EP1631584B1 - Method for the detection of the activity of gamma-secretase - Google Patents

Method for the detection of the activity of gamma-secretase Download PDF

Info

Publication number
EP1631584B1
EP1631584B1 EP04730223A EP04730223A EP1631584B1 EP 1631584 B1 EP1631584 B1 EP 1631584B1 EP 04730223 A EP04730223 A EP 04730223A EP 04730223 A EP04730223 A EP 04730223A EP 1631584 B1 EP1631584 B1 EP 1631584B1
Authority
EP
European Patent Office
Prior art keywords
secretase
protein
gamma
cell
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
EP04730223A
Other languages
German (de)
French (fr)
Other versions
EP1631584A1 (en
Inventor
Edmund Hoppe
Gisela Peraus
Jonathan Rothblatt
Ekkehard Leberer
Luc Mercken
Sylvie Dreisler
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sanofi Aventis Deutschland GmbH
Original Assignee
Sanofi Aventis Deutschland GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sanofi Aventis Deutschland GmbH filed Critical Sanofi Aventis Deutschland GmbH
Priority to EP04730223A priority Critical patent/EP1631584B1/en
Publication of EP1631584A1 publication Critical patent/EP1631584A1/en
Application granted granted Critical
Publication of EP1631584B1 publication Critical patent/EP1631584B1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/37Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/61Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/71Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/80Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • C07K2319/81Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor containing a Zn-finger domain for DNA binding

