EP1590486A2 - Method of preparing a collection of means for the detection of genes which can be induced by an inflammation mediator, and applications of same - Google Patents

Abstract

The invention relates to a method and tools for the detection of genes that can be induced by inflammation mediators, which can determine the exact physiological situation of an individual with a suspected or diagnosed inflammatory condition.

Description

 Method for preparing a collection of means for detecting genes inducible by an inflammation mediator, and applications

FIELD OF THE INVENTION

The present invention relates to a method and tools for detecting inducible genes by inflammation mediators capable of determining the precise physiological situation of an individual in whom an inflammatory condition is suspected or diagnosed.

PRIOR ART

The inflammatory reaction is one of the most common modes of response in the body to aggression. The induction of inflammation can be caused in particular by a bacterial, viral or fungal infection, by the development of cancerous tumors, by physical or chemical trauma or even during tissue necrosis.

The induction of an inflammatory state is accompanied by the release of numerous soluble mediators, in particular soluble mediators produced by neutrophils, monocytes / macrophages, lymphocytes, mast cells and platelets, these soluble mediators of inflammation. being commonly designated "cytokines", among which mention may be made of alpha, beta or gamma interferons, TNF alpha or interleukin-6.

Today, the clinical diagnosis of an inflammatory condition is mainly carried out by observation of various symptoms systematically found in well-listed pathologies, such as, for example, chronic inflammatory rheumatism, these symptoms possibly being easily identified, such as for example in the case of recent acute pneumonia. And when the causes of the inflammatory syndrome cannot be directly determined, we look for additional clinical clues allowing to guide a possible diagnosis, additional indices which are not necessarily accessible to the conventional diagnosis.

To complete the conventional diagnosis described above, it would be possible to detect the presence of the expression and / or the level of expression of certain genes known to be activated during the development of inflammation, such as some mediators of inflammation cited above.

However, to the knowledge of the applicant, there is currently no specific device making it possible to detect the presence of the expression and / or the level of expression of genes coding for mediators of inflammation.

The Japanese company TaKaRa Biomedicals markets a DNA chip on which are immobilized approximately 240 fragments of cDNA, with a length of approximately 300 bases each, derived from genes encoding cytokines, such as the genes encoding TNF, interleukin 1 alpha, interleukin 16, “Platelet Derived Growth Factor beta” or “PDGF-beta”, or gamma interferon. However, this DNA chip essentially contains cDNAs derived from genes encoding many other proteins not specifically linked to inflammation, such as prolactin, the tumor protein p53, integrins, the oncogene GRO2, the activator of the protein. RAS p21, ribosomal protein S5, chromatin-binding proteins, homologous protein of MutY from E. Coli, cyclin A2, and many enzymes belonging to various classes such as reductases, dehydrogenases etc.

The complementary diagnostic assistance tools available today are very incomplete because the cDNAs immobilized on these DNA chips are not representative of the multiple physiological situations that can be encountered during the triggering of an inflammatory reaction of a given type, in an individual.

There is therefore a need, in the prior art, for tools allowing a more precise detection of the physiological situation of a given individual, in whom the occurrence of an inflammatory reaction is suspected, or in whom has already been diagnosed with an inflammatory condition, whether local or systemic. SUMMARY OF THE INVENTION

The present invention relates to a method for preparing a set of means for detecting, in a body sample previously collected from an individual, the expression or level of expression of genes inducible by an inflammation mediator. It also relates to a set of detection means prepared by said method, comprising a collection of specific nucleotide probes.

The invention also relates to a device for detecting the expression, or the level of expression of genes inducible by an inflammation mediator.

The invention also relates to the use of a probe or of a plurality of nucleotide probes as defined above, for detecting the presence, in a sample, of one or of a plurality of acids ( s) nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of an inducible gene by a mediator of inflammation.

The invention also relates to a method for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of a gene inducible by an inflammation mediator, characterized in that said method comprises the following steps: a) bringing into contact a set of detection means as defined above or a device as defined above, with a sample to be tested; b) detecting the hybrids formed between the nucleotide probe (s) contained in said set of means or in said device and the nucleic acids possibly present in the sample.

The invention also relates to a method for producing an expression profile of inducible genes by an inflammation mediator from a sample containing the messenger RNAs synthesized by the cells of a human or non-human mammal. , or cDNAs obtained from said messenger RNAs, characterized in that it comprises the following steps: a) contacting a set of detection means as defined above or a device as defined above with said sample; c) Determine the identity of the nucleotide probes included in the set of means or in the device which are hybridized with the nucleic acids contained in the sample.

Also forming part of the invention are kits or kits suitable for implementing the above methods.

General definitions

Sample

By “sample” is meant according to the invention a material resulting, directly or indirectly, from the removal of a tissue fragment or an aliquot of biological fluid from a human or non-human mammal whose physiological situation is to be specified. vis-à-vis a possible inflammatory reaction. The initial sample can be the result of a biopsy performed in the individual, or a sample of a biological fluid such as a blood, saliva, tears, urine sample, etc. The sample also includes a medium containing the cellular messenger RNAs extracted from a biopsy or from a sample of biological fluid. The sample can also be a medium containing cDNAs obtained from messenger RNAs previously extracted from the biopsy or from the removal of the biological fluid.

Nucleic acid, nucleoid, etc.

According to the invention, any conventional technique of molecular biology, microbiology and recombinant DNA known to those skilled in the art can be used. Such techniques are described for example by SAMBROOK et al. (1989), GLOVER (1985), GAIT (1984), HAMES and HIGGINS (1984) and AUSUBEL et al. (1994).

According to the invention, the term “nucleic acid” means a bonuleoside deoxy, a ribonucleoside, a deoxyribonucleotide polymer, a hbonucleotide polymer, either in the form of a single-stranded molecule or of a double-stranded molecule, including RNA, DNA or a hybrid RNA / DNA molecule. The term "nucleic acid" embraces unnatural analogs of natural nucleotides.

Thus, the term "nucleotide" designates both natural nucleotides (A, T, G, C) as well as modified nucleotides which comprise at least one modification such as (i) a purine analog, (ii) a analog of a pyrimidine, or (iii) a similar sugar, such modified nucleotides being described for example in PCT application No. WO 95/04064.

The terms "nucleic acid", "polynucleotide", "oligonucleotide" or "nucleotide sequence" include RNA, DNA, cDNA or even RNA / DNA hybrid sequences of more than one nucleotide, in single strand form or in double strand form.

According to the invention, a nucleic acid “resulting directly” from the transcription of a determined gene essentially includes the messenger RNA (s) synthesized during the transcription step of said gene.

According to the invention, a nucleic acid "resulting indirectly" from the transcription of a determined gene essentially includes a cDNA obtained by the reverse transcription of a messenger RNA synthesized during the step of transcription of said gene. In general, reverse transcription of messenger RNA is carried out in the presence of a reverse transcriptase enzyme.

Gene inducible by an inflammation mediator

According to the invention, a gene "inducible by an inflammation mediator" consists of a gene whose transcription step or translation step is modified under the action of an inflammation mediator. Primarily, this expression encompasses genes whose transcription is activated by the action of an inflammation mediator. However, it also includes genes whose transcription is inhibited or blocked by an inflammation mediator.

By “inflammation mediator”, within the meaning of the invention, is meant a cytokine produced by the cells during the initiation or the development of an inflammatory reaction, local or systemic, in a human or non-human mammal. Mediators of inflammation include:

- Cytokines having a biological activity of increasing capillary permeability, such as histamine, bradykinin, C3a, C5a, LTC4, LTD4, PGE2, prostaglandins, factor XII, the kiniogenic factor;

- cytokines having a biological vasoconstriction activity, such as Thromboxane A2, leukotrienes C and D;

- Cytokines having a biological activity of increasing the adhesiveness of phagocytes to endothelial cells, such as interleukin-1, TNF-α or LTB4;

- Cytokines having a biological activity of inducing or activating the proliferation of medullary stem cells, such as interleukin-1 and C3c;

- cytokines having a biological activity of cellular chemotaxis, such as C5a, LTB4, interleukin-8, PAF (for the “Platelet Agregating Factor”), histamine, laminin, collagen fragments, lymphocyte factors, chemotactic factors;

- Cytokines having the biological activity of release of lysosomal intragranular mediators, such as C5a, interleukin-8, PAF;

- Cytokines having the biological activity of increasing the production of oxygen radicals, such as C5a, TNF-α, PAF, interleukin-8, interferon-γ (gamma);

- Cytokines having the biological activity of increasing phagocytosis, such as C3b, the Fc part of IgG, interferon-τ, fibronectin;

- cytokines having a biological activity of formation of inflammatory granulomas, such as interferon-γ, TNF-α and interleukin-1;

- pyrogenic cytokines, such as PGE2, interleukin-1 and TNF-α; - type I interferon cytokines, such as interferon-α, interferon-β and interferon-ω and type 11 interferon cytokines, such as interferon-γ;

- other cytokines, such as interleukin-1, interleukin-2, interleukin-3, interleukin-4, interleukin-5, interleukin-6, interleukin-7, Interleukin-8, Interleukin-9, Interleukin-10, Interleukin-12, Interleukin-13, Interleukin-15, Interleukin-17 or TNF-α.

Preferably, the "inflammation mediators" capable of inducing the genes selected according to the invention mainly include the type I and type II interferons defined above, TNF-α, IL-1, l 'IL-2, IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL -13, IL-15, angiotensin, LIF, CNTF, PDGF, erythropoietin, GCSF, GMCSF, growth hormone, oncostatin, prolactin and thrombopoietin.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides a method for preparing a set of means making it possible to detect the presence, in a sample, of nucleic acids resulting, directly or indirectly, from the transcription of one or more genes inducible by an inflammation mediator.

As previously stated, the initiation and development of an inflammatory reaction in an individual is accompanied by the release of various soluble factors by the cells, called mediators of inflammation. Through a cascade reaction, the mediators of inflammation thus released will induce or stimulate the expression of other genes by cells, some of which are already known.

The detection of the expression and / or the level of expression of these inducible genes by the various mediators of inflammation would therefore make it possible to determine the state of activation of a set of markers associated with the existence of 'an inflammatory reaction in the individual.

Such detection is therefore likely to supplement a prior clinical diagnosis, without this detection, in itself, is not an essential step in a process for diagnosing an inflammatory condition in an individual.

The applicant has shown according to the invention that the genes inducible by an inflammation mediator have common nucleic sequence characteristics.

More specifically, it is shown according to the invention that the sequence of certain genes inducible by an inflammation mediator obligatorily contain a sequence corresponding to the original definition of a first nucleotide consensus motif designated "ISRE / IRF-E" or “ISRE”, or a sequence corresponding to the original definition of a second nucleotide consensus motif designated “IWRM”, the original sequence characteristics of which are described in detail in the present description.

The work carried out by the inventors made it possible to define, for the first time, said consensus nucleotide patterns “ISRE” and “IWRM”, which made it possible to develop, according to the invention, a process for the preparation of '' a set of means for detecting the expression, or level of expression, of genes inducible by an inflammation mediator.

Thanks to the invention, the person skilled in the art therefore has the basic means enabling him to manufacture nucleotide probes specific for genes inducible by an inflammation mediator.

The use of these specific nucleotide probes, in hybridization reactions with nucleic acids contained in a sample, now makes it possible for those skilled in the art to determine precisely the physiological situation of an individual, at the time of taking a body sample from this individual, in whom any inflammatory reaction is already suspected or already diagnosed, whether it is a local or generalized inflammatory reaction, or, if applicable, a known systemic inflammatory syndrome under the name of SIRS.

Process for the preparation of a set of detection means of the invention.

Genes inducible by an inflammation mediator according to the invention The applicant has shown according to the invention that the genes which have, in their sequence, a nucleotide consensus motif "ISRE" or a nucleotide consensus motif "IWRM", motifs the structure of which is defined in detail below, consist of genes inducible by at least one inflammation mediator.

More specifically, the applicant has shown that the “ISRE” motif is in particular characteristic of genes inducible by type I interferons (IFN-α, IFN-β and IFN-ω) and type II interferons (IFN-γ) , as well as IL-6 and the TNF + IFN-γ combination.

More specifically, the applicant has shown that the “IWRM” motif is in particular characteristic of genes inducible by type II interferons (IFN-γ), and has contributed to highlighting a response of the genes containing the “GIRE” motif to IL-1, IL-2, IL-3, IL-4, IL-5, IL- 6, IL-9, IL-10, IL-12, IL-13, IL-15, angiotensin, LIF, CNTF, PDGF, erythropoietin, GCSF, GMCSF, growth hormone, oncostatin, prolactin and thrombopoietin.

The applicant has thus shown according to the invention that the genes inducible by an inflammation mediator are defined respectively as the genes having in their sequence the following structural characteristics:

- (i) the genes which comprise, in their sequence, a nucleotide consensus motif designated “ISRE / IRF-E” or even “ISRE”, which is characterized, according to the invention, by the following sequences: (i-1) the sequence SEQ ID No. 1 following "5'-NNNGAA [N] _x GAAACN- 3 '" (sense sequence), in which each "N" represents, independently of one another, a nucleotide chosen from A, T (or U), G, or C and "x1" is an integer equal to 2 or 3; and (i-2) the following sequence SEQ ID No. 2 "5'- NGTTTC [N] _x2 TTCNNN -3 '" (antisense sequence), in which each "N" represents, independently of one another, a nucleotide chosen from A, T (or U), G, or C and "x2" is an integer equal to 2 or 3. - (ii) genes which comprise, in their sequence, a nucleotide consensus motif designated "IWRM", "which can be characterized according to the invention by the following sequences:

(ii-1) the following sequence SEQ ID N ° 3 “5'-ATTTC [N] _y ιGAAA-3 '” (sense sequence), in which each “N” represents, independently of one another, a nucleotide chosen from A, T (or U), G, or C and “y1” is an integer equal to 3, 4 or 5. (ii-2) the sequence SEQ ID N ° 4 following “TTTC [N] _y2 GAAAT "(Antisense sequence), in which each" N "represents, independently of one another, a nucleotide chosen from A, T (or U), G, or C and" y2 "is an integer equal to 3, 4 or 5.

Process for the preparation of a set of detection means according to the invention.

