EP1601374B1 - Zusammensetzungen und verfahren zur diagnose und behandlung einer entzündung - Google Patents

Zusammensetzungen und verfahren zur diagnose und behandlung einer entzündung Download PDF

Info

Publication number
EP1601374B1
EP1601374B1 EP04720545A EP04720545A EP1601374B1 EP 1601374 B1 EP1601374 B1 EP 1601374B1 EP 04720545 A EP04720545 A EP 04720545A EP 04720545 A EP04720545 A EP 04720545A EP 1601374 B1 EP1601374 B1 EP 1601374B1
Authority
EP
European Patent Office
Prior art keywords
antibody
srb
diseases
antibodies
inflammatory
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
EP04720545A
Other languages
English (en)
French (fr)
Other versions
EP1601374A4 (de
EP1601374A2 (de
EP1601374B2 (de
Inventor
Nathan Karin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rappaport Family Institute for Research in the Medical Sciences
Original Assignee
Rappaport Family Institute for Research in the Medical Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=32994504&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=EP1601374(B1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Rappaport Family Institute for Research in the Medical Sciences filed Critical Rappaport Family Institute for Research in the Medical Sciences
Publication of EP1601374A2 publication Critical patent/EP1601374A2/de
Publication of EP1601374A4 publication Critical patent/EP1601374A4/de
Application granted granted Critical
Publication of EP1601374B1 publication Critical patent/EP1601374B1/de
Publication of EP1601374B2 publication Critical patent/EP1601374B2/de
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/564—Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination

Definitions

  • the present invention concerns the use of an anti-SR-BI antibody according to claim 1, an article of manufacture according to claim 2, a method of diagnosing according to claim 3.
  • the present invention relates to compositions and methods for diagnosing and treating inflammation. More particularly, the present invention relates to the use of scavenger receptor inhibitors in treatment of an inflammatory response and to methods of diagnosing an inflammatory response via detection of autoantibodies directed at scavenger receptors.
  • Inflammation is a physiological condition characterized in the acute form by the classical signs of pain, heat, redness, swelling and loss of function. Inflammation often accompanies diseases such as Multiple Sclerosis (MS), osteoarthritis, Inflammatory Bowl Disease (IBD) including Crohn's disease and ulcerative colitis, Rheumatoid Arthritis (RA), atherosclerosis, encephalomyelitis, Alzheimer's disease, stroke, traumatic brain injury, Parkinson's disease and others. In most cases, there is no effective cure for inflammation associated with such disease and existing treatments are palliative and largely fail to control the underlying causes of tissue degradation.
  • MS Multiple Sclerosis
  • IBD Inflammatory Bowl Disease
  • RA Rheumatoid Arthritis
  • encephalomyelitis Alzheimer's disease, stroke, traumatic brain injury, Parkinson's disease and others.
  • there is no effective cure for inflammation associated with such disease and existing treatments are palliative and largely fail to control the underlying causes of tissue degradation.
  • SRs Scavenger receptors
  • LDL low-density lipoprotein
  • SRs Scavenger receptors
  • polyanionic ligands e.g., modified proteins, sulfated polysaccharides and certain polynucleotides [1, 3, 4]. This property led to the hypothesis that these receptors form a part of an in innate immune response by serving as pattern recognition receptors that bind a wide variety of pathogen components [2-5].
  • SRB-I (also referred to as SR-BI or CLA-I) is a macrophage scavenger molecule and a receptor for high-density lipoprotein (HDL) [2, 3, 6, 7] that mediates cholesterol uptake from cells [ Rigotti A. et al., Curr. Opin. Lipidol., 8:181-8, 1997 ; Rigotti A. et al., Proc. Natl. Acad. Sci., 94:12610-5, 1997 ]. SRB-I can also serve as a receptor for non-HDL lipoproteins and appears to play an important role in reverse cholesterol transport.
  • HDL high-density lipoprotein
  • the present inventor has previously shown that the immune system can selectively generate autoimmunity to chemokines and other proinflammatory mediators when such a response is beneficial for the host [9, 10, 11, 12, 14, 15].
  • chemokines and other proinflammatory mediators when such a response is beneficial for the host [9, 10, 11, 12, 14, 15].
  • patients suffering from rheumatoid arthritis (RA) but not osteoarthritis (OA) have significant levels of autoantibodies directed to TNF- ⁇ , and therapies that neutralize the function of TNF- ⁇ suppress RA but not OA.
  • RA rheumatoid arthritis
  • OA osteoarthritis
  • Studies conducted by the present inventor have shown that selective amplification of these beneficial antibodies by targeted DNA vaccines provided protective immunity in experimental models (9, 10,11,12,14,15).
  • SR autoantibodies to scavenger receptor
  • SR-BI is present on the membranes of hepatocytes and steroidogenic tissues, including the adrenal gland, testes, and ovaries, where it mediates the uptake and transport of cholesteryl ester from high density lipoproteins. It has been demonstrated that transgenic animals which do not produce SR-BI are perfectly healthy, with the exception that the females are infertile. This provides evidence that inhibition of uptake, binding or transport of cholesteryl ester to SR-BI can be used to inhibit pregnancy. The same pathway can also be used to decrease production of steroids, and therefore be used as a therapy for disorders involving steroidal overproduction.
  • WO 95/05600 describes a method of screening a subject for a central nervous system disorder caused by autoimmune disease (e.g., an inflammatory seizure disorder) comprises collecting a sample from the subject and then detecting the presence or absence of anti-glutamate receptor autoantibodies (e.g., anti-GluR3 glutamate receptor autoantibodies) in the biological sample.
  • anti-glutamate receptor autoantibodies e.g., anti-GluR3 glutamate receptor autoantibodies
  • Methods of treating such disease by reducing the number of autoantibodies available to bind to glutamate receptors in the subject are also disclosed.
  • US-A-6,429,289 relates to two distinct scavenger receptor type proteins having high affinity for modified lipoproteins and other ligands have been isolated, characterized and cloned.
  • HaSR-BI an AcLDL and LDL binding scavenger receptor, which is distinct from the type I and type II macrophage scavenger receptors, has been isolated and characterized and DNA encoding the receptor cloned from a variant of Chinese Hamster Ovary Cells, designated Var-261.
  • dSR-CI a non-mammalian AcLDL binding scavenger receptor having high ligand affinity and broad specificity, was isolated from Drosophila melanogaster.
  • the isolated receptors are useful in screening for drugs that inhibit uptake of cholesterol in endothelial or adipose cells or macrophages, respectively. They are also useful as probes for the isolation of other lipoprotein receptors and in research the roles of these receptors.
  • an anti-SR-BI antibody is defined in claim 1
  • the article of manufacture is defined in claim 2
  • the method of diagnosing is defined to claim 3.
  • a method of reducing an inflammatory response in a subject comprising providing to a subject in need thereof a therapeutically effective amount of an agent capable of reducing activity and/or expression of a scavenger receptor or of an effector thereof, thereby reducing the inflammatory response in the subject.
  • the agent is selected from the group consisting of: (i) an oligonucleotide directed to an endogenous nucleic acid sequence expressing the scavenger receptor or the effector thereof; (ii) a chemical inhibitor directed to the scavenger receptor or the effector thereof; (iii) a neutralizing antibody directed at the scavenger receptor or the effector thereof; and (iv) a non-functional derivative of the scavenger receptor or the effector thereof.
  • the scavenger receptor is a class A scavenger receptor or a class B scavenger receptor.
  • class B scavenger receptor is SR-BI.
  • an agent capable of reducing activity and/or expression of scavenger receptor or of an effector thereof for the manufacture of a medicament for the treatment of inflammatory diseases is provided.
  • an article of manufacture comprising packaging material and a pharmaceutical composition identified for treating inflammatory diseases being contained within the packaging material, the pharmaceutical composition including, as an active ingredient, an agent capable of reducing activity and/or expression of scavenger receptor or of an effector thereof and a pharmaceutically acceptable carrier.
  • a method of diagnosing predisposition to, or presence of, an inflammatory disease in a subject comprising detecting anti scavenger receptor antibodies in a biological sample obtained from the subject, wherein a level above a predetermined normal threshold of the anti scavenger receptor antibodies in the biological sample is indicative of the inflammatory disease in the subject.
  • detecting the anti scavenger receptor antibodies in the biological sample is effected by ELISA, RIA and/or dot blot.
  • a humanized antibody having an antigen recognition domain capable of specifically binding a scavenger receptor.
  • the present invention successfully addresses the shortcomings of the presently known configurations by providing novel compositions and methods containing same for diagnosing and treating an inflammatory response.
  • the present invention is of compositions and methods which can be used for the diagnosis and treatment of inflammation. Specifically, the present invention relates to the use of scavenger receptor inhibitors in treating inflammatory response and to methods of diagnosing inflammatory response via detection of autoantibodies to scavenger receptors in subjects.
  • SR autoantibodies to scavenger receptor
  • reducing refers to preventing, curing, reversing, attenuating, alleviating, minimizing, suppressing or halting the deleterious effects of an inflammatory response.
  • inflammatory response refers to an immune response which results in inflammation, typically occurring as a result of injurious stimuli including infection, bums, trauma, neoplasia, autoimmune signals and exposure to chemicals, heat or cold or any other harmful stimulus.
  • An inflammatory response according to the present invention refers to an acute phase response and a chronic inflammation.
  • subject refers to subject who may benefit from the present invention such as a mammal (e.g., canine, feline, ovine, porcine, equine, bovine, human), preferably a human subject.
  • a mammal e.g., canine, feline, ovine, porcine, equine, bovine, human
  • the method of this aspect of the present invention is effected by providing to a subject in need thereof a therapeutically effective amount of an agent capable of reducing activity and/or expression of a scavenger receptor or of an effector thereof, thereby reducing the inflammatory response in the subject.
  • such an agent can directly reduce activity and/or expression of the scavenger receptor, or alternatively activate endogenous components which in turn reduce activity and/or expression of the scavenger receptor (indirect).
  • scavenger receptor refers to a gene product (i.e., RNA or protein) of a scavenger receptor, which is known in the Art.
  • scavenger receptors include but are not limited to class A scavenger receptors, class B scavenger receptors and class F scavenger receptors.
  • the scavenger receptor is preferably one which is expressed and displayed by macrophages.
  • the scavenger receptor of the present invention is SR-BI, a member of the CD36 family, GenBank Accession No. NP_005496, also known as CLA-I or SRB-I.
  • Scavenger receptor activity refers to cell adhesion activity, transporter activity, apoptotic activity, lipid metabolism activity, signal transduction activity and/or preferably cytokine secretion activity.
  • an effector of a scavenger receptor refers to an endogenous molecule which up-regulates or activates scavenger receptor activity.
  • an effector can be a modified lipid (e.g., oxidized lipid, glycated lipid, alkylated lipid, nitrated lipid, acetylated lipid), which binds to the scavenger receptor and activates signaling therefrom.
  • agents can be used in accordance with this aspect of the present invention to reduce the activity or expression of a scavenger receptor or an effector thereof.
  • an agent can either be directly administered to the subject or expressed in cells thereof as is further described hereinbelow.
  • the agent can be a neutralizing antibody which inhibits the activity of a scavenger receptor [such as by binding to the extracellular collagenous domain of SR which plays a role in ligand binding. See Acton (1993) J. Biol. Chem. 268(5):3530-7 ] or an effector thereof.
  • a scavenger receptor neutralizing antibody is described in Example 6 of the Examples section which follows.
  • Other SR-neutralizing antibodies are known in the art, see for example Frolov (2000) J. Biol. Chem. 275(17): 12769-12780 .
  • antibody refers to whole antibody molecules as well as functional fragments thereof, such as Fab, F(ab') 2 , and Fv that are capable of binding with antigenic portions of the target polypeptide.
  • functional antibody fragments constitute preferred embodiments of the present invention, and are defined as follows:
  • Purification of serum immunoglobulin antibodies can be accomplished by a variety of methods known to those of skill including, precipitation by ammonium sulfate or sodium sulfate followed by dialysis against saline, ion exchange chromatography, affinity or immunoaffinity chromatography as well as gel filtration, zone electrophoresis, etc. (see Goding in, Monoclonal Antibodies: Principles and Practice, 2nd ed., pp. 104-126, 1986, Orlando, Fla., Academic Press ). Under normal physiological conditions antibodies are found in plasma and other body fluids and in the membrane of certain cells and are produced by lymphocytes of the type denoted B cells or their functional equivalent.
  • Antibodies of the IgG class are made up of four polypeptide chains linked together by disulfide bonds.
  • the four chains of intact IgG molecules are two identical heavy chains referred to as H-chains and two identical light chains referred to as L-chains.
  • Additional classes include IgD, IgE; IgA, IgM and related proteins.
  • a recombinant scavenger receptor polypeptide may be used to generate antibodies in vitro (see Example 6 of the Examples section which follows).
  • a suitable host animal is immunized with the recombinant polypeptide.
  • the animal host used is a mouse of an inbred strain. Animals are typically immunized with a mixture comprising a solution of the recombinant polypeptide in a physiologically acceptable vehicle, and any suitable adjuvant, which achieves an enhanced immune response to the immunogen.
  • the primary immunization conveniently may be accomplished with a mixture of a solution of the recombinant polypeptide and Freund's complete adjuvant, said mixture being prepared in the form of a water in oil emulsion.
  • the immunization will be administered to the animals intramuscularly, intradermally, subcutaneously, intraperitoneally, into the footpads, or by any appropriate route of administration.
  • the immunization schedule of the immunogen may be adapted as required, but customarily involves several subsequent or secondary immunizations using a milder adjuvant such as Freund's incomplete adjuvant.
  • Antibody titers and specificity of binding to the polypeptide can be determined during the immunization schedule by any convenient method including by way of example radioimmunoassay, or enzyme linked immunosorbant assay, which is known as the ELISA assay.
  • ELISA assay enzyme linked immunosorbant assay
  • suitable antibody titers are achieved, antibody-producing lymphocytes from the immunized animals are obtained, and these are cultured, selected and cloned, as is known in the art.
  • lymphocytes may be obtained in large numbers from the spleens of immunized animals, but they may also be retrieved from the circulation, the lymph nodes or other lymphoid organs.
  • Lymphocytes are then fused with any suitable myeloma cell line, to yield hybridomas, as is well known in the art.
  • lymphocytes may also be stimulated to grow in culture, and may be immortalized by methods known in the art including the exposure of these lymphocytes to a virus, a chemical or a nucleic acid such as an oncogene, according to established protocols.
  • the hybridomas are cultured under suitable culture conditions, for example in multi-well plates, and the culture supernatants are screened to identify cultures containing antibodies that recognize the hapten of choice.
  • Hybridomas that secrete antibodies that recognize the recombinant polypeptide are cloned by limiting dilution and expanded, under appropriate culture conditions. Monoclonal antibodies are purified and characterized in terms of immunoglobulin type and binding affinity.
  • Antibody fragments according to the present invention can be prepared by proteolytic hydrolysis of the antibody or by expression in E. coli or mammalian cells (e.g. Chinese hamster ovary cell culture or other protein expression systems) of DNA encoding the fragment.
  • E. coli or mammalian cells e.g. Chinese hamster ovary cell culture or other protein expression systems
  • Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods.
  • antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5S fragment denoted F(ab') 2 .
  • This fragment can be further cleaved using a thiol reducing agent, and optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages, to produce 3.5S Fab' monovalent fragments.
  • an enzymatic cleavage using pepsin produces two monovalent Fab' fragments and an Fc fragment directly.
  • Fv fragments comprise an association of V H and V L chains. This association may be noncovalent, as described in Inbar et al. (Proc. Nat'l Acad. Sci. USA 69:2659-62, 1972 ). Alternatively, the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as glutaraldehyde. Preferably, the Fv fragments comprise V H and V L chains connected by a peptide linker.
