EP1631235A2 - Compositions et methodes de modulation de l'expression de la proteine b7 - Google Patents

Compositions et methodes de modulation de l'expression de la proteine b7

Info

Publication number
EP1631235A2
EP1631235A2 EP04752823A EP04752823A EP1631235A2 EP 1631235 A2 EP1631235 A2 EP 1631235A2 EP 04752823 A EP04752823 A EP 04752823A EP 04752823 A EP04752823 A EP 04752823A EP 1631235 A2 EP1631235 A2 EP 1631235A2
Authority
EP
European Patent Office
Prior art keywords
oligonucleotides
isis
seq
oligonucleotide
antisense
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04752823A
Other languages
German (de)
English (en)
Other versions
EP1631235A4 (fr
Inventor
Frank C. Bennett
Timothy A. Vickers
James G. Karras
Susan M. Freier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Isis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US10/444,206 external-priority patent/US20040023917A1/en
Application filed by Isis Pharmaceuticals Inc filed Critical Isis Pharmaceuticals Inc
Publication of EP1631235A2 publication Critical patent/EP1631235A2/fr
Publication of EP1631235A4 publication Critical patent/EP1631235A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02PCLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00Technologies relating to chemical industry
    • Y02P20/50Improvements relating to the production of bulk chemicals
    • Y02P20/582Recycling of unreacted starting or intermediate materials