Definitions

  • the invention relates to improved processes for the determination of the activity of ⁇ -secretase and the use of the processes.
  • the invention is based on the teachings of WO 00/34511 A2 .
  • AD Alzheimer's disease
  • plaques protein deposits, so-called plaques, can be detected at the molecular level, which are an essential characteristic of Alzheimer's disease.
  • the protein occurring most frequently in these plaques is a peptide of 40 to 42 amino acids, which is designated as A ⁇ -peptide.
  • This A ⁇ -peptide is a cleavage product of a significantly larger protein of 695 to 770 amino acids, the so-called amyloid precursor protein (APP).
  • APP amyloid precursor protein
  • APP sec is formed from APP by proteolytic cleavage, which is effected by the ⁇ -secretase.
  • the proteolytic cleavage takes place in a site of the amino acid sequence of APP, which is within the amino acid sequence of the A ⁇ -peptide (after amino acid residue 16 of the A ⁇ -peptide). Proteolysis of APP by the ⁇ -secretase thus excludes the formation of the A ⁇ -peptide.
  • the A ⁇ -peptide can thus only be formed from APP in an alternative processing route. It is postulated that two further proteases are involved in this processing route, one protease, which is designated as ⁇ -secretase, cleaving at the N-terminus of the A ⁇ -peptide in the APP and the second protease, which is designated as ⁇ -secretase, releasing the C-terminus of the A ⁇ -peptide ( Kang, J. et al., Nature, 325, 733 ) ( Figure 1 ).
  • a ⁇ -peptide Probably the strongest indication of the central role of the A ⁇ -peptide is the familial forms of Alzheimer's disease.
  • mutations are found in the APP gene around the area of the ⁇ - and ⁇ -secretase cleavage sites or in two further AD-associated genes (presenilins), which in cell culture lead to a significant increase in A ⁇ -peptide production ( Scheuner, D. et al., (1996), Nature Medicine, 2, 864 ).
  • Presenilins Presenilins
  • the ⁇ -secretase therefore has a crucial role in the formation of the A ⁇ -peptide (Wolfe, M.S. (2001), loc.cit).
  • a ⁇ -peptide In general, the detection of A ⁇ -peptide is difficult, since only a small amount of APP is converted ( Simons M, et al., Neurosci (1996) 1;16(3):899-908 ). Moreover, the A ⁇ -peptide is a very small fragment of about 4 kDa, which has a great tendency to self-aggregation due to its hydrophobic character. Accordingly, A ⁇ -peptide easily precipitates under physiological conditions ( Hilbich, C. et al., (1991) J. Mol. Biol., 218, 149 ) and is in its precipitated form not available for detection.
  • the detection of the A ⁇ -peptide in eukaryotic cells is carried out by means of immunobiological methods such as, e.g., ELISA, immunoprecipitation and Western blotting ( Suzuki, N. et al., Science 1994, 27, 264(5163) 1336 ; Haass, C. et al., (1992) Nature, 359, 322 ). Further, an in vitro assay for the determination of ⁇ -secretase activity from purified membrane fractions containing PS1 (presenilin 1) was described by Wolfe et al. (1999). These processes are very time consuming, as they involve incubation steps with appropriate antibodies, steps destroying the cells obtained from suitable cell culture or model organisms (e.g., C.
  • the said methods are not suitable in an automated assay system, e.g., for high throughput screening, to identify compounds, which specifically inhibit or decrease the activity of a ⁇ -secretase.
  • ⁇ -secretase activity is dependent upon an assembly of proteins ( Mattson, (2003) Nature 422, 385 ), which is, to date, only active in a complex membrane lipid environment.
  • WO00/34511A2 describes a process for the determination of ⁇ -secretase activity and for the detection of ⁇ -secretase by the detection of the A ⁇ -peptide.
  • the process of WO00/34511A2 utilizes a transgene which encodes a fusion protein comprising: the amino acid sequence GAIIGLMVGGWIATVIVITLVML (SEQ ID NO.
  • SP signal peptide
  • a first partial protein is formed, containing the amino acid sequence GAIIGLMVGGVV (SEQ ID NO. 2), and a second partial protein is formed, containing the amino acid sequence VIVITLVML (SEQ ID NO. 3).
  • the said first and/or second partial protein is detected, e.g., by use of a suitable reporter, which is, e.g., a reporter gene, which is activated by the release of a transcription activator coupled to the first and/or second partial protein.
  • the present invention relates to an improved process for the determination of ⁇ -secretase activity and the detection of a protein having ⁇ -secretase activity.
  • Particular embodiments of the process relate to processes for the identification of a ⁇ -secretase, of a cDNA which codes for a ⁇ -secretase, a subunit protein of ⁇ -secretase, or a ⁇ -secretase-like proteinase, and processes for the identification of a pharmaceutical active compound, which can modulate, e.g., decrease or inhibit the activity of a protein having ⁇ -secretase activity.
  • Such substances are of particular interest, if pharmaceutically acceptable and suitable for the treatment of Alzheimer's disease.
  • the present invention relates to a process for the detection of the activity of ⁇ -secretase wherein
  • said fusion protein does not contain one or more (i.e., beside SEQ ID No. 1 any further peptide) peptides acting as a signal for endo- or exocytosis and protease cleavage site with the exception of the SEQ ID No. 1.
  • the invention also relates to a process for the detection of the activity of ⁇ -secretase, wherein
  • This second partial protein which can be easily detected in the cytosol of a cell, e.g., as a fusion protein with a transcription activation factor (TAF) and the aid of a reporter gene; it serves as a detection tool for the presence of ⁇ -secretase or the quantification of a ⁇ -secretase activity.
  • the ⁇ -secretase cleavage site is located in the transmembrane domain of the APP (Kang, J. et al., (1987) Nature, 325, 733).
  • the APP transmembrane domain has the amino acid sequence GAIIGLMVGGVV 40 IA 42 TVIVITLVML.
  • the ⁇ -secretase cleaves after V 40 , A 42 or T 43 .
  • the A ⁇ -peptide which is produced by eukaryotic cells in cell culture, is secreted into the medium supernatant.
  • the release of the second partial protein can activate the expression of a reporter protein, which can be detected in eukaryotic cells.
  • a reporter protein e.g., TAF and the corresponding reporter gene
  • the first nucleotide sequence codes for a truncated APP or a modified APP, e.g., obtainable by site directed mutagenesis, in order to avoid coding of a peptide motif acting as a signal for endo- or exocytosis and/or protease cleavage site beside SEQ ID NO. 1.
  • said APP or part thereof encoded by the said first nucleotide sequence is a protein derived from APP of human, mouse, (e.g., APLP1 or APLP2).
  • the second nucleotide sequence preferably codes for any suitable signal peptide ("SP").
  • SP signal peptide
  • the signal peptide contains, e.g., the SP's according to SEQ ID NO. 5 (SP of human APP), SEQ ID NO. 12 (SP of yeast SUC2, "SP2"), or SEQ ID NO. 13 (SP of BM40, "SP3”) or any other signal peptide known, e.g., according to Heijne et al. (Nucl. Acids Res. (1986), 14(11)4683-4690 ).
  • the promoter can be suitable, e.g, for expression in mammalian cells, in C. elegans, in yeast, or in Drosophila.
  • Suitable promoters for mammalian cells are, e.g., CMV, HSV TK, SV40, LTR (all: Clontech, Heidelberg, Germany), and RSV (e.g. InvitrogenTM life technologies, NV Leek, Netherlands).
  • Promoters, which can be used for C. elegans are, e.g., unc-119, unc-54, hsp16-2, goa-1 and sel-12.
  • the promoters ADH1 (constitutive) ( Vlckova et al. (1994) Gene, 25(5), 472-4 ), GAL1 (conditionally inducible) ( Selleck et al. (1987) Nature 325, 173-7 ), MET3 (conditional) ( Cherest et al. (1987) Mol Gen Genet 210, 307-13 ) and MET25 (cf. e.g., Kerjan et al. (1986) Nucleic Acids Res. 14(20), 7861-71 ) are suitable.
  • the promoters MT metalothionine
  • Ac5 or Ds47 all: InvitrogenTM life technologies.
  • a eukaryotic cell is employed in the process, e.g., a human cell or a non-human cell, e.g., monkey, hamster, mouse, Drosophila, zebrafish or yeast.
  • a human cell or a non-human cell e.g., monkey, hamster, mouse, Drosophila, zebrafish or yeast.
  • E.g., a HeLa, HEK293, H4, SH-SY5Y, H9, Cos, CHO, N2A, SL-2 or Saccharomyces cerevisiae cell can be employed.
  • a C. elegans cell is employed.
  • the cell can be a constituent of a transgenic, non-human animal.
  • the transgenic cell can be a constituent of a transgenic C. elegans.
  • the invention relates to processes in which yeast cells, e.g., from the strain MaV203 (InvitrogenTM life technologies, Rockville, MD, USA) or EGY 48 (OriGene Technologies, Inc. Rockville, MD, USA), are used.
  • the transgene codes for a fusion protein; this is composed of the partial proteins which are encoded by the first and the second nucleotide sequence and, if appropriate, further nucleotide sequences.
  • the fusion protein thus contains the first partial protein and the second partial protein and, if appropriate, a further partial protein. However, it is important that the fusion protein does not contain any peptide motif acting as a signal for endo- or exocytosis and/or protease cleavage site, except for SEQ ID NO. 1.
  • protease cleavage sites are known to the skilled artisan from protease databases, e.g., MEROPS ( Rawlings et al. (2002) MEROPS: the protease database. Nucleic Acids Res. 30, 343-346 ).
  • the fusion protein according to instant invention does not contain a protease cleavage site, which is a caspase cleavage site, e.g., (IVL)ExD, especially, VEVA, VEVD and in another embodiment, the fusion protein according to instant invention does further not contain a signal peptide for endo- or exocytosis, which is a signal for APP internalization, e.g., NpxY or Di-leucine especially, NPTY.
  • a signal peptide for endo- or exocytosis which is a signal for APP internalization, e.g., NpxY or Di-leucine especially, NPTY.
  • the fusion protein has the amino acid sequence SEQ ID NO. 14. Beside SEQ. ID No. 1, said fusion protein does not contain any (one or more) further peptide motif acting as a signal for endo- or exocytosis (e.g., APP internalization signal) and/or protease (e.g., caspase) cleavage site.
  • APP internalization signal e.g., APP internalization signal
  • protease e.g., caspase
  • a transgene having the nucleotide sequence according to SEQ ID NO. 15 can be employed in the process.
  • the transgene is present in a vector.
  • This specific embodiment of the invention is also designated as SP-C55-Gal 4-VP16 (i.e., SPC55GV).
  • SP-C55-Gal 4-VP16 i.e., SPC55GV.
  • a fusion protein consisting of the signal peptide of APP, the C55 fragment of APP, GAL4 and VP16 is expressed.
  • This protein located in the transmembrane domain is cleaved within the C55 fragment and the second partial protein, i.e. the part of the fusion protein, which contains one part of the C55 fragment, GAL4 and VP16, is detected with the aid of a reporter plasmid.
  • transgene construct SPC55GV Beside the transgene construct SPC55GV, other reporter constructs are also conceivable in which, e.g., the transcription-activating domain could be inserted between the transmembrane domain and cytosolic domain of SPC55 or a Tag (e.g., MYC, FLAG) on the N- and C-terminus and between the transmembrane and the cytosolic domain of SPC55.
  • a Tag e.g., MYC, FLAG
  • the further coding nucleotide sequence codes for a protein, which used for the detection of the second partial protein.
  • the further coding nucleotide sequence is therefore located at the 3' end of the first nucleotide sequence.
  • the further coding nucleotide sequence codes, e.g., for a chimeric protein or another protein which is constructed from a number of domains, e.g., a protein which contains a DNA-binding domain and a transcription-activating domain.
  • the further coding nucleotide sequence codes for a protein which consists of a GAL4-binding domain and of the transcription-activating domain of VP16 (GAL4-VP16, "GV"), and the further partial protein preferably then has the amino acid sequence SEQ ID NO. 7.
  • the further partial protein can also contain a LexA-binding domain (e.g., Lex A-VP16). This further partial protein is particularly suitable for processes in which cells of the yeast strain EGY48 are used.
  • the invention relates to processes in which cells are used which are co-transfected with a reporter plasmid.
  • the reporter plasmid contains a reporter gene under the control of a regulatable promoter.
  • the reporter gene can code for GFP and its derivatives, e.g., EGFP (Enhanced Green Fluorescent Protein), EBFP, EYFP, d2EGFP, GFPuv or Luciferase (e.g., Promega, Mannheim, Germany), CAT (e.g., Promega), SEAP (e.g., Clontech), ⁇ Gal (e.g., Clontech), reef coral fluorescence protein (RCFP, Clontech) or apoptosis-inducing factors, e.g., Fas, TNF-R1, death domain and homologues ( Tartaglia et al.
  • GFP Enhanced Green Fluorescent Protein
  • EBFP Enhanced Green Fluorescent Protein
  • EYFP EYFP
  • the reporter plasmid can contain a minimal promoter, e.g., a GAL4 binding site in combination with the minimal promoter of HIV, of the CD4 promoter or the mec7 promoter.
  • the choice of the suitable regulatable promoter depends on the transcription-activating domain used.
  • a particular embodiment of the invention relates to the implementation of the process, where the cells used are yeast cells.
  • yeast expression vector pDBTrp InvitrogenTM life technologies, The Netherlands, Cat. No. 10835023
  • a MET-25 promoter is integrated (SEQ ID NO.
  • a large number of other expression vectors with different promoters e.g., the inducible GAL1-promoter, the constitutively active ADH1 promoter
  • different selection markers ADE, LEU, TRP, HIS, LYS, PHE
  • a particular embodiment of the invention relates to the use of yeast cells, which contain GAL4- or LexA-inducible reporter genes either stable integrated in their genome or extrachromosomal.
  • yeast strains MaV203 InvitrogenTM life technologies Inc., Rockville, MD, USA
  • EGY48 OriGene Technologies, Inc., Rockville, MD, USA
  • a particular embodiment of the processes relates to the use of a cell which was additionally transfected with a further recombinant vector.
  • the cell which is used for these embodiments normally has no or hardly any endogenous ⁇ -secretase or endogenous ⁇ -secretase activity and is not detectable using the above-mentioned processes.
  • This cell can be employed transformed with a further vector in which a nucleotide sequence - preferably a cDNA - is contained which codes for a ⁇ -secretase, a subunit protein of ⁇ -secretase, or a ⁇ -secretase-like proteinase.
  • a cDNA library can be employed.
  • This embodiment of the process can then be used, inter alia, to identify a ⁇ -secretase, a subunit protein of ⁇ -secretase, or a ⁇ -secretase-like proteinase or a cDNA, which codes for a ⁇ -secretase, a subunit protein of ⁇ -secretase, or a ⁇ -secretase-like proteinase.
  • transgene which codes for a fusion protein and contains the following constituents:
  • the first nucleotide sequence codes for APP or a part thereof, which comprises beside SEQ ID NO. 1 not any further peptide motif acting as a signal for endo- or exocytosis and/or protease cleavage site.
  • the transgene can, e.g., have the nucleotide sequence SEQ ID NO. 15.
  • the transgene can be present in a suitable vector, e.g., pcDNA 3.1+ or pDBTrp.
  • the description also discloses a process for the production of a transgenic non-human organism, e.g., of a transgenic C. elegans, wherein said transgene and/or a vector comprising said transgene is microinjected into the gonads of the organism, e.g., of a C. elegans.
  • the description also discloses a cell, which contains a transgene according to the invention and a transgenic C. elegans, which contains said transgene.
  • the description also discloses a cell, particularly a yeast cell, which contains said transgene, preferably present in a suitable vector. Further, the description discloses in particular to cells, preferably yeast cells, which contain the transgene and a cDNA library, resp., are suitable to be subject of a cDNA expression library (cDNA library).
  • the description discloses the use of the said transgenic or recombinant cells, preferably cells of yeast or C. elegans in a process for the determination or identification of ⁇ -secretase, cDNA encoding ⁇ -secretase, cDNA encoding a subunit protein of ⁇ -secretase, cDNA encoding a ⁇ -secretase-like proteinase, or the activity of ⁇ -secretase, a subunit protein of ⁇ -secretase, or a ⁇ -secretase-like proteinase, the use of the said cells in a process for the identification of inhibitors of the ⁇ -secretase activity ( ⁇ -secretase, a subunit protein of ⁇ -secretase, or a ⁇ -secretase-like proteinase), and the process thereof.
  • the description discloses processes for the identification of substances (effectors), which modulate (i.e., inhibit, decrease, increase or alter) the activity of a ⁇ -secretase, a subunit protein of ⁇ -secretase, or a ⁇ -secretase-like proteinase, the process containing the following steps:
  • the description also discloses processes for the identification of substances which inhibit the activity of a ⁇ -secretase, a subunit protein of ⁇ -secretase, or a ⁇ -secretase-like proteinase, where a transgene which codes for a protein which contains a signal peptide and the SEQ ID NO. 1 is expressed in the presence of a substance to be investigated and of a reporter plasmid and the effect of the substance to be investigated on the amount of second partial protein formed is determined, the second partial protein containing the amino acid sequence VIVITLVML (SEQ ID NO. 3).
  • Yet a further embodiment of instant description is a process for preparing a pharmaceutical comprising a) a process as described and b) mixing the identified pharmaceutical active compound with a pharmaceutical inert inorganic and/or organic excipients.
  • test kit for detecting the activity of ⁇ -secretase, a subunit protein of ⁇ -secretase, or a ⁇ -secretase-like proteinase comprising the transgene, vector, or cell as described above.
  • the plasmid encodes the APP signal peptide (SP) which is fused to the C-terminal 100 amino acid residues of APP (C100).
  • C100 begins with the N-terminus of the A ⁇ -peptide and ends with the C-terminus of APP. It must additionally be cleaved by the ⁇ -secretase in order to release the A ⁇ -peptide.
  • GAL4/VP16 (Seq ID No. 7) was fused to the C-terminus of SP-C100 (Seq ID No. 6).
  • GAL4/VP16 comprises the first 147 amino acid residues of the yeast transcription activator GAL4 and the 78 C-terminal amino acid residues of VP16, a transcription activator from the herpes simplex virus.
  • the GAL4 fragment takes over the function of the DNA binding, while the VP16 fragment activates the transcription (Sadowski et al., 1988).
  • pcDNA3.1+ (InvitrogenTM life technologies, The Netherlands, Cat. No. V79020) serves as the plasmid vector.
  • the mammalian cell reporter plasmid pGL2-MRG5 is pGL2 (Promega) in which a DNA fragment from pMRG5 (Ikeda et al., 1998), comprising five GAL4 DNA-binding sites upstream of the human immunodeficiency virus (HIV) core promoter (Kretzschmar et al., 1994), is inserted upstream of the luciferase reporter gene of pGL2.
  • the luciferase reporter gene was replaced by the gene for EGFP (Enhanced Green Fluorescent Protein) obtained from the vector pEGFP-N1 (Clontech Laboratories, Heidelberg).
  • SH-SY5Y Human neuroblastoma cells SH-SY5Y (ATCC CRL-2266) were co-transfected with both plasmids of Examples 1 and 2 and then microscopically analyzed under irradiation with light of wavelength 480 nm, by means of which EGFP is excited. It was possible to detect EGFP-expressing cells exhibiting strong green fluorescence. In order to ensure that the green fluorescence is specifically dependent on the expression of the EGFP by the reporter plasmid, SH-SY5Y cells were transfected only with the reporter plasmid pGL2-MRG5-EGFP. In these cells, no green fluorescence was detectable. The expression was activated by GAL4-VP16, which presupposes a proteolytic release of GAL4/VP16 from the C-terminus of SP-C100-GAL4/VP16.
  • Example 4 Use of the C100-Gal4/VP16 system for the detection of a cDNA coding for a ⁇ -secretase activity in cDNA libraries
  • SP-C100-Gal4/VP16 was cloned in the yeast expression vector pDBTrp (InvitrogenTM life technologies, The Netherlands, Cat. No. 10835023) under control of the MET25 promoter by replacing the portion of pDBTrp containing the ADH promoter and GAL4DB domains (positioned between the CYH2 gene and the multiple cloning site) with a DNA fragment containing the MET25 promoter from p415MET25 (Mumberg et al., 1994) upstream of SP-C100-Gal4-VP16.
  • the yeast strain MaV203 (InvitrogenTM life technologies) was transformed with this construct.
  • MaV203 is genetically modified and contains three GAL4-inducible reporter genes (URA3, HIS3, lacZ), which are stably integrated into the genome (Vidal et al., 1996).
  • URA3 GAL4-inducible reporter genes
  • HIS3 lacZ
  • Example 5 Identification of ⁇ -secretases by screening of a human B cell cDNA library
  • the coding region for the human signal peptide of SP-C100-GAL4/VP16 was replaced with a signal peptide derived from the yeast SUC2 gene (SP2; SEQ ID NO. 12), resulting in a construct encoding SP2-C100-GAL4NP16 (SEQ ID NO. 19).
  • the SP2-C100-GAL4/VP16 was obtained by EcoRI cleavage to excise the C100 fragment of SP2-C100 and replace it with C100-GAL4/VP16.
  • the fragments were cloned into the yeast expression vector pDBTrp (InvitrogenTM life technologies, The Netherlands, Cat. No. 10835023) containing the MET25 promoter, as described in Example 4.
  • Example 8 Cloning of SP3-C100, SP3-C100-GAL4NP16, and SP3-C-GAL4NP16-100
  • MaV203 cells expressing SP2-C-GAL4/VP16 -100 which is expressed at levels comparable to SP2-C100-GAL4/VP16, exhibited a Ura - -, His - -phenotype, as was exhibited also by MaV203 transformed with an empty vector control.
  • SP3-C-GAL4/VP16 -100 protein expressed in mammalian cells is processed correctly by ⁇ -secretase activity
  • SP3-C-GAL4/VP16-100 was transfected into mammalian cells that have been shown to express ⁇ -secretase activity endogenously (Haass et al., 1992).
  • the signal peptide in SP2-C-GAL4/VP16-100 was replaced, as described in Example 8, with a mammalian signal peptide derived from the basal membrane protein BM40, which is known for high level expression (SP3; SEQ ID NO. 13).
  • ⁇ -secretase was monitored by quantifying the secretion of A ⁇ into the culture medium.
  • the secreted A ⁇ was detected by a sandwich ELISA using monoclonal antibodies 6E10 and biotinylated 4G8 (Senetek PLC, Napa, California, USA; cf. Kim et al., 1990) as capture and detection antibodies, respectively.
  • Example 13 Construction of the mammalian expression plasmid SP3-C55-GAL4/VP16:
  • Constructs containing the C100 sequence of APP and GAL4/VP16 contain both the cleavage site of ⁇ -secretase and a cleavage site of caspase-like proteases.
  • an unspecific caspase-like activity could cleave SP3-C100-GAL4/VP16 between the authentic ⁇ -secretase site and the GAL4/VP16 domain to release GAL4/VP16 and activate the reporter system in mammalian cells
  • the 45 amino acid C-terminal segment of C100 contained in SP3-C100-GAL4/VP16, encoding the cytoplasmic domain of APP was deleted. Removal of the C-terminal 45 amino acids of C100 also eliminates an "internalization signal" peptide at the C-terminus of APP that directs the endocytosis of APP after being inserted in the plasma membrane.
  • the mammalian expression plasmid SP3-C55-GAL4/VP16 comprises the BM40 signal peptide (Seq ID No. 13), the N-terminal 55 amino acid residues (C55; Seq ID No. 6) of APP-C100, and GAL4/VP16.
  • C55 begins with the N-terminus of the A ⁇ -peptide and ends with the transmembrane domain of APP.
  • SP3-C55-GAL4/VP16 protein only the cleavage site for ⁇ -secretase is present.
  • C55 comprises the ⁇ -secretase cleavage site and must be cleaved by ⁇ -secretase in order to release the A ⁇ -peptide and GAL4/VP16.
  • Example 14 Stable transfected HEK293 cells
  • HEK293 cells Human Embryonic Kidney cell line, (ATCC)
  • ATCC Human Embryonic Kidney cell line
  • PGL2-MRG5 luciferase reporter plasmid PGL2-MRG5(described in Example 2).
  • stable cell lines were selected by incubation with 400 ⁇ g/ml Geneticin (GibcoBRL) to select for Neomycin resistant clones and thereafter characterized for stable expression of SP3-C55-GAL4/VP16 and luciferase.
  • HEK293 cells were co-transfected with the SP3-C55-GAL4/VP16 vector (0.03 ⁇ g) and the pGL2-MRG5 luciferase reporter vector (1 ⁇ g) in Multi-Well 12 plates.
  • the compounds DPAT from Elan Pharmaceuticals; Dovey et al., 2001
  • L-685,458 from Merck Pharmaceuticals; Shearman et al., 2000
  • DAPT 14nM
  • 19nM L-685,458
  • Luciferase activity was quantified by the Bright-Glo Luciferase Assay kit (Promega). A ⁇ in the cell medium was quantified by ELISA, using the antibodies 4G8 and 6E10 (from Senetek), as described in Example 11. These antibodies are specific for amino acids 17-24 (4G8) and 1-17 (6E10) of the A ⁇ -peptide.
  • a ⁇ was also identified by immunoprecipitation and by immunoblotting. Both methods identified a 4 kDa band corresponding to A ⁇ -peptide.
  • a clone of HEK293 cells that stably express both the SP3-C55-GAL4/VP16 and the MRG5-luciferase constructs was identified according to Example 14. This cell clone was used to examine the response of the stably-transfected mammalian cell assay system to DAPT (from Elan Pharm.; Dovey et al., 2001), and L-685,458 (from Merck Pharm.; Shearman et al., 2000)., Both compounds exhibited dose-dependent inhibition of luciferase activity (24h treatment) with an IC 50 of 230nM (DAPT) and 130nM (L-685,458), respectively.
  • stably double-transfected HEK293 cells are incubated, in Multi-Well 96 plates, in the presence of the compound(s) under investigation (e.g., compound library screening) at a concentration 10 ⁇ M or less in the assay, and luciferase activity is determined 24 hours later.
  • Luciferase activity can be quantified with the Luciferase Assay System kit (Promega), the Bright-Glo Luciferase Assay kit (Promega), or any other method for luciferase quantification.
  • a decrease in luciferase activity reflects a decrease in ⁇ -secretase activity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Psychiatry (AREA)
  • Hospice & Palliative Care (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Detecting (M1) activity of gamma -secretase, involves incorporating transgene encoding a fusion protein and comprising first nucleotide sequence (FNS), second nucleotide sequence (SNS), and a promoter, into a cell and expressing fusion protein, forming a first and second partial protein by cleaving the fusion protein using gamma -secretase present in cell; and detecting the first and/or second partial protein. Detecting (M1) the activity of gamma -secretase, involves: (a) obtaining a transgene that encode a fusion protein comprising a first nucleotide sequence (FNS) which codes for a protein having the amino acid sequence of Gly-Ala-Ile-Ile-Gly-Leu-Met-Val-Gly-Gly-Trp-Ile-Ala-Thr-Val-Ile-Val-Ile-Thr-Leu-Val-Met-Leu (S1), a second nucleotide sequence (SNS) which codes for a signal peptide, at the 5' end of FNS, a promoter, and if appropriate further coding and/or non-coding nucleotide sequence; (b) incorporating the transgene into a cell and expressing the fusion protein; (c) forming a first partial protein having amino acid sequence of Gly-Ala-Ile-Ile-Gly-Leu-Met-Val-Gly-Gly-Val-Val, and a second partial protein having amino acid sequence of Val-Ile-Val-Ile-Thr-Leu-Val-Met-Leu, by cleaving the fusion protein within (S1) using gamma -secretase present in the cell; and (d) detecting the first and/or second partial protein, or determining the amount of second partial protein and determining the activity of gamma -secretase using the determined amount of second partial protein, where the fusion protein contains (S1) and further does not contain one or more peptides acting as a signal for endo- or exocytosis and/or protease cleavage site. Independent claims are also included for: (1) a transgene (I) comprising FNS, SNS at the 5' end of FNS, promoter, and at least one further nucleotide sequence that codes for a DNA-binding domain and for a transcription-activating domain, at the 3' end of FNS; (2) a vector (V1) comprising (I); (3) a cell (II) comprising (I); (4) a transgenic C. elegans (III), comprising (I); (5) a yeast cell (IV) comprising (I); (6) a cell (V) comprising (I), a cDNA library and a reporter plasmid; (7) identifying (M2) substances that inhibit the activity of gamma -secretase, subunit protein of gamma -secretase or gamma -secretase-like proteinase, involves: (a) producing transgenic non-human organism or a transgenic cell, expressing and containing reporter plasmid carrying a protein binding site, a minimal promoter and a reporter gene, transgene comprising FNS, SNS, promoter and/or further non-coding and/or coding nucleotide sequence, and if appropriate, a cDNA which encodes gamma -secretase, subunit protein of gamma -secretase or gamma -secretase-like proteinase, incubating the transgenic non-human organism or the transgenic cell with a test substance, and determining the amount of second partial protein; (b) incorporating the transgene encoding the fusion protein having a signal peptide and (S1), reporter plasmid, and if appropriate, a cDNA which encodes gamma -secretase, subunit protein of gamma -secretase or gamma -secretase-like proteinase, into a cell, determining the expression of the fusion protein encoded by the transgene and a cDNA which encodes gamma -secretase, subunit protein of gamma -secretase or gamma -secretase-like proteinase encoded by the cDNA, in presence of the test substance, and determining the amount of second partial protein, where when the fusion protein is cleaved by the gamma -secretase present in the cell, the first and second partial proteins are formed, and when the fusion protein is not cleaved by the gamma -secretase present in the cell, the first and second partial proteins are not formed; or (c) determining the expression of the transgene encoding a fusion protein having a signal peptide and (S1), in the presence of a test substance, and determining the effect of the test substance based on the amount of the second partial protein formed; (8) inhibitor (VI) of gamma -secretase, subunit protein of gamma -secretase or gamma -secretase-like proteinase, identified by (M2); (9) a pharmaceutical composition (PC) comprising a pharmaceutical active compound inhibiting activity of gamma -secretase, subunit protein of gamma -secretase or gamma -secretase-like proteinase, identified by (M2); and (10) kit for detecting the activity of gamma -secretase, subunit protein of gamma -secretase or gamma -secretase-like proteinase, comprising (I), V1 or any one of (II)-(V). ACTIVITY : Neuroprotective; Nootropic. No biological data given. MECHANISM OF ACTION : Inhibits the activity of gamma -secretase, subunit protein of gamma -secretase or a gamma -secretase-like proteinase (claimed).