The subject of the invention is a method for the preparation of a set of means for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each resulting nucleic acid, directly or indirectly, from the transcription of a gene inducible by an inflammation mediator, characterized in that said method comprises the following steps: a) preparing a collection of nucleic acids contained in genes inducible by a mediator of l inflammation, according to the following preparation steps: ai) (i) Select, from one or more collections of nucleotide sequences of human origin, all of the sequences of which cover at least once the entire human genome, the sequences comprising at least one copy of a sequence chosen from sequences SEQ ID No. 1 to 4, then (ii) create a first collection of nucleotide sequences from each sequence previously selected ected, each nucleotide sequence contained in said first collection consisting, from the 5 ′ end towards the 3 ′ end, of the sequence SEQ ID No. 1, 2, 3 or 4, followed by the 285 consecutive nucleotides located in each sequence selected in (i), immediately on the 3 'side of the last 3' nucleotide of said sequence SEQ ID No. 1, 2, 3 or 4;

a2) (i) for each of the nucleotide sequences contained in said first collection created in step ai), eliminate the sequence SEQ ID No. 1, 2, 3 or 4 located at the 5 'end of said nucleotide sequence and ( ii) create a second collection of sequences containing all the sequences modified in (i), each of the sequences contained in said second collection constituting a "probe";

a3) (i) Search, for each of the nucleotide sequences contained in the second collection of sequences created in step a2), of the presence of at least one copy of a sequence SEQ ID No. 1, 2, 3 or 4, then (ii) elimination, in said second collection, of sequences comprising at least one copy of one of the sequences SEQ ID No. 1, 2, 3 or 4, whereby a third collection of sequences, not comprising the sequences thus eliminated, is created;

a4) (i) Search, for each of the nucleotide sequences contained in the third collection of sequences created in step a3), of each sequence of nucleotides corresponding to a nucleotide sequence of “Alu” type or of “repeated” type capable of be contained in said nucleotide sequence, then (ii) modification of the sequences comprising such a sequence of nucleotides, by masking said sequences of nucleotides corresponding to a nucleotide sequence of “Alu” type or of “repeat” type by replacement of each nucleotide A , T, G or C contained in said “Alu” or “repeated” sequence with a nucleotide “N” meaning indifferently A, T, G or C, then (iii) create a fourth collection of sequences containing all the sequences contained in the third collection, possibly modified according to (ii); a5) (i) Select, from one or more collections of sequences containing nucleotide sequences consisting of transcripts of the human genome, the sequences comprising at least one of the nucleotide sequences contained in the fourth collection of sequences created at step a4), then (ii) create a fifth collection of sequences containing all the sequences selected in (i);

a6) (i) Select, in the fifth collection of sequences created in step a5), the sequences comprising at least 60 consecutive nucleotides defining a sequence having at least 97% nucleotide identity with a nucleotide sequence included in at least one of the “probes” contained in the second collection of sequences created in step a2), then (ii) creating a sixth collection of nucleotide sequences containing the sequences thus selected, said sixth collection of sequences consisting of the collection of nucleic acids contained in genes inducible by an inflammation mediator;

b) synthesizing a collection of nucleotide probes specifically hybridizing with the transcription product of at least one gene inducible by an inflammation mediator, said gene comprising a nucleotide sequence contained in the sixth collection of sequences prepared in step a6) , said collection of probes thus synthesized consisting of the set of means for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly , transcription of an inducible gene by an inflammation mediator.

Six collections of sequences have been designated in step a) of the above method, essentially for the sake of clarity in understanding the method. According to a first embodiment, the six collections of sequences can concretely consist of six distinct collections of sequences.

According to a second embodiment, a single collection of sequences is created, the content of which in sequences is modified as each of the steps ai) to a6) is carried out.

According to yet another embodiment, less than six collections of sequences are created, only some of them being created specifically during the performance of one or more of the steps ai) to a6) of the method, the others collections designated in the process each resulting at a given stage of the process, from a simple modification of the content in sequences of a collection created in the previous stage.

According to a particular aspect of the above method, the collection of detection means that it makes it possible to prepare comprises, for each gene inducible by an inflammation mediator, several probes hybridizing specifically with the latter.

Advantageously, according to this particular aspect, the collection of detection means comprises, on average, at least two, preferably three, and quite preferably at least four probes which hybridize specifically with each gene inducible by a mediator of the 'inflammation.

Advantageously, the method described above is characterized in that it further comprises the following step c): c) immobilizing each of the nucleotide probes synthesized in step b) on a support.

Preferably, the above method is characterized in that the nucleotide probes are immobilized in an orderly manner on said support.

Preferably, the above method is characterized in that the nucleotide probes are immobilized on said support in the form of an ordered array of probes. Thus, using the method described above, the person skilled in the art is able, by simple routine operations, to synthesize the probes hybridizing specifically with the expression products of said inducible genes by a mediator of the inflammation, these probes constituting a set of detection means according to the invention, which is defined later in the description.

Detailed description of the process for the preparation of a set of detection means according to the invention. Step a) of the process

The process described in detail below was carried out successively for the sense and antisense sequences of each of the ISRE and IWRM motifs, successively on the plus (+) strand and the minus (-) strand of each of the human chromosomes, and this for all the nucleotide sequences contained in the human genome.

Step a) of the method is advantageously carried out using a computer program, said computer program containing all of the instructions necessary to control a computer, in the memory of which it is loaded, the execution of all the sub-steps of step a) of the process.

Generally, for carrying out step a) of the method by executing the instructions of a computer program, the person skilled in the art may refer to the basic software tools for programming and for searching and comparing. of nucleotide sequences described for example by AltschuI et al. (1990), Claverie et al. (1993), Wall et al. (1996), as well as the “xblast.c” and “blast.linux” software tools, the reference of which is given at the end of this description.

An illustrative example of a computer program enabling step a) of the process to be carried out, written in the Perl languages (Larry Wall et al., 1996) and C, is specified at the end of this description.

Step a) of the method of the invention is described in detail below, and express reference is made to each of the modules of the computer program capable of performing each of the substeps ai) to a6) of the method. In the embodiment of the method in which step a) is carried out using a computer program, said computer program advantageously comprises a central module, called a "master program", which includes the necessary instructions the execution of subroutines, called “modules”, each of its subroutines containing the instructions necessary for the execution of each of the sub-steps ai) to a6) of the method. In the present description, there is described the master program allowing the realization of step a) of the method for human genomic sequences which contain the first nucleotide consensus motif "ISRE". A person skilled in the art is able to easily adapt this example of a master program for human genomic sequences containing the second nucleotide consensus motif "IWRM", by replacing in the program the structural characteristics of the "ISRE" motif with the structural characteristics of the “IWRM” motif which have been detailed previously in the present description.

Step ai) corresponding to the pq1.pl program module

Search and successively retrieve the ISRE consensus pattern then IWRM in the form of a regular expression within a complete genome (in this case the draft of the human genome, UCSC version of June 13, 2001, http: //genome.ucsc. edu /) with an offset window of +1 followed by a sequence of 285 nucleotides (called "Electronic" Probe) directly downstream of each pattern found.

Step a2) corresponding to the pg2.pl program module

This step consists of eliminating, from the file resulting from the first step, each pattern found and keeping the adjacent Electronic Probe (so as to exclude a localization of the consensus patterns on a transcribed sequence).

Step a3) corresponding to the pq3.pl program module

At this stage, each of the Electronic Probes is tested for the possible presence of a second or more identical patterns in downstream of the first. Only Electronic Probes that do not contain it are kept.

The complementary sense and reverse pattern (antisense) are successively sought.

Step a4), filtering step corresponding to the modules pq4 160.pl and pg4 15.pl, respectively

At this stage, we compare each of the Electronic Probes with a bank made up of Alu sequences and Repeated Sequences (Files: alu.human and repbase.seq recovered on March 3, 2002 at the NCBI). From the repbase.seq file, all the "primate" sequences were extracted and these were added to the alu.human file to constitute the bank named alu + primate_repbase.

The comparison of each Electronic Probe against this bank, alu + primate_repbase, is carried out by a program called Blastn (1) by successively setting two values to the parameter E (Expect Value) of the blastn program, respectively 10th-160 and 10th-15. This parameter, E-Value (Expect Value) of the Blastn program, measures, after searching in a database, the number of alignments that could be due to chance. Consequently, the smaller this value, that is to say close to zero, the more significant the result obtained. In this step, the values set for this parameter, successively 10e-160 and 10e-15, are intended to retain only the long alignments and the short alignments that are statistically significant.

Only Electronic Probes meeting the criteria set in the Blastn program will be masked by means of another program called xblast (2,4), that is to say that the letters of the nucleic language (A, T, G, C) will be replaced by "N". This strategy therefore makes it possible to avoid that repeated sequences (constituting a sequence of N), present in the electronic probes, cannot be aligned with transcribed sequences (see below tc_bank-Hs). The other Electronic Probes will remain unmodified.

Step a5) corresponding to the program module pg5.pl The file resulting from step a4) (containing the electronic sequences in which the repeated sequences have been masked) is used by the Blastall program (5) against a bank of transcripts composed of the following files:

RefSeq

File rna.gbk.gz (origin: ftp://ftp.ncbi.nih.gOv/refseq/H sapiens / H sapi ens / RNA /) retrieved 24-07-2002.

Hs.fna.gz file (origin: ftp://ftp.ncbi.nih.goV/refseg/H sapiens / mRNA Prot /) retrieved 24-07-2002.

File mrna.gbk.gz (ohgine: lovelace. Infobiogen.fr in the following directory: / db / refseq / REFSEQ / H_sapiens / H_sapiens / mRNA /) recovered on 24-07-2002.

File rscu.gbff.Z (origin: ftp://ftp.ncbi.nih.gov/refseq/cumulative/) retrieved 24-07-2002.

UniGene

Hs.seq.uniq file. z (ohqine: ftp: //ftp.ncbi.nih.gov/repository/Unigene) retrieved 24-07-02.

GenBank:

File nt.Z (ohgine: ftp: //ftp.ncbi.nih.gov/blast/db/) retrieved 24-07-

2002; non-redundant data from GenBank, EMBL, DDBJ, PDB.

The sequences of the transcripts or ESTs recovered in each of the libraries concerned only the first 300 nucleotides. The whole has been gathered into a single file called tc_Bank-Hs.

The blastn program parameters used correspond to those defined by default.

Step a6) corresponding to the pg6.pl module The result file from step a5) was processed in order to select the significant homologies between the Electronic Probe and its transcript according to the following criteria:

- the Electronic Probe and the transcript are in the same direction, that is to say 5 '-> 3'.

- the length of the homology between the Electronic Probe and the homologous transcript is defined as a variable in the program (it was set to a value strictly greater than 60 nucleotides in this algorithm). This value was chosen on the one hand because it corresponds statistically to the size of an exon. In addition, the patterns sought (those responsible for early induction by cytokines) being predominantly located 100 nucleotides upstream from the transcription initiation site, it is highly likely that the alignment between the 285 nucleotides of the probe electronics and the first 300 nucleotides of transcripts covers a region of at least 60 nucleotides.

- In order to consider only the alignments starting at the start of the transcript (higher probability of being in the presence of the region immediately downstream of the initiation of the transcription), the program only selected the cases where the 60 nucleotides of the 300 nucleotides of the transcribed sequences are located at the 5 'end. Ideally, alignment begins at the first nucleotide of the 60 nucleotides. However, the program allowed alignment to begin within a window of 1 to 5 nucleotides from the 5 'end of the transcript (the value of 5 means preventing sequencing errors).

- the ratio of the number of identities between the Electronic Probe and that of the significantly homologous transcript is also a variable in the program (here fixed at 0.970).

Step b) of the process

In step b) of the method, a collection of nucleotide probes is synthesized specifically hybridizing with the transcript of at least one gene inducible by a mediator. inflammation, said transcript comprising a nucleotide sequence contained in the sixth collection of sequences prepared in step a6), said collection of probes thus synthesized consisting of the set of means for detecting the presence, in a sample; one or more nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of an inducible gene by an inflammation mediator.

Nucleotide probe

By “nucleotide probe”, within the meaning of the invention, is meant a polynucleotide which hybridizes specifically to a nucleic acid contained in a sample, this nucleic acid resulting, directly or indirectly, from the transcription of a determined gene, said specific gene being inducible by an inflammation mediator. A nucleotide probe of the invention does not hybridize with any other nucleic acid also contained in the same sample, under appropriate stringency conditions used for the hybridization reaction, which are preferably conditions of high stringency.

By high stringency hybridization conditions, within the meaning of the invention, is understood the following hybridization conditions:

Prehybridization: same conditions as for hybridization duration: 1 night.

Hybridization:

5 x SSPE (0.9 M NaCI, 50 mM sodium phosphate pH 11, 5 m M EDTA)

5 x Denhardt's (0.2% PVP, 0.2% Ficoll, 0.2% SAB)

100 μg / ml DNA of salmon sperm

0.1% SDS duration: 1 night. washes:

2 x SSC, 0.1% SDS 10 min 65 ° C 1 x SSC, 0.1% SDS 10 min 65 ° C 0.5 x SSC, 0.1% SDS 10 min 65 ° C 0.1 x SSC, 0.1% SDS 10 min 65 ° C.

The parameters defining the stringency conditions depend on the temperature at which 50% of the paired strands separate (Tm).

For sequences comprising more than 360 bases, Tm is defined by the relation:

Tm = 81.5 + 0.41 (% G + C) +16.6 Log (cation concentration) - 0.63 (% formamide) - (600 / number of bases) (SAMBROOK et al., (1989) , pages 9.54-9.62).

For sequences of length less than 30 bases, Tm is defined by the relation: Tm = 4 (G + C) + 2 (A + T).

Under suitable stringency conditions, in which the aspecific sequences do not hybridize, the hybridization temperature is approximately 5 to 30 ° C, preferably 5 to 10 ° C below Tm.

The hybridization conditions described above are used for the hybridization of a nucleic acid 20 bases in length and can be adapted as a function of the length of the nucleic acid whose hybridization is sought or of the type chosen marking, according to techniques known to those skilled in the art.

The suitable hybridization conditions can for example be adapted according to the teaching contained in the work of HAMES and HIGGINS (1985) or even in the work of AUSUBEL et al. (1989).

In particular, it must be taken into account that the level and the specificity of hybridization depends on various parameters, such as: a) the purity of the preparation of the nucleic acid on which the probe or the primer is to hybridize; b) the base composition of the probe or of the primer, the base pairs GC having a greater thermal stability than the base pairs A-T or AU; c) the length of the homologous base sequence between the probe or the primer and the nucleic acid; d) ionic strength: the rate of hybridization increases with increasing ionic strength and the duration of the incubation time; e) the incubation temperature; f) the concentration of the nucleic acid on which the probe or the primer is to hybridize; g) the presence of denaturing agents, such as agents promoting the breaking of hydrogen bonds, such as formamide or urea, which increase the stringency of the hybridization; h) the incubation time, the incubation rate increasing with the duration of the incubation; i) the presence of bulk exclusion agents, such as dextran or dextran sulfate, which increase the rate of hybridization by increasing the effective concentrations of the probe or primer and l nucleic acid which is to hybridize within the preparation.