Definitions

  • This invention relates to diagnostics, research reagents and therapeutics for disease states which respond to modulation of T cell activation.
  • this invention relates to antisense oligonucleotide interactions with certain messenger ribonucleic acids (mRNAs) or DNAs involved in the synthesis of proteins that modulate T cell activation.
  • mRNAs messenger ribonucleic acids
  • Antisense oligonucleotides designed to hybridize to nucleic acids encoding B7 proteins are provided. These oligonucleotides have been found to lead to the modulation of the activity of the RNA or DNA, and thus to the modulation of T cell activation. Palliative, therapeutic and prophylactic effects result.
  • Inflammation is a localized protective response mounted by tissues in response to injury, infection, or tissue destruction resulting in the destruction of the infectious or injurious agent and isolation of the injured tissue.
  • a typical inflammatory response proceeds as follows: recognition of an antigen as foreign or recognition of tissue damage, synthesis and release of soluble inflammatory mediators, recruitment of inflammatory cells to the site of infection or tissue damage, destruction and removal of the invading organism or damaged tissue, and deactivation of the system once the invading organism or damage has been resolved.
  • the normal, homeostatic mechanisms which attenuate the inflammatory responses are defective, resulting in damage and destruction of normal tissue.
  • B cells B-lymphocytes
  • T cells T-lymphocytes
  • T cells participate in the host's defense against infection but also mediate organ damage of transplanted tissues and contribute to cell attack in graft-versus-host disease (GVHD) and some autoimmune diseases.
  • GVHD graft-versus-host disease
  • APC antigen-presenting cell
  • T cell-APC interactions can be divided into three stages: cellular adhesion, T cell receptor (TCR) recognition, and costimulation. At least two discrete signals are required from an APC for induction of T cell activation. The first signal is antigen-specific and is provided when the TCR interacts with an antigen in the context of a major histocompatibility complex (MHC) protein, or an MHC complex (MHC) protein, or an antigen-presenting cell (MHC) protein, or an antigen-presenting cell (MHC) protein, or an antigen-presenting cell
  • MHC-related CD1 protein expressed on the surface of an APC (ACD,@ standing for Acluster of differentiation,® is a term used to denote different T cell surface molecules) .
  • the second (costimulatory) signal involves the interaction of the T cell surface antigen, CD28, with its ligand on the APC, which is a member of the B7 family of proteins.
  • CD28 a disulfide-linked homodimer of a 44 kilodalton polypeptide and a member of the immunoglobulin superfamily, is one of the major costimulatory signal receptors on the surface of a resting T cell for T cell activation and cytokine production (Allison, Curr. Opin.
  • B7-1 is normally expressed at low levels on APCs, however, it is upregulated following activation by cytokines or ligation of cell surface molecules such as CD40 (Lenschow et al., Proc. Natl. Acad. Sci. U.S.A., 1993, 90, 11054; Nabavi et al., Nature, 1992, 360, 266).
  • cytokines or ligation of cell surface molecules such as CD40
  • anti-B7-2 mAbs are potent inhibitors of T cell proliferation and cytokine production (Wu et al . , J. Exp . Med. , 1993, 178, 1789; Chen et al . , J " . Immunol . , 1994, 152 , 2105; Lenschow et al . , Proc . Na tl . Acad . Sci . U. S . A . , 1993,
  • B7:CD28 signaling may be a necessary component of other T cell costimulatory pathways, such as CD40:CD40L (CD40 ligand) signaling (Yang et al . , Science, 1996, 273, 1862).
  • CD40:CD40L CD40 ligand
  • B7-1 and B7-2 bind the cytolytic T-lymphocyte associated protein CTLA4.
  • CTLA4 is a protein that is structurally related to CD28 but is expressed on T cells only after activation (Linsley et al . , J. Exp . Med . , 1991, 174 , 561).
  • CTLA4-Ig A soluble recombinant form of CTLA4 , CTLA4-Ig, has been determined to be a more efficient inhibitor of the B7:CD28 interaction than monoclonal antibodies directed against CD28 or a B7 protein.
  • CTLA4-Ig results in the inhibition of antibody formation to sheep red blood cells or soluble antigen (Linsley et al . , Science, 1992, 257, 792) , prolongation of cardiac allograft and pancreatic islet xenograft survival (Lin et al . , J. Exp . Med . , 1993, 178, 1801; Lenschow et al . , 1992, Science, 257, 789 ; Lenschow et al .
  • oligonucleotides are provided which specifically hybridize with nucleic acids encoding B7-1 or B7-2. These oligonucleotides may be chemically modified or unmodified. Certain oligonucleotides of the invention are designed to bind either directly to mRNA transcribed from, or to a selected DNA portion of, the B7-1 or B7-2 gene, thereby modulating the amount of protein translated from a J37-1 or B7-2 mRNA or the amount of mRNA transcribed from a B7-1 or B7-2 gene, respectively.
  • Oligonucleotides may comprise nucleotide sequences sufficient in identity and number to effect specific hybridization with a particular nucleic acid. Such oligonucleotides are commonly described as “antisense.” Antisense oligonucleotides are commonly used as research reagents, diagnostic aids, and therapeutic agents. It has been discovered that the B7-1 and B7-2 genes, encoding B7-1 and B7-2 proteins, respectively, are particularly amenable to this approach. As a consequence of the association between B7 expression and T cell activation and proliferation, inhibition of the expression of B7-1 or B7- 2 leads to inhibition of the synthesis of B7-1 or B7-2, respectively, and thereby inhibition of T cell activation and proliferation.
  • oligonucleotides of the invention may be used to inhibit the expression of one of several alternatively spliced mRNAs of a B7 transcript, resulting in the enhanced expression of other alternatively spliced B7 mRNAs.
  • Such modulation is desirable for treating various inflammatory or autoimmune disorders or diseases, or disorders or diseases with an inflammatory component such as asthma, juvenile diabetes mellitus, myasthenia gravis, Graves' disease, rheumatoid arthritis, allograft rejection, inflammatory bowel disease, multiple sclerosis, psoriasis, lupus erythematosus, systemic lupus erythematosus, diabetes, multiple sclerosis, contact dermatitis, rhinitis, various allergies, and cancers and their metastases .
  • Such modulation is further desirable for preventing or modulating the development of such diseases or disorders in an animal suspected of being, or known to be, prone to such diseases or disorders .
  • the invention provides methods of inhibiting the expression of a nucleic acid molecule encoding B7-1 or B7-2 in an individual, comprising the step of administering to said individual a compound of the invention targeted to a nucleic acid molecule encoding B7-1 or B7-2, wherein said compound specifically hybridizes with and inhibits the expression of a nucleic acid molecule encoding B7-1 or B7-2.
  • the invention further provides methods of inhibiting expression of a nucleic acid molecule encoding B7-1 or B7-2 in an individual, comprising the step of administering to an individual a compound of the invention which specifically hybridizes with at least an 8 -nucleobase portion of an active site on a nucleic acid molecule encoding B7-1 or B7-2. Regions in the nucleic acid which when hybridized to a compound of the invention effect significantly lower B7-1 or B7-2 expression compared to a control, are referred to as active sites.
  • the invention provides methods of inhibiting the expression of a nucleic acid molecule encoding B7-1 or B7-2 in an individual comprising the step of administering a compound of the invention target to a nucleic acid encoding B7-1 or B7-2, wherein the compound inhibits B7-1 or B7-2 mRNA expression by at least 5% in 80% confluent HepG2 cells in culture at an optimum concentration compared to a control.
  • the compounds inhibit expression of mRNA encoding B7-1 or B7-2 in 80% confluent HepG2 cells in culture at an optimum concentration by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, or at least 50%, compared to a control .
  • a pharmaceutical comprosition comprising, as an active ingredient, a modified or unmodified antisense oligonucleotide, or a pharmaceutically acceptable salt thereof, in combination with one or more pharmaceutically acceptable carriers, diluents or excipients.
  • the invention also relates to pharmaceutical compositions which comprise an antisense oligonucleotide to a B7 protein in combination with a second anti-inflammatory agent, such as a second antisense oligonucleotide to a protein which mediates intercellular interactions, e.g., an intercellular adhesion molecule (ICAM) protein.
  • a second anti-inflammatory agent such as a second antisense oligonucleotide to a protein which mediates intercellular interactions
  • IAM intercellular adhesion molecule
  • Such methods can be used to detect the expression of B7 genes (i.e., B7-1 or B7-2) and are thus believed to be useful both therapeutically and diagnostically.
  • Methods of modulating the expression of B7 proteins comprising contacting animals with oligonucleotides specifically hybridizable with a B7 gene are herein provided. These methods are believed to be useful both therapeutically and diagnostically as a consequence of the association between B7 expression and T cell activation and proliferation.
  • the present invention also comprises methods of inhibiting B7-associated activation of T cells using the oligonucleotides of the invention. Methods of treating conditions in which abnormal or excessive T cell activation and proliferation occurs are also provided.
  • oligonucleotides of the invention employ the oligonucleotides of the invention and are believed to be useful both therapeutically and as clinical research and diagnostic tools.
  • the oligonucleotides of the present invention may also be used for research purposes .
  • the specific hybridization exhibited by the oligonucleotides of the present invention may be used for assays, purifications, cellular product preparations and in other methodologies which may be appreciated by persons of ordinary skill in the art .
  • the methods disclosed herein are also useful, for example, as clinical research tools in the detection and determination of the role of B7-I or B7-2 expression in various immune system functions and physiological processes and conditions, and for the diagnosis of conditions associated with their expression.
  • the specific hybridization exhibited by the oligonucleotides of the present invention may be used for assays, purifications, cellular product preparations and in other methodologies which may be appreciated by persons of ordinary skill in the art.
  • the oligonucleotides of this invention specifically hybridize to nucleic acids encoding B7 proteins, sandwich and other assays can easily be constructed to exploit this fact.
  • Detection of specific hybridization of an oligonucleotide of the invention with a nucleic acid encoding a B7 protein present in a sample can routinely be accomplished.
  • Such detection may include detectably labeling an oligonucleotide of the invention by enzyme conjugation, radiolabeling or any other suitable detection system.
  • a number of assays may be formulated employing the present invention, which assays will commonly comprise contacting a tissue or cell sample with a detectably labeled oligonucleotide of the present invention under conditions selected to permit hybridization and measuring such hybridization by detection of the label, as is appreciated by those of ordinary skill in the art.
  • the invention provides methods of treating a condition associated with an increase in the expression of B7.1 or B7.2 protein comprising administering to an individual in need of such treatment an effective amount of an antisense oligonucleotide of the present invention, or a pharmaceutically acceptable salt thereof.
  • the present invention provides for the use of an antisense oligonucleotide of the present invention, or a pharmaceutical composition thereof, for the treatment of a disorder associated with increased expression of B7-1 or B7-2 proteins .
  • the present invention provides for the use of an antisense oligonucleotide, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for inhibiting the expression of B7-1 or B7-2.
  • the present invention provides for the use of an antisense oligonucleotide, or a pharmaceuticallt acceptable salt thereof, in the manufacture of a medicament for the treatment of a disorder associated with expression of B7-1 or B7-2 by meanse of the methods described above.
  • the present invention provides a metod for treating asthma comprising administering to a patient an individual in need of such treatment an effective amount of an antisense oligonucleotide of the present invention, or a pharmaceutically acceptable salt thereof .
  • Figure 1 is a bar graph showing the inhibitory effect of the indicated oligonucleotides on B7-1 protein expression in COS-7 cells.
  • Figure 2 is a dose-response curve showing the inhibitory effect of oligonucleotides on cell surface expression of B7-1 protein.
  • Figure 3 is a bar graph showing the inhibitory effect of the indicated oligonucleotides on cell surface expression of B7-2 in COS-7 cells.
  • Figure 4 is a bar graph showing the inhibitory effect of the indicated oligonucleotides, including ISIS 10373 (a 20-mer) and ISIS 10996 (a 15-mer) on cell surface expression of B7-2 in COS-7 cells.
  • Figure 5 is a bar graph showing the specificity of inhibition of B7-1 or B7-2 protein expression by oligonucleotides. Cross-hatched bars, B7-1 levels; striped bars, B7-2 levels.
  • Figure 6 is a dose-response curve showing the inhibitory effect of oligonucleotides having antisense sequences to ICAM-1 (ISIS 2302) or B7-2 (ISIS 10373) on cell surface expression of the ICAM-1 and B7-2 proteins.
  • Figure 7 is a bar graph showing the effect of the indicated oligonucleotides on T cell proliferation.
  • Figure 8 is a dose-response curve showing the inhibitory effect of oligonucleotides on murine B7-2 protein expression in COS-7 cells. Solid line with asterisks, ISIS 11696; dashed line with triangles, ISIS 11866.
  • Figure 9 is a bar graph showing the effect of oligonucleotides ISIS 11696 and ISIS 11866 on cell surface expression of murine B7-2 protein in IC-21 cells.
  • Left (black) bars no oligonucleotide; middle bars, 3 ⁇ M indicated oligonucleotide; right bars, 10 ⁇ M indicated oligonucleotide.
  • Figure 10 is a graph showing the effect of ISIS 17456 on severity of EAE at various doses.
  • Figure 11A-B are graphs showing the detection of B7.2 mRNA (Fig. 11A) and B7.1 mRNA (Fig. IIB) during the development of ovalbumin-induced asthma in a mouse model.
  • Figure 12 is a graph showing that intratracheal administration of ISIS 121874, an antisense oligonucleotide targeted to mouse B7.2 , following allergen challenge, reduces the airway response to methacholine .
  • Figure 13 is a graph showing the dose-dependent inhibition of the Penh response to 50 mg/ml methacholine by ISIS 121874.
  • Penh is a dimensionless parameter that is a function of total pulmonary airflow in mice (i.e., the sum of the airflow in the upper and lower respiratory tracts) during the respiratory cycle of the animal. The lower the PENH, the greater the airflow.
  • the dose of ISIS 121874 is shown on the x-axis.
  • Figure 14 is a graph showing the inhibition of allergen-induced eosinophilia by ISIS 121874.
  • the dose of ISIS 121874 is shown on the x-axis.
  • Figure 15 is a graph showing the lung concentration- dose relationship for ISIS 121874 delivered by intratracheal administration .
  • Figure 16 is a graph showing ' the retention of ISIS 121874 in lung tissue following single dose (0.3 mg/kg) intratracheal instillation in the ovalbumin-induced mouse model of asthma.
  • Figure 17 is a graph showing the effects of ISIS 121874, a 7 base pair mismatched control oligonucleotide (ISIS 131906) and a gap ablated control oligonucleotide which does not promote cleavage by RNase H (ISIS 306058) .
  • Figures 18A-B is a graph showing the effect of ISIS
  • Figures 19A-B is a graph showing the effect of ISIS 121874 on B7.2 (Fig. 19A) and B7.1 (Fig. 19B) mRNA in draining lymph nodes of ovalbumin-challenged mice.
  • Figure 20 is a graph showing that treatment with an antisense oligonucleotide targeted to B7.1 (ISIS 121844) reduces allergen-induced eosinophilia in the ovalbumin-induced mouse model of asthma.
  • Figures 21A-B are graphs showing that treatment with
  • ISIS 121844 reduces the levels of B7.1 mRNA (Fig. 21A) and B7.2 mRNA (Fig. 2IB) in the mouse lung.
  • Figure 22 is a graph showing that aerosolized B7-2 antisense oligonucleotide (ISIS 121874) , but not a mismatch control oligonucleotide (ISIS 131906) , reduces the airway response to methacholine in an ovalbumin-induced mouse model of asthma .
  • Figure 23 is a graph showing that aerosolized B7-2 antisense oligonucleotide (ISIS 121874) , but not a mismatch control oligonucleotide (ISIS 131906) , reduces airway eosinophilia in ovalbumin-challenged mice.
  • Figure 24 is a graph showing that aerosolized B7-2 antisense oligonucleotide (ISIS 121874) , but not a mismatch control oligonucleotide (ISIS 131906) , reduces mucus oveproduction in ovalbumin-challenged mice.
  • the present invention employs oligonucleotides for use in antisense inhibition of the function of RNA and DNA encoding B7 proteins including B7-1 and B7-2.
  • the present invention also employs oligonucleotides which are designed to be specifically hybridizable to DNA or messenger RNA (mRNA) encoding such proteins and ultimately to modulate the amount of such proteins transcribed from their respective genes .
  • mRNA messenger RNA
  • mRNA to be interfered with include all vital functions such as translocation of the RNA to the site for protein translation, actual translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and possibly even independent catalytic activity which may be engaged in by the RNA.
  • the overall effect of such interference with mRNA function is modulation of the expression of a B7 protein, wherein "modulation” means either an increase (stimulation) or a decrease (inhibition) in the expression of a B7 protein. In the context of the present invention, inhibition is the preferred form of modulation of gene expression .
  • Oligonucleotides may comprise nucleotide sequences sufficient in identity and number to effect specific hybridization with a particular nucleic acid.
  • Antisense oligonucleotides which specifically hybridize to a portion of the sense strand of a gene are commonly described as “antisense.”
  • Antisense oligonucleotides are commonly used as research reagents, diagnostic aids, and therapeutic agents.
  • antisense oligonucleotides which are able to inhibit gene expression with extraordinar specificity, are often used by those of ordinary skill to elucidate the function of particular genes, for example to distinguish between the functions of various members of a biological pathway. This specific inhibitory effect has, therefore, been harnessed by those skilled in the art for research uses.
  • Antisense compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other short oligomeric compounds which hybridize to at least a portion of the target nucleic acid.
  • GCS external guide sequence
  • oligonucleotides are a preferred form of the antisense compounds of this invention
  • the present invention comprehends other families of antisense compounds as well, including but not limited to oligonucleotide analogs and mimetics such as locked nucleic acids (LNA) , peptide nucleic acids (PNA) , cyclohexynyl nucleic acids (CeNA) ethyloxy nucleic acids (ENA) which are described in more detail herein.
  • LNA locked nucleic acids
  • PNA peptide nucleic acids
  • CeNA cyclohexynyl nucleic acids
  • ENA ethyloxy nucleic acids
  • Hybridization in the context of this invention, means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases, usually on opposite nucleic acid strands or two regions of a nucleic acid strand. Guanine and cytosine are examples of complementary bases which are known to form three hydrogen bonds between them. Adenine and thymine are examples of complementary bases which form two hydrogen bonds between them. "Specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the DNA or RNA target and the oligonucleotide.
  • an oligonucleotide need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable.
  • An oligonucleotide is specifically hybridizable when binding of the oligonucleotide to the target interferes with the normal function of the target molecule to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment or, in the case of in vi tro assays, under conditions in which the assays are conducted.
  • the sequence of the oligomeric compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
  • an oligomeric compound may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure) .
  • the oligomeric compounds of the present invention comprise at least 70% sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise
  • sequence complementarity and even more preferably comprise 95% sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted.
  • an oligomeric compound in which 18 of 20 nucleobases of the oligomeric compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an oligomeric compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an oligomeric compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al . , J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
  • stringent hybridization conditions or “stringent conditions” refers to conditions under which an oligomeric compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence- dependent and will vary with different circumstances and in the context of this invention; “stringent conditions” under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
  • Oligonucleotides capable of modulating the expression of B7 proteins represent a novel therapeutic class of anti- inflammatory agents with activity towards a variety of inflammatory or autoimmune diseases, or disorders or diseases with an inflammatory component such as asthma, juvenile diabetes mellitus, myasthenia gravis, Graves' disease, rheumatoid arthritis, allograft rejection, inflammatory bowel disease, multiple sclerosis, psoriasis, lupus erythematosus, systemic lupus erythematosus, diabetes, multiple sclerosis, contact dermatitis, eczema, atopic dermatitis, seborrheic dermatitis, nummular dermatitis, generalized exfoliative dermatitis, rhinitis and various allergies.
  • an inflammatory component such as asthma, juvenile diabetes mellitus, myasthenia gravis, Graves' disease, rheumatoid arthritis, allograft rejection, inflammatory bowel
  • oligonucleotides capable of modulating the expression of B7 proteins provide a novel means of manipulating the proliferation of T cells. It is preferred to target specific genes for antisense attack.
  • "Targeting" an oligonucleotide to the associated nucleic acid is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a foreign nucleic acid from an infectious agent .
  • the target is a cellular gene associated with several immune system disorders and diseases (such as inflammation and autoimmune diseases) , as well as with ostensibly Anormal® immune reactions (such as . a host animal's rejection of transplanted tissue) , for which modulation is desired in certain instances.
  • the targeting process also includes determination of a region (or regions) within this gene for the oligonucleotide interaction to occur such that the desired effect, either detection or modulation of expression of the protein, will result. Once the target region have been identified, oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity to give the desired effect.
  • the 5' untranslated region hereinafter, the A5 ' -UTR@
  • the AtIR@ the translation initiation codon region
  • the AORF@ the open reading frame
  • the AtTR@ the translation termination codon region
  • the A3 ' -UTR® the 3' untranslated region
  • these regions are arranged in a typical messenger RNA molecule in the following order (left to right, 5' to 3 ' ) : 5'-UTR, tIR, ORF, tTR, 3'-UTR.
  • ORFs contain one or more sequences, known as Aintrons,® which are excised from a transcript before it is translated; the expressed (unexcised) portions of the ORF are referred to as Aexons® (Alberts et al . , Molecular Biology of the Cell, 1983, Garland Publishing Inc., New York, pp. 411-415).
  • Aintrons a sequence of sequences
  • Aexons® referred to as Aexons®
  • many eukaryotic ORFs are a thousand nucleotides or more in length, it is often convenient to subdivide the ORF into, e.g., the 5' ORF region, the central ORF region, and the 3' ORF region.
  • an ORF contains one or more sites that may be targeted due -to some functional significance in vivo .
  • sites include intragenic stem-loop structures- (see, .e.g., U.S. Patent No. 5,512,438) and, in unprocessed .mRNA molecules, intron/exon splice sites.
  • one preferred intragenic site is the region encompassing the translation initiation codon of the open reading frame (ORF) of the gene.
  • the translation initiation codon is typically 5 ' -AUG (in transcribed mRNA molecules; 5 ' -ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the AAUG codon,® the Astart codon® or the AAUG start codon.
  • the translation initiation codon is also referred to as the AAUG codon,® the Astart codon® or the AAUG start codon.
  • a minority of genes have a translation initiation codon having the RNA sequence 5 ⁇ -GUG, 5 ' -UUG or 5'-CUG, and 5 ' -AUA, 5 ' -ACG and 5'-CUG have been shown to function in vivo .
  • 5 ' -UUU functions as a translation initiation codon in vitro (Brigstock et al .
  • Atranslation initiation codon® and Astart codon® can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (prokaryotes) .
  • eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions, in order to generate related polypeptides having different amino terminal sequences (Markussen et al . ,
  • Astart codon® and Atranslation initiation codon® refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding a B7 protein, regardless of the sequence (s) of such codons. It is also known in the art that a translation termination codon (or Astop codon®) of a gene may have one of three sequences, i.e., 5'-UAA, 5 ' -UAG and 5 ' -UGA (the corresponding DNA sequences are 5 ' -TAA, 5 ' -TAG and 5 ' -TGA, respectively) .