  • sFv single-chain antigen binding proteins
  • the structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli.
  • the recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains.
  • Methods for producing sFvs are described, for example, by Whitlow and Filpula, Methods, 2: 97-105, 1991 ; Bird et al., Science 242:423-426, 1988 ; Pack et al., Bio/Technology 11:1271-77, 1993 ; and Ladner et al., U.S. Pat. No. 4,946,778 , all of which are hereby incorporated, by reference, in entirety.
  • CDR peptides (“minimal recognition units") can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells (see, for example, Larrick and Fry Methods, 2: 106-10, 1991 ).
  • Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab') 2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
  • Humanized antibodies include human immunoglobulins (recipient antibody) in which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • CDR complementary determining region
  • donor antibody such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • Humanized antibodies may also comprise residues, which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [ Jones et al., Nature, 321:522-525 (1986 ); Riechmann et al., Nature, 332:323-329 (1988 ); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992 )].
  • Fc immunoglobulin constant region
  • a humanized antibody has one or more amino acid residues introduced into it from a source, which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain.
  • humanization can be essentially performed following the method of Winter and co-workers [ Jones et al., Nature, 321:522-525 (1986 ); Riechmann et al., Nature 332:323-327 (1988 ); Verhoeyen et al., Science, 239:1534-1536 (1988 )], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
  • rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
  • humanized antibodies are chimeric antibodies ( U.S. Pat. No. 4,816,567 ), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • Human antibodies can also be produced using various techniques known in the art, including phage display libraries [ Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991 ); Marks et al., J. Mol. Biol., 222:581 (1991 )].
  • the techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies ( Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985 ) and Boerner et al., J. Immunol., 147(1):86-95 (1991 )].
  • human monoclonal antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos.
  • An agent for reducing the activity of a scavenger receptor or an effector thereof can also be a non-functional derivative thereof (i.e., dominant negative).
  • a non-functional derivative thereof i.e., dominant negative
  • artificial dominant negative molecules of scavenger receptors have been previously described by Acton (1993 Supra.
  • Such truncation mutants lack the positively charged collagenous extracellular domain and while retain trimerization, post-translational processing, intracellular transport, surface expression, and stability, are unable to bind ligand and have a dominant negative effects over wild-type receptors [see also Dejager et al. J Clin Invest. 1993 Aug;92(2):894-902 ].
  • the present invention can use the natural inhibitor of SR-A isoform which modifies ligand uptake [see Gough J Lipid Res. 1998 Mar;39(3):531-43 ].
  • Polypeptides of these non-functional derivatives can be synthesized using solid phase peptide synthesis procedures which are well known in the art and further described by John Morrow Stewart and Janis Dillaha Young, Solid Phase Peptide Syntheses (2nd Ed., Pierce Chemical Company, 1984 ). Synthetic peptides can be purified by preparative high performance liquid chromatography [ Creighton T. (1983) Proteins, structures and molecular principles. WH Freeman and Co. N.Y .] and the composition of which can be confirmed via amino acid sequencing.
  • these proteins can encoded expressed within the target cell from an exogenous polynucleotides ligated into a nucleic acid expression construct.
  • nucleic acid construct can be administered to the individual employing any suitable mode of administration, described hereinbelow (i.e., in vivo gene therapy).
  • the nucleic acid construct is introduced into a suitable cell via an appropriate gene delivery vehicle/method (transfection, transduction, homologous recombination, etc.) and an expression system as needed and then the modified cells are expanded in culture and returned to the individual (i.e., ex vivo gene therapy).
  • the nucleic acid construct of the present invention further includes at least one cis acting regulatory element.
  • cis acting regulatory element refers to a polynucleotide sequence, preferably a promoter, which binds a trans acting regulator and regulates the transcription of a coding sequence located downstream thereto.
  • Any suitable promoter sequence can be used by the nucleic acid construct of the present invention.
  • the promoter utilized by the nucleic acid construct of the present invention is active in the specific cell population transformed.
  • cell type-specific and/or tissue-specific promoters include promoters such as albumin that is liver specific [ Pinkert et al., (1987) Genes Dev. 1:268-277 ], lymphoid specific promoters [ Calame et al., (1988) Adv. Immunol. 43:235-275 ]; in particular promoters of T-cell receptors [ Winoto et al., (1989) EMBO J. 8:729-733 ] and immunoglobulins; [ Banerji et al.
  • the nucleic acid construct of the present invention can further include an enhancer, which can be adjacent or distant to the promoter sequence and can function in up regulating the transcription therefrom.
  • the nucleic acid construct of the present invention preferably further includes an appropriate selectable marker and/or an origin of replication.
  • the nucleic acid construct utilized is a shuttle vector, which can propagate both in E. coli (wherein the construct comprises an appropriate selectable marker and origin of replication) and be compatible for propagation in cells, or integration in a gene and a tissue of choice.
  • the construct according to the present invention can be, for example, a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome.
  • suitable constructs include, but are not limited to, pcDNA3, pcDNA3.1 (+/-), pGL3, PzeoSV2 (+/-), pDisplay, pEF/myc/cyto, pCMV/myc/cyto each of which is commercially available from Invitrogen Co. (www.invitrogen.com).
  • retroviral vector and packaging systems are those sold by Clontech, San Diego, Calif., including Retro-X vectors pLNCX and pLXSN, which permit cloning into multiple cloning sites and the trasgene is transcribed from CMV promoter.
  • Vectors derived from Mo-MuLV are also included such as pBabe, where the transgene will be transcribed from the 5'LTR promoter.
  • nucleic acid transfer techniques include transfection with viral or non-viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
  • viral or non-viral constructs such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
  • Useful lipids for lipid-mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Chol [ Tonkinson et al., Cancer Investigation, 14(1): 54-65 (1996 )].
  • the most preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses.
  • a viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus-defining element(s), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger.
  • Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct.
  • LTRs long terminal repeats
  • such a construct typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed.
  • the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of the present invention.
  • the construct may also include a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence.
  • a signal that directs polyadenylation will topically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
  • Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers.
  • the agent of this aspect of the present invention can be a chemical, which is designed to specifically inhibit the activity or expression of a scavenger receptor or an effector thereof.
  • a scavenger receptor inhibitor is Pitavastatin [NK-104, Circulation. 2004 Feb 17;109(6):790-6 ], which down-regulates expression of CD36.
  • TNF- ⁇ regulates scavenger receptor expression through MAPK (e.g., ERK, JNK, and p38).
  • MAPK e.g., ERK, JNK, and p38
  • RNA molecules Another agent capable of reducing the expression of an SR or effectors thereof is a small interfering RNA (siRNA) molecule.
  • RNA interference is a two-step process, the first step, which is termed as the initiation step, input dsRNA is digested into 21-23 nucleotide (nt) small interfering RNAs (siRNA), probably by the action of Dicer, a member of the RNase III family of dsRNA-specific ribonucleases, which processes (cleaves) dsRNA (introduced directly or via a transgene or a virus) in an ATP-dependent manner. Successive cleavage events degrade the RNA to 19-21 bp duplexes (siRNA), each with 2-nucleotide 3' overhangs [ Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002 ); and Bernstein Nature 409:363-366 (2001 )].
  • siRNA small interfering RNAs
  • the siRNA duplexes bind to a nuclease complex to from the RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • An ATP-dependent unwinding of the siRNA duplex is required for activation of the RISC.
  • the active RISC targets the homologous transcript by base pairing interactions and cleaves the mRNA into 12 nucleotide fragments from the 3' terminus of the siRNA [ Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002 ); Hammond et al. (2001) Nat. Rev. Gen. 2:110-119 (2001 ); and Sharp Genes. Dev. 15:485-90 (2001 )].
  • each RISC contains a single siRNA and an RNase [ Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002 )].
  • RNAi RNAi RNAi RNAi RNAi RNAi RNAi RNAi RNAi amplification step within the RNAi pathway has been suggested. Amplification could occur by copying of the input dsRNAs which would generate more siRNAs, or by replication of the siRNAs formed. Alternatively or additionally, amplification could be effected by multiple turnover events of the RISC [ Hammond et al. Nat. Rev. Gen. 2:110-119 (2001 ), Sharp Genes. Dev. 15:485-90 (2001 ); Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002 )]. For more information on RNAi see the following reviews Tuschl ChemBiochem. 2:239-245 (2001 ); Cullen Nat. Immunol. 3:597-599 (2002 ); and Brantl Biochem. Biophys. Act. 1575:15-25 (2002 ).
  • RNAi molecules suitable for use with the present invention can be effected as follows. First, an SRB-I mRNA sequence (e.g., GenBank Accession No. NP_005496), for example, is scanned downstream of the AUG start codon for AA dinucleotide sequences. Occurrence of each AA and the 3' adjacent 19 nucleotides is recorded as potential siRNA target sites. Preferably, siRNA target sites are selected from the open reading frame, as untranslated regions (UTRs) are richer in regulatory protein binding sites. UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex [ Tuschl ChemBiochem. 2:239-245 ].
  • UTRs untranslated regions
  • siRNAs directed at untranslated regions may also be effective, as demonstrated for GAPDH wherein siRNA directed at the 5' UTR mediated about 90 % decrease in cellular GAPDH mRNA and completely abolished protein level ( www.ambion.com/techlib/tn/91/912.html ).
  • potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server ( www.ncbi.nlm.nih.gov/BLAST/ ). Putative target sites which exhibit significant homology to other coding sequences are filtered out.
  • an appropriate genomic database e.g., human, mouse, rat etc.
  • sequence alignment software available from the NCBI server ( www.ncbi.nlm.nih.gov/BLAST/ ).
  • Qualifying target sequences are selected as template for siRNA synthesis.
  • Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55 %.
  • Several target sites are preferably selected along the length of the target gene for evaluation.
  • Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome.
  • a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene.
  • siRNA molecule directed at a SR i.e., p120
  • p120 a siRNA molecule directed at a SR
  • DNAzyme molecule capable of specifically cleaving an mRNA transcript or DNA sequence of interest.
  • DNAzymes are single-stranded polynucleotides which are capable of cleaving both single and double stranded target sequences ( Breaker, R.R. and Joyce, G. Chemistry and Biology 1995;2:655 ; Santoro, S.W. & Joyce, G.F. Proc. Natl, Acad. Sci. USA 1997;943:4262 )
  • a general model (the "10-23" model) for the DNAzyme has been proposed.
  • DNAzymes have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate-recognition domains of seven to nine deoxyribonucleotides each.
  • This type of DNAzyme can effectively cleave its substrate RNA at purine:pyrimidine junctions ( Santoro, S.W. & Joyce, G.F. Proc. Natl, Acad. Sci. USA 199 ; for rev of DNAzymes see Khachigian, LM [Curr Opin Mol Ther 4:119-21 (2002 )].
  • DNAzymes complementary to bcr-ab1 oncogenes were successful in inhibiting the oncogenes expression in leukemia cells, and lessening relapse rates in autologous bone marrow transplant in cases of CML and ALL.
  • Reducing expression of SR or an effector thereof can also be effected by using an antisense polynucleotide capable of specifically hybridizing with an mRNA transcript encoding the proteins of interest.
  • the first aspect is delivery of the oligonucleotide into the cytoplasm of the appropriate cells, while the second aspect is design of an oligonucleotide which specifically binds the designated mRNA within cells in a way which inhibits translation thereof.
  • antisense oligonucleotides suitable for the treatment of cancer have been successfully used [ Holmund et al., Curr Opin Mol Ther 1:372-85 (1999 )], while treatment of hematological malignancies via antisense oligonucleotides targeting c-myb gene, p53 and Bcl-2 had entered clinical trials and had been shown to be tolerated by patients [ Gerwitz Curr Opin Mol Ther 1:297-306 (1999 )].
  • SR-specific antisense molecules have been previously described by Rhainds Biochemistry. 2003 Jun 24;42(24):7527-38 ; Zingg Arterioscler Thromb Vasc Biol. 2002 Mar 1;22(3):412-7 ; and Imachi Lab Invest. 2000 Feb;80(2):263-70 .
  • Ribozyme molecule capable of specifically cleaving an mRNA transcript encoding this gene product.
  • Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest [ Welch et al., Curr Opin Biotechnol. 9:486-96 (1998 )].
  • the possibility of designing ribozymes to cleave any specific target RNA has rendered them valuable tools in both basic research and therapeutic applications.
  • ribozymes have been exploited to target viral RNAs in infectious diseases, dominant oncogenes in cancers and specific somatic mutations in genetic disorders [ Welch et al., Clin Diagn Virol. 10:163-71 (1998 )]. Most notably, several ribozyme gene therapy protocols for HIV patients are already in Phase 1 trials. More recently, ribozymes have been used for transgenic animal research, gene target validation and pathway elucidation. Several ribozymes are in various stages of clinical trials. ANGIOZYME was the first chemically synthesized ribozyme to be studied in human clinical trials.
  • ANGIOZYME specifically inhibits formation of the VEGF-r (Vascular Endothelial Growth Factor receptor), a key component in the angiogenesis pathway.
  • Ribozyme Pharmaceuticals, Inc. as well as other firms have demonstrated the importance of anti-angiogenesis therapeutics in animal models.
  • HEPTAZYME a ribozyme designed to selectively destroy Hepatitis C Virus (HCV) RNA, was found effective in decreasing Hepatitis C viral RNA in cell culture assays (Ribozyme Pharmaceuticals, Incorporated - WEB home page).
  • TFOs triplex forming oligonuclotides
  • the triplex-forming oligonucleotide has the sequence correspondence: oligo 3'--A G G T duplex 5'--A G C T duplex 3'--T C G A
  • triplex forming sequence preferably are at least 15, more preferably 25, still more preferably 30 or more nucleotides in length, up to 50 or 100 bp.
  • Transfection of cells for example, via cationic liposomes
  • TFOs Transfection of cells (for example, via cationic liposomes) with TFOs, and formation of the triple helical structure with the target DNA induces steric and functional changes, blocking transcription initiation and elongation, allowing the introduction of desired sequence changes in the endogenous DNA and resulting in the specific downregulation of gene expression.
  • Examples of such suppression of gene expression in cells treated with TFOs include knockout of episomal supFG1 and endogenous HPRT genes in mammalian cells ( Vasquez et al., Nucl Acids Res.