Preferably, a nucleotide probe according to the invention has a nucleotide sequence exactly complementary to the targeted target sequence. For the purposes of the present invention, a first polynucleotide is considered to be "complementary" to a second polynucleotide when each base of the first nucleotide is paired with the base complementary to the second polynucleotide whose orientation is reversed. The complementary bases are A and T (or A and U), and C and G.

Nucleotide probes of the invention

A nucleotide probe according to the invention is a nucleotide probe specifically hybridizing, under high stringency hybridization conditions, with the nucleotide sequence of a messenger RNA, or of the corresponding cDNA, which is the product of the transcription of a gene inducible by an inflammation mediator of the invention.

A nucleotide probe of the invention is at least 20 nucleotides in length and can reach a length of several kilobases, for example up to 6 kilobases, the maximum size of the probe being limited by the size of the targeted target sequence. Advantageously, a probe nucleotide according to the invention has a length ranging from 20 to 500 bases in length, preferably from 20 to 250 bases in length.

For example, a nucleotide probe according to the invention can comprise 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500, 600, 7100, 800, 900, 1000, 2000, 3000 or 4000 bases in length, the maximum size of the probe being limited by the size of the target nucleic acid targeted.

In general, the length of a nucleotide probe according to the invention can be defined by the following formula:

Ls = x in which:

- Ls is the length in bases of the probe, and

- x is an integer equal to or greater than 20, and x is equal to or less than the base length (La) of the target nucleic acid targeted, resulting directly or indirectly from the transcription of an inducible gene by a mediator of l 'inflammation.

A nucleotide probe according to the invention can be prepared by any suitable method well known to those skilled in the art, including by cloning and action of restriction enzymes or also by direct chemical synthesis according to techniques such as the phosphodiester method of NARANG et al. (1979) or BROWN et al. (1979), the diethylphosphoramidit.es method of BEAUCAGE et al. (1980) or the solid support technique described in European patent NΕP 0 707 592.

Each of the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention are included in a single cDNA obtained by reverse transcription of the messenger RNAs constituting a transcription product of a gene inducible by a mediator of inflammation. Each of the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention can therefore only be found in the sequence of a determined gene, or is complementary to a messenger RNA which is not produced only from this unique gene.

To manufacture a nucleotide probe according to the invention, which hybridizes with a determined gene whose expression is inducible by a mediator of inflammation, a person skilled in the art can synthesize a polynucleotide whose sequence is identical to a sequence of at least 20 consecutive nucleotides of the cDNA corresponding to this gene, or a polynucleotide complementary to a sequence of at least minus 20 consecutive nucleotides of a messenger RNA produced by this gene. The size of the target sequence will depend on the size sought for the nucleotide probe, within the limits specified above.

From each of the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention, those skilled in the art can easily obtain the complete messenger RNA or the complete cDNA corresponding to a single gene whose expression is inducible by a mediator of inflammation.

According to a first method, a person skilled in the art can search for the complete mRNA or cDNA sequence of the single gene comprising one of the sequences contained in the sixth collection of sequences created in step a6) of the method of invention according to the following steps:

(i) make a comparison between the sequences contained in one or more electronic sequence databases and the reference sequence contained in the sixth collection of sequences of the invention;

(ii) select the sequence or sequences listed in said one or more databases and which contain said reference sequence;

(iii) select, in the complete sequence selected in step (ii), the sequence of the polynucleotide to be synthesized to manufacture the nucleotide probe

According to a second method, a person skilled in the art can synthesize at least one nucleotide primer specific for a single gene, from the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention, then use this primer to produce a complete cDNA from a single messenger RNA with which said primer hybridizes, under the appropriate hybridization conditions, preferably high stringency hybridization conditions. The hybridization step, then the extension of the primer can be carried out by a person skilled in the art according to techniques conventional, by prior extraction of messenger RNAs present in human or non-human mammalian cells, in primary culture or in cell line, then contacting the specific primer under the appropriate hybridization conditions, then elongation of the primer in the presence of reverse transcriptase. The nucleotide primer having undergone the elongation described above can then be directly used as a specific probe. Alternatively, the nucleotide primer having undergone the elongation described above can serve as a starting product for the manufacture of the final specific probe, for example by the action of xonucleases, or also by the action of endonucleases of restriction, according to techniques well known to those skilled in the art.

According to a third method, a person skilled in the art can synthesize at least one nucleotide primer specific for a single gene, from the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention, then use this primer to produce complete cDNA from a collection of clones comprising vectors into which cDNAs originating from human or non-human mammal cells are inserted, according to techniques known to those skilled in the art. The complete cDNA thus generated can then be directly used as a specific probe. Alternatively, the complete cDNA can serve as a starting product for the manufacture of the final specific probe, for example by the action of xonucleases, or also by the action of restriction endonucleases, according to techniques well known in the art. skilled in the art.

Set of means and detection device according to the invention

The subject of the invention is a set of means for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly, from transcription a gene inducible by an inflammation mediator, characterized in that said set of means comprises, for each nucleic acid whose presence is sought, at least one nucleotide probe hybridizing specifically with said nucleic acid, said set of means being prepared by the process which has been described in detail in the present description.

The sixth collection of sequences, which consists of the collection of nucleic acids contained in genes inducible by an inflammation mediator, comprises unique sequences contained in genes which had, in the prior art, been more or less less characterized, from the point of view of their function. Thus, we can distinguish according to that for each of these genes:

(i) said gene had already been characterized as being involved in inflammation;

(ii) said gene possessed at least one function known in at least one physiological field other than inflammation;

(iii) said gene still had no known function.

The set of detection means of the invention comprises at least one probe which hybridizes specifically with a gene belonging

(a) in category (ii) above genes whose involvement in an inflammatory reaction was not known before the present invention or

(b) in category (ii) above genes for which no function had been identified before the invention.

Thus, according to a first preferred embodiment of a set of detection means according to the invention, said set of detection means comprises at least one probe hybridizing with a gene comprising a nucleotide sequence chosen from the sequences SEQ ID N ° 5 to SEQ ID N ° 10. The nucleotide sequences SEQ ID N ° 5 to SEQ ID N ° 10 are illustrated in particular by way of example and each consist of a single sequence found in the sequence of a gene of known function, said gene, or its expression products, which have not previously been described as genes whose expression is modified in an individual developing an inflammatory reaction. Said set of detection means can comprise probes each hybridizing specifically with a single one from 1, 2, 3, 4, 5 or 6 of the genes defined by each of the sequences SEQ ID No. 5 to SEQ ID No. 10.

According to a second preferred embodiment of a set of detection means according to the invention, said set of detection means comprises at least one probe hybridizing with a gene comprising a nucleotide sequence chosen from the sequences SEQ ID N ° 11 to SEQ ID N ° 25. The nucleotide sequences SEQ ID N ° 11 to SEQ ID N ° 25 are illustrated in particular in the example and each consist of a unique sequence found in the sequence of a previously unknown function gene. Said set of detection means can comprise probes each hybridizing specifically with a single one from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 of the genes defined by each of the sequences SEQ ID No. 11 to SEQ ID No. 25.

According to a third preferred embodiment, said set of detection means comprises at least one probe hybridizing with a gene comprising a nucleotide sequence chosen from the sequences SEQ ID No. 5 to SEQ ID No. 10 and at least one probe s hybridizing with a gene comprising a nucleotide sequence chosen from the sequences SEQ ID No. 11 to SEQ ID No. 25.

According to a fourth advantageous embodiment, the set of means according to the invention is characterized in that the nucleotide probe or probes are chosen from polynucleotides having at least 20 consecutive nucleotides of the sequences contained in the sixth collection of sequences created at step a6) of the method of the invention, or at least 20 consecutive nucleotides of the sequences complementary to the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention.

According to a fifth advantageous embodiment, the set of means according to the invention is characterized in that the nucleotide probe or probes are chosen from the sequences contained in the sixth collection of sequences created in step a6) of the method of invention, or a sequence complementary to the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention, or among the sequences complementary to the sequences contained in the sixth collection of sequences created in step a6 ) of the process of the invention.

According to a sixth advantageous embodiment, the set of detection means according to the invention is characterized in that each nucleotide probe consists of a polynucleotide included in the sequence of a messenger RNA or of a cDNA corresponding to a gene inducible by an inflammation mediator, which gene comprises a sequence contained in the sixth collection of sequences created in step a6) of the method of the invention, or in that each nucleotide probe consists of a polynucleotide whose sequence is complementary to that of a polynucleotide included in the sequence of a messenger RNA or of a cDNA corresponding to a gene inducible by an inflammation mediator, which gene comprises a sequence contained in the sixth collection of sequences created in step a6) of the method of the invention

The set of means according to the invention comprises at least one nucleotide probe chosen from the nucleotide probes as defined above. Advantageously, the set of means according to the invention comprises all of the nucleotide probes as defined above.

According to a seventh advantageous embodiment, the set of means more includes their probes which hybridize specifically with a determined nucleic acid, resulting, directly or indirectly, from the transcription of a nductible gene by an inflammation mediator.

According to a first aspect of this seventh embodiment, for a given nucleic acid, the set of means comprises several nucleotide probes hybridizing with the same target sequence, the number of nucleotide probes of identical sequences can vary from 2 to 10 probes . According to this particular aspect, the set of means of the invention allows a quantitative measurement of the target nucleic acid contained in the sample tested.

According to a second aspect of this seventh embodiment, for a given nucleic acid, the set of means comprises several nucleotide probes hybridizing with distinct target sequences included in said nucleic acid, the number of probes possibly varying from 2 to 10 probes. According to this particular aspect, the set of means allows a high detection sensitivity, because of its capacity to detect said target nucleic acid in the test sample, even in the case where said target nucleic acid has undergone physical alterations in the sample, such as cuts by exo- or endonucleases present in the starting source material, for example in a cell extract, or present in the sample to be tested.

Similarly, according to an advantageous embodiment, the set of detection means according to the invention comprises, for a determined target nucleic acid, several nucleotide probes hybridizing specifically with the latter, as described for the probes s' hybridizing with nucleic acids comprising a sequence chosen from the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention, or a sequence complementary to the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention.

The nucleic acids comprising the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention have common structural characteristics, which are representative of nucleic acids derived from genes inducible by an inflammation mediator .

Advantageously, the set of detection means of the invention comprises at least 10, 20, 30, 40, 50, 50, 100, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 nucleotide probes as defined above.

In general, the total number of probes contained in the set of detection means of the invention depends first of all on the number of distinct target nucleic acids, each corresponding to a transcription product of a gene inducible by a mediator of inflammation, which one seeks to detect in the sample. Thus, the total minimum number of probes contained in the set of detection means of the invention is defined by the following formula:

Ns _min = y, in which:

- Ns _m j _n is the minimum number of probes; and

- y represents the number of distinct target nucleic acids that one seeks to detect.

In addition, the total number of nucleotide probes contained in the set of detection means of the invention also depends on the number of identical nucleotide probes hybridizing with the same target sequence included in a determined nucleic acid which one seeks to detect and also depends on the number of probes hybridizing with distinct target sequences included in said target nucleic acid. Thus, the number of probes contained in the set of detection means of the invention can also be expressed according to the following formula:

NtotaF [ï (aa1.A1ai) + (aa2.A1 _a2 ) + ... + (any.A1 _ay )] + [(ab1.A2 _a2 ) + (ab2.A2 _a2 ) + ... + (abny. A2 _ay )] + ... + [(ax1.AX _aX ) + (ax2.A1 _a2 ) + ... + (axny.AX _ay )]], in which:

- N tota _l is the total number of probes; and

- A1, A2, ..., AX represent the nucleic acids corresponding to the transcription products (mRNA or cDNA) of the A1, A2, ..., AX genes inducible by an inflammation mediator;

- X is an integer whose maximum value is equal to the total number of sequences contained in the sixth collection of sequences created in step a6) of the method of the invention;

- A1 _a ι, A1 _a 2,, A1 _an respectively represent the distinct target sequences ai, a2, ..., an, contained in the target nucleic acid A1, for which at least one probe hybridizes specifically;

- n is an integer between 0 and 100, and is preferably equal to 0, 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20;

- an1, an2, ..., any represent the number of identical probes hybridizing to the same target sequence A1 _a -ι, A1 _a2 ,, A1 _ay , contained in the target nucleic acid A1 and independently represent the one from the other, an integer between 0 and 100, advantageously between 0 and 50, and are preferably equal to 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20;

A mandatory condition is that all of the detection means according to the invention contain at least one hybridizing probe. specifically with a nucleic acid comprising a sequence chosen from the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention, or with a nucleic acid comprising a sequence complementary to a sequence chosen from the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention.

The greater the number of probes which hybridize specifically with distinct target nucleic acids, the more precise the physiological situation of the cells of the human or non-human mammal from which the nucleic acids of the sample originate.

According to a first preferred embodiment, the set of detection means of the invention comprises at least one probe hybridizing with each of the nucleic acids comprising a sequence chosen from the sequences contained in the sixth collection of sequences created at step a6) of the method of the invention, or comprising a sequence complementary to a sequence chosen from the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention.

According to a second preferred embodiment, all of the detection means according to the invention may comprise only some of the above nucleotide probes, depending on the suspected physiological situation of the human or non-human mammal from which the sample originates. to test.

The practical implementation of the set of detection means according to the invention may show that only certain subsets of probes will be necessary to obtain an exhaustive result of the precise physiological situation of the human or non-human mammal from which the sample comes. to be tested, according to the symptoms that this individual expresses, or according to the nature of the pre-diagnosis or clinical diagnosis already established, for example because only some of the genes inducible by an inflammation mediator are activated, or on the contrary inhibited or blocked, in a determined pathophysiological situation. Each of the nucleotide probes described above can be labeled, if desired, by incorporating a label detectable by spectroscopic, photochemical, biochemical, immunochemical or even chemical means.

For example, such markers may consist of radioactive isotopes ( ³² P, ³³ P,, ³ H, ³⁵ S,), fluorescent molecules (5-bromodeoxyuridine, fluorescein, acetylaminofluorene, digoxigenin), chemiluminescent molecules or even ligands such as biotin.

The labeling of the probes is preferably done by incorporating labeled molecules within the polynucleotides by extension of primers, or else by adding to the 5 ′ or 3 ′ ends.

The nucleotide probes constituting the set of detection means of the invention can be in free form, in suspension in a solution suitable for carrying out the hybridization reaction with the nucleic acids possibly present in the sample to be tested. .

Set of means or devices of the invention comprising the probes immobilized on a support ("DNA chips").