  • Astart codon region® and Atranslation initiation region® refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3 ' ) from a translation initiation codon.
  • Astop codon region® and Atranslation termination region® refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon .
  • oligonucleotide refers to an oligomer or polymer of ribonucleic acid or deoxyribonucleic acid. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent intersugar (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced binding to target and increased stability in the presence of nucleases.
  • antisense compound is a single-stranded antisense oligonucleotide
  • double-stranded RNA (dsRNA) molecules has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection to viral defense and transposon silencing.
  • dsRNA double-stranded RNA
  • RNA interference RNA interference
  • RNAi the single-stranded RNA oligomers of antisense polarity of the dsRNAs which are the potent inducers of RNAi (Tijsterman et al . , Science, 2002, 295, 694-697). Oligomer and Monomer Modifications
  • a nucleoside is a base-sugar combination.
  • the base portion of the nucleoside is normally a heterocyclic base.
  • the two most common classes of such heterocyclic bases are the purines and the pyrimidines.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
  • the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
  • the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
  • the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred.
  • linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound.
  • the phosphate groups are commonly referred to as forming the internucleoside linkage or in conjunction with the sugar ring the backbone of the oligonucleotide.
  • the normal internucleoside linkage that makes up the backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • oligonucleotides containing modified e.g. non-naturally occurring internucleoside linkages include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a phosphorus • atom.
  • modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides .
  • Antisense oligonucleotides of the present invention that further comprise modified internucleoside linkages are preferred, particularly one in which one of the oxygen atoms of the phosphate group in the phosphodiester bond is replaced with a sulfur atom to form a phosphorothioate linkage.
  • modification of the intemucleotide linkage did not significantly interfere with RNAi activity.
  • certain preferred oligomeric compounds of the invention can also have one or more modified internucleoside linkages.
  • a preferred phosphorus containing modified internucleoside linkage is the phosphorothioate internucleoside linkage.
  • Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphoro- dithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 '-alkylene phosphonates, 5' -alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'- amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates , thionoalkylphosphonates , thionoalkylphosphotriesters, selenophosphates and borano- phosphates having normal 3' -5' linkages, 2' -5' linked analogs of these, and those having inverted polarity wherein one or more intemucleotide linkages is a 3 ' to 3 ' ,
  • Preferred oligonucleotides having inverted polarity comprise a single 3 ' to 3 ' linkage at the 3 ' -most intemucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof) .
  • Various salts, mixed salts and free acid forms are also included.
  • the MMI type internucleoside linkages are disclosed in the above referenced U.S. patent 5,489,677.
  • Preferred amide internucleoside linkages are disclosed in the above referenced U.S. patent 5,602,240.
  • Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones siloxane backbones
  • sulfide, sulfoxide and sulfone backbones formacetyl and thioformacetyl backbones
  • methylene formacetyl and thioformacetyl backbones riboacetyl backbones
  • alkene containing backbones sulfamate backbones; methyleneimino and methylenehydrazino backbones
  • sulfonate and sulfonamide backbones amide backbones; and others having mixed N, 0, S and CH 2 component parts.
  • oligonucleosides include, but are not limited to, U.S.: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
  • oligonucleotide mimetics includes oligonucleotide mimetics.
  • mimetic as it is applied to oligonucleotides is intended to include oligomeric compounds wherein only the furanose ring or both the furanose ring and the intemucleotide linkage are replaced with novel groups, Replacement of only the furanose ring is also referred to in the art as being a sugar surrogate.
  • the heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid.
  • PNA peptide nucleic acid
  • PNA oligomeric compounds include, but are not limited to, U.S.: 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA oligomeric compounds can be found in Nielsen et al . , Science, 1991, 254, 1497-1500. PNA has been modified to incorporate numerous modifications since the basic PNA structure was first prepared. The basic structure is shown below:
  • T is hydrogen, an amino protecting group, -C(0)R 5 , substituted or unsubstituted C ⁇ -C 10 alkyl, substituted or unsubstituted C 2 -C ⁇ 0 alkenyl, substituted or unsubstituted C 2 - Cio alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group, a reporter group, a conjugate group, a D or L ⁇ -amino acid linked via the ⁇ -carboxyl group or optionally through the ⁇ -carboxyl group when the amino acid is aspartic acid or glutamic acid or a peptide derived from D, L or mixed D and L amino acids linked through a carboxyl group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy,
  • T 5 is -OH, -N(Z )Z 2 , R 5 , D or L ⁇ -amino acid linked via the ⁇ -amino group or optionally through the ⁇ -amino group when the amino acid is lysine or ornithine or a peptide derived from D, L or mixed D and L amino acids linked through an amino group, a chemical functional group, a reporter group or a conjugate group;
  • Zi is hydrogen, C ⁇ -C 3 alkyl, or an amino protecting group;
  • Z 2 is hydrogen, C !
  • oligonucleotide mimetic Another class of oligonucleotide mimetic that has been studied is based on linked morpholino units (morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring.
  • a number of linking groups have been reported that link the morpholino monomeric units in a morpholino nucleic acid.
  • a preferred class of linking groups have been selected to give a non-ionic oligomeric compound.
  • the non-ionic morpholino-based. oligomeric compounds are less likely to have undesired interactions with cellular proteins.
  • Morpholino-based oligomeric compounds are non-ionic mimics of oligonucleotides which are less likely to form undesired interactions with cellular proteins (Dwaine A.
  • Morpholino-based oligomeric compounds are disclosed in United States Patent 5,034,506, issued July 23, 1991.
  • the morpholino class of oligomeric compounds have been prepared having a variety of different linking groups joining the monomeric subunits.
  • Morpholino nucleic acids have been prepared having a variety of different linking groups (L 2 ) joining the monomeric subunits.
  • the basic formula is shown below: wherein B x is a heterocyclic base moiety; i is hydroxyl or a protected hydroxyl; T ⁇ is hydrogen or a phosphate or phosphate derivative; L 2 is a linking group; and n is from 2 to about 50.
  • cyclohexenyl nucleic acids A further class of oligonucleotide mimetic is referred to as cyclohexenyl nucleic acids (CeNA) .
  • the furanose ring normally present in an DNA/RNA molecule is replaced with a cyclohenyl ring .
  • CeNA DMT protected phosphoramidite monomers have been prepared and used for oligomeric compound synthesis following classical phosphoramidite chemistry. Fully modified CeNA oligomeric compounds and oligonucleotides having specific positions modified with CeNA have been prepared and studied (see Wang et al . , J. Am. Chem. Soc , 2000, 122, 8595-8602). In general the incorporation of CeNA monomers into a DNA chain increases its stability of a DNA/RNA hybrid.
  • CeNA oligoadenylates formed complexes with RNA and DNA complements with similar stability to the native complexes.
  • the study of incorporating CeNA structures into natural nucleic acid structures was shown by NMR and circular dichroism to proceed with easy conformational adaptation. Furthermore the incorporation of CeNA into a sequence targeting RNA was stable to serum and able to activate E. Coli RNase resulting in cleavage of the target RNA strand.
  • the general formula of CeNA is shown below:
  • each Bx is a heterocyclic base moiety; Ti is hydroxyl or a protected hydroxyl; T 2 is hydroxyl or a protected hydroxyl; L 3 is a linking group; and n is from 2 to about 50
  • Another class of oligonucleotide mimetic can be prepared from one or more anhydrohexitol nucleosides (see, Wouters and Herdewijn, Bioorg. Med . Chem . Lett . , 1999, 9, 1563-1566) and would have the general formula:
  • B x is a heterocyclic base moiety; i is a hydroxyl or a protected hydroxyl; T 2 is a hydroxyl or a protected hydroxyl; L is a linking group; and n is from 2 to about 50
  • a further preferred modification includes Locked Nucleic Acids (LNAs) in which the 2 ' -hydroxyl group is linked to the 4 ' carbon atom of the sugar ring thereby forming a 2 ' - C, 4 ' -C-oxymethylene linkage thereby forming a bicyclic sugar moiety.
  • LNAs Locked Nucleic Acids
  • the linkage is preferably a methylene (-CH 2 -) n group bridging the 2 ' oxygen atom and the 4 ' carbon atom wherein n is 1 or 2 (Singh et al . , Chem. Commun., 1998, 4, 455-456).
  • LNA The basic structure of LNA showing the bicyclic ring system is shown below: wherein B x is a heterocyclic base moiety; Ti is a hydroxyl or a protected hydroxyl; T 2 is a hydroxyl or a protected hydroxyl; Z- L is a linking group; and n is from 2 to about 50;
  • LNAs determined by 2D NMR spectroscopy have shown that the locked orientation of the LNA nucleotides, both in single-stranded LNA and in duplexes, constrains the phosphate backbone in such a way as to introduce a higher population of the N-type conformation (Petersen et al . , J. Mol. Recognit . , 2000, 13, 44-53). These conformations are associated with improved stacking of the nucleobases (Wengel et al . , Nucleosides Nucleotides, 1999, 18, 1365-1370) . LNA has been shown to form exceedingly stable LNA:LNA duplexes (Koshkin et al . , J.
  • LNA hybridization was shown to be the most thermally stable nucleic acid type duplex system, and the RNA-mimicking character of LNA was established at the duplex level.
  • Introduction of 3 LNA monomers (T or A) significantly increased melting points (Tm +15/+11) toward DNA complements.
  • Tm +15/+11) toward DNA complements.
  • Tm +15/+11) toward DNA complements.
  • LNA:LNA duplexes The RNA-mimicking of LNA was reflected with regard to the N-type conformational restriction of the monomers and to the secondary structure of the LNA: RNA duplex. LNAs also form duplexes with complementary DNA, RNA or LNA with high thermal affinities. Circular dichroism (CD) spectra show that duplexes involving fully modified LNA (esp. LNA:RNA) structurally resemble an A-form RNA: RNA duplex. Nuclear magnetic resonance (NMR) examination of an LNA: DNA duplex confirmed the 3 ' -endo conformation of an LNA monomer. Recognition of double-stranded DNA has also been demonstrated suggesting strand invasion by LNA.
  • CD Circular dichroism
  • LNA-oligomeric compounds are useful in a wide range of diagnostic and therapeutic applications. Among these are antisense applications, PCR applications, strand-displacement oligomers, substrates for nucleic acid polymerases and generally as nucleotide based drugs. Potent and nontoxic antisense oligonucleotides containing LNAs have been described (Wahlestedt et al . , Proc. Natl. Acad. Sci. U. S.
  • LNAs confer several desired properties to antisense agents.
  • LNA/DNA copolymers were not degraded readily in blood serum and cell extracts.
  • LNA/DNA copolymers exhibited potent antisense activity in assay systems as disparate as G-protein-coupled receptor signaling in living rat brain and detection of reporter genes in Escherichia coli. Lipofectin-mediated efficient delivery of LNA into living human breast cancer cells has also been accomplished.
  • LNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al . , Tetrahedron, 1998, 54, 3607-3630). LNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226. The first analogs of LNA, phosphorothioate-LNA and 2 ' -thio-LNAs, have also been prepared (Kumar et al . , Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222).
  • oligonucleotide mimetics have been prepared to include bicyclic and tricyclic nucleoside analogs having the formulas (amidite monomers shown) :
  • DMT dimethyl methoxytrityl .
  • Steffens et al . Helv. Chim . Acta, 1997, 80 , 2426-2439; Steffens et al . , J. Am . Chem . Soc , 1999, 121, 3249-3255; and Renneberg et al . , J. Am. Chem. Soc , 2002, 124 , 5993-6002
  • Tm's thermal stabilities
  • Oligomeric compounds containing bicyclic nucleoside analogs have shown thermal stabilities approaching that of DNA duplexes.
  • Another class of oligonucleotide mimetic is referred to as phosphonomonoester nucleic acids incorporate a phosphorus group in the backbone.
  • This class of olignucleotide mimetic is reported to have useful physical and biological and pharmacological properties in the areas of inhibiting gene expression (antisense oligonucleotides, ribozymes, sense oligonucleotides and triplex-forming oligonucleotides) , as probes for the detection of nucleic acids and as auxiliaries for use in molecular biology.
  • Oligomeric compounds of the invention may also contain one or more substituted sugar moieties.
  • Preferred oligomeric compounds comprise a sugar substituent group selected from: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N- alkenyl; O- , S- or N-alkynyl; or 0-alkyl-0-alkyl , wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to .do alkyl or C 2 to C 10 alkenyl and alkynyl .
  • oligonucleotides comprise a sugar substituent group selected from: d to Cio lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, 0-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , 0N0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl , heterocycloalkaryl; aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • a sugar substituent group selected from: d to Cio lower
  • a preferred modification includes 2 ' -methoxyethoxy (2 ' -0-CH 2 CH 2 0CH 3 , also known as 2 ' -O- (2-methoxyethyl) or 2 ' -MOE) (Martin et al . , Helv. Chim. Acta, 1995, 78 , 486-504) i.e., an alkoxyalkoxy group.
  • Especially preferred compounds of the invention comprise 2'-MOE modifications.
  • a further preferred modification includes 2 ' - dimethylaminooxyethoxy, i.e., a O (CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2--DMAOE, as described in examples hereinbelow, and 2 ' -dimethylaminoethoxyethoxy (also known in the art as 2 ' -O- dimethyl-amino-ethoxy-ethyl or 2 ' -DMAEOE) , i.e., 2 ' -0-CH 2 -0- CH 2 -N(CH 3 ) 2 .
  • 2 ' - dimethylaminooxyethoxy i.e., a O (CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2--DMAOE, as described in examples hereinbelow
  • 2 ' -dimethylaminoethoxyethoxy also known in the art as 2 ' -O- dimethyl-amino-ethoxy-ethy
  • 2 ' -Sugar substituent groups may be in the arabino (up) position or ribo (down) position.
  • a preferred 2.' -arabino modification is 2'-F.
  • Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • R p and R q are each independently hydrogen or -Cio alkyl ;
  • R r is — R x — y ;
  • each R s , R , R u and R v is, independently, hydrogen, C(0)R w , substituted or unsubstituted -Co alkyl, substituted or unsubstituted C 2 -C ⁇ 0 alkenyl, substituted or unsubstituted -Cio alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group or a conjugate group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl; or optionally, R u and R v , together form a phthalimido moiety
  • sugar substituent groups include 0 [ (CH 2 ) n O] m CH 3 , 0(CH 2 ) n OCH 3 , 0(CH 2 ) n NH 2 , 0(CH 2 ) n CH 3 , 0(CH 2 ) n ONH 2 , and O (CH 2 ) n ON [ (CH 2 ) n CH 3 ) ] 2 , where n and m are from 1 to about 10.
  • Oligomeric compounds may also include nucleobase (often referred to in the art simply as “base” or “heterocyclic base moiety") modifications or substitutions.
  • nucleobase often referred to in the art simply as “base” or “heterocyclic base moiety” modifications or substitutions.
  • “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G) , and the pyrimidine bases thymine (T) , cytosine (C) and uracil (U) .
  • Modified nucleobases also referred herein as heterocyclic base moieties include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C) , 5-hydroxymethyl cytosine, xanthine, hypoxanthine , 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothy ine and 2-thiocytosine, 5-halouracil and cytosine, 5- propynyl (-C ⁇ C-CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil) , 4-thiouracil, 8-halo, 8- amino, 8-thiol, 8-thioalkyl, 8-
  • Particularly preferred base modifications of the present invention are 5-methyl cytosine modifications.
  • Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al .
  • nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5- substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine .
  • oligomeric compounds are prepared having polycyclic heterocyclic compounds in place of one or more heterocyclic base moieties.
  • a number of tricyclic heterocyclic compounds have been previously reported. These compounds are routinely used in antisense applications to increase the binding properties of the modified strand to a target strand. The most studied modifications are targeted to guanosines hence they have been termed G-clamps or cytidine analogs.
  • Many of these polycyclic heterocyclic compounds have the general formula:
  • T m data indicate an even greater discrimination between the perfect match and mismatched sequences compared to dC5 me . It was suggested that the tethered amino group serves as an additional hydrogen bond donor to interact with the Hoogsteen face, namely the 06, of a complementary guanine thereby forming 4 hydrogen bonds. This means that the increased affinity of G-clamp is mediated by the combination of extended base stacking and additional specific hydrogen bonding. Further tricyclic heterocyclic compounds and methods of using them that are amenable to the present invention are disclosed in United States Patent Serial Number 6,028,183, which issued on May 22, 2000, and United States Patent Serial Number 6,007,992, which issued on December 28, 1999, the contents of both are commonly assigned with this application and are incorporated herein in their entirety.
  • the oligonucleotides of the present invention also include variants in which a different base is present at one or more of the nucleotide positions in the oligonucleotide.
  • the first nucleotide is an adenosine
  • variants may be produced which contain thymidine, guanosine or cytidine at this position. This may be done at any of the positions of the oligonucleotide.
  • a 20-mer may comprise 60 variations (20 positions x 3 alternates at each position) in which the original nucleotide is substituted with any of the three alternate nucleotides.
  • a further preferred substitution that can be appended to the oligomeric compounds of the invention involves the linkage of one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting oligomeric compounds .
  • such modified oligomeric compounds are prepared by covalently attaching conjugate groups to functional groups such as hydroxyl or amino groups.
  • Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
  • Typical conjugates groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenan- thridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Groups that enhance the pharmacodynamic properties include groups that improve oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with RNA.
  • Groups that enhance the pharmacokinetic properties include groups that improve oligomer uptake, distribution, metabolism or excretion.
  • Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al . , Proc Natl . Acad. Sci . USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al . , Bioorg. Med . Chem . Let . , 1994, 4, 1053- 1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann . N. Y.
  • a phospholipid e.g., di-hexadecyl-rac-glycerol or triethyl- ammonium 1, 2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al . , Tetrahedron Lett . , 1995, 36, 3651-3654; Shea et al . , Nucl . Acids Res . , 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al .
  • the oligomeric compounds of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, ( S) - (+) -pranoprofen, carprofen, dansylsarcosine, 2, 3 , 5-triiodobenzoic acid, flufenamic acid, folinic acid, a. benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • active drug substances for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, ( S) - (+) -pranoprofen, car
  • Oligonucleotide-drug conjugates and their preparation are described in United States Patent Application 09/334,130 (filed June 15, 1999) which is incorporated herein by reference in its entirety.
  • Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but. are not limited to, U.S.: 4,828,979; 4,948,882; 5,218,105;
  • Chimeric oligomeric compounds It is not necessary for all positions in an oligomeric compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single oligomeric compound or even at a single monomeric subunit such as a nucleoside within a oligomeric compound.
  • the present invention also includes oligomeric compounds which are chimeric oligomeric compounds. "Chimeric" oligomeric compounds or "chimeras,” in the context of this invention, are oligomeric compounds that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a nucleic acid based oligomer.
  • Chimeric oligomeric compounds typically * contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
  • An. additional region of the oligomeric compound may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA: RNA hybrids.
  • RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of inhibition of gene expression.
  • Chimeric oligomeric compounds of the invention may be formed as composite structures of two or more oligonucleotides, oligonucleotide analogs, oligonucleosides and/or oligonucleotide mimetics as described above. Such oligomeric compounds have also been referred to in the art as hybrids hemimers, gapmers or inverted gapmers .
  • oligomeric compounds include nucleosides synthetically modified to induce a 3 ' -endo sugar conformation.
  • a nucleoside can incorporate synthetic modifications of the heterocyclic base, the sugar moiety or both to induce a desired 3 ' -endo sugar conformation.
  • These modified nucleosides are used to mimic RNA like nucleosides so that particular properties of an oligomeric compound can be enhanced while maintaining the desirable 3'- endo conformational geometry.
  • RNA type duplex A form helix, predominantly 3 ' -endo
  • RNA interference which is supported in part by the fact that duplexes composed of 2 ' - deoxy-2 ' -F-nucleosides appears efficient in triggering RNAi response in the C. elegans system.
  • Properties that are enhanced by using more stable 3 ' -endo nucleosides include but aren't limited to modulation of pharmacokinetic properties through modification of protein binding, protein off-rate, absorption and clearance; modulation of nuclease stability as well as chemical stability; modulation of the binding affinity and specificity of the oligomer (affinity and specificity for enzymes as well as for complementary sequences) ; and increasing efficacy of RNA cleavage.
  • the present invention provides oligomeric triggers of RNAi having one or more nucleosides modified in such a way as to favor a C3 ' -endo type conformation .
  • Nucleoside conformation is influenced by various factors including substitution at the 2 ' , 3 ' or 4 ' -positions of the pentofuranosyl sugar. Electronegative substituents generally prefer the axial positions, while sterically demanding substituents generally prefer the equatorial positions (Principles of Nucleic Acid Structure, Wolfgang Sanger, 1984, Springer-Verlag . ) Modification of the 2' position to favor the 3 ' -endo conformation can be achieved while maintaining the 2 ' -OH as a recognition element, as illustrated in Figure 2, below (Gallo et al . , Tetrahedron (2001), 57, 5707-5713. Harry-O' uru et al . , J. Org.
  • preference for the 3'- endo conformation can be achieved by deletion of the 2 ' -OH as exemplified by 2 ' deoxy-2 ' F-nucleosides (Kawasaki et al . , J. Med. Chem. (1993), 36, 831-841), which adopts the 3 ' -endo conformation positioning the electronegative fluorine atom in the axial position.
  • oligomeric triggers of RNAi response might be composed of one or more nucleosides modified in such a way that conformation is locked into a C3 ' - endo type conformation, i.e. Locked Nucleic Acid (LNA, Singh et al, Chem. Commun. (1998), 4, 455-456), and ethylene bridged Nucleic Acids (ENA, Morita et al, Bioorganic & Medicinal
  • the preferred conformation of modif ied nucleosides and their oligomers can be estimated by various methods such as molecular dynamics calculations , nuclear magnetic resonance spectroscopy and CD measurements .
  • modifications predicted to induce RNA like conformations, A-form duplex geometry in an oligomeric context are selected for use in the modified oligoncleotides of the present invention.
  • the synthesis of numerous of the modified nucleosides amenable to the present invention are known in the art (see for example, Chemistry of Nucleosides and Nucleotides Vol 1-3, ed. Leroy B.
  • Nucleosides known to be inhibitors/substrates for RNA dependent RNA polymerases for example HCV NS5B
  • the present invention is directed to oligonucleotides that are prepared having enhanced properties compared to native RNA against nucleic acid targets .
  • a target is identified and an oligonucleotide is selected having an effective length and sequence that is complementary to a portion of the target sequence.
  • Each .nucleoside of the selected sequence is scrutinized for possible .enhancing modifications.