  • TFOs designed according to the abovementioned principles can induce directed mutagenesis capable of effecting DNA repair, thus providing both downregulation and upregulation of expression of endogenous genes ( Seidman and Glazer, J Clin Invest 2003; 112:487-94 ).
  • Detailed description of the design, synthesis and administration of effective TFOs can be found in U.S. Patent Application Nos. 2003 017068 and 2003 0096980 to Froehler et al, and 2002 0128218 and 2002 0123476 to Emanuele et al , and U.S. Pat. No. 5,721,138 to Lawn .
  • oligonucleotide agents may further include base and/or backbone modifications which may increase bioavailability therapeutic efficacy and reduce cytotoxicity. Such modifications are described in Younes (2002) Current Pharmaceutical Design 8:1451-1466 .
  • the oligonucleotides of the present invention may comprise heterocylic nucleosides consisting of purines and the pyrimidines bases, bonded in a 3' to 5' phosphodiester linkage.
  • oligonucleotides are those modified in either backbone, internucleoside linkages or bases, as is broadly described hereinunder.
  • oligonucleotides useful according to this aspect of the present invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone, as disclosed in U.S. Pat.
  • Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.
  • Various salts, mixed salts and free acid forms can also be used.
  • modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • alkene containing backbones sulfamate backbones
  • sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH 2 component parts, as disclosed in U.S. Pat. Nos.
  • oligonucleotides which can be used according to the present invention, are those modified in both sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
  • the base units are maintained for complementation with the appropriate polynucleotide target.
  • An example for such an oligonucleotide mimetic includes peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • a PNA oligonucleotide refers to an oligonucleotide where the sugar-backbone is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • the bases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • Oligonucleotides of the present invention may also include base modifications or substitutions.
  • "unmodified” or “natural” bases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified bases include but are not limited to other synthetic and natural bases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted ura
  • 5-substituted pyrimidines include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C. [ Sanghvi YS et al. (1993) Antisense Research and Applications, CRC Press, Boca Raton 276-278 ] and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.
  • agent according to this aspect of the present invention can be also a molecule, which indirectly causes reduction of SR activity or expression.
  • an agent is a molecule which promotes specific immunogenic response to a scavenger receptor or an effector thereof in the subject.
  • a molecule can be an SR-BI protein, a fragment derived therefrom or a nucleic acid sequence encoding same (see Examples 1-5 of the Examples section which follows).
  • the agent is preferably administered with an immunostimulant in an immunogenic composition.
  • An immunostimulant may be any substance that enhances or potentiates an immune response (antibody and/or cell-mediated) to an exogenous antigen.
  • immunostimulants include adjuvants, biodegradable microspheres (e.g., polylactic galactide) and liposomes into which the compound is incorporated (see e.g., U.S. Pat. No. 4,235,877 ).
  • Vaccine preparation is generally described in, for example, M. F. Powell and M. J. Newman, eds., "Vaccine Design (the subunit and adjuvant approach),” Plenum Press (NY, 1995 ).
  • Illustrative immunogenic compositions may contain DNA encoding a scavenger receptor, such that the protein is generated in situ.
  • the DNA may be present within any of a variety of delivery systems known to those of ordinary skill in the art, including nucleic acid expression systems, bacteria and viral expression systems. Gene delivery techniques are well known in the art, such as those described by Rolland, Crit. Rev. Therap. Drug Carrier Systems 15:143-198, 1998 , and references cited therein.
  • the DNA is introduced using a viral expression system (e.g., vaccinia or other pox virus, retrovirus, lentivirus or adenovirus), which may involve the use of a non-pathogenic (defective), replication competent virus.
  • a viral expression system e.g., vaccinia or other pox virus, retrovirus, lentivirus or adenovirus
  • vaccinia or other pox virus retrovirus, lentivirus or adenovirus
  • the DNA may also be "naked,” as described, for example, in Ulmer et al., Science 259:1745-1749, 1993 and reviewed by Cohen, Science 259:1691-1692, 1993 .
  • the uptake of naked DNA may be increased by coating the DNA onto biodegradable beads, which are efficiently transported into the cells.
  • an immunogenic composition may comprise both a polynucleotide and a polypeptide component. Such immunogenic compositions may provide for an enhanced immune response.
  • immunostimulants may be employed in the immunogenic compositions of this invention.
  • an adjuvant may be included.
  • Most adjuvants contain a substance designed to protect the antigen from rapid catabolism, such as aluminum hydroxide or mineral oil, and a stimulator of immune responses, such as lipid A, Bortadella pertussis or Mycobacterium tuberculosis derived proteins.
  • Suitable adjuvants are commercially available as, for example, Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Mich.); Merck Adjuvant 65 (Merck and Company, Inc., Rahway, N.J .); AS-2 (SmithKline Beecham, Philadelphia, Pa.); aluminum salts such as aluminum hydroxide gel (alum) or aluminum phosphate; salts of calcium, iron or zinc; an insoluble suspension of acylated tyrosine; acylated sugars; cationically or anionically derivatized polysaccharides; polyphosphazenes; biodegradable microspheres; monophosphoryl lipid A and quil A. Cytokines, such as GM-CSF or interleukin-2,-7, or -12, may also be used as adjuvants.
  • Cytokines such as GM-CSF or interleukin-2,-7, or -12, may also be used as adjuvants.
  • the adjuvant composition may be designed to induce an immune response predominantly of the Th1 type.
  • High levels of Th1-type cytokines e.g., IFN- ⁇ , TNF- ⁇ , IL-2 and IL-12
  • Th2-type cytokines e.g., IL-4, IL-5, IL-6 and IL-10
  • the subject will support an immune response that includes Th1- and Th2-type responses.
  • the levels of these cytokines may be readily assessed using standard assays. For a review of the families of cytokines, see Mosmann and Coffinan, Ann. Rev. Immunol. 7:145-173, 1959 .
  • Preferred adjuvants for use in eliciting a predominantly Th1-type response include, for example, a combination of monophosphoryl lipid A, preferably 3-de-O-acylated monophosphoryl lipid A (3D-MPL), together with an aluminum salt.
  • MPL adjuvants are available from Corixa Corporation (Seattle, Wash.; see U.S. Pat. Nos. 4,436,727 ; 4,877,611 ; 4,866,034 and 4,912,094 ).
  • CpG-containing oligonucleotides in which the CpG dinucleotide is unmethylated also induce a predominantly Th1 response.
  • oligonucleotides are well known and are described, for example, in WO 96/02555 , WO 99/33488 and U.S. Pat. Nos. 6,008,200 and 5,856,462 .
  • Immunostimulatory DNA sequences are also described, for example, by Sato et al., Science 273:352, 1996 .
  • Another preferred adjuvant is a saponin, preferably QS21 (Aquila Biopharmaceuticals Inc., Framingham, Mass.), which may be used alone or in combination with other adjuvants.
  • an enhanced system involves the combination of a monophosphoryl lipid A and saponin derivative, such as the combination of QS21 and 3D-MPL as described in WO 94/00153 , or a less reactogenic composition where the QS21 is quenched with cholesterol, as described in WO 96/33739 .
  • Other preferred formulations comprise an oil-in-water emulsion and tocopherol.
  • a particularly potent adjuvant formulation involving QS21, 3D-MPL and tocopherol in an oil-in-water emulsion is described in WO 95/17210 .
  • Advants include Montanide ISA 720 (Seppic, France), SAF (Chiron, Calif., United States), ISCOMS (CSL), MF-59 (Chiron), the SBAS series of adjuvants (e.g., SBAS-2 or SBAS-4, available from SmithKline Beecham, Rixensart, Belgium), Detox (Corixa, Hamilton, Mont.), RC-529 (Corixa, Hamilton, Mont.) and other aminoalkyl glucosaminide 4-phosphates (AGPs), such as those described in pending U.S. patent application Ser. Nos. 08/853,826 and 09/074,720 .
  • SBAS series of adjuvants e.g., SBAS-2 or SBAS-4, available from SmithKline Beecham, Rixensart, Belgium
  • Detox Corixa, Hamilton, Mont.
  • RC-529 Corixa, Hamilton, Mont.
  • AGPs aminoalkyl glucosaminide 4-phosphates
  • a delivery vehicle can be employed with the immunogenic composition of the present invention in order to facilitate production of an antigen-specific immune response that targets tumor cells.
  • Delivery vehicles include antigen presenting cells (APCs), such as dendritic cells, macrophages, B cells, monocytes and other cells that may be engineered to be efficient APCs.
  • APCs antigen presenting cells
  • Such cells may be genetically modified to increase the capacity for presenting the antigen, to improve activation and/or maintenance of the T cell response, to have anti-tumor effects per se and/or to be immunologically compatible with the receiver (i.e., matched HLA haplotype).
  • APCs may generally be isolated from any of a variety of biological fluids and organs, including tumor and peritumoral tissues, and may be autologous, allogeneic, syngeneic or xenogeneic cells.
  • Dendritic cells are highly potent APCs ( Banchereau and Steinman, Nature 392:245-251, 1998 ) and have been shown to be effective as a physiological adjuvant for eliciting prophylactic or therapeutic antitumor immunity (see Timmeman and Levy, Ann. Rev. Med. 50:507-529, 1999 ).
  • dendritic cells may be identified based on their typical shape (stellate in situ, with marked cytoplasmic processes (dendrites) visible in vitro ), their ability to take up, process and present antigens with high efficiency and their ability to activate naive T cell responses.
  • Dendritic cells may, of course, be engineered to express specific cell-surface receptors or ligands that are not commonly found on dendritic cells in vivo or ex vivo, and such modified dendritic cells are contemplated by the present invention.
  • secreted vesicles antigen-loaded dendritic cells called exosomes
  • exosomes secreted vesicles antigen-loaded dendritic cells
  • Dendritic cells and progenitors may be obtained from peripheral blood, bone marrow, tumor-infiltrating cells, peritumoral tissues-infiltrating cells, lymph nodes, spleen, skin, umbilical cord blood or any other suitable tissue or fluid.
  • dendritic cells may be differentiated ex vivo by adding a combination of cytokines such as GM-CSF, IL-4, IL-13 and/or TNF- ⁇ to cultures of monocytes harvested from peripheral blood.
  • CD34 positive cells harvested from peripheral blood, umbilical cord blood or bone marrow may be differentiated into dendritic cells by adding to the culture medium combinations of GM-CSF, IL-3, TNF- ⁇ , CD40 ligand, LPS, flt3 ligand and/or other compound(s) that induce differentiation, maturation and proliferation of dendritic cells.
  • Dendritic cells are categorized as "immature” and “mature” cells, which allows a simple way to discriminate between two well characterized phenotypes.
  • Immature dendritic cells are characterized as APC with a high capacity for antigen uptake and processing, which correlates with the high expression of Fcy receptor and mannose receptor.
  • the mature phenotype is typically characterized by a lower expression of these markers, but a high expression of cell surface molecules responsible for T cell activation such as class I and class II MHC, adhesion molecules (e.g., CD54 and CD11) and costimulatory molecules (e.g., CD40, CD80, CD86 and 4-1BB).
  • APCs may generally be transfected with a polynucleotide encoding a SR, such that SR-BI, or an immunogenic portion thereof, is expressed on the cell surface. Such transfection may take place ex vivo, and a composition comprising such transfected cells may then be used for therapeutic purposes, as described herein. Alternatively, a gene delivery vehicle that targets a dendritic or other antigen presenting cell may be administered to the subject, resulting in transfection that occurs in vivo.
  • In vivo and ex vivo transfection of dendritic cells may generally be performed using any methods known in the art, such as those described in WO 97/24447 , or the gene gun approach described by Mahvi et al., Immunology and cell Biology 75:456-460, 1997 .
  • Antigen loading of dendritic cells may be achieved by incubating dendritic cells or progenitor cells with the SR polypeptide, DNA (naked or within a plasmid vector) or RNA; or with antigen-expressing recombinant bacterium or viruses (e.g., vaccinia, fowlpox, adenovirus or lentivirus vectors).
  • the polypeptide Prior to loading, the polypeptide may be covalently conjugated to an immunological partner that provides T cell help (e.g., a carrier molecule) such as described above.
  • an immunological partner that provides T cell help e.g., a carrier molecule
  • a dendritic cell may be pulsed with a non-conjugated immunological partner, separately or in the presence of the polypeptide.
  • agents which are capable of reducing the activity or expression of a scavenger receptor or effectors thereof is preferably effected by examining their effect on at least one of the above-described scavenger receptor activities.
  • modulation of inflammatory cytokine expression in macrophages such as described in Example 6 of the Examples section.
  • the above-described agents for reducing expression or activity of a scavenger receptor or of effectors thereof i.e., active ingredients
  • a "pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
  • the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
  • active ingredient refers to the preparation accountable for the biological effect.
  • physiologically acceptable carrier and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
  • An adjuvant is included under these phrases.
  • One of the ingredients included in the pharmaceutically acceptable carrier can be for example polyethylene glycol (PEG), a biocompatible polymer with a wide range of solubility in both organic and aqueous media (Mutter et al. (1979).
  • excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
  • excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
  • Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, inrtaperitoneal, intranasal, or intraocular injections.
  • oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, inrtaperitoneal, intranasal, or intraocular injections.
  • intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, inrtaperitoneal, intranasal, or intraocular injections.
  • one may administer a preparation in a local rather than systemic manner, for example, via injection of the preparation directly into a specific region of a patient
  • compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • the active ingredients of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
  • physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
  • Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
  • Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethylcellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
  • disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • Dragee cores are provided with suitable coatings.
  • suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
  • compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane or carbon dioxide.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane or carbon dioxide.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
  • the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
  • a suitable vehicle e.g., sterile, pyrogen-free water based solution
  • the preparation of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
  • compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.
  • the therapeutically effective amount or dose can be estimated initially from in vitro assays.
  • a dose can be formulated in animal models and such information can be used to more accurately determine useful doses in humans.
  • Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
  • the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
  • the dosage may vary depending upon the dosage form employed and the route of administration utilized.
  • the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.1 ).
  • dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
  • compositions to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
  • compositions including the preparation of the present invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
  • compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration.
  • Such notice for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
  • Inflammatory diseases include chronic inflammatory diseases and acute inflammatory diseases.
  • hypersensitivity examples include, but are not limited to, Type I hypersensitivity, Type II hypersensitivity, Type III hypersensitivity, Type IV hypersensitivity, immediate hypersensitivity, antibody mediated hypersensitivity, immune complex mediated hypersensitivity, T lymphocyte mediated hypersensitivity and DTH.
  • Type I or immediate hypersensitivity such as asthma.
  • Type II hypersensitivity include, but are not limited to, rheumatoid diseases, rheumatoid autoimmune diseases, rheumatoid arthritis ( Krenn V. et al., Histol Histopathol 2000 Jul; 15 (3):791 ), spondylitis, ankylosing spondylitis ( Jan Voswinkel et al., Arthritis Res 2001; 3 (3): 189 ), systemic diseases, systemic autoimmune diseases, systemic lupus erythematosus ( Erikson J. et al., Immunol Res 1998;17 (1-2):49 ), sclerosis, systemic sclerosis ( Renaudineau Y. et al., Clin Diagn Lab Immunol.
  • vasculitises necrotizing small vessel vasculitises, microscopic polyangiitis, Churg and Strauss syndrome, glomerulonephritis, pauci-immune focal necrotizing glomerulonephritis, crescentic glomerulonephritis ( Noel LH. Ann Med Interne (Paris). 2000 May;151 (3):178 ); antiphospholipid syndrome ( Flamholz R. et al., J Clin Apheresis 1999;14 (4):171 ); heart failure, agonist-like ⁇ -adrenoceptor antibodies in heart failure ( Wallukat G.
  • Type IV or T cell mediated hypersensitivity include, but are not limited to, rheumatoid diseases, rheumatoid arthritis ( Tisch R, McDevitt HO. Proc Natl Acad Sci U S A 1994 Jan 18;91 (2):437 ), systemic diseases, systemic autoimmune diseases, systemic lupus erythematosus ( Datta SK., Lupus 1998;7 (9):591 ), glandular diseases, glandular autoimmune diseases, pancreatic diseases, pancreatic autoimmune diseases, Type 1 diabetes ( Castano L. and Eisenbarth GS. Ann. Rev. Immunol. 8:647 ); thyroid diseases, autoimmune thyroid diseases, Graves' disease ( Sakata S.
  • delayed type hypersensitivity examples include, but are not limited to, contact dermatitis and drug eruption.
  • T lymphocyte mediating hypersensitivity examples include, but are not limited to, helper T lymphocytes and cytotoxic T lymphocytes.
  • helper T lymphocyte-mediated hypersensitivity examples include, but are not limited to, T h 1 lymphocyte mediated hypersensitivity and T h 2 lymphocyte mediated hypersensitivity.
  • cardiovascular diseases include, but are not limited to, cardiovascular diseases, rheumatoid diseases, glandular diseases, gastrointestinal diseases, cutaneous diseases, hepatic diseases, neurological diseases, muscular diseases, nephric diseases, diseases related to reproduction, connective tissue diseases and systemic diseases.
  • autoimmune cardiovascular diseases include, but are not limited to atherosclerosis ( Matsuura E. et al., Lupus. 1998;7 Suppl 2:S135 ), myocardial infarction ( Vaarala O. Lupus. 1998;7 Suppl 2:S132 ), thrombosis ( Tincani A. et a/., Lupus 1998;7 Suppl 2:S107-9 ), Wegener's granulomatosis, Takayasu's arteritis, Kawasaki syndrome ( Praprotnik S. et al., Wien Klin Klin Klin Klinschr 2000 Aug 25;112 (15-16):660 ), anti-factor VIII autoimmune disease ( Lacroix-Desmazes S.
  • autoimmune rheumatoid diseases include, but are not limited to rheumatoid arthritis ( Krenn V. et al., Histol Histopathol 2000 Jul;15 (3):791 ; Tisch R, McDevitt HO. Proc Natl Acad Sci units S A 1994 Jan 18;91 (2):437 ) and ankylosing spondylitis ( Jan Voswinkel et al., Arthritis Res 2001; 3 (3): 189 ).
  • autoimmune glandular diseases include, but are not limited to, pancreatic disease, Type I diabetes, thyroid disease, Graves' disease, thyroiditis, spontaneous autoimmune thyroiditis, Hashimoto's thyroiditis, idiopathic myxedema, ovarian autoimmunity, autoimmune anti-sperm infertility, autoimmune prostatitis and Type I autoimmune polyglandular syndrome.
  • diseases include, but are not limited to autoimmune diseases of the pancreas, Type 1 diabetes ( Castano L. and Eisenbarth GS. Ann. Rev. Immunol. 8:647 ; Zimmet P. Diabetes Res Clin Pract 1996 Oct;34 Suppl:S125 ), autoimmune thyroid diseases, Graves' disease ( Orgiazzi J.
  • autoimmune gastrointestinal diseases include, but are not limited to, chronic inflammatory intestinal diseases ( Garcia Herola A. et al., Gastroenterol Hepatol. 2000 Jan;23 (1):16 ), celiac disease ( Landau YE. and Shoenfeld Y. Harefuah 2000 Jan 16;138 (2):122 ), colitis, ileitis and Crohn's disease.
  • autoimmune cutaneous diseases include, but are not limited to, autoimmune bullous skin diseases, such as, but are not limited to, pemphigus vulgaris, bullous pemphigoid and pemphigus foliaceus.
  • autoimmune hepatic diseases include, but are not limited to, hepatitis, autoimmune chronic active hepatitis ( Franco A. et al., Clin Immunol Immunopathol 1990 Mar;54 (3):382 ), primary biliary cirrhosis ( Jones DE. Clin Sci (Colch) 1996 Nov;91 (5):551 ; Strassburg CP. et al., Eur J Gastroenterol Hepatol. 1999 Jun;11 (6):595 ) and autoimmune hepatitis ( Manns MP. J Hepatol 2000 Aug;33 (2):326 ).
  • autoimmune neurological diseases include, but are not limited to, multiple sclerosis ( Cross AH. et al., J Neuroimmunol 2001 Jan 1;112 (1-2):1 ), Alzheimer's disease ( Oron L. et al., J Neural Transm Suppl. 1997;49:77 ), myasthenia gravis ( Infante AJ. And Kraig E, Int Rev Immunol 1999;18 (1-2):83 ; Oshima M. et al., Eur J Immunol 1990 Dec;20 (12):2563 ), neuropathies, motor neuropathies ( Kornberg AJ. J Clin Neurosci.
  • autoimmune muscular diseases include, but are not limited to, myositis, autoimmune myositis and primary Sjogren's syndrome ( Feist E. et al., Int Arch Allergy Immunol 2000 Sep;123 (1):92 ) and smooth muscle autoimmune disease ( Zauli D. et al., Biomed Pharmacother 1999 Jun;53 (5-6):234 ).
  • autoimmune nephric diseases include, but are not limited to, nephritis and autoimmune interstitial nephritis ( Kelly CJ. J Am Soc Nephrol 1990 Aug;1 (2):140 ).
  • autoimmune diseases related to reproduction include, but are not limited to, repeated fetal loss ( Tincani A. et al., Lupus 1998;7 Suppl 2:S107-9 ).
  • autoimmune connective tissue diseases include, but are not limited to, ear diseases, autoimmune ear diseases ( Yoo TJ. et al., Cell Immunol 1994 Aug;157 (1):249 ) and autoimmune diseases of the inner ear ( Gloddek B. et al., Ann N Y Acad Sci 1997 Dec 29;830:266 ).
  • autoimmune systemic diseases include, but are not limited to, systemic lupus erythematosus ( Erikson J. et al., Immunol Res 1998;17 (1-2):49 ) and systemic sclerosis ( Renaudineau Y. et al., Clin Diagn Lab Immunol. 1999 Mar;6 (2):156 ); Chan OT. et al., Immunol Rev 1999 Jun;169:107 ).
  • infectious diseases include, but are not limited to, chronic infectious diseases, subacute infectious diseases, acute infectious diseases, viral diseases, bacterial diseases, protozoan diseases, parasitic diseases, fungal diseases, mycoplasma diseases and prion diseases.
  • diseases associated with transplantation of a graft include, but are not limited to, graft rejection, chronic graft rejection, subacute graft rejection, hyperacute graft rejection, acute graft rejection and graft versus host disease.
  • allergic diseases include, but are not limited to, asthma, hives, urticaria, pollen allergy, dust mite allergy, venom allergy, cosmetics allergy, latex allergy, chemical allergy, drug allergy, insect bite allergy, animal dander allergy, stinging plant allergy, poison ivy allergy and food allergy.
  • cancer examples include but are not limited to carcinoma, lymphoma, blastoma, sarcoma, and leukemia.
  • cancerous diseases include but are not limited to: Myeloid leukemia such as Chronic myelogenous leukemia. Acute myelogenous leukemia with maturation. Acute promyelocytic leukemia, Acute nonlymphocytic leukemia with increased basophils, Acute monocytic leukemia. Acute myelomonocytic leukemia with eosinophilia; Malignant lymphoma, such as Birkitt's Non-Hodgkin's; Lymphoctyic leukemia, such as Acute lumphoblastic leukemia.
  • Chronic lymphocytic leukemia Myeloproliferative diseases, such as Solid tumors Benign Meningioma, Mixed tumors of salivary gland, Colonic adenomas; Adenocarcinomas, such as Small cell lung cancer, Kidney, Uterus, Prostate, Bladder, Ovary, Colon, Sarcomas, Liposarcoma, myxoid, Synovial sarcoma, Rhabdomyosarcoma (alveolar), Extraskeletel myxoid chonodrosarcoma, Ewing's tumor; other include Testicular and ovarian dysgerminoma, Retinoblastoma, Wilms' tumor, Neuroblastoma, Malignant melanoma, Mesothelioma, breast, skin, prostate, and ovarian.
  • Adenocarcinomas such as Small cell lung cancer, Kidney, Uterus, Prostate, Bladder, Ovary, Colon, Sarcomas, Lipos
  • diagnosis refers to classifying a disease or a symptom as an inflammatory disease, determining a severity of such a disease, monitoring disease progression, forecasting an outcome of a disease and/or prospects of recovery.
  • the method is effected by detecting autoantibodies to a scavenger molecule in a biological sample obtained from the subject, wherein a level of the autoantibodies above a predetermined threshold (i.e., the level of the same in a biological sample obtained from a healthy individual) in indicative of the disease in the subject.
  • a predetermined threshold i.e., the level of the same in a biological sample obtained from a healthy individual
  • a “biological sample” refers to an antibody-containing sample of cell, tissue or fluid derived from the subject.
  • Antibodies present in the sample are typically found within cytoplasmic membrane-bound compartments (e.g., endoplasmic reticulum and Golgi apparatus) and on the surface of B lymphocytes (which synthesize antibody molecules) and immune effector cells such as, mononuclear phagocytes, natural killer (NK) cells and mast cells, which express specific receptors for binding antibody molecules.
  • Antibodies are also present in the plasma (i.e., fluid portion) of the blood and in the interstitial fluid of the tissues.
  • Antibodies can also be found in secretory fluids such as mucus, synovial fluid, sperm and milk into which certain types of antibody molecules are specifically transported.
  • Procedures for obtaining biological samples (i.e., biopsying) from individuals are well known in the art. Such procedures include, but are not limited to, blood sampling, joint fluid biopsy, cerebrospinal biopsy and lymph node biopsy. These and other procedures for obtaining tissue or fluid biopsies are described in details in http://www.healthatoz.com/healthatoz/Atoz/search.asp .
  • the titer (number) of antibody molecules for a scavenger receptor in the biological sample is determined.
  • Antibody titer can determined by techniques which are well known in the art such as ELISA and dot blot using an immobilized antigen (see for Example Abbas, Lichtman and Pober "Cellular and Molecular Immunology". W.B. Saunders International Edition 1994 pages 56-59 ).
  • the antigen is preferably immobilized on a solid support.
  • the solid support is preferably coated with a nonantigenic protein as well.
  • a peptide is typically immobilized on a solid matrix by adsorption from an aqueous medium, although other modes of immobilization applicable to proteins and peptides well known to those skilled in the art can be used.
  • Useful solid matrices are also well known in the art.
  • Such materials are water insoluble and include cross-linked dextran (e.g., SEPHADEX TM , Pharmacia Fine Chemicals, Piscataway, N.J.), agarose, polystyrene beads about 1 ⁇ m to about 5 mm in diameter, polyvinyl chloride, polystyrene, cross-linked polyacrylamide, nitrocellulose- or nylon-based webs such as sheets, strips or paddles; or tubes, plates or the wells of a microtiter plate such as those made from polystyrene or polyvinylchloride.
  • cross-linked dextran e.g., SEPHADEX TM , Pharmacia Fine Chemicals, Piscataway, N.J.
  • agarose agarose
  • polystyrene beads about 1 ⁇ m to about 5 mm in diameter
  • polyvinyl chloride polystyrene
  • polystyrene cross-linked polyacrylamide
  • nitrocellulose- or nylon-based webs such as sheets,
  • the antibody containing samples can be either a crude sample or immunoglobulin purified samples (e.g., ammonium sulfate precipitated fraction and/or chromatography isolated). Immunocomplexes are allowed to form and the support is washed to remove non-specifically bound antisera. Detection of immunocomplexes can be effected by adding labeled antibody-binding molecules such as staphylococcal protein A.
  • the label can be an enzyme such as horseradish peroxidase (HRP), glucose oxidase, or the like.
  • the major indicating group is an enzyme such as HRP or glucose oxidase
  • additional reagents are required to indicate that an immunocomplex has formed.
  • additional reagents for HRP include hydrogen peroxide and an oxidation dye precursor such as diaminobenzidine.
  • An additional reagent useful with glucose oxidase is 2,2,-azino-di-(3-ethyl-benzthiazoline-G-sulfonic acid) (ABTS).
  • Radioactive labels may also be used in accordance with the present invention.
  • An exemplary radiolabeling agent is a radioactive element that produces ⁇ ray emissions, such as 125 I.
  • Methods of protein labeling are well-known in the art and described in details by Galfre et al., Meth. Enzyol., 73:3-46 (1981 ). The techniques of protein conjugation or coupling through activated functional groups are also applicable. See, for example, Aurameas et al., Scand. J. Immunol., 8(7):7-23 (1978 ); Rodwell et al., Biotech., 3:889-894 (1984 ); and U.S. Pat. No. 4,493,795 .
  • Agents of the present invention can be included in a diagnostic or therapeutic kit.
  • antibodies and/or chemicals can be packaged in a one or more containers with appropriate buffers and preservatives and used for diagnosis or for directing therapeutic treatment.
  • the containers include a label.
  • Suitable containers include, for example, bottles, vials, syringes, and test tubes.
  • the containers may be formed from a variety of materials such as glass or plastic.
  • additives such as stabilizers, buffers, blockers and the like may also be added.
  • the kit can also include instructions for determining if the tested subject is suffering from, or is at risk of developing inflammation.
  • SRB-I vaccination prior to EAE induction in Lewis rats was evaluated by manifestation of EAE clinical symptoms.
  • the produced SRB-I autoantibodies were used to evaluate the effect of these antibodies on an ongoing disease.
  • Myelin Basic Protein (MBP) p68-86, Myelin Oligodendrocyte Glycoprotein (MOG) p33-55 were all synthesized on a MilliGen 9050 peptide synthesizer by standard 9-fluorenylmethoxycarbonyl chemistry and purified by high performance liquid chromatography. Sequence was confirmed by amino acid analysis and the correct mass was checked by mass spectroscopy. Peptides with over 95 % purity were used.
  • EAE Active induction of EAE in each experimental model was done as described before (20, 24, 25). Animals were then monitored for clinical signs daily by an observer blind to the treatment protocol. EAE was scored as follows: 0, clinically normal; 1, flaccid tail; 2, hind limb paralysis; 3, total hind limb paralysis, accompanied by an apparent front limb paralysis; 4, total hind limb and front limb paralysis.
  • RNA extracted from EAE brains of Lewis rats was subjected to RT-PCR using oligonucleotide primers [sense 5'-CCATGGGCGGCAGCTCCAGGGC-3' (SEQ ID NO: 1), anti-sense 5'-CTACAGCTTGGCTTCTTGCAC-3' (SEQ ID NO: 2)] complimentary to the published sequence of SRB-I (Accession No: AF071495).
  • This RT-PCR reaction mixture was subjected to an amplification program of 1 min at 95 °C, 1 min at 55 °C and 1 min at 72 °C for 25 cycles.
  • the 1.53 kb amplified product (SEQ ID NO:3) comprising nucleotides 10-1539 of SRB1R from Rattus norvegicus (Accession No: AF071495), was loaded onto a 5% polyacrylamide gel in TAE buffer, gel purified, sequenced and then ligated into a pcDNA3 plasmid. Prior to its use as a vaccine, the construct was injected to tibia muscle of rats that were sacrificed at different time points and the expression of RNA encoding SRB-I was verified. Under the working condition of the present study, SRB-I was highly transcribed in the leg muscle for not more than 25 days. DNA vaccines were administrated at a dose of 100 ⁇ g plasmid in 100 ⁇ l PBS to the to tibia muscle.