Description

  • The invention relates to improved processes for the determination of the activity of γ-secretase and the use of the processes. The invention is based on the teachings of WO 00/34511 A2 .
  • Alzheimer's disease (AD) is a neurodegenerative disorder of the brain, which is accompanied at the cellular level by a massive loss of neurons in the limbic system and in the cerebral cortex. In the brain areas affected, protein deposits, so-called plaques, can be detected at the molecular level, which are an essential characteristic of Alzheimer's disease. The protein occurring most frequently in these plaques is a peptide of 40 to 42 amino acids, which is designated as Aβ-peptide. This Aβ-peptide is a cleavage product of a significantly larger protein of 695 to 770 amino acids, the so-called amyloid precursor protein (APP).
  • APP is an integral transmembrane protein, which firstly traverses the lipid bilayer. By far the largest part of the protein is extracellular, while the shorter C-terminal domain is directed into the cytosol (Figure 1). The Aβ-peptide is shown dark-gray in Figure 1. About two thirds of the Aβ-peptide originates from the extracellular domain and about one third from the transmembrane domain of APP.
  • Beside the membrane-based APP, a secreted form of the amyloid precursor protein can be detected which consists of the large ectodomain of the APP and is designated as APPsec ("secreted APP"). APPsec is formed from APP by proteolytic cleavage, which is effected by the α-secretase. The proteolytic cleavage takes place in a site of the amino acid sequence of APP, which is within the amino acid sequence of the Aβ-peptide (after amino acid residue 16 of the Aβ-peptide). Proteolysis of APP by the α-secretase thus excludes the formation of the Aβ-peptide.
  • The Aβ-peptide can thus only be formed from APP in an alternative processing route. It is postulated that two further proteases are involved in this processing route, one protease, which is designated as β-secretase, cleaving at the N-terminus of the Aβ-peptide in the APP and the second protease, which is designated as γ-secretase, releasing the C-terminus of the Aβ-peptide (Kang, J. et al., Nature, 325, 733) (Figure 1).
  • To learn more about the secretases (α-secretase, β-secretase, γ-secretase) is of great interest, in particular in the context of investigations on Alzheimer's disease, e.g., for the identification of the secretases or factors involved in secretase regulation and Aβ-peptide formation (Wolfe, M.S. (2001), J. Med. Chem., 44(13), 2039-2060). The inhibition of β-secretase and in particular of γ-secretase could lead to a reduction in the Aβ-production, on the other hand an activation of the α-secretase could increase the processing of APP in APPsec and would thus simultaneously reduce the formation of the Aβ-peptide. A transgenic C. elegans, which is found in the course of such investigations is described in the German Patent Application DE 198 49 073 A1 .
  • There are many indications that the Aβ-peptide (Aβ) is a crucial factor in the occurrence of Alzheimer's disease. Inter alia, neurotoxicity of Aβ-fibrils in cell culture is postulated (Yankner, B.A. et al., (1990) Proc Natl Acad Sci USA, 87, 9020). In patients with Down's syndrome, in which the gene encoding APP occurs in an additional copy, the neuropathology characteristic of Alzheimer's disease also occurs even at an age of 30 years. Here, it is assumed that the overexpression of APP follows an increased conversion into the Aβ-peptide (Rumble, B. et al., (1989), N. Engl. J. Med., 320, 1446).
  • Probably the strongest indication of the central role of the Aβ-peptide is the familial forms of Alzheimer's disease. Here, mutations are found in the APP gene around the area of the β- and γ-secretase cleavage sites or in two further AD-associated genes (presenilins), which in cell culture lead to a significant increase in Aβ-peptide production (Scheuner, D. et al., (1996), Nature Medicine, 2, 864). There are a number of indications of the fact that APP is firstly cleaved into the Aβ-peptide by the β-secretase during its processing in order to serve subsequently as a substrate for γ-secretase. The γ-secretase therefore has a crucial role in the formation of the Aβ-peptide (Wolfe, M.S. (2001), loc.cit).
  • In general, the detection of Aβ-peptide is difficult, since only a small amount of APP is converted (Simons M, et al., Neurosci (1996) 1;16(3):899-908). Moreover, the Aβ-peptide is a very small fragment of about 4 kDa, which has a great tendency to self-aggregation due to its hydrophobic character. Accordingly, Aβ-peptide easily precipitates under physiological conditions (Hilbich, C. et al., (1991) J. Mol. Biol., 218, 149) and is in its precipitated form not available for detection.
  • The detection of the Aβ-peptide in eukaryotic cells is carried out by means of immunobiological methods such as, e.g., ELISA, immunoprecipitation and Western blotting (Suzuki, N. et al., Science 1994, 27, 264(5163) 1336; Haass, C. et al., (1992) Nature, 359, 322). Further, an in vitro assay for the determination of γ-secretase activity from purified membrane fractions containing PS1 (presenilin 1) was described by Wolfe et al. (1999). These processes are very time consuming, as they involve incubation steps with appropriate antibodies, steps destroying the cells obtained from suitable cell culture or model organisms (e.g., C. elegans). The said methods are not suitable in an automated assay system, e.g., for high throughput screening, to identify compounds, which specifically inhibit or decrease the activity of a γ-secretase. In part, this is because γ-secretase activity is dependent upon an assembly of proteins (Mattson, (2003) Nature 422, 385), which is, to date, only active in a complex membrane lipid environment.
  • Further, the activity of the γ-secretase can be demonstrated according to the teachings of WO00/34511A2 , which describes a process for the determination of γ-secretase activity and for the detection of γ-secretase by the detection of the Aβ-peptide. The process of WO00/34511A2 utilizes a transgene which encodes a fusion protein comprising: the amino acid sequence GAIIGLMVGGWIATVIVITLVML (SEQ ID NO. 1) as the enzymatic target site of γ-secretase, a signal peptide (SP) at the 5'-end, a promoter and, if appropriate, further coding and/or non-coding nucleotide sequences, which is incorporated into a cell in order to express the said fusion protein.
  • When the fusion protein is specifically cleaved by the γ-secretase present in the cell, a first partial protein is formed, containing the amino acid sequence GAIIGLMVGGVV (SEQ ID NO. 2), and a second partial protein is formed, containing the amino acid sequence VIVITLVML (SEQ ID NO. 3). Subsequently, the said first and/or second partial protein is detected, e.g., by use of a suitable reporter, which is, e.g., a reporter gene, which is activated by the release of a transcription activator coupled to the first and/or second partial protein.
  • Due to the known problems accompanied with the detection of Aβ-peptide, it is the problem of instant invention to improve the process of WO00/34511A2 , e.g., by decreasing the background signal and/or increasing the signal specificity, in order to improve the signal/noise ratio in the assay of the invention.
  • Surprisingly, it is possible to improve the signal/noise ratio in a process according to WO00/34511A2 by decreasing the unspecific release of first and/or second partial proteins due to unspecific protease activity. This is achieved, e.g., in the fusion peptide of WO00/34511A2 , by the exclusion/avoidance of any other sequences/motifs of protease cleavage sites and/or internalization sequences - beside the γ-secretase cleavage site. Therefore, the present invention relates to an improved process for the determination of γ-secretase activity and the detection of a protein having γ-secretase activity.
  • Particular embodiments of the process relate to processes for the identification of a γ-secretase, of a cDNA which codes for a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase, and processes for the identification of a pharmaceutical active compound, which can modulate, e.g., decrease or inhibit the activity of a protein having γ-secretase activity. Such substances are of particular interest, if pharmaceutically acceptable and suitable for the treatment of Alzheimer's disease.
  • The present invention relates to a process for the detection of the activity of γ-secretase wherein
    1. A. a transgene is used which encodes a fusion protein comprising:
      1. a) a first nucleotide sequence which codes for a protein which contains the amino acid sequence GAIIGLMVGGVVIATVIVITLVML (SEQ ID NO. 1), wherein said protein can be cleaved within said amino acid sequence by γ-secretase present in a cell, whereby a first partial protein, which contains the amino acid sequence GAIIGLMVGGVV (SEQ ID NO. 2), and a second partial protein, which contains the amino acid sequence VIVITLVML (SEQ ID NO. 3), are formed
      2. b) at the 5' end of the first nucleotide sequence, a second nucleotide sequence which codes for a signal peptide,
      3. c) a promoter and,
      4. d) further coding nucleotide sequences which code for a protein which is expressed as a fusion protein with the first partial protein and the second partial protein and which is used for the detection of the second partial protein, and, if appropriate, further non-coding nucleotide sequences;
    2. B. this transgene is incorporated into a human cell or a non-human eukaryotic cell and the fusion protein is expressed;
    3. C. the fusion protein is cleaved within the amino acid sequence SEQ ID NO. 1 by γ-secretase present in the cell, whereby the first partial protein and the second partial protein are formed and
    4. D. the second partial protein is detected,
    wherein with the exception of SEQ ID No. 1 said fusion protein does not contain one or more peptide motifs acting as a signal for endo- or exocytosis and/or protease cleavage site.
  • In the said process said fusion protein does not contain one or more (i.e., beside SEQ ID No. 1 any further peptide) peptides acting as a signal for endo- or exocytosis and protease cleavage site with the exception of the SEQ ID No. 1.
  • The invention also relates to a process for the detection of the activity of γ-secretase, wherein
    1. A. a transgene is used which encodes a fusion protein and contains the following constituents:
      1. a) a first nucleotide sequence which codes for a protein which contains the amino acid sequence GAIIGLMVGGWIATVIVITLVML (SEQ ID NO. 1), wherein said protein can be cleaved within said amino acid Sequence by γ-secretase present in a cell, whereby a first partial protein, which contains the amino acid sequence GAIIGLMVGGVV (SEQ ID NO.2), and a second partial protein, which contains the amino acid sequence VIVITLVML (SEQ ID NO. 3), are formed
      2. b) at the 5' end of the first nucleotide sequence, a second nucleotide sequence which codes for a signal peptide,
      3. c) a promoter and,
      4. d) further coding nucleotide sequences which code for a protein which is expressed as a fusion protein with the first partial protein and the second partial protein and which is used for the detection of the second partial protein, and, if appropriate, further non-coding nucleotide sequences;
    2. B. this transgene is incorporated into a human cell or a non-human eukaryotic cell and the fusion protein is expressed;
    3. C. the fusion protein is cleaved within the amino acid sequence SEQ ID NO. 1 by γ-secretase present in the cell, whereby the first partial protein and the second partial protein are formed, and
    4. D. the amount of second partial protein is determined and the activity of the γ-secretase is determined from the amount of second partial protein formed,
    characterized in that with the exception of SEQ ID No. 1 said fusion protein does not contain one or more peptide motifs acting as a signal for endo- or exocytosis and/or protease cleavage site.
  • The processes according to the invention ("Aβ-peptide screening assay", "γ-secretase assay") are suitable for the in vivo detection of a γ-secretase (protein having γ-secretase activity) or of the activity of a γ-secretase, enabling to employ the processes universally, even, e.g., in high throughput screening ("HTS") assays. The processes do not have the above-mentioned disadvantages of the conventional detection processes, particularly, laborious isolation and detection steps are avoided and the specific signal of the γ-secretase activity is significantly improved. The more specific signal is achieved by a considerably reduced background signal and avoidance, resp., decrease of the release of the first and second partial proteins due to the action of unspecific proteases.
  • An essential element of the processes according to the invention is that the C-terminal APP fragment, which is cleaved by the γ-secretase into two fragments - a first partial protein which contains the amino acid sequence GAIIGLMVGGVV (SEQ ID NO. 2) and a second partial protein which contains the amino acid sequence VIVITLVML (SEQ ID NO. 3), the second partial protein, which contains the amino acid sequence VIVITLVML (SEQ ID NO. 3), diffusing into the cytosol of the cell (Figure 2). This second partial protein, which can be easily detected in the cytosol of a cell, e.g., as a fusion protein with a transcription activation factor (TAF) and the aid of a reporter gene; it serves as a detection tool for the presence of γ-secretase or the quantification of a γ-secretase activity. The γ-secretase cleavage site is located in the transmembrane domain of the APP (Kang, J. et al., (1987) Nature, 325, 733). The APP transmembrane domain has the amino acid sequence GAIIGLMVGGVV40 IA42 TVIVITLVML. The γ-secretase cleaves after V40, A42 or T43. The Aβ-peptide, which is produced by eukaryotic cells in cell culture, is secreted into the medium supernatant.
  • With the aid of a suitable reporter system (e.g., TAF and the corresponding reporter gene), the release of the second partial protein can activate the expression of a reporter protein, which can be detected in eukaryotic cells. By means of the detection of the reporter protein, it can be demonstrated that a γ-secretase cleavage has taken place in the APP. As a result, the γ-secretase or the activity of the γ-secretase can be determined qualitatively and/or quantitatively.
  • The constituents of the process can be characterized in greater detail as follows:
  • The first nucleotide sequence codes for an amyloid precursor protein (APP) or a part thereof comprising SEQ ID NO. 1, wherein said APP or part thereof does not contain any further peptide motif acting as a signal for endo- or exocytosis and/or protease cleavage site. Preferably, said first nucleotide sequence codes for a protein which contains an amino acid sequence comprising SEQ ID NO. 1, e.g., SEQ ID NO. 6 or SEQ ID NO. 14. In further embodiments, the first nucleotide sequence codes for a truncated APP or a modified APP, e.g., obtainable by site directed mutagenesis, in order to avoid coding of a peptide motif acting as a signal for endo- or exocytosis and/or protease cleavage site beside SEQ ID NO. 1. In yet another embodiment, said APP or part thereof encoded by the said first nucleotide sequence is a protein derived from APP of human, mouse, (e.g., APLP1 or APLP2).