  • a preferred modification would be the replacement of one or more RNA nucleosides with nucleosides that have the same 3 ' -endo conformational geometry.
  • the selected sequence can be further divided into regions and the nucleosides of each region evaluated for enhancing modifications that can be the result of a chimeric configuration. Consideration is also given to the 5' and 3'- termini as there are often advantageous modifications that can be made to one or more of the terminal nucleosides .
  • the oligomeric compounds of the present invention include at least one 5 ' -modified phosphate group on a single strand or on at least one 5 ' -position of a double stranded sequence or sequences.
  • RNA-.RNA duplexes are more stable and have higher melting temperatures (Tm's) than DNA:DNA duplexes (Sanger et al . , Principles of Nucleic Acid Structure, 1984, Springer-Verlag; New York, NY.; Lesnik et al . , Biochemistry, 1995, 34, 10807-10815; Conte et al . , Nucleic Acids Res., 1997, 25, 2627-2634) .
  • Tm's melting temperatures
  • DNA:DNA duplexes Sanger et al . , Principles of Nucleic Acid Structure, 1984, Springer-Verlag; New York, NY.; Lesnik et al . , Biochemistry, 1995, 34, 10807-10815; Conte et al . , Nucleic Acids Res., 1997, 25, 2627-2634
  • the increased stability of RNA has been attributed to several structural features, most notably the improved base stacking interactions that result from an A-form geometry
  • RNA duplex which causes the duplex to favor the A-form geometry.
  • 2' hydroxyl groups of RNA can form a network of water mediated hydrogen bonds that help stabilize the RNA duplex (Egli et al . , Biochemistry, 1996, 35, 8489- 8494) .
  • deoxy nucleic acids prefer a C2 ' endo sugar pucker, i.e., also known as Southern pucker, which is thought to impart a less stable B-form geometry (Sanger, W. (1984) Principles of Nucleic Acid Structure, Springer-Verlag, New York, NY) .
  • B-form geometry is inclusive of both C2'-endo pucker and 04 ' -endo pucker.
  • RNA hybrid duplexes are usually less stable than pure RNA: RNA duplexes, and depending on their sequence may be either more or less stable than DNA: DNA duplexes (Searle et al . , Nucleic Acids Res . , 1993, 21 , 2051- 2056) .
  • the structure of a hybrid duplex is intermediate between A- and B-form geometries, which may result in poor stacking interactions (Lane et al . , Eur. J. Biochem . , 1993,
  • the stability of the duplex formed between a target RNA and a synthetic sequence is central to therapies such as but not limited to antisense and RNA interference as these mechanisms require the binding of a synthetic oligonucleotide strand to an RNA target strand. In the case of antisense, effective .
  • 2 ' -halogens have been studied showing that the 2 ' -fluoro derivative exhibits the largest population (65%) of the C3 ' -endo form, and the 2'-iodo exhibits the lowest population (7%) .
  • the populations of adenosine (2' -OH) versus deoxyadenosine (2'-H) are 36% and 19%, respectively.
  • the effect of the 2 ' -fluoro group of adenosine dimers (2 ' -deoxy-2 ' -fluoroadenosine - 2 ' -deoxy-2 ' -fluoro-adenosine) is further correlated to the stabilization of the stacked conformation.
  • the relative duplex stability can be enhanced by replacement of 2 ' -OH groups with 2 ' -F groups thereby increasing the C3 ' -endo population. It is assumed that the highly polar nature of the 2 ' -F bond and the extreme preference for C3 ' -endo puckering may stabilize the stacked conformation in a.n A-form duplex. Data from UN hypochromicity, circular dichroism, and 1 H MR also indicate that the degree of stacking decreases as the electronegativity of the halo substituent decreases. Furthermore, steric bulk at. the 2 ' -position of the sugar moiety is better accommodated in .an A-form duplex than a B-form duplex.
  • a 2 ' -substituent on the 3 ' -terminus of a dinucleoside monophosphate is thought to exert a number of effects on the stacking conformation: steric repulsion, furanose puckering preference, electrostatic repulsion, hydrophobic attraction, and hydrogen bonding capabilities. These substituent effects are thought to be determined by the molecular size, electronegativity, and hydrophobicity of the substituent. Melting temperatures of complementary strands is also increased with the 2 ' -substituted adenosine diphosphates . It is not clear whether the 3 ' -endo preference of the conformation or the presence of the substituent is responsible for the increased binding.
  • Oligonucleotides having the 2 ' -MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, P., Hel v. Chim . Acta, 1995, 78 , 486-504; Altmann et al . , Chi ia, 1996, 50, 168-176; Altmann et al . , Biochem . Soc . Trans . , 1996, 24 , 630- 637; and Altmann et al . , Nucleosides Nucleotides, 1997, 16, 917-926) .
  • the oligonucleotides having the 2 ' -MOE modification displayed improved RNA affinity and higher nuclease resistance.
  • Chimeric oligonucleotides having 2 ' -MOE substituents in the wing nucleosides and an internal region of deoxy-phosphorothioate nucleotides also termed a gapped oligonucleotide or gapmer
  • 2 ' -MOE substituted oligonucleotides have also shown outstanding promise as antisense agents in several disease states.
  • One such MOE substituted oligonucleotide is on the market for the treatment of CMV retinitis.
  • alkyl means d-d 2 preferably C ⁇ -C 8 , and more preferably d-C 6 , straight or (where possible) branched chain aliphatic hydrocarbyl.
  • heteroalkyl means d-d.2, preferably d-C 8 , an ⁇ ⁇ more preferably C ⁇ -C 6 , straight or (where possible) branched chain aliphatic hydrocarbyl containing at least one, and preferably about 1 to about 3, heteroatoms in the chain, including the terminal portion of the chain.
  • Preferred heteroatoms include N, 0 and S.
  • cycloalkyl means C 3 - C12, preferably C 3 -C 8 , and more preferably C 3 -C 6 , aliphatic hydrocarbyl ring .
  • alkenyl means C 2 - Ci2, preferably C 2 -C 8 , and more preferably C 2 -C 6 alkenyl, which may be straight or (where possible) branched hydrocarbyl moiety, which contains at least one carbon-carbon double bond.
  • alkynyl means C 2 - Ci 2/ preferably C 2 -C 8 , and more preferably C 2 -C 3 alkynyl, which may be- straight or '(where possible) branched hydrocarbyl moiety, which contains at least one carbon-carbon triple bond.
  • heterocycloalkyl means a ring moiety containing at least three ring members, at least one of which is carbon, and of which 1, 2 or three ring members are other than carbon.
  • the number of carbon atoms varies from 1 to about 12 , preferably 1 to about 6, and the total number of ring members varies from three to about 15, preferably from about 3 to about 8.
  • Preferred ring heteroatoms are N, O and S.
  • Preferred heterocycloalkyl groups include morpholino, thiomorpholino, piperidinyl, piperazinyl, homopiperidinyl , homopiperazinyl, homomorpholino, homothiomorpholino, pyrrolodinyl, tetrahydrooxazolyl, tetrahydroimidazolyl , tetrahydrothiazolyl , tetrahydroisoxazolyl, tetrahydropyrrazolyl , furanyl, pyranyl, and tetrahydroisothiazolyl .
  • aryl means any hydrocarbon ring structure containing at least one aryl ring.
  • Preferred aryl rings have about 6 to about 20 ring carbons.
  • Especially preferred aryl rings include phenyl, napthyl , anthracenyl , and phenanthrenyl .
  • hetaryl means a ring moiety containing at least one fully unsaturated ring, the ring consisting of carbon and non-carbon atoms.
  • the ring system contains about 1 to about 4 rings .
  • the number of carbon atoms varies from 1 to about 12, preferably 1 to about 6, and the total number of ring members varies from three to about 15, preferably from about 3 to about 8.
  • Preferred ring heteroatoms are N, O and S.
  • Preferred hetaryl moieties include pyrazolyl, thiophenyl , pyridyl , imidazolyl, tetrazolyl, pyridyl, pyrimidinyl, purinyl, quinazolinyl, quinoxalinyl, benzimidazolyl, benzothiophenyl, etc.
  • a moiety is defined as a compound moiety, such as hetarylalkyl (hetaryl and alkyl), aralkyl (aryl and alkyl), etc.
  • each of the sub- moieties is as defined herein.
  • an electron withdrawing group is a group, such as the cyano or isocyanato group that draws electronic charge away from the carbon to which it is attached.
  • Other electron withdrawing groups of note include those whose electronegativities exceed that of carbon, for example halogen, nitro, or phenyl substituted in the ortho- or para-position with one or more cyano, isothiocyanato, nitro or halo groups.
  • the terms halogen and halo have their ordinary meanings .
  • Preferred halo (halogen) substituents are Cl, Br, and I.
  • the aforementioned optional substituents are, unless otherwise herein defined, suitable substituents depending upon desired properties.
  • halogens Cl, Br, I
  • alkyl alkenyl, and alkynyl moieties
  • N0 2 NH 3 (substituted and unsubstituted)
  • acid moieties e.g. -C0 2 H, -OS0 3 H 2 , etc.
  • heterocycloalkyl moieties hetaryl moieties, aryl moieties, etc .
  • the squiggle ( ⁇ ) indicates ;a bond to an oxygen or sulfur of the 5 ' -phosphate :
  • Phosphate protecting groups include those described in US Patents No. US 5, 760, 209 , ' US 5,614,621, US 6,051,699, US 6,020,475, US 6,326,478, US 6,169,177, US 6,121,437, US
  • oligonucleotides in accordance with this invention preferably comprise from about 8 to about 80 nucleotides, more preferably from about 8 to about 50, even more preferably from about 12- 50 nucleotides and most preferably from about 15 to 30 nucleotides.
  • a nucleotide is a base- sugar combination suitably bound to an adjacent nucleotide through a phosphodiester, phosphorothioate or other covalent linkage .
  • the oligonucleotides of the present invention also include variants in which a different base is present at one or more of the nucleotide positions in the oligonucleotide.
  • variants may be produced which contain thymidine, guanosine or cytidine at this position. This may be done at any of the positions of the oligonucleotide.
  • a 20-mer may comprise 60 variations (20 positions x 3 alternates at each position) in which the original nucleotide is substituted with any of the three alternate nucleotides.
  • oligonucleotides are then tested using the methods described herein to determine their ability to inhibit expression of B7.1 or B7.2 mRNA.
  • pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesirable toxicological effects thereto.
  • Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium and the like.
  • Suitable amines are N,N' - dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N- methylglucamine and procaine (see, for example, Berge et al . , "Pharmaceutical Salts," J. of Pharma Sci . , 1977, 66, 1-19).
  • Sodium salts are especially preferred pharmaceutically acceptable salts of the compounds of the present invention.
  • the oligonucleotides used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA) .
  • oligonucleotides of the present invention can be utilized as therapeutic compounds, diagnostic tools and as research reagents and kits.
  • Atherapeutic uses® is intended to encompass prophylactic, palliative and curative uses wherein the oligonucleotides of the invention are contacted with animal cells either in vivo or ex vivo .
  • a therapeutic use includes incorporating such cells into an animal after treatment with one or more oligonucleotides of the invention.
  • the ex vivo modulation of, e.g., T cell proliferation by the oligonucleotides of the invention can be employed in, for example, potential therapeutic modalities wherein it is desired to modulate the expression of a B7 protein in APCs .
  • oligonucleotides that inhibit the expression of B7-1 proteins are expected to enhance the availability of B7-2 proteins on the surface of APCs, thus increasing the costimulatory effect of B7-2 on T cells ex vivo (Levine et al . , Science, 1996, 272, 1939).
  • an animal suspected of having a disease or disorder which can be treated or prevented by modulating the expression or activity of a B7 protein is, for example, treated by administering oligonucleotides in accordance with this invention.
  • the oligonucleotides of fche invention can be utilized in pharmaceutical compositions by- adding an effective amount of an oligonucleotide to a suitable pharmaceutically acceptable diluent or carrier. Workers in the field have identified antisense, triplex and other oligonucleotide compositions which are capable of modulating expression of genes implicated in viral, fungal and metabolic diseases. Antisense oligonucleotides have been safely administered to humans and several clinical trials are presently underway.
  • oligonucleotides can be useful therapeutic instrumentalities that can be configured to be useful in treatment regimes for treatment of cells, tissues and animals, especially humans.
  • the oligonucleotides of the present invention can be further used to detect the presence of B7-specific nucleic ' acids in a cell or tissue sample.
  • radiolabeled oligonucleotides can be prepared by 32 P labeling at the 5' end with polynucleotide kinase (Sambrook et al . , Molecular Cloning . A Labora tory Manual , Cold Spring Harbor Laboratory Press, 1989, Volume 2, pg . 10.59).
  • Radiolabeled oligonucleotides are then contacted with cell or tissue samples suspected of containing B7 message RNAs (and thus B7 proteins) , and the samples are washed to remove unbound oligonucleotide. Radioactivity remaining in the sample indicates the presence of bound oligonucleotide, which in turn indicates the presence of nucleic acids, complementary to the oligonucleotide, and can be quantitated using a scintillation counter or other routine means. Expression of nucleic acids encoding these proteins is thus detected. Radiolabeled oligonucleotides of the present invention can also be used to perform autoradiography of tissues to determine the localization, distribution and quantitation of B7 proteins for research, diagnostic or therapeutic purposes.
  • tissue sections are treated with radiolabeled oligonucleotide and washed as described above, then exposed to photographic emulsion according to routine autoradiography procedures.
  • the emulsion when developed, yields an image of silver grains over the regions expressing a B7 gene. Quantitation of the- silver grains permits detection of the expression of mRNA molecules encoding these proteins and permits targeting of oligonucleotides to these areas.
  • Analogous assays for fluorescent detection of expression of B7 nucleic acids can be developed using oligonucleotides of the present invention which are conjugated with fluorescein or other fluorescent tags instead of radiolabeling.
  • Such conjugations are routinely accomplished during solid phase synthesis using fluorescently- labeled amidites or controlled pore glass (CPG) columns. Fluorescein- labeled amidites and CPG are available from, e.g., Glen Research, Sterling VA.
  • the present invention employs oligonucleotides targeted to nucleic acids encoding B7 proteins and oligonucleotides targeted to nucleic acids encoding such proteins .
  • Kits for detecting the presence or absence of expression of a B7 protein may also be prepared. Such kits include an oligonucleotide targeted to an appropriate gene, i.e., a gene encoding a B7 protein.
  • kits and assay formats such as, e.g., Asandwich® assays, are known in the art and can easily be adapted for use with the oligonucleotides of the invention.
  • Hybridization of the oligonucleotides of the invention with a nucleic acid encoding a B7 protein can be detected by means known in the art .
  • Such means may include, conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection systems.
  • Kits for detecting the presence or absence of a B7 protein may also be prepared. The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art.
  • a patient in need of such therapy is administered an oligonucleotide in accordance with the invention, commonly in a pharmaceutically acceptable carrier, in doses ranging from 0.01 ⁇ g to 100 g per kg of body weight depending on the age of the patient and the severity of the disorder or disease state being treated.
  • the treatment regimen may last for a period of time which will vary depending upon the nature of the particular disease or disorder, its severity and the overall condition of the patient, and may extend from once daily to once every 20 years. Following treatment, the patient is monitored for changes in his/her condition and for alleviation of the symptoms of the disorder or disease state.
  • the dosage of the oligonucleotide may either be increased in the event the patient does not .respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disorder or disease state is observed, or if the disorder or disease state has been ablated. In some cases, it may be more effective to treat a patient with an oligonucleotide * of the invention in conjunction with other therapeutic modalities in order to increase the efficacy of a treatment regimen.
  • the term Atreatment regimen® is meant to encompass therapeutic, palliative and prophylactic modalities.
  • the oligonucleotides of the invention are used in conjunction with an anti-inflammatory and/or immunosuppressive agent, preferably one or more antisense oligonucleotides targeted to an intercellular adhesion molecule (ICAM) (E.g., ICAM-1).
  • an anti-inflammatory and/or immunosuppressive agent preferably one or more antisense oligonucleotides targeted to an intercellular adhesion molecule (ICAM) (E.g., ICAM-1).
  • ICAM intercellular adhesion molecule
  • anti-inflammatory and/or immunosuppressive agents that may be used in combination with the oligonucleotides of the invention include, but are not limited to, soluble ICAM proteins (e.g., sICAM-1) , antibody-toxin conjugates, prednisone, methylprednisolone, azathioprine, cyclophosphamide, cyclosporine, interferons, sympathomimetics, conventional antihistamines (histamine Hi receptor antagonists, including, for example, brompheniramine maleate, chlorpheniramine maleate, dexchlorpheniramine maleate, tripolidine HCl, carbinoxamine maleate, clemastine fumarate, dimenhydrinate, diphenhydramine HCl, diphenylpyraline HCl, doxylamine succinate, tripelennamine citrate, tripelennamine HCl, cyclizine HCl, hydroxyzine HCl, meclizine
  • an antisense oligonucleotide targeted to one B7 mRNA species e.g., B7-1
  • an antisense oligonucleotide targeted to a second B7 mRNA species e.g., ' .
  • oligonucleotide B7-2 in order to inhibit the costimulatory effect of B7 molecules to a more extensive degree than can be achieved with either oligonucleotide used individually.
  • two or more oligonucleotides of the invention are combined with each ' other in order to inhibit expression of both forms of the alternatively spliced mRNAs . It is known in the art that, depending on the specificity of the modulating agent employed, inhibition of one form of an alternatively spliced mRNA may not result in a sufficient reduction of expression for a given condition to be manifest.
  • such combinations may, in some instances, be desired to inhibit the expression of a particular B7 gene to an extent necessary to practice one of the methods of the invention.
  • it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ⁇ g to 100 g per kg of body weight, once or more daily, to once every 20 years.
  • prophylactic effects may be achieved by administration of preventive doses, ranging from 0.01 ⁇ g to 100 g per kg of body weight, once or more daily.
  • an individual may be made less susceptible to an inflammatory condition that is expected to occur as a result of ⁇ some medical treatment, e.g., graft versus host disease resulting from the transplantation of cells, tissue or an organ into the individual .
  • the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated.
  • Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer, dry powder inhaler, or metered dose inhaler; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Pulmonary administration methods are described in more detail below.
  • MDI Metered Dose Inhalers
  • pMDI Metered Dose Inhalers
  • This delivery system is the most widely used, and accounts for about 70-80% of the pulmonary delivery systems used worldwide and have been approved since the 1950' s.
  • MDI is based typically (except for QVARS which is a solution of beclomethasone DP in a mixture of ethanol and HFA 134a) on a suspension of a micronized drug in a CFC or HFA liquid under high pressure.
  • the drug is metered through a small chamber in the valve (typically 25-150 ⁇ L, most common 50 ⁇ L) and the suspension/HFA is aerosolized from the valve upon actuation and delivered as a dry powder, due to the evaporation of the propellant.
  • This device typically can have suspension concentrations of up to 2% solids in suspension, which will be able to deliver about 1 mg/puff of active to the airways.
  • Nebulization- continuous nebulizers This delivery system typically comprises a continuous generation of an aerosol cloud from a solution or a suspension in water by a stream of compressed air (jet nebulizers) or by a ultrasound energy (ultrasonic nebulizers) . Dosing is based on the time that the individual is exposed to the aerosol cloud and on the concentration of the drug in the solution or suspension. The patient or clinician is responsible for the preparation of the unit before and after dosing. Nebulizers continuously release drug throughout the respiratory cycle, but output is increased during inspiration in response to the patient's breathing. Large amounts of drug can be delivered to the airways. Some nebulizera detect pressure changes during breathing and constantly adapt to the inspiratory and expiratory flow pattern of the patient.
  • DPI Dry powder inhalers consist of a finely divided dry powder contained in a reservoir or in a metered unit dose that upon actuation (by inspiratory force- these devices are called passive DPI, or by energy provided by the device -these devices are called active DPI) will generate a plume of aerosolized powder particles that will be inhaled.
  • the DPI available can deliver up to a dose of 20-30 mg of active to the airways (Nektar and Alkermes) per puff.
  • Single Dose Nebulizers These devices have the way of metering the dose or have the doses pre-metered in unit dosage packages.
  • the aerosol is generated from an aqueous solution or suspension by energy provided by the device and some of them are breath actuated, which means that the dosing will only occur when the right inspiratory flow rate is achieve to ensure proper dosing.
  • the unit doses are typically 50-150 ⁇ L per dose, so depending on the solution concentration a dose of 10 to 20 mg per puff to the airways based on a solution concentration of around 150 mg/mL and a efficiency of around 60%.
  • Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
  • Oligonucleotides with at least one 2 ' -MOE modification are believed to be particularly useful for oral administration.
  • Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
  • Compositions for oral administration also include pulsatile delivery compositions and bioadhesive composition as described in copending U.S. Patent Application Serial Nos.
  • compositions for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives . Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or ' until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the 'patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates.
  • Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 50 s found to be effective in in vi tro and in vivo animal models. In general, dosage is from 0.01 ⁇ g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly.
  • dosage is from 0.01 ⁇ g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly.
  • the following examples illustrate the invention and are not intended to limit the same. Those skilled in the art will recognize, or be able to ascertain through routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the scope of the present invention. The following examples are provided for illustrative purposes only and are not intended to limit the invention. EXAMPLES
  • Example 1 Synthesis of Nucleic Acids Oligonucleotides Oligonucleotides were synthesized on an automated DNA synthesizer using standard phosphoramidite chemistry with oxidation using iodine, ⁇ -Cyanoethyldiisopropyl phosphoramidites were purchased from Applied Biosystems (Foster City, CA) . For phosphorothioate oligonucleotides, the standard oxidation bottle was replaced by a 0.2 M solution of 3H- 1 , 2-benzodithiole-3-one-l, 1-dioxide in acetonitrile for the stepwise thiation of the phosphite linkages.
  • the thiation cycle wait step was increased to 68 seconds and was followed by the capping step .
  • the 2'-fluoro phosphorothioate oligonucleotides of the invention were synthesized using 5 ' -dimethoxytrityl-3 ' - phosphoramidites and prepared as disclosed in U.S. patent application Serial No. 463,358, filed January 11, 1990, and
  • the 2 ' -methoxy (2 ' -O-methyl) oligonucleotides of the invention were synthesized using 2 ' -methoxy ⁇ - cyanoethyldiisopropyl-phosphoramidites (Chemgenes, Needham MA) and the standard cycle for unmodified oligonucleotides, except the wait step after pulse delivery of tetrazole and base is increased to 360 seconds.
  • Other 2 ' -alkoxy oligonucleotides are synthesized by a modification of this method, using appropriate 2 ' -modified amidites such as those available from Glen Research, Inc., Sterling, VA.
  • the 3 ' -base used to start the synthesis was a 2 ' -deoxyribonucleotide .
  • the 2 ' -O-propyl oligonucleotides of the invention are prepared by a slight ⁇ modification of this procedure.
  • the 2' -MOE oligonucleotides of the invention were synthesized according to the method of Martin, Helv. Chim . Acta 1995, 78, 486. For ease of synthesis, the last nucleotide was a deoxynucleotide . All 2 ' -MOE cytosines were 5-methyl cytosines, which were synthesized according to the following procedures.
  • the ether was decanted and the residue was dissolved in a minimum amount of methanol (ca. 400 mL) .
  • the solution was poured into fresh ether (2.5 L) to yield a stiff gum.
  • the ether was decanted and the gum was dried in a vacuum oven
  • HPLC showed the presence of approximately 70% product.
  • the solvent was evaporated and triturated with CH 3 CN (200 mL) .
  • the residue was dissolved in CHC1 3 (1.5 L) and extracted with 2x500 mL of saturated NaHC0 3 and 2x500 mL of saturated NaCI.