  • PCR product of SEQ ID NO: 3 was re-cloned into a PQE expression vector (Qaigen, Chatsworth, CA), expressed in E. coli and then purified by an NI-NTA-supper flow affinity purification of 6xHis proteins (Qaigen, Chatsworth, CA). After purification, the purity of recombinant SRB-I was verified by gel electrophoresis followed by N -terminus sequencing (Protein Services Unit of the Technion, Haifa, Israel).
  • a direct ELISA assay has been utilized to determine the anti SRB-I antibody titer in DNA vaccinated rats.
  • ELISA plates Nunc, Roskilde, Denmark
  • Sera from DNA vaccinated rats were added in serial dilutions from 2 5 to 2 30 to wells that were, or were not, coated previously with recombinant SRB-I.
  • Calculation of each titer was done by comparing the O.D. measured (405nm) in wells coated with SRB-I to those not coated with this recombinant gene product.
  • Goat anti-rat alkaline phosphatase conjugated IgG antibodies (Sigma) were used as a labeled antibody.
  • p-Nitrophenyl Phosphate (p-NPP) (Sigma) was used as a soluble alkaline phosphatase substrate.
  • Results were collected by ELISA reader (TECAN Spectra rainbow thermo absorber mini-plate reader). Results of triplicates were calculated as log 2 Ab titer ⁇ SE.
  • cDNA encoding rat ⁇ -actin (the natural cytoplasmic soluble form of ⁇ -actin, GenBank Accession NO: NM_0311444) was PCR amplified using specific oligonucleotide primers [sense 5'-ATGGATGACGATATCGCTGCGCTC-3' (SEQ ID NO:4); anti-sense 5'-CTACCGGCCAGCCAGACG-3' (SEQ ID NO:5)].
  • SEQ ID NO:4 anti-sense 5'-CTACCGGCCAGCCAGACG-3'
  • IgG was purified as described before (11).
  • Recombinant rat SRB-I (5 mg) encoded by SEQ ID NO:3, was bound to a CNBr activated Sepharose Column according to the manufactures instructions (Pharmacia biotech, catalog number 17-0820-01).
  • Anti SRB-I specific antibodies from sera (IgG fraction) of DNA vaccinated rats were loaded on the column and then eluted by an acidic elution buffer (glycine PH 2.5).
  • Isotype of the purified antibody was determined by an ELISA assay in which anti rat IgG1a, IgG2b and IgG1 (Jackson, USA) were used as detection antibodies. Purified antibody was mostly of the IgG2a Isotype (data not shown).
  • Murine peritoneal macrophages [obtained as described elsewhere (9)] were activated with LPS (1 ⁇ g/ml), washed once in FACS buffer (PBS, 0.25 % BSA, 0.05 % sodium azide), and then incubated for 0.5 hours in FACS buffer enriched with 1 % normal rat serum.
  • FACS buffer PBS, 0.25 % BSA, 0.05 % sodium azide
  • Control EAE rats displayed a significant titer against SRB-I ( Figure 1b log 2 Ab titer of 10 ⁇ 0.4 Vs 6 ⁇ 02 in naive rats, p ⁇ 0.05) that continued to persist till 6 days after recovery, and then regressed back to background levels (not shown).
  • DNA plasmid encoding SRB-I dramatically amplified this titer (log 2 Ab titer of 22 ⁇ 0.86, p ⁇ 0.001 as compared to each control group) to provide antibody mediated protective immunity ( Figure 1d ).
  • EAE rats did not develop a notable antibody titer to soluble ⁇ -actin and DNA plasmid encoding this gene product could not breakdown tolerance against self ( Figure 1b ).
  • SRB-I autoantibodies were found capable of specific binding to the recombinant SRB-I ( Figure 1c ), as well as to the natural form of SRB-I on activated macrophages ( Figure 1c ) and HEK293 line cells transfected with rat SRB-I (not shown). These autoantibodies could also adoptively transfer EAE resistance to other rats ( Figure 1d , mean maximal score of 3.3 ⁇ 0.3 in control rats Vs 1.66 ⁇ 0.18, p ⁇ 0.01).
  • the mechanism of action of anti SRB-I antibodies was evaluated by testing their ability to modify cytokine production by murine peritoneal macrophages.
  • Murine peritoneal macrophages Murine peritoneal macrophages:
  • Murine peritoneal macrophages were isolated as described before (9). Cells were then activated in vitro with 1 ⁇ g/ml LPS for 48 in the presence of (0, 10, 50 and 100 ⁇ g/ml) anti SRB-I polyclonal autoantibodies (CNBr purified, as described in Example 1 of the Examples section), or control IgG from normal rat serum (purified as described in Example 1 of the Examples section).
  • IL-12, TNF- ⁇ and IL-10 were determined by ELISA (TECAN Spectra rainbow thermo absorber mini-plate reader) using commercially available kits: mouse IL-12 (R&D system Inc. Mirmeapolis, MN), TNF- ⁇ & IL-10 (Diaclone, Besancon, France).
  • anti SRB-I antibodies affect the function of the immune system
  • these antibodies were purified and added to freshly isolated peritoneal macrophages that were activated in vitro with LPS.
  • the presence of anti SRB-I antibodies in the peritoneal macrophages culture effectively suppressed IL-12 and TNF- ⁇ production ( Figure 2a and Figure 2b , closed squares) and at the same time induced IL-10 production ( Figure 2c , closed squares) as compared to control IgG ( Figure 2 , open squares), all in a dose dependent manner ( Figure 2 ).
  • anti SRB-I antibodies redirect the polarization of macrophages from a pro-inflammatory to anti-inflammatory mediators.
  • SRB-I vaccine The effect of SRB-I vaccine on an ongoing disease was evaluated by EAE C57BL/6 mice vaccination with plasmid DNA encoding SRB-I, 12 days after onset of the disease.
  • mice approximately six weeks old, were purchased from Harlan (Jerusalem, Israel) and maintained under SPF conditions in the Technion animal facility (Bruce Rappaport Faculty of Medicine, Technion, Haifa, Israel).
  • EAE was induced according to Semi-chronic model of MOG induced EAE in the C57BL/6 mice as described before (20).
  • SRB-I plasmid DNA vaccine was prepared as described in Example 1 of the Examples section.
  • mice 12 days after the induction of EAE (1-2 days after its onset) sick mice were separated into 3 group of 6 C57BL/6 mice that were subjected to either a single administration of plasmid DNA encoding SRB-I (pcDNA3-SRB-I), a single administration of pcDNA3 (empty vector), or no injection (control).
  • Vaccination was effected by administration of 100 ⁇ g plasmid in 100 ⁇ l PBS as described Example 1 of the Examples section.
  • Anti SRB-I monoclonal antibody was produced, and tested for its ability to modulate cytokine production by peritoneal activated macrophages as well as to affect an ongoing EAE disease
  • mice C57/B6 mice were subsequently immunized (3 weekly immunizations) with the SRB-I encoding DNA plasmid. Two weeks after the last administration, these mice were subjected to active induction of EAE. Spleen cells were obtained for production of monoclonal antibodies two weeks later with SP2 cells (ATCC) as a fusion partner as described before ( E. Harlow & D. Lane, Antibodies, Cold Spring Harbor Laboratory Press, 1998 ). Screening of positive hybridoma was done in two steps of selection. The first one selected positive antibodies producing cells according to the ability to bind SRB-I over expressed by HEK293. Supernatant isolated from hybridoma clones (1000 wells) was then subjected to FACS analysis for their ability to bind SRB-I.
  • Peritoneal macrophages were obtained from thioglycollate (25 %, 3 ml) injected C57BL/6 mice and co-cultured with 1 ⁇ g/ml LPS for 48 in the presence, or absence, of anti SRB-I polyclonal antibody (1:100, Calbichem, San Diego, CA), the monoclonal anti SRB-I antibody generated as described above (Clone 5D8, 10 ⁇ g/ml), isotype matched control antibody (IgGl ⁇ , Sigma), HDL (Chemicon International Temecula, CA) or anti murine CD36 (5 ⁇ g/ml, Santa Cruz Biotechnology, Santa Cruz, CA). Cytokine levels were determined by ELISA as described in Example 2 of the Examples section. Results are shown as mean triplicates ⁇ SE.
  • Lewis rats were subjected to active EAE as described in Example 1 of the Examples section. 1-2 days after the onset of disease these Lewis rats (6 in each group) were treated, every other day, with 100 ⁇ g/ml of monoclonal antibody 5D8 (anti SRB-I monoclonal antibody selected from hybridoma, as described above), control murine IgG1 (Sigma), anti SRB-I polyclonal antibody (produced as described in Example 1 of the Examples section), control rat IgG2a purified from EAE rats that have been subjected to an empty plasmid DNA vaccination or PBS. Data was obtained by an observer blind to the experimental protocol as described in Example 1 of the Examples section. Results are presented as mean maximal score ⁇ SE.
  • the anti SRB-I monoclonal antibody produced by spleen cells isolated from the mice treated with SRB-I encoding DNA vaccine and the anti SRB-I specific polyclonal antibody could both suppress TNF- ⁇ production (1640 ⁇ 140 and 1760 ⁇ 190 pg/ml Vs 3280 ⁇ 210 pg/ml in control samples, p ⁇ 0.001, Table 1).
  • Control IgG1 ⁇ (Sigma) had no significant effect on the production of these cytokines (Table 1).
  • HDL could reduce TNF- ⁇ , production (2560 ⁇ 130 Vs 3280 ⁇ 210, p ⁇ 0.05) but also decreased the production of the anti-inflammatory cytokine IL-10 (Table 1).
  • Anti CD36 antibodies markedly increased TNF- ⁇ production (Table 1, p ⁇ 0.01).
  • the ability of the isolated anti SRB-I monoclonal antibody to suppress EAE was evaluated in adoptive transfer experiments.
  • the antibodies were transferred to EAE rats just after the onset of disease and led to a significant reduction in disease severity (mean maximal score of 1.66 ⁇ 0.2 in treated rats Vs 3 ⁇ 0.3 in control rats, p ⁇ 0.05, Figure 4 ).
  • Anti SRB-I antibodies were used to treat an induced IBD in Lewis rats.
  • mice were induced by intrarectal instillation of 250 ⁇ l of 125 mg/ml 2,4,6-trinitrobenzene sulfonic acid (TNBS) solution (Fluka, cat# 92822) dissolved in 50 % ethanol, using 8 cm neonate feeding tube as described before [ Fiorucci, S. et al., Immunity, 17:769., 2002 ]. 24 hours post injection all rats developed bloody diarrhea and severe diarrhea in the next day, accompanied with continuous loss of weight.
  • TNBS 2,4,6-trinitrobenzene sulfonic acid
  • SRB-I polyclonal antibodies and IgG antibodies were purified as described in Example 1 of the Examples section.
  • rat anti SRB-I polyclonal antibodies DNA vaccination based antibody, produced as described in Example 1 of the Examples section, 100 ⁇ g/rat in PBS
  • rat IgG from pre-immunized rats (100 ⁇ g/rat in PBS)
  • PBS control
  • Histological sections were conducted according to Fiorucci et al., [Fiorucci, S., et al., Immunity 17:769., 2002]. Briefly, on day 15 post induction of colitis, Lewis rats were sacrificed and colons (cecum to rectum) were extracted, flushed with PBS and fixed in NBF (neutral buffered formalin). Paraffin sections (6 ⁇ m) were made and stained with H&E (hematoxylin and eosin). Each section represents ⁇ 250 sections that were screened by an observer blind to the experimental protocol.
  • Histological colon sections of untreated rats showed normal mucosa with well defined colonic crypts and glands. Histological colon sections of both control rats (positive control of PBS treated rats and rats treated with control IgG) taken 15 days post induction of colitis, showed severe signs of inflammation, megacolon, and signs of perforations ( Figures 5b-c ). Positive control of PBS treated rat sections showed diffuse, mononuclear inflammatory infiltrates in the mucosa and lamina limbal, submucosa, and muscularis mucosae ( Figure 5b ).
  • Sections displayed various degrees of damage to colonic tissue, ranging from heavily infiltrated areas with epithelial exfoliation to lesions with total destruction of mucosal surface, transmural infiltration, necrosis, and loss of tissue architecture.
  • the control IgG colon sections showed massive destruction of colonic tissue with vast necrotic areas, absence of glandular structure and complete loss of tissue architecture ( Figure 5c ).
  • Congestion and edema and congestion were seen in and around blood vessels. Damage was continuous from rectum and extended proximally up to cecum ( Figure 5c ).
  • Histological colon sections of rats treated with anti SRB-I antibodies showed very little signs of inflammation, no perforations, and smaller and paler colons ( Figure 5d ).
  • Sections showed moderate inflammatory infiltration, compared to control IgG treated rats ( Figure 5d Vs. Figure 5c ). Although infiltrated, colonic mucosa seems intact with visible brush border and glands and no transmural infiltrates. Submucosa was also much less infiltrated with no wall thickening ( Figure 5d ).
  • a monoclonal human anti SRB-I antibody was produced for therapeutic use.
  • DNA encoding human SRB-I was amplified using sense primer: 5' CCATGGGCTGCTCCGCCAAA 3' (SEQ ID NO: 6), and anti-sense primer: 5' CTACAGTTTTGCTTCCTGCAG 3' (SEQ ID NO: 7)
  • anti-sense primer 5' CTACAGTTTTGCTTCCTGCAG 3' (SEQ ID NO: 7)
  • the above described reaction mixture was subjected to an amplification program of 1 min at 95 °C, 1 min at 55 °C and 1 min at 72 °C for 25 cycles, generating 1.53 kb DNA fragment of SEQ ID NO:8 (Homo sapiens encoding SRB-I mRNA, nucleotides 70-1599 from accession number :Z22555).
  • SEQ ID NO:8 Homo sapiens encoding SRB-I mRNA, nucleotides 70-1599 from accession
  • PCR product was gel-purified, cloned into a pUC57/T vector (T-cloning kit K1212; MBI Ferments, Vilnius, Lithuania) and then used to transform E. coli cells. Clones were then sequenced (Sequenase version 2; Upstate Biotechnology, Cleveland, OH) and transferred into a pcDNA3 vector (Invitrogen, San Diego, CA). Large-scale preparation of plasmid DNA was conducted using Mega prep (Qiagen, Chatsworth, CA).
  • HEK293 (ATCC) were transfected with human SRB-I as described before [ Scarselli E, et al., EMBO J. 21(19):5017-25, 2002 ]. Expression was verified by FACS analysis as described before [ Scarselli E, et al., EMBO J. 21(19):5017-25, 2002 ].
  • mice anti SRB-I monoclonal antibodies were produced according to one of the two following protocols:
  • mice C57/B6 mice were subsequently immunized (3 weekly immunizations) with the human SRB-I (SEQ ID NO:8) encoding DNA plasmid. Two weeks after the last administration, these mice were subjected to active induction of EAE. Spleen cells were obtained for production of monoclonal antibodies two weeks later with SP2 cells (ATCC) as a fusion partner as described before ( E. Harlow & D. Lane, Antibodies, Cold Spring Harbor Laboratory Press, 1998 ). Screening of positive hybridoma was done in two steps of selection. The first one selected positive antibodies producing cells according to the ability to bind the recombinant SRB-I over expressed by HEK293. Supernatant isolated from hybridoma clones (1000 wells) was then subjected to FACS analysis for their ability to bind SRE-I
  • the cloned human SRB-I (SEQ ID NO:8), obtained as described above, was re-cloned into a pQE expression vector, expressed in E. coli (Qiagen) and then purified by an NI-NTA-supper flow affinity purification of 6xHis proteins (Qiagen). After purification, the purity of the recombinant human SRB-I was verified by gel electrophoresis followed by sequencing (N terminus) by the Technion's sequencing services unit (Technion, Haifa, Israel). This recombinant human SRB-I was then injected into BALB/C mice.
  • First immunization was of 50 ⁇ g peptide emulsified in CFA [incomplete Frennd's adjuvant (IFA) supplemented with 10 mg/ml heat-killed Mycobacterium tuberculosis H37Ra in oil; Difco Laboratories, Detroit, MI] at a total volume of 400 ⁇ l into the peritoneal cavity. Later on, in a 3 weeks interval these mice were administrated with 50 ⁇ g/400 ⁇ l or recombinant human SRB-I emulsified in IFA (Difco Laboratories, Detroit, MI). Three weeks after the third interval mice were injected (intravenous) with 50 ⁇ g of recombinant human SRB-I in 100 ⁇ l PBS. Three days later spleen cells were obtained and preparation of monoclonal antibodies was conducted as described above.
  • IFA incomplete Frennd's adjuvant
  • mice monoclonal anti SRB-I antibody Potentially therapeutic mice monoclonal anti SRB-I antibody:
  • mice monoclonal anti SRB-I antibodies selected following protocol I described above
  • 3 pre-clones producing human monoclonal anti SRB-I antibodies selected following protocol II described above
  • Clones that are found cross reacting with murine SRB-I can be tested for their ability to suppress EAE (as described in Examples 1-4 of the Examples section) and IBD (as described in Example 5 of the Examples section). These clones are potentially effective in inflammation therapy of human diseases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Urology & Nephrology (AREA)
  • Rheumatology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Rehabilitation Therapy (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pain & Pain Management (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Claims (12)