Most preferably, the set of detection means according to the invention is characterized in that the nucleotide probe or probes contained therein are immobilized on a support.

Nucleotide probes or primers according to the invention can be immobilized on a solid support. Such solid supports are well known to those skilled in the art and include surfaces of the wells of microtitration plates, polystyrene beads, magnetic beads, nitrocellulose strips, or even microparticles such as latex particles.

According to a preferred embodiment, the probes according to the invention immobilized on a support are ordered in arrays, as in "DNA chips". Such ordered matrices have been described in particular in US Pat. No. 5,143,854, in PCT applications No. WO 90/150 70 and 92/10092. Supporting arrays on which oligonucleotide probes have been immobilized at a high density are for example described in US Pat. Nos. 5,412,087 and in PCT application No. WO 95/11995.

According to a particularly advantageous embodiment, the probes contained in the set of detection means of the invention are immobilized on the support in an orderly manner, for example in the form of an array of probes.

Most preferably, in the ordered array of probes, the position of each separate probe is predetermined and known.

The invention also relates to a device for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly, from transcription of a gene inducible by an inflammation mediator, characterized in that said device comprises at least one nucleotide probe or a plurality of nucleotide probes as defined in the present description, the nucleotide probe or probes being immobilized on a support.

According to a first aspect, the above device is characterized in that the plurality of nucleotide probes are immobilized in an orderly manner on said support.

Said support on which the probes constituting the set of detection means according to the invention are immobilized consists of a solid support. The nucleotide probes are fixed to said support, directly or indirectly, by coupling one or more binding molecules ("linkers") to the support, then by coupling each probe to a free part of the binding molecule. By way of illustration, but not limitation, the support may be a polymeric material, a glass, a ceramic, natural fibers, a silicone, a metal and composite materials of the materials mentioned above. The support has at least one substantially flat surface. By “practically flat” is meant a surface which is macroscopically planar for optimal fixation of the nucleotide probes, for example in the form of a two-dimensional matrix network. The surface of the solid support can be functionalized with a silane, as described for example in the American patent application published under the number US 2002/20081597 (Lowe et al.).

It can also be activated as described in the American patent application published under the number 2002/20076709 (Hevesi et al.). In this case, the immobilization support for the probes comprises olefinic groups, either that the olefinic groups are constitutive of the support material, or that they are incorporated into the support material by chemical reactions or by the surface deposition of molecules containing olefinic groups. The olefinic groups can be provided, for example, by fixing them with chlorosilane derivatives, then by oxidizing the olefinic groups to aldehyde.

The surface of the support can also be functionalized by thiol groups, as described in US Patent No. US 5,412,087 (McGall et al.).

According to yet another embodiment, the nucleotide probes are fixed in a non-covalent manner on the surface of the support, as described for example in American patent application No. 2002/20042069 (Myer et al.). For example, the nucleotide probes are linked to the support by weak bonds such as electrostatic interactions, hydrophobic interactions, Van der Waals forces, etc.

In general, a set of detection means or a device according to the invention, when it is in the form of a "DNA chip", can be prepared according to the techniques described in American patent n ° US 6,403,320 (Read et al.), The PCT application published under the number WO 95/11995 (Chee et al.) Or the PCT application published under the number WO 92/10092 (Fodor et al.).

The set of detection means or the device according to the invention can also be in the form of matrices or stacked or “stacked arrays”, as described in the American patent application No. 2002/20051995 (Kumar).

For the means used for the detection of the hybrid (s) formed with a nucleotide probe according to the invention, immobilized on a support, and a nucleic acid contained in the sample to be tested, the person skilled in the art will advantageously refer to the various patent applications and patent cited above.

The detection of the hybrids formed can be carried out in particular by measuring fluorescence or measuring radioactivity, for example when the nucleic acids contained in the sample have been labeled, according to techniques known per se, either by a fluorescent molecule or by a molecule radioactive, prior to bringing them into contact with the set of detection means or with the detection device according to the invention.

The detection of the presence of a probe / nucleic acid hybrid of the sample can also be carried out by measuring the variation of various physical parameters of the support, such as the variation of the temperature, of the wavelength of a light beam, of the conductivity or resistivity of the surface of the support, at the location of the support on which is immobilized a probe which has hybridized with a nucleic acid present in the sample to be tested.

Most preferably, the location, on the surface of the support, of each nucleotide probe of known sequence is predetermined. Thus, measuring the presence of a probe / nucleic acid hybrid of the sample, at any point on the surface of the support on which the probes are immobilized, makes it possible to first determine the different locations of the surface of the support. which the presence of a probe / nucleic acid hybrid of the sample is detected and / or quantified. In a second step, a comparison of the spatial coordinates in two dimensions (for the two-dimensional ordered matrices) or in three dimensions (for the stacked or “stacked arrays”) with a preset table of correspondence between the different spatial coordinates of the support and the identity of the probe (s) immobilized at these coordinates, makes it possible directly to determine the identity of genes inducible by an inflammation mediator which are active (if a hybridization with the corresponding probe (s) is detected) or inactive (if none hybridization with the corresponding probe (s) is not detected). Applications of the set of detection means and of the detection device according to the invention

As indicated above, the set of detection means or the detection device as defined above are useful, in general, for detecting the presence of nucleic acids, mainly messenger RNA or cDNA, indicating the level of activation d one or more genes inducible by an inflammation mediator.

A subject of the invention is also the use of a probe or of a plurality of nucleotide probes as defined above, for detecting the presence, in a sample, of one or of a plurality of acids ( s) nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of an inducible gene by a mediator of inflammation.

According to such a use, it is now possible to access detailed pathophysiological data concerning a human or non-human mammal in which an inflammatory reaction, local or systemic is suspected, or in which a local or systemic inflammatory reaction has already been diagnosed, if necessary generalized, such as for example a septic shock or a SIRS. The inflammatory reactions targeted include bacterial infections, whether acute, subacute or chronic. Also included are inflammations occurring in neoplastic pathologies, including malignant lymphomas, visceral neoplasias (kidney cancers, cancers of the digestive system, lung cancers). Also included are inflammations occurring during systemic diseases, such as chronic inflammatory rheumatism (e.g. rheumatoid arthritis), autoimmune connectivities (e.g., systemic lupus erythematosus), vasculitis (e.g. Horton's disease or gnarly peri-ertheritis). Also included are inflammatory reactions occurring during cardiovascular disease (eg, deep vein thrombosis), inflammatory disease (eg, Crohn's disease). Also included are the various iatrogenic inflammatory reactions caused by side effects induced by drug therapy, such as example the induction of inflammatory side effects by the active antibiotic or anti-epileptic principles.

The invention also relates to a method for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of a gene inducible by an inflammation mediator, characterized in that said method comprises the following steps: a) bringing a set of detection means or a detection device according to the invention into contact with a sample to be tested; b) detecting the hybrids formed between the nucleotide probe (s) contained in said set of means or in said device and the nucleic acids possibly present in the sample.

According to a first aspect, the above method is characterized in that, in step b), the identity of the nucleotide probe (s) which have hybridized with the nucleic acid (s) present in the sample is determined.

According to a second aspect, the above method is characterized in that, in step b), have determined the quantitative ratios of the different nucleic acids contained in the sample and which have hybridized with the nucleotide probes.

According to a third aspect, the above method is characterized in that, in step b), the identity of the nucleotide probe or probes having hybridized with the nucleic acids contained in the sample is determined.

According to a fourth aspect, the above method is characterized in that the nucleic acids contained in the sample are messenger RNAs synthesized by a human or non-human mammalian cell.

According to a fifth aspect, the above method is characterized in that the nucleic acids contained in the sample are cDNAs obtained by reverse transcription of messenger RNA synthesized by a human or non-human mammalian cell

A main utility of the set of detection means or of the device according to the invention is that it makes it possible to produce a profile of expression of inducible genes by an inflammation mediator, from a sample from an individual to be tested.

The invention also relates to a method for producing an expression profile of inducible genes by an inflammation mediator from a sample containing the messenger RNAs synthesized by the cells of a human or non-human mammal. , or cDNAs obtained from said messenger RNAs, characterized in that it comprises the following steps: a) bringing a set of means or a device according to the invention into contact with said sample; c) Determine the identity of the nucleotide probes included in the set of means or in the device which are hybridized with the nucleic acids contained in the sample.

The invention also relates to a method for producing an expression profile of inducible genes by an inflammation mediator from a sample containing the messenger RNAs synthesized by the cells of a human or non-human mammal, or cDNAs obtained from said messenger RNAs, characterized in that it comprises the following steps: a) carrying out the method for detecting the presence, in a sample, of one or more nucleic acid (s) (s), each nucleic acid resulting, directly or indirectly, from the transcription of an inducible gene by an inflammation mediator with said sample, as defined above; c) Determine the identity of the nucleotide probes which are hybridized with the nucleic acids contained in the sample.

The results obtained, that is to say the identity of the active genes and of the non-active genes, as well as, where appropriate, the level of activation of the active genes, is of a nature to accurately reflect the physiological or pathophysiological situation. of the individual tested, once the essential stage of a clinical diagnosis has been carried out.

In addition, when several expression profiles are produced from samples taken from the same individual, at different time periods, for example at determined time intervals, the set of results obtained is likely to account for the evolution of the physiological or pathophysiological situation of the individual tested, over time.

For example, regular monitoring of the development or reduction of an inflammatory reaction or disease may be performed for a given individual.

In particular, depending on the results obtained, the drug treatment can be adapted more finely, more rigorously and more precisely than with current investigative tools.

According to yet another aspect, the implementation of a set of detection means or of a detection device according to the invention makes it possible to determine the minimum combinatorial required to bring out a lymphocyte population capable of producing a particular type of '', to characterize in detail the responses of helper lymphocytes ("helper") which control inflammatory immunity (Th1 and Th2 lymphocytes), identify the appropriate conditions to suppress the immune response (eg in the case of diseases allergic and parasitic).

According to yet another aspect, the implementation of a set of detection means or of a detection device according to the invention allows the evaluation of the effects induced by type I interferons which are commonly used as therapeutic molecules in the treatment of diseases such as cancer, viral hepatitis and multiple sclerosis. Their use has in fact been limited due to the severe side effects, which can however be, to a certain extent, predicted by a precise study of the anti-viral and immunomodulatory properties, the more effectively the more we have the means to identify. the factors responsible for these side effects. The set of detection means and the detection device which are the subject of the present invention constitute one of the possible means of identifying the factors responsible for the aforementioned side effects.

Clinical studies based on the use of cytokines in oncology, due to the complexity of the auxiliary biological activities induced, show how much a therapy based on a dose-response effect may not lead to the desired therapeutic results. For example, if a cytokine acts via immunomodulation, too large a dose may suppress the desired biological response, while too small a dose may not induce the desired biological response.

According to yet another aspect, the development of a tolerance to the immunoregulatory effect during a daily treatment may require a therapeutic intervention spaced over time. Also in this situation, the implementation of a set of detection means or a detection device according to the invention allows the clinician to quickly establish the optimal dose of drug as well as the frequency of treatment for a given individual. .

In the state of the art, the use of stem cells in order to regenerate differentiated tissues is a therapeutic approach which is being considered more and more seriously. One of the main obstacles lies in the characterization of the combination of factors making it possible to control the passage from the stem cell to a well-defined mature cell. Currently, several scientific teams are working on the development of culture media containing the molecules necessary for the development of differentiated cells of a given tissue type. According to yet another aspect, the implementation of a set of detection means or of a detection device according to the invention makes it possible to identify the appropriate combination or combinations of specific growth factors, which allow the activation of the expression of suitable genes, markers of differentiation into a given cell type.

The subject of the invention is also a kit or kit for the production of an expression profile of inducible genes by an inflammation mediator from a sample containing the messenger RNAs synthesized by the cells of a human mammal. or non-human, or cDNAs obtained from said messenger RNAs, characterized in that it comprises a set of means or a device according to the invention.

According to a first aspect, the kit or kit as defined above further comprises the reagents necessary to carry out the hybridization reaction between the nucleotide probe (s) contained in said set of means or contained in said device. According to a second aspect, the kit or kit as defined above further comprises means intended to reveal the hybrids formed between the nucleotide probe or probes contained in said set of means or contained in said device and the nucleic acids contained in the 'sample.

The present invention is further illustrated, without however being limited, by the following examples.

EXAMPLES

Example 1: Detailed description of 21 genes inducible by an inflammation mediator according to the invention from which the probes constituting the detection means according to the invention are produced.

Description of references to sequences

Each nucleotide sequence representative of a gene inducible by an inflammation mediator referenced below in the present description consists of a cDNA obtained from a messenger RNA resulting from the transcription of an inducible gene by a mediator of l 'inflammation according to the invention.

These are the sequences SEQ ID N ° 5 to 25 below.

Each nucleotide sequence below is contained in the sequence of the corresponding complete gene, said complete gene comprising in its sequence an “ISRE” motif as defined above.

The cDNA sequences were classified according to each chromosome containing the corresponding gene.

For each chromosome, the cDNA sequences have been classified according to whether they are found on the strand (+) or on the strand (-) of the DNA of the chromosome considered.

For each strand (+) or (-) of a chromosome, the sequences have been classified according to whether they are oriented in the “sense” direction or in the “antisense” direction. For each strand of a determined chromosome, the sequences have been numbered as the Nth occurrence of the “ISRE” motif considered in the sequence of said strand (+) or (-) of said chromosome.

The reference of each cDNA sequence is constituted as follows:

- “SeqX” is, for a given strand ((+) or (-)) of a given chromosome, the Xth occurrence on said strand of the “ISRE” motif;

- The reference of each sequence also includes the abbreviated name of at least one electronic sequence database in which said sequence is listed:

- "emb" means the "EMBL" database;

- "Ref" means the database "RefSeq";

- "UG" means the "UNIGENE" database;

- "Dbj" means the database "Database Japan"; and

- "gb" means the "GenBank" database

- The reference of each sequence also includes the access number [identifier number] of the sequence in at least one of the sequence databases above.

- Where appropriate, the reference of each sequence includes various annotations such as the DNA clones from which the sequence originates and the name of the protein for which this sequence codes.

To the knowledge of the applicant, none of the genes represented by each of the nucleotide sequences below has been described as a gene whose expression is linked to an inflammatory reaction.

DESCRIPTION OF THE SEQUENCES

A. Genes with an ISRE motif (coding for proteins not known to be inducible by cytokines)

SEQ ID M ° 5 (Chromosome 1 - Strand (+), Sense)

> Seq 11210: starting position: 259 403 167

REASON = CTGGAAAGGAAACAG

Seql 210

> 0emb | XM_037495 | XM_037495 Homo sapiens disrupted in schizophrenia 1

(DISC1), mRNA.