  • the organic phase was dried over Na 2 S0 4 , filtered and evaporated. 275 g of residue was obtained.
  • the residue was purified on a 3.5 kg silica gel column, packed and eluted with EtOAc/Hexane/Acetone (5:5:1) containing 0.5% Et 3 NH.
  • the pure fractions were evaporated to give 164 g of product. Approximately 20 g additional was obtained from the impure fractions to give a total yield of 183 g (57%) .
  • Triethylamine (189 mL, 1.44 M) was added to a solution of triazole (90 g, 1.3 M) in CH 3 CN (1 L) , cooled to -5°C and stirred for 0.5 h using an overhead stirrer. POCl 3 was added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10°C, and the resulting mixture stirred for an additional 2 hours. The first solution was added to the later solution dropwise, over a 45 minute period. The resulting reaction mixture was stored overnight in a cold room. Salts were filtered from the reaction mixture and the solution was evaporated. The residue was dissolved in EtOAc (1 L) and the insoluble solids were • removed by filtration. The filtrate was washed with 1x300 mL of NaHC0 3 and 2x300 mL of saturated NaCI , dried over sodium sulfate and evaporated. The residue was triturated with EtOAc to give the title compound.
  • the resulting mixture was stirred for 20 hours at room temperature (tic showed the reaction to be 95% complete) .
  • the reaction mixture was extracted with saturated NaHC0 3 (1x300 mL) and saturated NaCI (3x300 mL) .
  • the aqueous washes were back-extracted with CH 2 C1 2 (300 mL) , and the extracts were combined, dried over MgS0 4 and concentrated.
  • the residue obtained was chromatographed on a 1.5 kg silica column using EtOAc ⁇ Hexane (3:1) as the eluting solvent. The pure fractions were combined to give 90.6 g (87%) of the title compound.
  • Adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to the thymidine (5-methyluridine) except the exocyclic amines are protected with a benzoyl moiety in the case of adenosine and cytidine and with isobutyryl in the case of guanosine.
  • the reactor was sealed and heated in an oil bath until an internal temperature of 160°C was reached and then maintained for 16 h (pressure ⁇ 100 psig) .
  • the reaction vessel was cooled to ambient and opened.
  • TLC Rf 0.67 for desired product and Rf 0.82 for are-T side product, ethyl acetate
  • reaction mixture was flushed with argon and dry THF (369.8mL, Aldrich, sure seal bottle) was added to get a clear solution.
  • Diethyl- azodicarboxylate (6.98mL, 44.36mmol) was added dropwise to the reaction mixture. The rate of addition is maintained such that resulting deep red coloration is just discharged before adding the next drop.
  • the reaction was stirred for 4 hrs . By that time TLC showed the completion of the reaction (ethylacetate :hexane, 60:40). The solvent was evaporated in vacuum.
  • Residue obtained was placed on a flash column and eluted with ethyl acetate: hexane (60:40), to get 2 ' -0- ( [2-phthalimidoxy) ethyl] -5 ' -t ⁇ butyldiphenylsilyl-5-methyluridine as white foam (21.819 g, 86%) .
  • reaction mixture was stirred for 10 minutes at lOEC. After that the reaction vessel was removed from the ice bath and stirred at room temperature for 2 h, the reaction monitored by TLC (5% MeOH in CH 2 C1 2 ) . Aqueous NaHC0 3 solution (5%, lOmL) was added and extracted with ethyl acetate (2x20mL) . Ethyl acetate phase was dried over anhydrous Na 2 S0 4 , evaporated to dryness. Residue was dissolved in a solution of IM PPTS in MeOH (30.6mL). Formaldehyde (20% w/w, 30 L,
  • Triethylamine trihydrofluoride (3.91mL, 24.0mmol) was dissolved in dry THF and triethylamine (1.67mL, 12mmol, dry, kept over KOH) .
  • This mixture of triethylamine-2HF was then added to 5 ' -0- tert-butyldiphenylsilyl-2 ' -0- [N, N- dimethylaminooxyethyl] -5-methyluridine (1.40g, 2.4mmol) and stirred at room temperature for 24 hrs . Reaction was monitored by TLC (5% MeOH in CH 2 C1 2 ) .
  • reaction mixture was dissolved in anhydrous acetonitrile (8.4mL) and 2-cyanoethyl- N,N,Nl,Nl-tetraisopropylphosphoramidite (2.12mL, 6.08mmol) was added.
  • the reaction mixture was stirred at ambient temperature for 4 hrs under inert atmosphere. The progress of the reaction was monitored by TLC (hexane : ethyl acetate 1:1) . The solvent was evaporated, then the residue was dissolved in ethyl acetate (70mL) and washed with 5% aqueous NaHC03 (40mL) . Ethyl acetate layer was dried over anhydrous Na2S04 and concentrated.
  • Residue obtained was chromatographed (ethyl acetate as eluent) to get 5 ' -O-DMT-2 ' -O- (2-N, N- dimethylaminooxyethyl) -5-methyluridine-3 ' - [ (2-cyanoethyl) -N,N- diisopropylphosphoramidite] as a foam (1.04g, 74.9%).
  • 2 ' - (Aminooxyethoxy) nucleoside amidites 2 ' - (Aminooxyethoxy) nucleoside amidites [also known in the art as 2 ' --0- (aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly.
  • the 2 ' -O-aminooxyethyl guanosine analog may be obtained by selective 2 ' -O-alkylation of diaminopurine riboside.
  • Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2'-0-(2- ethylacetyl) diaminopurine riboside along with a minor amount of the 3'-0-isomer.
  • 2 ' -O- (2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2'-0-(2- ethylacetyl) guanosine by treatment with adenosine deaminase . (PCT WO94/02501) .
  • Standard protection procedures should afford 2'-0- (2-ethylacetyl) -5'-0- (4,4'- dimethoxytrityl) guanosine and 2-N-isobutyryl-6-0- diphenylcarbamoyl-2 ' -0- (2-ethylacetyl) -5 ' -0- (4,4 ' - dimethoxytrityl) guanosine which may be reduced to provide 2-N- isobutyryl-6-0-diphenylcarbamoyl-2 ' -O- (2-ethylacetyl) -5 ' -O- (4 , 4 ' -dimethoxytrityl) guanosine .
  • the hydroxyl group may be displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N-isobutyryl-6-0-diphenylcarbamoyl-2 ' -O- (2- ethylacetyl) -5 ' -O- (4,4' -dimethoxytrityl) guanosine-3 ' - [ (2- cyanoethyl) -N,N-diisopropylphosphoramidite] .
  • 2 ' -dimethy1aminoethoxyethoxy (2"-DMAE0E) nucleoside amidites 2 ' -dimethylaminoethoxyethoxy nucleoside amidites (also known in the art as 2 ' -O-dimethylaminoethoxyethyl, i.e., 2 ' -0-CH 2 -0-CH 2 -N(CH 2 ) 2 , or 2 ' -DMAEOE nucleoside amidites) are prepared as follows. Other nucleoside amidites are prepared similarly.
  • the aqueous layer is extracted with ethyl acetate (3x200 mL) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate and concentrated.
  • the residue is columned on silica gel using methanol/ ethylene chloride 1:20 (which has 2% triethylamine) as the eluent. As the column fractions are concentrated a colorless solid forms which is collected to give the title compound as a white solid.
  • the reaction mixture is poured into water (200 mL) * and extracted with CH2C12 (2x200 mL) .
  • CH2C12 (2x200 mL)
  • the combined CH2C12 layers are washed with saturated NaHC03 solution, followed by saturated NaCI solution and dried over anhydrous sodium sulfate.
  • Evaporation of the solvent followed by silica gel chromatography using MeOH:CH2Cl2 :Et3N (20:1, v/v, with 1% triethylamine) gives the title compound.
  • oligonucleotides were purified by precipitation twice out of 0.5 M NaCI with 2.5 volumes ethanol. Analytical gel electrophoresis was accomplished in 20% acrylamide, 8 M urea, 45 mM Tris-borate buffer, pH 7.0. Oligodeoxynucleotides and their phosphorothioate analogs were judged from electrophoresis to be greater than 80% full length material.
  • B7 Antisense Oligonucleotides A series of oligonucleotides with sequences designed to hybridize to the published human B7-1 (hB7-l) and murine (mB7-l) mRNA sequences (Freeman et al . , J “ . Immunol . , 1989, 143 , 2714: , . and Freeman et al . , J. Exp . Med . , 1991, 174, 625 respectively) .
  • the reported alternative splicing for B7-1 is relatively simple, in that it results in messages extended 5 ' relative to the 5 ' terminus of the human and murine B7-1 cDNA sequences originally reported (Borriello et al . , J. Immunol., 1994, 153 , 5038; Inobe et al . , J. Immunol., 1996, 157, 588).
  • positions within these 5 ' extensions of the initially reported sequences have been given negative numbers (beginning with position -1, the most 3 ' base of the 5 ' extension) in Tables 1 and 2.
  • murine B7-2 transcripts are considerably more complex than that so far reported for B7-1; for example, at least five distinct murine B7-2 mRNAs, and at least two distinct human B7-2 mRNAs, can be produced by alternative splicing events (Borriello et al . , J. Immunol . , 1995, 155, 5490; Freeman et al . , WO 95/03408, published February 2 , 1995; see also Jellis et al . , Immunogenet . , 1995, 42, 85) .
  • Residues having 2' fluoro (2'F), 2 ' -methoxy (2 'MO) or 2 ' -methoxyethoxy (2' ME) • modification are emboldened, with the type of modification* being indicated by the respective abbreviations.
  • interresidue linkages are phosphodiester linkages; phosphorothioate linkages are indicated by an AS® in the superscript position (e.g., T S A) .
  • Target positions are numbered according to Freeman et al . , J. Immunol., 1989', 143:2714 (human B7-1 cDNA sequence; Table 1), Freeman et ai . , J. Exp . Med .
  • cDNA clones A cDNA encoding the sequence for human B7-1 was isolated by using the reverse transcription/polymerase chain reaction (RT-PCR) .
  • RT-PCR reverse transcription/polymerase chain reaction
  • Poly A+ RNA from Daudi cells ATCC accession No. CCL 2173 was reverse transcribed using oligo-dT primer under standard conditions.
  • the reaction mixture (20 ⁇ L) was brought to 100 ⁇ L with water.
  • a 10 ⁇ L aliquot from the RT reaction was then amplified in a 50 ⁇ L PCR reaction using the 5' primer, 5 ' -GAT-CAG-GGT-ACC-CCA-AAG-AAA-AAG-TGA-TTT-GTC-
  • ATT-GC-3 sense, SEQ ID NO: 20
  • 3' primer 5 ' -GAT-AGC-CTC-GAG-GAT-AAT-GAA-TTG-GCT-GAC-AAG- AC-3
  • the primers included unique restriction sites for subcloning of the PCR product into the vector pcDNA-3 (Invitrogen, San Diego, CA) .
  • the 5' primer was designed to have identity with bases 1 to 26 of the published human B7- 1 sequence (Freeman et al . , J. Immunol .
  • the 3' primer was designed to be complementary to bases 1450 to 1471 of the published sequence for B7-1 (positions 14-35 of the primer) and includes a Xho I restriction site (positions 7-12 of the primer) .
  • the reaction was extracted with phenol and precipitated using ethanol .
  • the product was digested with the appropriate restriction enzymes and the full-length fragment purified by agarose gel and ligated into the vector pcDNA-3 (Invitrogen, San Diego, CA) prepared by digesting with the same enzymes.
  • pcB7-l The resultant construct, pcB7-l, was confirmed by restriction mapping and DNA sequence analysis using standard procedures.
  • a mouse B7-1 clone, pcmB7-l was isolated in a similar manner by RT-PCR of RNA isolated from a murine B-lymphocyte cell line, 70Z3.
  • Poly A+ RNA from Daudi cells (ATCC accession No. CCL 213) was reverse transcribed using oligo-dT primer under standard conditions. Following a 30 minute reaction at 42°C and heat inactivation, the reaction mixture (20 ⁇ L) was brought to 100 ⁇ L with water.
  • a 10 ⁇ L aliquot from the RT reaction was then amplified in a 50 ⁇ L PCR reaction using the 5' primer, 5 ' -GAT-CAG-GGT-ACC-AGG-AGC-CTT-AGG-AGG-TAC-GG-3 ' (sense, SEQ ID NO: 1), and the 3' primer, 5 ' -GAT-AGC-CTC-GAG-TTA-TTT-CCA-GGT-CAT-GAG-CCA-3 '
  • the 5 ' primer was designed to have identity with bases 1-20 of the published B7-2 sequence (Azuma et al . , Nature, 1993, 366, 76 and Genban Accession No. L25259; positions 13-32 of the primer) and includes a Kpn I site
  • the 3' primer was designed to have complementarity to bases 1370- 1391 of the published sequence for B7-2 (positions 13-33 of the primer) and includes an Xho I restriction site (positions 7-12 of the primer) .
  • the reaction was extracted with phenol and precipitated using ethanol.
  • the product was digested with Xho I and Kpn I, and the full-length fragment purified by agarose gel and ligated into the vector pcDNA-3 (Invitrogen, San Diego, CA) prepared by digesting with the same enzymes.
  • the resultant construct, pcB7-2 was confirmed by restriction mapping and DNA sequence analysis using standard procedures.
  • a mouse B7-2 clone, pcmB7-2 was isolated in a similar manner by RT-PCR of RNA isolated from P388D1 cells using the 5' primer, 5 ' -GAT-CAG-GGT-ACC-AAG-AGT-GGC-TCC-TGT-AGG-CA (sense, SEQ ID NO: 99), and the 3' primer, 5 ' -GAT-AGC-CTC-GAG-GTA-GAA-TTC-CAA-TCA-GCT-GA (antisense, SEQ ID NO: 100) .
  • the 5' primer has identity with bases 1-20, whereas the 3' primer is complementary to bases 1096-1115, of the published murine B7-2 sequence (Chen et al . , J. Immun . , 1994, 152, 4929). Both primers incorporate the respective restriction enzyme sites found in the other 5' and 3' primers used to prepare cDNA clones.
  • the RT-PCR product was restricted with Xho I and Kpn I and ligated into pcDNA-3 (Invitrogen, Carlsbad, CA) .
  • cDNA clones corresponding to mRNAs resulting from alternative splicing events, are cloned in like fashion, using primers containing the appropriate restriction sites and having identity with (5' primers), or complementarity to (3' primers), the selected B7 mRNA.
  • Example 2 Modulation of hB7-l Expression by Oligonucleotides The ability of oligonucleotides to inhibit B7-1 expression was evaluated by measuring the cell surface expression of B7-1 in transfected COS-7 cells by flow cytometry .
  • a T-175 flask was seeded at 75% confluency with COS-7 cells (ATCC accession No. CRL 1651) .
  • the plasmid pcB7-l was introduced into cells by standard calcium phosphate transfection. Following a 4 hour transfection, the cells were trypsinized and seeded in 12-well dishes at 80% confluency. The cells were allowed to adhere to the plastic for 1 hour and were then washed with phosphate- buffered saline (PBS) .
  • PBS phosphate- buffered saline
  • OptiMEMTM (GIBCO-BRL, Gaithersburg, MD) medium was added along with 15 ⁇ g/mL of LipofectinTM (GIBCO-BRL, Gaithersburg, MD) and oligonucleotide at the indicated concentrations. After four additional hours, the cells were washed with phosphate buffered saline (PBS) and incubated with fresh oligonucleotide at the same concentration in DMEM (Dulbecco et al . , Virol . , 1959, 8 , 396; Smith et al . , Virol . , 1960, 12, 185) with 10% fetal calf sera (FCS) .
  • PBS phosphate buffered saline
  • treated COS-7 cells were harvested by brief trypsinization 24-48 hours after oligonucleotide treatment.
  • the cells were washed with PBS, then resuspended in 100 ⁇ L of staining buffer (PBS, 0.2% BSA, 0.1% azide) with 5 ⁇ L conjugated anti-B7-l-antibody (i.e., anti-hCD80-FITC, Ancell, Bayport, MN; FITC: fluorescein isothiocyanate) .
  • the cells were stained for 30 minutes at 4°C, washed with PBS, resuspended in 300 ⁇ L containing 0.5% paraformaldehyde. Cells were harvested and the fluorescence profiles were determined using a flow cytometer .
  • results The oligonucleotides shown in Table 1 were evaluated, in COS-7 cells transiently expressing B7-1 cDNA, for their ability to inhibit B7-1 expression.
  • the results ( Figure 1) identified ISIS 13805, targeted to the translation initiation codon region, and ISIS 13812, targeted to the 3 ' untranslated region (UTR) , as the most active oligonucleotides with greater than 50% inhibition of B7-1 expression. These oligonucleotides are thus highly preferred.
  • ISIS 13799 targeted to the 5' untranslated region
  • ISIS 13802 targeted to the 5' untranslated region
  • ISIS 13806 and 13807 both targeted to the 5' region of the ORF
  • ISIS 13810 targeted to the central portion of the ORF
  • Oligonucleotide ISIS 13800 which showed essentially no inhibition of B7-1 expression in the flow cytometry assay, and ISIS Nos. 13805 and 13812 were then evaluated for their ability to inhibit cell surface expression of B7-1 at various concentrations of oligonucleotide. The results of these assays are shown in Figure 2.
  • ISIS 13812 was a superior inhibitor of B7-1 expression with an IC 50 of approximately 150 nM.
  • ISIS 13800 targeted to the 5' UTR, was essentially inactive.
  • Example 3 Modulation of hB7-2 Protein by Oligonucleotides
  • the ability of hB7-2 oligonucleotides to inhibit B7-2 expression was evaluated by measuring the cell surface expression of B7-2 in transfected COS-7 cells by flow cytometry.
  • COS-7 cells were transfected with the plasmids pbcB7-2 or BBG-58, a human IC7AM-1 (CD54) expression vector (R&D Systems, Minneapolis, MN) introduced into cells by standard calcium phosphate transfection, (2) the oligonucleotides used were those described in Table 2, and (3) a conjugated anti-B7-2 antibody (i.e., anti-hCD86- FITC or anti-CD86-PE, PharMingen, San Diego, CA; PE: phycoerythrin) was used during flow cytometry.
  • a conjugated anti-B7-2 antibody i.e., anti-hCD86- FITC or anti-CD86-PE, PharMingen, San Diego, CA; PE: phycoerythrin
  • oligonucleotides exhibited inhibitory activity of 50% or better and are therefore highly preferred. These oligonucleotides are targeted to the 3' untranslated region (ISIS 9133), the translation initiation codon region (ISIS 9139) and the 5' untranslated region (ISIS 10373) . At the same concentration, ISIS 10715, ISIS 10716 and ISIS 10721, which are scrambled controls for ISIS 9133, ISIS 9139 and ISIS 10373, respectively, showed no inhibitory activity. Treatment with ISIS 10367 and ISIS 10369 resulted in greater than 25% inhibition, and these oligonucleotides are thus also preferred. These oligonucleotides are targeted to the 5' (ISIS 10367) and 3' (ISIS 10369) untranslated regions .
  • Example 4 Modulation of hB7-2 mRNA by Oligonucleotides Methods : For ribonuclease protection assays, cells were harvested 18 hours after completion of oligonucleotide treatment using a Totally RNATM kit (Ambion, Austin, TX) . The probes for the assay were generated from plasmids pcB7- 2 (linearized by digestion with Bgl II) and pTRI-b-actin (Ambion Inc., Austin, TX) .
  • RNA sequencing of the linearized plasmid from the SP6 promoter was performed in the presence of a- 32 P-UTP (800 Ci/mmole) yielding an antisense RNA complementary to the ' 3 ' end of B7-2 (position 1044-1391) .
  • the probe was gel-purified after treatment with DNase I to remove DNA template. Ribonuclease protection assays were carried out using an RPA IITM kit (Ambion) according to the manufacturer's directions. Total RNA (5 ⁇ g) was hybridized overnight, at 42°C, with 10 5 cpm of the B7-2 probe or a control beta-actin probe.
  • the hybridization reaction was then treated, at 37°C for 30 minutes, with 0.4 units of RNase A and 2 units of RNase TI .
  • Protected RNA was precipitated, resuspended in 10 ⁇ L of gel loading buffer and electrophoresed on a 6% acrylamide gel with 50% w/v urea at 20 W.
  • the gel was then exposed and the lanes quantitated using a Phosphorlmager (Molecular Dynamics, Sunnyvale, CA) essentially according to the manufacturer's instructions.
  • Example 5 Additional hB7-l and hB7-2 Oligonucleotides Oligonucleotides having structures and/or sequences that were modified relative to the oligonucleotides identified during the initial screening were prepared. These oligonucleotides were evaluated for their ability to modulate human B7-2 expression using the methods described in the previous examples.
  • ISIS 10996 an oligonucleotide having a 15 nucleotide sequence derived from the 20 nucleotide sequence of ISIS 10373, was also prepared and evaluated. ISIS 10996 comprises 15 nucleotides, 5 ' -GCG-AGC-TCC-CCG-TAC (SEQ ID NO: 90) contained within the sequence of ISIS 10373.
  • ISIS 10373 and 10996 overlap a potential stem-loop structure located within the B7-2 message comprising bases 1-67 of the sequence of hB7-2 presented by Azuma et al . ⁇ Nature, 1993, 366, 76) . While not intending to be bound by any particular theory regarding their mode(s) of action, ISIS 10373 and ISIS 10996 have the potential to bind as loop 1 pseudo-half-knots at a secondary structure within the target RNA.
  • the 15-mer ISIS 10996 is as (or more) active in the B7-2 protein expression assay than the 20-mer from which it is derived ( Figure 4; ISIS 10721 is a scrambled control for ISIS 10373) .
  • a related 16-mer, ISIS 10889 was also active in the B7-2 protein expression assay.
  • a structurally related 14-mer ISIS 10995
  • 13-mer ISIS 10994
  • 12-mer ISIS 10993
  • 11-mer ISIS 10992
  • 10-mer ISIS 10991
  • ISIS 10996 derivatives having 2' methoxethoxy substitutions were prepared, including a fully substituted derivative (ISIS 11539) , Agapmers® (ISIS 11541 and 11543) and Awingmers® (ISIS 11545 and 11547) .
  • the 2' -MOE substitution prevents the action of some nucleases (e.g., RNase H) but enhances the affinity of the modified oligonucleotide for its target RNA molecule.
  • RNase H some nucleases
  • These oligonucleotides are tested for their ability to modulate hB7-2 message or function according to the methods of Examples 3, 4, 7 and 8.
  • ISIS 10996 derivatives were prepared in order to be evaluated for their ability to recruit RNase L to a target RNA molecule, e.g., hB7-2 message.
  • RNase L binds to, and is activated by, (2 '-5') (A) n , which is in turn produced from ATP by (2 '-5') (A) n synthetase upon activation b , e. . interferon.
  • RNase L has been implicated in antiviral mechanisms and in the regulation of cell growth as well (Sawai, Chemica Scripta, 1986, 21, 169; Charachon et al . , Biochemistry, 1990, 29, 2550).
  • the combination of anti-B7 oligonucleotides conjugated to (2 ' -5 ' ) (A) n is expected to result in the activation of RNase L and its targeting to the B7 message complementary to the oligonucleotide sequence.
  • the following oligonucleotides have identical sequences (i.e., that of ISIS 10996) and identical (2 '-5') (A) 4 Acaps® on their 5' termini: ISIS 12492, 12495, 12496 and 13107.
  • the adenosyl residues have 3 ' hydroxyl groups and are linked to each other by phosphorothioate linkages.
  • the (3 '-5') portion of the oligonucleotide which has a sequence complementary to a portion of the human B7-2 RNA, is conjugated to the (2 1 - 5') (A) 4 Acap® via a phosphorothioate linkage from the 5' residue of the (3 '-5') portion of the oligonucleotide to an rz-aminohexyl linker which is bonded to the Acap® via anotherphosphorothioate linkage.
  • 2 1 - 5') (A) 4 Acap® via a phosphorothioate linkage from the 5' residue of the (3 '-5') portion of the oligonucleotide to an rz-aminohexyl linker which is bonded to the Acap® via anotherphosphorothioate linkage.
  • ISIS 12496 consists of unmodified oligonucleotides in the_ (3 '-5') portion of the oligonucleotide.
  • phosphorothioate linkages replace the phosphate linkages found in naturally occurring nucleic acids.
  • Phosphorothioate linkages are also employed in ISIS 12492 and 12495, which additionally have 2 ' -MOE substitutions. These oligonucleotides are tested for their ability to modulate hB7-2 message or function according to the methods of Examples 3 , , 7 and 8. Derivatives of ISIS 10996 having modifications at the 2' position were prepared and evaluated.
  • the modified oligonucleotides included ISIS 11539 (fully 2 ' -O-methyl) , ISIS 11541 (having 2 ' -O-methyl Awings® and a central 7-base Agap@) , ISIS 11543 (2 '-O-methyl wings with a 9-base gap), ISIS 11545 (having a 5' 2 ' -O-methyl wing) and ISIS 11547 (having a 3' 2 '-O-methyl wing).
  • the results of assays of 2 ' -O-methyl oligonucleotides were as follows. ISIS 11539, the fully 2 'O-methyl version of ISIS 10996, was not active at all in the protein expression assay.
  • the gapped and winged oligonucleotides (ISIS 11541, 11543, 11545 and 11547) each showed some activity at 200 nM (i.e., from 60 to 70% expression relative to untreated cells) , but less than that demonstrated by the parent compound, ISIS 10996 (i.e., about 50% expression) . Similar results were seen in RNA expression assays.
  • ISIS 10782 a derivative of ISIS 10373 to which cholesterol has been conjugated via a 5' n-aminohexyl linker, was prepared.
  • Lipophilic moieties such as cholesterol have 'been reported to enhance the uptake by cells of oligonucleotides in some instances, although the extent to which uptake is enhanced, if any, remains unpredictable.
  • ISIS 10782, and other oligonucleotides comprising lipophilic moieties are tested for their ability to modulate B7-2 message or function according to the methods of Examples 3 , ' 4 , 7 and 8.
  • ISIS 12362 (ISIS Nos. 12349 and 12474), ISIS 12363 (ISIS Nos. 12350 and 12475), ISIS 12364 (ISIS Nos. 12351 and 12476), ISIS 12365 (ISIS Nos. 12352 and 12477), ISIS 12366 (ISIS Nos. 12353 and 12478), ISIS 12367 (ISIS Nos. 12354 and 12479), ISIS 12368 (ISIS Nos. 12355 and 12480), ISIS 12369 (ISIS Nos. 12356 and 12481) and ISIS 12370 (ISIS Nos. 12357 and 12482) were prepared.
  • the central, non-2 ' -modified portions (Agaps®) of these derivatives support RNase H activity when the oligonucleotide is bound to its target RNA, even though the 2 ' -modified portions do not.
  • the 2 ' -modified Awings® of these oligonucleotides enhance their affinity to their target RNA molecules (Cook, Chapter 9 In : Antisense Research and Applications, Crooke et al . , eds., CRC Press, Boca Raton, 1993, pp. 171-172).
  • Another 2 ' modification is the introduction of a methoxy (MO) group at this position.
  • ISIS 12914 and 12915 comprise sequences complementary to the 5 ' untranslated region of alternative hB7 -1 mRNA molecules, which arise from alternative splicing events of the primary hB7-l transcript.
  • oligonucleotides include 2' methoxy modifications, and the enhanced target affinity resulting therefrom may allow for greater activity against alternatively spliced B7-1 mRNA molecules which may be present in low abundance in some tissues (Inobe et al . , J. Immun . , 1996, 157, 582).
  • ISIS 13498 and 13499 which comprise antisense sequences to other alternative hB7-l mRNAs, include 2 ' -MOE modifications in order to enhance their affinity for their target molecules, and 2 ' -MOE or 2 'methoxy substitutions are incorporated into the hB7-2 oligonucleotides ISIS 12912, 12913, 13496 and 13497.
  • oligonucleotides are tested for their ability to modulate hB7-l essentially according to the methods of Example 2 or hB7-2 according to the methods of Examples 3, 4, 7 and 8, with the exception that, when necessary, the target cells are transfected with a cDNA clone corresponding to the appropriate alternatively spliced B7 transcript.
  • Example 6 Specificity of Antisense Modulation Several oligonucleotides of the invention were evaluated in a cell surface expression flow cytometry assay to determine the specificity of the oligonucleotides for B7-1 as contrasted with activity against B7-2.