  1. Verwendung eines Anti-SR-B1-Antikörpers zur Herstellung eines Medikaments zur Behandlung von entzündlichen Erkrankungen.
  2. Herstellungsartikel, umfassend Verpackungsmaterial und eine pharmazeutische Zusammensetzung, ausgewiesen zur Behandlung von entzündlichen Erkrankungen, die innerhalb des Verpackungsmaterials enthalten ist, wobei die pharmazeutische Zusammensetzung als Wirkstoff einen Anti-SR-B1-Antikörper und einen pharmazeutisch verträglichen Träger einschließt.
  3. Verfahren zur Diagnostizierung einer Veranlagung für, oder eines Vorliegens von, eine(r) entzündliche(n) Erkrankung in einem Patienten, wobei das Verfahren den Nachweis von Anti-SR-B1-Antikörpern in einer von dem Patienten erhaltenen biologischen Probe umfasst, in welcher eine Menge an diesen Anti-SR-B1-Antikörpern in der biologischen Probe im Vergleich zu der Menge derselben in einer von einem gesunden Menschen erhaltenen biologischen Probe erhöht ist und auf die entzündliche Erkrankung in dem Patienten hinweist.
  4. Verfahren nach Anspruch 3, wobei der Nachweis der Anti-Scavenger-Rezeptor-Antikörper in der biologischen Probe durch ELISA, RIA und/oder Dot-Blot durchgeführt wird.
  5. Verwendung nach Anspruch 1 oder Herstellungsartikel nach Anspruch 2, wobei der Antikörper ein neutralisierender Anti-SR-B1-Antikörper ist.
  6. Verwendung nach Anspruch 1, wobei der Antikörper in der Lage ist, ein Zytokinprofil von Makrophagen von entzündungsfördernden Zytokinen in entzündungshemmende Zytokine zu verändern.
  7. Verwendung nach Anspruch 6, wobei die entzündungsfördernden Zytokine aus der Gruppe, bestehend aus IL-12 und TNF-α, ausgewählt sind.
  8. Verwendung nach Anspruch 6, wobei die entzündungshemmenden Zytokine IL-10 umfassen.
  9. Verwendung nach Anspruch 1, wobei die entzündliche Erkrankung eine chronische entzündliche Erkrankung ist.
  10. Verwendung nach Anspruch 1, wobei die entzündliche Erkrankung eine entzündliche Darmerkrankung ist.
  11. Verwendung nach Anspruch 1, wobei die entzündliche Erkrankung multiple Sklerose ist.
  12. Verfahren nach Anspruch 3, wobei der Anti-Scavenger-Rezeptor-Antikörper ein Anti-SR-B1-Antikörper ist.
EP04720545A 2003-03-12 2004-03-14 Zusammensetzungen und verfahren zur diagnose und behandlung einer entzündung Expired - Lifetime EP1601374B2 (de)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US45351203P 2003-03-12 2003-03-12
US45351403P 2003-03-12 2003-03-12
US453514P 2003-03-12
US453512P 2003-03-12
PCT/IL2004/000241 WO2004080385A2 (en) 2003-03-12 2004-03-14 Compositions and methods for diagnosing and treating an inflammation

