·斯坦福青年大学托管委员会 Aldehyde dehydrogenase modulators and methods of use thereof
US10457659B2 (en) 2011-04-29 2019-10-29 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for increasing proliferation of adult salivary stem cells
WO2014160185A2 (en) 2013-03-14 2014-10-02 The Board Of Trustees Of The Leland Stanford Junior University Mitochondrial aldehyde dehydrogenase-2 modulators and methods of use thereof
JP2020106382A (en) * 2018-12-27 2020-07-09 学校法人東邦大学 Method for detecting non-alcoholic steatohepatitis (NASH)
JPWO2024084807A1 (en) * 2022-10-19 2024-04-25

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL149694A0 (en) * 1999-12-23 2002-11-10 Exiqon As Therapeutic uses of lna-modified oligonucleotides
US20030104573A1 (en) * 2000-09-11 2003-06-05 Shimkets Richard A. Nucleotide sequences and amino acid sequences of secreted proteins involved in angiogenesis
WO2003025139A2 (en) * 2001-09-17 2003-03-27 Mayo Foundation For Medical Education And Research Cobalamin mediated delivery of nucleic acids, analogs and derivatives thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2005007889A1 *

Also Published As

Publication number Publication date
WO2005007889A1 (en) 2005-01-27
JP2007528717A (en) 2007-10-18

Similar Documents

Publication Publication Date Title
US20070054849A1 (en) Method for diagnosing hepatocellular carcinomas
JP4620670B2 (en) How to diagnose breast cancer
US8029981B2 (en) Hypoxia-inducible protein 2 (HIG2), a diagnostic marker for clear cell renal cell carcinoma
US20070092519A1 (en) Method for diagnosing chronic myeloid leukemia
US20130084578A1 (en) Breast cancer related gene znfn3a1
JP2006500946A (en) Diagnostic method of testicular seminoma
JP2009502112A (en) Methods for diagnosing and treating renal cell carcinoma
JP2005537007A (en) Method for diagnosing colon cancer and gastric cancer
US20070253954A1 (en) Epha4 As Therapeutic Target Of Prc And Pdaca
WO2005007889A1 (en) Method for diagnosing colorectal cancers
US20080063640A1 (en) Pin-Prc Transition Genes
US20080199468A1 (en) Method For Diagnosing Colorectal Cancers
US8182997B2 (en) Prostate cancer related gene STYK1
JP2009505631A (en) Cancer-related gene RASEGEF1A

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20060221

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

17Q First examination report despatched

Effective date: 20060713

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070124