  • The second nucleotide sequence preferably codes for any suitable signal peptide ("SP"). The signal peptide contains, e.g., the SP's according to SEQ ID NO. 5 (SP of human APP), SEQ ID NO. 12 (SP of yeast SUC2, "SP2"), or SEQ ID NO. 13 (SP of BM40, "SP3") or any other signal peptide known, e.g., according to Heijne et al. (Nucl. Acids Res. (1986), 14(11)4683-4690).
  • As a promoter, it is possible to use any suitable regulatable or constitutive promoter. The promoter can be suitable, e.g, for expression in mammalian cells, in C. elegans, in yeast, or in Drosophila. Suitable promoters for mammalian cells are, e.g., CMV, HSV TK, SV40, LTR (all: Clontech, Heidelberg, Germany), and RSV (e.g. Invitrogen™ life technologies, NV Leek, Netherlands). Promoters, which can be used for C. elegans are, e.g., unc-119, unc-54, hsp16-2, goa-1 and sel-12. For expression in yeast, the promoters ADH1 (constitutive) (Vlckova et al. (1994) Gene, 25(5), 472-4), GAL1 (conditionally inducible) (Selleck et al. (1987) Nature 325, 173-7), MET3 (conditional) (Cherest et al. (1987) Mol Gen Genet 210, 307-13) and MET25 (cf. e.g., Kerjan et al. (1986) Nucleic Acids Res. 14(20), 7861-71) are suitable. In Drosophila, it is possible to use, e.g., the promoters MT (metallothionine), Ac5 or Ds47 (all: Invitrogen™ life technologies).
  • A eukaryotic cell is employed in the process, e.g., a human cell or a non-human cell, e.g., monkey, hamster, mouse, Drosophila, zebrafish or yeast. E.g., a HeLa, HEK293, H4, SH-SY5Y, H9, Cos, CHO, N2A, SL-2 or Saccharomyces cerevisiae cell can be employed. In a particular embodiment of the invention a C. elegans cell is employed. The cell can be a constituent of a transgenic, non-human animal. In a particular embodiment, the transgenic cell can be a constituent of a transgenic C. elegans. In particular, the invention relates to processes in which yeast cells, e.g., from the strain MaV203 (Invitrogen™ life technologies, Rockville, MD, USA) or EGY 48 (OriGene Technologies, Inc. Rockville, MD, USA), are used.
  • The transgene codes for a fusion protein; this is composed of the partial proteins which are encoded by the first and the second nucleotide sequence and, if appropriate, further nucleotide sequences. The fusion protein thus contains the first partial protein and the second partial protein and, if appropriate, a further partial protein. However, it is important that the fusion protein does not contain any peptide motif acting as a signal for endo- or exocytosis and/or protease cleavage site, except for SEQ ID NO. 1.
  • Known protease cleavage sites are known to the skilled artisan from protease databases, e.g., MEROPS (Rawlings et al. (2002) MEROPS: the protease database. Nucleic Acids Res. 30, 343-346).
    Preferably, the fusion protein according to instant invention does not contain a protease cleavage site, which is a caspase cleavage site, e.g., (IVL)ExD, especially, VEVA, VEVD and in another embodiment, the fusion protein according to instant invention does further not contain a signal peptide for endo- or exocytosis, which is a signal for APP internalization, e.g., NpxY or Di-leucine especially, NPTY.
  • In one specific embodiment, the fusion protein has the amino acid sequence SEQ ID NO. 14. Beside SEQ. ID No. 1, said fusion protein does not contain any (one or more) further peptide motif acting as a signal for endo- or exocytosis (e.g., APP internalization signal) and/or protease (e.g., caspase) cleavage site.
  • In particular, a transgene having the nucleotide sequence according to SEQ ID NO. 15 (SPC55GV TAG) can be employed in the process. In particularly preferred embodiments of the process, the transgene is present in a vector. This specific embodiment of the invention is also designated as SP-C55-Gal 4-VP16 (i.e., SPC55GV). In this case, a fusion protein consisting of the signal peptide of APP, the C55 fragment of APP, GAL4 and VP16 is expressed. This protein located in the transmembrane domain is cleaved within the C55 fragment and the second partial protein, i.e. the part of the fusion protein, which contains one part of the C55 fragment, GAL4 and VP16, is detected with the aid of a reporter plasmid.
  • Beside the transgene construct SPC55GV, other reporter constructs are also conceivable in which, e.g., the transcription-activating domain could be inserted between the transmembrane domain and cytosolic domain of SPC55 or a Tag (e.g., MYC, FLAG) on the N- and C-terminus and between the transmembrane and the cytosolic domain of SPC55.
  • The further coding nucleotide sequence codes for a protein, which used for the detection of the second partial protein. Preferably, the further coding nucleotide sequence is therefore located at the 3' end of the first nucleotide sequence. The further coding nucleotide sequence codes, e.g., for a chimeric protein or another protein which is constructed from a number of domains, e.g., a protein which contains a DNA-binding domain and a transcription-activating domain. In a particular embodiment of the invention, the further coding nucleotide sequence codes for a protein which consists of a GAL4-binding domain and of the transcription-activating domain of VP16 (GAL4-VP16, "GV"), and the further partial protein preferably then has the amino acid sequence SEQ ID NO. 7. In yeast cells, the further partial protein can also contain a LexA-binding domain (e.g., Lex A-VP16). This further partial protein is particularly suitable for processes in which cells of the yeast strain EGY48 are used.
  • In particular, the invention relates to processes in which cells are used which are co-transfected with a reporter plasmid. The reporter plasmid contains a reporter gene under the control of a regulatable promoter. E.g., the reporter gene can code for GFP and its derivatives, e.g., EGFP (Enhanced Green Fluorescent Protein), EBFP, EYFP, d2EGFP, GFPuv or Luciferase (e.g., Promega, Mannheim, Germany), CAT (e.g., Promega), SEAP (e.g., Clontech), βGal (e.g., Clontech), reef coral fluorescence protein (RCFP, Clontech) or apoptosis-inducing factors, e.g., Fas, TNF-R1, death domain and homologues (Tartaglia et al. (1993) Cell 74, 845-53), ced3, ced4, ced9. As a regulatable promoter, the reporter plasmid can contain a minimal promoter, e.g., a GAL4 binding site in combination with the minimal promoter of HIV, of the CD4 promoter or the mec7 promoter. The choice of the suitable regulatable promoter depends on the transcription-activating domain used.
    A particular embodiment of the invention relates to the implementation of the process, where the cells used are yeast cells. As an alternative to the yeast expression vector pDBTrp (Invitrogen™ life technologies, The Netherlands, Cat. No. 10835023) into which in a special embodiment of the invention a MET-25 promoter is integrated (SEQ ID NO. 10), a large number of other expression vectors with different promoters (e.g., the inducible GAL1-promoter, the constitutively active ADH1 promoter) and with different selection markers (ADE, LEU, TRP, HIS, LYS, PHE) can be selected.
  • A particular embodiment of the invention relates to the use of yeast cells, which contain GAL4- or LexA-inducible reporter genes either stable integrated in their genome or extrachromosomal. In these embodiments preferably the yeast strains MaV203 (Invitrogen™ life technologies Inc., Rockville, MD, USA) or EGY48 (OriGene Technologies, Inc., Rockville, MD, USA) are used.
  • A particular embodiment of the processes relates to the use of a cell which was additionally transfected with a further recombinant vector. Preferably, the cell, which is used for these embodiments normally has no or hardly any endogenous γ-secretase or endogenous γ-secretase activity and is not detectable using the above-mentioned processes. This cell can be employed transformed with a further vector in which a nucleotide sequence - preferably a cDNA - is contained which codes for a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase. E.g., a cDNA library can be employed. This embodiment of the process can then be used, inter alia, to identify a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase or a cDNA, which codes for a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase. cDNA libraries which can be searched for a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase can be prepared from cells or tissues of any organism, e.g., B cells, neurons, glia cells, hippocampus, whole brain, placenta, kidney. Preferably, the cDNA is prepared from vertebrates (e.g., hamster, rat, mouse, dog, monkey, human), especially, from human cells or human tissues.
    In the case of cells, which without transfection exhibit no γ-secretase activity, but after transfection with a cDNA library exhibit γ-secretase activity, the cDNA present in the cell codes for a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase. This cDNA can be isolated by known processes from cells, which exhibit this behavior, and further be analyzed by known methods.
  • The present description also discloses a transgene, which codes for a fusion protein and contains the following constituents:
    1. a) a first nucleotide sequence which codes for a protein which contains the amino acid sequence GAIIGLMVGGWIATVIVITLVML (SEQ ID NO. 1),
    2. b) at the 5' end of the first nucleotide sequence, a second nucleotide sequence which codes for a signal peptide,
    3. c) a promoter and
    4. d) at least one further nucleotide sequence at the 3' end of the first nucleotide sequence, which codes for a DNA-binding domain and for a transcription-activating domain,
    wherein beside SEQ ID NO.1 said fusion protein does not contain one or more peptides acting as a signal for endo- or exocytosis and/or protease cleavage site.
  • Preferably, the first nucleotide sequence codes for APP or a part thereof, which comprises beside SEQ ID NO. 1 not any further peptide motif acting as a signal for endo- or exocytosis and/or protease cleavage site.
    The transgene can, e.g., have the nucleotide sequence SEQ ID NO. 15.
    The transgene can be present in a suitable vector, e.g., pcDNA 3.1+ or pDBTrp. Another embodiment of the description is a process, which relates to the use of the transgene and/or of the vector for the production of a transgenic cell, whereby, optionally, said transgenic cell is used to become a constituent of a non-human organism, suitable as an in vivo reporter organism. E.g., said transgene and/or vector can be used for the production of a transgenic C. elegans. In another embodiment, said transgene and/or the vector is used for the production of transgenic yeast cells, e.g., S. cerevisiae.
  • The description also discloses a process for the production of a transgenic non-human organism, e.g., of a transgenic C. elegans, wherein said transgene and/or a vector comprising said transgene is microinjected into the gonads of the organism, e.g., of a C. elegans. The description also discloses a cell, which contains a transgene according to the invention and a transgenic C. elegans, which contains said transgene. The description also discloses a cell, particularly a yeast cell, which contains said transgene, preferably present in a suitable vector. Further, the description discloses in particular to cells, preferably yeast cells, which contain the transgene and a cDNA library, resp., are suitable to be subject of a cDNA expression library (cDNA library).
  • The description discloses the use of the said transgenic or recombinant cells, preferably cells of yeast or C. elegans in a process for the determination or identification of γ-secretase, cDNA encoding γ-secretase, cDNA encoding a subunit protein of γ-secretase, cDNA encoding a γ-secretase-like proteinase, or the activity of γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase, the use of the said cells in a process for the identification of inhibitors of the γ-secretase activity (γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase), and the process thereof.
  • In particular, the description discloses processes for the identification of substances (effectors), which modulate (i.e., inhibit, decrease, increase or alter) the activity of a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase, the process containing the following steps:
    1. 1. Production of a transgenic non-human organism, e.g., of a transgenic C. elegans or Saccharomyces cerevisiae or of a transgenic cell, the transgenic non-human organism or the transgenic cell containing the transgene,
      the transgenic non-human organism or the transgenic cell moreover containing a reporter plasmid, the reporter plasmid carrying a protein binding site, a minimal promoter and a reporter gene and,
      if appropriate, a cDNA which encodes the γ-secretase the subunit protein of γ-secretase, or the γ-secretase-like proteinase, wherein
      the transgenic non-human organism or the transgenic cell expresses the transgene and, if appropriate, the γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase encoded by the cDNA;
    2. 2. the transgenic non-human organism or the transgenic cell is incubated with a test substance to be investigated; and
    3. 3. the amount of the second partial protein is detected.
  • The description also discloses a process for the identification of effectors of γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase, wherein
    1. 1. a transgene according to the invention is prepared/used;
    2. 2. the said transgene and a reporter plasmid and, if appropriate, a cDNA, which codes for a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase are integrated into the genome of a cell and the fusion protein encoded by the said transgene and, if appropriate, the γ-secretase, subunit protein of γ-secretase, or γ-secretase-like proteinase encoded by the cDNA are expressed in the presence of a substance to be investigated;
    3. 3. the fusion protein is
      1. a) cleaved within the amino acid sequence SEQ ID NO. 1 by the γ-secretase present in the cell, so that
      2. b) a first partial protein which contains the amino acid sequence GAIIGLMVGGVV (SEQ ID NO. 2) and a second partial protein which contains the amino acid sequence VIVITLVML (SEQ ID NO. 3) are formed; and
    4. 4. said second partial protein is determined qualitatively or quantitatively.
  • The description also discloses processes for the identification of substances which inhibit the activity of a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase, where a transgene which codes for a protein which contains a signal peptide and the SEQ ID NO. 1 is expressed in the presence of a substance to be investigated and of a reporter plasmid and the effect of the substance to be investigated on the amount of second partial protein formed is determined, the second partial protein containing the amino acid sequence VIVITLVML (SEQ ID NO. 3).
  • The description also relates to inhibitors of a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase, which are identified by the processes of the invention.
  • Inter alia, the processes can be used, e.g., in conjunction with the C55-Gal 4-VP16 system (i.e. a fusion protein consisting of C55, GAL4 and VP16 or using a nucleic acid which codes for a corresponding fusion protein) for:
    1. 1. Identification and determination (qualitative and/or quantitative) of the activity of a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase.
    2. 2. Identification of γ-secretases, a subunit protein of γ-secretase, or a γ-secretase-like proteinase in different tissues, cells and organisms or species. Identification and isolation of the cDNAs concerned which code for γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase and the further use of the cDNAs.