Publications (4)

Publication Number Publication Date
EP1601374A2 EP1601374A2 (de) 2005-12-07
EP1601374A4 EP1601374A4 (de) 2006-06-28
EP1601374B1 true EP1601374B1 (de) 2008-09-24
EP1601374B2 EP1601374B2 (de) 2012-05-23

Family

ID=32994504

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04720545A Expired - Lifetime EP1601374B2 (de) 2003-03-12 2004-03-14 Zusammensetzungen und verfahren zur diagnose und behandlung einer entzündung

Country Status (4)

Country Link
EP (1) EP1601374B2 (de)
AT (1) ATE409046T1 (de)
DE (1) DE602004016732D1 (de)
WO (1) WO2004080385A2 (de)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8017113B2 (en) 2003-03-12 2011-09-13 Rappaport Family Institute For Research In The Medical Sciences Compositions and methods for diagnosing and treating an inflammation
US7749714B2 (en) 2003-03-12 2010-07-06 Rappaport Family Institute For Research In The Medical Sciences Compositions and methods for diagnosing and treating prostate cancer
EP2147011A4 (de) * 2007-04-16 2012-07-18 Health Research Inc Verfahren zur inhibierung von scavenger receptor-a und erhöhung der immunreaktion auf antigene
EP2183596B1 (de) 2007-07-24 2012-10-03 ITH Immune Therapy Holdings AB Verfahren und mittel zur vorhersage der anfälligkeit für systemischen lupus erythematodes
US9068971B2 (en) * 2012-12-18 2015-06-30 Biocrine Ab Methods for treating and/or limiting development of diabetes
US20170274001A1 (en) * 2014-09-08 2017-09-28 Yale University Compositions and Methods for Increasing Red Blood Cells

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000288A2 (en) * 1994-06-23 1996-01-04 Massachusetts Institute Of Technology Class bi and ci scavenger receptors

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5529898A (en) * 1993-08-19 1996-06-25 Duke University Methods of detecting disorders of the central nervous system by detecting autoantibodies which specifically bind ionotropic glutamate receptors
US20020099040A1 (en) * 1997-09-05 2002-07-25 Monty Krieger Sr-bi antagonists and use thereof as contraceptives and in the treatment of steroidal overproduction
US20090011974A1 (en) † 2002-10-30 2009-01-08 Bocharov Alexander V Scavenger Receptor B1 (Cla-1) Targeting for the Treatment of Infection, Sepsis and Inflammation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000288A2 (en) * 1994-06-23 1996-01-04 Massachusetts Institute Of Technology Class bi and ci scavenger receptors

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BOCHAROV: "Synthetic Amphipathic-Helical Peptides", BASIC SCIENCE SUPPL. II CIRCULATION, vol. 106, no. 19, 5 November 2002 (2002-11-05), pages II84 - II85 *

Also Published As

Publication number Publication date
WO2004080385A2 (en) 2004-09-23
WO2004080385A3 (en) 2005-08-04
EP1601374A4 (de) 2006-06-28
EP1601374A2 (de) 2005-12-07
EP1601374B2 (de) 2012-05-23
DE602004016732D1 (de) 2008-11-06
ATE409046T1 (de) 2008-10-15

Similar Documents

Publication Publication Date Title
US9611324B2 (en) Compositions and methods for diagnosing and treating an inflammation
US11207393B2 (en) Regulatory T cell PD-1 modulation for regulating T cell effector immune responses
US8507273B2 (en) Gene encoding a multidrug resistance human P-glycoprotein homologue on chromosome 7p15-21 and uses thereof
US8486641B2 (en) Compositions and methods for diagnosing and treating prostate cancer
US10066014B2 (en) Anti CD84 antibodies, compositions comprising same and uses thereof
EP1601374B1 (de) Zusammensetzungen und verfahren zur diagnose und behandlung einer entzündung
WO2008146272A2 (en) Compositions and methods for treating cxcr6/cxcl16 associated diseases
IL170819A (en) Anti-sr – 1b compounds for the treatment of inflammation
IL190101A (en) Anti-sr – b1 antibodies and preparations containing them for the diagnosis and treatment of inflammation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050915

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
RIC1 Information provided on ipc code assigned before grant

Ipc: G01N 33/564 20060101ALI20060516BHEP

Ipc: A61K 48/00 20060101ALN20060516BHEP

Ipc: C07K 14/705 20060101ALN20060516BHEP

Ipc: C07K 16/28 20060101ALI20060516BHEP

Ipc: A61K 39/395 20060101ALI20060516BHEP

Ipc: A61K 39/00 20060101AFI20050823BHEP

Ipc: A61P 37/02 20060101ALI20060516BHEP

Ipc: C07K 16/46 20060101ALI20060516BHEP

A4 Supplementary search report drawn up and despatched

Effective date: 20060529

17Q First examination report despatched

Effective date: 20070410

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REF Corresponds to:

Ref document number: 602004016732

Country of ref document: DE

Date of ref document: 20081106

Kind code of ref document: P

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

Ref country code: AT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

NLV1 Nl: lapsed or annulled due to failure to fulfill the requirements of art. 29p and 29m of the patents act
PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: BE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20081224

Ref country code: ES

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090104

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: NL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090224

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

PLBI Opposition filed

Free format text: ORIGINAL CODE: 0009260

PLAX Notice of opposition and request to file observation + time limit sent

Free format text: ORIGINAL CODE: EPIDOSNOBS2

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: DK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

26 Opposition filed

Opponent name: PFIZER LIMTED

Effective date: 20090624

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

PLAF Information modified related to communication of a notice of opposition and request to file observations + time limit

Free format text: ORIGINAL CODE: EPIDOSCOBS2

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20090331

REG Reference to a national code

Ref country code: IE

Ref legal event code: MM4A

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20081224

Ref country code: IE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20090314

PLBB Reply of patent proprietor to notice(s) of opposition received

Free format text: ORIGINAL CODE: EPIDOSNOBS3

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20081225

PLAY Examination report in opposition despatched + time limit

Free format text: ORIGINAL CODE: EPIDOSNORE2

PLBC Reply to examination report in opposition received

Free format text: ORIGINAL CODE: EPIDOSNORE3

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20090314

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090325

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080924

PUAH Patent maintained in amended form

Free format text: ORIGINAL CODE: 0009272

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: PATENT MAINTAINED AS AMENDED

27A Patent maintained in amended form

Effective date: 20120523

AK Designated contracting states

Kind code of ref document: B2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

REG Reference to a national code

Ref country code: CH

Ref legal event code: AEN

Free format text: AUFRECHTERHALTUNG DES PATENTES IN GEAENDERTER FORM

REG Reference to a national code

Ref country code: DE

Ref legal event code: R102

Ref document number: 602004016732

Country of ref document: DE

Effective date: 20120523

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 13

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 14

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 15

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: ES

Payment date: 20190301

Year of fee payment: 16

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20200330

Year of fee payment: 17

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 20200330

Year of fee payment: 17

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DE

Payment date: 20200330

Year of fee payment: 17

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LI

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20200331

Ref country code: CH

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20200331

REG Reference to a national code

Ref country code: DE

Ref legal event code: R119

Ref document number: 602004016732

Country of ref document: DE

GBPC Gb: european patent ceased through non-payment of renewal fee

Effective date: 20210314

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: FR

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20210331

Ref country code: GB

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20210314

Ref country code: DE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20211001