  • the oligonucleotides tested in this assay included ISIS 13812, an inhibitor of B7-1 expression (Figure 1; Example 2) and ISIS 10373, an inhibitor of B7-2 expression ( Figure 3; Example 3) .
  • the results of this assay are shown in Figure 5.
  • ISIS 13812 inhibits B7-1 expression with little or no effect on B7-2 expression.
  • ISIS 10373 inhibits B7-2 expression with little or no effect on B7-1 expression.
  • ISIS 13872 (SEQ ID NO: 37, AGT- CCT-ACT-ACC-AGC-CGC-CT) , a scrambled control of ISIS 13812, and ISIS 13809 (SEQ ID NO: 51) were included in these assays and demonstrated essentially no activity against either B7-1 or B7-2.
  • Example 7 Modulation of hB7-2 Expression by Oligonucleotides in Antigen Presenting Cells The ability of ISIS 10373 to inhibit expression from the native B7-2 gene in antigen presenting cells (APCs) was evaluated as follows.
  • Monocytes were cultured and treated with oligonucleotides as follows. For dendritic cells, EDTA- treated blood was layered onto PolymorphprepTM (1.113 g/mL; Nycomed, Oslo, Norway) and sedimented at 500x g for 30 minutes at 20°C. Mononuclear cells were harvested from the interface. Cells were washed with PBS, with serum-free RPMI media (Moore et al . , N. Y. J. Med. , 1968, 68, 2054) and then with RPMI containing 5%, fetal bovine serum (FBS) . Monocytes were selected by adherence to plastic cell culture cell culture dishes for 1 h at 37°C.
  • PolymorphprepTM (1.113 g/mL; Nycomed, Oslo, Norway
  • Mononuclear cells were harvested from the interface. Cells were washed with PBS, with serum-free RPMI media (Moore et al . , N.
  • IL-4 interleukin-4
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • Monoclonal antibodies not described in the previous Examples included anti-hCD3 (Ancell, Bayport, MN) and anti- HLA-DR (Becton Dickinson, San Jose, CA) .
  • ISIS 10373 has a significant inhibitory effect on B7-2 expression with an IC 50 of approximately 250 nM. ISIS 10373 had only a slight effect on ICAM-1 expression even at a dose of 1 ⁇ M. ISIS 2302 (SEQ ID NO: 17) , a control oligonucleotide which has been shown to inhibit ICAM-1 expression, had no effect on B7-2 expression, but significantly decreased ICAM-1 levels with an IC 50 of approximately 250 nM. Under similar conditions, ISIS 10373 did not affect the cell surface expression of B7-1, HLA-DR or CD3 as measured by flow cytometry.
  • Example 8 Modulation of T Cell Proliferation by Oligonucleotides The ability of ISIS 2302 and ISIS 10373 to inhibit T cell proliferation was evaluated as follows. Monocytes treated with oligonucleotide and cytokines (as in Example 6) were used as antigen presenting cells in a T cell proliferation assay. The differentiated monocytes were combined with CD4+ T cells from a separate donor. After 48 hours, proliferation was measured by [ 3 H] thymidine incorporation.
  • T cell proliferation assays cells were isolated from EDTA-treated whole blood as described above, except that a faster migrating band containing the lymphocytes was harvested from just below the interface. Cells were washed as described in Example 6 after which erythrocytes were removed by NH 4 C1 lysis. T cells were purified using a T cell enrichment column (R&D Systems, Minneapolis, MN) essentially according to the manufacturer's directions. CD4+ T cells were further enriched from the entire T cell population by depletion of CD8+ cells with anti-CD8-conjugated magnetic beads (AMAC, Inc., Westbrook, ME) according to the manufacturer's directions.
  • AMAC anti-CD8-conjugated magnetic beads
  • T cells were determined to be >80% CD4+ by flow cytometry using Cy-chrome-conjugated anti-CD4 mAb (PharMingen, San Diego, CA) .
  • Antigen presenting cells APCs
  • APCs Antigen presenting cells
  • APCs (10 5 cells) were then combined with 4 x 10 4 CD4+ T cells in 350 ⁇ L of culture media.
  • purified CD3 mAb was also added at a concentration of 1 ⁇ g/mL.
  • proliferation was measured by determining uptake of 1.5 uCi of [ 3 H] -thymidine per well.
  • the control oligonucleotide (ISIS 10721) had an insignificant effect on T cell proliferation.
  • a combination treatment with both the anti-ICAM-1 (ISIS 2302) and anti-B7-2 (ISIS 10373) oligonucleotides resulted in a further decrease in T cell response.
  • Example 9 Modulation of Murine B7 Genes by Oligonucleotides
  • Oligonucleotides capable of inhibiting expression of murine B7-2 transiently expressed in COS-7 cells were identified in the following manner.
  • a series of phosphorothioate oligonucleotides complementary to murine B7-2 (mB7-2) cDNA were screened for their ability to reduce mB7-2 levels (measured by flow cytometry as in Example 2, except that a conjugated anti-mB7-2 antibody (i.e., anti-mCD86-PE, PharMingen, San Diego, CA) in COS-7 cells transfected with an mB7-2 cDNA clone.
  • a conjugated anti-mB7-2 antibody i.e., anti-mCD86-PE, PharMingen, San Diego, CA
  • Anti-mB7-2 antibody may also be obtained from the hybridoma deposited at the ATCC under accession No. HB-253. Oligonucleotides (see Table 2) capable of modulating murine B7-1 expression are isolated in like fashion, except that a conjugated anti-mB7-l antibody is used in conjunction with COS-7 cells transfected with an mB7-l cDNA clone.
  • the most active oligonucleotide identified was ISIS 11696 (GGA-TTG-CCA-AGC-CCA-TGG-TG, SEQ ID NO: 18), which is complementary to position 96-115 of the cDNA, a site which includes the translation initiation (AUG) codon.
  • Figure 8 shows a dose-response curve for ISIS 11696 and a scrambled control, ISIS 11866 (CTA-AGT-AGT-GCT- AGC-CGG-GA, SEQ ID NO: 19) .
  • ISIS 11696 inhibited cell surface expression of B7-2 in COS-7 cells with an IC 50 in the range of 200-300 nM, while ISIS 11866 exhibited less than 20% inhibition at the highest concentration tested (1000 nM) .
  • the IC-21 cell line was used.
  • IC-21 monocyte/macrophage cell line expresses both B7-1 and murine B7-2 (mB7-2) constitutively.
  • a 2-fold induction of expression can be achieved by incubating the cells in the presence of lipopolysaccharide (LPS; GIBCO-BRL, Gaithersburg, MD) (Hathcock et al . , Science, 1993, 262, 905) .
  • LPS lipopolysaccharide
  • IC-21 cells ATCC; accession No. TIB 186) were seeded at 80% confluency in 12-well plates in DMEM media with 10% FCS. The cells were allowed to adhere to the plate overnight. The following day, the medium was removed and the cells were washed with PBS.
  • OptiMEMTM Gibco-BRL, Gaithersburg, MD
  • LipofectinTM GIBCO-BRL, Gaithersburg, MD
  • Oligonucleotides were then added directly to the medium at the indicated concentrations. After incubation for 4 hours, the cells were washed with PBS and incubated overnight in culture medium supplemented with 15 ⁇ g/mL of LPS . The following day, cells were harvested by scraping, then analyzed for cell surface expression by flow cytometry. ISIS 11696 and ISIS 11866 were administered to IC-21 cells in the presence of LipofectinTM (GIBCO-BRL,
  • Antisense oligonucleotides used included ISIS 11696, ISIS 3082 (targeted to ICAM-1) and ISIS 1082 (a control oligonucleotide targeted to the herpes virus UL-13 gene sequence) . Dosages used were 1, 2, 2.5, 5 or 10 mg/kg of individual oligonucleotide (as indicated below) ; when combinations of oligonucleotides were administered, each oligonucleotide was given at a dosage of 1, 5 or 10 mg/kg (total oligonucleotide dosages of 2 , 10 and 20 mg/kg, respectively) . The survival times of the transplanted hearts and their hosts were monitored and recorded.
  • mice The mean survival time for untreated mice was 8.2 + 0.8 days (7,8,8,8,9,9 days). Treatment of the mice for 7 days with ISIS 1082 (SEQ ID NO: 125, unrelated control oligonucleotide) slightly reduced the mean survival times to 7.1 + 0.7 days (5 mg/kg/day; 6,7,7,7,8,8) or 7.0 +_ 0.8 days(10 mg/kg/day; 6,7,7,8).
  • mice for seven days with the murine B7-2 oligonucleotide ISIS 11696 (SEQ ID NO: 108) increased the mean survival time to 9.3 days at two doses (2 mg/kg/day, 9.3 +_ 0.6 days, 9,9,10; 10 mg/kg/day, 9.3 +_ 1.3 days, 8,9,9,11).
  • Treatment of mice for seven days with an ICAM-1 oligonucleotide, ISIS 3082 also increased the mean survival of the mice over several doses .
  • the mean survival time was 11.0 +_ 0.0 (11,11,11); at 2.5 mg/kg/day, the MSD was 12.0 +_ 2.7 (10,12,13,16); at 5 mg/kg/day, the MSD was 14.1 + 2.7 (10,12,12,13,16,16,17,17); and, at 10 mg/kg/day, the MSD was 15.3 +_ 5.8 (12,12,13,24).
  • Example 11 Detection of Nucleic Acids Encoding B7 Proteins Oligonucleotides are radiolabeled after synthesis by 32 P-labeling at the 5' end with polynucleotide kinase. Sambrook et al . , "Molecular Cloning. A Laboratory Manual," Cold Spring Harbor Laboratory Press, 1989, Volume 2, pg. 11.31. Radiolabeled oligonucleotide capable of hybridizing to a nucleic acid encoding a B7 protein is contacted with a tissue or cell sample suspected of B7 protein expression under conditions in which specific hybridization can occur, and the sample is washed to remove unbound oligonucleotide.
  • Radiolabeled oligonucleotide is contacted with a normal tissue* or cell sample under conditions that allow specific hybridization, and the sample is washed to remove unbound oligonucleotide. Radioactivity remaining in the samples indicates bound oligonucleotide and is quantitated using a scintillation counter or other routine means. A greater amount of radioactivity remaining in the samples, as compared to control tissues or cells, indicates increased expression of a B7 gene, whereas a lesser amount of radioactivity in the samples relative to the controls indicates decreased expression of a B7 gene. Radiolabeled oligonucleotides of the invention are also useful in autoradiography.
  • a section of tissues suspected of expressing a B7 gene is treated with radiolabeled oligonucleotide and washed as described above, then exposed to photographic emulsion according to standard autoradiography procedures .
  • a control of a normal tissue section is also maintained.
  • the emulsion when developed, yields an image of silver grains over the regions expressing a B7 gene, which is quantitated.
  • the extent of B7 expression is determined by comparison of the silver grains observed with control and test samples.
  • Analogous assays for fluorescent detection of expression of a B7 gene use oligonucleotides of the invention which are labeled with fluorescein or other fluorescent tags.
  • Labeled oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems, Foster City, CA) using standard phosphoramidite chemistry.
  • b- CyanoethyIdiisopropyl phosphoramidites are purchased from Applied Biosystems (Foster City, CA) .
  • Fluorescein-labeled amidites are purchased from Glen Research (Sterling, VA) .
  • Incubation of oligonucleotide and biological sample is carried out as described above for radiolabeled oligonucleotides except that, instead of a scintillation counter, a fluorescence microscope is used to detect the fluorescence.
  • Example 12 Chimeric (deoxy gapped) Human B7-1 Antisense Oligonucleotides Additional oligonucleotides targeting human B7-1 were synthesized. Oligonucleotides were synthesized as uniformly phosphorothioate chimeric oligonucleotides having regions of five 2 ' -MOE nucleotides at the wings and a central region of ten deoxynucleotides . Oligonucleotide sequences are shown in Table 6. Oligonucleotides were screened as described in Example 4. Results are shown in Table 7. Oligonucleotides 22315 (SEQ ID NO: 128) , 22316
  • SEQ ID NO: 26 resultsed in 50% or greater inhibition of B7-1 mRNA in this assay.
  • Oligonucleotides t Additional oligonucleotides targeting mouse B7-1 were synthesized. Oligonucleotides were synthesized as uniformly phosphorothioate chimeric oligonucleotides having regions of five 2 ' -MOE nucleotides at the wings and a central region of ten deoxynucleotides . Oligonucleotide sequences are shown in Table 9. Oligonucleotides were screened as described in Example 4. Results are shown in Table 10.
  • Oligonucleotides 18105 (SEQ ID NO: 156) , 18106 (SEQ ID NO: 157), 18109 (SEQ ID NO: 160), 18110 (SEQ ID NO: 161), 18111 (SEQ ID NO: 162) , 18112 (SEQ ID NO: 163) , 18113 (SEQ ID NO: 164), 18114 (SEQ ID NO: 165), 18115 (SEQ ID NO: 166), 18117 (SEQ ID NO: 168) , 18118 (SEQ ID NO: 169) , 18119 (SEQ ID NO: 170), 18120 (SEQ ID NO: 171), 18122 (SEQ ID NO: 173), and 18123 (SEQ ID NO: 174) resulted in greater than approximately 50% inhibition of B7-1 mRNA in this assay. TABLE 9 Nucleotide Sequences of Mouse B7-1 Chimeric (deoxy gapped) Oligodeoxynucleotides
  • Emboldened residues are 2 ' -MOE residues (others are 2 deoxy) .
  • All 2 ' -MOE cytosines and 2 ' -deoxy cytosines residues are 5-methyl-cytosines; all linkages are phosphorothioate linkages.
  • Example 14 Chimeric (deoxy gapped) Human B7-2 Antisense Oligonucleotides Additional oligonucleotides targeting human B7-2 were synthesized. Oligonucleotides were synthesized as uniformly phosphorothioate chimeric oligonucleotides having regions of five 2 ' -MOE nucleotides at the wings and a central region of ten deoxynucleotides . Oligonucleotide sequences are shown in Table 11. Oligonucleotides were screened as described in Example 4. Results are shown in Table 12.
  • Oligonucleotides 22284 (SEQ ID NO: 16), 22286 (SEQ ID NO: 176), 22287 (SEQ ID NO: 177), 22288 (SEQ ID NO: 178), 22289 (SEQ ID NO: 179), 22290 (SEQ ID NO: 180), 22291 (SEQ ID NO: 181), 22292 (SEQ ID NO: 182), 22293 (SEQ ID NO: 183), 22294 (SEQ ID NO: 184), 22296 (SEQ ID NO: 186), 22299 (SEQ ID NO: 189), 22300 (SEQ ID NO: 190), 22301 (SEQ ID NO: 191), 22302 (SEQ ID NO: 192), 22303 (SEQ ID NO: 193), 22304 (SEQ ID' O: 194), 22306 (SEQ ID NO: 196), 22307 (SEQ ID NO: 197), 2*2308 (SEQ ID NO: 198), 22309 (SEQ ID NO: 199),
  • Example 15 Chimeric (deoxy gapped) Mouse B7-2 Antisense Oligonucleotides Additional oligonucleotides targeting mouse B7-2 were synthesized. Oligonucleotides were synthesized as uniformly phosphorothioate chimeric oligonucleotides having regions of five 2 ' -MOE nucleotides at the wings and a central region of ten deoxynucleotides . Oligonucleotide sequences are * shown in Table 14. Oligonucleotides were screened as described in
  • Example 16 Effect of B7 Antisense Oligonucleotides on Cell Surface Expression
  • B7 antisense oligonucleotides were tested for their effect on cell surface expression of both B7-1 and .
  • B7-2 Cell surface expression was measured as described in Example 2. Experiments were done for both human B7 and mouse B7. Results for human B7 are shown in Table 16. Results for mouse B7 are shown in Table 17. In both species, B7-1 antisense oligonucleotides were able to specifically reduce the cell surface expression of B7-1.
  • B7-2 antisense oligonucleotides were specific for the B7-2 family member. These oligonucleotides were also specific for their effect on B7- 1 and B7-2 mRNA levels. TABLE 16 Inhibition of Human B7 Cell Surface Expression by Chimeric (deoxy gapped) Phosphorothioate Oligodeoxynucleotides
  • EXAMPLE 17 Effect of B7-1 Antisense Oligonucleotides in a Murine Model for Rheumatoid Arthritis Collagen-induced arthritis (CIA) was used as a murine model for arthritis (Mussener,A. , et al . , Clin. Exp. Immunol., 1997, 107, 485-493).
  • Female DBA/lLacJ mice Jackson Laboratories, Bar Harbor, ME between the ages of 6 and 8 weeks were used to assess the activity of B7-1 antisense oligonucleotides .
  • mice On day 0, the mice were immunized at the base of the tail with 100 ⁇ g of bovine type II collagen which is emulsified in Complete Freund's Adjuvant (CFA) . On day 7, a second booster dose of collagen was administered by the same route. On day 14, the mice were injected subcutaneously with 100 ⁇ g of LPS . Oligonucleotide was administered intraperitoneally daily (10 mg/kg bolus) starting on day -3 (three days before day 0) and continuing for the duration of the study. Oligonucleotide 17456 (SEQ ID NO. 173) is a fully phosphorothioated analog of 18122. Weights were recorded weekly. Mice were inspected daily for the onset of CIA.
  • CFA Complete Freund's Adjuvant
  • Paw widths are rear ankle widths of affected and unaffected joints were measured three times a week using a constant tension caliper. Limbs, were clinically evaluated and graded on a scale from 0-4 (with 4 being the highest) . Results are shown in Table 20. Treatment with B7-1 and B7-2 antisense oligonucleotides was able to reduce the incidence of the disease, but had modest effects on severity. The combination of 17456 (SEQ ID NO. 173) and 11696 (SEQ ID NO. 108) was able to significantly reduce the incidence of the disease and its severity.
  • Peak day is the day from onset of maximum swelling for each joint measure.
  • Severity is the total clinical score divided by the total number of mice in the group .
  • EXAMPLE 18 Effect of B7-1 Antisense Oligonucleotides in a Murine Model for Multiple Sclerosis
  • Experimental autoimmune encephalomyelitis is a commonly accepted murine model for multiple sclerosis (Myers, K.J., et al . , J. Neuroimmunol . , 1992, 41 , 1-8).
  • SJL/H, PL/J, (SJLxPL/J)Fl, (SJLxBalb/c)Fl and Balb/c female mice between the ages of 6 and 12 weeks are used to test the activity of a B7-1 antisense oligonucleotide.
  • mice are immunized in the two rear foot pads and base of the tail with an emulsion consisting of encephalitogenic protein or peptide (according to Myers, K. J. , et al., J. of Immunol., 1993, 151 , 2252-2260) in Complete Freund's Adjuvant supplemented with heat killed Mycobacterium tuberculosis. Two days later, the mice receive an intravenous injection of 500 ng Bordetella pertussis toxin and additional adjuvant . Alternatively, the disease may also be induced by the adoptive transfer of T-cells.
  • T-cells are obtained from the draining of the ' lymph nodes of mice immunized with encephalitogenic protein, or peptide in CFA.
  • the T cells are grown in tissue culture for several days and then injected intravenously into naive syngeneic recipients . Mice are monitored and scored daily on a 0-5 scale for signals of the disease, including loss of tail muscle tone, wobbly gait, and various degrees of paralysis.
  • Oligonucleotide 17456 SEQ ID NO. 173
  • a fully phosphorothioated analog of 18122 was compared to a saline control and a fully phosphorothioated oligonucleotide of random sequence (Oligonucleotide 17460) .
  • Oligonucleotides were synthesized as uniformly phosphorothioate chimeric oligonucleotides having regions of five 2 ' -MOE nucleotides at the wings and a central region of ten deoxynucleotides . All cytidines shown in Table 21 are 5 -methyl cytidines. Oligonucleotide sequences are shown in Table 21.
  • the human promonocytic leukaemia cell line, THP-1 American Type Culture Collection, Manassas, VA
  • FCS fetal calf serum
  • a total of 1 x 10 7 cells were electroporated at an oligonucleotide concentration of 10 micromolar in 2 mm cuvettes, using an Electrocell Manipulator 600 instrument (Biotechnologies and Experimental Research, Inc.) employing 200 N, 1000 ⁇ F. Electroporated cells were then transferred to petri dishes and allowed to recover for 16 hrs . Cells were then induced with LPS at a final concentration of 1 ⁇ g/ml for 16 hours. R ⁇ A was isolated and processed as described in previous examples . Results are shown in Table 22.
  • Oligonucleotides 113492, 113495, 113498, 113499, 113501, 113502, 113504, 113505, 113507, 113510, 113511, 113513 and 113514 resulted in 50% or greater inhibition of B7-1 mRNA expression in this assay.
  • SEQ ID NO: 228, 231, 234, 235, 237, 238, 240, 241, 243, 246, 247, 249 and 250 resulted in 50% or greater inhibition of B7-1 mRNA expression in this assay.
  • EXAMPLE 20 Additional antisense oligonucleotides targeted to human B7-2 Additional oligonucleotides targeting human B7-2 were synthesized. Oligonucleotides were synthesized as uniformly phosphorothioate chimeric oligonucleotides having regions of five 2 ' -MOE nucleotides at the wings and a central region of ten deoxynucleotides . All cytidnes shown in Table 23 are 5-methyl cytidines. Oligonucleotide sequences are shown in Table 23.
  • the human promonocytic leukaemia cell line, THP-1 (American Type Culture Collection, Manassas, VA) was maintained in RPMI 1640 growth media supplemented with 10% fetal calf serum (FCS; Life Technologies, Rockville, MD) .
  • FCS fetal calf serum
  • a total of 1 x 10 7 cells were electroporated at an oligonucleotide concentration of 10 micromolar in 2 mm cuvettes, using an Electrocell Manipulator 600 instrument (Biotechnologies and Experimental Research, Inc.) employing 200 V, 1000 ⁇ F. Electroporated cells were then transferred to petri dishes and allowed to recover for 16 hrs Cells were then induced with LPS and dibutyryl cAMP (500 ⁇ M) for 16 hours.
  • RNA was isolated and processed as described in previous examples. Results are shown in Table 24. Oligonucleotides ISIS 113131, 113132, 113134, 113138, 113142, 113144, 113145, 113146, 113147, 113148, 113149, 113150, 113153, 113155, 113157, 113158, 113159 and 113160 (SEQ ID NO: 255, 256, 258, 262, 266, 268, 269, 270, 271, 272 273, 274, 277, 279, 281, 282, 283 and 284) resulted in 50% or greater inhibition of B7-2 mRNA expression in this assay. TABLE 23: Nucleotide Sequences of Human B7-2 Chimeric (deoxy gapped) Oligodeoxynucleotides
  • oigonucleotides co-ordinates are from Genbank Accession NO.U04343, locus name "HSU04343".
  • EXAMPLE 21 Human skin psoriasis model Animal models of psoriasis based on xenotransplantation of human skin from psoriatic patients are advantageous because they involve the direct study of affected human tissue. Psoriasis is solely a disease of the skin and consequently, engraftment of human psoriatic skin onto SCID mice allows psoriasis to be created with a high degree of fidelity in mice.
  • BALB/cByJSmn-Prkdcscid/J SCID mice (4-6 weeks old) ** of either sex (Jackson Laboratory, Bar Harbor, ME) were maintained in a pathogen free environment.
  • mice were anesthetized by • intraperitoneal injection of 30 mg/kg body weight ketamine-HCl and 1 mg/kg body weight acepromazine .
  • mice were prepared for transplantation by shaving the hair from the dorsal skin, 2 "cm away from the head. The area was then sterilized and cleaned with povidone iodide and alcohol . Graft beds of about 1 cm x 1 cm were created on the shaved areas by removing full thickness skin down to the fascia. Partial thickness human skin was then orthotopically transferred onto the graft bed.
  • transplants were held in place by gluing the human skin to mouse-to-mouse skin with Nexband liquid, a veterinary bandage (Veterinary Products Laboratories, Phoenix, AZ) . Finally, the transplant and the wounds were covered with a thick layer of antibiotic ointment. After 4 weeks of transplantation, a 2 mm punch biopsy was obtained to confirm the acceptance of the graft and the origin of the skin in the transplant area. Only mice whose grafts did not show signs of infection were used for the study. Normal human skin was obtained from elective plastic surgeries and psoriatic plaques were obtained from shave biopsies from psoriatic volunteers.
  • a cream formulation comprising 10% isopropyl myristate, 10% glyceryl monooleate, 3% cetostearyl alcohol, 10% polyoxyl-20-cetyl ether, 6% poloxamer 407, 2.5% phenoxyethanol , 0.5% methylparaben, 0.5% propylparaben and water (final pH about 7.5) .
  • Biopsies were fixed in formalin for paraffin embedding and/or transferred to cryotubes and snap- frozen in liquid nitrogen and stored at -80°C.
  • Significant histological improvement marked by reduction of hyperkeratosis, acanthosis and lymphonuclear cellular infiltrates was observed in mice treated with the antisense oligonucleotides.
  • Rete pegs, finger-like projections of the epidermis into the dermis were also measured. These are phenotypic markers for psoriasis which lengthen as the disease progresses .
  • EXAMPLE 22 Mouse model of allergic inflammation In the mouse model of allergic inflammation, mice were sensitized and challenged with aerosolized chicken ovalbumin (OVA) . Airway responsiveness was assessed by inducing airflow obstruction with a methacholine aerosol using a noninvasive method. This methodology utilized unrestrained conscious mice that are placed into the main chamber of a plthysmograph (Buxco Electronics, Inc., Troy, NY). Pressure differences between this chamber and a reference chamber were_ used to extrapolate minute volume, breathing frequency and enhanced pause (Penh) . Penh is a dimensionless parameter that is a function of total pulmonary airflow in mice (i.e., the sum of the airflow in the upper and lower respiratory tracts) during the respiratory cycle of the animal .
  • OVA aerosolized chicken ovalbumin
  • PENH the lower the PENH, the greater the airflow. This parameter closely correlates with lung resistance as measured by traditional invasive techniques using ventilated animals (Hamelmann et al., Proc . Natl . Acad. Sci . U. S .A . 94:1350-1355, 1997). Dose- response data were plotted as raw Penh values to increasing concentrations of methacholine. This system was used to test the efficacy of antisense oligonucleotides targeted to human B7-1 and B7-2. There are several important features common to human asthma and the mouse model of allergic inflammation. One of these is pulmonary inflammation, in which cytokine expression and Th2 profile is dominant. Another is goblet cell hyperplasia with increased mucus production.
  • AHR airway hyperresponsiveness
  • cholinergic receptor agonists such as acetylcholine or methacholine.
  • the compositions and methods of the present invention may be used to treat AHR and pulmonary inflammation.
  • mice Female Balb/c mice (Charles Rivers Laboratory, Taconic Farms, NY) were maintained in micro-isolator cages housed in a specific pathogen-free (SPF) facility. The sentinel cages within the animal colony surveyed negative for viral antibodies and the presence of known mouse pathogens. Mice were sensitized and challenged with aerosolized chicken OVA. Briefly, 20 ⁇ g alum-precipitated OVA was injected intraperitoneally on days 0 and 14. On day 24, 25 and 26, the animals were exposed for 20 minutes to 1.0% OVA (in saline) J5y nebulization.
  • SPPF pathogen-free