> 0NM_018662 Homo sapiens disrupted in schizophrenia 1 (DISC1), mRNA. > 0gi | 11037064 | ref | NM_018662.1 | Homo sapiens disrupted in schizophrenia 1 (DISC1), mRNA

> 0gnl | UG | Hs # S3220035 Homo sapiens disrupted in schizophrenia 1 (DISC1), mRNA / cds = (53, 2617) / gb = NM_018662 / gi = 11037064

/ug≈Hs.26985 / len = 6930

> 0gi | 11037064 | ref | NM_018662.1 | Homo sapiens disrupted in schizophrenia 1 (DISC1), mRNA

> 0gi | 8163868 | gb | AF222980.1 IAF222980 Homo sapiens disrupted in Schizophrenia 1 protein (DISC1) mRNA, complete cds

> 0emb | XM_054775 | XM_054775 Homo sapiens disrupted in schizophrenia 1

(DISC1), mRNA.

> 0gi | 3413875 | dbj | AB007926.1 | AB007926 Homo sapiens mRNA for KIAA0 57 protein, partial cds

E = 5th-52 100/100 100 +/- -. 0 1-100 (99) 103-202 (99) Identities = 100/100 (100%) Strand = Plus / Plus

Query: 103 ggaaggagcaggaggcagcccaggcggagcgggaggagctggcagcggggcgcatgccag 162

I I I I I I! I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sb] and: 1 ggaaggagcaggaggcagcccaggcggagcgggagggggccgcgcc

Query: 163 gcgggggtcctcagggcgccccagccgccgccggcggcgg 202

I I M I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct: 61 gcgggggtcctcagggcgccccagccgccgccggcggcggg 100

SEQ ID M ° 6 (Chromosome 1, strand (+) - antisense)

> Seq 918: starting position: 22311514

REASON = AGTTTCCCTTCTCGA

> 0emb | XM_027908 | XM_027908 Homo sapiens PTEN induced putative kinase

1 (PINK1), mRNA.

> 0emb | XM_027908 | XM_027908 Homo sapiens PTEN induced putative kinase

1 (PINK1), mRNA.

> 0NM_032409 Homo sapiens PTEN induced putative kinase 1 (PINK1), mRNA.

> 0gi | 14165271 | ref | NM_032409.1 | Homo sapiens PTEN induced putative kinase 1 (PINK1), mRNA > 0gnl | UG] Hs # S3619730 Homo sapiens PTEN induced putative kinase 1

(PINK1), mRNA / cds = (94, 1839) / gb = N _032409 / gi = 14165271

/ug=Hs.6163 / len = 2700

> 0g | 14733777 | ref | X _027908.1 | Homo sapiens PTEN induced putative kinase 1 (PINK1), mRNA

> 0g | 14149099 I db] | AB053323.il AB053323 Homo sapiens PINK1 mRNA for

PTEN induced putative kinase 1, complete cds

> 0emb | XM_027909 | X _027909 Homo sapiens PTEN induced putative kinase

1 (PINK1), mRNA.

> 0gι | 141652711 ref | NM_032409.1 | Homo sapiens PTEN induced putative kinase 1 (PINK1), mRNA

E = le-49 96/96 100 + / -. 0 1-96 (95) 190-285 (95) Identities = 96/96 (100%)

Strand = Plus / Plus

Query 190 cgcagaggcaccgccccaagtttgttgtgaccggcgggggacgccggtggtggcggcagc 249

IIIIIIIIIIIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIII! IIIIIIIIIIIIIIIII Sbj and ^• 1 cgcagaggcaccgccccaagtttgttgtgaccggcgggggacgccggtggtggcggcagc 60

Query 250 ggcggctgcgggggcaccgggccgcggcgccaccat 285

I I I I I I I I I I I I I I I I I I I I M I I I M I I I I I I I I Sb ^ ct- 61 ggcggctgcgggggcaccgggccgcggcgocaccat 96

SEQ ID M ° 7 (Chromosome 1, Strand (-), Antisense)

> Seq 7826: starting position 182 700 849

REASON AGTTTCCGGTTCTGT

> 0emb | XM_016238 | XM_016238 Homo sapiens spermatogenesis associated 1

(SPATA1), mRNA.

> 0emb | XM_016238 | XM_016238 Homo sapiens spermatogenesis associated 1

(SPATA1), mRNA.

> 0NM_022354 Homo sapiens spermatogenesis associated 1 (SPATA1), mRNA.

> 0gι | 11641266 | ref | N _022354.1 | Homo sapiens spermatogenesis associated 1 (SPATA1), mRNA

> 0gnl | UG | Hs # S3219762 Homo sapiens spermatogenesis associated 1 (SPATA1), mRNA / cds = (161, 1015) / gb = N _022354 / gι = 11641266 / ug = Hs. 147403 / len = 1510

> 0gι | 20533492 | ref | XM 016238.7 | Homo sapiens spermatogenesis associated 1 (SPATA1), mRNA

> 0gi | 10717164 | gb | AF306347.1 | AF306347 Homo sapiens sperm- specific protein SP-2 mRNA, complete cds

> 0gi | 11641266 | ref | NM_022354.1 | Homo sapiens spermatogenesis associated protein 1 (SPAP1), mRNA

E = le-40 87/89 97 +/-: 0 2-90 (88) 108-196 (88) Identities = 87/89 (97%)

Strand = Plus / Plus

Query: 108 gcagtcggtgggcgcggcggctgctggagcgtagcgcgacccgactcttaagttttcttt 167

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I S j and: 2 gcagtcggtgggcgcggcggctgctgaggctctc

Query: 168 tcctctccagaggggccgattagggagag 196

I I I I I I I I I M I I I I I I I I I I I I I I I I I I Sbjct: 62 tcctctccagaggggccgattagggagag 90

SEQ ID N ° 8 (Chromosome 2, Strand (-), Sense)

> Seq 7130: starting position: 138255670 MOTIF = TGGGAAAGAGAAACA

> 0emb | XM_043407 | XM_043407 Homo sapiens splicing factor, arginine / serine-rich 3 (SFRS3), mRNA.

> 0NM_003017 Homo sapiens splicing factor, arginine / serine-rich 3

(SFRS3), mRNA.

> 0gi | 4506900 | ref | NM_003017.1 | Homo sapiens splicing factor, arginine / serine-rich 3 (SFRS3), mRNA

> 0gi | 338483 | gb | 10838.1 IHUMSRP20 Homo sapiens SR protein family, pre-mRNA splicing factor (SRp20) mRNA, complete cds

E = 3e-38 83/85 97 +/- -. 0 1-85 (84) 201-285 (84) Identities = 83/85 (97%) Strand = Plus / Plus

Query: 201 atgcatcgtgattcctgtccattggactgtaaggtttatgtaggcaatcttggaaacaat 260

I I I I I I I I I I I I I I I I I M I I I I I I I I I I I I I I I I I I I I I I I M I I I! I I I I M I I I Sbj and: 1 atgcatcgtgattcctgtccattggactgtaaggtttatgtaggcaatcttggaaacaat 60

Query: 261 ggcaacaagaccgaactggaacggg 285

I I II I II M I I III II I I I I I II Sbjct: 61 ggcaacaagacggaattggaacggg 85

SEQ ID N ° 9 (Chromosome 13, Strand (-), Sense)

> Seq 4101: starting position: 76713824 MOTIF = TGAGAAACCGAAACT > 0emb | X _054401 | XM_054401 Homo sapiens putative breast epithelial stromal interaction protein (BRESI1), mRNA.

> 0NM_033255 Homo sapiens epithelial stromal interaction 1 (breast)

(EPSTI1),

> 0gi | 15147247 | ref | N _033255.1 | Homo sapiens epithelial stromal interaction 1 (breast) (EPSTI1), mRNA

> 0gi | 1486163 | gb | AF396928.1 | Homo sapiens putative breast epithelial stromal interaction protein mRNA, complete cds

> 0gi | 15147247 | ref | NM_033255.11 Homo sapiens epithelial stromal interaction 1 (breast) (EPSTI1), mRNA

> 0gi | 21732483 | emb | A 831953.1 IHSM803266 Homo sapiens mRNA; cDNA DKFZp667P0410 (from clone DKFZp667P0410)

> gnl | UG | Hs # S3817942 Homo sapiens epithelial stromal interaction 1

(breast) (EPSTI1), mRNA / cds = (65, 988) / gb = NM_033255 / gi = 15147247 / ug = Hs. 343800 / len = 1508 E = e-131 236/236 100 +/-: 0 1- 236 (235) 50-285 (235)

Identities = 236/236 (100%) Strand = Plus / Plus

Query: 50 cgctaagcgtcccagccgcatccctcccgcagcgacggcggcccgggacccgcgggctgt 109

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I! I I I I I I I I I Sbjct: 1 cgctaagcgtcccagccgcatccctcccgcagcgacggcggcccgggacccgcgggctgt 60

Query: 110 gaaccatgaacacccgcaatagagtggtgaactccgggctcggcgcctcccctgcctccc 169

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I! I I I I I I I I I M Sbj and: 61 gaaccatgaacacccgcaatagagtggtgaactccgggctcggcgcctcccctgcctccc 120

Query: 170 gcccgacccgggatccccaggacccttctgggcggcaaggggagctgagccccgtggaag 229

I I I I I I I I I I I I I I I I I I I I I 1 I I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbj and: 121 gcccgacccgggatccccaggacccttctgggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggg

Query: 230 accagagagagggtttggaggcagcccctaagggcccttcgcgggagagcgtcgtg 285

I I I I I I I I I M I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I M I I I I I I I I I I Sbjct: 181 accagagagagggtttggagcagcccctaagggcccttcgcgggggggggggcgtg

SEQ No. 10.

> Seq 1032: starting position: 22391622

REASON = CAAGAAAACGAAACT

> 0emb | XM_037374 | XM_037374 Homo sapiens guanine nucleotide binding protein beta subunit 4 (GNB4), mRNA. > 0NM_021629 Homo sapiens guanine nucleotide binding protein beta subunit 4

> 0gi | 20357531 | ref | NM_021629.2 | Homo sapiens guanine nucleotide binding protein beta subunit 4 (GNB4), mRNA

> 0gnl | UG | Hs # S3219369 Homo sapiens guanine nucleotide binding protein beta subunit 4 (GNB4), mRNA / cds = (280, 1302) / gb = NM_021629 / gi = 20357531 / ug = Hs .172654 / len = 3302

> 0gi I 20357531 | ref | NM_021629.2 | Homo sapiens guanine nucleotide binding protein beta subunit 4 (GNB4), mRNA

> 0gi | 7023438 | dbj | AK001890.1 | AK001890 Homo sapiens cDNA F J11028 is, clone P ACE1004128, highly similar to GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT 4

> gnl | UG | Hs # S1971121 Homo sapiens cDNA FLJ11028 fis, clone PLACE1004128, highly similar to GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT 4 / cds = UNKNOWN / gb = AK001890 / gi = 7023438 /ug=Hs.172654 / len = 2567

E = 8e-79 148/148 100 +/-: 0 1-148 (147) 138-285 (147) Identities = 148/148 (100%)

Strand = Plus / Plus

Query: 138 acgtccccgccgggcccgcgcgcctcgtgcctcgcgcctcgcgcctccagccacgtcccc 197

I I I I I I I I! I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjc: 1 acgtccccgccgggcccgcgcgcctcgtgcctcgcgcctcgcgccccccc

Query: 198 gccccggctccggcgcgccgcggagttggctgctgggaggtgcgggactgggtgtggccg 257

! I I I I I I I I I I I M I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I M I I I I I I I M I I I I Sbjet: 61 gccccggctccggcgcgccgcggagttggctgctgggaggtgcgggactgggtgtggccg 120

Query: 258 gcggctctggtctcggctgtgagctgcg 285

I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct: 121 gcggctctggtctcggctgtgagctgcg 148

B. Genes with an ISRE motif (coding for proteins of unknown function)

SEQ ID N ° ll (Chromosome 1, Strand (+), Antisense)

> Seq 6431: starting position: 165 375 886

REASON AGTTTCTCTTTCTTC

> 0emb | XM_030965 | XM_030965 Homo sapiens hypothetical gene supported by AB033071; AB051480; AK000726; NM_015383 (LOC90335), mRNA. > 0emb | XM_030964 | XM_030964 Homo sapiens hypothetical gene supported by AB033071; AB051480; AK000726; NM_015383 (LOC90335), mRNA.

> 0emb | XM_034731 | XM_034731 Homo sapiens hypothetical protein (DJ328E19.C1.1), mRNA.

> 0emb | XM_044868 | X _044868 Homo sapiens hypothetical gene supported by AB033071; AB051480; AK000726; N _015383 (LOC92396), mRNA.

> 0emb | X _053190 | XM_053190 Homo sapiens hypothetical protein FLJ20719

(FLJ20719), mRNA.

> 0emb] XM_054554 | XM_054554 Homo sapiens hypothetical gene supported by AB033071; AB051480; AK000726; NM_015383 (LOC113657), mRNA.

> 0emb | XM_016972 | XM_016972 Homo sapiens hypothetical gene supported by AB033071; AB051480; AK000726; NM_015383 (LOC90335), mRNA.

> 0emb | X _054260 | XM_054260 Homo sapiens similar to KIAA1693 protein; hypothetical protein FLJ20719 (H. sapiens) (LOC91631), mRNA.

> 0NM_015383 Homo sapiens hypothetical protein DJ328E19.Cl .1 (DJ328E19.C1.1),

> 0gi | 657016 | ref | NM_015383.1 | Homo sapiens hypothetical protein (DJ328E19.C1.1), mRNA

E = 4th-34 76/78 97 +/- -. 0 1-78 (77) 208-285 (77) Identities = 76/78 (97%)

Strand = Plus / Plus

Query: 208 aagacctcataaaatttatgctgaggaatgagcgacagttcaaggaggagaagcttgcag 267

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I M I I M Sbj and: 1 aagatctcataaaatctatgctgaggaatgagcgacagttcaaggagagagaggtagcag

Query: 268 agcagctcaagcaagctg 285

IIIIIIIIIIIIIIIIII Sbjct: 61 agcagctcaagcaagctg 78 SEQ ID N ° 12

> Seq 964: starting position: 20574200 MOTIF = GCAGAAGAGGAAACT> 0emb | XM_009277 | XM_009277 Homo sapiens KIAA0963 protein (KIAA0963), mRNA. > 0NM_014963 Homo sapiens KIAA0963 protein (KIAA0963), mRNA.