    3. 3. In vivo screening, e.g., in yeast cells (e.g., Saccharomyces cerevisiae), in C. elegans or in cell culture, enabling to determine the activity of the γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase without using immunobiological methods.
    4. 4. Use of the process of instant invention for the identification and characterization of substances, e.g., pharmacological active compounds, which modulate the enzymatic or biological activity of the γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase, e.g., effectors (inhibitors, activators, modulators) of the γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase. In particular, this process can be employed in an HTS (High Throughput Screening). By use of HTS assay systems, substances can be identified which can be employed for the treatment of Alzheimer's disease and/or for preventive treatment.
    5. 5. Investigations on or in the context of Alzheimer's disease, e.g., promoting a deeper understanding of mutated APP or fragments thereof, or the function of membrane based proteases.
    6. 6. The described fusion proteins/transgenes, e.g., C55 in SP-C55-Gal 4-VP16, can be replaced by other fragments according to the invention and the γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase, its activity and regulation can be investigated with the aid of the processes.
  • Another embodiment of instant description is a pharmaceutical composition comprising a pharmaceutical active compound, which inhibits the activity of a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase which has been identified by a process as described above.
  • A further embodiment of instant description is a process for preparing a pharmaceutical composition comprising a process as described and formulating the said identified pharmaceutical active compound.
  • Yet a further embodiment of instant description is a process for preparing a pharmaceutical comprising a) a process as described and b) mixing the identified pharmaceutical active compound with a pharmaceutical inert inorganic and/or organic excipients.
  • And still another embodiment of instant description is a test kit for detecting the activity of γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase, comprising the transgene, vector, or cell as described above.
    • Figure 1: Figure 1 shows the amyloid precursor protein (Isoform APP695 and Isoforms APP770 or APP751) and secretase cleavage products.
    • Figure 2: Shows schematically the principle on which the processes are based: β-secretase cleavage site at the N-terminus; γ-secretase cleavage site in the transmembrane domain; C100 = C100 fragment of APP; GAL4-VP16 = DNA-binding domain, transcription-activating domain (consisting of DNA-binding domain and transcription activator), which binds to the protein-binding domain on the DNA of the reporter plasmid.
    • Figure 3: Construction of the expression plasmids SP-C100-GAL4-VP16: aa= amino acids; restriction cleavage sites Sac I, Hind III and Kpn I indicating the position of the cleavage site on the plasmid.
    • Figure 4: Expression plasmid pDBTrp-MET25-SP-C100-GAL4-VP16: Construction of the expression plasmid for the expression of the transgene in yeast.
  • The following examples shall illustrate the instant invention and are not regarded as a limitation of the inventive conception.
  • Examples: Example 1: Construction of the expression plasmid pcDNA3.1+ comprising SP-C100-GAL4NP16.
  • The plasmid encodes the APP signal peptide (SP) which is fused to the C-terminal 100 amino acid residues of APP (C100). C100 begins with the N-terminus of the Aβ-peptide and ends with the C-terminus of APP. It must additionally be cleaved by the γ-secretase in order to release the Aβ-peptide. GAL4/VP16 (Seq ID No. 7) was fused to the C-terminus of SP-C100 (Seq ID No. 6). GAL4/VP16 comprises the first 147 amino acid residues of the yeast transcription activator GAL4 and the 78 C-terminal amino acid residues of VP16, a transcription activator from the herpes simplex virus. As a fusion protein, the GAL4 fragment takes over the function of the DNA binding, while the VP16 fragment activates the transcription (Sadowski et al., 1988).
    pcDNA3.1+ (Invitrogen™ life technologies, The Netherlands, Cat. No. V79020) serves as the plasmid vector.
  • Example 2: Construction of the reporter plasmid pGL2-MRG5-EGFP
  • The mammalian cell reporter plasmid pGL2-MRG5 is pGL2 (Promega) in which a DNA fragment from pMRG5 (Ikeda et al., 1998), comprising five GAL4 DNA-binding sites upstream of the human immunodeficiency virus (HIV) core promoter (Kretzschmar et al., 1994), is inserted upstream of the luciferase reporter gene of pGL2. For easier detection in cell culture, the luciferase reporter gene was replaced by the gene for EGFP (Enhanced Green Fluorescent Protein) obtained from the vector pEGFP-N1 (Clontech Laboratories, Heidelberg).
  • Example 3: Co-transfection of human neuroblastoma cells
  • Human neuroblastoma cells SH-SY5Y (ATCC CRL-2266) were co-transfected with both plasmids of Examples 1 and 2 and then microscopically analyzed under irradiation with light of wavelength 480 nm, by means of which EGFP is excited. It was possible to detect EGFP-expressing cells exhibiting strong green fluorescence.
    In order to ensure that the green fluorescence is specifically dependent on the expression of the EGFP by the reporter plasmid, SH-SY5Y cells were transfected only with the reporter plasmid pGL2-MRG5-EGFP. In these cells, no green fluorescence was detectable. The expression was activated by GAL4-VP16, which presupposes a proteolytic release of GAL4/VP16 from the C-terminus of SP-C100-GAL4/VP16.
  • Example 4: Use of the C100-Gal4/VP16 system for the detection of a cDNA coding for a γ-secretase activity in cDNA libraries
  • SP-C100-Gal4/VP16 was cloned in the yeast expression vector pDBTrp (Invitrogen™ life technologies, The Netherlands, Cat. No. 10835023) under control of the MET25 promoter by replacing the portion of pDBTrp containing the ADH promoter and GAL4DB domains (positioned between the CYH2 gene and the multiple cloning site) with a DNA fragment containing the MET25 promoter from p415MET25 (Mumberg et al., 1994) upstream of SP-C100-Gal4-VP16. The yeast strain MaV203 (Invitrogen™ life technologies) was transformed with this construct. MaV203 is genetically modified and contains three GAL4-inducible reporter genes (URA3, HIS3, lacZ), which are stably integrated into the genome (Vidal et al., 1996). In MaV203 the proteolytic release of the GAL4/VP16 domain from SP-C100-Gal4-VP16 protein resulted in the activation of the URA3 and HIS3 read-out allowing growth on plates lacking uracil or hisitidine.
  • The expression of the SP-C100-Gal4-VP16 cDNA in MaV203 resulted in only low activity of the reporters, such that this in vivo functional assay system is suitable for screening for and detecting expression of a cDNA for a γ-secretase in a cDNA library.
  • Example 5: Identification of γ-secretases by screening of a human B cell cDNA library
  • The recombinant MaV203 yeast strain from Example 4 was used for the purpose of screening a human B cell cDNA library (ATCC 87286; American Type Culture Collection, Manassas, VA, U.S.A.; Elledge et al., 1991) for a cDNA encoding a protein with γ-secretase activity. Alternatively, a human hippocampal cDNA library, integrated into the yeast expression vectors p415-MET25 (Mumberg et al., 1994) or p415-ADH1 (Mumberg et al., 1995), can also be employed for screening for a cDNA which codes for a γ-secretase or a protein having γ-secretase-like activity.
  • Example 6: Cloning of SP2-C100 and SP2-C100-GAL4/VP16
  • The coding region for the human signal peptide of SP-C100-GAL4/VP16 (as described in Example 1) was replaced with a signal peptide derived from the yeast SUC2 gene (SP2; SEQ ID NO. 12), resulting in a construct encoding SP2-C100-GAL4NP16 (SEQ ID NO. 19).
  • SP2-C100 was constructed by amplifying the coding region of the mature form of C100 (without signal sequence, cf. SEQ ID NO. 4) with a 5'-primer, which included the coding sequence for the SUC2-signal peptide (SEQ ID NO. 12) and a 3'-primer corresponding to the natural stop codon (Kang et al., (1987)). In order to facilitate the exchange of the signal peptide, the primers EH47 (SEQ ID NO. 23) and EH49 (SEQ ID NO. 24) were designed so that the resulting PCR product contained an additional Nhel site joining the coding regions for the signal peptide and the mature peptide.
    Figure imgb0001
    EH49: 5'-CGGGATCCCTAGGCGCCGTTCTGCATCTGCTCAAAGAAC-3'
  • The SP2-C100-GAL4/VP16 was obtained by EcoRI cleavage to excise the C100 fragment of SP2-C100 and replace it with C100-GAL4/VP16.
    The fragments were cloned into the yeast expression vector pDBTrp (Invitrogen™ life technologies, The Netherlands, Cat. No. 10835023) containing the MET25 promoter, as described in Example 4.
  • Example 7: Cloning of SP2-C-GAL4/VP16-100
  • To obtain the construct SP2-C-GAL4/VP16-100 (SEQ ID NO. 17), three independent PCR reactions were performed by use of the following primers:
    • EH53: 5'-ACTATATCTAGAATGCTTTTGC-3'
    • EH54: 5'-TTCGATAGAAGACAGTAGCTTGCCAGATCTACCTTTCTTCTTCAGCATC ACCAA-3'
    • EH55: 5'-TTGGTGATGCTGAAGAAGAAAGGTAGATCTGGCAAGCTACTGTCTTCT ATCGAA-3'
    • EH56: 5'-ATGATGAATGGATGTGTACTGGCCACTAGTACCCCCACCGTACTCGTC AATT-3'
    • EH57: 5'-AATTGACGAGTACGGTGGGGGTACTAGTGGCCAGTACACATCCATTC ATCAT-3'
    • EH59: 5'-CGATAAGCTTGATATCGAATTC-3':
    1. 1) Using SP2-C100 as a template, the ectodomain and the transmembrane domain of C100 were amplified by use of primers EH53 (SEQ ID NO. 25) and EH54 (SEQ ID NO. 26) in such a way that the PCR product contained also the 3'-flanking region, which overlaps with the GAL4/VP16 coding region.
    2. 2) Using primers EH55 (SEQ ID NO. 27) and EH56 (SEQ ID NO. 28), and GAL4/VP16 as the DNA template, a PCR reaction was performed to amplify the coding region with 5'- and 3'-flanking regions corresponding to each side of SP2-C100.
    3. 3) The 3'-segment of SP2-C100 that encodes the cytoplasmic domain of C100 was amplified by use of primers EH57 (SEQ ID NO. 29) and EH 59 (SEQ ID NO. 30), resulting in a 5'-overlap with the GAL4/VP16 coding region. The resulting PCR products (of about 200 bp, 720 bp, and 100 bp) were purified and used for a final PCR in the presence of EH53 and EH59, corresponding to the 5'- and 3'-ends of SP2-C100. The final PCR product of about 1000 bp was cloned into a yeast expression vector derived from pDBTrp (Invitrogen™ life technologies, The Netherlands, Cat. No. 10835023) containing the MET25 promoter, as described in Example 4.
    Example 8: Cloning of SP3-C100, SP3-C100-GAL4NP16, and SP3-C-GAL4NP16-100
  • To create the three plasmid vectors for expression of SP3-C100, SP3-C100-GAL4NP16 (SEQ ID No.21), and SP3-C-GAL4NP16-900 (SEQ ID NO. 32) in mammalian cell systems, either C100, C100-GAL4NP16 or C-GAL4NP16-100 were sub-cloned from the yeast expression vectors of Example 6 or 7 into the mammalian expression vector pRc/CMV (Invitrogen, Cat. No. V75020), which contains the coding region for the BM40 signal peptide (SP3; SEQ ID NO.13). The coding regions of the C100, C100-GAL4NP16 or C-GAL4/VP16-100 were ligated in frame to the SP3 coding region at the unique Nhel restriction site described in Example 6.
  • Example 9: Improving the expression of C100-GAL4/VP16 in yeast
  • Quantification of the expression level of different constructs in crude lysates from transformed yeast revealed that the expression of SP-C100-GAL4/VP16 was very low, compared with lysates from yeast cells transformed with vectors encoding fusions with the yeast SUC2 signal peptide. For example, expression of SP2-C100-GAL4/VP16 resulted in the strong expression of a specific band of the expected size. However, also bands with higher electrophoretic mobility could be detected by immunoblotting, indicating non-specific degradation of the recombinant protein in yeast. The stability of the protein was improved in the case of C-GAL4/VP16-100 (see below) in which the GAL4/VP16 domain was inserted in-frame into C100, close to the γ-secretase cleavage site. Both fusion proteins gave expression levels comparable to the construct encoding C100 without GAL4/VP16, indicating that the two different fusions between C100 and GAL4/VP16 did not interfere with protein expression.
  • Example 10: Improving the background in yeast
  • The increased expression of C100-GAL4/VP16 due to the exchange of the signal peptides correlated with a strong increase in non-specific activation of the URA3, HIS3, and lacZ reporter systems in the yeast strain MaV203. Since yeast lacks γ-secretase activity, this was most likely due to non-specific processing of C100-GAL4/VP16 by cellular proteases and the release of active GAL4/VP16.
    By moving the GAL4/VP16 domain closer to the γ-secretase cleavage site the non-specific proteolytic cleavage detected with C100-GAL4NP16 at sites between the transmembrane domain of C100 and the amino terminal end of of the GAL4NP16 domain was essentially eliminated.
  • Cleavage of the various constructs was tested in MaV203 by examining GAL4/VP16-dependent activation of the reporter systems.
    Transformation of MaV203 with SP-C100-GAL4/VP16 exhibited a Ura+, His-phenotype (cf. Example 4). Increasing the expression levels by replacing the SP signal peptide with the SP2 peptide (to give SP2-C100-GAL4/VP16) resulted in a strong activation of all read-outs to a level similar to that detected in the positive control, MaV203 constitutively expressing full-length GAL4 protein (encoded by plasmid pCL1; Clontech Laboratories).
    In contrast, MaV203 cells expressing SP2-C-GAL4/VP16 -100, which is expressed at levels comparable to SP2-C100-GAL4/VP16, exhibited a Ura--, His--phenotype, as was exhibited also by MaV203 transformed with an empty vector control.
  • Therefore, SP2-C-GAL4/VP16-100 can be highly expressed in yeast, but still display very low non-specific activation of the GAL4-dependent reporters. High-level expression of the SP2-C-GAL4/VP16-100 protein, combined with a low background of non-specific cleavage/reporter activation, is a prerequisite for a read-out system with a surprisingly optimized signal-to-noise ratio.
  • Example 11: Processing of SP3-C-GAL4NP16-100 by γ-secretase in mammalian cells
  • To demonstrate that SP3-C-GAL4/VP16 -100 protein expressed in mammalian cells is processed correctly by γ-secretase activity, SP3-C-GAL4/VP16-100 was transfected into mammalian cells that have been shown to express γ-secretase activity endogenously (Haass et al., 1992). For expression in mammalian cells, the signal peptide in SP2-C-GAL4/VP16-100 was replaced, as described in Example 8, with a mammalian signal peptide derived from the basal membrane protein BM40, which is known for high level expression (SP3; SEQ ID NO. 13). Processing of γ-secretase was monitored by quantifying the secretion of Aβ into the culture medium. The secreted Aβ was detected by a sandwich ELISA using monoclonal antibodies 6E10 and biotinylated 4G8 (Senetek PLC, Napa, California, USA; cf. Kim et al., 1990) as capture and detection antibodies, respectively.
  • After transfection with SP3-C100 an eight-fold increase in Aβ secretion was observed in comparison to the empty vector control. Cells transfected with SP3-C100-GAL4NP16 or SP3-C-GAL4/VP16-100 secreted similar amounts of Aβ, indicating that neither the C-terminal nor the juxtamembrane fusion of GAL4NP16 interferes with proteolytic processing by γ-secretase.