  • the challenge was conducted using an ultrasonic nebulizer (PulmoSonic, The DeVilbiss Co., Somerset, PA). Animals were analyzed about 24 hours following the last nebulization using the Buxco electronics Biosystem. Lung function (Penh) , lung histology (cell infiltration and mucus production) , target mRNA reduction in the lung, inflammation (BAL cell type & number, cytokine levels) , spleen weight and serum AST/ALT were determined.
  • the anti-B7.2 mAb had no activity when administered after the OVA challenge.
  • the anti-B7.1 monoclonal antibody had no effect, either prophylactically or post-antigen challenge.
  • an effective B7 inhibitor which can be administered after antigen challenge, and which will reduce airway hyperresponsiveness and pulmonary inflammation.
  • the antisense oligonucleotides of the present inventors fit this description.
  • ASOs Antisense oligonucleotides
  • mice were dissolved in saline and used to intratracheally dose mice every day, four times per day, from days 15-26 of the OVA sensitization and challenge protocol .
  • the mice were anesthetized with isofluorane and placed on a board with the front teeth hung from a line. The nose was covered and the animal's tongue was extended wrth forceps and 25 ⁇ l of various doses of ASO v or an equivalent volume of saline (control) was placed at the back of the tongue until inhaled into the lung.
  • the deposition pattern of an ASO in the lung ISIS 13920 (5'- TCCGTCATCGCTCCTCAGGG-3' ; SEQ ID NO: 285) was also examined by immunohistochemical staining using a monoclonal antibody to the oligonucleotide, and showed that the ASO is taken up throughout the lung, most strongly by antigen presenting cells (APCs) and alveolar epithelium.
  • APCs antigen presenting cells
  • the B7 oligonucleotides used were: B7-1: 5' -GCTCAGCCTTTCCACTTCAG-3' (ISIS 121844; SEQ ID NO: 286) B7-2: 5' -GCTCAGCCTTTCCACTTCAG-3' (ISIS 121874; SEQ ID NO: 287) Both of these oligonucleotides are phosphorothioates with 2' -MOE modifications on nucleotides 1-5 and 16-20, and 2' -deoxy at positions 6-15, and all cytidines are 5-methyl cytidines. These ASOs were identified by mouse-targeted ASO screening by target mRNA reduction in mouse cell lines.
  • B7-2 19 mouse-targeted ASOs were screened by target mRNA reduction (Northern analysis) in IC-21 macrophages. Dose- response confirmation led to selection of ISIS 121874 (>70% reduction at 25 nM) .
  • B7-1 22 mouse-targeted ASOs were screened by target mRNA reduction (RT-PCR) in L-929 fibroblasts. Dose-response confirmation led to selection of ISIS 121844 (>70% reduction at 100 nM) . No cross hybridization was predicted, and no cross-target reduction was detected in transfected cells.
  • B7-2 forward: 5' -GGCCCTCCTCCTTGTGATG-3 ' (SEQ ID NO : 288) probe : 5 ' -/56-FAM/TGCTCATCATTGTATGTCACAAGAAGCCG/36- TAMTph/-3' (SEQ ID NO: 289) reverse: 5' -CTGGGCCTGCTAGGCTGAT-3 ' (SEQ ID NO: 290)
  • B7-1 forward: 5 ' -CAGGAAGCTACGGGCAAGTT-3 ' (SEQ ID NO: 291) probe: 5' -/56-FAM/TGGGCCTTTGATTGCTTGATGACTGAA/36- TAMTph/-3' (SEQ ID NO: 292) reverse: 5' -GTGGGCTCAGCCTTTCCA-3 ' (SEQ ID NO: 293)
  • BAL bronchial alveolar lavage
  • BAL cell counts and differentials Cytospins of cells recovered from BAL fluid were prepared using a Shandon Cytospin 3 (Shandon Scientific LTD, - Cheshire, England) .
  • Cell differentials were, performed from , slides stained with Leukostat (Fisher Scientific, Pittsburgh ⁇ PA) .
  • Total cell counts were quantified by hemocytometer and, together with the percent type bty differential, were used to calculate specific cell number.
  • Fig. 11A-11B B7.2 mRNA (Fig. 11A) and B7.1 mRNA (Fig. IIB) were detected in mouse lung and lymph node during the development of ovalbumin-induced asthma. Treatment with ISIS 121874 following allergen challenge reduces the airway response to methacholine (Fig. 12) .
  • the Penh value in B7.2 ASO-treated mice was about 40% lower than vehicle-treated mice, and was statistically the same as na ⁇ ve mice which were not sensitized with the allergen or treated with the ASO. This shows that B7.2 ASO-treated mice had significantly better airflow, and less inflammation, than mice which were not treated with the ASO. Treatment with a mismatch control oligonucleotide did not reduce airway hyperresponsiveness.
  • the dose-dependent inhibition of the Penh response to methacholine by ISIS 121874 is shown in Fig, 13.
  • the inhibition of allergen-induced eosinophilia by ISIS 121874 is shown in Fig. 14.
  • ISIS 121874 at 0.3 mg/kg reduced the total number of eosinophils by about 75% compared to vehicle-treated mice. Since increased numbers of eosinophils result from inflammation, this provides further support for the anti -inflammatory properties of the B7.2 ASO.
  • daily intratracheal delivery of ISIS 121874 does not induce splenomegaly, the concentration of ISIS 121874 achieved in lung tissue via daily intratracheal administration is proportional to the dose delivered (Fig. 15) and ISIS 121874 is retained in lung tissue for at least one week following single dose (0.3 mg/kg) intratracheal administration as determined by capillary gel electrophoresis (CGE) analysis (Fig. 16) .
  • CGE capillary gel electrophoresis
  • ISIS 121874 Two variants of ISIS 121874 were synthesized: a 7 base mismatch 5' -TCAAGTCCTTCCACACCCAA-3 ' (ISIS 306058; SEQ ID NO: 294) and a gap ablated oligonucleotide ISIS 306058 having the same sequence as ISIS 121874, but with 2 ' -MOE modifications at nucleotides 1, 2, 3, 6, 9, 13, 16, 18, 19 and 20. Because of the presence of 2' -MOE in the gap, this oligonucleotide is no longer an RNase H substrate and will not recruit RNase H to the RNA-DNA hybrid which is formed. The results (Fig.
  • ISIS 121874 The effect of ISIS 121874 on B7.2 and B7.1 mRNA in draining lymph nodes of allergen-challenged mice is shown in Figs. 20A and 20B, respectively. This shows that ISIS 121874 reduces both B7.2 and B7.1 mRNA (greater in lung vs . node) .
  • ISIS 121874 resulted in a dose-dependent inhibition of airway hypersensitivity, inhibited eosinophilia and reduced B7.1 and B7.2 expression in the lung and lymph nodes.
  • ISIS 121874 reduced levels of the following inflammatory molecules: IgE mRNA in the lung and IgE protein in the serum; reduced IL-5 mRNA in the lung and IL-5 protein in the BAL fluid; and reduced the serum level of macrophage chemokine (KC) .
  • IgE mRNA in the lung and IgE protein in the serum reduced IL-5 mRNA in the lung and IL-5 protein in the BAL fluid
  • KC macrophage chemokine
  • the airway response to methacholine 100 mg/ml was reduced to the level seen in na ⁇ ve mice at 0.01-0.3 ⁇ g/kg dose (FIG. 22) .
  • a mismatch control oligonucleotide had no effect on the airway response; to methacholine.
  • ISIS 121874 reduced airway . eosinophilia in a dose-dependent manner (FIG. 23).
  • mismatch control oligonucleotide had no effect.
  • aerosolized ISIS 121874 but not a mismatch control oligonucleotide, reduced the percentage , of eosinophils/macrophages in lungs from ovalbumin-challenged mice.
  • both intratracheal and aerosol administration of B7.2 antisense oligonucleotides effectively reduce airway hyperresponsiveness and pulmonary inflammation in a mouse model of allergen-induced asthma, and represents a therapeutically useful treatment of human pulmonary inflammatory disorders, including asthma.
  • a dose-dependent increase in lung concentration of ISIS 121874 was observed at 24 hours following single (0.06 mg/kg) or multiple (0.00006, 0.006, 0.005 or 0.06 mg/kg, q2d x 5) .
  • Example 24 B7.1 ASO in ovalbumin model of asthma
  • the same protocols described above for the B7.2 ASOs were used to test the effect of the B7.1 ASO ISIS 121844 (SEQ ID NO: 286) .
  • ISIS 121844 had no effect on the Penh response in mice challenged with methacholine.
  • ISIS 121844 reduced allergen- induced airway eosinophilia (Fig. 21) and reduced the levels of B7.1 and B7.2. in the mouse lung. (Figs 22A-B) .
  • treatment with B7.1 ASO produced anti- inflammatory effects, but did not prevent airway hyper- .. responsiveness.
  • conventional asthma medications including, but not limited to, montelukast sodium (SingulairTM) , albuterol, beclomethasone dipropionate, triamcinolone acetonide, ipratropium bromide (AtroventTM) , flunisolide, fluticasone propionate (FloventTM) and other steroids is also contemplated.
  • SingulairTM montelukast sodium
  • albuterol albuterol
  • beclomethasone dipropionate triamcinolone acetonide
  • ipratropium bromide AtroventTM
  • flunisolide fluticasone propionate
  • FloventTM fluticasone propionate
  • B7.1 and B7.2 may also be combined with one or more conventional asthma medications as described above for B7.1 or B7.2 alone.
  • mice The tolerability of a 2' -MOE modified antisense oligonucleotide was investigated in an inhalation toxicity study in mice.
  • CD1 mice were exposed to nine lung delivered doses of 1, 3 and 10 mg/kg over 18 days. No effect was seen on survival, clinical signs of toxicity, body weight or clinical pathology parameters. Lung morphology was unaffected except for dose-dependent changes in alveolar macrophages.
  • the treatment doses tested were three orders of magnitude greater than doses with which in vivo efficacy was observed.
  • a series of nucleic acid duplexes comprising the antisense compounds of the present invention and their complements can be designed to target B7.1 or B7.2.
  • the nucleobase sequence of the antisense strand of the duplex comprises at least a portion of an oligonucleotide to B7.1 or B7.2 as described herein.
  • the ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang.
  • the sense strand of the dsRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to either terminus.
  • both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini .
  • a duplex comprising an antisense strand having the sequence CGAGAGGCGGACGGGACCG and having a two- nucleobase overhang of deoxythymidine (dT) would have the following structure: cgagaggcggacgggaccgTT Antisense Strand M M I M I I I I I M I I I I I I TTgctctccgcctgccctggctggc Complement
  • a duplex comprising an antisense strand having the same sequence CGAGAGGCGGACGGGACCG may be prepared with blunt ends (no single stranded overhang) as shown : cgagaggcggacgggaccg Antisense Strand I I M M I I I M M M I I I I I gctctccgcctgccctggc Complement
  • RNA strands of the duplex can be synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, CO). Once synthesized, the complementary strands are annealed. The single strands are aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each strand is combined with 15uL of a 5X solution of annealing buffer. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2mM magnesium acetate. The final volume is 75 uL. This solution is incubated for 1 minute at 90°C and then centrifuged for 15 seconds.
  • the tube is allowed to sit for 1 hour at 37°C at which time the dsRNA duplexes are used in experimentation.
  • the final concentration of the dsRNA duplex is 20 uM.
  • This solution can be stored frozen (-20°C) and freeze-thawed up to 5 times .
  • the duplexed antisense compounds are evaluated for their ability to modulate B7.1 or B7.2 expression according to the protocols described herein.
  • the compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition.
  • Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of B7.1 or B7.2 in health and disease.
  • Representative phenotypic assays which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, OR; PerkinElmer, Boston, MA), protein-based assays including enzymatic assays (Panvera, LLC, Madison, WI ; BD Biosciences, Franklin Lakes, NJ; Oncogene Research Products, San Diego, CA) , cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, MI), triglyceride accumulation (Sigma-Aldrich, St.
  • angiogenesis assays i.e., MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies
  • B7.1 or B7.2 inhibitors identified from the in vi tro studies as well as control compounds at optimal concentrations which are determined by the methods described above .
  • treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.
  • Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest. Analysis of the genotype of the cell (measurement of the expression of one or more of the genes of the cell) after treatment is also used as an indicator of the efficacy or potency of the B7.1 or B7.2 inhibitors. Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.
  • Antisense inhibition of human B7.2 expression by chimeric phosphorothioate oligonucleotides having 2 * -MOE wings and a deoxy gap In accordance with the present invention, an additional series of antisense compounds were designed to target different regions of the human B7.2 RNA, using published sequences (GenBank accession number U04343.1, incorporated herein as SEQ ID NO: 295, GenBank accession number BC040261.1, incorporated herein as SEQ ID NO: 296 and GenBank accession number NT_005543.12 , a portion of which is incorporated herein as SEQ ID NO: 297) . The compounds are shown in Table 25.
  • Target site indicates the first (5'- most) nucleotide number on the particular target sequence to which the compound binds.
  • All compounds in Table 25 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap” region consisting of ten 2 ' -deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide "wings".
  • the wings are composed of 2 ' -MOE nucleotides.
  • cytidine residues are 5-methylcytidines .
  • the compounds were analyzed for their effect on human B7.2 mRNA levels in THP-1 cells by quantitative real-time PCR as described in other examples herein. Data are averages from three experiments. If present, "N.D.” indicates "no data”.
  • oligonucleotide probe that - anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes.
  • a reporter dye e.g., FAM or JOE, obtained from either PE-Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, IA
  • a quencher dye e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, IA
  • reporter dye emission is quenched by the proximity of the 3 ' quencher dye.
  • annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5 ' -exonuclease activity of Taq polymerase.
  • cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated.
  • mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ( "single-plexing" ) , or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art .
  • PCR reagents were obtained from Invitrogen Corporation, (Carlsbad, CA) .
  • RT-PCR reactions were carried out by adding 20 ⁇ L PCR cocktail (2.5x PCR buffer minus MgCl 2 , 6.6 mM MgCl 2 , 375 ⁇ M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM ® Taq, 5 Units MuLV reverse transcriptase, and 2.5x ROX dye) to 96-well plates containing 30 ⁇ L total RNA solution (20-200 ng) .
  • RT reaction was carried out by incubation for 30 minutes at 48° C. Following a 10 minute incubation at 95° C to activate the PLATINUM ® Taq, 40 cycles of a two-step PCR protocol were carried out: 95° C for 15 seconds (denaturation) followed by 60°C for 1.5 minutes (annealing/extension).
  • Gene target quantities obtained by real time RT-PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreenTM (Molecular Probes, Inc. Eugene, OR). GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately.
  • RNA quantification reagent Molecular Probes, Inc. Eugene, OR. Methods of RNA quantification by RiboGreenTM are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). In this assay, 170 ⁇ L of RiboGreenTM working reagent
  • Probes and primers to human B7.2 were designed to hybridize to a human B7.2 sequence, using published sequence information (GenBank accession number U04343.1.1, incorporated herein as SEQ ID NO: 295) .
  • the PCR primers were : forward primer: TGTTTCATTCCCTGATGTTACGA (SEQ ID NO: 445) reverse primer: AAAAGCCGCGTCTTGTCAGT (SEQ ID NO : 446) and the
  • PCR probe was: FAM-CAATATGACCATCTTCTGTATTCTGGA-TAMRA (SEQ ID NO: 447) where FAM is the fluorescent dye and TAMRA is the quencher dye .
  • the PCR primers were : forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 448) reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 449) and the
  • PCR probe was: 5' JOE-CAAGCTTCCCGTTCTCAGCC- TAMRA 3' (SEQ ID.
  • JOE is the fluorescent reporter dye and TAMRA is the quencher dye.
  • Oligonucleotides targeted to human B7.2 In accordance with the present invention, an additional series of antisense compounds was designed to target different regions of a human B7.2 RNA, ' - using published sequences (GenBank accession number U04343.1, incorporated herein as SEQ ID NO: 295, GenBank accession number BC040261.1, incorporated herein as SEQ ID NO: 296 and GenBank accession number NT_005543.12, a portion of which is incorporated herein as SEQ ID NO: 297, GenBank accession number BI824940.1, which is incorporated herein as SEQ ID NO: 451) .
  • the compounds are shown in Table 26.
  • Target site indicates the first (5'- most) nucleotide number on the particular target sequence to which the compound binds.
  • ISIS 331931 through ISIS 332004 (SEQ ID NO: 453 through SEQ ID NO: 526), ISIS 335973 (SEQ ID NO: 544), ISIS 335978 (SEQ ID NO: ' 549), ISIS 335993 (SEQ ID NO: 723) and ISIS 336004 (SEQ ID NO: 574) are exact matches to CD86 sequences from various other primate species, including Cynomolgous monkey and African Green Monkey.
  • ISIS 331993 through 332004 (SEQ ID NOs: 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525 and 526) are chimeric oligonucleotides 14-20 nucleotides in length, composed of varying combinations of 2 ' -deoxynucleotides and 2' -MOE nucleotides.
  • the 2' -MOE modifications are at nucleobases 11-18 in 331993; 13-18 in 331994 and 331997; 1-4 and 15-18 in 331995 and 331996; 13-16 in 331998; 1-3 and 14-16 in 331999 and 332000; 1-2 and 13-14 in 332001 and 332002; and 11-20 in 332003 and 332004.
  • ISIS 336088 through 336096 are 20 nucleotides in length, composed of 2 ' -MOE nucleotides.
  • ISIS 336098, 336101 and 336104 (SEQ ID NOs*: 664, 665 and 666, respectively) are 20 to 21 nucleotides in length, composed of 2 ' deoxynucleotides .
  • the internucleoside (backbone) linkages are phosphorophosphate throughout the nucleotdide. All cytidine residues are 5-methylcytidines. .
  • the remaining compounds in Table 26 and ISIS 129686 (CGTTATTAACCTCCGTTGAA, SEQ ID NO: 452) are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2'- deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide "wings". The wings are composed of 2 ' -MOE nucleotides.
  • the compounds were analyzed for their effect on human B7.2 mRNA levels in THP-1 cells. THP-1 cells were electroporated in 1mm cuvettes at a density of 1 X 10 7 cells/mL, a voltage of 75V and pulse length of 6ms, in the presence of 10 ⁇ M oligonucleotide. Cells were immediately treated with 1 ⁇ g/ml LPS and 0.5 mM dbcAMP, as described in other examples herein. Target mRNA was measured by quantitative real-time PCR as described in other examples herein. ISIS 129686 (SEQ ID NO: 452) was used as a scrambled control oligonucleotide. Data are averages from two experiments and are shown in Table 26. If present, "N.D.” indicates "no data”
  • the antisense compound is targeted to nucleobases 195-537 of a coding region of a nucleic acid encoding human B7.2 (SEQ ID NO: 296) .
  • Antisense inhibition of human B7.2 expression dose response
  • ISIS 323624 SEQ ID NO: 374)
  • ISIS 323641 SEQ ID NO: 391)
  • ISIS 323690 SEQ ID NO: 440
  • ISIS 331941 SEQ ID NO: 463
  • ISIS 331949 SEQ ID NO: 471
  • ISIS 331985 SEQ ID NO : 507
  • ISIS 331992 SEQ ID NO: 514
  • ISIS 331996 SEQ ID NO: 518) " were ' . identified as oligonucleotides *with good activity based on the results in Examples 27 and 29.
  • ISIS.13650 (TCCCGCCTGTGACATGCATT, SEQ ID NO: 667) and ISIS ' 129700 (TAGTGCGGACCTACCCACGA, SEQ ID NO:- 668), used as control oligonucleotides, are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2 ' -deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five- nucleotide "wings". The wings are composed of 2 ' -MOE nucleotides.
  • Cells were electroporated in 1mm cuvettes at a density of 1 X 10 7 cells/mL, a voltage of 75V and a pulse length of 6ms with an oligonucleotide dose of 2.5, 5, 10 or 20 ⁇ M. After electroporation, cells were treated with 1 ⁇ g/ml LPS and 0.5 mM dbcAMP for 16 hours to induce B7-2 expression.
  • Control cells were stimulated with 1 ⁇ g/ml LPS and 0.5 mM dbcAMP, but not treated with oligonucleotides.
  • Target mRNA levels were determined by quantitative realtime PCR as described in other examples herein, using two different primer-probe sets to confirm the results of the antisense oligonucleotide treatment.
  • the first primer probe set was #1608, consisting of a forward primer (SEQ ID NO: 445) , reverse primer (SEQ ID NO: 446) and probe (SEQ ID NO: 447) described in Example 28.
  • the second primer probe set was #1770, consisting of CGCATCCACCAGATGAATTCT (forward primer, SEQ ID NO: 669), AATTGGTACTATTTCAGGTTGACTGAAG (reverse primer, SEQ ID NO: 670) and AACTGTCAGTGCTTGCT (probe, SEQ ID NO : 671) .
  • the data are the average of two experiments and are presented in Table 27. The percent inhibition is expressed relative to the LPS/dbc/AMP-stimulated cells that were not exposed to oligonucleotides .
  • Inhibition of B7-2 protein expression by antisense oligonucleotide treatment dose response
  • the effects of antisense oligonucleotide treatment on cell surface expression of B7-2 was evaluated in THP-1 cells.
  • the cell surface expression of B7-1 was also measured as a test of the specificity of the B7-2 antisense oligonucleotides.
  • the oligonucleotides used for this study were ISIS 22300 (SEQ ID NO: 190) ISIS 113131 (SEQ ID NO: 255), ISIS 323641 (SEQ ID NO: 391) ISIS 323643 (SEQ ID NO: 393), ISIS 323653 (SEQ ID NO: 403) ISIS 323660 (SEQ ID NO: 410), ISIS 323661 (SEQ ID NO: 411) ISIS 323675 (SEQ ID NO: 425) , ISIS 323690 (SEQ ID NO: 440) ISIS 115675 (SEQ ID NO: 672) and ISIS 129690 (SEQ ID NO: 673) , used as control oligonucleotides, are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2 ' -deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five
  • the wings are composed of 2 ' -MOE nucleotides.
  • THP-1 cells were electroporated in the presence of 2.5, 10 or 20 ⁇ M of antisense or control oligonucleotides. The cells were immediately treated with 1 ⁇ g/ml LPS and 0.5 mM dbcAMP for 42 hours to induce B7-2 expression. Control cells were stimulated with 1 ⁇ g/ml LPS and 0.5 mM dbcAMP, but not exposed to oligonucleotides.
  • the cells were stained for 30 minutes at 4°C, washed with PBS, resuspended in 300 ⁇ L PBS containing 0.5% paraformaldehyde. Measurements of mean fluorescence activity were made by flow cytometry using the FL-1 and FL-2 channels of a BD Biosciences FACScan (BD Biosciences, San Jose, CA) . With this method, both B7-2 and B7-1 protein expression on the surface of the same cell was measured. The data are the average of two electroporation experiments and are presented in Table 28. The data are expressed as percent inhibition of protein expression relative to LPS/dbcAMP-stimulated cells that were not exposed to oligonucleotides. The data illustrate that the oligonucleotides of the present invention can reduce cell surface expression of B7-2 protein in a dose-dependent manner. Furthermore, the antisense inhibition is specific to B7-2, as the cell surface expression of B7-1 is not reduced.
  • Double stranded RNAs targeted to B7.2 In a further embodiment of the present invention, a series of blunt-ended nucleic acid duplexes comprising the antisense compounds of the present invention and their complements was designed to target human B7-2 as described in Example 25, using published sequences (GenBank accession number U04343.1, incorporated herein as SEQ ID NO: 295, GenBank accession number BC040261.1, incorporated herein as SEQ ID NO: 296 and GenBank accession number NT_005612.13 , a portion of which is incorporated herein as SEQ ID NO: 674, GenBank accession number L25259.1, which is incorporated herein as SEQ ID NO: 675) .
  • the sequences of the antisense strands are listed in Table 29, The sense strand of the dsRNA was designed and synthesized as the complement of the antisense strand, making both strands of the dsRNA duplex complementary over the entire length of the oligomeric compound.
  • Target sites are indicated by the first (5' most) nucleotide number, as given in the sequence source reference (indicated by GenBank accession number) to which the oligonucleotide binds. All compounds in Table 29 are oligoribonucleotides, 20 ' nucleotides in length with phosphodiester internucleoside linkages (backbones) throughout .
  • RNA strands of the duplex are synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, CO) . Once synthesized, the complementary strands are annealed. The single strands are aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each strand is combined with 15uL of a 5X solution of annealing buffer. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2mM magnesium acetate. The final volume is 75 uL. This solution is incubated for 1 minute at 90°C and then centrifuged for 15 seconds.
  • the tube is allowed to sit for 1 hour at 37°C at which time the dsRNA duplexes are used in experimentation.
  • the final concentration of the dsRNA duplex is 20 uM.
  • This solution can be stored frozen (-20°C) and freeze-thawed up to 5 times.
  • duplexed antisense compounds are evaluated for their ability to modulate B7-2 expression.
  • cells reached 80% confluency, they are treated with duplexed antisense compounds of the invention.
  • OPTI-MEM-1 reduced-serum medium Gibco BRL
  • 130 ⁇ L of OPTI-MEM-1 containing 12.. ⁇ g/mL LIPOFECTIN Gibco BRL
  • the desired duplex antisense compound at a final concentration of 200 nM.
  • the medium is replaced with fresh medium.
  • Cells are harvested 16 hours after treatment, at which time RNA is isolated and target reduction measured by RT-PCR.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pulmonology (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des compositions d'oligonucléotides antisens qui s'hybrident spécifiquement à des acides nucléiques codant des protéines B7, ainsi que l'utilisation de ces compositions dans l'inhibition de l'expression de l'ARNm de B7.
EP04752823A 2003-05-23 2004-05-19 Compositions et methodes de modulation de l'expression de la proteine b7 Withdrawn EP1631235A4 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US10/444,206 US20040023917A1 (en) 1996-12-31 2003-05-23 Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
US51061403P 2003-10-10 2003-10-10
US52040103P 2003-11-13 2003-11-13
US53729104P 2004-01-16 2004-01-16
PCT/US2004/015880 WO2005000202A2 (fr) 2003-05-23 2004-05-19 Compositions et methodes de modulation de l'expression de la proteine b7