> 0gnl | UG | Hs # S2139651 Homo sapiens KIAA0963 protein (KIAA0963), mRNA

/ cds = (215.4315) / gb = NM_014963 / gi = 7662409 /ug=Hs.7724

/ Len = 4877

> 0gi 1205455651 ref | XM_009277.5 | Homo sapiens KIAA0963 protein (KIAA0963), mRNA> 0gi | 4589569 | dbj | AB023180.1 | AB023180 Homo sapiens mRNA for KIAA0963 protein, complete cds> 0gi | 7662409 | ref | NM_014963.1 | Homo sapiens KIAA0963 protein (KIAA0963), mRNA E = le-30 64/64 100 +/- -. 0 1-64 (63) 222-285 (63)

Identities = 64/64 (100%) Strand = Plus / Plus

Query: 222 gcccgaaacccggaagtgagcggcggcagctgcgaggctcggagaaacaggcgccgcggg 281

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I! I I I I I I I I I I I I I I I I I I I I I I I Sbjet: 1 gcccgaaacccggaagtgagcggcggcagctgcgaggctcggagaaacaggcgccgcggg 60

Query: 282 etec 285

Sbjct: 61 etec 64

SEQ ID M ° 13 (Chromosome 10, Strand (+), Antisense)

> Seq 5530: starting position: 104011566 MOTIF = AGTTTCTGTTCCTTT> 0emb | XM_005954 | XM_005954 Homo sapiens KIAA0894 protein (KIAA0894), mRNA. > 0gi | 14745003 | ref | XM_005954.3 | Homo sapiens KIAA0894 protein (KIAA0894), mRNA

> 0NM_014896 Homo sapiens KIAA0894 protein (KIAA0894), mRNA. > 0gnl | UG | Hs # S2139630 Homo sapiens KIAA0894 protein (KIAA0894), mRNA

/ cds = (168, 1769) / gb = NM_014896 / gi = 7662365 /ug=Hs.199117

/ len = 4113> 0gi | 4240276 | dbj | AB020701.1 | AB020701 Homo sapiens mRNA for KIAA0894 protein, complete cds

> 0gi | 7662365 | ref | NM_014896.1 | Homo sapiens KIAA0894 protein (KIAA0894), mRNA E = 3e-47 99/100 99 +/-: 0 1-100 (99) 183-281 (98)

Identities = 99/100 (99%), Gaps = 1/100 (1%) Strand = Plus / Plus

Query: 183 gattattttgcttccggacctcgactggaaattttttaaaagcccttatgacaaatgagc 242

I I I I M I II I I I I II II Mil I I I I III I I II I I I I I II I I II I I I I I 1111 I I I II II I I I Sbj and: 1 gattattttgcttccggacctcgactggaaattttttaaaagcccttatgacaaatgagc 60

Query: 243 atgttacctctcc-tttttctttttagcagctttcagctt 281

II I 11 I II I I I II I II I I II III I I I I I Mil I I I I I I I Sbjct: 61 atgttacctctccttttttctttttagcagctttcagctt 100

SEQ ID N ° 14 (Chromosome 14, Strand (-), Sense)

> Seq 1684: starting position: 32572132 MOTIF = CCGGAAGCGGAAACT

> 0emb | XM_007430 | XM_007430 Homo sapiens KIAA0317 gene product (KIAA0317), mRNA.

> 0NM_014821 Homo sapiens KIAA0317 gene product (KIAA0317), mRNA.

> 0gnl | UG | Hs # S2139475 Homo sapiens KIAA0317 gene product (KIAA0317), mRNA / cds = (471, 2942) / gb = NM_014821 / gi = 7662051 /ug=Hs.20126 / len = 5402> 0gi | 7662051 | ref | NM_014821.1 | Homo sapiens KIAA0317 gene product (KIAA0317), mRNA E = le-49 99/100 99 +/-: 0 1-100 (99) 26-125 (99)

Identities = 99/100 (99%) Strand = Plus / Plus

Query: 26 gccggttcccaggccgggtggagaccaac ctggggtctgttggtgggagagtggggagc 85

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbj and: 1 gccggttcccaggccgggtggagaccgggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggg

Query: 86 ccgtcttctgctgagtgctgccgccccttcccaggacagc 125

I I I I I I I I I I I I I I I I I I I I! I I I I I I I I I I I I I I I I I I Sbjct: 61 ccgtcttctgctgagtgctgccgccccttcccaggacagc 100

SEQ ID N ° 15 (Chromosome 14, Strand (-), Sense)

> Seq 1961: starting position: 38133588

REASON = GCTGAAACCGAAACC

> 0emb | XM_007469 | XM_007469 Homo sapiens hypothetical protein

FLJ11271

(FLJ11271), mRNA.

> 0NM_018373 Homo sapiens hypothetical protein FLJ11271 (FLJ11271), mRNA. > 0gnl | UG | Hs # S2293578 Homo sapiens hypothetical protein FLJ11271

(FLJ11271), mRNA / cds = (82, 519) / gb = NM_018373 / gi = 8922963 /ug=Hs.109654 / len = 1354

> 0gι | 7023825 | dbj IAK002133.il AK002133 Homo sapiens cDNA FLJ11271 fis, clone PLACE1009319, moderately similar to Rattus norvegicus outer membrane protein mRNA

> 0g | 8922963 | ref | NM_018373.1 | Homo sapiens hypothetical protein FLJ11271 (FLJ11271), mRNA

E = 5th-52 100/100 100 +/- -. 0 1-100 (99) 11-110 (99) Identities = 100/100 (100%)

Strand = Plus / Plus

Query: 11 gggcgcagcgccgagattgattcaccttcacctgtgctgcactccagctgacccaagtag 70

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 1 I I I I I I I I I I I I I I I I 1 Sb and: 1 gggcgcagcgccgagattgattcaccttcacctgtgctgtagctagtagctgt

Query: 71 gaagccagacgagctgtaaaacatgaacggaagagtggat 110

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct: 61 gaagccagacgagctgtaaaacatgaacggaagagtggat 100

SEQ ID N ° 16 (Chromosome 15, Strand (-), Sense)

> Ξeq 2089: starting position: 43348924

REASON = CAGGAAATTGAAACT

> 0gι | 13375822 | ref | NM_024611.1 | Homo sapiens hypothetical protein

FLJ11896 (FLJ11896), mRNA

E = 5th-52 100/100 100 +/-: 0 1-100 (99) 185-284 (99) Identities = 100/100 (100%)

Strand = Plus / Plus

Query: 185 ataatagtgatggaaagacagctgttgtgggttctaacttaagttccagaccagctagtc 244

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I! I I I I I I I I I I I I I I I I S j and: 1 ataatagtgatggaaagacagctgttgtgggttctaacttaagttccagaccagctagtc 60

Query: 245 caaattcttcctcaggacaggcttctgtaggaaaccagac 284

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct: 61 caaattcttcctcaggacaggcttctgtaggaaaccagac 100

SEQ ID M ° 17 (Chromosome 2, Strand (-), Sense)

> Seq 4608: starting position: 88299855 MOTIF = AGCGAAAGAGAAACT> gnl | UG | Hs # S2532973 AV707659 Homo sapiens cDNA, 5 'end / clone = ADBBSAll / clone_end = 5' / gb = AV707659 / gι = 10724924

/ug=Hs.74921 / len = 733 E = 9e-85 164/166 98 +/- -. 0 1-166 (165) 120-285 (165)

Identified = 164/166 (98%) Strand = Plus / Plus

Quer: 120 aggctgcggaccagccccccacacttccccctacacctctggcgggttcgcgccgtggac 179

IIIIIIIIIII 1 IIII 1 IIIIIIIIIIIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIII Sbj and: 1 aggctgcggtccagccccccacactttcccctacacctctggcgggttcgcgccgtggac 60

Query: 180 gcccccgccctgcgggaggaggggctggcgcggattttagggacttcetgggatgcggag 239

Il I I I I I II I I I I I llll I I I III III I I Mil I I II I I I III II I UNI I Mil I I I Sbj et: 61 geccccgccctgcgggaggaggggctggcgcggattttagggacttcctgggatgcggag 120

Query: 240 atcggctctgaaccatcccctttctgctgcccggagctggggaagc 285

Il I I I I I I I 1 I llll I I I I II I I I II I I I I I I I I I llll Sbjct: 121 atcggctctgaaccatcccctttctgctgcccggagctggggaagc 166

SEQ ID N ° 18 (Chromosome 4, Strand (+), Sense)

> Seq 5668: starting position: 117322292 MOTIF = GAGGAAATAGAAACT> gnl | UG | Hs # S3365105 602498968F1 Homo sapiens cDNA, 5 'end / clone = IMAGE: 4612649 / clone_end = 5' / gb = BG428292 / gi = 13334798 / Hs. 292472 / len = 1008 _E --5e-31 68/68 100 + / -. 0 5-72 (67) 218-285 (67)

Identities = 68/68 (100%) Strand = Plus / Plus Query: 218 ttagggtcagtgaacagtaatgatttaggtatacagctaggacctacatttaaattctta 277

I I I I I I I 1 I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct: 5 ttagggtcagtgaacagtaatgatttaggacacagctaggaccttaatt

Query: 278 cetgteta 285

I I I I I I I I Sbjct: 65 cetgteta 72

ID No. 1.

> Seq 4720: starting position: 94183459 MOTIF = AATGAAAAGAAACTT> gnl | UG | Hs # S3552312 602624658F1 Homo sapiens cDNA, 5 'end / clone = IMAGE: 4749638 / clone_end = 5' / gb = BG678948 / gi = 13910345 / Hs.17384 / len = 955 E = 3e-35 82/83 98 + / -. 0 4-85 (81) 203-285 (82)

Identities = 82/83 (98%), Gaps = 1/83 (1%) Strand = Plus / Plus

Query: 203 aattcaaaacatactccttatattaaggattatagcaccatattttttgtatattcccta 262

111111111111111 m 1111111 m 11111111111111 1111111111 m 1111

Sbj and: 4 aattcaaaacatactccttatattaaggattatagcaccata-tttttgtatattcccta 62

Query: 263 tgtgtaactttttcctgttggta 285

111111111111111 m 11111

Sbjct: 63 tgtgtaactttttcctgttggta 85

SEQ ID N ° 20 (Chromosome 5, Strand (+), antisense) > Seq 6860: starting position: 137080329 M0TIF = GAAGAAATGAAACTT

> gnl | UG | Hs # S3438451 Homo sapiens FKSG56 (FKSG56) mRNA, complete cds

/ cds = (48,422) / gb = AF336883 / gι = 13384194 / ug = Hs. 344028 / len = 799 E = 2e-61 131/135 97 +/-: 0 1-135 (134) 151-285 (134)

Identities = 131/135 (97%) Strand = Plus / Plus

Query 151 ccttceccagtgtttgtgtccctgggtacttgagattagggagtggtgatgactcttaac 210 m ι n ι m 1 1 n 1 1 1 1 1 1 1 1 m i I I I I M ι n I I I I 1 1 1 1 1 1 1 1 m 1 1 1 1 1 1 1 1 1 1

Sbj and 1 ccttccgcagtgtttgtgtccctgggtacttgagattagggagtggtgatgactcttaac 60

Query 211 tagcatgctgccttcaagcatctgtttaacaaagcacatcttgcactgcccttaatccat 270

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 mm 1 1 1 1 1 m 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Sbjet 61 gagcatgctgccttcaagcatctgtttaacaaagcacatcttgcaccgcccttaatccat 120

Query 271 ttaaccctgagtgga 285 ι ι m 1 1 1 1 1 1 1 1 1

Sbj ct 121 tcaaccctgagtgga 135

SEQ ID N ° 21 (Chromosome 7, Strand (+), Sense)> Seq 7018 starting position 138487975 PATTERN = CTAGAAAGAGAAACT> gnl | UG | Hs # S2649922 Homo sapiens cDNA FLJ11779 fis, clone

HEMBA1005921 / cds = UNKNO N / gb = AR021841 / gι = 10433109 / ug = Hs. 196342 / len = 1336 E = 4th- 65 128/129 99 + / -. 0 1-129 (128) 157-285 (128)

Identified = 128/129 (99%) Strand ≈ Plus / Plus

Query 157 atcatagtagaaccaccgtgttctaaccttattgtgtatcaccataacagtttattgtgg 216

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 M 1 1 1 1 1 1 1 1 1 1 1 m ι m ι m 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Sb and 1 atcatagtagaaccaccgtgttctaaccttattgtgtatcaccataacagtttattgtgg 60

Query 217 ctetgatgtcataaaggaagagacatggaagaagaaaaagggggaaaaacgtagtattta 276

1 1 1 m 1 1 1 1 1 1 1 1 1 1 m 1 1 1 1 1 m 1 1 1 1 1 1 1 1 1 1 1 1 m 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Sbjet 61 ctctgatgtcataaaggaagagacatggaggaagaaaaagggggaaaaacgtagtattta 120

Query 277 aaattcttt 285 m 1 1 1 1 1 1

Sbj ct 121 aaattcttt 129

SEQ ID N ° 22

> Seq 2907: starting position: 56347835 MOTIF = CAGGAAAAGAAACTG> gnl | UG | Hs # S3053159 602303069F1 Homo sapiens cDNA, 5 'end

/ clone = I AGE: 4394585 / clone_end = 5 '/ gb = BG024183

/ gι = 12409495 / ug = Hs. 350159 / len = 1130 E = 2e-76 161/164 98 +/-: 0 1-164 (163) 117-278 (161)

Identities = 161/164 (98%), Gaps = 2/164 (1%) Strand = Plus / Plus

Query: 117 aggttactcactataaacaatatccacccaacacaa-gcaa-agtttattcctactttga 174 n n 1 1 1 n m m I I I I n 1 1 1 1 1 1 1 1 1 1 1 n 1 1 1 1 i m 1 1 1 1 1 1 1 1 1 1 m 1 1 1

Sbj and: 1 aggttactcactataaacaatatccaeccaacacaacgcgagagtttattcctactttga 60

Query: 175 atgccgtgaaaagaagacagaaaactccaaattaaggaaggtgaaatatgaggaaacagt 234

I I I 11 I III III I I I II I II I I I I III III I I III I I I III III I III I I II I llll I I I I Sb et: 61 atgccgtgaaaagaagacagaaaactccaaattaaggaaggtgaaatatgaggaaacagt 120

Query: 235 attttatgggttgcagtacattcttaataagtacttaaaaggta 278

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 m m 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 m 1 1 1 1

Sbjct: 121 attttatgggttgcagtacattcttaataagtacttaaaaggta 164

SEQ ID N ° 23 (Chromosome 8, Strand (+), Sense)