  • Example 12: Transcriptional activation of GAL4/VP16-dependent reporter gene by C-Ga14/VP16-100 expressed in mammalian cells
  • Processing of C100-GAL4/VP16 and C-GAL4/VP16-100 by γ-secretase results in the release of a polypeptide containing GAL4/VP16 and additional amino acids from flanking portions of C100. SP3-C100-GAL4/VP16 and SP3-C-GAL4/VP16-100 were co-transfected with the mammalian reporter-plasmid pGL2-MRG5-EGFP (Ikeda et al., 1998) described in Example 2, which contains five GAL4 DNA-binding sites upstream of the human immunodeficiency virus (HIV) core promoter and the cDNA encoding EGFP. The co-transfection of pGL2-MRG5-EGFP with the GAL4/VP16-containing fusions resulted in the appearance of GFP-positive cells in both cases.
  • Example 13: Construction of the mammalian expression plasmid SP3-C55-GAL4/VP16:
  • Constructs containing the C100 sequence of APP and GAL4/VP16 contain both the cleavage site of γ-secretase and a cleavage site of caspase-like proteases. To avoid that an unspecific caspase-like activity could cleave SP3-C100-GAL4/VP16 between the authentic γ-secretase site and the GAL4/VP16 domain to release GAL4/VP16 and activate the reporter system in mammalian cells, the 45 amino acid C-terminal segment of C100 contained in SP3-C100-GAL4/VP16, encoding the cytoplasmic domain of APP, was deleted. Removal of the C-terminal 45 amino acids of C100 also eliminates an "internalization signal" peptide at the C-terminus of APP that directs the endocytosis of APP after being inserted in the plasma membrane.
  • Thus, the mammalian expression plasmid SP3-C55-GAL4/VP16 comprises the BM40 signal peptide (Seq ID No. 13), the N-terminal 55 amino acid residues (C55; Seq ID No. 6) of APP-C100, and GAL4/VP16. C55 begins with the N-terminus of the Aβ-peptide and ends with the transmembrane domain of APP. In SP3-C55-GAL4/VP16 protein, only the cleavage site for γ-secretase is present. C55 comprises the γ-secretase cleavage site and must be cleaved by γ-secretase in order to release the Aβ-peptide and GAL4/VP16. Moreover, because the endocytic internalization signal peptide is not present in SP3-C55-GAL4/VP16, only γ-secretase catalyzing cleavage of plasma membrane-associated C55-GAL4/VP16 will release Aβ-peptide and activate GAL4/VP16-dependent transcription of the reporter system.
  • The expression plasmid was derived from the vector SP3-C-GAL4/VP16-100 by the introduction of a stop codon (TAG) after the GAL4/VP16 sequence. This was performed by replacing the Hpal-Clal fragment of SP3-C-GAL4/VP16-100 with a DNA fragment generated by PCR using SP3-C-GAL4/VP16-100 as the DNA template, a 5'-primer upstream of the unique the Hpal site in GAL4/VP16, and a 3'-primer (5'-CCATCGATTTTCTAACCCCCACCGTA-3'; Seq ID No. 31) that introduces a TAG stop codon (underlined) and a Clal restriction site at the C-terminus of the GAL4/VP16 opening reading frame.
  • Example 14: Stable transfected HEK293 cells
  • HEK293 cells (Human Embryonic Kidney cell line, (ATCC)) were co-transfected with the plasmid SP3-C55-GAL4/VP16 and
    the luciferase reporter plasmid PGL2-MRG5(described in Example 2).
    Subsequently, stable cell lines were selected by incubation with 400 µg/ml Geneticin (GibcoBRL) to select for Neomycin resistant clones and thereafter characterized for stable expression of SP3-C55-GAL4/VP16 and luciferase.
  • Example 15: Transient transfection of HEK 293 cells
  • HEK293 cells were co-transfected with the SP3-C55-GAL4/VP16 vector (0.03 µg) and the pGL2-MRG5 luciferase reporter vector (1 µg) in Multi-Well 12 plates.
  • The compounds DPAT (from Elan Pharmaceuticals; Dovey et al., 2001) and L-685,458 (from Merck Pharmaceuticals; Shearman et al., 2000), both known γ-secretase inhibitors, inhibited dose-dependently luciferase activity and Aβ-production, and exhibited an IC50 of 14nM (DAPT) and 19nM (L-685,458), respectively.
  • Luciferase activity was quantified by the Bright-Glo Luciferase Assay kit (Promega).
    Aβ in the cell medium was quantified by ELISA, using the antibodies 4G8 and 6E10 (from Senetek), as described in Example 11. These antibodies are specific for amino acids 17-24 (4G8) and 1-17 (6E10) of the Aβ-peptide.
  • In transient transfection experiments, Aβ was also identified by immunoprecipitation and by immunoblotting. Both methods identified a 4 kDa band corresponding to Aβ-peptide.
  • Example 16: Pharmacological characterization of the stable transfected HEK293 cells
  • A clone of HEK293 cells that stably express both the SP3-C55-GAL4/VP16 and the MRG5-luciferase constructs was identified according to Example 14. This cell clone was used to examine the response of the stably-transfected mammalian cell assay system to DAPT (from Elan Pharm.; Dovey et al., 2001), and L-685,458 (from Merck Pharm.; Shearman et al., 2000)., Both compounds exhibited dose-dependent inhibition of luciferase activity (24h treatment) with an IC50 of 230nM (DAPT) and 130nM (L-685,458), respectively.
  • Example 17: Identification of inhibitors of γ-secretase
  • For the identification of γ-secretase inhibitors, stably double-transfected HEK293 cells (see Example 14) are incubated, in Multi-Well 96 plates, in the presence of the compound(s) under investigation (e.g., compound library screening) at a concentration 10 µM or less in the assay, and luciferase activity is determined 24 hours later. Luciferase activity can be quantified with the Luciferase Assay System kit (Promega), the Bright-Glo Luciferase Assay kit (Promega), or any other method for luciferase quantification. A decrease in luciferase activity reflects a decrease in γ-secretase activity.
  • References:
    • Dovey et al. (2001) J. Neurochem. 76, 173.
    • Elledge et al. (1991) Proc. Natl. Acad. Sci. USA 88, 1731.
    • Estus et al. (1992) Science 255, 726.
    • Haass et al. (1992) Nature 359, 322.
    • Heijne et al. (1986) Nucl. Acids Res. 14(11), 4683-4690.
    • Hilbich et al. (1991) J. Mol. Biol. 218, 149.
    • Ikeda et al. (1998) Mol. Cell. Biol. 18, 10.
    • Kang et al. (1987) Nature 325, 733.
    • Kim et al. (1990) Neurosci. Res. Comm. 7, 113.
    • Kretzschmar et al. (1994) Mol. Cell. Biol. 14, 3927.
    • Maruyama et al. (1994) Biochem. Biophys. Res. Commun. 202, 1517.
    • Mattson (2003) Nature 422, 385.
    • Mumberg et al. (1994) Nucl. Acids Res. 22, 5767.
    • Mumberg et al. (1995) Gene 156,119.
    • Rumble et al. (1989), N. Engl. J. Med. 320,1446.
    • Sadowski et al. (1988) Nature 335, 563.
    • Scheuner et al. (1996), Nature Medicine 2, 864.
    • Shearman et al. (2000) Biochemistry 39, 8698.
    • Simons et al. (1996) J. Neurosci. 16(3), 899-908.
    • Suzuki et al. (1994) Science 264(5163),1336-1340.
    • Vidal et al. (1996) Proc. Natl. Acad. Sci. USA 93, 10315.
    • Yankner et al. (1990) Proc. Natl. Acad. Sci. USA 87, 9020.
    • For general recombinant DNA work:
      Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
    • For yeast work (DNA transformation):
      Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1994) Current Protocols in Molecular Biology, pp. 13.7.1-13.7.2, Greene Publishing Associates/Wiley-Interscience, New York '
    • For C. elegans work (transgenics):
      Mello, C. and Fire, A. (1995) DNA transformation. In: Epstein, H.F. and Shakes, D.C., ed. Caenorhabditis elegans: Modern Biological Analysis of an Organism. Methods in Cell Biology, Vol. 48. Academic Press, San Diego, CA, pp. 451-482.
    • SEQ ID No. 1 (APP fragment)
      GAIIGLMVGGVVIATVIVITLVML
    • SEQ ID No. 2 (APP fragment (First partial protein))
      GAIIGLMVGGVV
    • SEQ ID No. 3 (APP fragment (Second partial protein))
      VIVITLVML
    • SEQ ID No. 4 (C100 fragment)
      Figure imgb0002
    • SEQ ID No. 5 (Signal peptide of human APP (SP))
      MLPGLALFLL AAWTARA
    • SEQ ID No. 6 (C55 fragment)
      Figure imgb0003
    • SEQ ID No. 7 (GAL4-VP16)
      Figure imgb0004
    • SEQ ID No. 8 (SP-C100-GAL4-VP16)
      Figure imgb0005
      Figure imgb0006
    • SEQ ID No. 9 (Human APP)
      Figure imgb0007
      Figure imgb0008
      Figure imgb0009
    • SEQ ID No. 10 (Recombinant plasmid pDBTrp-MET25-SP-C100-GAL4-VP16)
      Figure imgb0010
      Figure imgb0011
      Figure imgb0012
      Figure imgb0013
      Figure imgb0014
    • SEQ ID No. 11 (SP-C100-GAL4-VP16 fusion protein)
      Figure imgb0015
    • SEQ ID No. 12 (Signal peptide of yeast SUC2 gene (SP2))
      MLLRAFLFLLAGFAAKISAALA
    • SEQ ID No. 13 (Signal peptide of mammalian basal membrane protein BM40 (SP3))
      MRAWIFFLLCLAGRALA
    • SEQ ID No. 14 (SP-C55-GAL4-VP16)
      Figure imgb0016
    • SEQ ID No. 15 (SP-C55-GAL4/VP16-TAG)
      Figure imgb0017
      Figure imgb0018
      Figure imgb0019
      Figure imgb0020
    • SEQ ID No. 16 (Recombinant Plasmid pDBTrp-MET25-SP-C-Gal4/VP16-100)
      Figure imgb0021
      Figure imgb0022
      Figure imgb0023
      Figure imgb0024
    • SEQ ID No. 17 (SP2-C-GAL4/VP16-100)
      Figure imgb0025
      Figure imgb0026
    • SEQ ID No. 18 (SP2-C-GAL4/VP16-100)
      Figure imgb0027
    • SEQ ID No. 19 (SP2-C100-GAL4/VP16)
      Figure imgb0028
      Figure imgb0029
    • SEQ ID No. 20 (SP2-C100-GAL4/VP16)
      Figure imgb0030
    • SEQ ID No. 21 (SP3-C100-GAL4/VP16)
      Figure imgb0031
      Figure imgb0032
    • SEQ ID No. 22 (SP3-C100-GAL4/VP16)
      Figure imgb0033
    • SEQ ID No. 23 (Primer EH47)
      Figure imgb0034
    • SEQ ID No.24 (Primer EH49)
      CGGGATCCCTAGGCGCCGTTCTGCATCTGCTCAAAGAAC
    • SEQ ID No.25 (Primer EH53)
      ACTATATCTAGAATGCTTTTGC
    • SEQ ID No.26 (Primer EH54)
      TTCGATAGAAGACAGTAGCTTGCCAGATCTACCTTTCTTCTTCAGCATC ACCAA
    • SEQ ID No.27 Primer EH55)
      TTGGTGATGCTGAAGAAGAAAGGTAGATCTGGCAAGCTACTGTCTTCT ATCGAA
    • SEQ ID No.28 (Primer EH56)
      ATGATGAATGGATGTGTACTGGCCACTAGTACCCCCACCGTACTCGTC AATT
    • SEQ ID No.29 (Primer EH57)
      AATTGACGAGTACGGTGGGGGTACTAGTGGCCAGTACACATCCATTC ATCAT
    • SEQ ID No.30 (Primer EH59)
      CGATAAGCTTGATATCGAATTC
    • SEQ ID No.31 (Primer C55-3')
      CCATCGATTTTCTAACCCCCACCGTA
    • SEQ ID No. 32 (Plasmid SP3-C-GAL4/VP16-100)
      Figure imgb0035
      Figure imgb0036
      Figure imgb0037
      Figure imgb0038
    SEQUENCE LISTING
    • <110> Aventis Pharma Deutschland GmbH
    • <120> Improved Aβ-Peptide screening assay
    • <130> DEAV2003/0046
    • <140>
      <141>
    • <160> 32
    • <170> PatentIn Ver. 2.1
    • <210> 1
      <211> 24
      <212> PRT
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: APP fragment
    • <400> 1
      Figure imgb0039
    • <210> 2
      <211> 12
      <212> PRT
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: APP fragment
    • <400> 2
      Figure imgb0040
    • <210> 3
      <211> 9
      <212> PRT
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: APP fragment
    • <400> 3
      Figure imgb0041
    • <210> 4
      <211> 100
      <212> PRT
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: C100 fragment
    • <400> 4
      Figure imgb0042
    • <210> 5
      <211> 17
      <212> PRT
      <213> Homo sapiens
    • <400> 5
      Figure imgb0043
    • <210> 6
      <211> 55
      <212> PRT
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: C55 fragment
    • <400> 6
      Figure imgb0044
    • <210> 7
      <211> 232
      <212> PRT
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: GAL4-VP16
    • <400> 7
      Figure imgb0045
      Figure imgb0046
    • <210> 8
      <211> 1813
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Mutagen
    • <400> 8
      Figure imgb0047
    • <210> 9
      <211> 3354
      <212> DNA
      <213> Homo sapiens
    • <400> 9
      Figure imgb0048
      Figure imgb0049
      Figure imgb0050
    • <210> 10
      <211> 8331
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: recombinant plasmid
    • <400> 10
      Figure imgb0051
      Figure imgb0052
      Figure imgb0053
      Figure imgb0054
    • <210> 11
      <2-11> 355
      <212> PRT
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Mutein
    • <400> 11
      Figure imgb0055
      Figure imgb0056
    • <210> 12
      <211> 22
      <212> PRT
      <213> Saccharomyces cerevisiae
    • <400> 12
      Figure imgb0057
    • <210> 13
      <211> 17
      <212> PRT
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Signal peptide
    • <400> 13
      Figure imgb0058
    • <210> 14
      <211> 308
      <212> PRT
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Mutein
    • <400> 14
      Figure imgb0059
      Figure imgb0060
    • <210> 15
      <211> 6454
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Mutagen
    • <400> 15
      Figure imgb0061
      Figure imgb0062
      Figure imgb0063
    • <210> 16
      <211> 8259
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: recombinant plasmid
    • <400> 16
      Figure imgb0064
      Figure imgb0065
      Figure imgb0066
      Figure imgb0067
    • <210> 17
      <211> 1089
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Mutagen
    • <400> 17
      Figure imgb0068
      Figure imgb0069
    • <210> 18
      <211> 362
      <212> PRT
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Mutein
    • <400> 18
      Figure imgb0070
      Figure imgb0071
    • <210> 19
      <211> 1080
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Mutagen
    • <400> 19
      Figure imgb0072
    • <210> 20
      <211> 359
      <212> PRT
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Mutein
    • <400> 20
      Figure imgb0073
      Figure imgb0074
      Figure imgb0075
    • <210> 21
      <211> 1074
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Mutagen
    • <400> 21
      Figure imgb0076
    • <210> 22
      <211> 358
      <212> PRT
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Mutein
    • <400> 22
      Figure imgb0077
      Figure imgb0078
      Figure imgb0079
    • <210> 23
      <211> 95
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Primer
    • <400> 23
      Figure imgb0080
    • <210> 24 .
      <211> 39
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Primer
    • <400> 24
      cgggatccct aggcgccgtt ctgcatctgc tcaaagaac     39
    • <210> 25
      <211> 22
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Primer
    • <400> 25
      actatatcta gaatgctttt gc     22
    • <210> 26
      <211> 54
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Primer
    • <400> 26
      ttcgatagaa gacagtagct tgccagatct acctttcttc ttcagcatca ccaa     54
    • <210> 27
      <211> 54
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Primer
    • <400> 27
      ttggtgatgc tgaagaagaa aggtagatct ggcaagctac tgtcttctat cgaa     54
    • <210> 28
      <211> 52
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Primer
    • <400> 28
      atgatgaatg gatgtgtact ggccactagt acccccaccg tactcgtcaa tt     52
    • <210> 29
      <211> 52
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Primer
    • <400> 29
      aattgacgag tacggtgggg gtactagtgg ccagtacaca tccattcatc at     52
    • <210> 30
      <211> 22
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Primer
    • <400> 30
      cgataagctt gatatcgaat tc     22
    • <210> 31
      <211> 26
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: Primer
    • <400> 31
      ccatcgattt tctaaccccc accgta     26
    • <210> 32
      <211> 6634
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Description of Artificial Sequence: recombinant plasmid
    • <400> 32
      Figure imgb0081
      Figure imgb0082
      Figure imgb0083
      Figure imgb0084