Publications (2)

Publication Number Publication Date
EP1631235A2 true EP1631235A2 (fr) 2006-03-08
EP1631235A4 EP1631235A4 (fr) 2008-05-21

Family

ID=33556628

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04752823A Withdrawn EP1631235A4 (fr) 2003-05-23 2004-05-19 Compositions et methodes de modulation de l'expression de la proteine b7

Country Status (2)

Country Link
EP (1) EP1631235A4 (fr)
WO (1) WO2005000202A2 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050234002A1 (en) 2004-01-23 2005-10-20 Mourich Dan V Antisense oligomers and methods for inducing immune tolerance and immunosuppression

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000074687A1 (fr) * 1999-06-04 2000-12-14 Isis Pharmaceuticals, Inc. Modulation antisens de l'expression de la proteine b7
WO2003083089A2 (fr) * 2002-03-28 2003-10-09 Revivicor Inc. Cellules tolerogenes presentant des antigenes

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1012331B1 (fr) * 1997-07-01 2006-03-29 Isis Pharmaceuticals, Inc. Compositions et procedes d'apport d'oligonucleotides par le tube digestif

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6319906B1 (en) * 1996-12-31 2001-11-20 Isis Pharmaceuticals Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
WO2000074687A1 (fr) * 1999-06-04 2000-12-14 Isis Pharmaceuticals, Inc. Modulation antisens de l'expression de la proteine b7
WO2003083089A2 (fr) * 2002-03-28 2003-10-09 Revivicor Inc. Cellules tolerogenes presentant des antigenes

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
DATABASE BIOSIS [Online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; February 2001 (2001-02), QIAN S ET AL: "Administration of antisense oligodeoxyribonucleotides against mRNA of CD80 or CD86 prolongs survival of cardiac allografts by inhibition of CTL activity" Database accession no. PREV200100372589 *
DATABASE MEDLINE [Online] US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US; 27 August 2003 (2003-08-27), LIANG XIAOYAN ET AL: "Administration of dendritic cells transduced with antisense oligodeoxyribonucleotides targeting CD80 or CD86 prolongs allograft survival." Database accession no. NLM12973117 *
LIANG X ET AL: "PHENOTYPE AND ALLOSTIMULATORY FUNCTION OF DENDRITIC CELLS TREATED WITH ANTISENSE OLIGODEOXYRIBONUCLEOTIDES TARGETING CD80 OR CD86 MRNA" TRANSPLANTATION PROCEEDINGS, ORLANDO, FL, US, vol. 33, no. 1/02, 1 February 2001 (2001-02-01), page 235, XP001036750 ISSN: 0041-1345 *
LIANG X ET AL: "Phenotype and allostimulatory function of dendritic cells treated with antisense oligodeoxyribonucleotides targeting CD80 or CD86 mRNA." TRANSPLANTATION PROCEEDINGS 2001 FEB-MAR, vol. 33, no. 1-2, February 2001 (2001-02), page 235, XP001036750 ISSN: 0041-1345 *
LIANG XIAOYAN ET AL: "Administration of dendritic cells transduced with antisense oligodeoxyribonucleotides targeting CD80 or CD86 prolongs allograft survival." TRANSPLANTATION 27 AUG 2003, vol. 76, no. 4, 27 August 2003 (2003-08-27), pages 721-729, XP002474974 ISSN: 0041-1337 *
QIAN S ET AL: "Administration of antisense oligodeoxyribonucleotides against mRNA of CD80 or CD86 prolongs survival of cardiac allografts by inhibition of CTL activity." TRANSPLANTATION PROCEEDINGS 2001 FEB-MAR, vol. 33, no. 1-2, February 2001 (2001-02), page 551, XP002474973 ISSN: 0041-1345 *
See also references of WO2005000202A2 *

Also Published As

Publication number Publication date
WO2005000202A3 (fr) 2006-01-19
EP1631235A4 (fr) 2008-05-21
WO2005000202A2 (fr) 2005-01-06

Similar Documents

Publication Publication Date Title
US7235653B2 (en) Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
AU2003294281B2 (en) Antisense modulation of apolipoprotein B expression
EP2468865B1 (fr) Modulation d'oligonucléotides antisens de l'expression stat3
US9476051B2 (en) Antisense modulation of superoxide dismutase 1, soluble expression
AU755515C (en) Antisense modulation of BCL-X expression
WO2005040180A2 (fr) Modulation antisens de l'expression de la superoxyde dismutase 1 soluble (sod-1)
EP1660682B1 (fr) Modulation antisens de l'expression de la kinase proteine activee par le mitogene p38
WO2000074687A9 (fr) Modulation antisens de l'expression de la proteine b7
US7897582B2 (en) Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
US7960355B2 (en) Compositions and methods for the modulation of the expression of B7 protein
WO2005000202A2 (fr) Compositions et methodes de modulation de l'expression de la proteine b7
ZA200503690B (en) Antisense modulation of apolipoprotein B expression

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

PUAK Availability of information related to the publication of the international search report

Free format text: ORIGINAL CODE: 0009015

17P Request for examination filed

Effective date: 20051219

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL HR LT LV MK

RIC1 Information provided on ipc code assigned before grant

Ipc: C07H 21/00 20060101ALI20060320BHEP

Ipc: C12N 5/00 20060101ALI20060320BHEP

Ipc: A61K 31/70 20060101AFI20060320BHEP

RIN1 Information on inventor provided before grant (corrected)

Inventor name: BAKER, BRENDA F.

Inventor name: FREIER, SUSAN, M.

Inventor name: KARRAS, JAMES, G.

Inventor name: VICKERS, TIMOTHY, A.

Inventor name: BENNETT, FRANK, C.

DAX Request for extension of the european patent (deleted)
RIC1 Information provided on ipc code assigned before grant

Ipc: A61P 11/06 20060101ALI20080407BHEP

Ipc: A61K 48/00 20060101ALI20080407BHEP

Ipc: C12N 15/11 20060101AFI20080407BHEP

A4 Supplementary search report drawn up and despatched

Effective date: 20080417

17Q First examination report despatched

Effective date: 20100324

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: ISIS PHARMACEUTICALS, INC.

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20121201