> Seq 1580: starting position: 30265967 MOTIF = GGAGAAACTGAAACT> gnl | UG | Hs # S2006324 EST383718 Homo sapiens cDNA / gb = A 971629

/ gi = 8161475 / ug = Hs. 88218 / len = 500 E = e-150 280/284 98 +/- -. 0 1-284 (283) 2-285 (283)

Identities = 280/284 (98%) Strand = Plus / Plus

Query: 2 agagattaaatgatttattcagtacatggcagggtcaggactgagccaaggcattgtggc 61

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 m 1 1 1 1 m 1 1 1 1 1 1 1 m 1 1 m 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Sbjct: 1 agagattaaatgatttattcagtacatggcagggtcaggactgagccaaggcattgtggc 60

Query: 62 tccagttcatctccccgttacggtcaggggtgcttatgaactcatagtggggtcgggggt 121

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I III I I I I I I I I I! I I I I I I I I I Sbjct: 61 tccagttcatttccccgttacggtcaggggtgcttatgaactcatagtggggtcgggggt 120

Query: 122 agaggagagacgtaacacaaacatgagaaacaattagaggaccatgcaaggcagggtgta 181

1 1 m 1 1 1 1 1 m m m m 1 1 1 m 1 1 1 1 1 1 1 m 1 1 m m ι m 1 1 1 1 1 1 1 1 1 1

Sbj and: 121 agaggagagacgtaacacaaacatgagaaacaattagaggaccatgcaaggcagggtgta 180

Query: 182 attcagtcctaaatcacataatccagagagcaagtgctagaagaattcgggagaaggagc 241

1 1 m 1 1 1 1 1 1 1 m 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 m 1 1 1 1 1 1 1 1 1 1 m m 1 1 1 1

Sbjct: 181 atteagtcetaaatcacataatccaaagagcaagtgctagaaaaattcgggagaaggagc 240

Query: 242 atttcctccaggcattcctgggatcctaccaagtgagaaggcag 285

1 1 1 1 m 1 1 1 m 1 1 1 1 1 1 m 1 1 1 1 1 1 m m 1 1 m 1 1 1 1

Sbjct: 241 atttcctccaggcattcctgggatcctaccaagtgaaaaggcag 284

SEQ ID N ° 24 (Chromosome 12, Strand (-), Sense) > Seq 3482: starting position: 71200075 OTIF = TTAGAAAATGAAACT

> gnl | UG | Hs # S2654527 Homo sapiens cDNA: F J23092 fis, clone NG07245, highly similar to AF007130 Homo sapiens clone 23750 unknown mRNA / cds = UNKNO N / gb = AK026745 / gi = 10439667 /ug=Hs.12871 / len = 2050 E = le-28 64/64 100 +/-: 0 1-64 (63) 222-285 (63)

Identities = 64/64 (100%) Strand = Plus / Plus

Query: 222 aaaatagacgatcgtttaaaattggaagcagagatggaattaaaagacttacaccagcct 281

1 1 1 1 m 1 1 1 1 m 1 1 1 1 1 1 1 1 1 1 1 1 1 1 m 1 1 1 1 1 1 1 1 m 1 1 1 1 1 1 1 1 n 1 1 1 1 1 1 1 1 1

Sbj and: 1 aaaatagacgatcgtttaaaattggaagcagagatggaattaaaagacttacaccagcct 60

Query: 282 yyyy 285 llll Sbjct: 61 yyyy 64

SEQ ID N ° 25 (Chromosome 15, Strand (+), Sense)

> Seq 3086: starting position: 77422375

REASON = CCAGAAATGAAACTT

> gnl | UG | Hs # S1570556 Homo sapiens mRNA full length insert cDNA clone

EUROIMAGE 28993 / cds≈UNériment / gb = A 109678 / gi = 5689803 /ug=Hs.21597 / len = 1426 E = e-108 197/197 100 +/-: 0 1-197 (196) 89-285 (196 )

Identities = 197/197 (100%) Strand = Plus / Plus

Query: 89 caattatagattaaaaatatcagaagcatttccagattattcttaaaagttgatgagatc 148

1 1 1 1 m 1 1 m 1 1 1 1 1 1 m m 1 1 1 1 1 m m m 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 m 1 1 1 1

Sbjct: 1 caattatagattaaaaatatcagaagcatttccagattattcttaaaagttgatgagatc 60

Query: 149 ttcccaaaccagaatgacaactgaggatgagatgtgcatagattaaatggtaaagtgggt 208

1 1 1 m 1 1 1 m m 1 1 1 1 m m 1 1 m m 1 1 m 1 1 m 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Sbj and: 61 ttcccaaaccagaatgacaactgaggatgagatgtgcatagattaaatggtaaagtgggt 120

Query: 209 ggttctcaggtgagaagcagtgaggaccattcattttgcagcctaaaaattttaggggat 268

1 1 1 1 1 1 1 1 1 m 1 1 1 1 m ι m 1 1 1 1 1 1 1 1 m 1 1 m 1 1 1 1 1 1 1 1 1 1 1 n ι m 1 1 1 1

Subject: 121 ggttctcaggtgagaagcagtgaggaccattcattttgcagcctaaaaattttaggggat 180

Query: 269 gcaaactgtcatttccc 285

1 1 1 1 1 1 1 1 1 m m 1 1

Sbjct: 181 gcaaactgtcatttccc 197 Example 2: Description of an illustrative example of a computer program for carrying out step a) of the method of the invention

The computer program illustrated below was written in the "PERL" programming language.

I. "Master" program (for the "ISRE" reason)

#! / Usr / bin / perl

# chrl .fa Brin Plus, Motif Sens, UCSC Version dated 13-06-2001

# ISRE Motif Meaning:. {3} GAA. {2,3} GAAAC. {1}

system "pg1.pl chrl .fa. {3} GAA. {2,3} GAAAC. {1}> res_chr1";

system "pg2.pl res_chr1> ti1";

System "pg3.pl ti1. {3} GAA. {2,3} GAAAC. {1}";

system "mv isre noins isre _-_ s";

system "mv isre_plus isre _ + _ s";

# Complementary ISRE Reverse pattern:. {1} GTTTC. {2,3} TTC. {3}

system "pg3.pl isre _-_ s. {1} GTTTC. {2,3} TTC. {3}";

system "mv isrejnoins isre2 _-_ s";

system "mv isre_plus isre2 _ + _ s";

system "pg4_new160.pl isre2 _-_ s alu + primate_repbase";

system "mv sequencg2 chr1_alu-"; system "pg4_new15.pl chr1_alu- alu + primate_repbase";

system "mv sequencg2 chr1_alu2-";

system "blastall -p blastn -d tc_bank -a2 -i chr1_alu2-> ta1";

system "pg6.pl ta1 0.970> plus_chr1";

# chrl .fa, strand Plus, Complementary Reverse Pattern, # UCSC version dated 13-06-2001

# Complementary ISRE Reverse pattern:. {1} GTTTC. {2,3} TTC. {3}

system "pg1.pl chrl .fa. {1} GTTTC. {2,3} TTC. {3}> res_chr1_as";

system "pg2.pl res_chr1_as> ti1_as";

system "pg3.pl ti1_as. {1} GTTTC. {2,3} TTC. {3}";

system "mv isre_ less isre _-_ as";

system "mv isre_plus isre _ + _ as";

# ISRE Motif Meaning:. {3} GAA. {2,3} GAAAC. {1}

system "pg3.pl isre _-_ as. {3} GAA. {2,3} GAAAC. {1}";

system "mv isrejnoins isre2 _-_ as";

system "mv isrej lus isre2_ + jas";

system "pg4_new160.pl isre2 _-_ as alu + primate_repbase"; system "mv sequencg2 chr1_alu-_as";

system "pg4_new15.pl chr1_alu-_as alu + primate_repbase";

system "mv sequencg2 chr1_alu2-_as";

system "blastall -p blastn -d tc_bank -a2 -i chr1_alu2-_as> ta1_as";

system "pg6.pl ta1_as 0.970> plus_chr1 as";

# revcomp_chr1.fa, Strand Less, ISRE Meaning Motif, UCSC Version dated 13-06-2001

# ISRE Motif Meaning:. {3} GAA. {2,3} GAAAC. {1}

system "pg1.pl rβvcomp_chr1.fa. {3} GAA. {2,3} GAAAC. {1}> res_chr1_rc";

system "pg2.pl res_chr1_rc> ti1_rc";

system "pg3.pl ti1_rc. {3} GAA. {2,3} GAAAC. {1}";

system "mv isrejnoins isre _-_ src";

system "mv isre_plus isre _ + _ src";

# Complementary ISRE Reverse pattern:. {1} GTTTC. {2,3} TTC. {3}

system "pg3.pl isre _-_ src. {1} GTTTC. {2,3} TTC. {3}";

system "mv isre_ less isre2 _-_ src";

system "mv isre_plus isre2 _ + _ src"; system "pg4_new160.pl isre2 _-_ src alu + primate_repbase";

system "mv sequencg2 chr1_alu-_rc";

system "pg4_new15.pl chr1_alu-_rc alu + primate_repbase";

system "mv sequencg2 chr1_alu2-_rc";

system "blastall -p blastn -d tc_bank -a2 -i chr1_alu2-_rc> ta1_rc";

system "pg6.pl ta1 e 0.970> less_chr1";

# revcomp_chr1.fa, Strand Less, Complementary Reverse Pattern, Version #UCSC from 06-13-2001

# Complementary ISRE Reverse pattern:. {1} GTTTC. {2,3} TTC. {3}

system "pg1.pl revcomp_chr1.fa. {1} GTTTC. {2,3} TTC. {3}> res_chr1_asrc";

system "pg2.pl res_chr1_asrc> ti1_asrc";

system "pg3.pl ti1_asrc. {1} GTTTC. {2,3} TTC. {3}";

system "mv isrejnoins isre _-_ asrc";

system "mv isre_plus isre _ + _ asrc";

# ISRE Motif Meaning:. {3} GAA. {2,3} GAAAC. {1}

system "pg3.pl isre _-_ asrc. {3} GAA. {2,3} GAAAC. {1}";

system "mv isre_ less isre2 _-_ asrc";

system "mv isre_plus isre2 _ + _ asrc";

system "pg4_new160.pl isre2 _-_ asrc alu + primate_repbase"; system "mv sequencg2 chr1_alu-_asrc";

system "pg4_new15.pl chr1_alu-_asrc alu + primate_repbase";

system "mv sequencg2 chr1_alu2-_asrc";

system "blastall -p blastn -d tc_bank -a2 -i chr1_alu2-_asrc> ta1_asrc";

system "pg6.pl ta1_asrc 0.970> less_chr1_as";

II. "Pg1.p1" module

#! / usr / bin / perl if ($ # ARGV 1) {print "usage: use 2 arguments: first, chromosome file; second, search pattern \ n"; exit; }

$ j = i; open (F, $ ARGV [0]) || die ("I can't open this chromosome file \ n"); $ regexp = $ ARGV [1]; $ line = <F>; while (Sline) {if ($ line = ~ / ^Λ > /) {$ name = $ line; $ seq = ""; while (($ line = <F>) && ($ line! ~ / ^Λ > /)) {chomp $ line; $ seq. = $ line; #device that: $ seq = $ seq. $ line

}

$ lseq = length ($ seq); for ($ i = 0; $ i <$ lseq; $ i ++) {$ partseq = substr ($ seq, $ i, 15); if ($ partseq = ~ / ^Λ $ regexp / o) {$ partseq = substr ($ seq, $ i, 300); $ seqelec {$ partseq} ++; print "> Seq $ j: starting position: $ i \ n $ partseq \ n"; $ j = $ j +1; }}} else {

$ line = <F>; }} close F;

III. "Pg2.p1" module

#! / usr / bin / perl $ 1 = 1;

if ($ # ARGV! = 0) {print "usage: <Sequence file in fasta format> \ n"; exit;

3 open (FS, $ ARGV [0]);

$ x = <FS>; while ($ x) {

if ($ x = ~ / ^Λ > /) {

$ line = $ x;

}

if ($ x! ~ / ^Λ > /) {

$ x = ~ s / ^Λ . {15} //;

$ line. = $ x; print $ line; } $ x = <FS>;

close (FS);

IV. "Pg3.p1" module

#! / Usr / bin / perl

if ($ # ARGV! = 1) {print "usage: 1st argument: - output file of pg2.pl \ n"; print "2nd argument: - regular expression pattern search \ n"; exit;

}

$ seq1 = "";

$ seq2 = ""; open (F, "$ ARGV [0]") || die "can't open the file ti1";

$ regexp = $ ARGV [1];

$ line = <F>; while ($ line) {

if ($ line = ~ / ^Λ > | ^Λ \ s +> /) {$ name = $ line; $ seq = "";

while (($ line = <F>) && ($ line! ~ / ^Λ > /)) {$ seq. = $ line; } $ lseq = length ($ seq);

for ($ i = 0; $ i <$ lseq; $ i ++) {

$ partseq = suBstr ($ seq, $ i, 15); if ($ partseq = ~ / ^Λ $ regexp / o) {

$ seqq {$ partseq} ++;

}} if (% seqq) {# test the content of the hash

$ name. = $ seq; $ seq1. = $ name; $ Name = ""; % seqq = (); } else {$ name. = $ seq; $ seq2. = $ name; $ name = ""; % seqq ≈ (); }

} else {

$ line = <F>; }}

close F;

select (ISRE_PLUS); open (ISRE_PLUS, ">isre_plus"); print ISRE_PLUS "$ seq1 \ n"; select (ISRE_MOINS); open (ISRE_MOINS, ">isrejnoins"); print ISRE_MOINS "$ seq2 \ n"; V. Module "pg4 160.p1"

#! / Usr / bin / perl

if ($ # ARGV! = 1) {print "usage: uses 2 arguments: - sequence file in fasta format \ n" print "- sequence bank in fasta format used \ n"; exit;

}

$ bank = $ ARGV [1]; open (FSE, "> sequencg2"); open (FSOR, "> fsor"); open (F, $ ARGV [0]);

$ line = <F>; while ($ line) {if ($ line = ~ / ^Λ > | ^Λ \ s +> /) {

$ name = $ line;

$ seq = "";

while (($ line = <F>) && ($ line! ~ / ^Λ > /)) {#chop $ line; $ seq. = Sline;

} open (FSOR, "> fsor"); pn nt FSOR $ name; pri nt FSOR $ seq; pri nt FSOR "\ n";

. Fsor $ = $ name; . Fsor $ = $ seq; #system "nedit fsor &";#print $ fsor; #exit; system "blastall -p blastn -d $ bank -e 1 e-160 -a2 -i fsor -o other"; open (FS, "other") || die ("blastn output file not found \ n");

while (($ line2 = <FS>) && ($ line2! ~ / No hits found /)) {}

if ($ line2 = ~ / No hits found /) {open (FSE, "" sequencg2 "); print FSE $ fsor;