Claims (27)

  1. A process for the detection of the activity of γ-secretase wherein
    A. a transgene is used which encodes a fusion protein comprising:
    a) a first nucleotide sequence which codes for a protein which contains the amino acid sequence GAIIGLMVGGVVIATVIVITLVML (SEQ ID NO. 1) wherein said protein can be cleaved within said amino acid sequence by γ-secretase present in a cell, whereby a first partial protein, which contains the amino acid sequence GAIIGLMVGGVV (SEQ ID No. 2), and a second partial protein, which contains the amino acid sequence VIVITLVML (SEQ ID No. 3) are formed
    b) at the 5' end of the first nucleotide sequence, a second nucleotide sequence which codes for a signal peptide,
    c) a promoter and,
    d) further coding nucleotide sequences which code for a protein which is expressed as a fusion protein with the first partial protein and the second partial protein and which is used for the detection of the second partial protein, and, if appropriate, further non-coding nucleotide sequences;
    B. this transgene is incorporated into a human cell or a non-human eukaryotic cell and the fusion protein is expressed;
    C. the fusion protein is cleaved within the amino acid sequence SEQ ID NO. 1 by γ-secretase present in the cell, whereby the first partial protein and the second partial protein are formed and
    D. the second partial protein is detected,
    characterized in that with the exception of SEQ ID No. 1 said fusion protein does not contain one or more peptide motifs acting as a signal for endo- or exocytosis and/or protease cleavage site.
  2. A process for the detection of the activity of γ-secretase, wherein
    A. a transgene is used which encodes a fusion protein and contains the following constituents:
    a) a first nucleotide sequence which codes for a protein which contains the amino acid sequence GAIIGLMVGGVVIATVIVITLVML (SEQ ID NO. 1) wherein said protein can be cleaved within said amino acid sequence by γ-secretase present in a cell, whereby a first partial protein, which contains the amino acid sequence GAIIGLMVGGVV (SEQ ID No. 2), and a second partial protein, which contains the amino acid sequence VIVITLVML (SEQ ID No. 3) are formed
    b) at the 5' end of the first nucleotide sequence, a second nucleotide sequence which codes for a signal peptide,
    c) a promoter and,
    d) further coding nucleotide sequences which code for a protein which is expressed as a fusion protein with the first partial protein and the second partial protein and which is used for the detection of the second partial protein, and, if appropriate, further non-coding nucleotide sequences;
    B. this transgene is incorporated into a human cell or a non-human eukaryotic cell and the fusion protein is expressed;
    C. the fusion protein is cleaved within the amino acid sequence SEQ ID NO. 1 by γ-secretase present in the cell, whereby the first partial protein and the second partial protein are formed, and
    D. the amount of second partial protein is determined and the activity of the γ-secretase is determined from the amount of second partial protein formed,
    characterized in that with the exception of SEQ ID No. 1 said fusion protein does not contain one or more peptide motifs acting as a signal for endo- or exocytosis and/or protease cleavage site.
  3. The process as claimed in one of claims 1 and 2, wherein the peptide motif is a caspase cleavage site.
  4. The process as claimed in one of claims 1 to 3, wherein the first nucleotide sequence codes for an amyloid precursor protein (APP) or a part thereof, wherein the said peptide motif is acting as a signal for endo- or exocytosis is NPTY and said peptide motif acting as a protease cleavage site is VEVD.
  5. The process as claimed in one or more of claims 1 to 4, wherein the first nucleotide sequence codes for a protein, which is derived from the amino acid sequence SEQ ID NO. 4.
  6. The process as claimed in one or more of claims 1 to 5, wherein the second nucleotide sequence codes for the signal peptide of human APP (SEQ ID NO. 5), SUC2 (SEQ ID NO. 12), or BM40 (SEQ ID NO. 13).
  7. The process as claimed in one or more of claims 1 to 6, wherein the signal peptide has the amino acid sequence SEQ ID NO. 5.
  8. The process as claimed in one or more of claims 1 to 7, wherein the promoter is a promoter for expression in mammalian cells, in C. elegans, in yeast or in Drosophila.
  9. The process as claimed in one or more of claims 1 to 8, wherein the promoter is the CMV, HSV TK, RSV, SV40, LTR, unc119, unc54, hsp16-2, G0A1, sel-12, ADH1, GAL1, MET3, MET25, MT, Ac5 or Ds47 promoter
  10. The process as claimed in claim 1, wherein the cell is an HeLa, 293, H4, SH-SY5Y, H9, Cos, CHO, N2A, SL-2 or yeast cell.
  11. The process as claimed in claim 1, wherein the cell is a C. elegans cell.
  12. The process as claimed in claim 1, wherein the cell is a constituent of a transgenic C. elegans.
  13. The process as claimed in claim 1, wherein the cell is a Saccharomyces cerevisiae cell.
  14. The process as claimed in one or more of claims 1 to 13, wherein the fusion protein contains the amino acid sequence SEQ ID NO. 6.
  15. The process as claimed in one or more of claims 1 to 14, wherein the further coding nucleotide sequence is localized at the 3' end of the first nucleotide sequence.
  16. The process as claimed in one or more of claims 1 to 15, wherein the further coding nucleotide sequence codes for a protein, which contains a DNA-binding domain and a transcription-activating domain.
  17. The process as claimed in one or more of claims 1 to 16, wherein the further coding nucleotide sequence codes for a protein which consists of a GAL4-binding domain and of the transcription-activating domain of VP16 (GAL4-VP16).
  18. The process as claimed in one or more of claims 1 to 17, wherein the cell is cotransfected with a reporter plasmid, where the reporter plasmid contains a reporter gene under the control of a regulatable promoter.
  19. The process as claimed in claim 18, wherein the regulatable promoter is activatable by the transcription-activating domain.
  20. The process as claimed in claim 19, wherein the reporter plasmid encodes the reporter gene for EGFP (Enhanced Green Fluorescent Protein), Ura 3, His 3 or Lac Z and the regulatable promoter contains GAL4 binding sites and a minimal promoter of HIV.
  21. The process as claimed in one or more of claims 1 to 20, wherein the transgene comprises a nucleotide sequence encoding SEQ ID NO. 14.
  22. The process as claimed in one or more of claims 1 to 21, wherein the transgene is present in a vector.
  23. The process as claimed in one or more of claims 1 to 22, wherein the recombinant vector is pcDNA 3.1+.
  24. The process as claimed in one or more of claims 1 to 23, wherein no endogenous γ-secretase activity is detectable in the cell.
  25. The process as claimed in one or more of claims 1 to 24, wherein the cell is cotransfected using a cDNA library.
  26. The process as claimed in claim 25, wherein cDNA prepared from human or non-human tissue or human or non-human cells is present in the cDNA library.
  27. The use of a process as claimed in one or more of claims 24 to 26 for the identification of a cDNA which codes for a γ-secretase, a subunit protein of γ-secretase, or a γ-secretase-like proteinase, where
    a) a cell is identified in which the activity of a γ-secretase is detectable and
    b) the cDNA which codes for the γ-secretase is isolated from this cell.
EP04730223A 2003-05-26 2004-04-29 Method for the detection of the activity of gamma-secretase Expired - Lifetime EP1631584B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP04730223A EP1631584B1 (en) 2003-05-26 2004-04-29 Method for the detection of the activity of gamma-secretase