$ Fsor = "";

$Name- '";

$ Seq = "";

} else {close FS; $ var = '~ / linuxJpa / programs / jp / prog_valides / xblast other fsor N ^" open (FSEQ,""sequencg2"); print FSEQ $ var; $ fsor = ""; $ name = ""; $ seq = "";}

else {

$ line = <F>;

close (F); close (FSOR); close (FSE);

VI. "Pg4 15.p1" module

#! / Usr / bin / perl if ($ # ARGV! = 1) {print "usage: uses 2 arguments: - sequence file in fasta format \ n"; print "- Fasta format sequence bank used \ n";exit;

}

$ bank = $ ARGV [1];

open (FSE, ">sequencg2"); open (FSOR, ">fsor"); open (F, $ ARGV [0]); $ line = <F>; while ($ line) {if ($ line = ~ / ^Λ > | ^Λ \ s +> /) {

$ name = $ line;

$ seq = ""; while (($ line = <F>) && ($ line! ~ / ^Λ > /)) {

$ seq. = $ line;

} open (FSOR, "> fsor"); print FSOR $ name; print FSOR $ seq; print FSOR "\ n";

. Fsor $ = $ name; . Fsor $ = $ seq;

system "blastall -p blastn -d $ bank -e 1e-15 -a2 -i fsor -o other";

open (FS, "other") || die ("blastn output file not found \ n"); while (($ line2 = <FS>) && ($ line2! ~ / No hits found /)) {}

if ($ line2 = ~ / No hits found /) {open (FSE, "" sequencg2 "); print FSE $ fsor;

$ Fsor = "";

$ Name = "";

$ Seq = "";

} else {close FS; $ var = ^' ~ / linuxj ^' pa / programs / jp / prog_valides / xblast other fsor N ^" open (FSEQ,""sequencg2"); print FSEQ $ var;

$ Fsor = "";

$Name- '";

$ Seq = "";

}

else {

$ line = <F>; }}

close (F); close (FSOR); close (FSE);

VII. Module "pg5.p1" system "blastall -p blastn -d tc_bank -a2 -i chr1_alu2-> filejesultat '

VIII. Module "pg6.p1 #! / Usr / bin / perl

if ($ # ARGV! = 1) {print "usage: 1st argument: <blastall output file> \ n"; print "2nd argument: <scalar variable value trueval> \ n"; exit;

} open (FS, $ ARGV [0]) || die ("file $ ARGV [0] not found \ n");

$ q = -1;

$ trueval = $ ARGV [1]; while (($ line = <FS>) && ($ line! ~ / Query = /)) {} while ($ line = ~ /Query=(.+$)/) {

$ Q ++;

$ t = -1; #initialize larget chomp $ line;

$ qname = $ 1; while (($ line = <FS>) && ($ line! ~ / ^Λ > /) && ($ Iine! ~ / Ouery = /)) {} while ($ line = ~ X> l) {

$ A ++;

$ hsp = -1; #initialize hsp

Goodhspinfo @ = ();

$ Goodhsp = 0;

$ Tname = ""; while ($ line! ~ / Length /) {

$ tname. = $ line;

$ line = <FS>;

} while (($ line = <FS>) && ($ line! ~ / Score = /)) {}

while ($ line = ~ / Score = /) {

$ Hsp ++;

$ tmin = 1 e10;

Tmax = $ -1e10;

$ qmin = 1 e10; $ Qmax = -1e10; $ line = ~ / Expect \ s \ = (. +) $ /; $ expect = $ 1; while (($ line = <FS>) && ($ line! ~ / ^Λ > /) && ($ line! ~ / Score = /) && ($ line! ~ / Query≈ /)) {

if ($ line = ~ / Strand = /) {if ($ line = ~ / Minus /) {

$ minus = 1; } Else {

Minus $ = 0; }} if ($ line = ~ / ldentities \ s = \ s (\ d +) V (\ d +) \ s \ ((\ d +) \% \) /) {$ id1 = $ 1; $ Id2 = $ 2; $ Pcent = S3; $ Truepcent = $ 1 / $ 2; $ Ali = "";

} if ($ line = ~ / Sbjct \: \ s (\ d +) ^.; (\ d +) $ /) {if ($ minus) {

$ lmin = (($ 2 <$ tmin)? $ 2: $ tmin);

$ tmax = (($ 1> $ tmax)? $ 1: $ tmax); } else {

$ tmin = (($ 1 <$ tmin)? $ 1: $ lmin);

$ tmax = (($ 2> $ tmax)? $ 2: $ tmax); }} if ($ line = ~ /Query\:\s(\d+).* (\ d +) $ /) {

$ qmin = (($ 1 <$ qmin)? $ 1: $ qmin); $ qmax = (($ 2> $ qmax)? $ 2: $ qmax);

}

. $ Ali = $ line; }

$ = $ Tlen tmax- $ tmin;

$ = $ Qlen qmax- $ qmin;

if ((! $ minus) && ($ truepcent> = $ trueval) && ($ tlen> 60) && ($ tmin <= 5)) {print "$ qname \ n $ tname E = $ expect $ id1 / $ id2 $ pcent +/-: $ minus $ tmin- $ tmax ($ tlen) $ qmin- $ qmax ($ qlen) \ n $ ali \ n \ n ";

}

}

}} close FS;

REFERENCES

Beaucage et al., Tetrahedron Lett 1981, 22: 1859-1862

Brown EL, Belagaje R, Ryan MJ, Khorana HG, Methods Enzymol 1979; 68: 109-151

GAIT (ed.), (1984). Nucleic Acid Hybridization.

GLOVER (ed.), 1985. DNA Cloning: A Practical Approach, Volumes I and II Oligonucleotide Synthesis, MRL Press, Ltd., Oxford, U.K.

HAMES and HIGGINS, 1985. Nucleic Acid Hybridization: a practical approach, Hames & Higgins Ed. IRL Press, Oxford.

Narang SA, Hsiung HM, Brousseau R, Methods Enzymol 1979; 68: 90-98 "

AltschuI, Stephen F., Warren Gish, Webb Miller, Eugène W. Myers, and David J. Lipman (1990), "Basic local alignment search tool",. J. Mol. Biol. 215: 403-10.

Claverie J.M. & David J. States (1993), Information Enhancement Methods for Large Scale Sequence Analysis, Computers and Chemistry 17: 191-201.

Xblast.c program; website, http://blast.wustl.edu/pub/xblast

Wall et al., Programming Perl By Larry Wall, Tom Christiansen & Randal L. Schwartz; Second Edition, September 1996., 670 pages.

Blast.linux.tar.Z Program Version 07/2001; ftp://ftp.ncbi.nih.gov/blast/ executables /

Claims

1. Method for the preparation of a set of means for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly, from transcription of an inducible gene by an inflammation mediator, characterized in that said method comprises the following steps: a) preparing a collection of nucleic acids contained in genes inducible by an inflammation mediator, according to the following preparation steps: ai) (i) Select, from one or more collections of nucleotide sequences of human origin, all of the sequences of which cover the entire human genome at least once, the sequences comprising at least one copy of '' a sequence chosen from sequences SEQ ID N ° 1 to 4, then (ii) create a first collection of nucleotide sequences from each previously selected sequence, each sequence this nucleotide contained in said first collection being constituted, from the 5 ′ end towards the 3 ′ end, of the sequence SEQ ID No. 1, 2, 3 or 4, followed by the 285 consecutive nucleotides located, in each sequence selected in (i) immediately on the 3 ′ side of the last nucleotide 3 ′ of said sequence SEQ ID No. 1, 2, 3 or 4;

a2) (i) for each of the nucleotide sequences contained in said first collection created in step ai), eliminate the sequence SEQ ID No. 1, 2, 3 or 4 located at the 5 ′ end of said nucleotide sequence and ( ii) create a second collection of sequences containing all the sequences modified in (i), each of the sequences contained in said second collection constituting a "probe";

a3) (i) Search, for each of the nucleotide sequences contained in the second collection of sequences created in step a2), the presence of at least one copy of a sequence SEQ ID No. 1, 2, 3 or 4, then (ii) elimination, in said second collection, of sequences comprising at least one copy of one sequences SEQ ID No. 1, 2, 3 or 4, whereby a third collection of sequences, not including the sequences thus eliminated, is created;

a4) (i) Search, for each of the nucleotide sequences contained in the third collection of sequences created in step a3), of each sequence of nucleotides corresponding to a nucleotide sequence of “Alu” type or of “repeated” type capable of be contained in said nucleotide sequence, then (ii) modification of the sequences comprising such a sequence of nucleotides, by masking said nucleotide sequences corresponding to a nucleotide sequence of “Alu” type or of “repeat” type by replacement of each nucleotide A , T, G or C contained in said “Alu” or “repeated” sequence with a nucleotide “N” meaning indifferently A, T, G or C, then (iii) create a fourth collection of sequences containing all the sequences contained in the third collection, possibly modified according to (ii);

a5) (i) Select, from one or more collections of sequences containing nucleotide sequences consisting of transcripts of the human genome, the sequences comprising at least one of the nucleotide sequences contained in the fourth collection of sequences created at step a4), then (ii) create a fifth collection of sequences containing all the sequences selected in (i);

a6) (i) Select, in the fifth collection of sequences created in step a5), the sequences comprising at least 60 consecutive nucleotides defining a sequence having at least 97% identity in nucleotides with a sequence nucleotide included in at least one of the “probes” contained in the second collection of sequences created in step a2), then (ii) creating a sixth collection of nucleotide sequences containing the sequences thus selected, said sixth collection of sequences consisting in the collection of nucleic acids contained in genes inducible by an inflammation mediator;

b) synthesizing a collection of nucleotide probes specifically hybridizing with the transcription product of at least one gene inducible by an inflammation mediator, said gene comprising a nucleotide sequence contained in the sixth collection of sequences prepared in step a6) , said collection of probes thus synthesized consisting of the set of means for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly , transcription of an inducible gene by an inflammation mediator.

2. Method according to claim 1, characterized in that it further comprises the following step c): c) immobilizing each of the nucleotide probes synthesized in step b) on a support.

3. Method according to claim 2, characterized in that the nucleotide probes are immobilized in an orderly manner on said support.

4. Method according to claim 3, characterized in that the nucleotide probes are immobilized on said support in the form of an ordered array of probes.

5. Set of means for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of an inducible gene by an inflammation mediator, characterized in that said set of means comprises, for each nucleic acid whose presence is sought, at least one nucleotide probe hybridizing specifically with said nucleic acid, said set of means being prepared by the method according to claim 1.

6. Set of means according to claim 5, characterized in that the sequence of the nucleotide probe (s) has a length of at least 20 nucleotides.

7. Set of means according to one of claims 5 or 6, characterized in that the nucleotide probe (s) are marked with a detectable molecule.

8. Set of means according to claim 7, characterized in that the probe or probes are marked by a radioactive molecule, by a fluorescent molecule or by a chemiluminescent molecule.

9. Set of means according to one of claims 5 to 8, characterized in that the nucleotide probe (s) are immobilized on a support.

10. Set of means according to claim 9, characterized in that the probes are immobilized on the support in an orderly manner.

11. Set of means according to one of claims 9 and 10, characterized in that the probe or probes immobilized on the support forms an ordered matrix.

12. Device for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of a gene inducible by an inflammation mediator, characterized in that said device comprises at least one nucleotide probe or a plurality of nucleotide probes prepared by the method according to claim 1, the nucleotide probe or probes being immobilized on a support.

13. Device according to claim 12, characterized in that the plurality of nucleotide probes are immobilized in an orderly manner on said support.

14. Use of a probe or a plurality of nucleotide probes as defined in one of claims 1 to 4, for detecting the presence, in a sample, of one or a plurality of acid (s ) nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of an inducible gene by a mediator of inflammation.

15. Method for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of a gene inducible by a mediator of inflammation, characterized in that said method comprises the following steps: a) bringing into contact a set of means according to one of claims 5 to 11, or a device according to one of claims 12 or 13, with a sample to be tested; b) detecting the hybrids formed between the nucleotide probe (s) contained in said set of means or in said device and the nucleic acids possibly present in the sample.

16. Method according to claim 15, characterized in that, in step b), the identity of the nucleotide probe (s) which have hybridized with the nucleic acid (s) present in the sample is determined.

17. The method of claim 15, characterized in that, in step b), have determined the quantitative ratios of the different nucleic acids contained in the sample and which have hybridized with the nucleotide probes.

18. The method of claim 15, characterized t? U ^ ue, a i ciciμe b), determining the identity of the nucleotide probe (s) having hybridized with the nucleic acids contained in the sample.

19. Method according to one of claims 15 to 18, characterized in that the nucleic acids contained in the sample are messenger RNAs synthesized by a human or non-human mammalian cell.

20. Method according to one of claims 15 to 18, characterized in that the nucleic acids contained in the sample are cDNAs obtained by reverse transcription of messenger RNA synthesized by a human or non-human mammalian cell

21. Method for producing an expression profile of inducible genes by an inflammation mediator from a sample containing the messenger RNAs synthesized by the cells of a human or non-human mammal, or cDNAs obtained from starting from said messenger RNAs, characterized in that it comprises the following steps: a) bringing an assembly of means according to one of claims 5 to 11 or a device according to one of claims 12 or 13 into contact with said sample; c) Determine the identity of the nucleotide probes included in the set of means or in the device which are hybridized with the nucleic acids contained in the sample.

22. Method for producing an expression profile of inducible genes by an inflammation mediator from a sample containing the messenger RNAs synthesized by the cells of a human or non-human mammal, or cDNAs obtained from starting from said messenger RNAs, characterized in that it comprises the following steps: a) carrying out the method according to one of claims 15 to 20 with said sample; c) Determine the identity of the nucleotide probes which are hybridized with the nucleic acids contained in the sample.

23. Kit or kit for the production of an expression profile of inducible genes by an inflammation mediator from a sample containing the messenger RNAs synthesized by the cells of a human or non-human mammal, or CDNAs obtained from said messenger RNAs, characterized in that it comprises a set of means according to one of claims 5 to 11 or a device according to one of claims 12 or 13.

24. Kit or kit according to claim 23, characterized in that it further comprises the reagents necessary to carry out the hybridization reaction between the nucleotide probe (s) contained in said set of means or contained in said device.

25. Kit or kit according to one of claims 23 or 24, characterized in that it further comprises means intended to reveal the hybrids formed between the nucleotide probe (s) contained in said set of means or contained in said device and the nucleic acids in the sample.