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP20030011807 EP1481987A1 (en) 2003-05-26 2003-05-26 Method for screening inhibitors of the gamma-secretase
EP04730223A EP1631584B1 (en) 2003-05-26 2004-04-29 Method for the detection of the activity of gamma-secretase
PCT/EP2004/004550 WO2004104037A1 (en) 2003-05-26 2004-04-29 Method for screening inhibitors of the gamma-secretase

Publications (2)

Publication Number Publication Date
EP1631584A1 EP1631584A1 (en) 2006-03-08
EP1631584B1 true EP1631584B1 (en) 2008-04-30

Family

ID=33104072

Family Applications (2)

Application Number Title Priority Date Filing Date
EP20030011807 Withdrawn EP1481987A1 (en) 2003-05-26 2003-05-26 Method for screening inhibitors of the gamma-secretase
EP04730223A Expired - Lifetime EP1631584B1 (en) 2003-05-26 2004-04-29 Method for the detection of the activity of gamma-secretase

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP20030011807 Withdrawn EP1481987A1 (en) 2003-05-26 2003-05-26 Method for screening inhibitors of the gamma-secretase

Country Status (17)

Country Link
US (1) US7892778B2 (en)
EP (2) EP1481987A1 (en)
JP (1) JP4903046B2 (en)
KR (1) KR101215855B1 (en)
CN (1) CN1795203B (en)
AT (1) ATE393779T1 (en)
AU (1) AU2004241151B2 (en)
BR (1) BRPI0410736A (en)
CA (1) CA2526790C (en)
DE (1) DE602004013440T2 (en)
DK (1) DK1631584T3 (en)
ES (1) ES2307012T3 (en)
IL (1) IL172119A (en)
MX (1) MXPA05012663A (en)
NO (1) NO334058B1 (en)
RU (1) RU2373284C2 (en)
WO (1) WO2004104037A1 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007028655A2 (en) * 2005-09-09 2007-03-15 H. Lundbeck A/S Drug discovery for neurodevelopmental disorders and their complications
WO2007030937A2 (en) * 2005-09-16 2007-03-22 Institut De Recherches Cliniques De Montreal/I.R.C.M. Screening proteinase modulators using a chimeric protein and ski-i proprotein convertase substrates and inhibitors
KR100883158B1 (en) * 2005-10-26 2009-02-10 주식회사 뉴젝스 Method for measuring the activity of protease in living cells
JP2007300856A (en) * 2006-05-11 2007-11-22 Hiroshi Mori Amyloid protein imitation
WO2008061673A2 (en) * 2006-11-24 2008-05-29 Synthon B.V. Drug discovery for cancer
CN104880441B (en) * 2015-05-14 2017-12-22 上海皓拓生物技术有限公司 The screening technique and its screening system of beta-secretase specific inhibitor
WO2017041037A1 (en) * 2015-09-04 2017-03-09 The Trustees Of Columbia University In The City Of New York Disruption of the interaction between amyloid beta peptide and dietary lipids

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH07132033A (en) * 1993-11-12 1995-05-23 Hoechst Japan Ltd Alzheimer's disease model transgenic animal
WO1998015828A1 (en) * 1996-10-07 1998-04-16 Scios Inc. Method to identify direct inhibitors of the beta-amyloid forming enzyme gamma-secretase
DE19849073A1 (en) * 1998-10-24 2000-04-27 Aventis Pharma Gmbh Transgene encoding amyloid precursor protein or its fragment, used to produce transgenic nematodes used, e.g. to screen for agents for treating Alzheimer's disease
DE19856261C1 (en) * 1998-12-07 2000-03-30 Hoechst Marion Roussel De Gmbh Detection of gamma-secretase by detection of A-beta peptide useful for determining gamma-secretase activity and for identifying inhibitors
DE19920514A1 (en) * 1999-05-05 2000-11-16 Boehringer Ingelheim Pharma Methods for finding proteases that specifically cleave membrane-bound substrates
WO2002093177A2 (en) * 2001-05-11 2002-11-21 Medical Research Council Assays for identifying modulators of rhomboid polypeptides

Also Published As

Publication number Publication date
DE602004013440T2 (en) 2009-05-20
CA2526790C (en) 2013-12-24
JP4903046B2 (en) 2012-03-21
RU2005140567A (en) 2006-06-27
MXPA05012663A (en) 2006-05-25
NO20056029L (en) 2006-02-24
AU2004241151B2 (en) 2009-04-09
ES2307012T3 (en) 2008-11-16
DE602004013440D1 (en) 2008-06-12
NO334058B1 (en) 2013-12-02
US7892778B2 (en) 2011-02-22
BRPI0410736A (en) 2006-06-27
EP1481987A1 (en) 2004-12-01
KR20060015312A (en) 2006-02-16
ATE393779T1 (en) 2008-05-15
JP2008502302A (en) 2008-01-31
AU2004241151A1 (en) 2004-12-02
EP1631584A1 (en) 2006-03-08
RU2373284C2 (en) 2009-11-20
US20050032150A1 (en) 2005-02-10
CA2526790A1 (en) 2004-12-02
WO2004104037A1 (en) 2004-12-02
IL172119A (en) 2010-12-30
KR101215855B1 (en) 2012-12-31
HK1091215A1 (en) 2007-01-12
CN1795203B (en) 2010-06-16
CN1795203A (en) 2006-06-28
DK1631584T3 (en) 2008-09-01

Similar Documents

Publication Publication Date Title
JP4594529B2 (en) Screening assay for Aβ-peptide
EP1483576B1 (en) Novel method for detecting and analyzing protein interactions in vivo
Pellegrini et al. PAMP and PARL, two novel putative metalloproteases interacting with the COOH-terminus of Presenilin-1 and-2
Cervantes et al. Homodimerization of presenilin N-terminal fragments is affected by mutations linked to Alzheimer’s disease
EP1481987A1 (en) Method for screening inhibitors of the gamma-secretase
KR102342622B1 (en) Amyloid beta expression constructs and uses therefor
US20030148356A1 (en) Novel APP mutation associated with an unusual Alzheimer&#39;s disease pathology
US20020025508A1 (en) Process for finding a protease inhibitor
DE60210266T2 (en) METHOD FOR DETECTING MODULATORS OF A SECRETASE ACTIVITY
US20060270841A1 (en) Assays to monitor amyloid precursor protein processing
Florean et al. High content analysis of γ-secretase activity reveals variable dominance of presenilin mutations linked to familial Alzheimer's disease
Puryer et al. Human, insect and nematode caspases kill Saccharomyces cerevisiae independently of YCA1 and Aif1p
Lefterov et al. Cysteine 73 in bleomycin hydrolase is critical for amyloid precursor protein processing
US6649346B2 (en) Methods of identifying agents that affect cleavage of amyloid-β precursor protein
US20030036169A1 (en) Methods for modulating transcriptional activation using mint proteins
JP2008502302A5 (en)
US9204623B2 (en) Transgenic mouse model expressing amyloid β 4-42 peptide
WO2000003248A1 (en) Method for identifying a presenilinase inhibitor
WO2002068663A1 (en) Tau-opathy model
US20040038338A1 (en) Influence of LRP cytoplasmic domain on Abeta production
WO2001049871A2 (en) Process for finding a protease inhibitor
Nitsch et al. Proteasomal Degradation of the APP Intracellular Domain (AICD) and Regulation of its Nuclear Signaling
MXPA01005486A (en) A&amp;bgr;-PEPTIDE SCREENING ASSAY
US20100017894A1 (en) Mutants of Human App and Their Use for the Production of Transgenice Animals
Tian et al. The Intronic GABRG2 Mutation, IVS6+ 2T→ G, Associated with CAE Altered Subunit mRNA Intron Splicing, Activated Nonsense-Mediated Decay and Produced a Stable Truncated γ2 Subunit

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20051227

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

RIN1 Information on inventor provided before grant (corrected)

Inventor name: ROTHBLATT, JONATHAN

Inventor name: MERCKEN, LUC

Inventor name: PERAUS, GISELA

Inventor name: HOPPE, EDMUND

Inventor name: DREISLER, SYLVIE

Inventor name: LEBERER, EKKEHARD

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20061220

RTI1 Title (correction)

Free format text: METHOD FOR THE DETECTION OF THE ACTIVITY OF GAMMA-SECRETASE

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

Free format text: LANGUAGE OF EP DOCUMENT: FRENCH

REF Corresponds to:

Ref document number: 602004013440

Country of ref document: DE

Date of ref document: 20080612

Kind code of ref document: P

REG Reference to a national code

Ref country code: DK

Ref legal event code: T3

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080430

NLV1 Nl: lapsed or annulled due to failure to fulfill the requirements of art. 29p and 29m of the patents act
PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080930

Ref country code: NL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080430

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080730

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080430

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2307012

Country of ref document: ES

Kind code of ref document: T3

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080430

Ref country code: PL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080430

REG Reference to a national code

Ref country code: HU

Ref legal event code: AG4A

Ref document number: E003690

Country of ref document: HU

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080731

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080430

ET Fr: translation filed
PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080430

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080430

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20090202

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080430

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: LU

Payment date: 20090522

Year of fee payment: 6

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20090430

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080731

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080430

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080430

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20100429

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DK

Payment date: 20141011

Year of fee payment: 11

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 20141011

Year of fee payment: 11

Ref country code: FR

Payment date: 20141027

Year of fee payment: 11

Ref country code: ES

Payment date: 20141111

Year of fee payment: 11

Ref country code: IE

Payment date: 20141016

Year of fee payment: 11

Ref country code: GB

Payment date: 20141013

Year of fee payment: 11

Ref country code: DE

Payment date: 20141031

Year of fee payment: 11

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: HU

Payment date: 20141013

Year of fee payment: 11

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: IT

Payment date: 20141021

Year of fee payment: 11

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: BE

Payment date: 20141011

Year of fee payment: 11

REG Reference to a national code

Ref country code: DE

Ref legal event code: R119

Ref document number: 602004013440

Country of ref document: DE

REG Reference to a national code

Ref country code: DK

Ref legal event code: EBP

Effective date: 20150430

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

GBPC Gb: european patent ceased through non-payment of renewal fee

Effective date: 20150429

REG Reference to a national code

Ref country code: IE

Ref legal event code: MM4A

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GB

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20150429

Ref country code: LI

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20150430

Ref country code: CH

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20150430

Ref country code: DE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20151103

Ref country code: IT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20150429

REG Reference to a national code

Ref country code: FR

Ref legal event code: ST

Effective date: 20151231

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: FR

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20150430

Ref country code: HU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20150430

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20150429

Ref country code: DK

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20150430

REG Reference to a national code

Ref country code: ES

Ref legal event code: FD2A

Effective date: 20160526

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20150430

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: BE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20150430